WO1988000975A1

WO1988000975A1 - High level inducible expression of heterologous genes

Info

Publication number: WO1988000975A1
Application number: PCT/US1987/001871
Authority: WO
Inventors: Randal J. Kaufman; David Israel
Original assignee: Genetics Institute, Inc.
Priority date: 1986-08-01
Filing date: 1987-07-31
Publication date: 1988-02-11
Also published as: JPH02500161A; AU7802587A; EP0318500A1; EP0318500A4

Abstract

A method for producing high level expression of a selected protein and stable cell lines useful therein. This method involves culturing a cell line containing amplified copies of a cDNA sequence encoding a steroid or other ligand receptor, and amplified copies of a vector comprising an expression control sequence (incuding a promoter) which is responsive to the complex of said ligand and its receptor in operative association with a selected exogenous protein, in the presence of the ligand.

Description

HIGH LEVEL INDUCIBLE EXPRESSION OF HETEROLOGOUS GENES

This invention relates generally to a novel expression system for obtaining high level inducible expression of selected heterologous genes. More specifically, the invention discloses host cells which express high levels of a receptor for a ligand and contain a DNA sequence encoding a heterologous protein operatively linked to a transcriptional control element responsive to the presence of the legand-receptor complex. These host cells are capable of high level expression of the heterologous gene upon induction by the addition of the ligand to the culture medium.

BACKGROUND

Steroid hormones, such as estrogen, progesterone, testosterone, and the glucocorticoids, as well as the hormone thyroxin and compounds such as dioxin regulate the expression of responsive genes through interaction with a cytoplasmic soluble receptor protein. This receptor protein in turn interacts with the genome. Although the mechanism by which this interaction alters expression is unknown, it does increase the transcription rate of specific genes. Both genetic and biochemical evidence has suggested that specific DNA binding may be involved in eliciting a biological response.

One representative receptor protein, the glucocorticoid receptor, is widely distributed and expressed in many cultured cell lines. The control of gene expression by glucocorticoids has been widely studied as a model for transcriptional regulation. A number of gluσocorticoid-responsive transcription units have been identified including mouse mammary tumor virus (MMTV) , mouse and human metal lothionine, rat alpha 2u-globulin, and rat and human growth hormone. [See, e.g., Hollenberg et al, Nature , 318:365 (1985)]. The DNA sequences mediating the transcriptional induction via the glucocorticoid receptor-hormone complex are rapidly being identified. In particular, the MMTV long terminal repeat (LTR) contains specific DNA sequences identified to bind the hormone-receptor complex (See, e.g., Payvar, F. et al., 1983, Cell 35..381-392) . For the MMTV-LTR these sequences are upstream from the transcription start site and appear to act independent of orientation and position. Based on footprinting analyses, a consensus DNA binding sequence sharing the core sequence 5 ' TGT/CTCT 3 ' has been proposed (Karin, M. et al., 1984, Nature 308:513-519) .

In general, all cells express their endogenous gluco¬ corticoid receptor gene and thus have some capacity to respond to glucocorticoid. The glucocorticoid responsive element of the MMTV-LTR has been juxtaposed to several different genes in order to derive transcription units which, after introduction into mammalian cells expressing endogenous receptor protein, can be induced by the addition of a glucocorticoid such as dexa ethazone . Chandler V.L. et al., 1983, Cell 3.3:489-499; Lee, F. et al., 1981, Nature 294:228-232; Huang, A. L. et al., 1981, Cell 27:245-255; Groner B. et al . in Hormones and Cell Regulation. J.E. Dumont, J. Nunez, A. Scutz eds 6.: 217-228 (Elsever North Holland Biomedical Press, Amsterdam, 1982) . However, the response is generally very low and variable along the range of only a 3 to 10 -fold increase in ex¬ pression. One possible reason for the low level induction is that the level of glucocorticoid receptor protein is limiting in the transfected cells. BRIEF SUMMARY OF THE INVENTION

As one aspect of the present invention, a cell line is provided which is capable of high level expression of a selected heterologous gene in the presence of a selected ligand, e.g. steroid. The cell line (preferably eucaryotic, with mammalian being especially) contains multiple copies of a DNA sequence encoding a receptor protein for the selected ligand. The multiple copies of receptor coding sequence are obtained by amplifying the receptor gene in synchrony with a selectable, amplifiable marker. Selection of both the marker and specific receptor protein are within the skill of the art. The cell line is also characterized by a vector which contains the DNA sequence coding for the selected heterologous gene in operative association with a- transcriptional control sequence including an element responsive to the presence of the ligand-reσeptor protein complex. Preferably the transcriptional control sequence comprises a promoter which is responsive to an enhancer when the enhancer is induced by the presence of the ligand-receptor complex. Thus, in the presence of the complex, the enhancer is induced resulting in increased promotor efficiency or activity, and thus, an increased rate of transcription of the heterologous gene. The selection of a responsive transcriptional control sequence depends on the initial choice of the receptor protein. Several receptor protein/ responsive transcriptional control sequence combinations have been reported in the art. An alternative preferred embodiment of the host cell of the present invention contains multiple copies of the responsive transcriptional control sequence and associated heterologous gene. Multiple copies are obtained by amplification of gene copy number using a selectable amplifiable marker which is the same as , or preferably different from the marker associated with the receptor-encoding DNA sequence.

