WO1988002025A1 - Expression vectors for bacilli - Google Patents

Expression vectors for bacilli Download PDF

Info

Publication number
WO1988002025A1
WO1988002025A1 PCT/US1987/002113 US8702113W WO8802025A1 WO 1988002025 A1 WO1988002025 A1 WO 1988002025A1 US 8702113 W US8702113 W US 8702113W WO 8802025 A1 WO8802025 A1 WO 8802025A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
coding sequence
sequence
vector
bacillus
Prior art date
Application number
PCT/US1987/002113
Other languages
French (fr)
Inventor
Barbara Schneider Vold
Christopher Joseph Green
Brian Joseph Patrick Murphy
Original Assignee
Sri International
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sri International filed Critical Sri International
Publication of WO1988002025A1 publication Critical patent/WO1988002025A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus

Definitions

  • the present invention relates to the production of proteins by recombinant DNA methods in bacteria of the genus Bacillus.
  • Escherichia coli is currently the procaryotic host most utilized for biotechnology applications. Bacilli, however, offer several potential advantages over ⁇ . coli as a host. Many of the Bacilli are non-pathogenic, thus the potential problem of toxins which must be removed by purification, is not present. Large scale fermentation of certain Bacilli (e.g., B. subtilis) is an established industrial procedure. Moreover, since the Bacilli are secretory organisms, there is the potential advantage of the secretion of the products produced in the recombinant system. SibaKov et al., Genetics and Biotechnology of Bacilli, p. 153 (A.T. Ganesan & J. Hoch eds. 1984) [hereinafter Gen. & Biotech, of Bacilli 1. This latter property is desirable because of the economic advantage gained by the simplification of the purification process.
  • control of the expression of a foreign (heterologous) polypeptide in transformed bacteria is often by metabolite-regulated induction or repression of the operon containing the coding sequence for the heterologous polypeptide.
  • Bacilli may offer another type of control mechanism for the expression of a heterologous proteins i.e., the control may be linked to the natural differentiation mechanisms which are related to the process of sporulation.
  • RNA polymerase that differ by their ⁇ subunit
  • ⁇ 29 appears about two hours after the initiation of sporulation.
  • the RNA polymerase incorporating ⁇ 29 appears to play a role in the expression of genes necessary for the development of the endospo ⁇ e.
  • the spoIID gene promoter is an E ⁇ 29 -recognized promoter. Rong et al. (1986) J. Bacteriol. 165:771-779. Several unidentified E ⁇ 29 -recognized transcription units have also been reported. Ray & Haldenwang (1986) J.
  • the B. subtilis rrnB operon has been cloned and sequenced. The existence of a E ⁇ 29 -recognized promoter at the 3' end of this region has not been recognized. See, e.g., Bott et al. in Gen. & Biotech. of Bacilli, supra, pp. 19-34: Green & Void (1983) Nucl.
  • the present invention provides a method of producing proteins by recombinant methods in bacteria of the genus Bacillus.
  • the DNA constructs and methods provided by the present invention take advantage of a newly discovered promoter recognized by E ⁇ 29 .
  • the present invention provides for the expression of the desired protein in the bacteria after the end of the exponential growth, and during the sporulation process. Expression is regulated by the natural developmental processes of Bacillus, without the need for the addition of inducers.
  • This newly discovered E ⁇ 29 -recognized promoter is also a very strong Bacillus promoter, and can be conveniently adapted for use in new as well as existing Bacillus expression vectors.
  • the new promoter disclosed herein has been named the bvx promoter.
  • the present invention is directed to a vector comprising a double-stranded DNA segment, said DNA segment comprising, in the 5' to 3' direction on the untranscribed strand, the elements:
  • the present invention is directed to synthetic bvx promoter sequences.
  • the present invention is directed to a bacterium of the genus Bacillus the genome of which comprises a double-stranded DNA segment, said DNA segment comprising, in the 5' to 3' direction on the untranscribed strand, the elements:
  • the present invention is also directed to methods of producing the heterologous protein expressed by the above Bacillus.
  • Figure 1 shows the nucleotide sequence of the naturally occurring bvx promoter. Boxes indicate the
  • FIG. 1 shows the nucleotide sequence of a synthetically produced bvx promoter.
  • the promoter fragment has been prepared so as to have HindlII compatible overhangs.
  • Figure 3 is a schematic representation of the construction of plasmids pS29P. an expression vector having two convenient cloning sites downstream of the bvx promoter. The construction and pS29P is described in Example III.
  • Figure 4 shows the nucleotide sequence of the bvx expression cassette in M13mp18.
  • Figure 5 shows the nucleotide sequence of the bvx expression cassette in M13mp18 having cloned therein a synthetic gene for human connective tissue activating peptide (CTAP-III). This construction is described in Example IV.
  • a “replicon” is any genetic element (e.g., plasmid. chromosome, virus) that behaves as an autonomous unit of DNA replication in vivo: i.e., capable of replication under its own control.
  • a “vector” is a replicon. such as plasmid or cosmid. to which another DNA segment may be attached so as to bring about the replication of the attached segment.
  • a “shuttle vector” is a vector that is capable of replication in at least two different hosts that do not have compatible replication systems (e.g., E . coli and B. subtilis).
  • double-stranded DNA molecule refers to the polymeric form of deoxyribonucleotides (the adenine or A. guanine or G. thymine or T. and cytosine or C nucleotides) in its normal, double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules, viruses, plasmids, and chromosomes, both in vivo and in vitro.
  • sequences sometimes will be described with reference to a single strand according to the normal convention of giving only the sequence in the 5' to 3' direction (left to right) along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the transcribed RNA).
  • a DNA “coding sequence” is a DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a coding sequence can include, but is not limited to. procaryotic sequences, cDNA from e ⁇ karyotic mRNA. genomic DNA sequences from eukaryotic DNA, preferably intron-free. and synthetic DNA sequences.
  • a coding sequence is "heterologous" to the promoter that controls its expression when the coding sequence encodes a different protein than that encoded by the sequence under the control of the promoter found in nature.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
  • the promoter sequence is bounded at its 3' terminus by a transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements nec-essary to initiate transcription at levels detectable above background.
  • the transcription initiation site is conveniently defined by mapping with nuclease SI.
  • protein binding domains consistensus sequences responsible for the binding of RNA polymerase.
  • a cell which has been "transformed" by an exogenous DNA sequence is a cell which has had the exogenous DNA introduced into it.
  • the exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA.
  • a "clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • Two DNA sequences are "substantially homologous" when at least about 90 ⁇ . and preferably at least about 95 ⁇ . of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions. See, e.g., Maniatis et al., supra: DNA CLONING, supra.
  • “Expression” denotes the in vivo process by which a gene produces a polypeptide. It involves transcription of the relevant gene into messenger RNA (mRNA) and the translation of the mRNA into a polypeptide. In those cases where a polypeptide includes a secretory signal, it includes secretion of the polypeptide to the external medium.
  • mRNA messenger RNA
  • ⁇ denotes a protein factor which binds to the core enzyme of Bacilli DNA-dependent RNA polymerase to form a holoenzyme. and which determines the consensus sequences recognized by the RNA polymerase.
  • E ⁇ 29 is the RNA polymerase containing ⁇ 29 . preferably B . subtilis E ⁇ 29
  • regulatory sequences are those sequences that function to control the transcription and translation of a gene. These include the promoter, signals for the termination of transcription, for ribosomal binding, and for the initiation and termination of translation.
  • a group of regulatory sequences "control" the expression of a coding sequence when the juxtaposition of the regulatory sequences relative to the coding sequence is such that the coding sequence will be expressed.
  • a “restriction site” is a segment of double-stranded DNA containing the recognition site for a restriction endonuclease (restriction enzyme).
  • a “secretory signal” sequence is the polypeptide sequence found at the amino terminal of a secreted protein and results in the secretion of the protein from the cell. Secretory signal sequences are removed in vivo during post-ttanslational processing.
  • the "genome” of an organism refers to the entire genetic material within the organism, including both chromosomal and extra-chromosomal elements such as plasmids. cosmids. and prophages.
