WO1988010269A1

WO1988010269A1 - Growth factors

Info

Publication number: WO1988010269A1
Application number: PCT/AU1988/000191
Authority: WO
Inventors: Milton Thomas William Hearn; Joseph Bertolini; Mark Andrew Guthridge
Original assignee: Monash University
Priority date: 1987-06-18
Filing date: 1988-06-15
Publication date: 1988-12-29
Also published as: JPH03500529A; EP0364481A4; EP0364481A1

Abstract

A peptide analogue of mammalian heparin binding growth factor (HBGF-beta), wherein from 1 to 12 amino acids are absent from the amino terminal sequence. The following are also disclosed and claimed: methods of preparation and isolation of the analogues, including recombinant DNA and peptide synthesis techniques; compositions containing the analogues; antibodies, including monoclonal antibodies, to the analogues, and preparation thereof; and compositions containing the analogues or antibodies thereto, and applications of the analogues and antibodies, including clinical applications.

Description

GROWTH FACTORS This invention relates to mammalian growth factors and in particular to heparin-binding growth factors.

Background and Prior Art

The heparin-binding growth factors are polypeptide mitogens, found in brain, pituitary and other mesenchymal, neuroectodermal and epithelial derived tissues, which induce proliferation of cells in vitro and in vivo. These factors include basic fibroblast growth factor (FGF-1), acidic fibroblast growth factor, and transforming growth factors o and / . A number of these molecules have angiogenic activity, and this has been summarized in a review by Polkman and lagsbrun (Science 235 442-447, 1987).

Heparin binding growth f ctor-/. (HBGH- 2 ). a mesenchy ally directed growth factor with angiogenic properties, has been purified to homogeneity from tissue extracts or serum from several species (for example bovine, porcine, human, rat) . A form of heparin binding growth factor (HBGF-Λ 1) isolated from bovine brain has been shown to have an identical amino acid seguence to bovine fibroblast growth factor - A (FGF-Λ 1-146) so these two are now considered synonymous. The total amino acid seguence established for bHBGF-/5 1, beginning with thιe amino-terminal residue Pro is

Pro¹ Ala Leu Pro Glu 5 Asp Gly Gly Ser Gly 10

Ala Phe Pro Pro Gly 15 His Phe Lys Asp Pro 20

Lys Arg Leu Tyr Cys 25 Lys Asn Gly Gly Phe 30

Phe Leu Arg He His 35 Pro Asp Gly Arg Val 40 Asp Gly Val Arg Glu 45 Lys Ser Asp Pro His 50

He Lys Leu Gin Leu 55 Gin Ala Glu Glu Arg 60

Gly Val Val Ser He 65 Lys Gly Val Cys Ala 70

Asn Arg Tyr Leu Ala 75 Met Lys Glu Asp Gly 80

Arg Leu Leu Ala Ser 85 Lys Cys Val Thr Asp 90 Glu Cys Phe Phe Phe 95 Glu Arg Leu Glu Ser 100

Asn Asn Tyr Asn Thr 105 Tyr Arg Ser Arg Lys 110

Tyr Ser Ser Trp Tyr 115 Val Ala Leu Lys Arg 120

Thr Gly Gin Tyr Lys 125 Leu Gly Pro Lys Thr 130

Gly Pro Gly Gin Lys 135 Ala He Leu Phe Leu 140 Pro Met Ser Ala Lys 145 Ser 146

This amino acid seguence corresponds to the complete seguence for the mature 146 residue form of basic FGF-ϋ derived from bovine pituitary glands as described by Esch, F., et al Proc. Natl. Acad. Sci (USA) (1985) S2_ 6507-6511. The characterisation and biological properties of this HBGF-Λ form has been recently reviewed by Gospodarowicz, D. et al. Mol. Cell Endocr. (1986) 46 187-204 and Fiddes J.C. et al. Int. Patent Publ. WO 87/01728. Other growth factors with related biological activity but different primary structures to HBGF-A , including endothelial cell growth factor, tumor angiogenesis factor, and acidic fibroblast growth factors, 5 have been characterised (see for example, Lobb R.R. et al. Biochemistry (1984) 2 _, 6295-6299; Maciag T et al. Science (1984) 225, 932-935; Klagsbrun et al., Proc. Natl. Acad. Sci. USA (1985) 8_2 805-809; Bohlen P et al. EMBO J (1985) _4, 1951-1956; Gimenez-Gallego G. et al. Science (1985) 230, 10 1385-1388; Esch. P. Biochem. Biophys. Res. Comm. (1985) 133, 554-562; Thomas, K.A. et al; Proc Natl. Acad. Sci. USA (1984) 81, 357-361; US Patent No. 4,444,760). These other growth factors are known to exhibit different primary amino acid seguences to HBGF-/£ , are derived from different genes and 15 show different biological effects and potencies.

The mature HBGF- in impure form has been alleged to be effective in wound healing of tissue subjected to trauma (Davidson et. al. Journal of Cell Biology (1985) 100, 1219-1227; Thomas K.A. et al. op. cit.), including the 0 treatment of myocardial infarction (Svet-Moldavsky G et. al. Lancet 1977, 1913, US Patents 4296100, 4378347), in neuronal survival in fetal rat hippocampal neurons (Walicke, P., Proc. Natl. Acad Sci (USA) 1986) _83_, 3012-3016 Schubert D et al. , J.C.B. 1987, 104, 635-643) and in angiogenesis (D. Amore et 5 al., Ann Rev. Physcol 1987, £9_, 453-464, Folkman, Persp. Biol. Med. 1985, 2_9_, 11-33) .

During the course of our purification and characterisation studies other forms of HBGF->£ , hitherto not described, have been discovered. These new forms represent 0 novel, truncated analogues which are effective in stimulating cell proliferation and growth in a wide variety of cell types in a manner analogous to the complete protein.

We have now isolated and fully characterized new forms of one of the heparin-binding growth factors. A related 5 but different polypeptide has previously been described (Esch, P. et al. (1985) Proc. Natl. Acad. Sci., USA 82, 6507). The biological mechanism involved in the biosynthesis of these new polypeptide structures was, however, not evident in the earlier work. The polypeptide mitogens which we have isolated and fully characterized surprisingly represent new truncated variants not previously described. Although they can be considered as fragments of a larger form, the sites of fragmentation are not self-evident from any previously published work.

The polypeptide mitogens which we have isolated and characterized are biologically active, having the activity of HBGF- h in a variety of systems in vitro and in vivo, including their ability to promote angiogenesis. It is thus likely that these variant polypeptides may be general mesodermal cell/tissue growth factors arising from tissue-specific post translational processing, although other modes of expression and synthesis cannot be excluded. They are maximally active, depending on the in vitro cell culture assay system, between K 10 —12 and 10—16 mole.

