WO1989007614A1 - Facteurs nucleaires associes a la regulation de la transcription - Google Patents

Facteurs nucleaires associes a la regulation de la transcription Download PDF

Info

Publication number
WO1989007614A1
WO1989007614A1 PCT/US1989/000553 US8900553W WO8907614A1 WO 1989007614 A1 WO1989007614 A1 WO 1989007614A1 US 8900553 W US8900553 W US 8900553W WO 8907614 A1 WO8907614 A1 WO 8907614A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
protein
sequence
gene
binding
Prior art date
Application number
PCT/US1989/000553
Other languages
English (en)
Inventor
David Baltimore
Ranjan Sen
Phillip A. Sharp
Harinder Singh
Louis Staudt
Jonathan Lebowitz
Albert S. Baldwin, Jr.
Roger Clerc
Lynn M. Corcoran
Original Assignee
Massachusetts Institute Of Technology
Whitehead Institute For Biomedical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Massachusetts Institute Of Technology, Whitehead Institute For Biomedical Research filed Critical Massachusetts Institute Of Technology
Publication of WO1989007614A1 publication Critical patent/WO1989007614A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)

Definitions

  • This invention is in the field of molecular biology.
  • Trans-acting factors that mediate B cell specific transcription of immunoglobulin (Ig) genes have been postulated based on an analysis of the expression of exogenously introduced Ig gene recombinants in lymphoid and non-lymphoid cells.
  • Ig immunoglobulin
  • Two B cell-specific, cis-acting transcriptional regulatory elements have been identified. One element is located in the intron between the variable and constant regions of both heavy and kappa light chain genes and acts as a 'transcr ip tional enhancer. The second element is found upstream of both heavy chain
  • This element directs lymphoid-specific transcription even in the presence of viral enhancers.
  • Mouse and human light chain promoters contain the octamer sequence ATTTGCAT approximately 70 base pairs upstream from the site of initiation.
  • Heavy chain gene promoters contain the identical sequence in inverted orientation, ATGCAAAT, at the same position. This element appears to be required for the efficient utilization of Ig promoters in B cells. The high degree of sequence and positional conservation of this element as well as its apparent functional requirement suggests its interaction with a sequence-specific transcription factor but no such factor has been identified.
  • This invention pertains to human lymphoid-cell nuclear factors which hind to gene elements associated with regulation of the transcription of Ig gene s and to methods fo r identif icat ion and fo r isolation of such factors.
  • the factors are involved in the regulation of transcription of Ig genes.
  • the invention also pertains to the nucleic acid encoding the regulatory factors, to methods of cloning factor-encoding genes and to methods of altering transcription of Ig genes in lymphoid cells or lymphoid derived cells, such as hybridoma cells, by transfecting or infecting cells with nucleic acid encoding the factors.
  • Four different factors which bind to transciptional regulatory DNA elements of Ig genes were identified and isolated in nuclear extracts of lymphoid cells. Two of the factors, IgNF-A and E, are constitutive; two IgNF-B and ⁇ -3 (hereinafter NF- ⁇ B) are lymphoid cell specific. Each factor is described below.
  • IgNF-A binds to DNA sequences in the upstream regions of both the murine heavy and kappa light chain gene promoters and also to the murine heavy chain gene enhancer. The binding is sequence specific and is probably mediated by a highly conserved sequence motif, ATTTGCAT, present in all three transcrip tional elements. A factor with binding specificity similar to IgNF-A is also present in human HeLa cells indicating that IgNF-A may not be tissue specific.
  • E factors are expressed in all cell types and bind to the light and heavy chain enhancers.
  • IgNF-B exhibits the same sequence-specificity as IgNF-A; it binds to upstream regions of murine heavy and kappa light chain gene promoters and to murine heavy chain gene enhancer. This factor, however, is lymphoid specific; it is restricted to B and T cells. Kappa- 3 (NF - ⁇ B )
  • NF- ⁇ B binds exclusively to the kappa light chain gene enhancer (the sequence TGGGGATTCCCA). It is specific to B -lymphocytes (B-cells) and also appears to be B-cell stage specific.
  • the factors were identified and isolated by means of a modified DNA binding assay.
  • the assay has general applicability for analysis of protein DNA interactions in eukaryotic cells.
  • DNA probes embodying the relevant DNA elements or segments thereof are incubated with cellular nuclear extracts. The incubation is performed under conditions which allows the formation of protein-DNA complexes. Protein-DNA complexes are resolved from uncomplexed DNA by electrophoresis through polyacrylamide gels in low ionic strength buffers. In order to minimize binding of protein in a sequence nonspecific fashion a competitor DNA species can be added to the incubation mixture of the extract and DNA probe.
  • This invention also pertains to the genes encoding the four factors associated with transcriptional regulation.
  • the invention also pertains to a method of cloning DNA encoding the transcriptional regulatory factors. The method involves screening for expression of the part of the binding protein with binding-site, DNA probes. Identifi- cation and cloning of the genes can also be accomplished by conventional techniques. For example, the desired factor can be purified from crude cellular nuclear extracts. A portion of the protein can then be sequenced and with the sequence information, oligonucleotide probes can be constructed and used to identify the gene coding the factor in a cDNA library.
  • Genes encoding the regulatory factors can be used to alter cellular transcription.
  • positive acting lymphoid specific factors involved inIg gene transcription can be inserted into Ig-producing cells in multiple copies to enhance Ig production.
  • Genes encoding tissue specific factors can be used in conjunction with genes encoding constitutive factors, where such combinations are determined necessary or desireable. Modified genes, created by, for example, mutagenesis techniques, may also be used. Further, the sequence-specific DNA binding domain of the factors can be used to direct a hybrid or altered protein to the specific binding site.
  • DNA sequences complimentary to regions of the factor-encoding genes can be used as DNA probes to determine expression of the factors for diagnostic purposes and to help identify other factor-encoding genes.
  • Antibodies can be raised against the factors which can also be used as probes for factor expression.
  • the cloned genes permit development of assays to screen for agonists or antagonists of gene expression and/or of the factors themselves.
  • Figure la is a schematic depiction of the 5' region of the MOPC 41 V ⁇ gene segment
  • Figure 1b is an autoradiograph of gel electrophoresis DNA binding assays with the SfaNI-SfaNI ⁇ promoter fragment of the MOPC 41 V ⁇ gene
  • Figure 1c is an autoradiograph of gel electrophoresis DNA binding assay with overlapping ⁇ promoter fragments.
  • Figure 2 show autoradiographs of binding competition analysis in nuclear extracts of human (a) EW and (b) HeLa nuclear extracts.
  • Figure 3 shows the results of DNase I foot printing analysis of factor-DNA complexes.
  • Figure 4a shows the nucleotide sequences of actual and putative binding sites of IgNF-A
  • Figure 4b is an autoradiograph of binding assays with various DNA probes of three Ig transcriptional control elements.
  • Figure 5a shows the DNA sequence of the promoter region of MODC41;
  • Figure 5b shows an autoradiograph of RNA transcript generalized in whole cell extracts made from human B lymphoma cell lines RAMOS and EW and from HeLa cells from the indicated templates.
  • Figure 6 shows an autoradiogarph of RNA transcripts from templated containing an upstream deletion.
  • Figure 7 is a radioautograph of the binding of B cell nuclear extract to the MOPC-41 ⁇ promoter region showing the IgNF-A and IgNF-B complexes.
  • Figure 8 shows the binding of T cell and non-lymphoid cell nuclear extracts to the MOPC-41 ⁇ promoter region.
  • Figure 9a shows a restriction map of the ⁇ -enhancer;
  • Figure 9b shows an autoradiograph binding assay carried out with ⁇ -enhancer fragments.
  • Figure 10a shows a restriction map of the ⁇ 300 fragment
  • Figure 10b shows complexes formed by various subfragments of ⁇ 300
  • Figure 10c and 10d show competition binding assays with the subfragment ⁇ 70 .
  • Figure 11 and 11b show a location of binding sites in ⁇ 50 and ⁇ 70 by the methylation interference technique; Figure lie provides a summary of these results.
  • Figure 12a and 12b show an autoradiograph of binding complexes formed with ⁇ 50 and ⁇ 70 in B-cell and non B-cell extracts.
  • Figure 13a is a restriction map of ⁇ enhancer
  • Figure 13b shows a autoradiograph of binding assays with ⁇ -enhancer fragments
  • Figure 13c and 13d show an autoradiograph of competition assays with ⁇ -enhancer fragments.
  • Figure 14 shows location of NK- ⁇ B binding by methylation interference experiments.
  • Figure 15a shows binding analysis of NK- ⁇ B in various lymphoid and non-lymphoid cells;
  • Figure 15b shows the binding analysis of NK- ⁇ B in cells at various stages of B-cell differentiation.
  • Figure 16 shows the ⁇ gt11-EBNA-1 ( ⁇ EB) recombinant and the oriP probe.
  • Figure 17 shows the sequence of the DNA probe used to screen for an H2TF1 and NF- ⁇ B expression.
  • Figure 18a shows the nucleotide sequence of the oct-2 gene derived from cDNA and the predicted amino acid sequence of encoded proteins.
  • Figure 18b shows the nucleotide sequence of the 3' terminus and predicted the amino acid sequence of the C-terminus derived from clone pass-3.
  • Figure 18c is a schematic representation of the amino acid sequence deduced from oct-2 gene derived cDNA .
  • Figure 19 is a schemetac representation of expression plasmid pBS -ATG-oct-2.
  • Figure 20 shows amino acid sequence alignment of the DNA binding domain of oct-2 factor with homeoboxes of several other genes.
  • transcrip tional regulatory factors described herein can be broadly classified as constitutive (nonlymphoid) or tissue (lymphoid) specific. All factors are believed to play a role in transcription of Ig genes. Constitutive factors may have a role in regulating transcription of other genes (as might the lymphoid-specific factors) as they are found in non-lymphoid cells.
  • IgNF-A binds to Ig regulatory DNA elements in the region of mouse heavy and kappa light chain gene promoters and also to mouse heavy chain gene enhancer.
  • DNAase I footprint analysis indicates that the binding is mediated by the octamer sequence (ATTTGCAT) which occurs in mouse and human light chain gene promoters approximately 70 base pairs upstream from the site of initation and in heavy chain gene promoters at about the same position (in inverted sequence).
  • ATTTGCAT octamer sequence
  • IgNF-A binding site in Ig promoters significantly reduces the level of accurately initiated transcripts in vivo. See, e.g., Bergman, Y. et a l . , Proc. Natl. Acad. Sci. USA, 81: 7041-7045 (1984); Mason, J.O. et al. Cell 41 479-487 (1985). As demonstrated below (See Exemplification), this also occurs in an i.n vitro transcription system. IgNF-A appears to be a positive transacting factor.
  • IgNF-A binding site appears to be a functional component of the B-cell-specific Ig promoter.
  • sequences from this promoter containing the IgNF-A binding site specify accurate transcription in B-cells but not in Hela cells.
  • IgNF-A may not be restricted to B-cells because a factor was detected in Hela cell extracts which generated complexes with similar mobilities and sequence specificity (as tested by competition analysis).
  • the Ig octamer motif in the IgNF-A binding site has recently been shown to be present in the upstream region (about 225 bp) of vertebrate U1 and U2 snRNA genes.
  • IgNF-A may be a constitutive activator protein that also functions in the high level expression of U1 and U2 snRNA genes in vertebrate cells.