  • the present invention is based, in part, on the discovery of a new Bacillus promoter, the bvx promoter, downstream from the tRNA gene cluster in the rrnB operon of B. subtilis.
  • the sequence of the naturally occurring promoter is shown in Figure 1. Large regions of the naturally occurring extended bvx promoter region can be altered without significantly affecting promoter activity. The alteration of E ⁇ 29 promoter regions is known in the art. See Tatti et al. (1985) Gene
  • bvx promoter includes any promoter which is recognized (i.e., transcription initiated) by E ⁇ 29 of a Bacillus and having the following structure:
  • N x is the nucleotide sequence upstream from the -35 consensus sequence.
  • N x will generally comprise a linker sequence.
  • N s is a spacer sequence separating the -10 and -35 consensus sequences. In the naturally occurring bvx promoter.
  • N s is 13 nucleotides in length. It is known to vary the spacing between consensus sequences in promoters 1 or 2 nucleotides in either direction. Thus. N s should generally be chosen within the range of about 11 to 15 nucleotides in length but most preferably about 13 nucleotides to correspond to the wild type promoter. While it is generally preferred to use nucleotide sequence homologous to the naturally occurring promoter, alternative promoter constructs can be conveniently screened for promoter activity with promoter-probe vectors. See. e.g., Donnelly & Sonenshein (1984) J. Bacteriol. 157:965-967: Zukowski et al. (1983) Proc. Nat'l Acad. Sci. USA 80: 1101-1105; Mongkolsuk et al.
  • N y is the nucleotide sequence downstream from the -10 consensus sequence and will contain the transcription initiation site (about 5-8 nucleotides downstream from the -10 consensus sequence, depending on the method used to determine the site), the ribosome binding site. etc.
  • N y may also contain a linker sequence to facilitate the ligation of synthetic bvx promoters to heterologous ribosome binding sites.
  • the naturally occurring bvx promoter can be cloned, as described more fully below. Since the promoter region is not large, and considering the desirability of altering flanking nucleotide sequences, it is preferred to prepare synthetic bvx promoters.
  • the synthetic promoters are prepared using automated DNA synthesizers, as is well-known in the art.
  • the synthetic promoters are constructed according to the following structural formula:
  • L x and L y are linker regions of x and y base pairs in length, respectively. While the selection of the appropriate length is within the skill of the art. x and
  • Y will usually be a maximum of about 50. and preferably
  • L x and L y are double-stranded molecules except for an overhang at their 5' or 3' termini to facillitate their cloning.
  • the single-stranded overhang will usually be in the range of about 2-8 nucleotides in length, and preferably about 2 to about 4 nucleotides. These overhangs may or may not generate restriction sites upon ligation to a DNA molecule with a complimentary sticky end.
  • L y may optionally contain a ribosome binding site.
  • N s is the spacer region described above.
  • the bvx promoter region described herein is employed in expression vectors and used to regulate the expression of a heterologous protein in Bacillus.
  • One method of using the disclosed bvx promoter is to substitute it for an existing promoter region in a known
  • Bacillus expression vector Bacillus expression vectors are known in the art. See. e.g., Grandi et al. (1986)
  • the bvx promoter is used to construct new expression vectors.
  • the bvx expression cassette can be constructed, for example, in an E. coli vector and then cloned into either a Bacillus vector or an E. coli/Bacillus shuttle vector.
  • Various shuttle vectors are known in the art. See. e.g., Sullivan et al. (1984) Gene 29:21-26; Andreoli (1985) Mol. Gen. Genet.
  • a basic expression cassette comprises, in a 5' to 3' direction on the nontranscribed strand. the bvx promoter, the transcription initiation site. a ribosome binding site, a cloning site for a heterologous coding sequence (at least one restriction site), and a transcription termination sequence.
  • the cloning site is preferably comprised of two restriction sites for different restriction endonucleases, This facilitates the orientation of the heterologous coding sequence upon insertion.
  • Bacilli such as B. subtilis are secretory organisms. it may be desirable to place the heterologous coding sequence under the control of a secretory signal sequence, unless the heterologous coding sequence already encodes one.
  • Methods of placing heterologous coding sequences under the control of signal sequences for the production of recombinant proteins in Bacillus is known. See. e.g.. Sibakov et al. in Gen. & Biotech of Bacilli, supra, pp.153-162; Yamane et al., Ibid., pp.181-191; Vasantha & Thompson (1986) J. Bacteriol. 165:837-842; Ferrari et al. (1986) J. Bacteriol.
  • Secreting bvx expression vectors can be constructed by cloning into the expression cassette a heterologous coding, sequence containing the appropriate signal sequence. If the heterologous protein selected, however, does not have an appropriate signal sequence, the appropriate DNA sequence could be ligated to the 5' terminus of the heterologous coding sequence prior to its insertion into the expression cassette or expression vector. Alternatively, a sequence encoding an appropriate signal sequence can be first cloned into the expression cassette at the cloning site downstream of the ribosome binding site.
  • sequences encoding procaryotic proteins such as Bacillus proteins, include subtilisin. neutral protease, ⁇ -amylase, and the like. Coding sequences for mammalian proteins may also be selected. Examples of mammalian proteins whose coding sequences can be selected include, but are not limited to. human growth hormone, insulin, interleukin-2. tumor necrosis factor, tissue plasminogen activator, interferons and the like. Platelet factor 4 is an example of a mammalian protein for which a synthetic coding sequence can be prepared from a known amino acid sequence. See, e.g., Caplan et al.
  • the appropriate expression cassette can be employed in the transformation of Bacilli.
  • transformation can be effected.
  • a chromosomal fragment from a Bacillus is cloned into, for example, an E. coli vector.
  • the chromosomal fragment should contain a restriction site in a non-essential region.
  • the bvx expression cassette is then cloned into this restriction site so that it is flanked by adjacent chromosomal DNA sequences. It is also preferred to include an appropriate selection marker functional in the Bacillus within the expression cassette.
  • the E. coli vector containing the expression cassette/Bacillus chromosomal DNA construct is then used to transform the selected Bacillus.
  • the vector should not have a replication system functional in the host Bacillus. Transformed bacteria are grown under selective pressure for several generations.
  • the bvx expression cassette is cloned into a convenient shuttle vector.
  • shuttle vectors for Bacillus are known in the art. See, e.g., Mongkolsuk et al. (1985) Gene 37:83; Donnelly & Sonenshein. (1984) J. Bacteriol. 157:965-967; Peschke et al. (1985) J. Mol. Biol. 186:547.
  • a shuttle vector can then be used to transform a Bacilli where the heterologous coding sequence will be expressed.
  • Non-Bacilli hosts can include, for example. Staphylococcus aureus. B. subtilis. B. licheniformis. B.
  • protease deficient mutants may be desirable if there are indications that the heterologous protein is particularly sensitive to protease degradation. If the heterologous protein is itself a protease, the use of a protease deficient host will both simplify screening for transfotmant cells and the isolation of the product. Examples of protease deficient mutants include, but are not limited to. B. subtilis 168 strain S-87. Burnett et al. (1986) J. Bacteriol 165:139-145 (available from Dr. J.H. Hageman. New Mexico State Univ., Las Cruces. N.M.).
  • asporogenous mutants Since the bvx promoter is recognized by E ⁇ 29 . however, it is important to select a mutant in which sporulation is blocked after the induction of ⁇ 29 synthesis.
  • An example of such a strain is B. subtilis strain" 1S26.
  • Transformation of the host with the expression vector may be by any known means.
  • B. subtilis cells are made competent by incubation in medium containing high concentrations of Ca ++ and
  • the heterologous polypeptide is without a secretory signal sequence resulting in the product being maintained within the Bacilli, the cells containing the product will be harvested, and disrupted to release the product. If the heterologous polypeptide has been secreted as a result of the secretory signal, the product will be isolated from the medium. Harvesting and isolation of the polypeptide product may be by any convenient means, including but not limited to centrifugation. chromatography, electrophoresis. dialysis, and extraction. The selection of the appropriate recovery technique will depend on the nature of the protein and is within the skill of the art.
  • subtilis insert and then recirculated by blunt-end ligation with T4 DNA ligase (16°C. overnight).
