WO1990001561A1

WO1990001561A1 - Diagnostic method

Info

Publication number: WO1990001561A1
Application number: PCT/GB1989/000875
Authority: WO
Inventors: Hugh Gurling; Robin Sherrington
Original assignee: University College London
Priority date: 1988-07-29
Filing date: 1989-07-31
Publication date: 1990-02-22
Also published as: EP0413003A1; GB8818076D0; AU4043289A

Abstract

A method for the analysis of a genomic DNA sample taken from a human individual to detect a genetic abnormality predisposing or causing the said individual or a related individual to suffer from schizophrenia, which method comprises analysing the said genomic DNA sample involving the use of one or more DNA probes which are human genomic clones to detect the presence of a polymorph or mutation indicative of an allele linked to or associated with the disease allele for schizophrenia is disclosed, as is a kit for such a method.

Description

Diagnostic Method

This invention relates to a diagnostic method; more particularly, it relates to a method for the diagnosis of individuals suffering from or liable to suffer from schizophrenia.

Schizophrenia is a common disorder with a lifetime prevalence of 0.85%. The illness develops in early adult life and is characterised by psychotic symptoms which include hallucinations and delusions and a constellation of symptoms, such as inappropriate emotional responses, a disorder of thinking, erratic behaviour, as well as social and occupational deterioration. Patients often relapse into a psychotic state when treatments with anti-psychotic drugs are stopped.

The mode of genetic transmission which operates for schizophrenia is still in dispute. There is less evidence for a single major locus gene effect in schizophrenia than for other conditions, such as manic depression and Alzheimer's disease. Some geneticists who have studied schizophrenia favour a major single autosomal locus compared to other models (Kidd et al, Social. Biol., 20, 254-265, (1973); Karlsson, Br. J. Psychiatry, 140, 600-606, (1983)). A two gene model has also been proposed in which a principle dominant gene and a secondary, also dominant, gene need to be present before the illness develops (Book, Acta Genet., 4, 1-100, (1953). Risch et al (Am. J. Hum. Genet., 36, 1039-1059, (1985)) argue that recessive alleles at a single major locus present in a high frequency in the general population could account for 62.9% of the liability for developing schizophrenia, which is somewhat similar to the suggestion of recessive inheritance put forward by Kidd et al. In a more recent re-analysis of the data, O'Rourke et al (Am. J. Hum. Genet., 34, 630-649, (1983)) reject a two allele single major locus model as sufficient to explain all the observed familial distributions of schizophrenia. They concur with Elston et al (Neuropsychobiol., 4, 193-206, (1978)) who believe that schizophrenia must be either heterogeneous or polygenic. Linkage studies of schizophrenia to attempt to localize schizophrenia mutations to specific chromosomes have been negative. One such study found a link between schizophrenia and oculocutaneous albinism (Baron, M. Am. J. Psychiatry, 133, 1070-1073). Many cytogenic abnormalities have, however, been reported in schizophrenia, such as a chromosome 19 fragile site (Abstracts from the European Society of Human Genetics Symposium on "Human Behaviour and Genetics," Chi. Genet., 20, 363-402, (1981)). A recent report of chromosomal abnormalities in two related Chinese schizophrenics has implicated chromosome 5 (Bassett et al, The Lancet, 8589. 799-800, (1988)).

Many authorities have claimed that environmental factors arising from the family are causative. Researchers who thought that a genetic component was relevant have claimed that the linkage approach that was used in the present invention would not produce significant results. This was because the mode of genetic transmission operating for schizophrenia may be too complex as there was incomplete penetrance (inheritance of the schizophrenia locus may not always produce the disease) and probable genetic heterogeneity (more than one schizophrenia locus).

Surprisingly, the present inventors have found scientific evidence to show that a single chromosome locus is involved in aetiology of schizophrenia. The present inventors have shown that the inheritance of a dominant allele at a single major locus on chromosome 5 is sufficient for the development of schizophrenia.

As confirmed by the present inventors, schizophrenia is associated with an abnormality on chromosome 5. The chromosome 5 schizophrenia locus lies within the cytogenic bands 5gll-5gl3, when defined in terms of cytogenic banding, or, when defined in terms of genetic distances, the schizophrenic locus lies on chromosome 5 at a recombination fraction of between 0.00% and 7% from DNA marker p105-153Ra (D5S39) and 10% from p105-599Ha (D5S76). The fact that a specific schizophrenia mutation has now been localised enables probes hybridising for this region of the chromosome to be used to predict with a reasonable degree of certainty the likelihood of an individual carrying the schizophrenia mutation or even to detect the schizophrenia mutation in individuals. In general terms, the present invention relates to a method of detection of carrier status for schizophrenia which involves the analysis of a DNA sample using a probe, more particularly one of the four probes (human genomic clones), M4, p105-153Ra, p105-599Ha and PSY5.1. Such probes may be labelled radioactively or non-radioactively by known means. The analysis methods to be used for the present purpose detect single base pair mutations, deletions and polymorphisms at or near the chromosome 5 schizophrenia susceptibility locus using (non) radioactive labelling.