Since these HBGF-Λ variants appear to exhibit a tissue specific processing capability which might underlie enhanced biological potency as an autocrine factor compared to exogenous components derived from other morphologically and physically distant sources, it is an object of the present invention to overcome, or at least alleviate, one or more difficulties related to the prior art and provide the opportunity to utilize these HBFG- Λ variants in specific and general biological applications.

In particular, it would be desirable to have available the tissue specific form of these HBGF-/J variants, or derivatives made by chemical or genetic manipulation, in adeguate guantities in a high degree of purity, and presented in a form compatible with use as a slow release therapeutic substance suitable for topical or internal modes of delivery. Summary of the Invention

According to one aspect of the invention there is provided a peptide analogue of a mammalian heparin-binding growth factor (HBGF-Λ) wherein from 1 to 12 amino acid residues are absent from the amino terminal seguence.

Preferably the polypeptide analogue is a human, bovine, porcine, sheep, horse or rat HBGF-6 analogue.

More preferably the polypeptide analogue has an amino terminal structure selected from: Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys

Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys

Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys

Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys

Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys

Arg Leu Tyr Cys

Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Try Cys

According to a second aspect of the invention there is provided a method of isolation of truncated forms of HBGF-Λ from a mammalian source comprising the steps of: subjecting a sample containing HBGF-5 truncated forms to ammonium sulphate fractionation, isolating and pooling fractions having HBGF-.0 activity, and subjecting the pooled fractions to seguential steps of cation exchange chromatography, triazine dye affinity chromatography or heparin affinity chromatography, and size exclusion chromatography, and optionally reversed phase chromatography. If both triazine dye and heparin affinity chromatography are used, preferably the triazine dye affinity chromatography step is immediately after the cation exchange chromatography step. Preferably the cation exchange chromatographic step involves a rigid, macroporous, monodisperse polymeric chromatographic support derivatised with carboxylmethyl or sulphonic acid groups, such as the Pharmacia Fast Flow S or Accell Ξ.

Preferably the triazine dye affinity chromatography involves either a single or a tandem affinity chromatographic system selected from the following: Procion triazine dyes Yellow MX4R, Yellow MX3R, Yellow MXGR, Yellow MX8G, Blue MXG, Blue MX4GD, Blue MX3G, Blue MX7RX, or Turquoise MXG, Brown

MX5BR, Red MX5B, Rubine MXB, or equivalent or similar triazine dyes obtained from ICI, Ciba Geigy and other manufacturers of such triazine dyes.

Preferably the heparin affinity chromatographic step involves heparin immobilised to carbonyldiimidazole (CDI) activated hydroxylic matrices such as Fractogel HW65, Trisacryl GW3000, Superose 12 or glycidylpropoxylsilicas available in various porosities and particle diameters. Preferably the reversed phase chromatography involves butyl -, octyl -, or octadecyl - groups chemically bonded to monodisperse non-porous or porous silica particles with particle sizes ranging from 0.7 - 60 μm with particle size distribution from +_ 1% to + 30%, depending on the sizing procedure used to sieve the silica particles. Preferably the source of truncated forms of HBGF-/. is selected from tissue ho ogenates, plasma, tissue or cell cultures, cell or tissue culture conditioned medium, and tumour cells.

According to a third aspect of the invention there is provided a method for the preparation of polypeptide analogues of mammalian HBGF-^ comprising transformation of a susceptible bacterial, yeast, baculovirus, insect or mammalian cell host with a DNA sequence capable of directing the expression of the truncated analogues of HBGF- A . The DNA sequences may be recombinant, synthetic, chromosomal fragments, cDNA or combinations thereof, and may be incorporated into a suitable cloning vehicle such as a plasmid. The inserted coding sequences may incorporate deletions or omissions to account for differences between the sequences of the truncated analogues (e.g. destetrapeptido-HBGF- A and related polypeptides) and the complete compound.

Furthermore, the polypeptide analogues may have an amino- or carboxy- terminal extension which includes a biological binding site which is recognised by heparin, heparan sulphate, chondroitin sulphate, or a binding or transport protein or substance involved in the chemical or biological recognition of HBGF-5 analogues in vivo or in vitro

Alternatively, the complete polypeptide chain of HBGF- A may be cleaved by appropriate aminopeptidases as part of the downstream processing or modification of natural or recombinant material to generate truncated variants in accordance with the present invention.

In a further aspect of the present invention there is provided a method for the preparation of a peptide analogue of mammalian HBGF-5 wherein from 1 to 12 amino acid residues are absent from the N-terminal, which method comprises the steps of

(a) providing a peptide analogue having an N-terminal structure of Pro-ala-leu-pro-glu-asp-gly- gly-ser-gly-ala-phe-pro-pro-gly-his-phe-lys-asp-pro- lys-arg-leu-tyr-cys- ... and

(b) subjecting the peptide analogue to one or more N-terminal amino acid cleavage steps.

The peptide analogues can be produced by appropriate modifications to conventional de novo or semi-synthetic methods based on solid-phase or solution peptide synthesis methods existing for the production of the intact HBGF- 5 peptide. These modifications would be readily apparant to those skilled in the art.

Specifically, despeptido HBGF-/*. may be synthesised chemically using procedures suitable for HBGF- but with the final 1 to 12 cycles of amino acid ligation omitted. Synthetic despeptido and related peptides specific for other mammalian species may be produced by techniques similar to those used for bovine HBGF- > using amino acid sequence information for these peptides.

According to a fourth aspect of the invention there is provided an antibody specific for the polypeptide analogues according to the invention.

According to a fifth aspect of the invention there is provided a method of immunoassay of heparin-binding growth factors comprising the step of using either the polypeptide analogues according to the invention or antibody specific thereto, coupled to a suitable marker.

According to a sixth aspect of the invention there are provided methods of diagnosis and treatment of disease in a mammal comprising the step of utilizing either the peptide analogues according to the invention or antibody specific thereto.

More specifically, the HBGF-/-S variants and related polypeptide analogues may be administered alone or together with a pharmaceutically acceptable diluent, carrier, or excipient suitable for the intended method and site of administration.

The dose rates and times for the administration of despeptido HBGF- may be set at levels proportionally less than for intact HBGF-. in accordance with the increased potency of the present invention. Dose rates of approximately 1 to 1000 micrograms/kilogram/day may be used. Dose rates of approximately 10 to 100 micrograms/kilogram/day are preferred.

In one preferred embodiment of this aspect of the invention there is provided a composition for enhancing the healing of an internal or external wound in a mammal in need of such treatment comprising a peptide analogue of HBGF-/S as defined above adsorbed on or entrapped in a physiologically compatible carrier material, whereby a therapeutically effective amount of the peptide is provided at the wound site. Preferably the carrier material is selected from a synthetic or natural organic polymer and chemically modified inorganic molecules. More preferably the carrier is cellulose or another polysaccharide. Preferably the amount of peptide is 1 to 1000 ^cg/Kg, more preferably 1 to 100 ^ιg/Kg body weight of the mammal.