  • the presence of an IgNF-A binding site in the mouse heavy chain enhancer suggests the additional involvement of IgNF-A in enhancer function. It is known that deletion of an 80 bp region of the enhancer containing the putative binding site reduces enhance activity approximately tenfold.
  • IgNF-A also binds in a sequence-specific manner to the SV40 enhancer (J. Weinberger, personal communication), wh ⁇ ch contains the Ig octamer motif, thereby strengthening the notion that the factor participates in enhancer function.
  • the E factors are constitutive factors which binds to the Ig light and heavy chain enhancer.
  • Factor IgNF-B binds to the same regulatory elements as IgNF-A.
  • the binding site for IgNF-B is the octamer motif.
  • IgNF-B is lymphoid cell specific. It was found in nuclear extracts from pre-B, mature B and myeloma cell lines and in nuclear extracts from some T cell lymphomas. IgNF-B was undetectable in nuclear extracts of several non-lymphoid cells.
  • the gene encoding IgNF-B has been cloned (oct-2 clone below) and the its nucleotide sequence has been determined. See Figure 18A.
  • NF- ⁇ B binds only to the Ig light chain enhancer.
  • the binding is mediated by the sequence TGGGATTCCCA.
  • the factor is lymphoid cell specific and also lymphoid stage specific; it is expressed only by mature B-cells. In this case, it is a marker of B cell maturation (the factor can be used to type B cell lymphomas).
  • the transcriptional regulatory factors described above were identified in extracts of cellular nuclear protein by means of an improved gel electrophoresis DNA binding assay with enhanced sensitivity.
  • This improved assay is a modification of an original assay based on the altered mobility of protein-DNA complexes during gel electrophoresis.
  • the original assay has been extensively employed in equilibrium and kinetic analyses of purified prokaryotic gene regulatory proteins. See, e.g., Fried, M. and
  • the simple alternating copolymer, duplex poly(dl-dC)- poly(dl-dC) was used as the competitor DNA species.
  • the use of this copolymer as competitor resulted in an enhancement of sensitivity for detection of specific protein-DNA complexes.
  • the assay is performed essentially as described by Strauss and Varshavky, supra, except for the addition of the poly(di-dC)-poly(di-dC).
  • An extract of nuclear protein is prepared, for example, by the method of Dingnam, J.D. et al., Nucl. Acids Res.
  • the extract is incubated with a radiolabled DNA probe that is to be tested for binding to nuclear protein.
  • the incubation is carried out in the presence of the poly(di-dC)-poly-(dl-dC) competitor in a physiological buffer.
  • DNA protein complexes are resolved from free DNA probes by electrophoresis through a polyacrylamide gel in a low ionic strength buffer and visualized by autoradiography.
  • protein samples (about 10 ⁇ g protein) are incubated with approximately 10,000 cpm (about 0.5 ng) of an end-labeled 32 P double-stranded DNA probe fragment in the presence of about 0.8 - 4 ng poly(di-dC)-poly(di-dC) (Pharmacia) in a final volume of about 25 ⁇ l. Incubations are carried out at 30° for 30-60 minutes in 10 mM Tris HCl (pH 7.5), 50 mM NaCl, 1 mM DTT , 1 mM EDTA. Protein-DNA complexes are resolved on low-ionic strength polyacrylamide gels.
  • Samples are layered onto low ionic-strength 4% polyacrylamide gels (0.15x16 cm; acrylamide:bisacrylamide weight ratio of 30:1). Gels are pre-electrophoresed for about 30 min at 11 V/cm in buffer consisting of 6.7 mM TrisHCl, (pH 7.5), 3.3 mM NaOAc, and 1 mM EDTA. Buffer is recirculated between compartments. Gels are electrophoresed at the same voltage at room temperature, transferred to Whatman 3MM, dried and autoradiographed. The enhanced sensitivity of the assay is illustrated by initial experiments leading to identification of the factor IgNF-A.
  • the simple alternating copolymer probably competes less effectively than heterologous DNA sequences for binding of a sequence-specific factor, thereby significantly increasing the sensitivity of the assay.
  • the assay has general applicability for elucidation of mammalian gene regulatory proteins.
  • a further increase in sensitivity in this assay is obtained by the use of small DNA probes (about 100 bp or less) which minimize non-specific binding interactions in a crude extract.
  • binding competition tests can be perfomed to analyze the sequence specificity of protein-DNA interactions.
  • an unlabeled DNA fragment to be examined for competitive binding to the protein factor can be added to the incubation mixture of protein extract and labeled DNA probe (along with the poly(dl-dC)-poly(dl-dC)).
  • the disappearance of protein-DNA probe complex, or its diminishment indicates that the unlabeled fragments compete for binding of the protein factor.
  • relative binding affinity of the protein to a probe sequence can be assessed by examining the ability of a competitor to displace the protein at varying concentrations.
  • lymphoid cell factors entails the use of the in vitro transcription system developed from cells of lymphoid cell lineage. This system is described in detail in the Exemplification section below.
  • the function of a factor can be indirectly assessed in this system by employing templates for transcription which carry deletions of the binding domain of the factor. As has been noted above, deletion of the upstream sequence located between -44 and -79 bp from the cap site of the MOPC41 ⁇ gene disrupts transcription in this system (This has also been noted in in vivo systems).
  • the deleted region includes the IgNF-A binding site.
  • a direct way to assess the function of the factors is to show that transcription can be modulated by removal and replacement of the factor in the in vitro transcription system with an appropriate template.
  • the intact M0PC41 ⁇ promoter gene can be used as a template in the in vitro system described and transcription of this template can be assessed in the presence and absence of a factor (for instance, NF- ⁇ B, a lymphoid specific factor).
  • the factor can be removed from the lymphoid cell extract by chromatographic fractionation and then replaced. If the level of transcription is diminished in the absence and restored by replacement of the factor, a direct indication of the factors involvement in transcription is provided.
  • antisera or monoclonal antibody can be raised against a purified or enriched preparation of the factor.
  • the antibody can be used to probe for expression of the factor in a library of cDNA of cells known to express the factor.
  • the genes encoding transcrip tional regulatory factors can be isolated by a novel method for cloning genes that encode sequence-specific DNA binding proteins. The method involves screening a library of recombinant expression vectors for expression of the factor with a DNA probe comprising the recognition (binding) site for the factor. Expression of the factor is identified by the presence of complex between the DNA probe and the expressed binding protein. The approach has general applicability to the cloning of sequence-specific DNA binding proteins.
  • an expression library is created by inserting DNA (e.g., cDNA from a cell which expresses the sequence specific binding protein) into an appropriate expression vector to establish an expression library.
  • DNA e.g., cDNA from a cell which expresses the sequence specific binding protein
  • a preferred expression vector Is the bacteriophage ⁇ gt11 which is capable of expressing foreign DNA inserts within E. coli. See e.g., Young, R.A. and Davis, R.W. in Genetic Engineering: Principles and Techniques, vol 7 (eds Setlow, J. & Hollaender, A.) 29-41 (Plenum, New York 1985).
  • plasmid vectors may be used.
  • the expression library is screened with a binding-site, DNA probe.
  • the probe comprises the DNA sequence recognized by the binding protein, for example, an appropriate transcrlptional regulatory element such as the octamer or ⁇ -element. In preferred embodiments the probe is less than 150bp in length to reduce nonspecific binding.
  • the probe can be an oligomer of the binding site. Multiple copies of the site provide for multiple protein binding to the probe.
  • the DNA probe is a labeled DNA. The preferred label is 32 P.
  • the binding site probe is incubated with host cell protein under conditions which allow the probe to complex with the any cognate binding protein expressed in the cell.
  • the formation of such complexes are determined by detecting label associated with the protein.
  • the screening is performed by generating a replica of host cell lysates and by screening the replicated protein with the probe.
  • a replica of host cell lysates For example, when the bacteriophage ⁇ gt11 is used, recombinant viruses are plated In arrays onto a lawn of E. coli and replica of the resulting viral plaques is made by transferring plaque protein onto an appropriate adsorbtive surface (e.g. protein replica filters).
  • the adsorbed plaque protein is contacted with the probe under conditions which permit the formation of complexes between adsorbed protein and the probe.
  • the replica is then washed to remove unbound probe and then examined for associated label.
  • the protein can be examined autoradiograghically for the presence of label.
  • a nonspecific competitor e.g. protein
  • DNA can be used along with the recognition site probe to reduce nonspecific binding to the probe.
  • DNA examples include poly (dl-dC)-poly(dl-dC) and denatured calf thymus DNA.
  • the protein-probe complexes can be stabilized covalently for detection by, for example, uv irradiation.
  • This method of screening for sequence specific binding proteins is dependent, inter alia, upon: i) the functional expression of the binding domain of the desired binding protein in the host cell; ii) a strong and selective interaction between the binding domain and the DNA probe; and iii) a sufficiently high level of expression of the binding protein.
  • the factor can be purified chromatographically by, for example, ion exchange, gel filtration and affinity chromatography or combinations thereof. Once the factor is sufficiently purified, it can be partially sequenced from the sequence Information, oligodeoxynucleotide probes can be made and used to identify the gene encoding the factor in a cDNA library.
  • the genes encoding positive transcrip tional regulatory factors can provide a means for enhancing gene expression.
  • Lymphoid-specific factors involved in positive regulation of Ig gene transcription can provide a method for enhancement of immunoglobulin production in lymphoid cells.
  • Lymphoid cells such as monoclonal antibody producing hybridomas or myelomas, can be transfected with multiple copies of a gene encoding a regulatory factor to induce greater production of Ig.
  • the gene encoding a regulatory factor can be linked to a strong promoter.
  • the construct can be designed to incorporate a selectable marker as well). Multiple copies of the construct can be inserted into the cell by transfection procedures such as elec troporation.
  • the cell can be transfected with multiple factors, including constitutive factors, where factors are determined to act in conjunction, possibly synergistically.
  • factor genes By amplifying factor genes In this manner, overexpression of the regulatory factors can be induced in the transfected cell and consequently production of immunoglobulin enhanced in these cells.
  • the factor-encoding genes can be modified by, for example, techniques of mutagenesis.
  • the genes can be synthesized by methods of nucleic acid synthesis in modified forms. These genes could provide modified regulatory factors which have equivalent or improved properties over the natural factors.
  • the modified factors could have an improved capability to enhance transcription.
  • These modified factors are intended to be encompassed by the present invention.
  • the gene encoding IgNF-B has been cloned and sequenced and the nucleotide sequence is shown in Figure 18A.
  • the modified nucleotide sequence can be obtained either naturally (e.g. polymorphic variants) or by mutagenesis to yield substantially complementary sequences having comparable or improved biological activity. Fragments of the sequence may also be used.
  • This invention encompasses sequences to which the sequence of Figure 18A hybridizes in a specific fashion.
