WO1989012100A1

WO1989012100A1 - Complete nucleotidic sequence of the complementary dna of the genomic rna of the potyvirus, genes coding for the potyvirus capside protein and application of said genes to the creation of potyvirus-resistant transgenic plants

Info

Publication number: WO1989012100A1
Application number: PCT/FR1989/000260
Authority: WO
Inventors: Christophe Robaglia; Mylène DURAND-TARDIF; Jean Masson
Original assignee: Institut National De La Recherche Agronomique (Inr
Priority date: 1988-05-30
Filing date: 1989-05-30
Publication date: 1989-12-14
Also published as: AU3964189A; FR2631973A1; FR2631973B1; EP0444040A1

Abstract

Gene coding for the potyvirus capside protein, particularly the potato virus. Method for obtaining said coding gene, the method comprising the insertion of a fragment of a synthetic DNA having an ATG codon at a selected point of the complementary DNA sequence coding for the capside protein. Applications to the production of transgenic potyvirus-infection resistant plants.

Description

FULL NUCLEOTIDE SEQUENCE OF DNA

COMPLEMENTARY TO POTYVIRUS GENOMIC RNA, GENES ENCODING POTYVIRUS CAPSIDE PROTEIN AND

APPLICATIONS OF THESE GENES TO PLANT CREATION

TRANSGENIC RESISTANT TO POTYVIRUSES.

The present invention relates to the determination of the complete nucleotide sequence of the DNA complementary to the genomic RNA of potyvirus, including that of the potato virus Y, and to the use of this sequence to create genes capable to confer on plants a resistance to potyviruses, by the creation of transgenic plants resistant to phytopathogenic viruses and in particular to potyvirus.

Viral conditions are a problem for the pathologist; in fact, because of the dependence of the virus on host cells, it is difficult to destroy it without running the risk of damaging the organism which it parasites. The means of control are therefore essentially preventive; vaccines are used in animals with immune systems and in plants, seed selection and resistance varieties. Curative methods are based on the use of molecules that interfere with replication (analogs of bases such as azidothymidine) which are not without side effects for the host. In plants, thermotherapy and the cultivation of meristems allow healthy plants to be regenerated from infected plants (Morel and Martin, 1952).

Potyviruses are the largest group of plant viruses, comprising more than 70 apparently distinct members. These viruses are defined by the filamentary structure of their particle, 600 to 900 nm long, containing approximately 5% of nucleic acid and 95% of proteins. Each particle contains a single molecule of simple RNA positive strand of molecular weight 3-3.5 × 10 ⁶ , and the subunits of a single polypeptide of molecular weight 32-34 × 10 ³ . They induce the formation of inclusions of characteristic forms which accumulate in the cytoplasm and sometimes in the nucleus. They are transmitted naturally by aphids in a non-persistent fashion and some are also transmitted by seed. Transmission of potyviruses by aphids is dependent on the presence of a helper protein, encoded by the viral genome, in the infected plant (Pirone and Thornbury, 1983). These viruses are often serologically interconnected. Most have a relatively narrow host spectrum. They infect a large number of plant species belonging to monocots as well as dicots. Potato virus Y (PVY) is the typical member of this group. It is pathogenic for various nightshades of agronomic interest such as tobacco, peppers, tomatoes and various varieties of potatoes. In the latter species, yields can be reduced by 10 to 80% depending on the strain of virus, the cultivar and the time of infection. The Y virus and the leaf curly virus (PLRV, belonging to the luteovirus group), are considered to be the two most important viruses affecting the potato in the world. Early infection of tobacco with PVY can lead to a yield reduction of around 30%, and necrosis of the nerves from the nerves, caused by the N strain, can cause complete loss of the crop. There are three main strains, characterized by the symptoms caused on control plants: groups O, N, and C. Viruses belonging to group O (common strains), generally induce severe systemic symptoms of embossing, and leaf necrosis drooping in potatoes, systemic necrosis in Physalis floridana and systemic mottling in tobacco. Group N (strains of necrosis of the ribs of the tobacco), produces severe systemic necrosis of the ribs in tobacco, systemic mottling in Physalis floridana and slightly accentuated mottling in the majority of potato cultivars. Group C viruses, including the PVC virus which is not transmissible by aphids, produce hypersensitivity reactions in many potato cultivars. These groups, although very serologically related, show great intra-group variability. We can say that there are no reproducible serological differences between Yo, Yn and Yc. The reported inter-group cross-protection results are contradictory (De Bokx and Huttinga, 1981). The capsid protein sequence of an Australian isolate (PVYd) revealed 92% identity with the capsid of the Pepper Mottle Virus (PeMV) and 62% with that of the Tobacco Etch Virus (TEV), the N- terminal of these proteins showing the greatest divergences (Shukla et al., 1986).

The molecular study of potyviruses is relatively recent. These viruses are difficult to purify because of their particle instability and their tendency to form aggregates.