According to a seventh aspect of the invention there is provided a cell or tissue culture medium comprising a polypeptide analogue according to the invention. Preferably the medium is a chemically-defined medium.

The number of deletions resulting in maximal activity is species-specific, and also to a certain extent tissue-specific. In rat the despentapeptide form is most active, whereas in bovine the destri- or destetrapeptides have greatest activity.

For example the compound bovine destripeptide HBGF-Λ having the formula of bovine fibroblast-growth factor (FGF-1) as described by Esch et al. (1985), but lacking the amino acid residues Pro-Ala-Leu from the N-terminal region, is effective in promoting cell proliferation, and in stimulating both protein synthesis and DNA synthesis in cellular systems at concentrations between 10 and 50-fold lower than required for the entire bovine HBGF-Λ .

Similarly, other variant forms of HBGF- . hitherto not previously described or characterised from tissue extracts from bovine, human, porcine and rat sources, representing truncated destripeptide to desdodecapeptide structures related to the corresponding HBGF-^ from other species, also show enhanced potencies in in vitro and in vivo cellular assays involving de novo protein and DNA synthesis.

The sites of truncation are not predictable from the amino acid sequence of entire bovine HBGF- β .

The invention will now be described in detail by way of reference to the following non-limiting examples and to the figures, in which: Brief Description of the Figures

Figure 1 shows elution profiles of tissue homogenates chromatographed on CM-Sephadex G50;

Figure 2 shows elution profiles of partially-purified HBGF- despeptides from different sources on.heparin-Sepharose;

3 Figure 3 shows uptake of [ H]-thymidine by

(a) ovine ovarian granulosa cells and mouse 3T3 fibroblasts in response to bovine HBGF-. destripeptide, and (b) mouse 3T3 fibroblasts,

(c) bovine lung endothelial cells, and

(d) bovine ovarian granulosa cells in response to bovine HBGF- /> destetrapeptide;

Figure 4 shows results of titration of rabbit antiserum to bovine HBGF-. destripeptide using the radioimmunoassay according to the invention; and Figure 5 shows the displacement of

1.5 I-destetrapeptido HBGF-/S from antibody by purified HBGF-/. from bovine brain (a), pig brain (b) and bovine lung, rat brain, and rat chondrosarcoma (c);

Figure 6 shows the levels of destetrapeptido HBGF-/*> detected by radioimmunoassay (a) in extracts of bovine lung and ovine pituitary and (b) in rat serum and extracts of rat brain and pituitary; Figure 7 shows the effect of various hormones and growth factors on the destetrapeptido HBGF-5 content of cultured bovine ovarian theca cells;

(a) Effect of luteinising hormone (LH) ;

(b) Effect of luteinising hormone (LH), epidermal growth factor (EGF), insulin-like growth factor I (IGF-I) and transforming growth factor -f> (TGF-S ) ; and

Figure 8 shows the effect of destetrapeptido HBGF-A on progesterone production by cultured bovine ovarian granulosa cells. Description of the Invention

We have found that the heparin-binding growth factor (HBGF- f> ) isolated from various mammalian tissues exhibits considerable N-terminal amino acid sequence heterogeneity. Several lines of evidence suggest that tissue-specific post-tranεlational processing in each tissue represents an important mechanism for the specific production of a unique form of HBGF-/. which manifests optimal biological activity with the adjacent cell bodies, i.e. functions dominantly as an autocrine factor such that truncation represents a unique biological mechanism to permit and discriminate specific proliferative response activity from a generalised cell mitogenic response. The evidence for this conclusion is based on the following observations: (1) the abundance of a specific truncated form is characteristic of the tissue type from which it is isolated;

(2) truncated forms can be isolated from tissue extracts when protease inhibitors are present in high concentration throughout the purification;

(3) the site(s) of cleavage for truncation are not those normally associated with currently-recognised proteolytic enzymes found in mammalian cell extracts, whether or not the extracts are contaminated with microorganisms; and

(4) specific activity (potency) differences of the truncated forms are found with maximal response activity parallelling the cell/tissue source.

Because of their greater abundance, we have focused on the bovine and porcine HBGF- . truncated variants, and in particular the destripeptido and destetrapeptido-HBGF-/ s. However, it will be clearly understood that these forms are illustrative only, and that the invention is not limited thereto.

We have carried out experiments relating to: (i) the purification of the destripeptide/destetrapeptide, despentapeptide and other despeptido forms lacking up to twelve amino acid residues from the N-terminal position of HGBF-Λ from bovine, rat, and pig brain, pituitary, lung, ovary, plasma, and corpus luteum (designated bHBGF-/. , rHBGF-/i , and pHBGF-/ respectively) and from human- plasma (designated hHBGF-$ ) ;

(ii) the characterisation of the amino acid sequences of these variants; (iii) the chemical synthesis of polypeptide analogues related to these HBGF-/4 variants,

(iv) the production of polyclonal antibodies to these HBGF-/. variants and the use of these polyclonal antibodies in establishing a diagnostic procedure for monitoring the biological function and concentration of these factors; and

(v) the utilization of the polypeptide analogues to enhance the proliferation, growth and mobilisation of fibroblast, endothelial, granulosa and other mesenchymal, neuroectodermal and epithelial cells in vitro and to enhance endothelial cell outgrowth in vivo as an angiogenic or neovascularisation factor.

Example 1 Purification of despeptido analogues from tissue Isolation of destripeptide HBGF-_ destetrapeptide HBGF- ? , despentapeptide HBGF-. and other despeptido forms of HBGF-5 has been achieved from bovine, pig and rat brain, lung, pituitary, ovary, corpus luteum and plasma, and from human plasma and a rat chondrosarcoma tumour cell line.

These polypeptides were purified to homogeneity from tissue homogenates or plasma in the presence of protease inhibitors (ImM disodium ethylenediamine-tetraacetate (EDTA) , 2mM phenylmethylsulphonylfluoride, 2.5 mg/1 leupeptin, 2.5 mg/1 pepstatin, and 2.5-5.0 mg/1 benzamidine) by solubilisation at pH 3.5-4.5 with phosphate buffer (O.lM NaH_PO. containing O.lM NaCl) and partially fractionated using ammonium sulphate fractionation (1-4.IM), followed by sequential use of cation exchange chromatography, heparin affinity chromatography and size exclusion chromatography.

Addition of a further step of triazine dye affinity chromatography immediately after the cation exchange step enhances the resolution of the heparin affinity step, and has the further advantage of prolonging the life of the affinity columns.

Triazine dye affinity chromatography and heparin affinity chromatography may be used as alternatives. For large scale purification triazine dye columns are cheaper, and are preferred for this reason. A reversed phase chromatography step may optionally be used for final purification.