  • the DNA binding domain of the factors which is responsible for the binding sequence-specificity, can be combined with different "activators" (responsible for the effect on transcription) to provide modified or hybrid proteins for transcrip tional regulation.
  • DNA sequences encoding the binding domain can be linked to DNA sequences encoding the activator to form a gene encoding a hybrid protein.
  • the activator portion can be derived from one of the factors or from other molecules.
  • the DNA binding region of the hybrid protein serves to direct the protein to the cognate DNA sequence. For example, in this way, stronger RNA polymerase activators can be designed and linked to the appropriate DNA binding domain to provide for stronger enhancement of transcription.
  • DNA probes for the genes encoding the regulatory factors can be used to determine expression of the genes or to identify related genes by hybridization techniques. This can have diagnostic value for conditions relating to aberrant expression of the factor.
  • Cells can be typed as positive or negative for expression of a particular factor.
  • the DNA probes are labeled DNA sequences complementary to at least a portion of nucleic acid encoding a transcriptional regulatory factor.
  • the labeled probe is contacted with a sample to be tested (e.g., a cell lysate) and Incubated under stringent hybridization conditions which permit the labeled probe to hybridize with only DNA or RNA containing the sequence to which the probe is substantially complementary.
  • the unhybridized probe is then removed and the sample is analyzed for hybridized probe.
  • the DNA probes can also be used to identify genes encoding related transcrip tional regulatory factors.
  • the stringent conditions of hybridization are sufficiently relaxed so that related DNA sequences which are not completely homologous to the probe can be detected.
  • Antibodies can be raised against the transcriptional regulatory factors of this invention.
  • the antibodies can be polyclonal or monoclonal and they can be used as diagnostic reagents in assays to determine expression of a factor by particular cells or to quantitate levels of a factor.
  • a gene encoding a transcriptional regulatory factor can also be used to develop in vivo or in vitro assays to screen for agonists or antagonists of a factor-encoding gene or of the factor encoded by the gene.
  • genetic constructs can be created in which a reporter gene (e.g., the CAT gene) is made dependent upon the activity of a factor-encoding gene. These constructs introduced into host cells provide a means to screen for agonists or antagonists of the factor- encoding gene.
  • the antagonists may be used to decrease the activity of the factors and thus may be useful in the therapy of diseases associated with the overactivity of a transcriptional regulatory factor.
  • Such agonists or antagonists identified by assays employing the factor-encoding genes of this invention are within the scope of this invention.
  • the SfaNI fragment was subcloned into the Smal site of pS64 (pSPIgV ⁇ , provided by N. Speck). For binding analysis this fragment was excised from pSPIgV by digesting with Hind III and Eco RI . These latter sites flank the Sma I site in the polylinker of pSP64. After end-labeling with [ ⁇ - 32 P]dATP and the large fragment of E. coli DNA polymerase I, the radiolabeled fragment was isolated by polyacrylamide gel electrophoresis. Binding reactions were performed and the reaction mixtures resolved by electrophoresis ( Figure lb). The 32Plabeled fragment
  • Binding reactions (25 ⁇ l) contained 10 mM Tris. HCl (pH 7.5), 50 mM NaCl, 1 mM DTT, 1 mM EDTA, 5% glycerol and 8 ⁇ g EW nuclear extract protein. Reactions 2-6 additionally contained 800, 1600, 2400, 3200 and 4000 ⁇ g , respectively, of poly(dl-dC)-poly(dl-dC).
  • Reactions 7-11 contained 300, 600, 900, 1200 and 1500 ng, respectively, of Hinf I digested E. coli chromosomal DNA. After a 30 min incubation at room temperature, the resulting complexes were resolved in a low ionic strength 4% polyacrylamide gel ( acrylamide:bisacrylamide weight ratio of 30:1) containing 6.7 mM Tris. HCl (pH 7.5), 3.3 mM Na-acetate and 1 mM Na-EDTA. See Strauss, F. and Varshavsky, A. Cell 37 889-901 (1984). The gel was preelectrophoresed for 30 min at llV/cm.
  • Electrophoresis was carried out at the same voltage gradient for 90 min at room temperature with buffer recirculation. The gel was then dried and auto- radiographed at -70°C with a screen.
  • F and B indicate positions of free and bound fragments respectively.
  • Binding assays were performed as detailed above using 2400 ng poly(dl-dC)-poly(dl-dC)) and the following DNA fragments: ⁇ SfaNI-SfaNI ( ⁇ 0.5 ⁇ g , 10,000 cpm, lane 1), ⁇ PvuII-Kpnl (-0.5 ⁇ g , 10,000 cpm, lane 2), ⁇ PvuII-SfaNI ( ⁇ 0.1 ⁇ g , 5000 cpm, lane 3) and pSP64 PvuII-EcoRI ( ⁇ 0.2 ng, 5000 cpm, lane 4).
  • the ⁇ PvuII-SfaNI fragment was derived from the plasmid pSPIgV by digesting with PvuII and EcoRI.
  • the EcoRI site is in the polylinker and therefore this fragment contains 16 bp of polylinker sequence.
  • Binding assays were performed as detailed above using radio- labeled ⁇ PvuII-SfaNI fragment (about 0.1 ng, 5000 cpm), 2400 ng poly(dI-dC)-poly(dl-dC) and 6 ⁇ g Hela nuclear extract protein (provided by P. Grabowski). Reactions 1 and 2 additionally contained 100 ⁇ g of pSP64 and pSPIgV ⁇ , respectively.
  • the B cell nuclear extract was applied to a heparin- sepharose column equilibrated with 10 mM
  • the coding strand of the ⁇ promoter probe was 3' end-labeled (Eco RI site) with [ ⁇ - 32 P] dATP using the large fragment of E. coli DNA polymerase.
  • Reaction 1 was digested with DNase I (5 ⁇ g/ml) for 2.5 min at room temperature in the absence of B cell nuclear protein.
  • Reaction 2 was initially incubated with the heparin Sepharose fraction of the EW nuclear factor (14 ⁇ g protein) for 15 min at room temperature and then digested with DNase I as above. Each reaction was stopped with EDTA (5 mM) and the products separated by native polyacrylamide gel electrophoresis as detailed above.
  • Lane 1 contains products of free fragment digestion from reaction 1.
  • Lanes 2 and 3 contain digestion products eluted from bound bands B1 and B2 , respectively, from reaction 1.
  • Lanes 1', 2' and 3' corresponds to 1, 2 and 3, respectively, with the exception that the former set was digested with DNase 1 for 5 min.
  • A-G chemical cleavage ladders of the K promoter probe were co- electrophoresed to map the binding domain. See Maxam, A. and Gilbert, W. Meth. Enzymol. 65 , 499-525 (1980).
  • V binding site is defined by the DNase I protection assay (* Indicates boundaries of the protected region).
  • the V H and J H -C U sequences are putative binding sites in the
  • Binding competitions Binding assays (10 ⁇ l) were performed as detailed above using 1600 ng poly(dl-dC)-poly(dl-dC) and the heparin Sepharose fraction of the EW nuclear factor
  • V L probe (about 0.1 ⁇ g , 5000 cpm) lanes 1-3, 10, 11.
  • J H -C ⁇ probe (-0.2 ⁇ g , 5000 cpm), lanes 7-9, 14, 15.
  • Lanes 2, 5, 8 additionally contained 5 ng of a V promoter oligomer (36 bp, spanning positions -81 to -44 of the MOPC-41 V ⁇ gene segment) whereas lanes 3, 6, 9 contained 50 ng of the same oligomer.
  • Lanes 11, 13, 15 additionally contained 50 ⁇ g of a J H -C H oligomer (41 bp, spanning positions -1 to 40 of the heavy chain enhancer).
  • a J H -C H oligomer 41 bp, spanning positions -1 to 40 of the heavy chain enhancer.
  • Complementary single-stranded synthetic oligonucleotides were kindly made by Dr. Ronald Mertz, Gentechnik der Universitat Munchen and Dr. E. L. Winnacker, Institut fur Biochemie der Universitat Munchen. They were annealed prior to use as competition substrates in the binding assay.
  • DNase I footprint analysis was used to delineate at a higher resolution the binding domain(s) of factor(s) present in complexes B1 and B2.
  • the binding factor(s) from B cells was partially purified by chromatography of nuclear extract protein on a heparin sepharose column. Most of the binding activity eluted in a 0.25 M KCl step fraction, giving a purification of approximately 5-fold (data not shown; see legend to Fig. 3).
  • DNase I was added for a partial digestion after incubation of the partially purified factor(s) with the ⁇ promoter probe B1 and B2 species were then resolved from free fragment by polyacrylamide gel electrophoresis.
  • Bound DNA was eluted from both B1 and B2 bands and examined by denaturing polyacrylamide gel electrophoresis (Fig. 3, lanes 2, 3 and 2', 3').
  • DNase I digests of the ⁇ promoter probe in the absence of B cell protein (lanes 1 and 1') and A+C chemical cleavage ladders were coelectrophoresed to map the binding domain.
  • Factor(s) in the B1 complexes (lanes 2 and 2') appeared to protect a 19 nucleotide region on the coding strand.
  • the 5' and 3' boundaries of the protected region map to positions -72 and -52, respectively, from the site of transcriptional initiation.
  • the region of DNase I protection was centered about the conserved octanucleo tide sequence ATTTGCAT suggesting Its importance in the recognition of the Ig promoter by the nuclear factor.
  • B2 complexes showed a virtually identical DNase I protection pattern as B1 complexes and therefore do not appear to involve additional DNA contacts (lanes 3 and 3').
  • the simplest interpretation of this observation is that the B2 complex is generated by dimerization through protein-protein interactions of the factor responsible for the B1 complex.
  • the B2 complex could be formed either by the binding of another protein to the factor responsible for the B1 complex or by recognition of the same set of sequences by a distinct DNA binding protein.
  • V H mouse heavy chain promoter
  • the V H promoter fragment was derived from the 5' region of the V 17.2.25 gene and included nucleotides between positions -154 and +57 relative to the transcriptional start site.
  • the heavy chain enhancer fragment was derived from the germline J H C ⁇ region and spanned positions 81 to 251 within a 313 bp region implicated in enhancer function. Banerji, T. et al. Cell 33 729-740 (1983). The conserved octanucleotide is positioned between coordinates 166 to 173 in the above fragment (Fig. 4a).
  • the B-cell heparin sepharose fraction (purified on the basis of binding to the Kappa promoter sequence, Fig. 4b, lane 1) evidenced binding to both the V H promoter fragment (lane 4) and to the enhancer fragment (lane 7).
  • Figure 5a Templates. The deletions 5' ⁇ 5 and 5' ⁇ 7 have been described before. See Bergman Y. et al PNAS USA 81:7041 (1981). The highly conserved octanucleotide sequence which is found upstream of all sequenced heavy and light chain variable region genes Is boxed (labelled "OCTA"). It is located approximately 30 base pairs upstream from the "TATA" box.
  • the plasmids p ⁇ and p ⁇ were constructed by converting the 5'-ends of 5' ⁇ 5 and 5' ⁇ 7 into a Hind III site by means of synthetic linkers followed by cloning the fragment up to the Bgl II site in the J k -C k major intron into Hind III, Bam HI digested pUC-13.
  • p ⁇ E k and p/cE k represent plasmids containing either the kappa enhancer of the heavy chain enhaner cloned into the unique Hind III site of pK.
  • the segments used as the enhancers are an 800 bp Hind
  • the cell lines RAMOS and EW were grown in RPMI medium containing 10% inactivated fetal calf serum to a density of 5-8 ⁇ 10 cells per ml.
  • Whole cell extracts were generated according to the procedure of Manley et al., Proc. Natl. Acad. Sci. USA 77: 3855 (1980), and had a final protein concentration of approximately 18 mg/ml. Run off transcription reactions were carried out at 30° for 60' in a reaction volume of 20 ⁇ l.
  • a typical reaction mix contained 9 ul (160 ⁇ g) of whole cell extract, 50 uM each of ATP, CTP and GTP, .5 uM UTP, 10 ⁇ Ci of ⁇ - 32 P UTP (NEG 007X, 7600 Ci/mM) 5 mM creatine phosphate, 0.3 mg/ml creatine phosphokinase (Sigma), 12 mM Hepes 7.9, 12% glycerol, 60 mM KCl, 5 mM MG ++ , 1 mM EDTA, 0.6 mM DTT, linearized template (about 50 ⁇ g) and poly (dl-dC)-poly(dl-dc) as a non-specific carrier (about 400 ⁇ g).
  • the reactions were terminated by adding 200 ⁇ l of stop buffer (7M urea, 100 mM LiCl, 0.5% SDS, 10 mM EDTA, 250 ⁇ g/ml tRNA, 10 mM Tris (pH 7.9), followed by two extractions with phenol: chloroform: isoamyl alcohol (1:1:0.05), one with chloroform and precipitation with ethanol.