As a starting point, DNA from a human individual may be extracted from blood or other suitable human tissue according to standard protocols (Hodgkinson, S., et al. Nature, 325, 805-806, 1987). Amplification of specific genomic regions from patients or their relatives within or linked to in particular the four probes M4, p105-153Ra, p105-599Ha and PSY5.1, as well as at other loci at or closely linked to the chromosome 5 schizophrenia susceptibility locus may be carried out by the use of pairs of oligonucleotide sequences obtained from the probes and the use of a polymerase chain reaction (Saiki, R.K., Science, 239, 487-491, 1988). The two oligonucleotide sequences flank the DNA segments to be amplified and are used as primers for Taql polymerase or Klenow extension of the annealed primers. Primer oligonucleotide sequences that may be used include:

p105-153Ra 5'CCATTTTATTTCATCCAGCTG3'

5'TCCAGACCCTTCTGTGGCATG3'

p105-599Ha 5'GAAGCTACATCCAAACTCAG 3'

5'GATGCTGACCTCTTAATATTAG 3' Probe M4, which was found by the inventors to be genetically linked to the chromosome 5 schizophrenia locus, was obtained from Dr. A. Retief, University of Stellenbosch, South Africa. The probe PSY5.1 was obtained by screening a human phage library with the clone p105-153Ra and selecting clones that contained at least a fraction of the original sequence. This has enabled further polymorphisms to be detected at this locus. Other primers derived from the clones M4 and PSY5.1 may be obtained by known means. These primers hybridise to opposite strands of the target sequence and are oriented so that DNA synthesis by the polymerase proceeds across the region between the two primers. Amplification of intervening and flanking sequences of the oligonucleotide primers may produce sufficient quantities of DNA for the following techniques.

Restriction fragment length polymorphisms may be identified in the amplified products by using restriction enzymes to cleave the amplified DNA and separating the resultant digested DNA by size on an agarose gel. The relative position and frequency of fragments provide information as to whether disease or normal alleles have been inherited.

In the case of base pair polymorphisms in the amplified products found by DNA sequencing, amplification of the sequences at or near the schizophrenia susceptibility gene is carried out as described above with the additional step that direct sequencing techniques are applied. A sequencing primer complimentary to the amplified DNA enables the chain termination method to be used (Sanger, F, et al., Proc. Nat. Acad. Sci., USA, 74, 5463-5467, 1977). The number and position of base pair polymorphisms or substitutions may be used to indicate carrier status as described by Wong, C, et al, Nature, 330, 384-386, 1987. CA, CT, (GATA)_n and (GACA)_n repeat sequence polymorphisms may be found in the amplified products from patients or their relatives and also used to predict the carrier status. In this approach, sequences at or near the schizophrenia locus which possess dinucleotide repeat sequences exhibiting polymorphism are observed. They may be detected by the use of clones derived from M4, p105-153Ra, p105-599Ha and PSY5.1 by the screening of gene libraries. In addition, other plasmid, phage or cosmid clones from chromosome 5q11-q13 containing these specific repeat sequences can be identified and then screened using radioactive repeat probes for the presence of repeat sequences. After amplification of the relevant sequences, the products may be separated in size on a 6% polyacrylamide gel, the gel may be dried and the alleles detected by autoradiography (Litt, N, and Jeffrey, A, Am. J. Hum. Genet., 44, 397-401, 1989). Deletions in genomic DNA from patients and their relatives may be identified from the use of oligonucleotide primers that span either side of a deletion related to carrier status. The use of PCR will produce a shorter length product than that of the normal genomic sequence. Detection of this shorter product may be accomplished by agarose gel electophoresis and ethidium bromide fluorescent staining.

Allele specific oligonucleotide probes may be used to detect base pair polymorphisms or deletions linked to or at the schizophrenia susceptibility gene both in genomic DNA and in PCR amplified products. Allele specific oligonucleotides have single base pair mismatches between normal and affected alleles. The dot blot system of hybridization, autoradiography and allele detection may be employed as described by Engelhe et al, Proc. Nat. Acad. Sci., USA, 544, 1988. RNA probes produced by suitable cloning vectors may be used in Southern hybridization experiments and denaturing gel electrophoresis may be used to detect polymorphisms at or closely linked to the schizophrenia susceptibility locus.