This purification procedure was used for samples from all the species studied, and appears to be generally applicable. Purification was monitored by testing fractions

3 for ability to stimulate [ H] thymidine uptake by mouse 3T3 fibroblasts. Active fractions were further tested using ovarian granulosa cells and aortic endothelial cells (see below) .

Chromato^graphy media found to be suitable for the purification procedure are summarized in Table 1. Other suitable media will be apparent to the person skilled in the art .

Table 1

Typical conditions ^'

Separation method Medium Column Bed volume (ml)

Cation exchange CM-Sephadex G50 K50/30 500 Mono-S HR5/5, HR16/5 1, 10 Fast-Flow S K50/30 500

Triazine Dye Cibacron F3G-A K16/20 20-100

Procion Red He3B/) K16/100

He7B series ) Procion Mx5B ) series )

Heparin Affinity Heparin-Sepharose K16/20 20-200

Size exclusion Sephadex G-100 ) K26/70 295-4000

Sephadex G-75 )

Typical elution profiles of tissue homogenates on CM-Sephadex G-50 and heparin-Sepharose are shown in Figures 1 and 2. The bar indicates fractions with HBGF activity.

Elution from the cation exchange column may be performed stepwise or using a gradient, depending upon the sample.

Samples varied considerably with respect to their content of haemoglobin, lipid, and tissue debris, which affected the choice of conditions .

On the heparin-Sepharose columns, there was no apparent correlation between HBGF activity as assessed by stimulation of [ Hj-thymidine uptake by 3T3 fibroblasts (upper panel in Figs. 2b, c) and protein content as assessed by absorbance at 280 nm (lower panel). Example 2 Characterisation

The purified truncated forms of HBGF-A have been further characterised by:

(i) sodium dodecylsulphate-polyacryla ide gel electrophoresis (SDS-PAGE) under native and reducing conditions; isolated bands were used for:

(ii) electrotransfer and immunoblot procedures using cellulose nitrate or Zeta-probe membranes and specific polyclonal antisera, (iii) amino acid compositional analysis;

(iv) determination of apparent molecular weight by size exclusion chromatography; and

(v) N-terminal sequencing of the intact despeptido-HBGF-/. s and sequencing of peptide fragments derived from reduction, alkylation and enzymatic digestion of the despeptido - HBGF-τ5s.

Typical results of SDS-PAGE analysis, in which conventional molecular weight standards of 14,3000 to 68000 kD were used, indicated that the truncated forms of HBGF-X had molecular weight in the range 17,000 to 18,000.

For amino acid composition and amino terminal sequence analysis, purified HBGF- fractions were pooled and desalted using Centricon-10 microconcentrators. For amino and composition, the samples were evaporated to dryness or precipitated with 4 volumes of AR grade methanol followed by centrifugation, resuspended in methanol and transferred to an hydrolysis tube. The samples were hydrolysed at 110°C with 5M hydrochloric acid containing 1.25 nmol or norleucine standard and 0.1% phenol for 24 hours. Amino acid analysis was performed on a Durrum D-500 or Waters Pico-Tag amino acid analyser system. Amino terminal sequence and internal sequence determination of enzymatic digested HBGF-/5 fragments were performed with an Applied Biosystems Model 470A sequencer. The phenylthiohydantoin (PTH) derivatives of the amino acids were analysed by reversed phase HPLC using modifications of the method of Zimmerman CL. et. al. Meth Enzym (1977) 1_, 45-51. Results of the amino acid composition analysis of the HBGF-J fragments in terms of moles of individual amino acid per mole of HBGF- were completely consistent with the amino acid composition values deduced from the amino acid sequence determinations.

Example 3 Biological Activities

(i) Cultured cells and isolated tissue.

Monolayer cultures of Balb/c 3T3 mouse fibroblasts, bovine and ovine granulosa cells, and bovine endothelial cells were dispersed with porcine trypsin 2 (E.C.3.4.4.4) , grown in

Dulbecco's minimum essential medium (DMEM) containing 5% fetal calf serum (FCS) at 37° in 5% C0_ in oxygen for 2 days. The cells were recovered by replacing the culture medium with saline EDTA-phosphate buffer pH7.2 (Flow Labs) containing 0.0025% pronase, washed and suspended in DMEM containing 3%

3 FCS and subcultured at 3x10 cells/10Oul. Five hours prior to assay the culture medium was replaced with serum-free medium containing [ H] - thymidine and the cells cultured for 2 days with various treatments. At the end of the treatment period, the cells were disrupted with 1% SDS and the mitogenic activity determined from the incorporation of [ H]-thymidine into DNA. Similar protocols have been employed for

[ 35S]-methionine and [14C]-leucine incorporation into trichloroacetic acid- precipitable protein material. Bovine aortic arch endothelial cells were seeded in

RPMI 1640 tissue culture medium containing 5% fetal calf serum at a concentration of 1.5 x 10 cells/ml. After culture for

24h at 37 C, aliquots of the isolated growth factors, tissue extracts and controls were added to the cells. Cell proliferation was quantified daily for serially diluted samples using an electronic cell counter (Coulter Electronics, Inc. ) .

The bovine lung endothelial cell culture protocol was based on modifications of the Ryan and White procedure (Tissue Culture Methods 3-0(1), 9-13, 1986) using the Jacobson and Ryan microcarriers (Tissue and Cell, 14, 69-83, 1982). Cell proliferation activity and endogenous activity with the myoblast L6 cell line, and collagenase dispersed rat hepatocyte, chrondrocyte and chrondrosarcoma cells were measured using the following procedures: Culture of the myoblast L6 cell line was carried out in enriched Dulbecco's minimal essential medium (DMEM) supplemented with 3.6g glucose, 4.Og Hepes, 3.7g sodium bicarbonate, 200 mg glutamine, 10000U penicillin, lOOOOug streptomycin and 250 ug amphotericin B/ml per litre of medium. Confluent cells were subcultured after 5-7 days, washed twice with phosphate buffered saline (PBS) and trypsinised for 3 min., then immediately diluted with DMEM and aliquoted to calO cells/ml prior to assay. Similar culture procedures were utilised for the hepatocyte and other cell lines. Culture of the rat chondrocyte culture involved the following procedures. The sternum and costal ribs were removed from rats under sterile conditions. After removing adhering connective tissue, the sternum and ribs were minced and digested in 10 ml 0.25% (w/v) trypsin in Ham's F12 medium for 30 min. at 37°C. The supernatant was carefully aspirated, and 10 ml of 0.2% (w/v) collagenase in Ham's F12 was added to the remaining cartilage segments. Digestion was continued for 1 hr at 37°C, then the supernatant containing the liberated chondrocytes was removed. The cells were pelleted by centrifugation, resuspended and grown in Ham's F12 containing 10% FCS.