  • stop buffer 7M urea, 100 mM LiCl, 0.5% SDS, 10 mM EDTA, 250 ⁇ g/ml tRNA, 10 mM Tris (pH 7.9)
  • the RNA's were treated with glyoxal and analyzed by electro- phoresls through a 1.4% agarose gel In 10 mM sodium phosphate (pH 6.8), 1 mM EDTA. See Manley et al. supra.
  • the gel was then dried for autoradiography with an intensifying screen at -70°C.
  • Figure 6 Effect of the upstream deletion 5' ⁇ 7 on in vitro transcription in B cell extracts utilizing a pre-incubation pulse chase protocol. Run off transcripts obtained utilizing templates containing either the wild type promoter (lane 1) or the truncated Kappa promoter (lanes 2,3). Lanes 4-6: In vitro transcription using closed circular templates containing the wild type promoter (lane 4) or the truncated ⁇ promoter (lanes 5-6). In these reactions 50 ng of a closed circular template containing the adenov'irus major late promoter (MLP) was included as an Internal control. The transcripts specific to the ⁇ template or the adenovirus template are Indicated as ⁇ and MLP, respectively.
  • MLP major late promoter
  • the plasmid pFLBH contains sequences from 14.7 to 17.0 map units of adenovirus inserted between the Bam HI and Hind III sites of pBR322 and was the kind gift of A. Fire and M. Samuels.
  • Either the linearized or the supercoiled template (50 ⁇ g ) was incubated in a volume of 20 ⁇ l with 9 ⁇ l (about 150 ⁇ g) of EW extract, 6% (wt/vol) polyethylene glycerol 20,000 and all other components described for Fig. 5b except the nucleotides for a period of 60 minutes at 30°C. Transcription was initiated by the addition of nucleotides and radioactive UTP to the following final concentrations: 60 uM each of ATP, CTP and GTP and 1 ⁇ M UTP and 10 ⁇ Ci ⁇ - 32 P UTP (NEG 007X, 600 Ci/mM).
  • the initiating pulse was maintained for 10' at 30° followed by a 10' chase with a vast excess of non- radioactive nucleotides. Final concentrations during the chase were as follows: 330 ⁇ M ATP, CTP, GTP and 1 mM UTP. The reactions were quenched, worked up and the run off transcripts analyzed as described above. Mapping of the initiation site of the transcript was conducted as follows: Transcripts generated from closed circular templates were taken up in 20 ⁇ l of HE (50 mM Hepes, pH 0.7, 1 mM EDTA) and 10 ⁇ l was used for hybridization selection.
  • a hybridization template complementary to the ⁇ RNA was constructed by cloning the Pva II-Sau 3A fragment which contains the cap site of the M0PC41 gene (Queen and Baltimore, Cell 33: 741 (1983)) into the M13 phage MP9. Single stranded phage DNA was prepared and purified by density gradient centrifugation through cesium chloride. MLP specific transcripts were detected using the M13 clone XH11 provided by A. Fire and M. Samuels. Hybridizations were done in a final volume of 15 ⁇ l in the presence of 750 mM NaCl and 100-200 ug of single stranded complementary DNA at 50°C for 2 hrs.
  • the reactions were then diluted with 200 ⁇ l of cold quench solution (0.2 M NaCl, 10 mM Hepes pH 7.5, 1 mM EDTA) and 2 U of ribonuclease T1 added. Digestion of single stranded RNA was allowed to proceed for 30' at 30° C after which the reactions were extracted once with phenol chloroform isoamyl alcohol (1:1:.05) and precipitated with carrier tRNA. The pellet was washed once with cold 70% ETOH, dried and resuspended in 80% v/v formamide, 50 mM Tris borate, pH 8.3 and 1 mM EDTA.
  • cold quench solution 0.2 M NaCl, 10 mM Hepes pH 7.5, 1 mM EDTA
  • RNA was denatured at 95°C for 3 min and then electrophoresed through a 6% polyacrylamide 8.3 M urea sequencing gel.
  • the upper of 2 bands ( ⁇ ) derived form the immunoglobulin promoter represent the correct start for ⁇ transcription.
  • the lower band is seen at variable intensities and probably does not represent a different cap site, as explained below.
  • Fig. 5a The template representing the wild type gene (pK) was derived from the M0PC41 ⁇ gene and contained sequences from approximately 100 bp upstream from the transcription initiation site (end point 5' ⁇ 5, Fig. 5a) to the Bgl II site in the majorJ ⁇ -C ⁇ intron Max, E.E. , J. Biol. Chem. 256: 5116.
  • the template representing an inactive promoter mutant was constructed by engineering a Hind III site into the 5' -end of 5' ⁇ 7 and cloning the segment of the gene up to the Bgl II site into pUC13 cut with Hind III and Bam HI.
  • transcripts ending at this site were examined by electrophoretic separation.
  • a run off transcript of 2.3 kb was evident when RAMOS, EW or HeLa cell extracts were used (Fig. 5b, lanes 2, 4 and 6).
  • a ⁇ chain enhancer sequence was added to the construct, no effect was evident implying that transcription in these extracts is enhancer independent (Fig. 5b, lanes 1, 3 and 5).
  • the resulting complex was digested with ribonuclease T1 and the ribonuclease-resistant RNA fragments were analyzed by electrophoresis through a 6% polyacrylamide gel with 8.3 M urea. Analysis of in vitro synthesized RNA by this method is shown in Fig.
  • Radioactivity in this assay is proportional to the number of correct initiations occurring during the pulse.
  • the mobility shift gel electrophoresis assay was used to screen nuclear extracts from a variety of cell lines for octamer binding proteins.
  • the band corresponding to IgNF-A was found in all extracts but a second band with distinct mobility from IgNF-A was found only in nuclear extracts from lymphoid cells.
  • This lymphoid-specific octamer binding protein, termed IgNF-B was found in nuclear extracts from all pre-B, mature B and myeloma cell lines tested and in nuclear extracts from some T cell lymphomas (see Figure 7 and 8). IgNFB was not detected in nuclear extracts from the non-lymphoid cell lines, Hela, ⁇ 2, Cos and Mel (see Figure 8).
  • IgNF-B was shown to be specific for the same octamer sequence as IgNF-A by competition experiments in which the IgNFB band was selectively competed by unlabelled DNA fragments sharing only the octamer sequence and not by DNA fragments lacking the octamer sequence.
  • IgNF-B binds to the upstream octamer sequence in lymphoid cells and activate transcription.
  • the fully functional ⁇ enhancer has been localized to a 700 bp Xbal EcoRI fragment from the maior intron between J H and C ⁇ .
  • This fragment can be further subdivided by cleaving at the Pstl site to generate a 400 bp Xbal-Pstl fragment ( ⁇ 400) and a 300 bp Pstl-EcoRI fragment ( ⁇ 300). It has been shown by transient transfections that 30-50% of the tissue specific enhancer activity is retained in ⁇ 300, whereas there is no detectable activity of ⁇ 400.
  • the gel binding assay was employed to investigate what protein factors may interact with the u-enhancer. Briefly, end-labelled DNA fragments were incubated with nuclear extracts made from tissue culture cells.
  • the adjacent u400 fragment (lanes 6,7,8) or a 450 bp fragment containing the ⁇ light chain enhancer (lanes 9,10,11), cause only a minor effect even at the highest concentrations used.
  • the ⁇ enhancer fragment (compare lanes 9 and 2).
  • both the ⁇ and the ⁇ enhancers interact with at least one common protein and this is not the factor being detected by binding the u300 fragment.
  • the increase in the specific complex in the presence of the ⁇ enhancer is probably due to the removal of factors common to both the enhancers from the reaction mix, thus leaving more of the labelled fragment available to bind to the ⁇ specific factor being detected by it.
  • FIG. 10a shows a partial restriction map of the relevant region of the ⁇ enhancer.
  • ⁇ 300 was digested with Alul, Hinfl and Ddel to generate a number of 50-70 bp fragments labelled ⁇ 50, ⁇ (60) 2 (a mixture of Alul-Ddel and
  • Fragment ⁇ 50 forms a major complex band (lanes 2,3,4) that Is barely decreased even In the presence of 4 ug of poly (dl-dC) -poly(dl-dC) (lane 4). The mixture of the two 60 bp fragments does not give rise to a discrete complex band (lanes 6,7,8). Finally the ⁇ 70 fragment gave 2 faint, but discrete, nucleoproteln complex bands (lanes 10,11,12) of which the lower one is again barely affected by 3 ugm of non-specific carrier poly (dl - C) - (dl - C) (lane 12).
  • the complex generated with ⁇ 50 is specifically competed away in the presence of ⁇ 300 (of which u50 is a part), or a ⁇ promoter fragment, but not by corresponding amounts of ⁇ 400 or a ⁇ enhancer fragment, consistent with the complex being generated by the interaction of the previously described factor IgNF-A with its cognate sequence.
  • This factor recognizes a conserved octanucleotide, ATTTGCAT, found in the promoters of all sequenced immunoglobulin genes and within this subfragment of the heavy chain enhancer.
  • Ephrussi et al. and Church et al. have used methylation protection experiments to define a set of G residues within the heavy chain enhancer that ar e sp ec i f ical ly re s is tant to me thyl at i on by DMS in B cells.
  • This result lead to the proposal that tissue- specific DNA binding proteins were respon- sible for this decreased accessibility of the reagent to DNA.
  • the protection was observed in 4 clusters, the DNA sequences of which were sufficiently homologous to derive a consensus sequence for the binding site of a putative factor.
  • binding reactions and competition assay were done for a fraction generated by chromatography of the crude extract over a heparin- sepharose column, that contained ⁇ 70 binding activity and was significantly depleted of IgNF-A.
  • ⁇ 50 or ⁇ 170 was endlabeled and incubated with the column fraction, no specific nucleoprotein complexes were seen upon electro- phoretic analysis.
  • Tissue specificity of the factors detected In order to determined whether the proteins identified are limited to expression only in B cells, a large number of extracts made from B cells and non-B cells were screened (Figure 12). Complexes that co-migrate with the ones generated and characterized (by competition and methylation interference experiments) in the B cell line EW, were observed on both the fragments ⁇ 50 and ⁇ 70 ( Figure 12; ⁇ 70) in all the cell lines examined. Although the complex generated in each extract has not been further characterized, we interpret this data as indicating that both these factors are non-tissue specific. A second complex (NF- ⁇ B) was observed with the ⁇ 50 fragment that was restricted to B and T cells only.
  • An enhancer element has also bee.n identified in the major intron of the ⁇ light chain gene. Picard and Schaffner showed that the enhancement activity can be localized to a -500 bp Alul-Alul fragment and Queen and Stafford have further refined the 5' and 3' boundaries so that the enhancer may be considered restricted to 275 base pairs within the larger fragment. We have dissected this region into a number of smaller fragments and assayed each of these by means of the gel binding assay for the location of protein binding sites.
  • FIG. 13a A restriction map of the relevant region of the ⁇ enhancer is shown in Figure 13a.
  • the black boxes represent sequences identified by Church et al. to be homologous to the putative protein binding domains detected in the ⁇ enhancer in vivo.
  • the complex is specifically competed away by the addition of unlabelled ⁇ 70 during the incubation (compare lanes 3 and 4 with lane 2), but not by ⁇ 60 (lanes 5,6), ⁇ 170 (lanes 7,8) or the SV40 enhancer (lanes 9,10). Further, the protein that binds to this sequence co - fractionates with the ⁇ 70 binding activity through two sequential chromatographic steps (Heparin agarose and DEAE Sepharose). Thus we conclude that the same sequence specific protein binds to both the fragments ⁇ 70 and ⁇ 2 and therefore there is at least one common protein interacting with both the ⁇ and the ⁇ enhancers.
  • the ⁇ 3 complex failed to be competed away by ⁇ 300 (compare lanes 3 and 4 with lane 2), ⁇ 400 (compare lanes 5 and 6 with lane 2) as a ⁇ promoter containing fragment (compare lanes 1 and 8 with lane 2).
  • the complex was specifically competed away with both the complete ⁇ enhancer (lanes 9,10) and the SV40 enhancer (lanes 11,12).
  • the band below the major ⁇ 3 complex was seen at variable intensities in different experiments and failed to compete even with the complete ⁇ enhancer in this experiment and has not been further investigated at this stage.