Denaturing gel electrophoresis may be used to identify base pair or other polymorphisms or mutations at or closely linked to the schizophrenia susceptibility locus (Myers, R.M., et al. Nature, 313, 495-498, 1985). DNA from the patient and other affected and unaffected relatives is extracted from blood, for example, digested, made single stranded and reannealed to probe RNA or DNA which has also been made single stranded. The resultant heteroduplexes may be separated electrophoretically in a formamide denaturing gradient gel and the relative position of heteroduplexes versus homoduplexes provides information as to which alleles an individual has inherited. The ligase mediated gene detection system may also be used to identify carriers. In this method, two oligonucleotide probes are hybridised to the denatured target DNA sampled from patients or their relatives so that the 3' end of one oligonucleotide is immediately adjacent to the 5' end of the other. The DNA ligase may then join the two juxtaposed oligonucleotides by the formation of a phosphodiester bond, provided that the nucleotides at the junction are correctly base paired with the target strand. The ligation event thus positively identifies the sequences complementary to the two nucleotides. A heterozygous sample is therefore scored as positive for both alleles. The joining of oligonucleotides may be demonstrated by labelling one of the oligonucleotides with biotin and the other with ³²P, for example. After ligation, the biotinylated oligonucleotides are bound to streptavidin immobilised on a solid support. Radioactive oligonucleotides that have been ligated remain on the support after washing and may be autoradiographed (Landegren, U., et al, Science, 241, 1077-1080, 1988).

Polymorphisms or mutations at or near the chromosome 5 schizophrenia susceptibitlity locus may be identified by use of the "arms" method of identification or the 'COP' method (competitive oligonucleotide primers) (Gibbs, et al, (1989) Nucleic acids research, 17; and Newton, C.R. et al , (1989), Nucleic acids research, 17, 2503). In this instance, an allele specific oligonucleotide with one or more base pair mismatches compared to the wild type, together with a second primer without a mismatch are used to amplify the intervening DNA. In the case of the allele with the mismatch, no amplified products will be detectable at autoradiography or with non-radioactive labelling or on agarose gel electrophoresis.

The RNAse protection system may also be used to detect mutations and polymorphisms related to schizophrenia. In this method, mismatches between probe RNA and genomic sequence are detected according to the method of Myers, R. (1985b) Science, 230, 1242. Various techniques of such DNA analysis to provide the desired indication are known and some have been exemplified. The presently-preferred approach will be illustrated in more detail below. In one embodiment, the present invention provides a method for the analysis of a genomic DNA sample taken from a human individual to detect a genetic abnormality predisposing or causing the said individual or a related individual to suffer from schizophrenia, which method comprises analysing the said genomic DNA sample involving the use of one or more DNA probes which are human genomic clones to detect the presence of a polymorphism or a mutation indicative of an allele linked to or associated with the disease allele for schizophrenia.

More particularly, the present invention relates to such a method which comprises digesting the said genomic DNA sample with a suitable restriction enzyme, probing the restriction fragments with one or more DNA probes which hybridise to chromosome 5q11-5q13 region and investigating the length of the restriction fragments hybridising to the probe or probes to detect the presence of a restriction fragment polymorph indicative of an allele linked to or associated with the disease allele for schizophrenia. Specific clones which may be used as probes in such methodology include M4, p105-599Ha, p105-153Ra or PSY5.1. As necessary, the genomic DNA sample may be digested with Taql, Xbal or Mspl. Preferably, Southern blots of the genomic DNA sample, which may be extracted from a blood sample or a buccal smear, and which have been digested by the restriction enzyme, are hybridised to the probe. For convenience, the above method may be practiced using a kit. Such a kit will always include the necessary probe(s), but the other necessary reagent(s) will vary depending upon the analysis approach to be adopted. In general terms, the present invention also provides a kit for use in the analysis of a genomic DNA sample taken from a human individual to detect a genetic abnormality predisposing or causing the said individual or related individual to suffer from schizophrenia by analysing the said DNA sample involving the use of one or more DNA probes which are human genomic clones to detect the presence of a polymorph or mutation indicative of an allele linked to or associated with the disease allele for schizophrenia, the said kit comprising at least one DNA probe which is a human genomic clone and at least one other reagent suitable for use in the method.

More particularly, the presently-preferred kit functions by hybridising the said DNA sample, following treatment with a restriction enzyme, to one or more DNA probes and investigating the length of the restriction fragments hybridising to the probe or probes to detect the presence of a restriction fragment polymorph indicative of an allele linked to or associated with the disease allele for schizophrenia, the said kit comprising at least one labelled DNA probe which hybridises to chromosome 5q11-5q13 region and at least one other reagent suitable for use in the method, in particular a restriction enzyme, such as Taql, Xbal or Mspl. The DNA probes are generally those mentioned above, which may be radioactively labelled or non-radioactively labelled. The precise means by which the method according to the invention is applied to an individual will depend on the probe which is available and, in particular, how close the site of hybridization of the probe is to the site of the schizophrenia mutation. In the case of a probe which hybridises to a site linked to the site of the schizophrenia mutation, it will not be possible to diagnose with certainty the presence of the schizophrenia mutation in an individual. As well as applying the method of the invention to the individual, it will also be necessary to obtain similar data from parents and/or other relatives which will enable a prediction to be made with a reasonable degree of certainty as to whether the individual carries the schizophrenia mutation. A similar method can also be applied in genetic counselling.