Representative data on the in vitro proliferation and DNA synthesis in the 3T3-fibroblast cell line, in bovine lung endothelial cells and bovine granulosa cells from small and large follicles are shown in Figure 3. Equivalent results to those shown in Figures 3b-d were obtained with bovine HBGF-ά destripeptide.

Example 4 Production of Polyclonal Antisera against Despeptido-HBGF-A - Adult female and male New Zealand white rabbits were immunised with the destripeptide HBGF-A .... desdodecapeptide HBGF- emulsified in Marcol 52-Montanide 888 (9:1 v/v) by intramuscular or subcutaneous administration. The despeptide was given alone, or coupled to ovalbumin or keyhole limpet haemocyanin by conventional methods. Polypeptide coupling to carrier proteins for immunisation used the bifunctional reagent 6-maleimidocapronic - acyl - N-hydroxysuccinimide ester essentially as described by Stevens, V.C. et al. Immunol Letts. (1986) 12, 11-18. Following emulsification with adjuvant containing trehalose dimycolate and mono hosphoryl lipid A the mixture was injected three times intra-muscularly at a dose of 0.5 mg conjugate per immunisation. Subsequent immunisations involved between 0.1 - 0.5 mg conjugate per immunisation. Subsequent booster immunizations were given at 3 week intervals. Sera were examined for their ability to bind radioiodinated factors incubated in lOmM phosphate, 150 mM NaCl, lOmM EDTA, 0.1% serum albumin pH 7.2, using double antibody techniques. It was found that coupling to a protein carrier was necessary to obtain a significant antibody titre.

Antibodies against the carrier proteins were removed from the recovered antisera by adsorption with the specific carrier protein.

Example 5 Radioimmunoassay of HBGF-3

A specific radioimmunoassay utilizing heparin-Sepharose purified bovine pituitary destripeptide HBGF-,_. or destetrapeptide HBGF-S as standard and purified iodinated bovine pituitary FGF as tracer was developed and characterized. The assay used polyclonal antibodies prepared as in Example 4. It will be appreciated that the use of monoclonal antibodies prepared by methods well-known in the art, and other well-known types of immunoassay such as enzyme-linked immunoassay (ELISA) and fluorescent immunoassay, are within the scope of the invention. Tracer was labelled with 125I by the lactoperoxidase method (Thorell, J.I. and B.F. Johansson [1971]: Biochim. Biophys. Acta 251 ;63). The tracer was used at approximately

10,000 cpm/lOO l in buffer containing lOmM NaH-PO. - lOmM EDTA - 150mM NaCl-0.2% Triton X-100 - 0.1% human serum albumin, pH7.4. Samples and standards were dissolved in buffer containing lOmM NaH-P0₄ - lOmM EDTA - 150mM NaCl - 0.1% human serum albumin, pH7.4 (assay buffer). For the assay, 200 pi assay buffer, 100 jul standard, sample or control, 100 μl tracer and 100 jul anti-HBGF-i. antibody (1:1000 in assay buffer containing 1:700 normal rabbit serum) were mixed and incubated for 2 days at 4°C, followed by addition of 1 ml polyethylene glycol 600 (4% in 0.9% NaCl) and incubation for a further 30 minutes at 4°C. The samples were then centrifuged, the supernatants were discarded, and the radioactivity in the precipitates was counted in a gamma counter.

Results of a typical assay are shown in Figure 4. The tracer was 125I-bHBGF-4 destripeptide, and the antiserum was directed against bHBGF-/i destripeptide. A final dilution of antiserum of 1:5000 resulted in 36% binding. Scatchard and logit plots derived from antiserum binding curves were linear, indicating that the antiserum was monospecific.

Example 5 Detection of Despeptido HBGF-. in Tissues

The radioimmunoassay has been used to determine the abundance of related truncated forms of HBGF-/3 in a variety of samples, including a) tissue homogenates - bovine ovarian theca rat brain, pituitary ovine pituitary

b) purified tissue extracts

- bovine brain, pituitary, lung, porcine brain, rat brain, chondrosarcoma c) serum - bovine, ovine, human, rat

d) conditioned cell culture medium

- bovine ovarian theca cells rat pituitary cells Results for displacement of 125I-destetrapeptido

HBGF-A from antibody by bovine, pig and rat brain, brain lung and rat chondrosarcoma are shown in Figure 5.

It is of particular interest that the assay could detect HBGF-/_ in extracts of rat chondrosarcoma, a tumour cell line.

Example 6 Role of Despeptido HBGF-4 in Ovarian Function

Data confirming the importance of these factors in folliculogenesis, blastocyst development, blastocyst implantation and placental vascularisation were obtained from studies on the role of the HBGF-5 variants in the ovary. The autocrine mechanism of action for these factors was further documented from studies with

(1) bovine ovarian theca and

(2) ovarian granulosa cells in culture, which demonstrated that the factors are not secreted into conditioned medium but are found as cell contents. With theca cells from large follicles, the content was 2.5 times that found with theca cells derived from small follicles; this is consistent with the anticipated role for follicular development and maturation prior to the luteal phase (Figure 7a). In addition, a ca.l.5X effect on the synthesis of the theca factor was induced by luteinising hormone (LH) either alone or in synergy with other growth factors (EGF, IGF-1 or TGF-/5 ) . (Figures 7a, 7b). The intraovarian regulatory role of the specific

HBGF-/S form was documented through the down-regulation of response when exogenous stimulation of the granulosa cells in culture was carried out with the factor at higher concentrations (Figure 8). Progesterone production by granulosa cells was significantly decreased by doses of destetrapeptido HBGF- ) greater than 100 pg per ml culture. This effect was observed at 2, 4 and 6 days of culture.

Example 7 Effect of Despeptido HBGF-j on Angiogenesis The functional sequelae of the angiogenic role of these HBGF-/5 polypeptides are being assessed by determination of their dose dependent effect on

(1) tissue plasminogen (tPA) activator activity in endothelial and granulosa cell lysates using a human plasminogen/streptokinase/S2251 chromogenic substrate system with activity monitored from absorbance changes at 405nm against a tPA standard from human melanoma cell line.

(2) endothelial cell chemotaxis using the methods of Boyden (J. Exp. Med. , 115, 4530463 1962 and Banda et. al. (Proc. Natl Acad. Sci. 19_. 1113 -1111 1982).

The data demonstrated that the truncated HBGF-/5 polypeptides had maximal activity at about 0.1 fM (i.e. ED-.-, of about 20 pg/ml culture fluid) in these angiogenesis assays.