  • the 581 bp B. subtilis DNA fragment in this plasmid contains nucleotides from position number 1913 to 2494 of the numbering scheme used by Wawrousek et al., 1984. supra. Plasmid pUCtglu was tested in an in vitro run-off transcription assay, as described previously. (Tatti et al., 1985. Gene 36: 151-157). to determine if this plasmid contained a promoter that could be utilized by E ⁇ 29 . In this assay, plasmid pUCtglu that had been cleaved at the unique EcoRI site was incubated with E ⁇ 29 and ribonucleotide triphosphates including [ ⁇ - 32 P]CTP.
  • the transcripts were visualized by autoradiography after electrophoresis into a polyacrylamide (PA) urea gel. Transcription of this linear template by E ⁇ 29 resulted in a 150 nt transcript which did not result when linear template was transcribed by E ⁇ 43 . E ⁇ 32 or E ⁇ 37 .
  • PA polyacrylamide
  • the 150 nt transcript appeared to be generated from within the 581 bp B. subtilis DNA cloned in pUCtglu since incubation of pUC8 with E ⁇ 29 did not result in a detectable transcript.
  • This transcript was eluted from a PA-urea gel and allowed to hybridize to the DNA fragments that were generated by cleavage of pUCtglu with EcoRI and Seal. Cleavage of pUCtglu with
  • EcoRI and Seal separates the plasmid into two fragments. one of which is a 530 bp fragment that contains most of the original 581 bp B. subtilis DNA fragment which was cloned in pUCtglu. After separation of the two DNA fragments by electrophoresis. the DNA was transformed to nitrocellulose. Southern (1975) J. Mol. Biol.
  • the 150 nt transcript hybridized to the 530 bp DNA fragment and not to the larger DNA fragment that contains the pUC8 derived portion of pUCtglu. indicating that the transcript was encoded by the B. subtilis derived 581 bp DNA fragment in pUCtglu.
  • RNA was synthesized from 8 ⁇ g of supercoiled pUCtglu with E ⁇ 29 as described previously. Tatti et al., (1985) Gene 36:151-157. After ethanol precipitation, this RNA was allowed to hybridize with
  • the 5' terminus of the 150 nt transcript within the 581 bp Hpal-EcoRI DNA fragment was then mapped according to the SI nuclease mapping procedure of Moran et al. (1981) Cell 25:783-791.
  • the size of the labelled DNA that was protected from S1 nuclease was determined by electrophoresis into a PA-urea gel. A more rapidly migrating minor band also was detected in the same lane, but probably was an artifact since it could be produced by protecting the labelled probe with supercoiled pUCtglu DNA.
  • the protected DNA fragment was not detected in a control experiment where no RNA was added.
  • the products of the dideoxy sequencing reactions from this region of the plasmid were used as size markers when measuring the length of the S1 nuclease protected fragment. These dideoxy reaction products were synthesized from a primer located downstream from the EcoRI site and subsequent cleavage of the products by EcoRI before electrophoresis. Kudo et al., (1985) J. Bacteriol. 161:158-163. The length of the protected fragment mapped the 5' terminus of the RNA to the nucieotide labelled +1 in Figure 1. In vivo mapping placed the start site as early as the G or A corresponding to the -1 or -2 in Figure 1.
  • RNA transcripts corresponding to the above in vitro transcripts were tested for the presence of RNA transcripts corresponding to the above in vitro transcripts, especially cells that had begun to sporulate since that is the time of E ⁇ 29 abundance.
  • RNA was prepared from B. subtilis SMY grown in Difco sporulation medium during the exponential growth phase
  • RNA was used in S1 mapping experiments similar to those described above, however the DNA was uniformly labelled with [ ⁇ - 32 P]dCTP to a higher specific activity in order to increase the changes of detecting low level transcription from this region.
  • This probe was digested with SI nuclease after incubation in hybridization buffer (Gilman and Chamberlin. 1983) with RNA that was isolated from B. subtilis SMY during exponential growth, one hour after exponential growth and two hours after exponential growth. In other reactions, the probe was digested with SI nuclease after incubation with E. coli RNA or no RNA.
  • the size of the protected DNA was determined by electrophoresis into a high resolution PA-urea gel next to the dideoxy sequencing reaction products of this DNA. The size of the protected DNA was within 1 nucleotide of that expected for a transcript which was initiated from the bvx promoter by E ⁇ 29
  • the following example is directed to the production of a synthetic bvx promoter sequence and its use in an expression vector.
  • Two complimentary strands of oligonucleotides. with HindlII overhangs at the 5' ends, spanning the bvx promoter region were constructed using an Applied Biosystems' Model 380A DNA synthesizer according to manufacturer's instructions (the downstream ligation will not regenerate a HindlII site due to the substitution of T for A).
  • the two strands were gel purified (7M urea. 8% polyacrylamide). boiled for 5 minutes in equi-molar concentrations (100 pmoles/strand) and allowed to cool to room temperature to produce ds oligomers. These were then phosphorylated at the 5' end with T4 polynucleotide kinase by standard techniques.
  • the promoter probe expression vector pCED6 can be used to fuse suspected promoter sequences to the E. coli ⁇ -galactosidase coding sequence at a Hindlll site. This plasmid also contains both E. coli and B. subtilis replicons. Its construction is described in Donnelly & Sonenshein (1984) J. Bacteriol. 157:965-967. Plasmid pCED6 was cut with Hindlll at 37°C for 1 hour and then treated with bacterial alkaline phosphatase for 1 hour at 65°C to prevent religation of the vector onto itself.
  • the double-stranded promoter oligomer was then inserted into the Hindlll site of pCED6 by treatment with T4 DNA ligase (overnight at 16oC) in standard buffer conditions.
  • T4 DNA ligase overnight at 16oC
  • the resulting recombinants were transformed into E. coli strain JM101 using the CaCl 2 methods as described in Maniatis et al., supra.
  • B. subtilis strain PSL1 was grown in 30 ml of Penassay medium. When the culture was still in log phase, an aliquot of 7.5 ml was asceptically centrifuged at 8.000K. 4°C for 10 min. The resulting pellet was resuspended in 1 ml of Spizizen medium 1 (Spiz I). This medium consists of 1x Spizizen salts (see J. Spizizen. Proc. Nat'l Acad. Sci. USA 44: 1072 (1983)) plus 0.02% casein amino acids. 0.01% yeast extract. 0.6% glucose.
  • the pellet was resuspended in 0.5 ml of Penassay.
  • Transformants were then plated directly onto agar containing kanamycin (5 ⁇ g/ml) and 40 ⁇ g/ml of
  • cloning is done in E. coli strain JM101.
  • a 203 bp TaqI restriction fragment is isolated from the rrnB operon. It contains the terminator region for tRNA gene cluster of rrnB fragment. Green & Void (1983) Nucl. Acids Res. 11: 5763-5774.
  • the terminator fragment is cloned into the AceI site of phage M13mp18 (BRL).
  • Clones having the proper orientation (5' end of terminator sequence proximal to the Sall site of M13) are then cut with Hindlll and PstI are ligated with a synthetic ribosome binding site (rbs) for B. subtilis having a Hindlll overhang at its 5' end and a 3' Pstl overhang.
  • the rbs fragment also has an EcoRI site between the PstI end and the rbs site ( Figure 4).
  • Clones having the synthetic rbs fragment are then cut with Hindlll and then ligated with the synthetic bvx promoter fragment from Example II ( Figure 2). Those having the proper orientation (3' end of promoter proximal to the 5' end of rbs fragment) are selected, cut with Hindlll and Xmal, and the ca 300 bp fragment containing the promoter/rbs/terminator cassette isolated.
  • a new plasmid is created from pMK3 (Sullivan et al. (1984). Gene 29:21-26) by restriction with Eco RI to remove a small Eco RI fragment, blunt ending the plasmid with SI nuclease and religating. This creates a modified pMK3 (pMK3 ⁇ Eco) without any Eco RI sites.
  • the E ⁇ 29 cassette is then ligated into the
  • Plasmid pS29P is a shuttle vector, having both E. coli and B. subtilis origins of replication. It isca 7.6 kb, and is Amp r in E. coli, and Km r in B. subtilis. There is a unique PstI cloning site for selected cloning sequences downstream from the rbs. There is also a convenient EcoRI site for the insertion of coding sequences adjacent to the PstI site.
  • CTAP-III human connective tissue activating peptide
  • the synthetic gene is cloned into EcoRI- and Pstl-cut pS29P (Example III), and transformed into E. coli as described above. Plasmids are then isolated from Amp r colonies and used to transform B. subtilis strain PSL1. Ostroff & Pene (1983) J. Bacteriol. 156:934-936. Colonies are screened 2-4 hours after sporulation begins for expression of CTAP-III. Colonies are screened by testing cell lysate for CTAP-III activity (Castor et al., supra). or by screening with a monoclonal antibody to CTAP-III produced by standard methods. Alternatively isolated RNA is screened by hybridization to a CTAP-III probe.
  • This example is directed to the construction of an expression vector having heterologous protein that is secreted by a Bacilli under the control of the bvx promoter.
  • Plasmid DNA is isolated from these colonies and then cut with Hindlll. The cut plasmid DNA is then ligated with the synthetic bvx promoter fragment, and B. subtilis PSL1 transformed therewith. Kanam ⁇ cin resistant colonies are then screened for subtilisin by a bioassay. immunoassay. or RNA hybridization according to standard methods.