Another aspect of the present invention involves a method for obtaining inducible high level expression of the heterologous protein. The method involves culturing the host cells of the present invention in the presence of an effective amount of an appropriate ligand for the receptor. When the host cells of this invention are cultured in the presence of an effective amount of the ligand, the ligand comp lexes with the receptor protein . Th i s comp l ex activates the responsive transcriptional control element, resulting in high levels of expression of the selected heterologous gene (cDNA or gemomiσ DNA) , and high levels of production of the heterologous protein.

A further aspect of this invention involves placing the selectable , amplif iable marker associated with the heterologous gene ( and optionally the marker associated with the receptor gene as well ) under the control of a transcriptional control sequence containing an element which is responsive to the presence of the ligand-receptor complex. Amplification of the marker gene, and concurrent coamp l i f iσat ion of the heterologous gene may then be conducted initially in the presence of the inducing ligand, and subsequently in decreas ing amounts o f inducer , resulting in a cell line with highly amplified copies of the selectable and heterologous genes .

H et er o l o g ou s p rote ins inc lude among o thers thrombolytic agents such as human tissue-type plasminogen activator (t-PA) and urokinase (u-PA) ; coagulation-related proteins such as human Factor VIII : c , Factor IX, anti- throm in III and Von Willebrand factor; erythropoietin; superoxide dismutase; thro bomodulin; ly phokines such as interleukins , interferons , tumor necrosis factor and colony stimulating f actors including GM-CSF , G-CSF , M-CSF , ulti-CSF, meg-CSF, CSF-1, etc.; growth hormones such as human, bovine, etc. growth hormones; and variants of such proteins.

DETAILED DESCRIPTION OF THE INVENTION

The present invention involves a cell line or host cell which is capable of expressing high levels of a heterologous gene through use of a receptor protein-ligand complex which operates to "turn-on" a responsive transcriptional control sequence containing a responsive element linked to the heterologous gene. The cell line may be produced in the following preferred manner. An expression vector is constructed containing a DNA sequence encoding the receptor protein and a selectable-amplifiable gene, such as adenosine deaminase (ADA) [See, e.g. R.J. Kaufman et al., Proc Natl ' 1 Acad. Sci USA, 8_3.:3136 (1986)] or dihydrofolate reduσtase (DHFR) [See, Kaufman et al., Mol. Cell Biol. 5:1750-1759 (1985)]. The receptor may be chosen from among those known to one of skill in the art, e.g. , receptors for estrogen, progesterone, testosterone and glucocorticoids. These receptors are known to be expressable in many cell lines. [See, e.g., Hollenberg, supra] .

Suitable cells or cell lines to be transformed with this first vector are preferably stable mammalian cells, such as Chinese hamster ovary cells (CHO) deficient in the gene for DHFR. Another suitable mammalian cell line, is the monkey COS-1 cell line. A similarly useful mammalian cell line is the CV-1 cell line. Also useful in the practice of this invention are HeLa cells, melanoma cell lines such as the Bowes cell line, mouse L cells, mouse fibroblasts, mouse NIH 3T3 cells, human hepatoma Hep G2 cell lines, mouse myeloma cell lines, and the like, depending upon the other requirements placed upon the cell line. Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention.

Upon transformation with this first expression vector, the cell population is exposed to environmental pressure sufficient to require the cell to produce more copies of the amplifiable gene, e.g. ADA, for survival. [See, e.g. C. Yeung et al. , J. Biol. Chem, 258:8330 (1983)] The cells are examined for the presence of the marker and those cells which have successfully incorporated the marker DNA will exhibit the marker identity. Thus when trans¬ forming a cell with a vector containing marker gene and an exogenous gene, the selectable marker enables the identi¬ fication of those cells which have incorporated the first vector from those cells which have not.

Once the host cell or cell line is transformed with the first vector containing marker DNA and the gene coding for the receptor protein, and desired transformants are selected, they are screened for ligation of the receptor gene into their chromosomes or for expression of the receptor protein itself. Screening for ligation of the receptor gene can be accomplished using Southern blot analysis. Screening for expression of the receptor protein can utilize standard immunological or biological assays. Once the transformants have been identified, expression of the receptor gene can be amplified by subculturing the cells containing the first vector which also encodes the selectable amplifiable gene in the presence of a selection agent in constant or increasing amounts. Transformation of the host cells containing the amplifiable marker and receptor protein coding sequence and amplification thus yields cells which produce high levels of the receptor protein for the desired ligand.

A second vector is constructed which contains a transcriptional control sequence containing an element responsive to the ligand-receptor complex, the transcriptional control sequence being in operative association with a heterologous gene desired to be expressed at high levels. For optimal expression, the second vector may also contain a selectable amplifiable marker, the same, or preferably distinct from, the marker contained within the first vector. This second vector is transformed into the same host cell line which now contains multiple copies of the transcription unit for the receptor protein. If the second vector contains an amplifiable marker, it can- be amplified in the host by growth selection as described above, so that the resulting cells contain multiple copies of the transcription unit for the hetero¬ logous protein as well as multiple copies of the transcription unit for the receptor. It should be noted that in the practice of this invention, transcription units may in general contain either cDNA or genomic DNA encoding the desired receptor protein, marker and heterologous protein as well as a transcriptional control sequence in operative association- therewith.