A protein (VPg) is covalently linked to the 5 'end of the viral RNA (Hari, 1981), which is polyadenylated at the 3' end (Hari, 1979). Initial "in vitro" translation studies suggested that genomic RNA could be translated into a high molecular weight polyprotein, which would then be matured into smaller proteins (Yeh and Gonsalves, 1985. Hellman et al., 1983). This hypothesis was confirmed by analysis of the nucleotide sequence of the tobacco etch virus (TEV) and tobacco vein mottling virus (TVMV) genomic RNAs (Allison et al., 1986. Domier et al., 1986), these RNAs would code for 345kD and 340kD polyproteins respectively. This mechanism is similar to that used by animal picornaviruses (Nicklin et al, 1986) and by

Comovirus (Goldbach, 1987). The proteolytic cleavages in these viruses are mainly made at the Gln-Gly (Picornavirus) and Gln-Gly, Gln-Ser and Gln-Met (Comovirus) sites.

By combining these data, the approximate size of the cistrons and the cleavage site of the capsid protein,

Domier et al, 1986, proposed a proteolytic cleavage map of the TVMV polyprotein. The same group (Domier et al, 1987) subsequently published an analysis of the sequence homologies of the proteins thus defined, with those of the Picorna-, Como-, and Caulimoviruses. Finally, Carrington and Dougherty (1987) demonstrated that one of the two nuclear inclusions of TEV was a protease, which enabled these researchers to propose a partial genetic map of the Potyvirus genome by comparison with genomic RNAs of picornaviruses ( poliovirus), comovirus (CPMV), nepovirus (TBRV) and potyvirus (TVMV).

In 1985, Sanford and Johnston (J. THEOR. BIOL. 395-40) proposed the concept of resistance derived from the pathogen, which can be stated as follows: nucleotide sequences derived from the pathogen can be used to modify the host genetically in order to that it becomes resistant to the pathogen. This is possible because the life cycle of a parasite, like that of any organism, results from a sum of molecular events regulated at various levels. Resistance therefore comes from an interruption in the development of the parasite by one of its genes expressing itself at the wrong time, in the wrong place, in too large a quantity or in a modified counter-functional form.

In 1986, Powell-Abel et al. (SCIENCE, 212, 738-743) have demonstrated the existence of partial protection against the tobacco mosaic virus (TMV) in plants expressing a gene coding for the capsid protein of this virus. Similar results have been obtained with the alfalfa mosaic virus (AlMV) (Loesch Fries et al., 1987), then with potato virus X (PVX) and cucumber mosaic virus (CMV) (Tumer et al., 1987, EMBO J., 6, 1181-1188 and 1987, NATO ASI Series A Life Science Plenum Press NY & LONDON, pp 351-356). It would appear that the presence of the capsid protein in the cell prevents the entry of the virus or its decapidation: in fact the inoculation of viral RNA can overcome the protection observed in transgenic plants (Nelson et al., 1987 VIROLOGY, 158, 126-132). The fact that this protection results in a delay in the appearance of lesions on the inoculated leaves, suggests an inhibitory effect at later stages of the infection, such as a reduction in the rate of multiplication or a blockage of the transport of the virus. cell to cell. The Authors of these works draw a parallel with the phenomenon of cross-protection where infection of a plant by a weakly virulent strain of a virus protects it against the effects of a subsequent infection by another strain of the same virus ( Fulton, 1980, ANN. REV. PHYTOPATH., 24, PP. 67). The reasons for these observations could be multiple. It has been shown, for several viruses, that the capsid protein, in addition to its structural role, has a regulatory function. In the early stages of infection, the capsid protein of the alfalfa mosaic virus would play a role in the binding of the polymerase to the 3 'end of the RNA, and therefore an activator of the synthesis of the negative strand, and in the late stages it would repress it, making the overall synthesis of RNA not symmetrical, in favor of the production of the positive strand (Houwing and Jaspars, 1987). Similarly, the bacteriophage QB capsid protein would have a double negative regulatory role, by suppressing viral replication, while promoting the translation of its own gene, and by suppressing the translation of the gene coding for the polymerase, by binding to its domain. initiation (Bernardi, 1972; Robertson, 1975). Using this latest data, Grumet, Sanford and Johnston, (1987, MOLECULAR STRATEGIES FOR CROP

PROTECTION, ALA | î R. LISS INC pp. 3-12) demonstrated the validity of the concept of resistance derived from the pathogen, by obtaining high levels of resistance to this bacteriophage in E. coli strains expressing its capsid protein, even at multiplicities of infection important.

The inhibition of the viral cycle therefore seems to take place at least during an early stage: decapsidation or entry of the virus into cells; this is suggested by the fact that naked RNA retains its infectious power. In transgenic plants, the virus could therefore not begin its replication cycle. This differs from protection experiments using the properties of the CMV satellite RNA, in which a related virus, "Tomato aspermy virus" (TAV), although not producing symptoms on transformed plants, is perfectly capable of replicate it. This observation may raise the risk of creating plants which would be reservoirs of a virus, harmless to them and undetectable, but which can spread to other species.