Abstract

The Bacillus promoter bvx, which is recognized by Bacillus RNA polymerase Esigma29, as well as expression vectors and methods of producing recombinant protein.

Description

EXPRESSION VECTORS FOR BACILLI
Technical Field
The present invention relates to the production of proteins by recombinant DNA methods in bacteria of the genus Bacillus.
Government Grant
This invention was made in part with United States Government support under a grant or contract from the National Institutes of Health. The United States Government has certain rights in this invention.
Background
Escherichia coli is currently the procaryotic host most utilized for biotechnology applications. Bacilli, however, offer several potential advantages over Ε . coli as a host. Many of the Bacilli are non-pathogenic, thus the potential problem of toxins which must be removed by purification, is not present. Large scale fermentation of certain Bacilli (e.g., B. subtilis) is an established industrial procedure. Moreover, since the Bacilli are secretory organisms, there is the potential advantage of the secretion of the products produced in the recombinant system. SibaKov et al., Genetics and Biotechnology of Bacilli, p. 153 (A.T. Ganesan & J. Hoch eds. 1984) [hereinafter Gen. & Biotech, of Bacilli 1. This latter property is desirable because of the economic advantage gained by the simplification of the purification process.
In E. coli. control of the expression of a foreign (heterologous) polypeptide in transformed bacteria is often by metabolite-regulated induction or repression of the operon containing the coding sequence for the heterologous polypeptide. Bacilli, however, may offer another type of control mechanism for the expression of a heterologous proteins i.e., the control may be linked to the natural differentiation mechanisms which are related to the process of sporulation.
Cellular differentiation in Bacilli is triggered by a deprivation of nutrients. Under these conditions, which normally occur at high cell density, the cells of spore-forming Bacilli cease normal cell division and begin the sporulation process. Sporulation is complex and involves extensive alterations in the biochemistry, physiology, and morphology of the developing cell. One of these changes involves the σ subunit (and resulting specificity) of DNA-dependent RNA polymerase. The recognition of promoters by bacterial RNA polymerases is largely determined by hexanucleotide consensus sequences in promoters centered approximately 10 and 35 base pairs upstream from the startpoint of transcription. The type of σ subunit in Bacilli RNA polymerase governs specificity for a particular promoter consensus sequence.
In Bacillus subtilis. for example, several forms of RNA polymerase that differ by their σ subunit
(and thereby their specificity for promoter consensus sequences) are known. One particular subunit. σ29, appears about two hours after the initiation of sporulation. The RNA polymerase incorporating σ 29 (Eσ29) appears to play a role in the expression of genes necessary for the development of the endospoεe.
See, e.g., Haldenwang et al. (1981) Cell 25:615-624:
Motan et al. (1981) Cell 25:783-791: Trempy et al.
(1985) Proc. Natl. Acad. Sci. USA 82:4189-4192. Understanding the nucleotide sequences responsible for the promoter specificity of Eσ29 has been limited by the few σ29 promoters available. The best characterized σ29 promoter is the "ctc promoter." See, e.g., Tatti & Moran (1984) J. Mol.
Biol. 175-.285-297: Tatti et al. (1985) Gene 36:151-157;
Tatti & Moran (1985) Nature (London) 314:190-297: Ray et al. (1985) J. Bacteriol. 163:610-614: Moran et al. in
The Third International Conference on Genetics and
Biotechnology of Bacilli, p. 75 (July 15-17. 1985.
Stanford University) (abstract). The spoIID gene promoter is an Eσ29-recognized promoter. Rong et al. (1986) J. Bacteriol. 165:771-779. Several unidentified Eσ29-recognized transcription units have also been reported. Ray & Haldenwang (1986) J.
Bacteriol. 166:472-478. A comparison of four Eσ29-recognized promoters has been made in N.E.L.
Unnasch (1982) Ph.D. Thesis. Harvard University,
Cambridge. MA.
The B. subtilis rrnB operon has been cloned and sequenced. The existence of a Eσ29-recognized promoter at the 3' end of this region has not been recognized. See, e.g., Bott et al. in Gen. & Biotech. of Bacilli, supra, pp. 19-34: Green & Void (1983) Nucl.
Acids Res. 11:5763-5774: Wawrousek et al. (1984) J.
Biol. Chem. 259:3694-3702: Green et al. (1985) Gene
38:261-266; Void & Green (1986) J. Bacteriol.
166:306-312.
Wong et al. in Gen. & Biotech, of Bacilli. supra, pp. 209-221 and Rong et al. (1986). supra, each disclose the expression of heterologous coding sequences under the control of an Eσ29-recognized promoter.
Representative examples of cloning and expressing foreign genes in bacilli are discussed below. More extensive citations to the literature can be found in the detailed description.
Chater & Hopwood (1982) Trends in Bioch. Sci., Vol. 7, discusses the expression of several foreign proteins in B. subtilis. See also Band & Henner (1984) DNA 3: 17-21: Grange et al. (1984) Nuc. Acids Res. 12:3585-3601: Flock et al. (1984) Mol. Gen. Genet. 195:246-251.
Various expression vectors for Bacillus are known in the art. See. e.g.. Sibakov et al. in Gen. & Biotech, of Bacilli, supra, pp.153-162: Grandi et al. (1986) Plasmid 16:1-14.
Henner et al. in Molecular Biology of Microbial Differentiation, pp.95-103 (Hoch & Setlow eds. 1985). disclose the expression of subtilisin in B. subtilis under the control of the B. amyloliguefaciens amylase promoter.
Wong et al. (1984) Proc. Nat'l Acad. Sci. USA 8111184-1188. disclosed the sequence of the B. subtilis subtilisin E promoter. Subtilisin E is expressed only during the stationary growth phase.
Yansura & Henner in Gen. & Biotech, of Bacilli. supra, pp.249-263. disclose the construction of hybrid promoters containing the RNA polymerase recognition sites of Bacillus promoters and the operator from the lac promoter. When a gene is placed under the control of such hybrid promoters in B. subtilis expressing lac represser, gene expression is mediated through the addition of IPTG.
Lovett et al. in Gen. & Biotech, of Bacilli. supra, p.275. disclose a system in which the expression of chloramphenicol acetyltransferase is induced in B. subtilis by chloramphenicol. It is believed that the control of expression occurs after transcription through the induction of translation. Donnelly & Sonenshein (1984) J. Bacteriol. 157:965-967 is an example of the use of promoter-probe vectors to determine whether a selected DNA sequence has promoter activity in B. subtilis.
Sullivan et al. (1984) Gene 2.9:21-26. is an example of shuttle vectors useful for cloning genes in E. coli and B. subtilis.
Summary of the Invention
The present invention provides a method of producing proteins by recombinant methods in bacteria of the genus Bacillus. The DNA constructs and methods provided by the present invention take advantage of a newly discovered promoter recognized by Eσ29. Thus. the present invention provides for the expression of the desired protein in the bacteria after the end of the exponential growth, and during the sporulation process. Expression is regulated by the natural developmental processes of Bacillus, without the need for the addition of inducers. This newly discovered Eσ29-recognized promoter is also a very strong Bacillus promoter, and can be conveniently adapted for use in new as well as existing Bacillus expression vectors. The new promoter disclosed herein has been named the bvx promoter.
In one embodiment, the present invention is directed to a vector comprising a double-stranded DNA segment, said DNA segment comprising, in the 5' to 3' direction on the untranscribed strand, the elements:
(i) a bvx promoter:
(ii) a ribosome binding site:
(iii) a cloning site suitable for ligation of a coding sequence: and
(iv) a transcription termination sequence, said elements being positioned and oriented such that a coding sequence cloned into said restriction site is expressible under the control of said elements in a
Bacillus transformed with said DNA segment in the presence =Eσ29
In another embodiment, the present invention is directed to synthetic bvx promoter sequences.
In a further embodiment, the present invention is directed to a bacterium of the genus Bacillus the genome of which comprises a double-stranded DNA segment, said DNA segment comprising, in the 5' to 3' direction on the untranscribed strand, the elements:
(i) a bvx promoter:
(ii) a ribosome binding site:
(iii) a coding sequence heterologous to said bvx promoter: and
(iv) a transcription termination sequence, said elements being positioned and oriented such that said coding sequence is expressed under the control of said elements in said Bacillus in the presence of Eσ29.
The present invention is also directed to methods of producing the heterologous protein expressed by the above Bacillus.
These and other embodiments of the present invention will be readily apparent to those of ordinary skill in the art from the following description.
Description of the Figures
Figure 1 shows the nucleotide sequence of the naturally occurring bvx promoter. Boxes indicate the
-10 and -35 consensus sequences responsible for
Eσ29-recognition. The +1 nucleotide is the site of transcription initiation. Figure 2 shows the nucleotide sequence of a synthetically produced bvx promoter. The promoter fragment has been prepared so as to have HindlII compatible overhangs.
Figure 3 is a schematic representation of the construction of plasmids pS29P. an expression vector having two convenient cloning sites downstream of the bvx promoter. The construction and pS29P is described in Example III.
Figure 4 shows the nucleotide sequence of the bvx expression cassette in M13mp18.
Figure 5 shows the nucleotide sequence of the bvx expression cassette in M13mp18 having cloned therein a synthetic gene for human connective tissue activating peptide (CTAP-III). This construction is described in Example IV.
Detailed Description
The practice of the present invention will employ, unless otherwise indicated, conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Maniatis. Fritsch & Sambrook. Molecular Cloning: A Laboratory Manual (1982): DNA Cloning. Volumes I and II (D.N. Glover ed. 1985): Oligonucleotide Synthesis (M.J. Gait ed. 1984): Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds. 1985): Molecular Cloning and Gene Regulation in Bacilli (A. Ganesan. S. Chang & J. Hoch eds. 1982); The Molecular Biology of the Bacilli. Vol. I (D. Dubnau ed. 1982): Gen. & Biotech, of Bacilli, supra: The Molecular Biology of the Bacilli. Vol. II (D. Dubnau 1985): Dean & Dooley (1981) Microb. Gene. Bull. 51:8-19. In describing the present invention, the following terminology will be used in accordance with the definitions set out below.
A "replicon" is any genetic element (e.g., plasmid. chromosome, virus) that behaves as an autonomous unit of DNA replication in vivo: i.e., capable of replication under its own control.
A "vector" is a replicon. such as plasmid or cosmid. to which another DNA segment may be attached so as to bring about the replication of the attached segment. A "shuttle vector" is a vector that is capable of replication in at least two different hosts that do not have compatible replication systems (e.g., E . coli and B. subtilis).