Examples of gene probes which can be used in the manner described above are clones p105-599 Ha and p105-153 Ra. These clones are random genomic DNA clones mapping to the 5q11-5q13 region of human chromosomes and were obtained from Dr. John Wasmuth, University of California at Irvine, USA. Use of these clones to probe Southern blots of genomic DNA digested with Taq I and Msp I, respectively, can be used to detect individuals likely to carry the schizophrenia mutation by means of restriction fragment length polymorphism. Further details of the use of these probes in a particular study are given below. Other gene probes mapping to the same region of the human chromosomes can be used in a similar way.

The fact that a mutation causing schizophrenia has now been localised to a specific region of the human chromosomes also enables gene probes to be developed which are associated with the schizophrenia mutation.

Gene probes associated with schizophrenia (linkage disequilibrium) rather than just being linked to schizophrenia can be found by creating gene libraries that originate from the area of chromosome referred to herein which has been shown to be involved in schizophrenia (5q11-5q13). These libraries will be screened to select clones (probes) that show zero recombination fraction with schizophrenia and are therefore very close in terms of genetic distance. This will manifest itself as an association between schizophrenia and restriction fragment length polymorphisms that are found with the chromosome 5 region specific clones.

The use of such probes will enable the method according to the invention to be used to detect the schizophrenia mutant in individuals without any need for data to be obtained from relatives.

The present invention also provides a kit for use in the method described above.

In order to utilize the kit a DNA sample must be obtained from the patient. This DNA sample may be extracted from a blood sample or buccal smear and is digested with a suitable restriction enzyme. The resultant fragments will be separated by size, for example, using gel electrophoresis and transferred to a nylon filter. The fragments may then be examined using the kit.

The kit according to the invention comprises DNA corresponding to the nucleic acid sequence identified as being polymorphic and found to be in association with schizophrenia. This DNA sequence will be labelled in a suitable manner, for example using a radioactive or biotin label, and hybridised with the genomic DNA from the patient. The size of fragments present will indicate which alleles of the schizophrenia linkage marker system are present. The results may be interpreted as a probability that the chromosome 5 schizophrenia mutation is present or absent.

The present invention is based on work using the probes p105-599 Ha and p105-153 Ra referred to above and a summary of this work is as follows.

Multiplex schizophrenia kindreds were studied, ascertained because of their suitability for linkage studies. Seven kindreds (5 Icelandic, 2 English) were found to be informative for p105-599Ha/TaqI, p105-153Ra/MspI or p105-153Ra/XbaI restriction fragment length polymorphisms (probes p105-599Ha and p105-153Ra have been given the D segment codes D5S76 and D5S39, respectively). The five Icelandic families were ascertained after identification of schizophrenic probands who were amongst currently hospitalised patients during 1986 and 1987. The two English families were selected on the basis of having four or more affected individuals. The families contained multiply affected sibships with schizophrenia known to be present in at least three generations. Extensive genealogical tracing was carried out to ensure a single unilateral source for a dominantly inherited disease allele entering into each kindred. The informative families contained one hundred and four individuals at risk. Patients and their relatives gave informed consent and were interviewed by a psychiatrist using the Schizophrenia and Affective Disorders Schedule - lifetime version (SADS - L) (Spitzer et a , Research diagnostic criteria for a selective group of functional disorders, 3rd Edition, New York State Psychiatric Institute, N.Y., 1978). The SADS-L information and extensive medical information were used to diagnose all cases according to the Research Diagnostic Criteria (RDC) (Spitzer et al, loc cit) and DSM-III

(American Psychiatric Association, Committee on

Nomenclature and Statistics; Diagnostic and Statistical

Manual for Mental Disorders, Ed. 3, Washington D.C., 1980).

These are the two most widely used reliable and valid systems for psychiatric diagnosis for research purposes. Independent validation of diagnosis from all sources of information was carried out by two further psychiatrists. Diagnosis was carried out blind to the results of linkage work in the laboratory.

There were 42 cases of schizophrenia as defined by DSM-III and RDC. They exhibited a wide variety of clinical subtypes of schizophrenia. The schizophrenic patients all had histories of psychiatric hospitalisation and prolonged treatment with antipsychotic drugs. A further six individuals were diagnosed as having schizotypal features (RDC) in combination with paranoid or schizoid personality disorders (DSM-III). This group is referred to as having schizophrenic spectrum disorders. Two of these six individuals had typical psychotic episodes in reaction to alcohol drinking, but were not alcoholic and did not reach criteria for RDC or DSM-III schizophrenia.