Alternatively, the amplifiable marker associated with the DNA encoding the heterologous protein, and optionally the marker associated with the. receptor gene as well, can be placed under control of the inducible element, i.e. under the transcriptional control of the responsive transcriptional control sequence. Amplification of the marker gene initially occurs in the presence of the inducing ligand, e.g. steroid. Cells are subsequently selected in increasing concentrations of cytoxic agents to amplify the selectable marker, e.g. as is known in the art. When maximum amplification of the selectable gene has been achieved using methods that are within the skill of the art, the concentration of inducing ligand is gradually reduced e.g. stepwise. Cells that further amplify the inducible selectable marker under submaximal concentrations of ligand will thus be obtained. Inclusion of a second. heterologous gene during the amplification procedure yields a cell line highly amplified in both genes.

It should be further understood that the host cells may be transformed with the two vectors in either order, or may be transformed with both vectors simultaneously, with the two vectors linked to one another or unlinked. The two vectors may contain the same or different selectable, amplifiable markers and may be amplified in either order or simultaneously. If the transformants are obtained by sequential introduction of two ^'vectors, it is preferable to have two independently selectable markers, one in each vector. In one embodiment, the receptor gene is operatively linked to a transcriptional control sequence which is itself responsive to the ligand-receptor complex. In that embodiment expression both of the receptor gene and of the gene encoding the heterologous protein is induced by the presence of the ligand for the receptor.

The vectors for use in producing the cells or cell lines useful in the method of the present invention are preferably supercoiled, double-stranded circular constructs, the form in which vectors are obtained from the standard prokaryotiσ cloning procedure. However, the vectors may be linearized, i.e., covalently cleaved at one point, incidental to other steps such as ligation to genomic accessory DNA. Various vector systems including bovine papilloma virus or retrovirus systems can be used in developing the cell line provided they express the marker gene at a level above that expressed by cells containing an endogenous marker gene. Preferably at least 5-times greater expression is desired, more preferably at least 10-times.

Two classes of vectors can be employed in transformation herein — unlinked and linked vectors. Transformation with unlinked vectors, that is, one vector containing the selectable marker gene and another vector containing the desired receptor protein gene, can be accomplished simultaneously. Methods for facilitating cellular uptake of DNA are well known to those skilled in the art. However, to most effectively obtain coamplif ication of the marker and receptor gene in the first instance, or the marker gene, promoter gene and heterologous gene, in the second instance, the use of linked vectors is preferred. In the first instance, the coding strands of the marker and receptor genes are preferably joined by directly ligating the receptor stop codon adjacent to and upstream from the marker gene start codon, i.e., to produce a vector encoding a polycistronic transcription unit. The genes may be ligated through an oligodeoxyribonucleotide bridge. The bridge should be free of termination or start codons, and of palindromes, to reduce the probability of forming RNA hairpin loop. Preferably, the components of the second vector should be similarly closely ligated in a linked vector. In alternative embodiments employing unlinked vectors, the vector containing the amplifiable marker gene may also contain the enhancer for the promotor of the transcriptional control sequence associated with the heterologous or receptor gene of the companion vector. In such embodiments the promotor for the heterlogous or receptor gene, but not the promoter^' for the marker gene, is responsive to the enhancer present only in the vector containing the marker upon exposure to the ligand.

The first and second vectors can also contain one or more other elements such as enhancers, promoters, introns, accessory DNA, a polyadenylation site and three prime non-coding regions. [See Clark, S.C. et al., Proc. Natl.- Acad. Sci. USA 82.: 2541-2547 (1984); see also Kaufman, R.J., Proc. Natl. Acad. Sci. USA 82.:689-693 (1985)]. These may be obtained from natural sources or synthesized by known procedures. Basically, if the components found in DNA are available in large quantity, e.g., components such as viral functions, or if they are to be synthesized, e.g., polyadenylation sites, large quantities of vectors may be obtained with appropriate use of restriction enzymes by simply culturing the source organism, digesting its DNA with an appropriate endonuclease, separating the DNA fragments and identifying the DNA containing the element of interest and recovering the same.

In the method of the present invention, these cell lines are exposed to effective amounts of the appropriate ligand, which activates the transcriptional control element by complexing with the receptor proteins. One skilled in the art can determine the amount of ligand to add to the culture based on factors such as the binding constant for the ligand and receptors, the binding constant for the ligand-receptor complex and the transcriptional control element, the level of amplification in the host cell, the level of transcription desired and that observed at various ligand concentrations. A presently preferable amount is in the range of about 10~⁶ molar. The cell line of the present invention thus provides expression of the desired heterologous gene product at very high levels.

The following examples illustrate the invention.

EXAMPLE 1 Cloninσ the Glucocorticoid Receptor cDNA

All recombinant DNA techniques, unless specifically set forth herein, are performed as described in Maniatis et al. , Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, NY 1982) . The sequence of the human glucocorticoid receptor cDNA has been presented (Hollenberg et al., 1985, supra.. Two forms of the glucocorticoid receptor have been cloned; only the alpha form has been found to bind gluco¬ corticoid. In order to isolate a full length functional glucocorticoid receptor cDNA, the following approach is taken. A cDNA library is prepared in lambda phage GT10 from mRNA isolated from human liver by oligo dT priming for reverse transcriptase, addition of Xho I linkers, and ligation into lambda phage GT10 as follows. 5 micrograms of poly (A⁺) human liver RNA was reverse transcribed with urine reverse transcriptase (BRL) according to the sup¬ plier's recommendations. Following first strand synthesis the method detailed in Toole et al., 1984, Nature 312: 342-347 was used with the exception that the following EcoRI adaptors (containing an internal Xho site) were substituted for the EcoRI linkers.