A "double-stranded DNA molecule" refers to the polymeric form of deoxyribonucleotides (the adenine or A. guanine or G. thymine or T. and cytosine or C nucleotides) in its normal, double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules, viruses, plasmids, and chromosomes, both in vivo and in vitro. In discussing the structure of particular double-stranded DNA molecules, sequences sometimes will be described with reference to a single strand according to the normal convention of giving only the sequence in the 5' to 3' direction (left to right) along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the transcribed RNA).
A DNA "coding sequence" is a DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to. procaryotic sequences, cDNA from eυkaryotic mRNA. genomic DNA sequences from eukaryotic DNA, preferably intron-free. and synthetic DNA sequences. A coding sequence is "heterologous" to the promoter that controls its expression when the coding sequence encodes a different protein than that encoded by the sequence under the control of the promoter found in nature.
A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by a transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements nec-essary to initiate transcription at levels detectable above background. The transcription initiation site is conveniently defined by mapping with nuclease SI. Within the promoter sequence will be found protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
A cell which has been "transformed" by an exogenous DNA sequence is a cell which has had the exogenous DNA introduced into it. The exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA.
A "clone" is a population of cells derived from a single cell or common ancestor by mitosis.
Two DNA sequences are "substantially homologous" when at least about 90\. and preferably at least about 95\. of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions. See, e.g., Maniatis et al., supra: DNA CLONING, supra.
"Expression" denotes the in vivo process by which a gene produces a polypeptide. It involves transcription of the relevant gene into messenger RNA (mRNA) and the translation of the mRNA into a polypeptide. In those cases where a polypeptide includes a secretory signal, it includes secretion of the polypeptide to the external medium.
"σ" denotes a protein factor which binds to the core enzyme of Bacilli DNA-dependent RNA polymerase to form a holoenzyme. and which determines the consensus sequences recognized by the RNA polymerase. "Eσ29" is the RNA polymerase containing σ29. preferably B . subtilis Eσ29
"Regulatory sequences" are those sequences that function to control the transcription and translation of a gene. These include the promoter, signals for the termination of transcription, for ribosomal binding, and for the initiation and termination of translation. A group of regulatory sequences "control" the expression of a coding sequence when the juxtaposition of the regulatory sequences relative to the coding sequence is such that the coding sequence will be expressed.
A "restriction site" is a segment of double-stranded DNA containing the recognition site for a restriction endonuclease (restriction enzyme).
A "secretory signal" sequence is the polypeptide sequence found at the amino terminal of a secreted protein and results in the secretion of the protein from the cell. Secretory signal sequences are removed in vivo during post-ttanslational processing. The "genome" of an organism refers to the entire genetic material within the organism, including both chromosomal and extra-chromosomal elements such as plasmids. cosmids. and prophages.
The present invention is based, in part, on the discovery of a new Bacillus promoter, the bvx promoter, downstream from the tRNA gene cluster in the rrnB operon of B. subtilis. The sequence of the naturally occurring promoter is shown in Figure 1. Large regions of the naturally occurring extended bvx promoter region can be altered without significantly affecting promoter activity. The alteration of Eσ29 promoter regions is known in the art. See Tatti et al. (1985) Gene
36: 151-157. The consensus sequences, shown in the open boxes in Figure 1. appear to be the only essential regions of the bvx promoter. Thus, a "bvx promoter" includes any promoter which is recognized (i.e., transcription initiated) by Eσ29 of a Bacillus and having the following structure:
5'-Nx-GAATAAAT-Ns-ACTATGAT-Ny-3'.
Nx is the nucleotide sequence upstream from the -35 consensus sequence. In the synthetic bvx promoter. Nx will generally comprise a linker sequence. Ns is a spacer sequence separating the -10 and -35 consensus sequences. In the naturally occurring bvx promoter.
Ns is 13 nucleotides in length. It is known to vary the spacing between consensus sequences in promoters 1 or 2 nucleotides in either direction. Thus. Ns should generally be chosen within the range of about 11 to 15 nucleotides in length but most preferably about 13 nucleotides to correspond to the wild type promoter. While it is generally preferred to use nucleotide sequence homologous to the naturally occurring promoter, alternative promoter constructs can be conveniently screened for promoter activity with promoter-probe vectors. See. e.g., Donnelly & Sonenshein (1984) J. Bacteriol. 157:965-967: Zukowski et al. (1983) Proc. Nat'l Acad. Sci. USA 80: 1101-1105; Mongkolsuk et al.
(1983) J. Bacteriol. 155: 1399-1406; Yoshimura et al.
(1984) J. Bacteriol. 159:905-912. Ny is the nucleotide sequence downstream from the -10 consensus sequence and will contain the transcription initiation site (about 5-8 nucleotides downstream from the -10 consensus sequence, depending on the method used to determine the site), the ribosome binding site. etc.
Ny may also contain a linker sequence to facilitate the ligation of synthetic bvx promoters to heterologous ribosome binding sites.
The naturally occurring bvx promoter can be cloned, as described more fully below. Since the promoter region is not large, and considering the desirability of altering flanking nucleotide sequences, it is preferred to prepare synthetic bvx promoters. The synthetic promoters are prepared using automated DNA synthesizers, as is well-known in the art. The synthetic promoters are constructed according to the following structural formula:
Figure imgf000014_0001
Lx and Ly are linker regions of x and y base pairs in length, respectively. While the selection of the appropriate length is within the skill of the art. x and
Y will usually be a maximum of about 50. and preferably
20 or less. Lx and Ly are double-stranded molecules except for an overhang at their 5' or 3' termini to facillitate their cloning. The single-stranded overhang will usually be in the range of about 2-8 nucleotides in length, and preferably about 2 to about 4 nucleotides. These overhangs may or may not generate restriction sites upon ligation to a DNA molecule with a complimentary sticky end. Ly may optionally contain a ribosome binding site. Ns is the spacer region described above.
The bvx promoter region described herein is employed in expression vectors and used to regulate the expression of a heterologous protein in Bacillus. One method of using the disclosed bvx promoter is to substitute it for an existing promoter region in a known
Bacillus expression vector. Bacillus expression vectors are known in the art. See. e.g., Grandi et al. (1986)
Plasmid 16:1-14 (and references cited therein); Sibakov et al. in Gen. & Biotech, of Bacilli, supra, pp.153-162;
Schoner et al. (1983) Gene 22: 47-57; Chatter & Hopwood (1982). supra; Usvurne et al. (1985) J. Bacteriol.
163: 1101-1108; Flock et al. (1984) Mol. Gen. Genet.
195 :246-251; Grange et al. (1984) Nuc. Acids Res.
12: 3585-3601: Band & Henner (1984) DNA 3:17-21; Wong et al. in Gen. & Biotech, of Bacilli, supra, pp.209-221;
Rong et al. (1986) J. Bacteriol. 165:771-779: Donnelly &
Sonenshein in Molecular Cloning and Gene Regulation in
Bacilli, supra, pp.63-72; Goldfarb et al. in Ibid. pp.311-324: Grandi. Del Bue. Andrews. Timm. Cosmina.
Franchi. Viale. & Toma (1986) J. Biol. Chem. Synthetic bvx promoters will be particularly preferred ih this application since the appropriate linker overhangs can be prepared with the bvx promoter.
In a preferred embodiment, the bvx promoter is used to construct new expression vectors. To accomplish this. it is convenient to construct the bvx promoter and appropriate Bacillus regulatory sequences within an "expression cassette"; i.e., a DNA segment flanked by restriction sites to facilitate its cloning into various vectors. The bvx expression cassette can be constructed, for example, in an E. coli vector and then cloned into either a Bacillus vector or an E. coli/Bacillus shuttle vector. Various shuttle vectors are known in the art. See. e.g., Sullivan et al. (1984) Gene 29:21-26; Andreoli (1985) Mol. Gen. Genet. 199:372-380; Peschke et al. (1985) J. Mol. Biol. 186:547; Mongkolsuk et al. (1985) Gene 37: 83; Ostroff & Pene (1983) J. Bacteriol. 156:934-036: Band et al. (1983) Gene 26:313.
The expression cassette is assembled employing standard recombinant techniques. A basic expression cassette comprises, in a 5' to 3' direction on the nontranscribed strand. the bvx promoter, the transcription initiation site. a ribosome binding site, a cloning site for a heterologous coding sequence (at least one restriction site), and a transcription termination sequence. The cloning site is preferably comprised of two restriction sites for different restriction endonucleases, This facilitates the orientation of the heterologous coding sequence upon insertion.
Since Bacilli such as B. subtilis are secretory organisms. it may be desirable to place the heterologous coding sequence under the control of a secretory signal sequence, unless the heterologous coding sequence already encodes one. Methods of placing heterologous coding sequences under the control of signal sequences for the production of recombinant proteins in Bacillus is known. See. e.g.. Sibakov et al. in Gen. & Biotech of Bacilli, supra, pp.153-162; Yamane et al., Ibid., pp.181-191; Vasantha & Thompson (1986) J. Bacteriol. 165:837-842; Ferrari et al. (1986) J. Bacteriol. 166:173-179: Fahnestock & Fisher (1986) J. Bacteriol. 165:796-804: Kovacevic et al. (1985) J. Bacteriol. 162:521-528; Ohmura et al. (1984) Nuc. Acids Res. 12: 5307-5319. Various signal sequences for Bacillus have been cloned. See, e.g., Vasantha et al., Ibid., pp.163-172; Wells et al., Ibid., pp.173-180. See also Mezes & Lampen in The Molecular Biology of the Bacilli. Vol. II. supra, pp.151-183; Lampen & Nielsen in Molecular Cloning and Gene Regulation in Bacilli, supra. pp.99-109.
Secreting bvx expression vectors can be constructed by cloning into the expression cassette a heterologous coding, sequence containing the appropriate signal sequence. If the heterologous protein selected, however, does not have an appropriate signal sequence, the appropriate DNA sequence could be ligated to the 5' terminus of the heterologous coding sequence prior to its insertion into the expression cassette or expression vector. Alternatively, a sequence encoding an appropriate signal sequence can be first cloned into the expression cassette at the cloning site downstream of the ribosome binding site. In the absence of appropriate restriction sites occurring naturally near the 3' terminus of the signal sequence and the 5' terminus of the coding sequence, these termini are modified so that when the coding sequence is ligated into a cloning site downstream of the signal sequence (in the expression cassette), the coding sequences is in the correct reading frame with the signal sequence.