The clinical presentation and natural history of the schizophrenia present in these families was not considered to be different from other sporadic, non- familial cases of schizophrenia. A further eight individuals had psychiatric illnesses which were not part of the schizophrenic spectrum of disorders according to RDC and DSM-III criteria. The inclusion of these individuals as cases for linkage analysis had a marked affect on the lod score.

Blood was taken for blood group and serum marker determinations, for DNA extraction and for the establishment of lymphoblastoid cell lines. standard methods for DNA extraction and restriction mapping were employed (Hodgkinson et al, loc cit). Paternity was confirmed using a combination of blood group markers and minisatellite DNA finger prints (Gurling et al, A Genetic Perspective for Schizophrenia and Related Disorder, Eds. Smeraldi and Kidd, Edi-Hermes, Milan, (in press 1988) and Jeffreys gt al. Nature, 314, 67-73, (1985)).

The random genomic DNA clones (p105-599 Ha and P105-153 Ra) mapping to the 5q11-5q13 region were used to probe Southern blots to detect restriction fragment length polymorphisms segregating in the effective kindreds. The lod score method was used to calculate the probability of linkage between marker and disease alleles at specific recombination fractions (genetic distances) as opposed to non-linkage (50% recombination). These were calculated by the LINKAGE programs.

In the fragmented families typically found associated with most mental disorders there is incomplete knowledge of the genotypes of all individuals in the family. Accordingly, an estimate using likelihood analysis is usually employed to estimate the amount of recombination between two alleles and the probability at which the observed data could arise. A quantitative expression for the likelihood of linkage between loci is given as the lod score which is the log to the base 10 of the relative probability of observing the family at a recombinant fraction of less than 0.5 (i.e. the marker is linked to the disease locus) to the probability of the recombinant fraction being 0.5 (i.e. no linkage). Lod scores that are higher than 3 represent the likelihood that linkage has occurred between the marker and disease alleles as opposed to non-linkage at a value of about 50:1 taking prior probability into account. A lod score of 3 or higher is considered good evidence for linkage.

The present study started from the prior hypothesis that chromosome 5 was involved in schizophrenia. This hypothesis and the methods of analysis used increased the odds that the results are valid. Methods of analysis were used that did not require penetrance parameters to be estimated which excluded the incorporation of an unknown variable. The linkage information was first analysed in a "penetrance free" model (PF) as shown in Table 1 below. The use of the PF model allows an accurate estimate of the recombination fraction between marker and disease locus because information from unaffected individuals who may have inherited the mutation (non penetrant carriers) will not be mistaken as recombinants. The data was next analysed as a fully penetrant dominant disorder (DOMS, DOMSS and DOMSSF models. Table 1). In order further to explore the effect of variable penetrance of the disease allele lod scores were calculated at penetrance values varying between 95% and 50% (INCSS model, Table 1).

Prior to the onset of the study it was decided to include as cases all those individuals who fell into the category of RDC and DSM-III defined schizophrenia, as well as the schizophrenic "spectrum" disorders. In the affected schizophrenic and schizophrenic spectrum individuals, 28 informative meioses were observed and amongst these there were 24 non-recombinants and 4 recombinants. In the affected schizophrenic and schizophrenia spectrum individuals, 28 informative meioses were observed and amongst these there were 24 non-recombinants and 4 recombinants. The results for p105-599 Ha are shown in Table 2 and demonstrate that information drawn from both the affected and unaffected individuals detected the best evidence for linkage in families F35 and F41 as shown in the dominant model (DOMSS) .

In other families (F27, F20) good evidence for linkage was found when all unaffected individuals were not scored for the presence or absence of schizophrenia as in the Penetrance Free model (PF). This result suggested that there were some individuals who had inherited the mutation but were not suffering from schizophrenia or schizophrenia spectrum disorder. Figure 1 demonstrates a family (F41) showing strong evidence for linkage under a dominant model

(DOMSS and DOMSSF) .

In Table 3, the results for linkage between schizophrenia and p105-153 Ra also show evidence for linkage, but in a different set of families. The best evidence for linkage is found with the PF and DOMSSF models, as opposed to the DOMSS model. The mean age of onset for schizophrenia was 25.97 years (S.D. = 8.2). There were three individuals who developed schizophrenia after the age of 30. There was no linear relationship between age and age of onset of schizophrenia amongst the affected individuals once they had reached the age of thirty. The unaffected individuals in the families were all over the age of 30, therefore it was not justifiable to assign penetrance parameters (liability classes) according to age.