This risk appears to be excluded in the event that such inhibition could be obtained by using a gene coding for the capsid.

The major problem posed by the construction of a gene coding for the PVY capsid protein was the absence of a translation initiation codon allowing the synthesis of the protein by cellular machinery. It would have been possible to use an AUG codon in phase located upstream of the gene. The first being 57 nucleotides from the first codon, there would be production of a protein extended by 19 amino acids compared to the mature capsid protein of the virus and its function could be altered. Furthermore, this codon was not in an optimal context of type A - AUGG translation (Kozak, 1986). In this regard, it should be noted that the Articles relating to the expression of such a gene in plants and the establishment of a resistance phenotype indicates a strong accumulation of protein, from 0.1 to 0.8% of soluble proteins. To obtain this accumulation, at least two relatively predictable factors must be optimized during the assembly of the gene: the strength of the promoter used and the nature of the sequences preceding and surrounding the initiation codon.

Consequently, the object of the present invention is to construct a gene coding for the capsid protein of potyvirus and in particular of PVY, under conditions such that its function cannot be altered, by adding an ATG sequence. at the 5 'end of the coding sequence for the potyvirus capsid. Potyviruses have the particularity of having as translation product, a single polyprotein which gives functional proteins only after proteolytic cleavage in precise places of the polyprotein, by a specific protease precisely coded by the viral genome; as a result, the present invention also aims to provide a system capable of blocking the action of the protease in order to prevent the appearance of viral proteins and, consequently, symptoms of l viral infection of the plants concerned. The subject of the present invention is transgenic plants resistant to infection by potyviruses, characterized in that they are obtained from plant cell lines, in particular from plant species liable to be infected by potyviruses, modified by introduction of a gene coding for the potyvirus capsid protein.

According to one embodiment of the invention, said transgenic plants are characterized in that the gene introduced is a gene coding for the capsid protein of potyvirus, resulting from the addition of an ATG sequence to the 5 'end of the cDNA sequence encoding for said potyvirus capsid protein, provided with signals for regulating gene expression in a plant cell.

According to a particularly advantageous embodiment of the invention, the ATG initiation codon of the introduced gene is included in a consensus sequence, of the type AX ₁ X ₂ ATGG in which X or Y are identical or different and each represents one nucleotides A, T, G or C. Of course, the seeds derived from these transgenic plants and used for the reproduction of these fall within the scope of the present invention.

The present invention also relates to a gene coding for the capsid protein of potyvirus, characterized in that it results from the addition of an ATG sequence to the 5 'end of the cDNA sequence coding for said protein. of capsid of potyvirus.

According to one embodiment of this gene, its ATG initiation codon is included in a sequence of type AX ₁ X ₂ ATGG, where X ₁ and X ₂ are as defined above.

According to another embodiment of this gene, it comprises the DNA sequence complementary to the following nucleotide sequence (I):

The present invention further relates to a DNA sequence constituted by a gene coding for the capsid protein of potyvirus as defined above, provided with signals for regulating genetic expression in a plant cell.

The present invention further relates to a process for obtaining a gene coding for the capsid protein of potyvirus, characterized in that a fragment of a synthetic DNA comprising an ATG codon is inserted at a chosen point of the cDNA sequence coding for the capsid protein, the plasmids containing the desired junction then being isolated by hybridization with a synthetic oligonucleotide covering half the sequence of the synthetic DNA fragment and half the sequence of the 5 'end of the sequence of the gene coding for the potyvirus capsid protein.

The present invention further relates to a process for obtaining cDNA from potyvirus genomic RNA, which is characterized in that the first strand of cDNA is synthesized by the action of reverse transcriptase on RNA genome of potyvirus using random hexamers as initiators of the first strand, the RNA / DNA hybrid obtained is converted into double-stranded DNA by the joint action of three enzymes, RnaseH. of E. coli, which partially degrades the RNA part of the hybrid, creating primers on which the DNA polymerase acts, which displaces the cleavage by synthesizing DNA by its 3 '->5' activity and by degrading RNA by its 5 '->3' activity, the DNA fragments thus created are joined by the ligase of E. coli, the double-stranded cDNA is then treated with Sl-nuclease, the repair of its ends is carried out using T ₄ -DNA-polymerase and the cDNA is separated according to its size on gel. low melting agarose, then ligated into a Smal cleavage site of an appropriate vector and the recombinant plasmids are introduced into E. coli, collected and sequenced by an appropriate sequencing method.

Clones, obtained by insertion of double-stranded cDNA in an appropriate plasmid, are partially sequenced by the deletion method or by subcloning of restriction fragments in an appropriate vector, the selection of said clones being carried out by hybridization with a mixture synthetic oligonucleotides of 20 mothers deduced from the amino acid sequence of the N-terminus of the capsid protein.