5' AATTCCTCGAGAGCT 3 '

3' GGAGCTCTCGA-PO4 5' An aliqout of this library containing about 4 x 10⁵ recombinants was used for the screening. Hybridization conditions used were 6 x SSC, 0.1% SDS, 100 ug/ml denatured calf thy us DNA, 5 x Denhardts, 0.1 pmol/ml of [ ³²p] -labelled oligonucleotide . Hybridization was generally for 14 hours at 48 °C. Filters were then washed with 6 x SSC, 0.1% SDS for 1-2 hours at 48°C and autoradiographed for 14 hours.

The library thus constructed contains Xhol linkers at the 5* and 3' ends of the cDNA. Thus, full length clones can be excised from lambda phage by Xhol digestion (Xhol does not recognize any sites in the glucocorticoid receptor cDNA) , and the resultant inserts isolated for ligation into appropriate expression vectors. A ³²P-labeled 35-mer oligonucleotide (prepared by phosphorylation using gam a- 3²P-ATP and polynucleotide kinase) containing the sequence

5 • -CAGAGTTGATATTCACTGATGGACTCCAAAGAATC-3 ^« which spans the translation initiation codon for the glucocorticoid receptor cDNA is used to screen the cDNA library as described in Maniatis et al., supra. Positives are then isolated, replated, and screened with a radiolabeled (anti-sense) oligonucleotide containing the sequence

5'-GCAATAGTTAAGGAGATTTTCAACCAC-3 ' which is specific to the alpha form of the receptor.

Alternatively, the rat glucocorticoid receptor cDNA may be obtained by the method of, or using other conventional methods and the information provided by, R. Miesfeld et al., 1986, Cell 46.: 389-399.

EXAMPLE 2

Introduction of the Glucocorticoid Receptor cDNA into Mammalian Expression Vectors

The mammalian expression vector pMT2 Cla-Xho is a derivative of p91023(b) (Wong et al. , Science 228:810-815, 1985) differing from the latter in that it contains the ampiσillin resistance gene in place of the tetracycline resistance gene and further contains a Xhol site for insertion of cDNA clones. The functional elements of pMT2 Cla-Xho have been described (Kaufman, R.J. , 1985, Proc. Natl. Acad. Sci. USA 82.:689-693) and include the adenovirus VA genes, the SV40 origin of replication including the 72 bp enhancer, the adenovirus major late promoter including a 5' splice site and the majority of the adenovirus tripartite leader sequence present on adenovirus late mRNAs, a 3' splice acceptor site, a DHFR insert, the SV40 early polyadenylation site (SV40) , and pBR322 sequences needed for propagation in E. coli.

Plasmid pMT2 Cla-Xho is obtained by EcoRI digestion of pMT2-VWF, which has been deposited (29 May 1986) with the American Type Culture Collection (ATCC) , Rockville, MD (USA) under accession number ATCC 67122. EcoRI digestion excises the cDNA insert present in pMT2-VWF, yielding pMT2 in linear form. Plasmid pMT2 is digested with Xba and Eσo RV which removes a portion of the adenovirus VA region. The ends of the Xba/Eco RV-digested pMT2 DNA are rendered flush ended with Klenow fragment of DNA polymerase I and then ligated to a Clal linker. Plasmid DNA is then digested with EcoRI, blunted as above, and ligated to an EcoRI adapter,

5' P0₄-AATTCCTCGAGAGCT 3' 3¹ GGAGCTCTCGA 5' digested with Xhol, and ligated, yielding pMT2 Cla-Xho, which may then be used to transform E. σoli to ampicillin resistance. Plasmid pMT2 Cla-Xho DNA may be prepared by conventional methods.

The Xhol fragment containing the human glucocorticoid receptor cDNA sequence is isolated from the lambda GT phage and ligated to Xhol-digested pMT2 Cla-Xho DNA. Alternatively, the rat cDNA may be used as a Xhol fragment instead of the human cDNA. Ligated DNA is used to transform E. coli HB10I to ampicillin resistance. Colonies are screened by filter hybridization to ³²P-labeled oligonucleotides (as above) . Positively hybridizing clones are grown and DNA isolated for gel electrophoretic^' analysis after restriction endonuclease digestion. The proper orientation of the cDNA in the vector can be established by digestion with restriction enzyms such as EcoRI, Bglll, and PstI. One particular clone containing the appropriate orientation of the glucocorticoid receptor cDNA insert is designated pMT2-GRl.

The mammalian expression vector pMT2-ADA-VWF, which has been deposited (31 July 1986) with ATCC under accession number ATCC 67172, is also a derivative of pMT2-VWF. This vector is similar to pMT2 except it also contains the adenosine deaminase selectable, amplifiable marker gene. PMT2-ADA was constructed by isolating a Pvu II - Hinfl fragment from pSV2 ADA (la) (Orkin, S.H. et al., 1985, Mol. Cell. Biol. 5_:762-767) containing the SV40 early promoter and human ADA coding region, and inserting the fragment into a unique Xbal site in pMT2 which had previously been treated with Klenow fragment of DNA pol I in order to remove the 5 ' protruding ends . This generated an ADA tr an s c r i p t i o n un i t wh i ch ut i l i z e s th e S V40 l ate polyadenylation s ignal present in pMT2 . The VWF cDNA fragment was then inserted into the unique EcoRI cloning site to generate pMT2-ADA-VWF . The VWF coding segment is excised from pMT2 -ADA-VWF by EcoRI digestion and is replaced by the glucocorticoid receptor cDNA. The ends of the Xhol fragment of the glucocorticoid receptor cDNA fragment are rendered flush ended with Klenow fragment of DNA po lymerase I and then ligated to EcoRI synthetic adapters having sequence