The results are shown in Tables 2, 3 and 4. They indicate that information drawn from the unaffected (but possible carrier) individual detected the best evidence for linkage in families F35 and F41 as shown in the dominant model (DOMSS). In other families (F27, F20) better evidence for linkage was found when all unaffected individuals were not scored for the presence or absence of schizophrenia penetrance free model: (PF).

Figures 1 and 2 demonstrate families showing strong evidence of linkage. The mean age of onset of schizophrenia was twenty-eight years (SD +- 9.3) and there were three individuals who developed schizophrenia after the age of thirty. Because almost all of the unaffected individuals were past the age of risk, it was not possible to carry out an analysis with penetrance set according to the age of the unaffected individuals. A more detailed analysis of penetrance (Table 4) showed that the maximum lod scores did not vary very much for penetrance values for schizophrenia of between 95% and 65%. Figure 2 shows the pedigree diagram of F20 which was informative for both markers and shows linkage when the markers are combined into haplotypes.

A test of heterogeneity (Homog. Ott, Analysis of Human Genetic Linkage, Johns Hopkins University Press, Baltimore, 1985, and Ott, Am. J. Hum. Genet., 39, 159-165, (1986)) rejected evidence of heterogeneity of linkage when applied to the dominant model (Chi 2 = 19.94, p = 0.0000). The highest lod score for schizophrenia and spectrum disorders was reached employing a dominant model with complete penetrance. This analysis would normally overestimate the recombination fraction be confounding non-penetrant carriers with recombinants. The best estimate for the genetic distance (recombination fraction) between schizophrenia and p105-599 Ha and/or p105-153 Ra should be given by the "penetrance free" model. However, the maximum lod score for both models is found as the same recombination fraction, suggesting that the non-penetrant carriers of the mutation in the families were all assumed to be obligate carriers by the LINKAGE programs by virtue of transmitting the illness to affected offspring. The penetrance free model removes much of the linkage information and is an underestimate of the statistical probability against the results reprinted herein having occurred by chance.

Analysing the data on the assumption that all individuals that had mental disorders other than schizophrenia may also be showing the effect of the mutations segregating in the families gave the highest lod score of 6.9 suggesting that these individuals were indeed suffering from a typical expression of the schizophrenia mutation. If the three psychiatric cases were not genetically related to schizophrenia, the lod score would have decreased.

The chromosome 5 schizophrenia susceptibility gene may be followed as it is transmitted from parents to children within specific families with the use of a test kit for the schizophrenia locus. This consists of the DNA probes p105-153Ra and PSY5.1 at a recombination fraction (genetic distance) of between 0.00 and 0.07 (0.00% and 0.07%) from the schizophrenia locus. In addition, at 0.1 (10%) recombination probe p105-599Ha is linked to schizophrenia on the centromeric side of p105-153Ra. The test consists of the hybridization of the probes, after they have been made radioactive with ³²P to genomic DNA extracted from patients and their family members and digested with the relevant enzymes (Taql, Xbal, Mspl). Specific restriction fragment length polymorphisms found with these markers at Southern hybridization enable the detection of unaffected carriers and the confirmation of a diagnosis of schizophrenia, schizophrenia spectrum disorders and related schizophrenia fringe disorders. TABLE 1 DESCRIPTION OF THE MODELS EMPLOYED FOR LINKAGE ANALYSIS

MODEL: PF Robust, "penetrance free" model. Linkage information between marker and disease obtained only from schizophrenic and spectrum cases, unaffected cases scored as unknown at the schizophrenia locus.

MODEL: DOMS Assuming dominant inheritance and complete penetrance schizophrenia cases scored as affected, schizophrenia spectrum cases excluded. Unaffected obligate carriers scored as unknown at the disease locus.

MODEL: INCSS Penetrance for schizophrenia genotype under a dominant model with incomplete penetrance varied from 95% to 50%. Individuals with schizophrenia and schizophrenia spectrum disorders given positive affection status.

MODEL: DOMSS Assuming dominant inheritance and complete penetrance. Schizophrenia and spectrum cases scored as affected. Unaffected obligate carriers scored as unknown at the disease locus.