  • the observation that the SV40 enhancer specifically competes for binding of this factor is not altogether surprising since this fragment and the SV40 enhancer share an identical stretch of 11 nucleotides.
  • pre- preB cell line C5, Figure 15B, lane 4
  • mouse pre-B cell lines HTFL, 38B9, 70Z, Figure 15B, lanes 6,8,10.
  • this factor appears to be not only tissue-specific, i.e., limited to cells of the B lymphoid lineage, but is also stage-specific within that lineage. In the series of extracts examined, the presence of this factor bears a striking correlation with ⁇ expression.
  • a Hinfil-Ahall DNA fragment of the EBV genome (coordinates 107,946-109,843), that contains the EBNA-1 open reading frame, was subcloned using BamHI linkers into the BamHI site of pUC13 (pUCEBNA-1).
  • the ⁇ gtll-EBNA-1 recombinant was constructed by inserting the 600 bp Saml-BamHI fragment of pUCEBNA-1 (EBV coordinates 109,298-109,893) into the EcoRI site of ⁇ gtll using an EcoRI linker (GGAATTCC).
  • a phage recombinant containing the EBNA-1 insert in the sense orientation was isolated by immunoscreening with EBNA-1 antibodies (see below). In this recombinant, the carboxy-terminal region of EBNA-1 (191 amino acids) Is fused in frame to the carboxy- terminus of ⁇ -galactosidase.
  • the human B cells (RPMI 4265) cDNA library constructed in the expression vector ⁇ gtll was purchased from Clontech Laboratories, Inc.
  • the library contains approximately 9 ⁇ 10 independent clones and has an average insert size of 1.2 kb.
  • the standard pair of ⁇ gtll host strains, Y1090 and Y1098, were employed.
  • the former was used to screen ⁇ gtll recombinants and the latter to generate ⁇ lysogens for the analysis of ⁇ - ga l fusion proteins.
  • the plasmid pUCoriP1 was constructed by sub- cloning the EcoRI-Ncol fragment from the oriP region of the EBV genome into the Smal site of pUC13. This fragment contains 20 high affinity binding sites for EBNA-1.
  • pUCoriP2 was derived from pUCoriP1 by subcloning of an oriP fragment (EcoRI-BstXI) of the latter into the Smal site of pUC13.
  • pUCoriP2 contains 11 high affinity binding sites for EBNA-1.
  • pUC0RI ⁇ 2 was made by insertion of a synthetic binding site for the bacteriophase ⁇ O protein (AAATCCCCTAAAACGAGGGATAAA) into the Smal site of pUC13.
  • the complementary oligonucleotides were a gift of R. MacMacken.
  • pUCMHCI and pUCmhcI were constructed by insertion of the following oligonucleotides:
  • pUCOCTA is a similarly constructed pUC18 derivative that contains a synthetic recognition site (ATGCAAAT) for the mammalian octamer binding protein(s).
  • the plasmids P190H2KCAT (-190 to +5) and pl38H2KCAT (-138 to +5) contain 5'-deletions of the H-2K gene promoter fused to the coding sequence for chloramphenicol acetyl transferase. All plasmids DNAs were purfied by an alkaline lysis protocol followed by two bandings in CsCl-EtBr gradients. Binding Site Probes Competitor DNAs
  • the MHC , mhcl, ori and OCTA probes were generated by digesting the corresponding pUC plasmids with EcoRI and Hindlll. The resulting products were end- labeled with [ ⁇ - 32 P]dATP using the large fragment of E. Coli DNA polymerase I. dCTP, dGTP and dTTP were included in these reactions so as to fill in the ends of the restriction fragments. The labeled fragments were separated by native polyacrylamide gel electrophoresis. The binding site fragments (60-75 bp) were eluted from the gel and purified by ELUTIPTM
  • pUCoriP2 was digested with EcoRI and Hindlll, and the oriP fragment (-400 bp) isolated by low melt agarose gel electrophoresis. This DNA fragment was then digested with Hpall and the products labeled as detailed above.
  • the smaller of the two Hpall fragments (-90 bp) was isolated for use as the oriP probe.
  • the MHCg probe was prepared by digesting pl90H2KCAT with Xhol was labeling as before. The labeled DNA was then digested with Hindi and the 90 bp probe fragment purified as before. This probe contains sequence from -190 to -100 of the upstream region of the H-2K gene.
  • the ⁇ 6MHCg (-190 to +270) and ⁇ 11MHCg (-138 to +270) competitor DNAs were prepared by digesting the plasmids, p190H2KCAT and p138H2KCAT, with Xhol and EcoRI.
  • the H2KCAT fragments were isolated by low melt agarose gel electrophoresis.
  • EBNA-1 Epstein-Barr virus nuclear antigen
  • the Epstein-Barr virus nuclear antigen (EBNA-1) was selected as the model protein.
  • EBNA-1 is required for maintenance of the EBV genome as an autonomously replicating plasmid in human cell lines. It is also a transactivator of viral gene expression.
  • the carboxy-terminal region of EBNA-1 (191 amino acids) has been expressed in E. coli as a fusion protein and shown to encode a sequence-specific DNA binding domain.
  • the fusion protein binds to multiple high affinity sites at three different loci in the EBV genome.
  • Extracts of ⁇ gtll and ⁇ EB-lysogens were incubated with labeled oriP DNA and the products resolved by native polyacrylamide gel electrophoresis. With the ⁇ EB extract, a distinct set of protein-DNA complexes was observed. The formation of these complexes was specifically competed by an excess of plasmid DNA containing EBNA-1 binding sites. Thus, the ⁇ -gal-ENBA-l fusion protein has the expected sequence- specific DNA binding activity.
  • ⁇ EB plaques can be specifically detected using radiolabeled oriP DNA.
  • the control probe (ori) contains a high affinity binding site for the bacteriophage ⁇ O protein.
  • the specific array of spots generated by the oriP probe corresponded to plaques on the master plate as well as to spots that reacted with antiserum to ⁇ -gal on the replica filter. Furthermore, in a similar experiment the oriP probe did not detect control ⁇ gtll plaques.
  • a ⁇ gtll library of cDNAs prepared with mRNA from human B cells was screened using the conditions developed with ⁇ EB.
  • the DNA probe used in the screen contained a regulatory element from a mouse MHC class I gene (H-2K , Figure 17). This sequence (MHC) was synthesized and cloned into the pUC polylinker. The mammalian transcriptional regulatory factors H2TF1 and NF- ⁇ B bind with high affinity to this MHC element. In a screen of 2.5 ⁇ 10 5 recombinants, two positive phage, designated ⁇ h3 and ⁇ h4, were isolated.
  • ⁇ h3 and ⁇ h4 phage were challenged with other DNA probes to determine if their detection was specific for the MHC probe.
  • ⁇ h3 and ⁇ h4 were not detected by the ori probe.
  • OCTA a related probe containing a recognition site for the immunoglobulin octamer binding protein(s).
  • a mutant MHC binding site probe (mhcl Figure 17) was used to more stringently test the sequence- specificity of the presumptive fusion proteins.
  • the mhcl probe did not detect either ⁇ h3 or ⁇ h4 plaques. These data strongly suggested that the two phage express proteins that bind specifically to the MHC element Characterization of the DNA Binding Proteins Encoded by ⁇ h3 and ⁇ h4 Direct evidence that the ⁇ -gal fusion proteins encoded by ⁇ h3 and ⁇ h4 are responsible for the sequence-specific DNA binding activities was obtained by screening Western blots with DNA and antibody probes. Lysogens of ⁇ gtll, ⁇ h3 and ⁇ h4 were isolated and induced to generate high levels of their respective ⁇ -gal proteins.
  • ⁇ h3 and ⁇ h4 encode ⁇ -gal fusion proteins which bind specifically to the MHC element DNA.
  • the two phage may be identical since they encode the same size fusion proteins.
  • P1 (approximate m.w. 160,000) probably represents the full length fusion protein whereas P2 is a presumptive proteolytic cleavage product.
  • the ⁇ -gal portion of this fusion polypeptide has a molecular weight of approximately 120,000, the cDNA encoded portion must have a molecular weight of 40,000.
  • a gel electrophoresis DNA binding assay was used to confirm the sequence specificity of the ⁇ h3 and ⁇ h4 fusion proteins as well as to better define their recognition properties.
  • Extracts derived from the ⁇ gtl1, ⁇ h3 and ⁇ h4 lysogens were assayed, with the MHC probe.
  • a novel DNA binding activity was detected specifically in extracts of the ⁇ h3 and ⁇ h4 lysogens. This activity was IPTG inducible indicating that it was a product of the lacZ fusion gene.
  • a competition assay indicated that the activity represented a sequence-specific DNA binding protein.
  • Two 5' deletion mutants of the H-2K genomic sequence was used as competitor DNAs.
  • the segment 6MHCg extends to 190 nucleotides upstream of the transcription start site and contains the MHC sequence element.
  • the segment ⁇ 11MHCg on the other hand, only contains 138 nucleotides of sequences upstream of the Initiation site and therefore lacks the MHC element. Increasing amounts of ⁇ 6MHCg specifically competed for the binding of the ⁇ h3 fusion protein to the MHC element oligonucleotide probe while the control ⁇ 11MHCg did not compete. It should be noted that the sequences flanking the MHC element in the probe used for the initial screening, the cloned oligonucleotide, are totally difference from the sequences flanking the same element in the genomic probe, ⁇ 6MHCg. Therefore, the fusion protein appears to exclusively recognize the common MHC element.
  • This site is related in sequence to the MHC element but is recognized by H2TF1 with a 10 to 20 fold lower affinity (Figure 17).
  • a mutant ⁇ enhancer ( ⁇ EN) has been characterized both in vivo and in vitro. This mutant sequence has no B cell specific enhancer activity and is not bound by NF- ⁇ B. The mutant contains clustered base substitutions and an insertion of a base pair in one of the two symmetric half sites ( Figure 17). The binding of the ⁇ h3 fusion protein to the wild type ⁇ -element and the mutant version was tested. The ⁇ EN probe generated a complex with a mobility similar to those obtained with the MHC probes. No specific complex was formed with the mutant ⁇ -enhancer DNA.
  • the ⁇ EN site differs, in part, from the MHC site by the substitution of two adenine residues for guanine residues. As discussed below, these guanine residues are probably contacted by the fusion.
  • the contacts of the fusion protein with the MHC element were probed chemically by modification of the DNA with dimethylsulfate. After partial methylation at purine residues, the modified probe was used in the gel electrophoresis DNA binding assay.
  • Free (F) and bound (B) probe DNA was recovered, subjected to chemical cleavage at methylated interference experiment.
  • strong interference was detected when any of central guanine residues of each putative half site was modified at the N-7 position in the major groove.
  • Weaker interference was observed when the external guanine residue in either putative half site was similarly modified.
  • the fusion protein appears to symmetrically contact the MHC element in a manner similar to both H2TF1 and NF- ⁇ B.
  • the recombinant phage ⁇ h3 and ⁇ h4 contain cross-hybridizing and equivalent size (approximately 1 b) cDNA segments.
  • the inserts also have indistinguishable restriction maps and therefore appear to be identical.
  • Southern blot hybridization confirmed that these cDNA segments are homologous to sequences in the human genome.
  • the patterns of hybridization to restriction digests of genomic DNAs of various human cell lines are identical.
  • restriction digests with Bam HI (no site in cDNA) and Pst I (on site in cDNA) both generate two prominent bands suggests that the cDNAs are derived from a single copy gene.
  • a similarly simple hybridization pattern is observed on probing the mouse and rate genomes.
  • the expression of the human gene was analyzed by Northern blot hybridization. A single, large transcript (approximately 10 kb) was observed with polyA(+) RNA from both B (X50-7) and non-B human cells (HeLa). This transcript is moderately abundant in both cell types. Since the cDNA library was constructed by oligo dT priming, we were probably fortunate to obtain the coding region for the DNA binding domain within the 1 kb segments of the recombinant phage. However, this only Illustrates the power of the screening strategy for the isolation of clones encoding sequence-specific DNA binding domains.
  • a novel strategy is disclosed for the molecular cloning of genes encoding sequence-specific DNA binding proteins.