5^«-AATTCCTCGAGAGCT-3 •

GGAGCTCTCGA-PO4-5' The resultant adapted fragment is ligated to the EcoRI digested and isolated vector fragment from pMT2-ADA-VWF and the resultant DNA used to transform E. coli DH5 to ampi¬ cillin resistance. Colonies are screened as above and DNA is prepared from positively hybriding clones and analyzed by restriction endonuclease digestion. The resultant expression plasmid containing the correct orientation of the glucocorticoid receptor cDNA insert is designated PMT2-ADA-GR1 and is similar to pMT2-GR except it also contains the ADA selectable marker (See below) .

EXAMPLE 3

Construction of Inducible Expression Vectors Utilizing: the Mouse Mammary Tumor Virus LTR

A. The expression plasmid pMMTV-LTR-CAT is constructed by introduction of the MMTV-LTR into the plasmid pSVO-Cat (ATCC No. 37153; Gorman et al., 1982, Mol. Cell. Biol. 2 % 1044-1051). The 1.4 kb PstI MMTV-LTR fragment from the left hand end of the MMTV genome contains all but a few base pairs of one LTR in addition to 135 bp coding for RNA beyond the 5' leader or "strong-stop" sequence [Donehower, L.A., Huang, A.L., and Hager, G.L., J. Virol. 37:226-238, (1981) . This fragment was treated with T4 DNA polymerase to remove the 5' protruding ends and the Hind III linkers were added by ligation with T4 DNA ligase. The fragment containing the Hind III linkers at its termini was then inserted into the unique Hindlll site of pSVO-Cat and the resultant DNA used to transform E. coli HB101 to ampicillin resistance. Colonies were screened for proper orientation of the inserted MMTV-LTR. One resultant correct plasmid has been designated pMMTV-LTR-CAT. It should be noted that several suitable cloned MMTVs are available from ATCC.

The expression plasmid pMMTV-LTR-D26 is constructed as follows. Plasmid pAdD26SVpA(3) which contains a mouse DHFR cDNA under control of the adenovirus MLP and includes the first leader exon nd 5' splice site from adenovirus late mRNA (Kaufman and Sharp, 1982, Mol. Cell Biol. 2 :1304-1319) is digested with EcoRI, treated with Klenow fragment of DNA polymerase I, and PstI linkers applied (Collaborative Res.). The DNA is then digested with PstI and the linear large fragment containing the DHFR coding sequence is isolated and ligated to the 1.4 kb PstI MMTV-LTR-containing fragment. The DNA is used to transform E.. coli to tetracycline resistance and recombinants containing the MMTV-LTR insert are identified by colony hybridization. Plasmid DNA is prepared and analyzed for proper orientation by restriction endonuclease digestion. The resultant plasmid having the insert in the proper orientation is digested partially with PstI, treated with T4 DNA polymerase, and the linear DNA isolated, ligated and used to transform E. coli in order to derive pMMTV-LTR-D26. It contains the SV40 origin of replication, the MMTV-LTR, the DHFR coding region, and SV40 early polyadenylation site, and the origin of replication and tetracycline resistance gene from pBR322. This plasmid contains a unique PstI site for insertion of cDNA clones immediatley downstream from the MMTV-LTR region.

The construction of pMMTV-LTR-GRI is as follows. pMMTV-LTR-D26 is digested with PstI and ligated to the synthetic adapter having the sequence.

5' TCGACAGGCTCGCCTGCA 3^! GTCCGAGCGG-PO4 5^! Then the glucocorticoid receptor cDNA-containing Xhol fragment is ligated to this DNA and used to transform E. coli HB101 to tetracycline resistance. The resultant colonies are screened for proper orientation of the insert with respect to the MMTV-LTR promoter.

The- construction of the Factor VIII expression plasmid pMMTV-LTR-VIII is as follows. Plasmid SP64-VIII (ATCC No. 39812, deposited 23 August 1984), which contains the full length factor VIII cDNA on a single Sail fragment-, is digested with Sail. The factor Vlll-encoding Sail fragment is then ligated to synthetic adapters having sequence:

5' TCGACAGGCTCGCCTGCA 3' GTCCGAGCGG-PO4 5^! and the factor VIII cDNA fragment isolated after agarose gel electrophoresis. The resultant DNA is ligated to PstI digested pMMTV-LTR-D26 and then used to transform E. coli to tetracycline resistance. Then the colonies are screened for the presence of the factor VIII insert by filter hybridization to a factor VIII probe and appropriate positives are grown for isolation of DNA. The orientation of the factor VIII cDNA in the expression plasmid is determined by restriction endonuclease analysis. The resultant plasmid is designated pMMTV-LTR-VIII.