MODEL: DOMSSF Assuming dominant inheritance and complete penetrance. Schizophrenia, spectrum and all other non schizophrenic psychiatric disorders included as cases. Unaffected obligate carriers scored as unknown at the disease locus. TABLE 2 TWO POINT LOD SCORES AT SPECIFIED

RECOMBINATION FRACTIONS FOR LINKAGE BETWEEN SCHIZOPHRENIA AND P105.599Ha

FAMILY RECOMBEATON FRACTEN MODEL 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 0.40 0.45

ALL FAMILIES COMBINED (F20,F27,F35,F36,F41,F74)

PF - 1.74 2.26 2.27 2.05 1.69 1.26 0.82 0.42 0.14 DOMSS - 3.08 3.92 4.11 3.95 3.49 2.84 2.04 1.14 0.33

DOMSSF - 3.42 4.57 4.78 4.54 4.01 3.24 2.31 1.29 0.38

F20

PF 0.90 0.31 0.72 0.62 0.52 0.41 0.30 0.19 0.09 0.03 DOMSS - 0.18 0.02 0.10 0.12 0.12 0.09 0.00 0.03 0.00 DOMSSF 1.20 1.09 0.98 0.85 0.72 0.58 0.44 0.29 0.15 0.04 F27

PF 0.65 0.99 0.99 0.94 0.81 0.65 0.47 0.29 0.12 DOMS - 0.10 0.34 0.54 0.62 0.62 0.56 0.44 0.29 0.12 DOMSSF -1.00 -0.02 0.44 0.64 0.70 0.65 0.52 0.35 0.16

F35

PF - 0.19 -0.00 0.06 0.08 0.07 0.05 0.03 0.01 0.00

DOMSS 0.39 0.62 0.73 0.74 0.68 0.57 042 0.24 0.07 DOMSSF 1.07 1.33 1.34 1.25 1.08 0.86 0.60 0.32 0.09 F36

PF -0.04 -0.03 -0.02 -0.01 -0.00 -0.00 -0.00 -0.00 0.00 0.00

DOMSS - 0.22 - 0.18 - 0.14 - 0.11 -0.08 -0.05 -0.03 -0.01 -0.00 -0.00 DOMSSF - 0.31 - 0.31 - 0.30 - 0.28 - 0.24 - 0.18 - 0.13 -0.08 -0.03 -0.01 F41

PF 0.59 0.69 0.64 0.54 0.41 0.26 0.13 0.03 -0.01

DOMSS 3.30 3.16 2.87 2.51 2.09 1.62 1.11 0.57 0.12 DOMSSF 2.72 2.66 2.45 2.16 1.80 1.40 0.95 0.48 0.09 F74

PF -0.16 -0.11 -0.07 -0.04 -0.03 -0.01 -0.01 -0.00 -0.00 -0.00 DOMSS -0.23 -0.15 -0.08 -0.02 -0.01 0.03 0.03 0.03 0.02 0.01 DOMSSF - 0.23 -0.15 -0.08 -0.02 -0.01 0.03 0.03 0.03 0.02 0.01

Gene frequency for schizophrenia: 0.0085 TABLE 3 LOD SCORES AT SPECIFIED RECOMBINATION

FRACTIONS FOR LINKAGE BETWEEN SCHIZOPHRENIA AND P105-153Ra ALLELES

FAMILY RECOMBMATION FRACTION

0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 0.40 0.45

ALL FAMILIES COMBINED (F20 ,F35, F36,F40,F74)

PF 1.16 1.20 1.05 0.86 0.66 0.46 0.29 0.14 0.04 -0.00

DOMSS - 0.14 0.46 0.52 0.48 0.58 0.25 0.12 0.02 -0.03

DOMSSF - 1.74 1.88 1.72 1.44 1.10 0.75 0.42 0.16 0.01

F20

PF 0.21 0.11 0.03 -0.03 -0.07 -0.09 -0.09 -0.08 -0.06 -0.03

DOMSS - -0.62 -0.45 -0.41 -0.39 -0.37 -0.32 -0.35 -0.16 -0.08

DOMSSF 0.81 0.66 0.50 0.34 0.19 0.07 -0.03 -0.07 -0.08 -0.06

F35

PF 0.65 0.57 0.50 0.41 0.33 0.25 0.17 0.10 0.05 0.02

DOMSS - -0.24 -0.02 0.06 0.09 0.09 0.08 0.05 0.03 0.00

DOMSSF - -0.24 -0.02 0.06 0.09 0.09 0.08 0.05 0.03 0.00

F36.

PF -0.41 -0.09 0.03 0.08 0.10 0.09 0.07 0.05 0.02 0.01

DOMSS -0.37 -0.36 -0.26 -0.13 -0.03 0.03 0.05 0.05 0.03 0.01

DOMSSF 0.30 -0.03 0.21 0.32 0.35 0.33 0.26 0.18 0.10 0.03

F40

PF 0.30 0.26 0.21 0.17 0.13 0.10 0.06 0.04 0.02 0.00

DOMSS 0.60 0.54 0.47 0.39 0.32 0.24 0.17 0.10 0.05 0.01

DOMSSF 0.60 0.54 0.47 0.39 0.32 0.24 0.17 0.10 0.05 0.01

F74

PF 0.41 0.35 028 0.22 0.17 0.11 0.07 0.03 0.01 0.00

DOMSS 0.92 0.32 0.72 0.61 0.49 0.38 0.27 0.17 0.08 0.02

DOMSSF 0.92 0.32 0.72 0.61 0.49 0.38 0.27 0.17 0.08 0.02 TABLE 4 MULTIPOINT LOD SCORES BETWEEN SCHIZOPHRENIA, p105-599Ha AND p105-153Ra