Example 8 Adsorption to carriers for local administration In view of the propensity of the HBGF-A variants to bind strongly to heparin and other sulphated support carriers such as heparansulphate proteoglycans and SP-cellulose, SP-agarose, or SP-derivatised polymethacrylate copolymers etc., which was the basis of the purification route used in the isolation of the HBGF- A variants, a procedure for the immobilisation of these factors on to derivatised carrier particles, membranes or sheets for topical use in wound dressings has been developed. The procedure is based on coupling heparin or heparansulphate proteoglycans to preactivated cellulose and adsorptively binding the factor(s) at a subsequent step. The preferred method of preactivation involves the use of carbonyldiimidazole (Hearn, Meth. Enzym, 1987, 135, 102-131). The rat implant system based on the Schilling Hunt polyvinylsponge insert impregnated with exogenous factor(s) or control substances was used to establish assessment with external wounds. Additional endogenous factor activity was found in wound fluid as well as follicular fluid, with a 2.5 fold increase in growth rate of stomatised cells mediated by these factors being observed. The HBGF-/S variants are batch adsorbed to heparin derivatised polymers prepared for example from -.-aminocaproyl derivatised cellulose, agarose, jj-glycidoxyl propylsilica, hydromethylated polymethacrylate, derivatised polyvinylalcohol (Fractogels) of tris-acrylamide copolymers (Trisacryl) essentially according to the methods of Finlay et al Anal Biochem., 109 (1980) 354; Schutyser et al Affinity Chromatography and Related Techniques (T.C. Gribnan, J. Visser and R.J.F. Nivard eds) Elsevier Sci Publ. 1982, pp 1433-153; P. Cuatrecasas J. Biol. Chem., 245 (1975) 3059 and M. Hearn, Meth. Enzymol. 135 (1987) 102. Conditions for batch absorption involved isotonic PBS, pH7.4, with or without serum albumin as carrier. Typical absorption capacities were InM/g of carrier, although significantly higher values i.e. luM-lOpM/g are potentially achievable due to the ligand density of the carrier. Up to 15-20 μmole/gm of carrier can be applied to the support system. Under isotonic conditions the HBGF-Λ despeptides thus applied to a carrier are suitable for use as a slow release system for stimulation of angiogenesis and wound healing.

Example 8 Alternative methods for detection of despeptido

HBGF- A in tissues and extracts. Experimental protocols utilising Western, Southern and Northern blot analysis, oligonucleotide probe hybridisation with polyadenylated mRNA specific for the EBGΕ- 6 structure, 5'-labelling using T. polynucleotide kinase/- 32P-ATP or 3*-labelling using phosphonucleotidyltransferase/ - 35S-ATP, and in situ hybridisation with cell or tissue sample sections can be used to monitor and quantify the presence of the HBGF- variants in various tissues from different mammalian species. For example, the oligonucleotide probe with the sequence such as CGGTTTGCACACACTCC, GACACAACCCCTCTCTCTTCTGCTTG and CTAGTAATCTTCCATCTTCTTTCATAG, when 3'- labelled with phosphonucleotidyltransferase and S-ATP to a high specific activity, permits the detection and quantitation of mRNA levels corresponding to the HBGF-/S in both normal and transformed cells such as chondrocytes, chondrosarcomas, hepatoma and colorectal carcinoma specimens, using in situ hybridisation technigues, dot blot methods or agarose gel probe procedures. HBGF- f> despeptides have been found in hepatoma and in colorectal carcinoma specimens by these methods.

Example 9 Synthesis of oligonucleotides

Oligonucleotide probes corresponding to HBGF-Λ were synthesized on the Model 380A DNA synthesizer (Applied Biosystems Inc.) using phosphoramidite chemistry and purified on a Dupont Zorbax Bio Series Oligo column (8 cm x 6.2 mm) followed by desalting on a G-25 column (2.8 cm x 9 mm).

Oligonucleotides were either 5' end labelled using T. polynucleotide kinase and 32P-ATP or 3' end labelled using phosphonucleotidyl transferase and 35S-ATP. All probes had final specific activities of 5 x 10 8 - 8 x 109 dpm/ug.

Example 10 In Situ Hydridization

Microscope slides were baked, coated with poly-L-lysine, treated with 0.1% diethyl pyrocarbonate and allowed to air dry. Mono dispersed cells in culture medium were spun onto slides using a Cytospin (10 - 3x10 cells/slide) . Transverse 5-10um sections were cut from OCT embedded tissue on a cryostat at -20°C and mounted on microscope slides. Both cells and tissue slices were left on dry-ice blocks for 20 min. and then fixed for 10 min. in 4% glut raldehyde, lOOmM Na N- P0. , 20% ethylene glycol pH 7.3. After fixation some slides were incubated at 37 C for 1 hour with either ribonuclease (25ng/ml in Tris HCl 15mM, EDTA 1 mM, NaCl 50mM pH 7.5) or Proteinase K (lng/ml in 20mM Tris HCl, 2mM CaCl- pH 7.4). Slides were then placed in hybridization buffer containing 5 x SSC (1 x SSC = 0.15MNaCl, 0.015M a₃ citrate), 50mM NaH_P0₄, 0.2% BSA, 0.2% polyvinylpyrrolidone, 0.2% Ficoll, 0.2% denatured herring sperm DNA, 0.4% denatured yeast + RNA, 50% formamide and lOmM f_> -mereaptoethanol was included if S-ATP labelled digonucleotides were to be used, for 20 min. at 20°C, 20 min. at 37°C and 60 min. at 37°. Twenty μl of labelled probe (250000-500000 dpm) in hybridization buffer was applied to each slide and allowed to hybridize in a humidified container at 37°C for 24 hours. Slides were then washed in 4 x SSC for 10 min, 2 x SSC for 10 min, 1 x SSC for 30 min, all with lOmM β -mercaptoethanol, and finally ethanol for 5 min. Air-dried slides were dipped in G5 nuclear tra.ck emulsion and exposed at -70°C in light proof boxes for 1-4 weeks, then developed in Kodak D19 for 5 min, rinsed in 1% acetic acid for 1 min. fixed in 25% sodium thiosulphate for 3 min. and repeatedly washed in tap water. The slides were air dried, stained with haematoxylin and eosin, and mounted.

Using this method, HBGF-/4 was detected in rat chondrocytes, rat chondrosarcoma, bovine aortic and lung endothelial cells, and rat ganglion neurons, and in human hepatoma and colorectal carcinoma.

Example 11 Synthesis of despeptido HBGF-/.

Synthetic peptides corresponding to the internal sequence of the destetrapeptido-HBGF-/i have been synthesised by solid phase methods on the benzhydrylamine/divinylbenzene resin. The synthesis of the peptide Leu Arg He His Pro Asp Gly Arg Val Asp Gly is representative of the methods.