  • This strategy can be used to isolate genes specifying mammalian, transcription regulatory proteins.
  • An important step in this approach is the detection of bacterial clones synthesizing significant levels of a sequence-specific DNA binding protein by screening with a labeled DNA binding site probe.
  • This approach is similar to that previously developed for the isolation of genes by screening recombinant libraries with antibodies specific for a given protein.
  • the phage expression vector, ⁇ gtll developed previously for immunological screening can be in this approach.
  • the functional DNA binding domain is contained within a short tract of amino acids. Thus it is reasonable to expect the functional expression in E. coli of the sequence- specific DNA binding domain of most eukaryo- tic regulatory proteins.
  • the equilibrium association constants of site-specific DNA binding proteins range over many orders of magnitude (10 7 -0 12 M). The following analysis suggests that successful screening may be restricted to proteins with relatively high binding constants. If a regulatory protein has an association constant of 10 M, then under the screening conditions (the DNA probe is in excess and at a concentration of ( ⁇ 10 M) approximately half of the active molecules on the filter will have DNA bound. Since the filters are subsequently washed for 30 minutes, the fraction of protein-DNA complexes that remain will be determined by their dissociation rate constant.
  • the dissociation rate constant will be 10 - 3 S -1 .
  • Such a protein-DNA complex will have a half life of approximately 15 minutes. Thus only a quarter of the protein-DNA complexes will survive the 30 minute wash.
  • For a binding constant of 10 6 M then only about a tenth of the active protein molecules will have DNA bound and much of this signal will be lost since the half-life of these complexes is approximately 1.5 minutes. Isolation of recombinants encoding proteins with binding constants of 10 6 or lower may be possible given that the binding of probe to less than 1% of the total fusion protein within a plaque can be detected.
  • the sensitivity of the current methodology for low affinity proteins could be significantly enhanced by covalent stabilization of protein-DNA complexes. This might be accomplished by procedures such as UV-irradiation of pre-formed complexes. Since the binding constants of regulatory proteins are dependent on ionic strength, temperature and pH, these factors might also be manipulated to enhance detection.
  • ⁇ EB and ⁇ h3 recombinants with DNA binding site probes required high level expression of their fusion proteins.
  • the fusion proteins accumulate, after induction, to a level of about 1% of total cellular protein.
  • This level of recombinant protein expression is typical of ⁇ gtll as well as other E. coli vectors.
  • the strategy of cloning a gene on the basis of specific detection of its functional recombinant product in E. coli has considered potential. Indeed, while our work was in progress, this approach was used by other to isolate clones encoding a peptide acetyltransferase and a calmodulin-binding protein. Direct screening of clones encoding recombinant protein products has also been used to isolate ras GTP-binding mutants.
  • the ⁇ h3 recombinant expresses a ⁇ -gal fusion protein that recognizes related transcription control elements in the enhancers of the MHC class I and immunoglobulin ⁇ -chain genes (see Figure 17 for sequences). This protein also binds a similar element in the SV40 enhancer 72bp repeat. Furthermore, there are two putative binding sites in the long terminal repeat (LRT) of the HIV genome ( Figure 17) . One of these is identical to the site in the SV40 enhancer and therefore should be recognized by the fusion protein.
  • LRT long terminal repeat
  • a common factor NF- ⁇ B
  • NF- ⁇ B binds to the three related elements in the enhancer
  • the SV40 72 bp repeat an the HIV-LTR binds to the three related elements in the enhancer, the SV40 72 bp repeat an the HIV-LTR.
  • these three binding sites are more closely related to one another than they are to the MHC site ( Figure 17).
  • the former set can be viewed as variants of the MHC site which exhibits perfect two-fold symmetry.
  • the pUC polylinker contains the sequence, CGGGGA, which is a variant of one of the symmetric halves (TGGGGA) of the MHC element.
  • the fusion protein does not bind with detectably affinity to the pUC polylinker.
  • a high affinity interacter appears to require both symmetric halves.
  • the MHC element is a component of an enhancer that functions in a variety of cell types that express MHC class I genes.
  • the ⁇ -element is a component of a cell-type specific enhancer that functions only in B cells. The activity of this enhancer is induced in pre-B cells upon their differentiation Into mature B lymphocytes. Such differentiation, in vitro, is accompanied by transcriptional activation of the chain gene. The ⁇ -element appears to dictate the B cell specificity of the ⁇ -enhancer.
  • the different modes of functioning of the MHC and ⁇ -elements are correlated with the properties of their corresponding recognition factors, H2TF1 and NF- ⁇ B.
  • H2TF1 activity is detected in a variety of differentiated cell types and this protein appears to stimulate MHC class I gene transcription approximately 10-fold.
  • NF- ⁇ B activity is detected only a mature B cells. In addition, this activity. is induced during differentiation of pre-B cells to mature lymphocytes.
  • NF- ⁇ B activity is also induced by phorbol ester treatment of non-B cell lines (HeLa, Jurkat). In the case of Jurkat cells, a T4 + human T cell line, NF- ⁇ B appears to stimulate the transcriptional activity of the HIV-LTR. It should be noted that induction of NF- ⁇ B in non-B cells does not require new protein synthesis. Thus the protein for NF- ⁇ B must exist in cells before induction and the activated by a post-translational modification.
  • the recombinant protein binds the MHC element DNA with 2-5 fold higher affinity than the ⁇ -element.
  • the fusion protein has relative affinities intermediate between those of H2TF1 and NF- ⁇ B.
  • H2TF1 binds theMHC element with 10- to 20-fold higher affinity than the ⁇ -element while NF- ⁇ B recognizes both elements with roughly equivalent affinity.
  • Antibodies raised against the ⁇ h3 fusion protein will be useful in clarifying its structural relationship with H2TF1 and NF- ⁇ B. A definitive relationship will emerge from a comparison of the deduced amino acid sequence of the cDNA and the protein sequences of H2TF1 and NF- ⁇ B. It should be noted that in terms of protein expression, both H2TF1 and NF- ⁇ B are present in a wide variety of mammalian cells. Furthermore, the DNA binding specificities of these two factors are remarkably similar. These facts as well as the observations that the cDNA in ⁇ h3 hybridizes to a single copy gene and to a single mRNA in both B and non-B cells suggest that all three binding activities may be products of the same gene. This hypothesis would imply that H2TF1 and NF- ⁇ B represent alternative modifications of a common protein.
  • DNA sequencing was performed on double stranded plasmid DNA templates according to the Sanger dideoxy- nucleotide protocol as modified by United States Biochemical for use with bacteriophage T7 DNA polymerase (Sequenase). The entire sequence was confirmed by sequencing the opposite strand and in the GC-rich regions by sequencing according to Maxam and Gilbert (Methods Enzymol., 65 : 449-560, (1980).
  • Plasmids Constructions cDNA's were subcloned from ⁇ gtll to pGEM4
  • Plasmid pBS-ATG was kindly provided by H. Singh and
  • Figure 19A was designed for transcription and translation in vitro and was constructed by cleaving pBS-ATG with Smal and ligating the blunt-ended EcoRI 1.2 kb cDNA fragment from plasmid 3-1 (position 655 to 1710 in Figure 18A).
  • the binding reactions were incubated at room temperature for 30 min and contained 10 mM Tris HCl pH7.5, 50 mM NaCl, 1 mM DTT, 1 mM EDTA pH8 , 5% glycerol, 25 ⁇ g/ml sonicated denatured calf thymus DNA in 2.5 ⁇ g/ml sonicated native calf thymus DNA as nonspecific competitors.
  • NF-A2 was purified to >90% homogeneity from nuclear extracts derived from the human Burkett's lymphoma cell line, BJAB. Purification was accomplished by sequential fractionation on Zetachrom QAE discs (Cuno Inc.), heparin sepharose (Pharmacia), ssDNA cellulose (Pharmacia), and on a DNA affinity column which contained an immobilized double stranded
  • Tryptic digests were performed at room temperature in a buffer consisting of 20 mM Hepes, KOH, pH 7.9, 20% glycerol, 0.5 M KCl, 0.2 mM EDTA, 0.5 mM DTT. Aliquots of purified NF-A2 (-250 ng) or of affinity purified oct-2 protein (90,000 cpm) were incubated with varying amounts of trypsin (affinity purified trypsin was a gift of Dan Doering). After
  • the randomly primed cDNA library in ⁇ gtll was generated by standard methods (Gubler, U. and Hoffman, B.J., Genes 25:263-269 (1983)). Random hexamers (Pharmacia) were used to prime the first strand cDNA synthesis. The unamplified library contained 500,000 recombinants. This library was screened by the method described above using a radiolabelled DNA probe consisting of four copies, in direct orientation, of a 26bp oligonucleotide derived from the Vk41 promoter.
  • the probe was constructed by cloning four copies of the oligonucleotide in direct orientation into the BamHI site of the pUC polylinker and radiolabelling the 112 bp Smal-Xbal fragment.
  • the library was screened with the tetramer probe (at 1 ⁇ 10 6 cpm/ml) as described above for the cloning of NF- ⁇ B with the following modification.
  • the specificity of the DNA binding proteins encoded by the recombinant phage was investigated by preparing extracts of induced phage lysogens. Lysogen extracts from both phages bound to the tetramer probe in a mobility shift assay whereas lysogen extracts from non-recombinant ⁇ gtll showed no binding to this probe. Only the phage 3 extract bound strongly to the ⁇ promoter probe. Because the inserts of phage 3 and phage 5 (1.2 kb and 0.45 kb in size, respectively) were found to cross-hybridize by Southern blotting analysis, phage 3 was chosen for further analysis.
  • Phage 3 encoded an octamer binding protein as demonstrated by a competition mobility shift assay in which the lysogen extract was bound to the ⁇ promoter probe in the presence of competing unlabelled DNA fragments containing either the wild type or mutant octamer motifs.
  • Phage lysogen extracts were prepared as described above for NF- ⁇ B cloning. The extracts were assayed in a mobility shift assay as described above using the octamer-containing PvuII-EcoRl fragment from pSPIgVk as the radiolabelled probe. Binding reactions were carried out in the absence or presence of 24 ⁇ g of cold competitor DNA containing no octamer motif, the wild type octamer motif or mutant octamer motifs as described.
  • the phage-encoded octamer binding protein was further compared to NF-A1 and NF-A2 using a methylation interference footprinting assay. Methylation interference was performed as described using thenon-coding strand of the octamer-containing PvuII- EcoRl fragment of pSPlgVk as radiolabelled probes. The probes were partially methylated and used in preparative mobility shift DNA binding assays.
  • DNA present in the bound bands was isolated, cleaved at the modified purine residues and subjected to denaturing polyacrylamide gel electrophoresis.
  • the footprint obtained using the lysogen extract was centered over the octamer motif and was very similar to the footprints of NF-A1 and NF-A2 from a BJAB nuclear extract and from a WEHI 231 nuclear extract (see above).
  • the phage insert could encode an octamer binding protein distinct from NF-A1 and NF-A2.
  • the phage-encoded ⁇ -galactosidase fusion protein was directly shown to be the octamer binding protein in the phage lysogen extracts.
  • Phage lysogen extracts were subjected to SDS polyacrylamide gel electrophoresis and transferred to nitrocellulose filters. After a denaturation/renaturation procedure (Celenza, J.L. and Carlson, M. Science 233: 1175-1180 (1986)), the filters were probed with either the radiolabelled octamer- containing tetramer probe
  • OCTA a non-specific DNA probe
  • pUC non-specific DNA probe