The selection of an appropriate heterologous coding sequence is within the skill of that art. Sequences encoding procaryotic proteins, such as Bacillus proteins, include subtilisin. neutral protease, α-amylase, and the like. Coding sequences for mammalian proteins may also be selected. Examples of mammalian proteins whose coding sequences can be selected include, but are not limited to. human growth hormone, insulin, interleukin-2. tumor necrosis factor, tissue plasminogen activator, interferons and the like. Platelet factor 4 is an example of a mammalian protein for which a synthetic coding sequence can be prepared from a known amino acid sequence. See, e.g., Caplan et al. (1979) Blood 53,:604-618; Castor et al. (1983) Proc. Nafl Acad. Sci. USA 80:765-799. An example of a valuable non-mammalian protein for which a synthetic coding sequence can also be prepared is the Thrombin-specific inhibitor, hirudin. See. e.g., Markwardt (1970) Methods in Enzymology 19: 924-932; Stone & Hoffstenge (1986) Biochemistry 25:4622-4628.
Once the appropriate expression cassette has been constructed. it can be employed in the transformation of Bacilli. There are several approaches by which transformation can be effected. For example, it may be desirable to have the bvx expression cassette containing the heterologous coding sequence integrated into the chromosome of a Bacillus. As is known in the art. this can be accomplished by a double recombinant cross. See. e.g., Fahnestock et al. (1986) J. Bacteriol. 165:1011-1014: Niavdet et al. (1985) J. Bacteriol. 163:111-120: Albertin & Galizzi (1985) J. Bacteriol. 162:1203-1211. In this approach, a chromosomal fragment from a Bacillus is cloned into, for example, an E. coli vector. The chromosomal fragment should contain a restriction site in a non-essential region. The bvx expression cassette is then cloned into this restriction site so that it is flanked by adjacent chromosomal DNA sequences. It is also preferred to include an appropriate selection marker functional in the Bacillus within the expression cassette. The E. coli vector containing the expression cassette/Bacillus chromosomal DNA construct is then used to transform the selected Bacillus. The vector should not have a replication system functional in the host Bacillus. Transformed bacteria are grown under selective pressure for several generations. In transformants where a double-recombinant cross has occurred (one in each flanking chromosomal DNA region), stable transformants will result. In those where only a single recombinant cross has occurred, there will be a measurable loss of the selective phenotype due to spontaneous deletions of the integrated vector. Clones not demonstrating a significant loss of selectable phenotype over several generations are. therefore, selected. See, e.g., PCT/US83/0102C (Pub. No. WO84/00381 Feb. 2. 1984).
In a preferred embodiment, the bvx expression cassette is cloned into a convenient shuttle vector. Various shuttle vectors for Bacillus are known in the art. See, e.g., Mongkolsuk et al. (1985) Gene 37:83; Donnelly & Sonenshein. (1984) J. Bacteriol. 157:965-967; Peschke et al. (1985) J. Mol. Biol. 186:547. A shuttle vector can then be used to transform a Bacilli where the heterologous coding sequence will be expressed.
Various hosts within the Bacilli family may be employed, particularly mutants having desired properties. See, e.g.. Ostroff & Pene. J. Bacteriol. 156:934-936: Dean & Dooley (1981) Microbial. Genetics Bull. 51:8-19. Particular species include, but are not limited to. B. subtilis. B. cereus. B. amyloliαuefaciens. B. licheniformis. B. brevis. B. pumilis. B. natto. B. megaterium. and B. stearothermophilus. Non-Bacilli hosts can include, for example. Staphylococcus aureus. B. subtilis. B. licheniformis. B. amyloliouefaciens. and B. stearothermophilus are preferred for protein production. The use of protease deficient mutants may be desirable if there are indications that the heterologous protein is particularly sensitive to protease degradation. If the heterologous protein is itself a protease, the use of a protease deficient host will both simplify screening for transfotmant cells and the isolation of the product. Examples of protease deficient mutants include, but are not limited to. B. subtilis 168 strain S-87. Burnett et al. (1986) J. Bacteriol 165:139-145 (available from Dr. J.H. Hageman. New Mexico State Univ., Las Cruces. N.M.). It may also be desirable to use asporogenous mutants. Since the bvx promoter is recognized by Eσ29. however, it is important to select a mutant in which sporulation is blocked after the induction of σ 29 synthesis. An example of such a strain is B. subtilis strain" 1S26.
Rong et al. (1986) J. Bacteriol. 165:771-779 (available from Bacillus Genetic Stock Center). A host developed to stabilize plasmids carrying introduced genes is B.. subtilis strain PSL1. Ostroff & Peπe, supra.
Transformation of the host with the expression vector may be by any known means. In some cases B. subtilis cells are made competent by incubation in medium containing high concentrations of Ca++ and
Mg++. Another system for transformation is that of
Chang and Cohen. Mol.Gen.Genetics 168 (1979):111. which involves polyethylene glycol induced DNA uptake by protoplasts and subsequent regeneration of the bacterial cell wall. Methods of growing transformed Bacillus to express foreign proteins are known in the art. For Bacillus transformed with bvx expression cassettes. the cells are grown in nutrient medium until the appropriate stage of sporulation has occurred to induce the synthesis of the heterologous polypeptide. Typically this will occur after the cells have reached the stationary growth phase and are at a high density. If the host is B. subtilis. for example. Eσ29 will be maximally active from approximately two to four hours (T2-T4) after exponential growth has ceased.
If the heterologous polypeptide is without a secretory signal sequence resulting in the product being maintained within the Bacilli, the cells containing the product will be harvested, and disrupted to release the product. If the heterologous polypeptide has been secreted as a result of the secretory signal, the product will be isolated from the medium. Harvesting and isolation of the polypeptide product may be by any convenient means, including but not limited to centrifugation. chromatography, electrophoresis. dialysis, and extraction. The selection of the appropriate recovery technique will depend on the nature of the protein and is within the skill of the art.
EXAMPLES
Set forth below are specific embodiments of the present invention. These examples are included for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Many standard techniques are employed in the examples, and one of ordinary skill in the art will be able to substitute alternative and/or equivalent techniques therefor. Thus, variations on the embodiment set forth below are intended to be within the scope of the invention.
I.
The following example describes the cloning and characterization of promoter bvx from B. subtilis.
A part of rrnB operon had been cloned and the nucleotide sequence of the entire operon determined previously. See Green & Void (1983) Nucl. Acids Res. 11: 5736-5774; Wawrousek et al. (1984) J. Biol. Chem. 259:3694-3702. A DNA fragment that contained the promoter distal end of the rrnB operon and adjacent DNA was generated as follows. Plasmid pUCTG5 contains a 4.5 kb EcoRI DNA segment from the rrnB operon. Void & Green (1986) J. Bacteriol. 166:306-312. This plasmid was treated with Hpal and Smal to remove the 5' region of the B. subtilis insert and then recirculated by blunt-end ligation with T4 DNA ligase (16°C. overnight). The 581 bp B. subtilis DNA fragment in this plasmid (pUCtglu) contains nucleotides from position number 1913 to 2494 of the numbering scheme used by Wawrousek et al., 1984. supra. Plasmid pUCtglu was tested in an in vitro run-off transcription assay, as described previously. (Tatti et al., 1985. Gene 36: 151-157). to determine if this plasmid contained a promoter that could be utilized by Eσ29. In this assay, plasmid pUCtglu that had been cleaved at the unique EcoRI site was incubated with Eσ29 and ribonucleotide triphosphates including [α- 32P]CTP.
The transcripts were visualized by autoradiography after electrophoresis into a polyacrylamide (PA) urea gel. Transcription of this linear template by Eσ 29 resulted in a 150 nt transcript which did not result when linear template was transcribed by Eσ43. Eσ32 or Eσ37.
The 150 nt transcript appeared to be generated from within the 581 bp B. subtilis DNA cloned in pUCtglu since incubation of pUC8 with Eσ29 did not result in a detectable transcript. To confirm that the 150 nt transcript was encoded by the 581 bp B. subtilis DNA fragment that was cloned in pUCtglu. this transcript was eluted from a PA-urea gel and allowed to hybridize to the DNA fragments that were generated by cleavage of pUCtglu with EcoRI and Seal. Cleavage of pUCtglu with
EcoRI and Seal separates the plasmid into two fragments. one of which is a 530 bp fragment that contains most of the original 581 bp B. subtilis DNA fragment which was cloned in pUCtglu. After separation of the two DNA fragments by electrophoresis. the DNA was transformed to nitrocellulose. Southern (1975) J. Mol. Biol.
98: 503-517. The 150 nt transcript hybridized to the 530 bp DNA fragment and not to the larger DNA fragment that contains the pUC8 derived portion of pUCtglu. indicating that the transcript was encoded by the B. subtilis derived 581 bp DNA fragment in pUCtglu.
RNA was synthesized from 8 μg of supercoiled pUCtglu with Eσ 29 as described previously. Tatti et al., (1985) Gene 36:151-157. After ethanol precipitation, this RNA was allowed to hybridize with
0.4 μg of 32P-labelled pUCtglu DNA (labelled at the
5' terminus of the EcoRI site according to Berkner et al., 1977. J. Biol. Chem. 252:3176-3180) and subsequently treated with S1 nuclease as described previously. Ray et al., (1985) J. Bacteriol.
163:610-614. The S1 treated hybrid was denatured and subjected to electrophoresis in an 8% PA - 8.3M urea gel. Moran et al. (1981). supra. The end labelled DNA also was hybridized with yeast RNA or with nonlabelled supercoiled pUCtglu DNA. End labelled DNA that was not treated with SI was also run.
The 5' terminus of the 150 nt transcript within the 581 bp Hpal-EcoRI DNA fragment, was then mapped according to the SI nuclease mapping procedure of Moran et al. (1981) Cell 25:783-791. The size of the labelled DNA that was protected from S1 nuclease was determined by electrophoresis into a PA-urea gel. A more rapidly migrating minor band also was detected in the same lane, but probably was an artifact since it could be produced by protecting the labelled probe with supercoiled pUCtglu DNA. The protected DNA fragment was not detected in a control experiment where no RNA was added. The products of the dideoxy sequencing reactions from this region of the plasmid were used as size markers when measuring the length of the S1 nuclease protected fragment. These dideoxy reaction products were synthesized from a primer located downstream from the EcoRI site and subsequent cleavage of the products by EcoRI before electrophoresis. Kudo et al., (1985) J. Bacteriol. 161:158-163. The length of the protected fragment mapped the 5' terminus of the RNA to the nucieotide labelled +1 in Figure 1. In vivo mapping placed the start site as early as the G or A corresponding to the -1 or -2 in Figure 1.