ALL FAMILIES COMBINED

Recombination Fraction

MODEL 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 0.40 0.45

PF* - 2.11 2.72 2.73 2.46 2.03 1.52 0.99 0.51 0.16

DOMS** - 2.52 3.78 4.13 3.99 3.55 2.88 2.05 1.15 0.35

DOMSS** - 3.90 4.99 5.19 4.91 4.32 3.49 2.49 1.40 0.43

DOMSSF** - 5.01 6.10 6.17 5.73 4.96 3.94 2.77 1.53 0.46INCSS**- PENETRANCE VARIED FROM 95% TO 50%

95% -8.11 4.19 5.01 5.09 4.76 4.06 3.32 2.34 1.90 0.39

85% -3.37 4.26 4.59 4.85 4.45 3.82 3.00 2.06 1.11 0.32

75% -1.25 4.23 4.71 4.58 4.14 3.49 2.69 1.81 0.94 0.02

65% 0.05 4.06 4.45 4.26 3.80 3.16 2.39 1.57 0.79 0.21

50% 1.24 3.60 3.82 3.60 3.14 2.54 1.86 1.16 0.55 0.13

* Most likely gene order: p105-599Ha, Schizophrenia, p105-153Ra.

Recombination fraction between p105-153Ra and

schizophrenia = 0.05.

** Most likely gene order: Schizophrenia, p105-153Ha, p105-153Ra.

Recombination fraction between p105-153Ra and

p105-153Ha = 0.075.

Claims

1. A method for the analysis of a genomic DNA sample taken from a human individual to detect a genetic abnormality predisposing or causing the said individual or a related individual to suffer from schizophrenia, which method comprises analysing the said genomic DNA sample involving the use of one or more DNA probes which are human genomic clones to detect the presence of a polymorphism or mutation indicative of an allele linked to or associated with the disease allele for schizophrenia.

2. A method for the analysis of a genomic DNA sample taken from a human individual to detect a genetic abnormality predisposing or causing the said individual or a related individual to suffer from schizophrenia, which method comprises digesting the said genomic DNA sample with a suitable restriction enzyme, probing the restriction fragments with one or more DNA probes which hybridise to chromosome 5q11-5q13 region and investigating the length of the restriction fragments hybridising to the probe or probes to detect the presence of a restriction fragment polymorph indicative of an allele linked to or associated with the disease allele for schizophrenia.

3. A method as claimed in claim 1 or claim 2 in which the genomic DNA sample is digested with Taql, Xbal or Mspl.

4. A method as claimed in any of claims 1 to 3 in which the probe is clone M4, p105-599 Ha, p105-153 Ra or PSY5.1.

5. A method as claimed in any of claims 1 to 4 in which Southern blots of the genomic DNA sample digested by the restriction enzyme are hybridised to the probe.

6. A method as claimed in any of claims 1 to 5 in which the genomic DNA sample is extracted from a blood sample or buccal smear.

7. A kit for use in the analysis of a genomic DNA sample taken from a human individual to detect a genetic abnormality predisposing or causing the said individual or a related individual to suffer from schizophrenia by analysing the said DNA sample, involving the use of one or more DNA probes which are human genomic clones to detect the presence of a polymorphism or mutation indicative of an allele linked to or associated with the disease allele for schizophrenia, the said kit comprising at least one DNA probe which is a human genomic clone and at least one other reagent suitable for use in the method.

8. A kit for use in the analysis of a genomic DNA sample taken from a human individual to detect a genetic abnormality predisposing or causing the said individual or a related individual to suffer from schizophrenia by hybridising the said DNA sample, following treatment with a restriction enzyme, to one or more DNA probes, and investigating the length of the restriction fragments hybridising to the probe or probes to detect the presence of a restriction fragment polymorph indicative of an allele linked to or associated with the disease allele for schizophrenia, the said kit comprising at least one labelled DNA probe which hybridises to chromosome 5q11-5q13 region and at least one other reagent suitable for use in the method.

9. A kit as claimed in claim 7 or claim 8 in which the said other reagent is a restriction enzyme.

10. A kit as claimed in claim 8 or claim 9 in which the restriction enzyme is Taql, Xbal or Mspl.

11. A kit as claimed in any of claims 7 to 10 in which the DNA probe is clone M4, p105-599 Ha, p105-153 Ra or PSY5.1.

12. A kit as claimed in any of claims 7 to 11 in which the DNA probe is radioactively labelled or non-radioactively labelled.