The present invention further relates to the complete nucleotide sequence of the PVY genomic RNA, which is characterized in that it comprises 9704 bases followed by a poly-A end, in that a non-coding region with the 5 'end, which comprises 185 bases, precedes the single and long open reading phase, in that said phase codes for a polyprotein of 3063 amino acids and in that it is followed by a non-region 331 base coding at the 3 'end. According to an advantageous embodiment of said complete sequence of potyvirus genomic RNA, this is represented by the following nucleotide and amino acid (II) sequence:

According to the invention, the position of the sequence of the capsid protein in the above-mentioned RNA sequence is such that its N-terminal end is located at position 2796 of the polyprotein. The present invention further relates to the DNA sequence complementary to the sequence (II) defined above.

The present invention also encompasses any nucleotide sequence specific for the PVY genome, included in the sequence (II) or in the DNA sequence complementary to said sequence II.

In addition to the foregoing provisions, the invention also comprises other provisions, which will emerge from the description which follows. The invention will be better understood using the additional description which follows, which refers to examples of implementation of the invention.

It should be clearly understood, however, that these examples are given solely by way of illustration of the subject of the invention, - of which they do not in any way constitute a limitation.

EXAMPLE 1: Cloning and sequencing of the DNA complementary to the potyvirus Y genomic RNA of the potato (PVY): 1. Development of the conditions for obtaining the cDNA of the PVY RNA.

The synthesis of complementary DNA is traditionally considered to be a delicate process involving many successive enzymatic steps. PVY RNA being a single large molecule

(9.8kb) constitutes a material of choice for the optimization of this technique.

The cDNA was synthesized by the method of

GUBLER and HOFFMAN (1984). In this method the first strand is synthesized in a conventional manner by the action of reverse transcriptase, and the RNA / DNA hybrid obtained is converted into double-stranded DNA by the joint action of 3 enzymes: RNaseH from E. coli partially degrades the RNA part of the hybrid, creating primers for DNA polymerase I which displaces the cleavage by synthesizing DNA by its 3 '->5' activity while degrading the RNA by its 5 'activity -> 3 ', the DNA fragments thus created are joined by the ligase of E. coli chosen because of its inability to join DNA with free ends. The optimal concentration of KCl for obtaining long retrotranscripts of viral RNA is 140 mM.

Thanks to the excellent quality of the available RNA and probably also to the absence of strong secondary structures, it was possible to synthesize a complete first strand cDNA (approximately 10kb) using reverse transcriptase of the myeloplastoma virus. avian (Genofit and Life Science).

In order to increase the mass of synthesized cDNA, a second aliquot of enzyme was added (25-30 units for 2 μg of RNA in a reaction volume of 20 μl) as well as 10 units of RNasin after 30 'of reaction at 43ºC and the incubation was continued for 30 '. The use of random primers in place of oligodT made it possible to increase the yield by a factor of 5 to 10 but at the expense of the size of the products synthesized. The second strand synthesis reaction takes place in the same tube as the first strand synthesis, after increase in volume. This increase in volume appeared critical to obtain a reproducible conversion of 80 to 100%; it must be at least 10 times. It has been shown that the addition of E. coli DNA ligase is not necessary for the complete conversion into double-stranded DNA of a small RNA such as the messenger coding for globin (GUBLER and HOFFMAN , 1984).

RNase A treatment was included at the end of second strand synthesis; in order to obtain perfectly blunt ends, the repair step has takes place for a very short time in the absence of nucleotides allowing the DNA polymerase of phage T4 to resect the 3 'ends of the DNA; the nucleotides are added and the incubation then continues normally. 2. Cloning and sequencing of the cDNA.

Initially, two cDNA libraries of the PVY genomic RNA were constructed, by the method of addition of homopolymeric extensions in the vector pTZ 19 (Pharmacia), each of them containing approximately 150 clones, one by priming of the first strand with random primers and the other by priming with oligodT. The screening of this latter library with a mixture of synthetic oligonucleotides of sequence GC (A / G) AATGATAC (A / T) AT (C / T / A) GA (T / C) GC, deduced from that of the first amino acids of the PVYn capsid protein, ANDTIDA, made it possible to select about twenty clones. Based on the size of the insert they contained, plasmids pY139 (1kb), pY118 (1.8kb) and pY117 (3.6kb) were chosen to be sequenced. The partial sequence of plasmids pY139 and pY118 was carried out by a sequential deletion method based on the cleavage properties of DNAse I in the presence of Mn ²⁺ ions (LIN et al., 1985) and that of plasmid pY117 by sub -cloning of restriction fragments generated by the enzymes Rsal, Ddel, Hinfl and Taql in the vector

Bluescript KS + (Stratagene). The insertion contained in the plasmid pY139 was found to originate from a cDNA initiated on a sequence of 5 adenines corresponding to two lysines at positions 176 and 177 of the protein sequence previously published (SHUKLA et al. 1986).

EXAMPLE 2 Synthesis of complementary DNA.