Dinucleotides capable of priming transcription in vitro (in the presence of limited concentrations of ribonucleosides triphosphates) were used to confirm the start point of transcription. See Minkley & Pribnow (1973) J. Mol. Biol. 77: 255-277; Moran et al. (1981). supra. Transcripts were generated from linearized pUCtglu by Eσ29 in presence or absence of dinucleotide. as described in Moran et al. (1981). supra. In the presence of only 2 μM ribonucleotide triphosphates. the transcript was not initiated. The transcript was generated when 120 uM ATP was added to the mixture. Of the 15 dinucleotides tested (150 μM each), only ApA and GpA primed transcription. This was in good agreement with the start point determined by the in vivo S1 mapping experiment since the sequence G or A was found at this position (see Fig. 1).
B. subtilis was then tested for the presence of RNA transcripts corresponding to the above in vitro transcripts, especially cells that had begun to sporulate since that is the time of Eσ29 abundance.
RNA was prepared from B. subtilis SMY grown in Difco sporulation medium during the exponential growth phase
(mid log), one hour after the end of exponential growth
(T1) and two hours after the end of exponential growth
(T2) as described previously. Ray et al. (1985) J.
Bacteriol. 163:610-614. This RNA was used in S1 mapping experiments similar to those described above, however the DNA was uniformly labelled with [α- 32P]dCTP to a higher specific activity in order to increase the changes of detecting low level transcription from this region. A 582 bp Hpal-EcoRI fragment of B. subtilis DNA that contained the bvx promoter was cloned between the
Smal and EcoRI sites of M13mp19. An oligonucleotide
(5'CCGCTTTTGCCATTCAGCTC3') that was complementary to the region located 105 nt downstream from the bvx promoter was used to prime dideoxynucleotide sequencing reactions. The products of these reactions were subjected to electrophoresis into a PA urea gel and visualized by autoradiography. A single-stranded DNA probe of high specific activity (109 cpm/ug) was produced by extension of the oligonucleotide primer in vitro with DNA polymerase (Klenow) in the presence of 800 (Ci/mM)[α-32P]dCTP. This single-stranded probe was purified by electrophosesis on a PA-urea gel after cleavage with TagI and denaturation. This probe was digested with SI nuclease after incubation in hybridization buffer (Gilman and Chamberlin. 1983) with RNA that was isolated from B. subtilis SMY during exponential growth, one hour after exponential growth and two hours after exponential growth. In other reactions, the probe was digested with SI nuclease after incubation with E. coli RNA or no RNA.
As expected, RNA isolated from T1 and T2 cells, but not mid log cells, protected the DNA from digestion by S1 nuclease. The data indicated that expression at T1. was minimally above background, but quite substantial at T2. The size of the protected DNA was determined by electrophoresis into a high resolution PA-urea gel next to the dideoxy sequencing reaction products of this DNA. The size of the protected DNA was within 1 nucleotide of that expected for a transcript which was initiated from the bvx promoter by Eσ29
II.
The following example is directed to the production of a synthetic bvx promoter sequence and its use in an expression vector.
Two complimentary strands of oligonucleotides. with HindlII overhangs at the 5' ends, spanning the bvx promoter region (Figure 2) were constructed using an Applied Biosystems' Model 380A DNA synthesizer according to manufacturer's instructions (the downstream ligation will not regenerate a HindlII site due to the substitution of T for A). The two strands were gel purified (7M urea. 8% polyacrylamide). boiled for 5 minutes in equi-molar concentrations (100 pmoles/strand) and allowed to cool to room temperature to produce ds oligomers. These were then phosphorylated at the 5' end with T4 polynucleotide kinase by standard techniques.
The promoter probe expression vector pCED6 can be used to fuse suspected promoter sequences to the E. coli β-galactosidase coding sequence at a Hindlll site. This plasmid also contains both E. coli and B. subtilis replicons. Its construction is described in Donnelly & Sonenshein (1984) J. Bacteriol. 157:965-967. Plasmid pCED6 was cut with Hindlll at 37°C for 1 hour and then treated with bacterial alkaline phosphatase for 1 hour at 65°C to prevent religation of the vector onto itself. The double-stranded promoter oligomer was then inserted into the Hindlll site of pCED6 by treatment with T4 DNA ligase (overnight at 16ºC) in standard buffer conditions. The resulting recombinants were transformed into E. coli strain JM101 using the CaCl2 methods as described in Maniatis et al., supra.
Bacterial colonies were transferred from agar plates onto a nitrocellulose filter by standard techniques. Positive clones were selected by probing with a 32P end-labelled single strand of bvx oligomer insert (2 x 106 cpm/filter). Hybridization of the filters was performed according to the polyethylene glycol method of R.M. Amasino (1986). Analytical
Biochem. 152:304-307. Filters were then washed three times in 2x SSC and 0.1% SDS for a total of 30 minutes.
Positive colonies were grown in liquid 2xYT media (10 g/l Tryptone. 5 g/l yeast extract. 5 g/l NaCl) and the plasmids harvested by standard SDS lysis procedure.
Maniatis et al., supra. Plasmids were then transformed into B. subtilis strain PSL1 by the following protocol. B. subtilis strain PSL1 was grown in 30 ml of Penassay medium. When the culture was still in log phase, an aliquot of 7.5 ml was asceptically centrifuged at 8.000K. 4°C for 10 min. The resulting pellet was resuspended in 1 ml of Spizizen medium 1 (Spiz I). This medium consists of 1x Spizizen salts (see J. Spizizen. Proc. Nat'l Acad. Sci. USA 44: 1072 (1983)) plus 0.02% casein amino acids. 0.01% yeast extract. 0.6% glucose. 0.05 mg/ml of tryptophan. arginine. leucine and theonine, and 0.02 mg/ml histidine. The resuspended pellet was used to adjust 10 ml of Spiz I. in a side arm flask, to a Klett reading of 30. The flask and contents were incubated at 37°C in a water bath with vigorous shaking. The cells were grown 45 min. past break point out of exponential phase. The entire culture was diluted with 90 ml of prewarmed Spiz II medium (Spiz II medium is Spiz I + 0.5 mM CaCl2 & 2.5 mM MgCl2) and incubated at 37°C. for 90 min. Cells were now considered to be maximally competent. At this point. 1 ml of 0.1 M EGTA was added to the cell suspension. The incubation was continued for 5 min., 37ºC. The culture was cooled in an ice slurry and centrifuged asceptically at 4°C. 10 min., 8,000 x g. The pellet was resuspended in 10 ml Spiz II + 1 mM EGTA
(10x cells). In sterile plastic tubes. 0.5 ml of 10x cells and 1-2 μg of pCED6 (with the synthetic Eσ 29 insert) were incubated 60 min., 37°C. with aeration. At the end of this incubation. 5 ml of Penassay was added and the suspension was centrifuged at 5K. 10 min., 4°C.
The pellet was resuspended in 0.5 ml of Penassay.
Transformants were then plated directly onto agar containing kanamycin (5 μg/ml) and 40 μg/ml of
Bluo-gal (BRL). A number of colonies were a deep intense blue, indicating that the bvx promoter is a very strong promoter in Bacilli.
III.
The following examples describes the construction of an expression vector with convenient insertion sites downstream of the promoter for selected coding sequences. The construction is shown schematically in Figure 3.
For convenience, cloning is done in E. coli strain JM101. A 203 bp TaqI restriction fragment is isolated from the rrnB operon. It contains the terminator region for tRNA gene cluster of rrnB fragment. Green & Void (1983) Nucl. Acids Res. 11: 5763-5774. The terminator fragment is cloned into the AceI site of phage M13mp18 (BRL). Clones having the proper orientation (5' end of terminator sequence proximal to the Sall site of M13) are then cut with Hindlll and PstI are ligated with a synthetic ribosome binding site (rbs) for B. subtilis having a Hindlll overhang at its 5' end and a 3' Pstl overhang. The rbs fragment also has an EcoRI site between the PstI end and the rbs site (Figure 4).
Clones having the synthetic rbs fragment are then cut with Hindlll and then ligated with the synthetic bvx promoter fragment from Example II (Figure 2). Those having the proper orientation (3' end of promoter proximal to the 5' end of rbs fragment) are selected, cut with Hindlll and Xmal, and the ca 300 bp fragment containing the promoter/rbs/terminator cassette isolated. A new plasmid is created from pMK3 (Sullivan et al. (1984). Gene 29:21-26) by restriction with Eco RI to remove a small Eco RI fragment, blunt ending the plasmid with SI nuclease and religating. This creates a modified pMK3 (pMK3ΔEco) without any Eco RI sites.
The Eσ 29 cassette is then ligated into the
Hindlll-Xmal sites of this plasmid to give expression vector pS29P.
Plasmid pS29P is a shuttle vector, having both E. coli and B. subtilis origins of replication. It isca 7.6 kb, and is Ampr in E. coli, and Kmr in B. subtilis. There is a unique PstI cloning site for selected cloning sequences downstream from the rbs. There is also a convenient EcoRI site for the insertion of coding sequences adjacent to the PstI site.
IV.
The following example describes the construction of expression vectors with heterologous coding sequences under the control of the bvx promoter.
A synthetic gene for human connective tissue activating peptide (CTAP-III) is prepared by standard methods of automated DNA synthesis based on the amino acid sequence given in Castor et al. (1983) Proc. Nat'l Acad. Sci. USA 80:765-769. A possible DNA sequence is shown in Figure 5. The CTAP-III gene is synthesized to have a 5' EcoRI linker and a 3' PstI linker, as shown in the figure.
The synthetic gene is cloned into EcoRI- and Pstl-cut pS29P (Example III), and transformed into E. coli as described above. Plasmids are then isolated from Ampr colonies and used to transform B. subtilis strain PSL1. Ostroff & Pene (1983) J. Bacteriol. 156:934-936. Colonies are screened 2-4 hours after sporulation begins for expression of CTAP-III. Colonies are screened by testing cell lysate for CTAP-III activity (Castor et al., supra). or by screening with a monoclonal antibody to CTAP-III produced by standard methods. Alternatively isolated RNA is screened by hybridization to a CTAP-III probe.
V.
This example is directed to the construction of an expression vector having heterologous protein that is secreted by a Bacilli under the control of the bvx promoter.
Wong et al. (1984) Proc. Nat'l Acad. Sci. USA 81:1184-1188. discloses the DNA sequence of the B. subtilis subtilisin E gene (Figure 2 therein). A synthetic gene is prepared having the disclosed sequence with the following modif ications : the sequence -5 through -1 is changed to 5'-AGCTT-3' to provide a Hindlll overhang, and the sequence 5'TAGTAACTGCAG-3' is added as +484 to +495 to provide a PstI overhang. This synthetic gene, including its ribosome binding site, is cloned into pMK3, as described above. E. coli is transformed and Amp colonies selected. Plasmid DNA is isolated from these colonies and then cut with Hindlll. The cut plasmid DNA is then ligated with the synthetic bvx promoter fragment, and B. subtilis PSL1 transformed therewith. Kanamγcin resistant colonies are then screened for subtilisin by a bioassay. immunoassay. or RNA hybridization according to standard methods.
Variations of the above specific embodiments, particularly in the choice of coding sequence, host, and vector are readily within the skill of the ordinary artisan and do not depart from the scope of the present invention as described in the following claims.