B. Various derivatives of the expression vector pMT2 that contain on© or more inducible elements derived from the MMTV-LTR are constructed as follows. A portion of the LTR from the Haelll to SacI restriction endonuclease sites (nucleotides -225 to -105 relative to the start of transcription) is obtained from the LTR. An oligo¬ nucleotide, and its complimentary strand, containing sequence from the aforementioned Sad ^"site to nucleotide- 50 of the LTR, followed by sequences recognized by the restriction endonulease Bglll and containing an overhang compatible with an EcoRI site are chemically synthesized. The sequence of the resulting cassette is shown below:

σcjcaaccttgcg

CH.am) -+ + gggttggaacgc

gttcccaaggcttaagtaagtttttggttacaaaqtgttctjtaaaacgaggatgtgagac + + + !----+ + — . + caagggttccgaattcattcaaaaaccaatgtttgacaagaattttgctcctacactctg

aaaggatacaagaaaaccttaaataggtttagaatacatttatctagacttaa

See Fig. 1. The vector pSP64 is cut with S al and EcoRI, and ligated to the Haelll-SacI LTR fragment plus the synthetic oligo- nucleotides. Plasmids containing the desired sequences (pSP64 -225:-50) are identified by restriction enzyme analysis. A subfragment of pSP64 -225:-50 containing inducible enhancer elements from the MMTV LTR and synthetic ends are now excised on one side (-225) with any restriction enzyme that is contained in the pSP64 polylinker from the HinDIII to BamHI sites, and on the other end (-50) with Bglll or EcoRI. Such semisynthetic fragments are ligated into the vector pMT2 at various sites, in multiple numbers, and in various orientations. For example, the inducible element is purified from pSP64- 225:-50 following digestion with BamHI and Bglll, and is ligated in multiple orientations and various copy number into one or more of the BamHI and Bglll sites in pMT2. Such vectors contain elements (SV40 enhancer and Adenovirus major late promoter) for high constituitive expression, and can be induced to even higher expression levels by the addition of hormone. Alternatively, pSP64-225:-50 is digested with HinDIII and Bglll, and the inducible element is used to replace the SV40 enhancer contained between the HinDIII and BamHI sites in pMT2, resulting in a vector that is expressed very poorly in the absence of hormone, and that is highly inducible. The inducible derivatives of pMT2 are then identified by transient expression of the DHFR gene in the absence or presence of hormone in a suitable cell line containing amplified copies of the hormone receptor gene. Such derivatives having the desirable properties of both high induction ratios and high maximum expression are used for an expression vector for Factor VIII or other cDNAs as described above. EXAMPLE 4

Expression of Functional Glucocorticoid Receptor cDNA in COS Cells

The identification of a functional glucocorticoid receptor cDNA clone is made by analysis of its expression after introduction into COS monkey cells. The function of the glucocorticoid receptor can be analyzed by examining the levels of chlora phenicol acetyltransf erase (CAT) expression derived from the glucocorticoid responsive MMTV-LTR in pMMTV-LTR-CAT. COS cells are transfected by the DEAE-dextran procedure (Kaufman, R.J. Proc. Natl. Acad. Sci. USA 8_.2:689-693, 1985) with pMMTV-LTR-CAT or pSV2-CAT (ATCC No. 37155; a plasmid contructed to. express CAT from the SV40 early promter; Gorman et al., 1982, supra) in combination with pMT2 (vector alone) or pMT2-GRl. 48 hr post transfection the cells are treated with 10"⁶M dexamethasone and are analyzed for CAT activity at 72 hr post-transf ection as described (Gorman et al., Mol. Cell Biol. 2:1044-1051, 1982). Only in the presence of pMT2-GRl and with the addition of dexamethasone is there significant CAT expression from pMMTV-LTR-CAT. The degree of induction by cotransf ection of pMMTV-LTR-CAT with pMT2-GRl is much greater than the degree of induction by cotransf ection with pMT2. Alternatively, constructs may be readily prepared containing a DHFR gene under the transcriptional control of the LTR or a transcriptional control sequence containing a glucocorticoid-responsive LTR- fragment. Induction of high level transcription of the DHFR gene can be observed by conventional Northern analysis. EXAMPLE 5

Development of Chinese Hamster Ovary (CHO) Cells that are Hicrhlv Responsive to Glucocorticoids

DHFR deficient CHO cells, (CHO DHFR"), (DUKX-B11) (Chasin and Urlaub, Proc Natl. Acad. Sci. USA. 1980), are grown in alpha media with 10 ug/ml each of thymidine, deoxyadenosine, and adenosine. These cells can be trans¬ formed to the DHFR⁺ phenotype by transfection with DHFR expression plasmids and subsequently, the transfected DNA can be amplified to high copy number by selection for methotrexate resistance. The expression plasmid pMT2-GRl is cotransf ected with pAdD26SVpA(3) as described (Kaufman et al. , 1985). 25 ug of pMT2-GRl is mixed with 1 ug of pAdD25ASVp(A) 3 and transfected by CaP0₄ coprecipitation as described (Kaufman and Sharp, JMB 1982) . 48 hr post- transf ection, the cells are plated into selective media (alpha media lacking nuσleosides and containing 10% dialyzed fetal calf serum) . Two weeks later the transformants are pooled (approximately 100 .trans- formants/pool) and grown in sequentially increasing concen¬ trations of methotrexate. After selection from 0.02 uM methotrexate to 1.0 uM methotrexate, six pools are assayed for glucocorticoid receptor expression. The pool exhibiting the highest level of expression, monitored e.g. by the level of CAT induction by dexamethasone after transfection with pMMTV-LTR-CAT as in Example 7, is subsequently cloned. One clone is designated PGR1.