FIRST STRAND, Mix RNA PolγA + and H20, incubate at 80 ° C, cool in ice, - RNA 2-3μg

- H ₂ O for a final volume of 19μ l Add in order:

- RNAsin 1 μl Biotec 10μ / μl

- oligo pdT 1 μl 2μg / μl or random primers 4μg / μl

- RT buffer 5 × 4 μl

- dNTPs 2 μl 10mM AGT, 5mM C

- alpha- ³² P-dCTP 1 μl 800Cie / mmol

- NaPPi 80mM 1 μl TOTAL 19 μl

Mix (without bubbles) pre-incubate 2 'at 43 ° C

- Reverse-Transcriptase 1 μl (Genofit 25-30μ / μl)

- 43ºC 30 '

- Reverse-Transcriptase 1 μl

- RNasin 1 μl

- 43ºC 30 '

Put in ice and take 2 × 1μl to calculate the mass of synthesized cDNA and for an alkaline gel.

SECOND STRAND To the 1st strand mixture 18 μl add:

- H ₂ O qs 200 μl final volume

- buffer 5 × 40 μl

- DNAPolymerase 50 μ Amersham

- DNAligase (E. coli) 2 μ Biolabs

- B-NAD 10mM 2 μl 3.3mg / 500μl

- prepared immediately

- RNaseH 1.5 μ BRL

- 16ºC 2 h.

- 22ºC 30 'room temperature

- CDTA 0.5M 10 μl

- RNaseA (2μg / μl) 2 μl

- 37ºC 15 '

- Phenol 100 μl Vortex

- Chloroform 100 μl "

- centrifuge 5 '10000rpm

Take the aqueous phase, wash the organic phase with 50 μl TC, combine the two aqueous phases (250 μl) - extract twice with 500 μl of ether - NH-Ac 8M 125 μl

- ETOH 95% 850 μl mix

- -80ºC 5 'Warm to room temperature - centrifuge 30' 10000rpm

Take the supernatant, check the AR in the pellet at the monitor.

Resuspend in 50 μl of TC by vortexing to recover the DNA stuck to the wall of the tube. Add :

- NH ₄ AC 25 μl

- ETOH 95% 200 μl mix

- 10 'glass

- centrifuge 15 '10000rpm Remove the supernatant, count (normally almost more RA)

- ETOH 70% 800 μl

- centrifuge 5 '

Take the supernatant, check the RA in the pellet and dry it moderately.

At this stage the cDNA can be cloned by adding homopolymeric extensions ("tailing").

REPAIR OF THE END

Resuspend the DNA in 42 μl of water by incubating 5 'at 55 ° C. - Add :

- T4Pol lOx buffer 5 μl

- RNaseH 0.5 μ

- RNaseA (2μg / μl) 1 μl - T4DNApolγmérase 4 μ (Amersham) - 37 ° C 1 'exonuclease 3' -> 5

- dNTPs 2 μl (lOmM AGT, 5mM C)

- 37 ° C 30 '

- Klenow Polymerase 2 μ

- room temperature 10 '- glass 10'

- CDTA 2 μl 0.5M - phenol 25 μl

- 25 μl chloroform Vortex

- centrifuge 5 '10000rpm

Take the supernatant, re-extract the organic phase with 50 μl of TC, combine the two aqueous phases.

- extract twice with 200 μl of ether

- NH.AC 8M 50.μl

- ETOH 95% 400 μl mix

- -80ºC 5 'reheat to temp. ambient - centrifuge 15 '10000rpm

Take the supernatant, check RA in the pellet, rinse with 70% ETOH, dry moderately. The cDNA is ready for blunt-end cloning or the addition of linkers / adapters. BUFFERS

1st STRAND 5 ×: 250mM Tris-HCl pH 8.3 at 43 ° C (8.9 at 22ºC)

750mM KCl 50mM MgCl ₂ 50mM DTT 2nd STRAND 5 ×: 250mM Tris-HCl pH 7.5

500mM KCl 25mM MgCl ₂ 25mM DTT 250μg / μl BSA T4DNAPolymerase 10 × of. Maniatis et al. (1982)

- All the solutions used for the synthesis of the first strand must be free of traces of RNase, that is to say made with water treated with diethylpyrocarbonate (100ml of sterile water + 1ml of 10% DEPC in the ethanol, leave to act for 1 hour, re-sterilize).

- do not over-dry the cDNA pellets because they can become insoluble, dry less of it in a "Speedvac" or rinse with 95% ethanol and allow to evaporate.

- at the end of the synthesis of the 2nd strand, the two successive precipitations eliminate 99% of the non-incorporated radioactivity, check the presence of a cDNA pellet with moni tor at this stage (and at the others).

- to observe the size of the first strand cDNA: add 5 μg of glycogen (or tRNA) to 1 μl of the reaction mixture, precipitate twice in the presence of 2.5M ammonium acetate, resume in an alkaline gel buffer (of. MANIATIS et al. 1982).