Modifications of the Merrifield solid phase peptide synthesis procedure (Merrifield R.D. et al. J. Amer. Chem. Soc. , 1963, j$5_; 2139-2145) were used. Peptides were synthesised initially in the alpha/straight chain form with all amino acid side chain group protected. For the tBOC synthetic approach, the _; -amino functionality of the incoming amino acid was protected with the tertbutyloxycarbonyl (tBOC) group with deprotection following coupling with trifluoroacetic acid in dichloromethane. A similar synthetic strategy using the Fmoc (9-fluorenylmethylcarbonyl group) protection is also suitable. The initial coupling to the benzhydramine resin employed a 3-fold excess of the designated side chain protected amino acid dissolved in N, N'- dimethyl-formamide (DMF) . Subsequent couplings employed a two-fold excess of side chain protected amino acid in DMF. The amino acids were sequentially activated using tert-butanol and dicyclohexylcarbodiimide in DMF and allowing the reactants to stir at room temperature for 5-10 min. The acylurea was removed by filtration and the asymmetric anhydride added to the resin. The suspended resin was stirred for the reaction time of 120 min. at room temperature. Each coupling was monitored for unreacted amino groups with 2, 4, 6-trinitrobenzenesulphonic acid. Similar strategies with the symmetrical protected amino acid anhydrides or the pentachlorophenylesters led to preparations of identical products. After the final coupling was completed, the fully protected resin bound peptide was deprotected with trifluoroacetic acid and the deprotected peptide cleaved from the resin using liquid hydrogen fluoride as the acid and dimethylsulphide/p-cresol or thioanisole as the scavenger or other cleavage methods familiar to experienced workers in peptide synthesis. The deprotected cleaved peptide was removed from the resin by washing with trifluoroacetic and, then water, then water/acetonitrile (1:1) mixtures. Washings were combined and lyophilised. The crude product was chromatographed by anion exchange on Whatman DE52 and then desalted on Biogel P2 gels. Further purification was achieved using reversed phase HPLC with octadecylsilica as stationary phase (or other n-alkylsilica) and aguo-organic solvent gradients such as 0-75% water-acetonitrile -0.1% trifluoracetic acid or 0-75% water-acetonitrile-lOOmM ammonium bicarbonate as the mobile phase. Synthetic peptides were characterised by amino acid compositional analysis, analytical reversed phase HPLC with several elution systems, fast atom bombardment - mass spectroscopy (FAB-MS), FTIR-infrared spectroscopy, and paper electrophoresis. Peptides were conjugated to carrier proteins for use as antigens, as described above, for production of polyclonal and monoclonal antibodies.

Results

The data show that:

(a) several hitherto unknown forms of HBGF- have been purified to homogeneity and the primary seguence structures confirmed; (b) Addition of these despeptido-forms to fibroblast cell in vitro assay systems resulted in dose-dependent increases in cell growth and proliferation which were 10-to 50-fold more potent than the bovine fibroblast growth factor-1 whose structure is as reported by Esch et al. (1985) .

(c) Addition of these despeptido-forms to granulosa and endothelial cell in vitro assay systems resulted in dose-dependent increases in protein and DNA production and in cell growth and numbers, with corresponding dose-dependent effect on cell enzymatic parameters such as aromatase and procollagenase activities;

(d) The actions of these despeptido HBGFs are distinct from those of other growth factors such as epidermal growth factor (EGF), platelet-derived growth factor (PDGF) , transforming growth factors K or ^ (TGF- <*. or - ) or fibroblast growth factor - « (FGF-.-X) , which show different time-course profiles for cell proliferation and different molar responsiveness for maximal stimulation.

(e) Specific radioimmunoassays based on these despeptido - HBGF -As show that selective tissue-specific processing of these factors occurs, consistent with these analogues exhibiting unique biological actions with respect to potency, tissue specificity, and ability to promote both autocrine cell stimulation and paracrine-induced tissue growth, including the intrusion of neovascular bodies involving endothelial cell capillarisation. Potential Applications of the Invention

Because of their very potent mitogenic activity for small capillary endothelial cells in vitro and their ability to induce neovascularisaton in vivo, the heparin-binding growth factors probably represent a key class of growth factors in wound healing and in maintenance of normal and pathological vascularisation of tissue, including corneal cells, smooth muscles and glial cells. In view of the broad spectrum of mitogenic activity exhibited by the heparin-binding growth factors it is likely that they stimulate and co-ordinate mitogenesis of multiple cell types via an autocrine/paracrine mechanism during normal cellular growth and tissue repair or during growth of transformed cells such as tumour cells. We have also detected heparin-binding growth factor-like activity in solid tumors. The use of peptidic antagonists of HBGF-/S or alternatively immunosuppression of HBGF-. thus has potential to either arrest or reverse the growth of solid tumors, many of which are not responsive to surgery, chemotherapy or radiotherapy. (a) Inasmuch as increased and sustained cell growth, DNA polymerase activity and de novo DNA and protein biosynthesis are all indices of proliferation and outgrowth of mesodermal cells such as endothelial cells in lung or small capillaries, or granulosa cells in ovarian follicles, and insofar as such functions are indices of neovascularisation or angiogenesis and follicular growth, the presence of the despeptido-HBGF-/3s promotes folliculogenesis and neovascularisation of placental tissue, and may be involved in blastocyst implantation. (b) Inasmuch as continued and increased endothelial cell activity is an index of angiogenesis in vivo, and insofar as the biological properties of the despeptide - HBGF-,. s induce a dose-dependent increase in such activity, these factors are angiogenic factors, and would be useful to promote vascularization and wound healing. (c) Inasmuch as continued and increased epidermal/epithelial cell activity is an index of tissue repair and wound healing, and insofar as the biological properties of these despeptido HBGF-Λs promote a dose-dependent increase in such activity, these despeptido HBGF-Λs are capable of promoting tissue repair and wound healing.

(d) Inasmuch as decreased vascularisation and withdrawal of the blood supply from tumours is known to impede the growth, or lead to regression, of solid neoplasms, the use of antibodies to these factors, either as a locally-administered bolus or as an immobilised, cross-linked antibody depot will promote a decrease in vascularisation. This would have application in the control of growth of solid tumours such as chondrosarcomas, hepatomas, colorectal carcinomas and ovarian tumours, many of which are not responsive to surgery, chemotherapy or radiotherapy. Other potential applications include inhibition of vasculogenesis in order to prevent conditions such as diabetic retinopathy and retrolental fibroplasia.

(e) Despeptide HBGF-/S may be involved in the control of neuronal growth in central and peripheral nervous tissue, and in regulation of differentiation of specialised tissues such as muscle. (f) By analogy, use of synthetic peptides related to these despeptido-HBGF-5s is likely to enhance cell proliferation and growth and so provide methods for selective tissue repair, regeneration or proliferation.

(g) By analogy, antisera to synthetic peptides related to these despeptido-HBGF-_ s are likely to inhibit cell proliferation and growth and so provide methods for -inhibiting vascularisation, with potential uses as in (d) above.