Claims

1. A vector comprising a double-stranded DNA segment, said DNA segment comprising, in the 5' to 3' direction on the untranscribed strand, the elements:
(i) a bvx promoter: (ii) a ribosome binding site: (iii) a first restriction site suitable for cloning a coding sequence; and (iv) a transcription termination sequence, said elements being positioned and oriented such that a coding sequence cloned into said first restriction site is expressible under the control of said elements in a
Bacillus transformed with said DNA segment in the presence of Eσ 29
2. The vector of claim 1 wherein said bvx promoter is the sequence:
Figure imgf000032_0001
where Ns is a double-stranded spacer sequence of s base pairs length, s being from about 13 to about 15.
3. The vector of claim 1 capable of replication in B. subtilis.
4. The vector of claim 1 wherein said bvx promoter is substantially homologous to the naturally occurring promoter.
5. The vector of claim 1 further comprising a second restriction site adjacent to said first restriction site and recognized by a restriction endonuclease other than the restriction endonuclease that recognizes said first restriction site.
6. The vector of claim 1 further comprising a start codon between said ribosome binding site and said first restriction site.
7. The vector of claim 6 further comprising a DNA sequence encoding a secretory signal sequence between said start codon and said first restriction site.
8. The vector of claim 1 further comprising a coding sequence heterologous to said bvx promoter ligated into said first restriction site.
9. The vector of claim 8 wherein said coding sequence encodes a mammalian protein.
10. A shuttle vector according to claim 1.
11. The vector of claim 1 wherein said bvx promoter comprises the sequence:
5'-TCGAATAAATACTATAAATGAAAACTATGATGTCAGAAT-3' 3'-AGCTTATTTATGATATTTACTTTTGATACTACAGTCTTA-5'
12. A bacterium of the genus Bacillus, the genome of which comprises a double-stranded DNA segment, said DNA segment comprising, in the 5' and 3' direction on the untranscribed strand. the elements: (i) a bvx promoter:
(ii) a ribosome binding site;
(iii) a coding sequence heterologous to said bvx promoter: and
(iv) a transcription termination sequence, said elements being positioned and oriented such that said coding sequence is expressed under the control of said elements in said Bacillus in the presence of Eσ29 .
13. A B. subtilis according to claim 12.
14. A bacterium according to claim 12 wherein said DNA segment is contained in a plasmid that can replicate in said bacteria.
15. The bacterium of claim 12 wherein said coding sequence is for a procaryotic polypeptide.
16. The bacterium of claim 15 wherein said procaryotic polypeptide is a Bacillus polypeptide.
17. The bacterium of claim 12 wherein said coding sequence encodes a mammalian polypeptide.
18. A method of producing a recombinant protein comprising growing a Bacillus culture comprising bacterium according to claim 12. and recovering the polypeptide encoded by said coding sequence from said culture after the induction of Eσ29.
19. A method of producing a recombinant protein comprising growing a Bacillus culture comprising bacterium according to claim 13, and recovering the polypeptide encoded by said coding sequence from said culture after the induction of Eσ29.
20. A method of producing a recombinant protein comprising growing a Bacillus culture comprising bacterium according to claim 14. and recovering the polypeptide encoded by said coding sequence from said culture after the induction of Eσ29.
21. A method of producing a recombinant protein comprising growing a Bacillus culture comprising bacterium according to claim 15. and recovering the polypeptide encoded by said coding sequence from said culture after the induction of Eσ29.
22. A method of producing a recombinant protein comprising growing a Bacillus culture comprising bacterium according to claim 16, and recovering the polypeptide encoded by said coding sequence from said culture after the induction of Eσ29.
23. A method of producing a recombinant protein comprising growing a Bacillus culture comprising bacterium according to claim 17, and recovering the polypeptide encoded by said coding sequence from said culture after the induction of Eσ 29.
PCT/US1987/002113 1986-09-17 1987-08-28 Expression vectors for bacilli WO1988002025A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US90836886A 1986-09-17 1986-09-17
US908,368 1986-09-17

Publications (1)

Publication Number Publication Date
WO1988002025A1 true WO1988002025A1 (en) 1988-03-24

Family

ID=25425678

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1987/002113 WO1988002025A1 (en) 1986-09-17 1987-08-28 Expression vectors for bacilli

Country Status (1)

Country Link
WO (1) WO1988002025A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002002766A2 (en) * 2000-06-29 2002-01-10 E.I. Dupont De Nemours And Company Natural promoters for gene expression and metabolic monitoring in bacillus species
US7413877B2 (en) * 2003-11-06 2008-08-19 Genencor International, Inc. Bacterial expression of bowman-birk protease inhibitors and variants thereof
US7772181B2 (en) 2008-10-15 2010-08-10 Danisco Us Inc. Personal care compositions comprising modified variant Bowman Birk Protease Inhibitors
US7803902B2 (en) 2008-10-15 2010-09-28 Danisco Us Inc. Modified variant bowman birk protease inhibitors
CN114292867A (en) * 2021-12-31 2022-04-08 淮阴工学院 Bacillus expression vector and construction method and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Gene, Volume 37, 1985, Elsevier Science Publishers, C.J. GREEN et al.: "Nucleotide Sequence of the Bacillus Subtilis Ribosomal RNA Operon, rrnB", pages 261-266 *
Gene, Volume 48, Nos. 2,3, 1986, Elsevier Science Publishers B.V., (Biomedical Division), R.E. HAL et al.: "Promoter used by Sigma-29 RNA Polymerase from Bacillus Subtilis", pages 301-306 see the whole document *
Nucleic Acids Research, Volume 11, No. 18, 1983, IRL Press Limited, (Oxford, GB),G.C. STEWART et al.: "DNA Sequence of the Tandem Ribosomal RNA Promotor for B. Subtilis Operon rrnB", pages 6289-6300 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002002766A2 (en) * 2000-06-29 2002-01-10 E.I. Dupont De Nemours And Company Natural promoters for gene expression and metabolic monitoring in bacillus species
WO2002002766A3 (en) * 2000-06-29 2003-01-09 Du Pont Natural promoters for gene expression and metabolic monitoring in bacillus species
US6617148B2 (en) 2000-06-29 2003-09-09 E. I. Du Pont De Nemours And Company Natural promoters for gene expression and metabolic monitoring in bacillus species
US7413877B2 (en) * 2003-11-06 2008-08-19 Genencor International, Inc. Bacterial expression of bowman-birk protease inhibitors and variants thereof
US7696173B2 (en) 2003-11-06 2010-04-13 Danisco Us Inc. Compositions comprising bowman-birk protease inhibitors and variants thereof
US7772181B2 (en) 2008-10-15 2010-08-10 Danisco Us Inc. Personal care compositions comprising modified variant Bowman Birk Protease Inhibitors
US7803902B2 (en) 2008-10-15 2010-09-28 Danisco Us Inc. Modified variant bowman birk protease inhibitors
US7947475B2 (en) 2008-10-15 2011-05-24 Danisco Us Inc. Modified variant Bowman Birk protease inhibitors
US8394941B2 (en) 2008-10-15 2013-03-12 Danisco Us Inc. Modified variant Bowman Birk Protease Inhibitors
US8962796B2 (en) 2008-10-15 2015-02-24 Danisco Us Inc. Modified variant Bowman Birk protease inhibitors
CN114292867A (en) * 2021-12-31 2022-04-08 淮阴工学院 Bacillus expression vector and construction method and application thereof
CN114292867B (en) * 2021-12-31 2024-01-23 淮阴工学院 Bacillus expression vector and construction method and application thereof

Similar Documents

Publication Publication Date Title
US5352604A (en) Alkaline proteolytic enzyme and method of production
US5093257A (en) Hybrid prokaryotic polypeptides produced by in vivo homologous recombination
Projan et al. Replication properties of pIM13, a naturally occurring plasmid found in Bacillus subtilis, and of its close relative pE5, a plasmid native to Staphylococcus aureus
Kenney et al. Genetic evidence that RNA polymerase associated with sigma A factor uses a sporulation-specific promoter in Bacillus subtilis.
Gonzy-Tréboul et al. Developmental regulation of transcription of the Bacillus subtilis ftsAZ operon
Yang et al. Identification of the pleiotropic sacQ gene of Bacillus subtilis
US4666848A (en) Polypeptide expression using a portable temperature sensitive control cassette with a positive retroregulatory element
US4910141A (en) 3'-expression enhancing fragments and method
Connors et al. Cloning and nucleotide sequencing of genes for three small, acid-soluble proteins from Bacillus subtilis spores
JP2002504379A (en) Production of polypeptides in Bacillus cells
US5175101A (en) Recombinant restriction enzyme sau3ai
AU643511B2 (en) Bacterial vectors
US4801537A (en) Vector for expression of polypeptides in bacilli
EP0195078A1 (en) Bacillus strains with reduced extracellular protease levels
EP0817856A1 (en) Introduction of dna into bacillus strains by conjugation
Zukowski et al. Hyperproduction of an intracellular heterologous protein in a sacUh mutant of Bacillus subtilis
Popham et al. Cloning, nucleotide sequence, mutagenesis, and mapping of the Bacillus subtilis pbpD gene, which codes for penicillin-binding protein 4
Gholamhoseinian et al. Regulation of transcription of the cell division gene ftsA during sporulation of Bacillus subtilis
CA1311429C (en) Vector for polypeptides in bacilli
Schoner et al. Enhanced expression of mouse dihydrofolate reductase in Bacillus subtilis
Hackett et al. Cloning, nucleotide sequencing, and genetic mapping of the gene for small, acid-soluble spore protein gamma of Bacillus subtilis
WO1988002025A1 (en) Expression vectors for bacilli
US5612192A (en) DNA base sequence containing regions involved in the production and secretion of a protein, recombinant DNA including the whole or a part of the DNA base sequence, and method of producing proteins by use of the recombinant DNA
US4654307A (en) Novel bacteria containing a plasmid having a tRNA code
Meinhardt et al. Cloning and sequencing of the leu C and npr M genes and a putative spo IV gene from Bacillus megaterium DSM319

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BE DE FR GB IT NL