- under these conditions, the two strands are marked; we can only mark the second strand by adding 32P-dCTP only at the beginning of its synthesis. - Calculation of the quantities of DNA synthesized:

To 1 μl of reaction mixture, add 4 μl of water, deposit 2 μl on two Whatman GF / C filters, dry, wash one of them three times in 10 ml of 10% TCA, rinse with acetone, dry. Place in two scintillation vials, add 5ml of water and count the radioactivity on the 32P or 3H channel, calculate the percentage of incorporation X. dCTP 0.5mM => 10nmoles / 20μl 10 × X = Ynmoles of dCTP incorporated 4 × Y = total amount of incorporated nmoles (ACGT)

Average molecular weight of a dNTP = 350g therefore: 4 × Y × 350 = weight of synthesized DNA.

- The percentage of conversion of RNA into cDNA can range from 15 to 50% depending on the quality of the RNA, the percentage of synthesis of the second strand is 80 to 100%.

EXAMPLE 3 Cloning of cDNA by adding homopolymeric extensions.

1. Preparation of the vector: Digest 40 μg of vector (pUC, pT2, Bluescript) with Pst1, do two successive digestions, or better, purify the linear plasmid on gel.

- Resuspend at 1μg / μl in water.

- To lengthen 10 μg of vector (approximately lOpmoles of ends for these plasmids): Mix:

- TdT buffer 10 × 5 μl

- Tris-HCl 1M pH 6.8 1.5 μl

- BSA 1mg / ml 5 μl

- dGTP ImM 5 μl

- H ₂ O 20.5 μl

- alpha- ³² PdGTP 800Cie / mmole 1 μl

Pre-incubate 5 'at 37ºC, put in ice. Add :

- DNA 1 μg / μl 10 μl - Terminal transferase 2 μl Pharmacia 27 μ / μl TOTAL 50 μl

Immediately take 2 × 1 μl and place on two GF / C filters to assess the background noise (it is better to make the AR measurements in duplicate). - incubate 5 'at 25 ° C, stop in ice

- take 2 × 1 μl to measure the total AR

2 × 1 μl to measure the incorporated AR (incorporated AR-background noise)

-% incorporation = × 100 total AR

100μmoles dGTP = 100pmoles / μl => 5000pmoles / 50μl

% incorporation × 5000 = pmoles incorporated pmoles incorporated

= number of nucleotides added pmoles of ends

- the optimal size of the extensions is 15 to 25 nucleotides, the reaction being approximately linear, it is therefore possible to reincubate at 25 ° C. for a time defined by the first incubation. - inactivate the enzyme 5 'at 65 ° C, extract with phenol / chloroform, twice with ether, precipitate with ethanol in 2. 5M ammonium acetate, take up to 20ng / μl in TE.

2. Preparation of the cDNA. - the cDNA must be separated from the synthetic primers which, due to their small size, have a very large number of ends. This separation can be done either on a Sephadex G100 column or on a Biogel column

A50 which has the advantage of separating DNA according to size. The columns are poured into a 1 ml pipette, with the smallest possible internal diameter.

- DNA is taken up in column buffer (TC + 0.4M

LiCl), dissolved 5 'at 65ºC, centrifuged 5' to remove any insoluble debris, adjusted to 5% glycerol and loaded on the column. - Elution is monitored on the monitor and the fractions containing DNA are mixed and precipitated with ethanol (in the case of a Biogel A50 column, only the fractions of the ascending part of the RA peak are preserved, this which corresponds to molecules larger than 800 bps). - It is quite difficult to estimate the number of ends represented by the cDNA due to its heterogeneity in size and inaccuracies in the measurement of its weight; it is therefore advantageous to carry out a range of elongation on part of the sample.

- Mix: Buffer Tdt 10 × 4 μl

Tris HCl 1M pH 6.8 1.2 μl

BSA lmg / lml 4 μl dCTP ImM 4 μl

H ₂ O qs 40 μl

- Incubate 5 'at 25 ° C

- Add: cDNA × μl 50-100ng

Terminal transferase 1 1.5 μl

- Take aliquots of 5 μl every 30 secoi stop in the ice and inactivate the enzyme 5 'at 65ºC. - Use 2.5 μl of each aliquot for hybridization with 20 ng of vector in 50 μl of TE + 0.15 M NaCl, incubate 90 'at 58 ° C, 10' at room temperature, keep in ice or freeze. Do not forget the vector control without cDNA. - Transform 200 μl of competent bacteria with 25 μl of each hybridization mixture. - Count the recombinant clones by difference with the blue / white control and / or selection and / or hybridization on colonies with 10-20 ng of labeled cDNA by random priming.

- once the best elongation time has been determined, reprocess the same amount of cDNA under these conditions: it is possible to further optimize the cloning efficiency by hybridizing variable amounts of cDNA with 20 ng of vector.

EXAMPLE 4 Obtaining clones by priming the cDNA on the viral RNA using random hexamers.