Comparison of structure of HBGF-,. isolated from different species shows that the amino acid seguence is strongly conserved, with differences in only one or two amino acids. These differences are probably the result of single nucleotide changes. Because of the sites of these changes, the bovine and human despeptido HBGF-/6 show differences only at residues 112 and 128. Similarly in sheep, at residue 10 gly is replaced by ser. This suggests that bovine HBGF-/5 analogues may not be immunogenic in humans, and that sheep HBGF-^ analogues will either be slightly immunogenic or will have different potency from the human peptide. A high degree of cross-species activity would in general be predicted. This is confirmed through the ability of oligonucleotide probes constructed from the amino acid sequence of one species form of the HBGF-Λ variants to hybridise with the corresponding mRNA or DNA isolated from the tissues of other species.

Although we have found that there is some degree of tissue specificity as regards endogenous truncated forms of HBGF-i , it appears that this does not affect the activity of exogenously administered despeptide HBGF- J other than in relation to potency at a given site. The significance of the endogenous specificity probably lies in the resulting ability to mount a localized response to a stimulus such as trauma. There may also be a functional amplication, for example by a further processing step in situ.

It will be clearly understood that the invention in its general aspects is not limited to the specific details referred to hereinabove.

The following words used hereinabove are Trade Marks: Accell, Biogel, Centricon, Cibacron, Cytospin, Fast-Flow S, Fractogel, Mono S, Pico-Tag, Sephadex, Sepharose, Superose, Marcol, Montanide, Trisacryl, Zeta-probe, Zorbax.

Claims

CLAIMS :

1. A peptide analogue of mammalian heparin-binding growth factor (HBGF-Λ ) wherein from 1 to 12 amino acids are absent from the amino terminal sequence.

2. A peptide analogue according to Claim 1 which is an analogue of human, bovine, porcine, ovine, equine or rat HBGF-^ .

3. A peptide analogue according to Claim 1 or Claim 2 in which the amino terminal structure is selected from

(a) Ala Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys ,

(b) Leu Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys ,

(c) Pro Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys ,

(d) Glu Asp Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys ,

(e) Gly Gly Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys ,

(f) Ser Gly Ala Phe Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Tyr Cys ,

(g) Pro Pro Gly His Phe Lys Asp Pro Lys Arg Leu Try Cys

4. A peptide analogue according to Claim 1, Claim 2 or Claim 3 in biologically pure form.

5. A method of isolation of truncated forms of HBGF-JØ from a mammalian source comprising the steps of: subjecting a sample containing HBGF-/. truncated forms to ammonium sulphate fractionation, isolating and pooling fractions having HBGF-/i activity, and subjecting the pooled fractions to sequential steps of

(i) cation exchange chromatography,

(ii) triazine dye affinity chromatography or heparin affinity chromatography, and

(iii) size exclusion chromatography.

6. A method according to Claim 5, in which a triazine dye affinity chromatography step precedes a heparin affinity chromatography step.

7. A method according to Claim 6 which additionally incorporates a reversed phase chromatography step.

8. A method according to Claim 5, Claim 6 or Claim 7 in which the source of truncated forms of HBGF-/5 is selected from tissue homogenates, plasma, tissue or cell cultures, cell or tissue conditioned medium, and tumour cells.

9. A method of preparation of a peptide analogue according to Claim 1, Claim 2, Claim 3 or Claim 4 comprising the steps of transforming baculovirus or a bacterial, yeast, insect or mammalian cell host with a DNA seguence capable of directing expression of a peptide having the activity of HBGF-/ in which 1 to 12 amino acids are absent from the amino terminal sequence, culturing the host in a nutrient medium, and recovering the peptide analogue.

10. A method of preparation of a peptide analogue according to Claim 1, Claim 2, Claim 3 or Claim 4 which comprises the steps of

(a) providing an HBGF-5 peptide having amino terminal structure

Pro-ala-leu-pro-glu-asp-gly-gly-ser-gly-ala-phe- pro-pro-gly-his-phe-lys-asp-pro-lys-arg-leu-tyr-cys- .... , and

(b) subjecting the peptide analogue to between 1 and 12 amino terminal amino acid cleavage steps.

11. An antibody directed against a peptide analogue according to Claim 1, Claim 2, Claim 3 or Claim 4.

12. An antibody according to Claim 11 which is a monoclonal antibody.

13. A method of preparation of an antibody specific to a peptide analogue according to Claim 1, Claim 2, Claim 3 or Claim 4, comprising the steps of:

(a) coupling the peptide analogue to a protein carrier to form a conjugate; (b) forming an emulsion of the conjugate with an adjuvant

(c) immunizing an animal with the emulsion; and

(d) recovering antiserum from the animal.

14. A pharmaceutical or veterinary composition comprising a therapeutically effective dose of a peptide analogue according to Claim 1, Claim 2, Claim 3 or Claim 4, together with a physiologically acceptable diluent, carrier or excipient.

15. A pharmaceutical or veterinary composition comprising an antibody according to Claim 11 or Claim 12, together with a physiologically acceptable diluent, carrier or excipient.

16. A composition for enhancing the healing of an internal or external wound in a mammal in need of such treatment comprising a peptide analogue of HBGF-/3 according to Claim 1, Claim 2, Claim 3 or Claim 4 adsorbed on or entrapped in a physiologically compatible carrier material, whereby a therapeutically effective amount of the peptide is provided at the wound site.

17. A composition according to Claim 16 wherein the carrier material is selected from a synthetic or natural organic polymer and chemically modified inorganic particles.

18. A composition according to Claim 16 or Claim 17 wherein the amount of peptide is 1 to 1000 mg/kg body weight of the mammal.

19. A method of diagnosis of disease in a mammal comprising the step of utilizing either a peptide analogue according to any one of Claims 1 to 4 or an antibody thereto according to Claim 11 or Claim 12.

20. A method of stimulating an activity selected from wound healing, angiogenesis, tissue growth, tissue repair, and ovarian function in a mammal in need of such treatment comprising the step of administering to said mammal an effective amount of a peptide analogue according to Claim 1, Claim 2, Claim 3 or Claim 4.

21. A method of inhibiting angiogenesis in a mammal in need of such treatment, comprising administering to said mammal an effective dose of an antibody according to Claim 11 or Claim 12.

22. A method of immunoassay of HBGF-Λ factors comprising the step of using either a polypeptide analogue according to any one of Claims 1 to 4 or antibody specific thereto according to Claim 11 or Claim 12, coupled to a suitable marker.

23. A cell or tissue culture medium comprising a peptide analogue according to Claim 1, Claim 2, Claim 3 or Claim 4.

24. A medium according to Claim 23 which is a chemically-defined medium.

25. A peptide analogue according to Claim 1, Claim 2, Claim 3 or Claim 4 which is synthesized by chemical methods.