A cell line that expresses the glucocorticoid receptor upon addition of dexamethasone is prepared by introduction of pMMTV-LTR-GRI and pAdD26SVpA ( 3 ) into DHFR deficient CHO cells as described above and then selected for increasing degrees of methotrexate resistance. The resultant cell line expresses the glucocorticoid receptor at high levels upon addition of dexamethasone to the medium. EXAMPLE 6 Development of Mouse Fibroblast-like cells that are Highly Responsive to Glucocorticoids

NCTC clone 9 (strain L) cells (ATCC CCL1) are subjected to protoplast fusion of pMT -ADA-GRl as described by Sandri-Goldin R.M. et al., Mol. Cell. Biol. 1:743-752. For protoplast fusion, pMT2-

ADA-GR1 was introduced into E. coli HBlOl and bacteria grown in 50 ml of m9 salts containing 0.5% casamino acids, 0.4% glucose, 0.012% MgS0₄, 5 ug/ml thiamine and 50 ug/ml ampicillin to absorbance of 0.6 at 600 nm. Chloramphenicol was added to 250 ug/ml and the culture incubated 37°C for an additional 16 hours in order to amplify the plasmid copy number. The cells were centrifuged at 3,000 x g for 10 min. at 4°C and suspended in 2.5 ml of chilled 20% sucrose in 50 mM Tris-Cl pH 8.0. Lysozyme was added (0.5 ml of a 5 mg/ml solution in 0.25M Tris-Cl pH 8.0) and the mixture held on ice for 5 min. EDTA (1 ml of .25 M EDTA pH 8.0) was added for an additional 5 min. on ice, and then 1.0 ml of .05 M Tris-Cl pH 8.0 was added slowly. The suspension was incubated 15' at 37"C until the bacteria were converted to protoplasts. The suspension was then slowly diluted with 20 ml of prewar ed medium containing 10% sucrose and 10mm MgCl and held at 37°C for 15 min. The solution of proto¬ plasts (approximately 10⁹/ml) is added to NCTC clone 929 mouse fibroblast-like cells in a 6-well microtitre plate (approximately 7xl0⁵ cells/well) at a ratio of approximately l-2xl0⁴ protoplasts/cell and the protoplasts pelleted onto the^° cells by centrifuging 2000 RPM for 8 min. in a swinging microtiter dish rotor of an IEC Model K centrifuge. After centrifugation, the supernatant is removed by aspiration. A 2 ml amount of polyethylene glycol solution [50 g of PEG-

1450 (Baker Chem Co.) in 50 ml of medium] is added to each of the 6-well microtiter plate. The cells are again centrifuged at 200-0 RPM for 90 seconds, the polyethylene glycol solution removed, and the plates rinsed 3 times with 4 ml o f s erum- f ree med ium/we l l . Ce l l s are then trypsinized, suspended in 10 ml media containing 10% calf serum, and centrifuged in a conical tube at 500 RPM in a clinical centrifuge. Pelleted cells from -3 wells are pooled and plated into a 10 cm tissue culture dish. Fresh medium containing 100 ug/ml of kanamycin, 10 ug/ml each of penicillin and streptomycin, and 10% dialyzed fetal calf serum is added to each plate. The kanamycin is included to prevent the growth of any bacteria which had escaped conversion to protoplasts. Forty-eight hours post-trans- f ection, cells are plated (8 x 10⁴ cells/10 cm plate) into either ( 1) media 1 , Dulbeccos modified essential (DME) media supplemented with 10 ug/ml thymidine, 15 ug/ml hypothaxine, 4 uM 9-0-xylo-furanosyl adenine (Xyl-A) , with varying concentrations of R-deoxycoformycin (dCF) (2) media 2 , DME media supplemented with 10 ug/ml thymidine, 10 ug/ml deoxyadenosine, 1 mM uridine, 1- 0 M adenosine and varying concentration of dCF . [See , Yeung et al . , supra] Four plates at each dCF concentration level are prepared for both media. The two media used correspond to two selection procedures for ADA. To avoid detoxification of the σytological agents by the low levels of ADA endogenous to fetal calf serum, 10% fetal calf serum is added just prior to use of the media.

This transfection procedure is also repeated exactly as decribed above with no exogeneous ADA DNA placed into the cel l s to p roduce moσk-tran≤ f cted cells for comparison . Selection for DNA uptake is preferably measured using about 4 uM Xyl-A and about. 0.003-00.01 uM dCF.

Transformants are amplified using the 11-AAU procedure in combination with increasing levels of dCF as described in Yeung, C. et al., supra at 8338-8345, and above. Transformants are maintained in DME medium supplemented with 10% fetal calf serum (Grand Island Biological Company) and incubated at 37°C. The transformed cells are grown in the medium described above.

The selected transformed colonies are pooled and placed into media 2. These cells are then exposed to O.luM or 0.5 uM of dCF respectively. Those cells not producing large amounts of ADA are killed. Once growth resumes for surviving cells, the cells are passaged several times at the same level of dCF. Then the dCF concentration is increased . Cells are exposed to dCF step-wise at levels of 0.03 uM, 0.1 uM, 0.5 UM, 1 uM, 5 uM and 20 uM.

This treatment results in an amplification for the transformants selected. Further amplification is obtained by continuing to apply selection pressure on surviving cells with step-wise increments of dCF as described above. The amplification procedures result in a cell line containing mutiple copies of the gene coding for human glucocorticoid receptor protein. The resultant mouse cells are ideal recipients for BPV derived vectors that contain MMTV-LTR transcription units.