The method described below makes it possible to obtain, in a single step, all the clones necessary for obtaining the gene coding for the capsid protein, then to sequence them and to order the data obtained by computer processing.

This type of sequencing technique is commonly used for the analysis of defined fragments of cloned DNA, but had not been used, in a systematic manner, to obtain the nucleotide sequence of large RNAs. An analogous method but comprising the insertion of the cDNA, after digestion with restriction enzymes, has been described by Goelet et al. (1984) to obtain portions of the TMV RNA sequence.

A cDNA library initiated with random primers, treated with S1 nuclease, repaired and ligated in the Smal site of the polyvalent vector Bluescript, was constructed. This plasmid contains the origin of replication of phage M13 and makes it possible to obtain single-stranded DNA after superinfection of the strain with a phage such as M13K07. - About 150 clones from this library were sequenced, some of them were also sequenced directly on the plasmid DNA (Chen and Seeburg, 1985). These data were analyzed using the "shotgun" sequencing program installed on the computer of the Interuniversity Information Processing Center (CITI II). By combining the sequences from these clones and those (partial) from pY139, pY118 and pY117, almost 90% of the total genetic information was obtained. The remaining 10% were more rationally sequenced using synthetic oligonucleotides, by sequencing plasmids on the complementary strand or by reading sequences further from the primer using DNA polymerase from the phage T7 (Sequenase, USB). The sequence of the 5 ′ end of the genome was carried out directly on the viral Arn with a synthetic primer.

One advantage of the method thus tested is that the sequence obtained from several cDNAs cloned independently, makes it possible to analyze the variability of the viral genome. Indeed, because of the infidelity of viral RNA polymerases and the absence of a correction system, the genomes of RNA viruses often exhibit a certain microheterogeneity. This has been proposed as a cause of their rapid evolution (Steinhauer and Holland, 1987). The protocol followed is that described in Example 2.

EXAMPLE 5 Construction of a gene coding for the PVY capsid protein

The method chosen is derived from that described by KALYAN et Al (GENE-1986, 42, 331-337) which makes it possible to add a fragment of synthetic DNA to a chosen point of a sequence, the splice being able to be checked at the base, thanks to the use of a very sensitive screen based on the characteristics of the molecular hybridization of an oligonucleotide probe. We start from a plasmid pY-118 into which we want to insert a cDNA of 1.8kb corresponding to the 3 'end of the PVY genome.

Using the exonuclease Bal31, deletions were created in the plasmid, from a unique HindIII site located approximately 400 base pairs 5 'from the sequence GCAAATGACACA, corresponding to the first acids capsid protein amines. The deleted fragments were then ligated with a synthetic sequence adapter (VA) (VB):

5 'GATCCGAAGGAGAAACCATG 3' 20mere (VA) 3 'GCTTCCTCTTTGGTACp 5' lômere (VB) of which only the 16mere is phosphorylated, then the excess of adapters has been eliminated, the 5 'ends phosphorylated, and the recircularized plasmids and introduced into E .coli. the choice of the sequence of these adapters was made taking into account the consensus sequence defined by Joshi (1987), who compared the 5 'regions of 79 plant genes, consensus: 5' TAAACAAIGGCT 3 '

Alterations have been introduced in relation to this consensus in order to create an Ncol restriction site encompassing the junction with the capsid gene and to place a Shine-Dalgarno sequence to allow possible expression in E. coli.

About 3000 colonies were screened by hybridization with an oligonucleotide labeled with ³² P of sequence (VI) hereinafter 5 ′ TTTGGTAGCGTTTACT 3 ′ (VI) comprising 8 bases homologous to the adapter and 8 bases homologous to the start of the gene for capsid. which made it possible to demonstrate by hybridization the presence of the desired junction. The hybridization conditions were those of Sartoris et coli (1987):

(4x (G + C) + 2x (A + T)) × 20 0.9M Na Hybridization temperature = nb of bases, ie 55ºC for this oligonucleotide probe, the washings being carried out in 0.9M Na at room temperature, then for 5 minutes at hybridization temperature - 3 ° C. Hybridization temperature = 4 (G + C) +2 (A + T) -5 at 10 ° C 0.9M Na but seem to be more discriminating. A first positive clone was obtained, its insertion could not be released by digestion with the enzymes BamHI (the site created by addition of the adapters) and Hpall (sine placed at 16 base pairs downstream of the coder. natural translation of the gene; because the procedure did not create the expected BamHI site, the insertion was therefore isolated thanks to the presence of the Ncol site encompassing the ATG sequence, its ends filled with Klenow polymerase, and transferred into the linear plasmid pUC1318 at the Xbal site at the comtless ends of the same facen. This made it possible to reconstitute the sequence A-- ATGG, which was verified by sequencing. The fragment was then excised from the plasmid using the sites BamHI duplicates of the latter and transferred into the expression vectors pMarcel70 and pMRKE70.