  • the OCTA probe specifically bound to the ⁇ -galactosidase fusion proteins of phage 3 and phage 5 to a much greater extent than the pUC probe thus formally showing that the octamer binding activity was encoded by the phage inserts.
  • the apparent molecular weights of the largest fusion proteins of phage 3 and phage 5 lysogens are consistent with the entire phage inserts contributing coding sequences to the fusion proteins. Proto teolysis was presumed to account for the heterogeneity in apparent molecular weight of the fusionproteins.
  • phage 3 which defines what we term the oct-2 gene, was used in a Southern blot analysis to probe human and mouse genomic DNA digested with several restriction enzymes. Restriction enzyme digested genomic DNA was electrophoresed through a 1% agarose gel and transferred to Zetabind (CUNO Laboratory, Inc.) by standard techniques (Maniatis, T., Frisch, E.F. and Sambrook, J. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY. (1982)). The phage 3 insert was radiolabelled by randomly primed synthesis using hexanucleotides (Pharmacia). Following standard prehybridization high- stringency hybridization
  • the oct-2 cDNA segment (1.2 kb ) of phage 3 was used to identify additional overlapping recombinants in the same library.
  • One of these phage (pass-3) contained a 1.8 kb DNA insert.
  • Sequence analysis of the cDNA segment in the original ⁇ gtll phage (3-1) revealed a long open reading frame (ORF) which was ended with multiple nonsense codons at its 3' terminus.
  • the N terminus of the open reading frame in both of these cDNA segments was not represented in the cDNA inserts.
  • Figure 18 shows the amino-acid sequence of oct-2 protein depicted in plain capital letters.
  • cDNA-clone pass-5.5 spans from position 1 (5' end) to position 750 (3' end).
  • cDNA clone pass-3 5' end and 3' end are respectively at position 92 in Figure 18a and 1847 in Figure 18b.
  • cDNA clone 3-1 starts at position 650 and ends at position 1710.
  • the nucleotide sequence shown in panel A was reconstructed by merging the DNA sequences from clone pass-5.5 from position 1 to 100, from clone pass-3 from 100 to 660 and from clone 3-1 from position 660-1710. Extensive nucleotide sequence overlaps were available to allow unequivocal merges.
  • Figure 18b shows the nucleotide sequence of the 3' terminus and predicted amino acid sequence of the C-terminus derived from clone pass-3.
  • the code is the same as in A and the vertical arrow denotes the divergence point.
  • Figure 18c is a schematic representation of the amino acid sequence deduced from oct-2 gene derived cDNA.
  • the code is as in panel A.
  • the DNA binding domain is depicted as DNA and the region containing the four regularly spaced L residues is boxed-in.
  • LORF stands for long open reading frame
  • N stands for N-terminus
  • C for COOH - terminus.
  • the oct-2 protein appears to specifically bind DNA as a monomer. It is interesting to speculate that the "leucine zipper" region of oct-2 might be important for interaction with other proteins as there is no obvious reason to restrict the binding of such a structure to self-recognition.
  • Figure 20 shows the amino acid sequence alignment of the DNA binding domain of oct-2 factor with homeoboxes from Antp. (Schneuwly et al., EMBO J. 5: 733-739 (1986), cut (Blochlinger, Nature 333: 629-635 (1988), en (Poole et al., Cell 40: 37-43 (1985), proteins (boxed-in amino-acid sequences) and with homeobox-related amino acid sequences from the S . cerevisae proteins Matal (Miller, EMBO J. #: 1061-1065 (1984), Mat ⁇ 2. (Astell et al., Cell 27: 15-23
  • DNA binding domain is most strongly argued by its homology with the DNA binding domain of the yeast mating regulatory protein, MAT ⁇ (Astell et al., Cell 27: 15-23 (1981); Scott and Weiner, Proc. Natl. .Acad. Sci. USA 81: 4115-4119 (1984)), which also has homology through this subregion of the homeobox but does not conserve the other invarient of the homeobox.
  • MAT ⁇ The homologous regions in these proteins can be folded into a helix-turn-helix structure similar to that first identified in the structural analysis of phage ⁇ repressor (for a review, see Pabo and Sauer, Ann. Rev. Biochem. 53: 293-321 (1984)).
  • sequences at the 3' end of the pass-3 recombinant abruptly diverged from that of recombinant 3-1 at the position (1463) of its termination codon (see vertical arrow in Figure 18B).
  • the substituted sequences in the second recombinant, pass-3 extended the reading frame of the oct-2 related protein by an additional 16 amino acids.
  • total polyA(+) RNA from the BJAB cell line was analyzed by Northern blot with a DNA fragment from the novel 3' terminal portion of the pass-3 cDNA.
  • This specific probe hybridized only to the two fastest migrating mRNAs of the total family of six mRNAs which were detected by hybridization with the total 3-1 cDNA. A similar specific probe was excised from the 3' terminus of the 3-1 cDNA. In contrast, this probe only hybridized to the two slowest migrating mRNAs in the total family of six. This suggests that the two cDNA segments correspond to different populations of oct-2 mRNAs. The proteins encoded by the two cDNAs should only differ at their C terminus by 16 amino acids or approximately 1.5 kD. In vitro transcription/translation of subfragments of the 3-1 and pass-3 recombinants was used to confirm this prediction.
  • Fragments representing the 3' portions of 3-1 and pass-3 were subcloned into the expression plasmid pBS-ATG.
  • the resulting plasmid DNAs were transcribed with bacteriophage T7 RNA polymerase and were subsequently translated in a reticulocyte system.
  • the resulting polypeptides migrated with the mobilities of the anticipated molecular weights 34kD and 32.4 kD.
  • the polypeptide from the pass-3 cDNA was 1.6 kD larger than that from the 3-1 cDNA.
  • Both polypeptides specifically bound a probe containing the octanucleotide sequence, producing a readily detectable DNA-protein complex in the gel mobility assay. This suggests that the oct-2 gene is expressed as a family of polypeptides in B-cells.
  • oct-2 The expression of the oct-2 gene was assessed by Northern blot analysis of mRNA from 13 lymphoid and non-lymphoid cell lines and was found to be predominant ly restricted to lymphoid cells.
  • BJAB human mature B cell line (poly(A)-containing mRNA); 10. BJAB (total mRNA); 11. Hut78: human T cell line; 12. HeLa: human cervical carcinoma cell line; 13. EL4: mouse T cell line.
  • mRNA was electrophoresed through a formaldehyde-containing 1.3% agarose gel and transfered to a nitrocellulose filter by standard techniques (Maniatis, supra.). Following prehybridization, the filter was hybridized at high stringency with radiolabelled oct-2 probe (above). The filter was washed in 0.2XSSC, 0.1% SDS at 68°C.
  • All five B lymphoma cell lines including pre-B and mature B cell lines, and one of three T lymphoma cell lines expressed a family of 6 transcripts.
  • a glioma cell line, U1242( ) showed detectable expression of this gene.
  • the various transcripts estimated to be 7.2 kb , 5.8 kb, 5.4 kb, 3.7 kb, 3.1 kb and 1.2 kb long, were expressed in somewhat varying amounts relative to each other in the positive cell lines.
  • NF-A2 purified preparations of NF-A2 consist of three or more major polypeptides with distinct molecular weights which could be the products of the family of transcripts that we have observed.
  • EL4 was the only line that showed large amounts of NF-A2.
  • NF-A2 was previously believed to be expressed only in lymphoid cells we found that nuclear extracts from the glioma cell line that expressed the oct-2 gene contained an octamer binding protein which comigrated with NF-A2 in the mobility shift assay.
  • NF-A2 was discovered when the NF-A2 factor was purified from nuclear extracts of BJAB cells by conventional chromatography followed by multiple passages over an affinity column containing immobilized oligomers of the octanucleotide sequence.
  • the purified NF-A2 consisted of three bands as resolved by gel electrophoresis, a major band and two minor bands with deduced molecular weights of 61 kD and 58 kD, and 63 kD, respectively.
  • a cDNA (pass-3) for the oct-2 gene was inserted into the polylinker of the pGEM (Promega) expression vector. Translation of RNA transcribed from the SP6 promoter-pass-3 cDNA construct yielded a major polypeptide of 61 kD which comigrated with the prominent polypeptide from the purified sample of NF-A2.
  • the mobility of a DNA-protein complex in the gel assay is primarily determined by the molecular weight of the protein. Complexes were generated with the affinity purified NF-A2 and the products of translation in vitro of RNA from the oct-2 cDNA. These complexes co-migrated during electrophoresis in a native gel, again suggesting that the oct-2 cDNA encodes the major form of the NF-A2 factor.
  • the affinity purified NF-A2 protein and the polypeptide translated in vitro from the oct-2 cDNA were also compared by partial tryptic digestion. Samples from different digestion times of NF-A2 were resolved by denaturing gel electrophoresis and detected by staining with silver. The mobility of these partial fragments was compared with those observed after a parallel analysis of 35 S-methionine labelled polypeptide from transcription/translation of the pass-3 cDNA in vitro. The two samples generated a similar set of digestion fragments, again suggesting that NF-A2 is encoded by the oct-2 cDNA.
  • Protein sequence comparisons suggested that the DNA binding domain of oct-2 was specified by a domain (positions 952 to 1135) that was distantly related to both the helix-turn-helix structure of bacterial repressors and the homeobox-proteins.
  • a fragment of the cDNA encompassing this region (655 to 1710) was inserted into the expression vector pBS-ATG so that RNA could be transcribed from the truncated templates by bacteriophage T7 RNA polymerase as indicated in Figure 19A.
  • the polypeptides translated in vitro from these RNAs were tested for specific DNA binding by addition of the total translation mix to the DNA-protein gel assay. Polypeptides produced from RNAs terminating at positions 1710 (Kpnl), 1443 (Stul), and 1134
  • Two distinct but similarly migrating protein-DNA complexes were detected in the sample generated by translation of RNA from the Stul cleaved template. Faint slower migrating complex comigrated with the complex generated with templates cleaved by Kpnl. The presence of the two complexes in the Stul-sample is due to a partial digestion. of the plasmid DNA. The slower migrating complex is probably produced by protein terminated at the stop codon TAA located at position 1465. The faster migrating complex probably results from molecules terminated at the Stul site.
  • sequence-specific binding proteins have an oligomeric structure.
  • bacterial represser proteins typically bind sites with two-fold rotational symmetry by forming a similarly symmetric dimer (Ptashne, Cell Press and Blackwell Scientific Publications, (1986)).
  • the binding site sequence of the oct-2 protein is not symmetric but oligomeric proteins could bind to non-symmetric sites.
  • Other examples of oligomerization of sequence-specific binding proteins are the GCN4 protein of yeast (Hope and Struhl, EMBO J. 6 : 2781-2784, (1987)) and the C/EBP protein of mammals.
  • Anti-sera raised in rabbits against a bacterial fusion protein containing oct-2 encoded sequence recognized the native oct-2 protein in metabolically labeled ( 35 S- methionine) human B cells.
  • the molecular cloning of a lymphoid-res tricted octamer binding protein gene demonstrates that higher eukaryotes have adopted a strategy of genetic diversification of transcriptional regulatory proteins which bind a common regulatory motif.
  • the ubiquitous and lymphoid-specific octamer binding proteins have indistinguishable DNA binding sites yet appear to have distinct functional properties (Staudt, L.M. et al, Nature 323: 640-643 (1986)).
  • Structure-function analysis of cloned yeast transcription factors (Petkovich, M. et al., Nature 330:444-450 (1987); Giguere, V. et al., Nature 330: 625-629
  • the clones ⁇ h3 and oct-2 have been deposited at the American Type Culture Collection in Rockville, Maryland and assigned the ATCC accession numbers 67629 and 67630 respectively.