An alternative method of transfecting and amplifying the p91023 vector containing both the ADA gene and the receptor protein gene is to transfect and coamplify the resultant cells with unlinked vectors, one containing ADA and the other containing the receptor protein gene, in the procedures of this example. The ability of the amplified transformants to respond to glucocorticoids is tested as below in Example 7. The pooled amplified transformants which show the best induction are subsequently cloned. EXAMPLE 7

Analys is for Dexamethasone Induction o f Glucocorticoid Expressiing Cell Lines

Cell lines derived as described above are tested for their ability to mount a glucocorticoid response by the following approach. Duplicate plates of cells are trans¬ fected by the following approach . Duplicate plates of cells are transfected by the DEAE-dextran mediated DNA transfection procedure ( Sompayrac , L . M. , and K. J. Dana, Proc . Natl . Acad . Sc i . USA 7_8_: 7575-7578 ) with either PSV2CAT or pMMTV-LTR-CAT DNA and dexamethasone (10""⁶ M) is added . Then 72 hrs post-transf ection, cell extracts are prepared and assayed for CAT activity as described by Gorman et al . (Mol . Cell . Biol . 2: 1044-1051, 1982) . For comparison, similar plates are assayed that do not contain added dexamethsone . The cel l l ines showing a large induction o f CAT expres s ion are the ones that are expressing high levels of the glucocorticoid receptor.

EXAMPLE 8

Amplification of PMMTV-LTR-VIII in CHO DHFR Deficient Glucocorticoid Receptor Expressing Cells

The CHO cell line described above in Example 5 is used as a recipient for gene transfer using pMMTV-LTR-VIII and pSV2ADA (Orkin et al., Mol. Cell. Biol. 1:762-767, 1985). Briefly, 25 ug of pMMTV-LTR-VIII and 2 ug of pSV2ADA are σopreσipi ted with CaP0₄ to transfect the CHO GR-1 cell line. 48 hrs post-transfection, cell are subcultured into ADA selective media as described in Example 6 above and in Kaufman et al., Proc Natl. Acad. Sci. USA 8J3:3136-3140, 1986. Transformants are pooled and propagated in ADA amplification media (1.1 mM adenosine, 1 mM uridine, 10 ug/ml alanosine, and increasing concentrations of 2' deoxycofor ycin) . The cells that contain amplified factor VIII genes are monitored for factor VIII by activity assays as described (Toole et al., Nature 312 : 342-347 , 1984) before and after addition of 10~⁶ M dexamethasone for 24 hrs prior to harvesting the conditioned media. The results demonstrate that addition of dexamethasone elicits factor VIII activity from the CHO cells. It should be noted that other vectors containing ADA transcription units, may be used in place of pSV2ADA. One such vector may be obtained by EcoRI digestion of pMT2-ADA-VWF (to remove the VWF cDNA followed by ligation.

Although examples given are specific to the particular hormone, the selection schemes, the cell lines, and the order in which the genes are introduced and amplified, the invention is pertinent to the use of recombinant means to develop mammalian cell lines which are highly inducible with steroid hormones by introducing a foreign steroid receptor gene which is efficiently expressed into a mammalian cell line.

Claims

What is claimed is:

1. A method for producing- high level expression of an exogenous selected protein comprising culturing in the presence of an effective amount of a selected ligand a cell which comprises amplified copies of a gene coding for a receptor protein capable of forming a complex with said ligand, and amplified copies of a vector comprising a gene coding for said selected protein in operative association with a transcriptional control sequence responsive to the presence of the complex formed by the receptor and the ligand.

2. The method according to claim 1, wherein said cell is selected from the group consisting of mammalian and insect cells and cell lines.

3. The method according to claim 1, wherein said mammalian cell lines are selected from the group consisting of Bowes cell line, mouse L cells, mouse fibroblasts, mouse NIH 3T3 cells, human hepatoma Hep G2 cell lines, human HeLA, monkey CV1 and CHO cell lines.

4. A cell line for use in producing high levels of expression of a selected exogenous protein in the presence of an effective amount of a selected ligand comprising: amplified copies of a gene coding for a ligand receptor protein, and amplified copies of a vector comprising a gene coding for said selected exogenous protein in operative association with a transcriptional control sequence responsive to the presence of the complex formed by the receptor and the ligand.

5. The cell line according to claim 4, wherein said receptor is selected from the group consisting of glucocorticoid receptor, testosterone receptor, estrogen receptor, progesterone receptor, thyroxin receptor and dioxin receptor.

6. The cell line according to claim 4, wherein said transcriptional control sequence is selected from the group consisting of the mouse mammary tumor virus LTR, mouse metallothionine , human metallothionine, rat alpha 2u-globulin, and rat and human growth hormone transcriptional control sequence and protions thereof which are responsive to a ligand-receptor complex.

7. The cell line according to claim 4, wherein the exogeneous protein is human factor VIII :q or an analog thereof.

8. The cell line according to claim 4, wherein the gene coding for the receptor is under the transcriptional control of a transcriptional control sequence responsive to the presence of a ligand-receptor complex.

9. A method for amplifying a gene which comprises culturing a cell line of claim 4 in the presence of the ligand, culturing the resultant cells in the substantial absence of the ligand and selecting cells for increased levels of the gene.