Subsequently, two new positive clones were isolated which have the BamHI site well, which makes it possible to preserve the consensus introduced into the adapter. The coding sequence was isolated by digesting with the enzymes BamHI and Hpall, its ends filled and it was cloned in the same plasmid pUC1318 in order to add BamHI sites at the two ends. The fragment was then excised and inserted into the same expression vectors (of: figures la and lb in the appendix)

Note that these expression vectors have only one restriction site allowing the insertion of the above sequence, which will then be transcribed.

These pMARCEL 70 and pMRKE70 vectors were created from the pMARCEL19 and pMRKE35 vectors respectively, and contain a promoter constructed from that of 35 S RNA by duplicating a transcriptional activation region located from -343 to -90 relative to at the transcription initiation site (KAY et al., 1987), which promoter has the advantage of producing 10 fcis more transcripts than the one from which it originates. EXAMPLE 6 Expression in Plants of the Coding Gene According to the Invention

The sequence inserted into the expression vectors pMARCEL 70 and pMRKE 70, obtained in Example 5, was introduced by electroporation into tobacco and potato protoplasts.

The cell colonies obtained are resistant to kanamycin.

The same gene has also been introduced into lettuce protoplasts, under the same conditions, in order to obtain protection against the lettuce mosaic virus, to test the hypothesis that because of the sequence similarities between the capsid proteins of the potyviruses, the capsid protein of one of them is able to protect plants against another potyvirus.

As is apparent from the above, the invention is in no way limited to those of its modes of implementation, embodiment and application which have just been described more explicitly; on the contrary, it embraces all the variants which may come to the mind of the technician in the matter, without departing from the framework, or the scope, of the present invention.

Claims

CLAIMS 11) Transgenic plants resistant to infection by potyviruses, characterized in that they are obtained from plant cell lines, in particular from plant species liable to be infected by potyviruses, modified by introduction of a gene encoding the potyvirus capsid protein.

2 º) transgenic plants according to claim 1, characterized in that the gene introduced is a gene coding for the capsid protein of potyvirus, resulting from the addition of an ATG sequence to the 5 'end of the sequence CDNA encoding said potyvirus capsid protein.

3 °) Transgenic plants according to any one of Claims 1 or 2, characterized in that the ATG initiation codon of the introduced gene is included in the sequence AX ₁ X ₂ ATGG, in which X ₁ and X ₂ are identical or different and each represents one of the nucleotides A, T, G or C. 4 °) Seeds for the reproduction of transgenic plants, characterized in that they come from transgenic plants according to any one of Claims 1 to 3.

5 °) Gene coding for the potyvirus capsid protein, characterized in that it results from the addition of an ATG sequence to the 5 ′ end of the cDNA sequence coding for said potyvirus capsid protein.

6 °) Gene according to Claim 5, characterized in that its initiation codon ATG is included in a sequence of type AX.LX2ATGG, in which X ₁ and X ₂ are identical or different and each represents one of the nucleotides A , T, G or C.

7 °) Gene according to any one of Claims 5 or 6, characterized in that it comprises the DNA sequence complementary to the following nucleotide sequence (I):

8 °) DNA sequence characterized in that it consists of a gene coding for the capsid protein of potyvirus, according to any one of Claims 4 to 7, provided with signals for regulating gene expression in a plant cell.

9 °) Method for obtaining a gene coding for the potyvirus capsid protein, characterized in that a fragment of a synthetic DNA comprising an ATG codon is inserted at a chosen point of the cDNA sequence coding for the capsid protein, the plasmids containing the desired junction then being isolated by hybridization with a synthetic oligonucleotide covering half the sequence of the synthetic DNA fragment and half the sequence of the 5 ′ end of the sequence of the gene coding for the potyvirus capsid protein.

10 °) Method for obtaining the cDNA of the potyvirus genomic RNA, characterized in that the first strand of cDNA is synthesized by action of reverse transcriptase on the potyvirus genomic RNA using random hexamers as first strand initiators.

11 °) Complete nucleotide sequence of the PVY genomic RNA, characterized in that it comprises 9704 bases followed by a poly-A end, in that a non-coding region at the 5 'end, which comprises 185 bases, precedes the single and long open reading phase, in that said phase codes for a polyprotein of 3063 amino acids and in that it is followed by a non-coding region of 331 bases at the 3 ′ end . 12 °) Sequence according to claim 13, characterized in that it is represented by the following nucleotide and amino acid sequence (II):

13º) Sequence according to any one of Claims 11 and 12, characterized in that the position of the sequence of the capsid protein in the amino acid sequence derived from the above-mentioned RNA sequence is such that its N- terminus terminal is located at position 2796 of the polyprotein.

14 °) RNA fragments, characterized in that they contain a PVY-specific nucleotide sequence, which constitutes a part of the nucleotide sequence according to Claim 12.

15º) DNA fragments, characterized in that they contain all or part of a DNA sequence complementary to an RNA sequence specific for PVY, and derived from the RNA sequence according to Claim 12.