Abstract

Des facteurs de protéines constitutives et spécifiques à certains tissus se lient aux éléments régulatoires de la transcription des gènes d'Ig (promoteurs et amplificateurs). On a identifié et isolé ces facteurs par un essai amélioré de liaison d'ADN et la protéine. On peut isoler et utiliser des gènes de codage de facteurs qui régulent de manière positive la transcription afin d'améliorer la transcription de gènes d'Ig.
PCT/US1989/000553 1988-02-12 1989-02-10 Facteurs nucleaires associes a la regulation de la transcription WO1989007614A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US15520788A 1988-02-12 1988-02-12
US155,207 1988-02-12
US28017388A 1988-12-05 1988-12-05
US280,173 1988-12-05

Publications (1)

Publication Number Publication Date
WO1989007614A1 true WO1989007614A1 (fr) 1989-08-24

Family

ID=26852101

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1989/000553 WO1989007614A1 (fr) 1988-02-12 1989-02-10 Facteurs nucleaires associes a la regulation de la transcription

Country Status (2)

Country Link
CA (1) CA1340999C (fr)
WO (1) WO1989007614A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5591840A (en) * 1992-09-23 1997-01-07 Hoffmann-La Roche Inc. Antisense oligonucleotides directed against nucleic acids encoding NFKB transcription factor
US5723300A (en) * 1995-07-10 1998-03-03 University Of Massachusetts Medical Center Nuclear localized transcription factor kinase and diagnostic assays related thereto
US5731400A (en) * 1988-02-17 1998-03-24 Maxdem Incorporated Rigid-rod polymers
US5989810A (en) * 1991-08-22 1999-11-23 Board Of Trustees Of Leland Stanford Jr. University Screening methods for immunosuppressive agents
US6376175B1 (en) 1989-07-18 2002-04-23 Osi Pharmaceuticals, Inc. Methods of discovering chemicals capable of functioning as gene expression modulators
US7628989B2 (en) 2001-04-10 2009-12-08 Agensys, Inc. Methods of inducing an immune response
US7927597B2 (en) 2001-04-10 2011-04-19 Agensys, Inc. Methods to inhibit cell growth
US8901171B2 (en) 2010-01-27 2014-12-02 Takeda Pharmaceutical Company Limited Compounds for suppressing a peripheral nerve disorder induced by an anti-cancer agent

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1987004170A1 (fr) * 1986-01-09 1987-07-16 Massachusetts Institute Of Technology Facteurs nucleaires associes a la regulation de la transcription

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1987004170A1 (fr) * 1986-01-09 1987-07-16 Massachusetts Institute Of Technology Facteurs nucleaires associes a la regulation de la transcription

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Science, volume 227, no. 4684, 18 January 1985, M. Mercola et al.: "Immunoglobulin heavy-chain enhancer requires one or more tissue-specific factors", pages 266-270 *
Science, volume 241, 29 July 1988, L.M. Staudt et al.: "Cloning of a lymphoid-specific cDNA encoding a protein binding the regulatory octaber DNA mofif", pages 577-580 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5731400A (en) * 1988-02-17 1998-03-24 Maxdem Incorporated Rigid-rod polymers
US6376175B1 (en) 1989-07-18 2002-04-23 Osi Pharmaceuticals, Inc. Methods of discovering chemicals capable of functioning as gene expression modulators
US5989810A (en) * 1991-08-22 1999-11-23 Board Of Trustees Of Leland Stanford Jr. University Screening methods for immunosuppressive agents
US5591840A (en) * 1992-09-23 1997-01-07 Hoffmann-La Roche Inc. Antisense oligonucleotides directed against nucleic acids encoding NFKB transcription factor
US5723300A (en) * 1995-07-10 1998-03-03 University Of Massachusetts Medical Center Nuclear localized transcription factor kinase and diagnostic assays related thereto
US7628989B2 (en) 2001-04-10 2009-12-08 Agensys, Inc. Methods of inducing an immune response
US7641905B2 (en) 2001-04-10 2010-01-05 Agensys, Inc. Methods of inducing an immune response
US7736654B2 (en) 2001-04-10 2010-06-15 Agensys, Inc. Nucleic acids and corresponding proteins useful in the detection and treatment of various cancers
US7927597B2 (en) 2001-04-10 2011-04-19 Agensys, Inc. Methods to inhibit cell growth
US7951375B2 (en) 2001-04-10 2011-05-31 Agensys, Inc. Methods of inducing an immune response
US8901171B2 (en) 2010-01-27 2014-12-02 Takeda Pharmaceutical Company Limited Compounds for suppressing a peripheral nerve disorder induced by an anti-cancer agent

Also Published As

Publication number Publication date
CA1340999C (fr) 2000-05-23

Similar Documents

Publication Publication Date Title
US6410516B1 (en) Nuclear factors associated with transcriptional regulation
US5804374A (en) Nuclear factors associates with transcriptional regulation
Dickinson et al. A tissue-specific MARSAR DNA-binding protein with unusual binding site recognition
Inoue et al. IκBγ, a 70 kd protein identical to the C-terminal half of p110 NF-κB: a new member of the IκB family
Ewel et al. Alternative DNA-protein interactions in variable-length internucleosomal regions associated with Drosophila Adh distal promoter expression
D'Avino et al. The moulting hormone ecdysone is able to recognize target elements composed of direct repeats
Paonessa et al. Purification of a NF1‐like DNA‐binding protein from rat liver and cloning of the corresponding cDNA.
Lai et al. Editing of glutamate receptor B subunit ion channel RNAs by four alternatively spliced DRADA2 double-stranded RNA adenosine deaminases
Angel et al. Oncogene jun encodes a sequence-specific trans-activator similar to AP-1
Superti‐Furga et al. The− 117 mutation in Greek HPFH affects the binding of three nuclear factors to the CCAAT region of the gamma‐globin gene.
Rosen et al. Isolation and characterization of the rat proenkephalin gene.
Means et al. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site
Hurst et al. Identification and functional characterisation of the cellular activating transcription factor 43 (ATF-43) protein
Bucci et al. Interaction cloning and characterization of the cDNA encoding the human prenylated rab acceptor (PRA1)
de Launoit et al. The transcription of the intercellular adhesion molecule-1 is regulated by Ets transcription factors
Kim et al. Physical characterization of the purified CCAAT transcription factor, alpha-CP1.
Cockell et al. Binding sites for hepatocyte nuclear factor 3β or 3γ and pancreas transcription factor 1 are required for efficient expression of the gene encoding pancreatic α-amylase
Zomerdijk et al. Antigenic variation in Trypanosoma brucei: a telomeric expression site for variant-specific surface glycoprotein genes with novel features
AU6131194A (en) Tata-binding protein associated factors, nucleic acids encoding tafs, and methods of use
Morgan Transcription factor Sp1 binds to and activates a human hsp70 gene promoter
Sumner et al. Expression of multiple classes of the nuclear factor-1 family in the developing human brain: differential expression of two classes of NF-1 genes
Tolnay et al. Heterogeneous nuclear ribonucleoprotein D0B is a sequence-specificDNA-binding protein
Grimes et al. Structural and functional analysis of the rat testis‐specific histone H1t gene
Ambrose et al. Locations of nucleosomes on the regulatory region of simian virus 40 chromatin
Leclercq et al. A novel germ-line J K transcript starting immediately upstream of J K 1

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE