USRE48468E1 - Means and methods for counteracting muscle disorders - Google Patents

Means and methods for counteracting muscle disorders Download PDF

Info

Publication number
USRE48468E1
USRE48468E1 US15/881,574 US201815881574A USRE48468E US RE48468 E1 USRE48468 E1 US RE48468E1 US 201815881574 A US201815881574 A US 201815881574A US RE48468 E USRE48468 E US RE48468E
Authority
US
United States
Prior art keywords
dystrophin
exon
patient
compound
antisense oligonucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US15/881,574
Inventor
Josephus Johannes De Kimpe
Gerard Johannes Platenburg
Judith Christina Theodora Van Deutekom
Annemieke Aartsma-Rus
Garrit-Jan Boudewijn van Ommen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Leids Universitair Medisch Centrum LUMC
Biomarin Technologies BV
Original Assignee
Leids Universitair Medisch Centrum LUMC
Biomarin Technologies BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/NL2008/050673 external-priority patent/WO2009054725A2/en
Application filed by Leids Universitair Medisch Centrum LUMC, Biomarin Technologies BV filed Critical Leids Universitair Medisch Centrum LUMC
Priority to US15/881,574 priority Critical patent/USRE48468E1/en
Assigned to ACADEMISCH ZIEKENHUIS LEIDEN reassignment ACADEMISCH ZIEKENHUIS LEIDEN ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: AARTSMA-RUS, ANNEMIEKE, DE KIMPE, JOSEPHUS JOHANNES, PLATENBURG, GERARD JOHANNES, VAN DEUTEKOM, JUDITH CHRISTINA THEODORA, VAN OMMEN, GARRIT-JAN
Assigned to BIOMARIN TECHNOLOGIES B.V. reassignment BIOMARIN TECHNOLOGIES B.V. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: PROSENSA TECHNOLOGIES B.V.
Assigned to PROSENSA TECHNOLOGIES B.V. reassignment PROSENSA TECHNOLOGIES B.V. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: AARTSMA-RUS, ANNEMIEKE, DE KIMPE, JOSEPHUS JOHANNES, PLATENBURG, GERARD JOHANNES, VAN DEUTEKOM, JUDITH CHRISTINA THEODORA, VAN OMMEN, GARRIT-JAN
Application granted granted Critical
Publication of USRE48468E1 publication Critical patent/USRE48468E1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/58Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids containing heterocyclic rings, e.g. danazol, stanozolol, pancuronium or digitogenin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1719Muscle proteins, e.g. myosin or actin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/313Phosphorodithioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/314Phosphoramidates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/318Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3181Peptide nucleic acid, PNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3233Morpholino-type ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Definitions

  • Becker Muscular Dystrophy and Duchenne Muscular Dystrophy are genetic muscular dystrophies with a relatively high incidence. In both Duchenne and Becker muscular dystrophy the muscle protein dystrophin is affected. In Duchenne dystrophin is absent, whereas in Becker some dystrophin is present but its production is most often not sufficient and/or the dystrophin present is abnormally formed. Both diseases are associated with recessive X-linked inheritance. DMD results from a frameshift mutation in the DMD gene. The frameshift in the DMD gene results in the production of a truncated non-functional dystrophin protein, resulting in progressive muscle wasting and weakness. BMD occurs as a mutation does not cause a frame-shift in the DMD gene.
  • BMD As in BMD some dystrophin is present in contrast to DMD where dystrophin is absent, BMD has less severe symptoms then DMD.
  • the onset of DMD is earlier than BMD.
  • DMD usually manifests itself in early childhood, BMD in the teens or in early adulthood.
  • the progression of BMD is slower and less predictable than DMD. Patients with BMD can survive into mid to late adulthood. Patients with DMD rarely survive beyond their thirties.
  • Dystrophin plays an important structural role in the muscle fiber, connecting the extracellular matrix and the cytoskeleton.
  • the N-terminal region binds actin, whereas the C-terminal end is part of the dystrophin glycoprotein complex (DGC), which spans the sarcolemma.
  • DGC dystrophin glycoprotein complex
  • mechanical stress leads to sarcolemmal ruptures, causing an uncontrolled influx of calcium into the muscle fiber interior, thereby triggering calcium-activated proteases and fiber necrosis.
  • the skipping of an exon is preferably induced by the binding of antisense oligoribonucleotides (AONs) targeting either one or both of the splice sites, or exon-internal sequences. Since an exon will only be included in the mRNA when both the splice sites are recognised by the spliceosome complex, splice sites are obvious targets for AONs. Alternatively, or additionally, one or more AONs are used which are specific for at least part of one or more exonic sequences. Using exon-internal AONs specific for an exon 46 sequence, we were previously able to modulate the splicing pattern in cultured myotubes from two different DMD patients with an exon 45 deletion 11 .
  • AONs antisense oligoribonucleotides
  • exon 46 was skipped, which resulted in a restored reading frame and the induction of dystrophin synthesis in at least 75% of the cells.
  • exon skipping can also efficiently be induced in human control and patient muscle cells for 39 different DMD exons using exon-internal AONs 1,2,11-15 .
  • exon skipping techniques applied on the dystrophin gene result in the generation of at least partially functional—albeit shorter—dystrophin protein in DMD patients. Since DMD is caused by a dysfunctional dystrophin protein, it would be expected that the symptoms of DMD are sufficiently alleviated once a DMD patient has been provided with functional dystrophin protein. However, the present invention provides the insight that, even though exon skipping techniques are capable of inducing dystrophin synthesis, DMD symptom(s) is/are still further alleviated by administering to a DMD patient an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
  • the present invention therefore provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising:
  • adjunct compound for reducing inflammation preferably for reducing muscle tissue inflammation
  • adjunct compound for improving muscle fiber function, integrity and/or survival preferably for reducing muscle tissue inflammation
  • the present invention further provides a method for enhancing skipping of an exon from a dystrophin pre-mRNA in cells expressing said pre-mRNA, said method comprising
  • the present invention further provides a method for enhancing skipping of an exon from a dystrophin pre-mRNA in cells expressing said pre-mRNA in an individual suffering from Duchenne Muscular Dystrophy or Becker Muscular Dystrophy, the method comprising:
  • a functional dystrophin is preferably a wild type dystrophin corresponding to a protein having the amino acid sequence as identified in SEQ ID NO: 1.
  • a functional dystrophin is preferably a dystrophin, which has an actin binding domain in its N terminal part (first 240 amino acids at the N terminus), a cystein-rich domain (amino acid 3361 till 3685) and a C terminal domain (last 325 amino acids at the C terminus) each of these domains being present in a wild type dystrophin as known to the skilled person.
  • the amino acids indicated herein correspond to amino acids of the wild type dystrophin being represented by SEQ ID NO:1.
  • Alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual in a method of the invention may be assessed by any of the following assays: prolongation of time to loss of walking, improvement of muscle strength, improvement of the ability to lift weight, improvement of the time taken to rise from the floor, improvement in the nine-meter walking time, improvement in the time taken for four-stairs climbing, improvement of the leg function grade, improvement of the pulmonary function, improvement of cardiac function, improvement of the quality of life.
  • Assays is known to the skilled person. As an example, the publication of Manzur at al (2008, ref 58) gives an extensive explanation of each of these assays.
  • An adjunct compound for reducing inflammation comprises any therapy which is capable of at least in part reducing inflammation, preferably inflammation caused by damaged muscle cells.
  • Said adjunct compound is most preferably capable of reducing muscle tissue inflammation.
  • Inflammation is preferably assessed by detecting an increase in the number of infiltrating immune cells such as neutrophils and/or mast cells and/or dendritic cells and/or lymphocytes in muscle tissue suspected to be dystrophic. This assessment is preferably carried out in cross-sections of a biopsy 57 of muscle tissue suspected to be dystrophic after having specifically stained immune cells as identified above. The quantification is preferably carried out under the microscope. Reducing inflammation is therefore preferably assessed by detecting a decrease in the number of immune cells in a cross-section of muscle tissue suspected to be dystrophic.
  • Detecting a decrease preferably means that the number of at least one sort of immune cells as identified above is decreased of at least 1%, 2%, 3%, 5%, 7%, 10%, 12%, 15%, 17%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the number of a corresponding immune cell in a same individual before treatment. Most preferably, no infiltrating immune cells are detected in cross-sections of said biopsy.
  • An adjunct compound for improving muscle fiber function, integrity and/or survival comprises any therapy which is capable of measurably enhancing muscle fiber function, integrity and/or survival as compared to an otherwise similar situation wherein said adjunct compound is not present.
  • the improvement of muscle fiber function, integrity and/or survival may be assessed using at least one of the following assays: a detectable decrease of creatine kinase in blood, a detectable decrease of necrosis of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic, and/or a detectable increase of the homogeneity of the diameter of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic.
  • a detectable decrease of creatine kinase in blood a detectable decrease of necrosis of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic
  • a detectable increase of the homogeneity of the diameter of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic are known to
  • a treatment in a method according to the invention is about at least one week, about at least one month, about at least several months, about at least one year, about at least 2, 3, 4, 5, 6 years or more.
  • an adjunct compound for increasing turnover of damaged muscle cells comprises any therapy which is capable of at least in part inducing and/or increasing turnover of damaged muscle cells.
  • Damaged muscle cells are muscle cells which have significantly less clinically measurable functionality than a healthy, intact muscle cell. In the absence of dystrophin, mechanical stress leads to sarcolemmal ruptures, causing an uncontrolled influx of calcium into the muscle fiber interior, thereby triggering calcium-activated proteases and fiber necrosis, resulting in damaged muscle cells.
  • Increasing turnover of damaged muscle cells means that damaged muscle cells are more quickly broken down and/or removed as compared to a situation wherein turnover of damaged muscle cells is not increased.
  • Turnover of damaged muscle cells is preferably assessed in a muscle biopsy, more preferably as described in 57 using a cross-section of a biopsy.
  • a detectable increase of turnover may be an increase of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the area wherein turnover has been identified using a biopsy cross-section. The increase is measured by comparison to the turnover as assessed in a same individual before treatment.
  • a combination of a therapy for providing an individual with a functional dystrophin protein, together with an adjunct therapy for reducing inflammation, preferably for reducing muscle tissue inflammation in an individual, is particularly suitable for use as a medicament.
  • Such combination is even better capable of alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy as compared to a sole therapy for providing an individual with a functional dystrophin protein.
  • This embodiment also enhances the skipping frequency of a dystrophin exon from a pre-mRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon.
  • the enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
  • a combination of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation in said individual, for use as a medicament since said combination is particularly suitable for counteracting DMD, the invention also provides a use of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation in said individual, for the preparation of a medicament for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy.
  • said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
  • Preferred adjunct compound for reducing inflammation include a steroid, a TNF ⁇ inhibitor, a source of mIGF-1 and/or an antioxidant.
  • any other compound able to reduce inflammation as defined herein is also encompassed within the present invention.
  • Each of these compounds is later on extensively presented.
  • Each of the compounds extensively presented may be used separately or in combination with each other and/or in combination with one or more of the adjunct compounds used for improving muscle fiber function, integrity and/or survival.
  • a combination of a therapy for providing an individual with a functional dystrophin protein, together with an adjunct therapy for improving muscle fiber function, integrity and/or survival in an individual is particularly suitable for use as a medicament.
  • Such combination is even better capable of alleviating one or more symptom(s) of Duchenne Muscular Dystrophy as compared to a sole therapy for providing an individual with a functional dystrophin protein.
  • a combination of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for improving muscle fiber function, integrity and/or survival in said individual, for use as a medicament is also particularly suitable for counteracting DMD.
  • a use of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for improving muscle fiber function, integrity and/or survival in said individual, for the preparation of a medicament for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy is therefore also provided.
  • said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
  • Preferred adjunct compounds for improving muscle fiber function, integrity and/or survival include a ion channel inhibitor, a protease inhibitor, L-arginine and/or an angiotensin II type I receptor blocker.
  • any other compound able to improving muscle fiber function, integrity and/or survival as defined herein is also encompassed within the present invention.
  • Each of these compounds is later on extensively presented. Each of the compounds extensively presented may be used separately or in combination with each other and/or in combination with one or more of the adjunct compounds used for reducing inflammation.
  • a pharmaceutical preparation which comprises at least one of the above mentioned combinations comprising a compound for providing an individual with a functional dystrophin protein together with an adjunct compound according to the invention. Further provided is therefore a pharmaceutical preparation comprising:
  • an adjunct compound for reducing inflammation preferably for reducing muscle tissue inflammation in said individual, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival in said individual, and
  • a combination of a steroid and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a steroid and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD.
  • This embodiment also enhances the skipping frequency of a dystrophin exon from a pre-mRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon.
  • the enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
  • the usual doses are about 0.5-1.0 mg/kg/day, preferably about 0.75 mg/kg/day for prednisone and prednisolone, and about 0.4-1.4 mg/kg/day, preferably about 0.9 mg/kg/day for deflazacort.
  • a combination of mIGF-1, or a compound capable of enhancing mIGF-1 expression or an mIGF-1 activity, and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of mIGF-1, or a compound capable of enhancing mIGF-1 expression or mIGF-1 activity, and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD.
  • such combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
  • an increased amount or activity of mIGF-1 may be reached by increasing the gene expression level of an IGF-1 gene, by increasing the amount of a corresponding IGF-1 protein and/or by increasing an activity of an IGF1-protein.
  • a preferred mIGF-1 protein has been earlier defined herein.
  • An increase of an activity of said protein is herein understood to mean any detectable change in a biological activity exerted by said protein or in the steady state level of said protein as compared to said activity or steady-state in a individual who has not been treated.
  • Increased amount or activity of mIGF-1 is preferably assessed by detection of increased expression of muscle hypertrophy biomarker GATA-2 (as described in 27).
  • Gene expression level is preferably assessed using classical molecular biology techniques such as (real time) PCR, arrays or Northern analysis.
  • a steady state level of a protein is determined directly by quantifying the amount of a protein. Quantifying a protein amount may be carried out by any known technique such as Western blotting or immunoassay using an antibody raised against a protein.
  • the quantification of a gene expression level and/or a corresponding protein the quantification of a substrate of a corresponding protein or of any compound known to be associated with a function or activity of a corresponding protein or the quantification of said function or activity of a corresponding protein using a specific assay may be used to assess the alteration of an activity or steady state level of a protein.
  • an activity or steady-state level of a said protein may be altered at the level of the protein itself, e.g. by providing a protein to a cell from an exogenous source.
  • an increase of a polypeptide activity means an increase of at least 5% of a polypeptide activity using a suitable assay. More preferably, an increase of a polypeptide activity means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more. The increase is preferably assessed by comparison to corresponding activity in the individual before treatment.
  • a preferred way of providing a source of mIGF1 is to introduce a transgene encoding mIGF1, preferably an mIGF-1 Ea isoform (as described in 27, human homolog IGF-1 isoform 4: SEQ ID NO: 2), more preferably in an AAV vector as later defined herein.
  • a transgene encoding mIGF1 preferably an mIGF-1 Ea isoform (as described in 27, human homolog IGF-1 isoform 4: SEQ ID NO: 2), more preferably in an AAV vector as later defined herein.
  • Such source of mIGF1 is specifically expressed in muscle tissue as described in mice in 27.
  • a compound for providing an individual with a functional dystrophin protein is combined with an antioxidant.
  • Oxidative stress is an important factor in the progression of DMD and promotes chronic inflammation and fibrosis 29 .
  • the most prevalent products of oxidative stress, the peroxidized lipids are increased by an average of 35% in Duchenne boys.
  • Increased levels of the enzymes superoxide dismutase and catalase reduce the excessive amount of free radicals causing these effects.
  • a dietary supplement Protandim® LifeVantage was clinically tested and found to increase levels of superoxide dismutase (up to 30%) and catalase (up to 54%), which indeed significantly inhibited the peroxidation of lipids in 29 healthy persons 30 .
  • Idebenone is another potent antioxidant with a chemical structure derived from natural coenzyme Q10. It protects mitochondria where adenosine triphosphate, ATP, is generated by oxidative phosphorylation.
  • ATP adenosine triphosphate
  • Idebenone was recently applied in clinical trials in the US and Europe demonstrating efficacy on neurological aspects of Friedreich's Ataxia 31 .
  • a phase-IIa double-blind, placebo-controlled randomized clinical trial with Idebenone has recently been started in Belgium, including 21 Duchenne boys at 8 to 16 years of age.
  • an anti-oxidant is a mixture of antioxidants as the dietary supplement Protandim® (LifeVantage).
  • a daily capsule of 675 mg of Protandim® comprises 150 mg of B. monniera (45% bacosides), 225 mg of S. marianum (70-80% silymarin), 150 mg of W. somnifera powder, 75 mg green tea (98% polyphenols wherein 45% EGCG) and 75 mg turmeric (95% curcumin).
  • a compound for providing an individual with a functional dystrophin protein is combined with an ion channel inhibitor.
  • the presence of damaged muscle membranes in DMD disturbs the passage of calcium ions into the myofibers, and the consequently disrupted calcium homeostasis activates many enzymes, e.g. proteases, that cause additional damage and muscle necrosis.
  • Ion channels that directly contribute to the pathological accumulation of calcium in dystrophic muscle are potential targets for adjunct compounds to treat DMD.
  • drugs such as pentoxifylline, block exercise-sensitive calcium channels 32 and antibiotics that block stretch activated channels reduce myofibre necrosis in mdx mice and CK levels in DMD boys 33 .
  • ion channel inhibitors of the class of xanthines are used. More preferably, said xanthines are derivatives of methylxanthines, and most preferably, said methylxanthine derivates are chosen from the group consisting of pentoxifylline, furafylline, lisofylline, propentofylline, pentifylline, theophylline, torbafylline, albifylline, enprofylline and derivatives thereof. Most preferred is the use of pentoxifylline.
  • Ion channel inhibitors of the class of xanthines enhance the skipping frequency of a dystrophin exon from a pre-mRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon.
  • the enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
  • Suitable dosages of pentoxifylline are between about 1 mg/kg/day to about 100 mg/kg/day, preferred dosages are between about 10 mg/kg/day to 50 mg/kg/day. Typical dosages used in humans are 20 mg/kg/day.
  • an ion channel inhibitor is administered to said individual prior to administering a compound for providing an individual with a functional dystrophin protein.
  • said ion channel inhibitor is administered at least one day, more preferred at least one week, more preferred at least two weeks, more preferred at least three weeks prior to administering a compound for providing said individual with a functional dystrophin protein.
  • a compound for providing an individual with a functional dystrophin protein is combined with a protease inhibitor.
  • Calpains are calcium activated proteases that are increased in dystrophic muscle and account for myofiber degeneration.
  • Calpain inhibitors such as calpastatin, leupeptin 34 , calpeptin, calpain inhibitor III, or PD150606 are therefore applied to reduce the degeneration process.
  • a new compound, BN 82270 (Ipsen) that has dual action as both a calpain inhibitor and an antioxidant increased muscle strength, decreased serum CK and reduced fibrosis of the mdx diaphragm, indicating a therapeutic effect with this new compound 35 .
  • Another compound of Leupeptin/Carnitine Myodur has recently been proposed for clinical trials in DMD patients.
  • MG132 is another proteasomal inhibitor that has shown to reduce muscle membrane damage, and to ameliorate the histopathological signs of muscular dystrophy 36 .
  • MG-132 CBZ-leucyl-leucyl-leucinal
  • MG-132 has shown to inhibit the proteasomal degradation of dystrophin-associated proteins in the dystrophic mdx mouse model 36 .
  • This compound is thus also suitable for use as an adjunct pharmacological compound for DMD.
  • a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual comprising administering to said individual a protease inhibitor and a compound for providing said individual with a functional dystrophin protein.
  • a combination of a protease inhibitor and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a protease inhibitor and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD.
  • said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
  • the skilled person will know which quantities are preferably used.
  • a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual comprising administering to said individual L-arginine and a compound for providing said individual with a functional dystrophin protein.
  • a combination of L-arginine and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of L-arginine and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD.
  • said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
  • a compound for providing an individual with a functional dystrophin protein is combined with angiotensin II type 1 receptor blocker Losartan which normalizes muscle architecture, repair and function, as shown in the dystrophin-deficient mdx mouse model 23 .
  • angiotensin II type 1 receptor blocker Losartan which normalizes muscle architecture, repair and function, as shown in the dystrophin-deficient mdx mouse model 23 .
  • One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual angiotensin II type 1 receptor blocker Losartan, and a compound for providing said individual with a functional dystrophin protein.
  • a compound for providing an individual with a functional dystrophin protein is combined with an angiotensin-converting enzyme (ACE) inhibitor, preferably perindopril.
  • ACE inhibitors are capable of lowering blood pressure. Early initiation of treatment with perindopril is associated with a lower mortality in DMD patients 22 .
  • One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual an ACE inhibitor, preferably perindopril, and a compound for providing said individual with a functional dystrophin protein.
  • a combination of an ACE inhibitor, preferably perindopril, and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of an ACE inhibitor, preferably perindopril, and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD.
  • said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
  • the usual doses of an ACE inhibitor, preferably perindopril are about 2 to 4 mg/day 22 .
  • a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing is combined with a ACE inhibitor and/or with any adjunct compounds as identified earlier herein.
  • the invention thus provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said adjunct compound comprises a steroid, an ACE inhibitor (preferably perindopril), angiotensin II type 1 receptor blocker Losartan, a tumour necrosis factor-alpha (TNF ⁇ ) inhibitor, a source of mIGF-1, preferably mIGF-1, a compound for enhancing mIGF-1 expression, a compound for enhancing mIGF-1 activity, an antioxidant, an ion channel inhibitor, a protease inhibitor, L-arginine and/or a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing.
  • ACE inhibitor preferably perindopril
  • angiotensin II type 1 receptor blocker Losartan e.g., a tumour necrosis factor-alpha (TNF ⁇ ) inhibitor
  • TNF ⁇ tumour necrosis factor-alpha
  • an individual is provided with a functional dystrophin protein in various ways, for instance by stop codon suppression by gentamycin or PTC124 16,17 , or by adeno-associated virus (AAV)-mediated gene delivery of a functional mini- or micro-dystrophin gene 18-20 .
  • AAV adeno-associated virus
  • One embodiment therefore provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, comprising a sequence which is complementary to a non-exon region of a dystrophin pre mRNA.
  • said AON is used which is solely complementary to a non-exon region of a dystrophin pre mRNA.
  • Splicing of a dystrophin pre-mRNA occurs via two sequential transesterification reactions.
  • the 2′OH of a specific branch-point nucleotide within the intron that is defined during spliceosome assembly performs a nucleophilic attack on the first nucleotide of the intron at the 5′ splice site forming the lariat intermediate.
  • the 3′OH of the released 5′ exon then performs a nucleophilic attack at the last nucleotide of the intron at the 3′ splice site thus joining the exons and releasing the intron lariat.
  • the branch point and splice sites of an intron are thus involved in a splicing event.
  • an oligonucleotide comprising a sequence which is complementary to such branch point and/or splice site is preferably used for exon skipping.
  • said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, comprising a sequence which is complementary to a splice site and/or branch point of a dystrophin pre mRNA.
  • splice sites contain consensus sequences
  • an oligonucleotide or a functional equivalent thereof comprising a sequence which is complementary of a splice site
  • AON oligonucleotide or a functional equivalent thereof
  • one preferred embodiment provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, comprising a sequence which is complementary to a dystrophin pre-mRNA exon.
  • said AON is capable of specifically inhibiting an exon inclusion signal of at least one exon in said dystrophin pre-mRNA. Interfering with an exon inclusion signal (EIS) has the advantage that such elements are located within the exon.
  • EIS exon inclusion signal
  • exon-internal AONs specific for an exon 46 sequence we were previously able to modulate the splicing pattern in cultured myotubes from two different DMD patients with an exon 45 deletion 11 . Following AON treatment, exon 46 was skipped, which resulted in a restored reading frame and the induction of dystrophin synthesis in at least 75% of the cells.
  • exon skipping can also efficiently be induced in human control and series of patients with different mutations, including deletions, duplications and point mutations, for 39 different DMD exons using exon-internal AONs 1,2,11-15 .
  • Said activity is preferably retained to at least some extent when it represents at least 50%, or at least 60%, or at least 70% or at least 80% or at least 90% or at least 95% or more of corresponding activity of said oligonucleotide the functional equivalent derives from.
  • oligonucleotide when used it may be replaced by a functional equivalent thereof as defined herein.
  • an oligonucleotide, or a functional equivalent thereof comprising or consisting of a sequence which is complementary to a dystrophin pre-mRNA exon provides good anti-DMD results.
  • an oligonucleotide, or a functional equivalent thereof is used which comprises or consists of a sequence which is complementary to at least part of dystrophin pre-mRNA exon 2, 8, 9, 17, 19, 29, 40-46, 48-53, 55 or 59, said part having at least 13 nucleotides.
  • said part may also have at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides.
  • an AON which comprises or consists of a sequence which is complementary to at least part of dystrophin pre-mRNA exon 51, 44, 45, 53, 46, 43, 2, 8, 50 and/or 52, said part having at least 13 nucleotides. However, said part may also have at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides.
  • Most preferred oligonucleotides are identified by each of the following sequences SEQ ID NO: 3 to SEQ ID NO: 284. Accordingly, a most preferred oligonucleotide as used herein is represented by a sequence from SEQ ID NO:3 to SEQ ID NO:284. A most preferred oligonucleotide as used herein is selected from the group consisting of SEQ ID NO:3 to NO:284.
  • an oligonucleotide of the invention which comprises a sequence that is complementary to part of dystrophin pre-mRNA is such that the complementary part is at least 50% of the length of the oligonucleotide of the invention, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90% or even more preferably at least 95%, or even more preferably 98% or more.
  • the oligonucleotide of the invention consists of a sequence that is complementary to part of dystrophin pre-mRNA as defined herein.
  • an oligonucleotide may comprise a sequence that is complementary to part of dystrophin pre-mRNA as defined herein and additional flanking sequences.
  • the length of said complementary part of said oligonucleotide is of at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides.
  • additional flanking sequences are used to modify the binding of a protein to the oligonucleotide, or to modify a thermodynamic property of the oligonucleotide, more preferably to modify target RNA binding affinity.
  • RNA molecules exhibit strong secondary structures, mostly due to base pairing of complementary or partly complementary stretches within the same RNA. It has long since been thought that structures in the RNA play a role in the function of the RNA. Without being bound by theory, it is believed that the secondary structure of the RNA of an exon plays a role in structuring the splicing process. Through its structure, an exon is recognized as a part that needs to be included in the mRNA. Herein this signalling function is referred to as an exon inclusion signal.
  • a complementary oligonucleotide of this embodiment is capable of interfering with the structure of the exon and thereby capable of interfering with the exon inclusion signal of the exon.
  • Oligonucleotides of this preferred embodiment i.e. those with the said overlap directed towards open and closed structures in the native exon RNA, are a selection from all possible oligonucleotides. The selection encompasses oligonucleotides that can efficiently interfere with an exon inclusion signal. Without being bound by theory it is thought that the overlap with an open structure improves the invasion efficiency of the oligonucleotide (i.e.
  • complementarity is used herein to refer to a stretch of nucleic acids that can hybridise to another stretch of nucleic acids under physiological conditions. It is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand.
  • oligonucleotides comprising mismatches in the region of complementarity but that retain the capacity to hybridise to the targeted region(s) in the pre-mRNA, can be used in the present invention.
  • at least the complementary parts do not comprise such mismatches as these typically have a higher efficiency and a higher specificity, than oligonucleotides having such mismatches in one or more complementary regions. It is thought that higher hybridisation strengths, (i.e.
  • the complementarity is between 90 and 100%. In general this allows for approximately 1 or 2 mismatch(es) in an oligonucleotide of around 20 nucleotides
  • the secondary structure is best analysed in the context of the pre-mRNA wherein the exon resides. Such structure may be analysed in the actual RNA. However, it is currently possible to predict the secondary structure of an RNA molecule (at lowest energy costs) quite well using structure-modelling programs.
  • a non-limiting example of a suitable program is RNA mfold version 3.1 server 41 .
  • a person skilled in the art will be able to predict, with suitable reproducibility, a likely structure of the exon, given the nucleotide sequence. Best predictions are obtained when providing such modelling programs with both the exon and flanking intron sequences. It is typically not necessary to model the structure of the entire pre-mRNA.
  • the open and closed structure to which the oligonucleotide is directed are preferably adjacent to one another. It is thought that in this way the annealing of the oligonucleotide to the open structure induces opening of the closed structure whereupon annealing progresses into this closed structure. Through this action the previously closed structure assumes a different conformation. The different conformation results in the disruption of the exon inclusion signal. However, when potential (cryptic) splice acceptor and/or donor sequences are present within the targeted exon, occasionally a new exon inclusion signal is generated defining a different (neo) exon, i.e. with a different 5′ end, a different 3′ end, or both.
  • an oligonucleotide comprising determining a (putative) binding site for an SR (Ser-Arg) protein in RNA of a dystrophin exon and producing an oligonucleotide that is complementary to said RNA and that at least partly overlaps said (putative) binding site.
  • the term “at least partly overlaps” is defined herein as to comprise an overlap of only a single nucleotide of an SR binding site as well as multiple nucleotides of said binding site as well as a complete overlap of said binding site.
  • Such a method for generating an oligonucleotide is also performed by reversing the described order, i.e. first generating an oligonucleotide comprising determining, from a secondary structure of RNA from a dystrophin exon, a region that assumes a structure that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and subsequently generating an oligonucleotide, of which at least a part of said oligonucleotide is complementary to said closed structure and of which at least another part of said oligonucleotide is complementary to said open structure.
  • This is then followed by determining whether an SR protein binding site at least overlaps with said open/closed structure. In this way the method of WO 2004/083432 is improved.
  • the selections are performed simultaneously.
  • oligonucleotide directed to an SR protein binding site results in (at least partly) impairing the binding of an SR protein to the binding site of an SR protein which results in disrupted or impaired splicing.
  • an open/closed structure and an SR protein binding site partly overlap and even more preferred an open/closed structure completely overlaps an SR protein binding site or an SR protein binding site completely overlaps an open/closed structure. This allows for an improved disruption of exon inclusion.
  • the invention thus provides a method, combination, use or pharmaceutical preparation as described above, wherein said SR protein is SF2/ASF or SC35 or SRp40.
  • an oligonucleotide or functional equivalent thereof is used which is complementary to an intronic splicing enhancer (ISE), an exonic splicing enhancer (ESE), an intronic splicing silencer (ISS) and/or an exonic splicing silencer (ESS).
  • ISE intronic splicing enhancer
  • ESE exonic splicing enhancer
  • ISS intronic splicing silencer
  • ESS exonic splicing silencer
  • a dystrophin exon is in one preferred embodiment skipped by an agent capable of specifically inhibiting an exon inclusion signal of said exon, so that said exon is not recognized by the splicing machinery as a part that needs to be included in the mRNA. As a result, a mRNA without said exon is formed.
  • An AON used in a method of the invention is preferably complementary to a consecutive part of between 13 and 50 nucleotides of dystrophin exon RNA or dystrophin intron RNA.
  • an AON used in a method of the invention is complementary to a consecutive part of between 16 and 50 nucleotides of a dystrophin exon RNA or dystrophin intron RNA.
  • said AON is complementary to a consecutive part of between 15 and 25 nucleotides of said exon RNA.
  • an AON is used which comprises a sequence which is complementary to a consecutive part of between 20 and 25 nucleotides of a dystrophin exon RNA or a dystrophin intron RNA.
  • RNA Ribonucleic acid
  • RNA/RNA hybrids are very stable. Since one of the aims of the exon skipping technique is to direct splicing in subjects it is preferred that the oligonucleotide RNA comprises a modification providing the RNA with an additional property, for instance resistance to endonucleases and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, reduced toxicity, increased intracellular transport, tissue-specificity, etc.
  • said modification comprises a 2′-O-methyl-phosphorothioate oligoribonucleotide modification.
  • said modification comprises a 2′-O-methyl-phosphorothioate oligodeoxyribonucleotide modification.
  • an oligonucleotide which comprises RNA which contains a modification, preferably a 2′-O-methyl modified ribose (RNA) or deoxyribose (DNA) modification.
  • the invention provides a hybrid oligonucleotide comprising an oligonucleotide comprising a 2′-O-methyl-phosphorothioate oligo(deoxy)ribonucleotide modification and locked nucleic acid.
  • This particular combination comprises better sequence specificity compared to an equivalent consisting of locked nucleic acid, and comprises improved effectivity when compared with an oligonucleotide consisting of 2′-O-methyl-phosphorothioate oligo(deoxy)ribonucleotide modification.
  • oligonucleotide peptide nucleic acid and/or locked nucleic acid. Most preferably, a morpholino phosphorodiamidate is used. Suitable but non-limiting examples of equivalents of oligonucleotides of the invention can be found in 44,50 . Hybrids between one or more of the equivalents among each other and/or together with nucleic acid are of course also suitable.
  • locked nucleic acid is used as a functional equivalent of an oligonucleotide, as locked nucleic acid displays a higher target affinity and reduced toxicity and therefore shows a higher efficiency of exon skipping.
  • an oligonucleotide, or a functional equivalent thereof, which is capable of inhibiting inclusion of a dystrophin exon into dystrophin mRNA is combined with at least one other oligonucleotide, or functional equivalent thereof, that is capable of inhibiting inclusion of another dystrophin exon into dystrophin mRNA.
  • This embodiment is further referred to as double- or multi-exon skipping 2,15 . In most cases double-exon skipping results in the exclusion of only the two targeted exons from the dystrophin pre-mRNA.
  • said first and said second exon are separated in said dystrophin pre-mRNA by at least one exon to which said oligonucleotide is not complementary.
  • stretches of nucleotides complementary to at least two dystrophin exons are separated by a linking moiety.
  • the at least two stretches of nucleotides are thus linked in this embodiment so as to form a single molecule.
  • the DMD gene is a large gene, with many different exons. Considering that the gene is located on the X-chromosome, it is mostly boys that are affected, although girls can also be affected by the disease, as they may receive a bad copy of the gene from both parents, or are suffering from a particularly biased inactivation of the functional allele due to a particularly biased X chromosome inactivation in their muscle cells.
  • the protein is encoded by a plurality of exons (79) over a range of at least 2.6 Mb. Defects may occur in any part of the DMD gene. Skipping of a particular exon or particular exons can, very often, result in a restructured mRNA that encodes a shorter than normal but at least partially functional dystrophin protein.
  • Each compound, an oligonucleotide and/or an adjunct compound as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and/or an organ in vivo of individuals affected by or at risk of developing DMD or BMD, and may be administered directly in vivo, ex vivo or in vitro.
  • oligonucleotide or functional equivalent thereof may for example be provided to a cell in the form of an expression vector wherein the expression vector encodes a transcript comprising said oligonucleotide.
  • the expression vector is preferably introduced into the cell via a gene delivery vehicle.
  • a preferred delivery vehicle is a viral vector such as an adeno-associated virus vector (AAV), or a retroviral vector such as a lentivirus vector 4,51,52 and the like.
  • plasmids, artificial chromosomes, plasmids suitable for targeted homologous recombination and integration in the human genome of cells may be suitably applied for delivery of an oligonucleotide as defined herein.
  • Preferred for the current invention are those vectors wherein transcription is driven from PolIII promoters, and/or wherein transcripts are in the form fusions with U1 or U7 transcripts, which yield good results for delivering small transcripts. It is within the skill of the artisan to design suitable transcripts.
  • Such fusions may be generated as described 53,54 .
  • the oligonucleotide may be delivered as is. However, the oligonucleotide may also be encoded by the viral vector. Typically this is in the form of an RNA transcript that comprises the sequence of the oligonucleotide in a part of the transcript.
  • Suitable excipients comprise polyethylenimine (PEI), or similar cationic polymers, including polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives, ExGen 500, synthetic amphiphils (SAINT-18), LipofectinTM, DOTAP and/or viral capsid proteins that are capable of self assembly into particles that can deliver such compounds, preferably an oligonucleotide and optionally together with an adjunct compound as defined herein to a cell, preferably a muscle cell.
  • Such excipients have been shown to efficiently deliver (oligonucleotide such as antisense) nucleic acids to a wide variety of cultured cells, including muscle cells. Their high transfection potential is combined with an excepted low to moderate toxicity in terms of overall cell survival. The ease of structural modification can be used to allow further modifications and the analysis of their further (in vivo) nucleic acid transfer characteristics and toxicity.
  • Lipofectin represents an example of a liposomal transfection agent. It consists of two lipid components, a cationic lipid N-[1-(2,3 dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) (cp. DOTAP which is the methylsulfate salt) and a neutral lipid dioleoylphosphatidylethanolamine (DOPE). The neutral component mediates the intracellular release.
  • DOTMA cationic lipid N-[1-(2,3 dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride
  • DOPE neutral lipid dioleoylphosphatidylethanolamine
  • Another group of delivery systems are polymeric nanoparticles.
  • the skilled person may select and adapt any of the above or other commercially available alternative excipients and delivery systems to package and deliver a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound for use in the current invention to deliver said compound for the treatment of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in humans.
  • a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound could be covalently or non-covalently linked to a targeting ligand specifically designed to facilitate the uptake in to the cell, cytoplasm and/or its nucleus.
  • a targeting ligand specifically designed to facilitate the uptake in to the cell, cytoplasm and/or its nucleus.
  • Such ligand could comprise (i) a compound (including but not limited to peptide (-like) structures) recognising cell, tissue or organ specific elements facilitating cellular uptake and/or (ii) a chemical compound able to facilitate the uptake in to cells and/or the intracellular release of an a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound from vesicles, e.g. endosomes or lysosomes.
  • a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound are formulated in a medicament which is provided with at least an excipient and/or a targeting ligand for delivery and/or a delivery device of said compound to a cell and/or enhancing its intracellular delivery.
  • the invention also encompasses a pharmaceutically acceptable composition comprising a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound and further comprising at least one excipient and/or a targeting ligand for delivery and/or a delivery device of said compound to a cell and/or enhancing its intracellular delivery.
  • an oligonucleotide and an adjunct compound may not be formulated in one single composition or preparation. Depending on their identity, the skilled person will know which type of formulation is the most appropriate for each compound.
  • the invention provides a kit of parts comprising a compound for providing an individual with a functional dystrophin protein and an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
  • a concentration of an oligonucleotide as defined herein which is ranged between about 0.1 nM and about 1 ⁇ M is used. More preferably, the concentration used is ranged between about 0.3 to about 400 nM, even more preferably between about 1 to about 200 nM. If several oligonucleotides are used, this concentration may refer to the total concentration of oligonucleotides or the concentration of each oligonucleotide added.
  • concentrations of concentration of oligonucleotide(s) as given above are preferred concentrations for in vitro or ex vivo uses.
  • the concentration of oligonucleotide(s) used may further vary and may need to be optimised any further.
  • a compound preferably an oligonucleotide and an adjunct compound to be used in the invention to prevent, treat DMD or BMD are synthetically produced and administered directly to a cell, a tissue, an organ and/or patients in formulated form in a pharmaceutically acceptable composition or preparation.
  • the delivery of a pharmaceutical composition to the subject is preferably carried out by one or more parenteral injections, e.g. intravenous and/or subcutaneous and/or intramuscular and/or intrathecal and/or intraventricular administrations, preferably injections, at one or at multiple sites in the human body.
  • a DMD patient with a functional dystrophin protein with a therapy based on read-through of stopcodons.
  • Compounds capable of suppressing stopcodons are particularly suitable for a subgroup of DMD patients which is affected by nonsense mutations ( ⁇ 7%) resulting in the formation of a stop codon within their dystrophin gene.
  • said compound capable of suppressing stopcodons comprises the antibiotic gentamicin.
  • gentamicin treatment induced novel dystrophin expression up to 20% of normal level, albeit with variability among animals. Human trials with gentamicin have however been inconclusive 55 .
  • PTC124 belongs to a new class of small molecules that mimics at lower concentrations the readthrough activity of gentamicin.
  • Administration of PTC124 resulted in the production of full-length and functionally active dystrophin both in vitro and in mdx mice 16 .
  • Phase I/II trials with PTC124 are currently ongoing, not only for application in DMD but also for cystic fibrosis 16,17 .
  • the references 16 and 17 also describe preferred dosages of the PCT124 compound for use in the present invention.
  • said compound for providing said individual with a functional dystrophin protein comprises a compound for suppressing stop codons.
  • Said compound for suppressing stop codons preferably comprises gentamicin, PTC124 or a functional equivalent thereof. Most preferably, said compound comprises PTC124.
  • an individual is provided with a functional dystrophin protein using a vector, preferably a viral vector, comprising a micro-mini-dystrophin gene.
  • a vector preferably a viral vector, comprising a micro-mini-dystrophin gene.
  • a recombinant adeno-associated viral (rAAV) vector is used.
  • AAV is a single-stranded DNA parvovirus that is non-pathogenic and shows a helper-dependent life cycle.
  • viruses adenovirus, retrovirus, and herpes simplex virus
  • rAAV vectors have demonstrated to be very efficient in transducing mature skeletal muscle.
  • Application of rAAV in classical DMD “gene addition” studies has been hindered by its restricted packaging limits ( ⁇ 5 kb).
  • a compound for providing an individual with a functional dystrophin protein and at least one adjunct compound according to the invention can be administered to an individual in any order.
  • said compound for providing an individual with a functional dystrophin protein and said at least one adjunct compound are administered simultaneously (meaning that said compounds are administered within 10 hours, preferably within one hour). This is however not necessary.
  • at least one adjunct compound is administered to an individual in need thereof before administration of a compound for providing an individual with a functional dystrophin protein. Further provided is therefore a method according to the invention, comprising:
  • a functional dystrophin protein in a cell comprising pre-mRNA of a dystrophin gene encoding aberrant dystrophin protein, the method comprising:
  • said method further comprising allowing translation of mRNA produced from splicing of said pre-mRNA.
  • said method is performed in vitro, for instance using a cell culture.
  • the verb “to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded.
  • the verb “to consist” may be replaced by “to consist essentially of” meaning that a compound or adjunct compound as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention.
  • indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements.
  • the indefinite article “a” or “an” thus usually means “at least one”.
  • the word “approximately” or “about” when used in association with a numerical value preferably means that the value may be the given value of 10 more or less 1% of the value.
  • FIGS. 2A-2E Prescreening Studies of the Four Patients.
  • FIG. 3 RT-PCR Analysis of RNA Isolated from Serial Sections of Biopsy Specimens from the Patients.
  • RT-PCR reverse-transcriptase-polymerase-chain-reaction
  • FIGS. 4A-4B Dystrophin-Restoring Effect of a Single Intramuscular Dose of PRO051.
  • Immuno fluorescence analysis with the use of the dystrophin antibody MANDYS106 clearly shows dystrophin expression at the membranes of the majority of fibers throughout the biopsy specimen obtained from each patient (B).
  • Western blot analysis of total protein extracts isolated from the patients' biopsy specimens with the use of NCL-DYS1 antibody show restored dystrophin expression in all patients (A).
  • FIG. 5 Exon 23 skipping levels on RNA level in different muscle groups (Q: quadriceps muscle; TA: tibialis anterior muscle; DIA: diaphragm muscle) in mdx mice (two mice per group) treated with PS49 alone (group 3) or with PS49 and prednisolone (group 4).
  • FIGS. 6A-6B In muscle cells, DMD gene exon 44 (A) or exon 45 (B) skipping levels are enhanced with increasing concentrations of pentoxyfilline (from 0 to 0.5 mg/ml).
  • FIG. 6C Exon 23 skipping levels on RNA level in different muscle groups (Q: quadriceps muscle; TA: tibialis anterior muscle; Tri: triceps muscle; HRT: heart muscle) in mdx mice (two mice per group) treated with PS49 alone (group 3) or with PS49 and pentoxyfilline (group 4).
  • FIG. 8 Human IGF-1 Isoform 4 amino acid sequence.
  • FIGS. 9A-9M Various oligonucleotides directed against the indicated exons of the dystrophin 20 (DMD)
  • PRO051 is a synthetic, modified RNA molecule with sequence 5′-UCA AGG AAG AUG GCA UUU CU-3′, and designed to specifically induce exon 51 skipping 59 . It carries full-length 2′-O-methyl substituted ribose moieties and phosphorothioate internucleotide linkages.
  • Four DMD patients with different specific DMD gene deletions correctable by exon 51 skipping were included. At day 0, a series of safety parameters was assessed. The patient's leg (i.e.
  • tibialis anterior muscle was fixed with a tailor-made plastic mould and its position was carefully recorded.
  • a topical anesthetic (EMLA) was used to numb the skin
  • PRO051 were given along a line of 1.5 cm between two small skin tattoos, using a 2.5 cm electromyographic needle (MyoJect Disposable Hypodermic Needle Electrode, TECA Accessories) to ensure intramuscular delivery.
  • Each injection volume was 200 ⁇ l, containing 200 ⁇ g PRO051, dispersed in equal portions at angles of approximately 30 degrees. At day 28, the same series of safety parameters was assessed again.
  • the leg was positioned using the patient's own mould, and a semi-open muscle biopsy was taken between the tattoos under local anesthesia using a forceps with two sharp-edged jaws (Blakesley Conchotoma, DK Instruments). The biopsy was snap-frozen in liquid nitrogen-cooled 2-methylbutane. Patients were treated sequentially. At the time of study, two patients (nr. 1 and 2) were also on corticosteroids (prednisone or deflazacort), one had just stopped steroid treatment (nr. 4) and one patient never used steroids (nr. 3) (see Table 1). This latter patient was also the one who lost ambulance at the youngest age when compared to the other three patients.
  • RNA level RT-PCR analysis, not shown
  • novel expression of dystrophin on protein level immunofluorescence and western blot analyses, summarized in Table 1.
  • assessment of the series of safety parameters routine plasma and urine parameters for renal and liver function, electrolyte levels, blood cell counts, hemoglobin, aPTT, AP50 and CH50 values) before and after treatment, indicated that the PRO051 compound was locally safe and well tolerated.
  • acetone-fixed cross-sections of the biopsy were incubated for 90 minutes with monoclonal antibodies against the central rod domain (MANDYS106, Dr. G.
  • the blot was incubated overnight with dystrophin monoclonal antibody NCL-DYS1 (Novocastra Laboratories, 1:125), followed by goat anti-mouse IgG-HRP (Santa Cruz Biotechnology, 1:10.000) for one hour Immuno-reactive bands were visualized using the ECL Plus Western Blotting Detection System (GE Healthcare) and Hyperfilm ECL (Amersham, Biosciences). Signal intensities were measured using ImageJ. Novel dystrophin protein expression at the sarcolemma was detected in the majority of muscle fibers in the treated area in all four patients. The fibers in each section were manually counted after staining for laminin- ⁇ 2, a basal lamina protein unaffected by dystrophin deficiency.
  • patient 2 had 726 fibers, of which 620 were dystrophin-positive, while patient 3 had 120 fibers, of which 117 were dystrophin-positive.
  • the dystrophin intensities were typically lower than those in a healthy muscle biopsy.
  • Western blot analysis confirmed the presence of dystrophin in varying amounts.
  • the dystrophin signals were scanned and correlated to the control (per ⁇ g total protein). The amounts varied from 3% in patient 3 with the most dystrophic muscle, to 12% in patient 2 with the best preserved muscle.
  • a preexisting primary myoblast culture 1 was used for the prescreening of Patient 4.
  • fibroblasts were converted into myogenic cells after infection with an adenoviral vector containing the gene for the myogenic transcription factor (MyoD) as described previously.
  • MyoD myogenic transcription factor
  • 1,64,65 Myotube cultures were transfected with PRO051 (100 nM) and polyethylenimine (2 ⁇ l per microgram of PRO051), according to the manufacturer's instructions for ExGen500 (MBI Fermentas). RNA was isolated after 48 hours.
  • RT-PCR Reverse transcriptase-polymerase chain reaction
  • immunofluorescence Western blot analyses were performed as reported previously 1,12 PCR fragments were analyzed with the use of the 2100 Bioanalyzer (Agilent) and isolated for sequencing by the Leiden Genome Technology Center.
  • acetone-fixed sections were incubated for 90 minutes with monoclonal antibodies against the central rod domain (MANDYS106, Dr. G. Morris, United Kingdom) at a dilution of 1:60, the C-terminal domain (NCL-DYS2, Novocastra Laboratories) at a dilution of 1:30, or (as a reference) laminin (Chemicon International), a basal lamina protein that is unaffected by dystrophin deficiency, at a dilution of 1:150, followed by Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody (Molecular Probes) at a dilution of 1:250 for 1 hour.
  • Sections were mounted with Vectashield Mounting Medium (Vector Laboratories). ImageJ software (W. Rasband, National Institutes of Health, http://rsb.info.nih.gov/ij) was used for quantitative image analysis as described previously. 60,61 Entire cross sections were subdivided into series of 6 to 10 adjacent images, depending on the size of the section. To ensure reliable measurements, staining of the sections and recording of all images were performed during one session with the use of fixed exposure settings and the avoidance of pixel saturation. The lower-intensity threshold was set at background for Duchenne's muscular dystrophy, and positive fluorescence was quantified for each section (area percentage), both for dystrophin and laminin ⁇ 2.
  • Western blot analysis was performed as described previously 1 with the use of pooled homogenates from sets of four serial 50- ⁇ m sections throughout the biopsy specimen. For each patient, two amounts of total protein—30 ⁇ g and 60 ⁇ g—were applied, and for the control sample, 3 ⁇ g.
  • the Western blot was incubated overnight with dystrophin monoclonal antibody NCL-DYS1 (Novocastra Laboratories) at a dilution of 1:125, followed by horseradish-peroxidase-labeled goat antimouse IgG (Santa Cruz Biotechnology) at a dilution of 1:10,000 for 1 hour. Immunoreactive bands were visualized with the use of the ECL Plus Western blotting detection system (GE Healthcare) and Hyperfilm ECL (Amersham Biosciences). Signal intensities were measured with the use of ImageJ software.
  • RT-PCR identified a novel, shorter fragment caused by exon-51 skipping, as confirmed by sequencing ( FIG. 3 ). Further transcript analysis showed no other alterations (data not shown).
  • Mdx mice (C57Bl/10ScSn-mdx/J) were obtained from Charles River Laboratories (The Netherlands). These mice are dystrophin-deficient due to a nonsense mutation in exon 23. AON-induced exon 23 skipping is therapeutic in mdx mice by removing the nonsense mutation and correction of the open reading frame.
  • mice per group Two mdx mice per group were injected subcutaneously with: Group 1) physiologic salt (wk 1-8), Group 2) prednisolone (1 mg/kg, wk 1-8), Group 3) mouse-specific antisense oligonucleotide PS49 designed to specifically induce exon 23 skipping (100 mg/kg, wk 4 (5 times), week 5-8 (2 times), Group 4) prednisolone (1 mg/kg, wk 1-8)+PS49 (100 mg/kg, wk 4 (5 times), week 5-8 (2 times).
  • PS49 (5′ GGCCAAACCUCGGCUUACCU 3′) has a full-length phosphorothioate backbone and 2′O-methyl modified ribose molecules.
  • mice All mice were sacrificed at 1 week post-last-injection. Different muscles groups, including quadriceps, tibialis anterior, and diaphragm muscles were isolated and frozen in liquid nitrogen-cooled 2-methylbutane. For RT-PCR analysis, the muscle samples were homogenized in the RNA-Bee solution (Campro Scientific, The Netherlands). Total RNA was isolated and purified according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics, The Netherlands), 300 ng of RNA was used in a 20 ⁇ l reaction at 55° C. for 30 min, reverse primed with mouse DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94° C. (40 sec), 60° C.
  • UNIFectylin interacts electrostatically with nucleic acids, provided that the nucleic acid is negatively charged (such as 2′-O-methyl phosphorothioate AONs).
  • Pentoxyfillin Sigma Aldrich
  • RNA-Bee solution Campro Scientific, The Netherlands
  • 500 ng of RNA was used in a 20 ⁇ l reaction at 55° C. for 30 min, reverse primed with DMD gene-specific primers.
  • First PCRs were performed with outer primer sets, for 20 cycles of 94° C. (40 sec), 60° C.
  • Mdx mice C57Bl/10ScSn-mdx/J were obtained from Charles River Laboratories (The Netherlands). These mice are dystrophin-deficient due to a nonsense mutation in exon 23. AON-induced exon 23 skipping is therapeutic in mdx mice by removing the nonsense mutation and correction of the open reading frame.
  • mice per group Two mdx mice per group were injected subcutaneously with: Group 1) pentoxyfilline (50 mg/kg, wk 1-2), Group 2) mouse-specific antisense oligonucleotide PS49 designed to specifically induce exon 23 skipping (100 mg/kg, wk 2 (2 times), Group 3) pentoxyfilline (50 mg/kg, wk 1-2)+PS49 (100 mg/kg, wk 2 (2 times).
  • PS49 (5′ GGCCAAACCUCGGCUUACCU 3′) has a full-length phosphorothioate backbone and 2′O-methyl modified ribose molecules.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention provides means and methods for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy and/or Becker Muscular Dystrophy. Therapies using compounds for providing patients with functional muscle proteins are combined with at least one adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or at least one adjunct compound for improving muscle fiber function, integrity and/or survival.

Description

Notice: More than one reissue application has been filed for the reissue of U.S. Pat. No. 9,243,245. Besides the instant application, other reissue applications include two reissue applications (U.S. application Ser. No. 15/881,604 and U.S. application Ser. No. 15/881,610), which were both filed on Jan. 26, 2018; two continuation reissue applications (U.S. application Ser. No. 16/249,759 and U.S. application Ser. No. 16/249,777) which were both filed on Jan. 16, 2019; one continuation reissue application (U.S. application Ser. No. 16/353,978) which was filed on Mar. 14, 2019; and two divisional reissue applications (U.S. application Ser. No. 16/373,429 and U.S. application Ser. No. 16/373,459), which were both filed on Apr. 2, 2019.
This application is a reissue of U.S. Pat. No. 9,243,245, filed as U.S. application Ser. No. 12/767,702 on Apr. 26, 2010, which is a continuation application of and claims priority to of PCT/NL2008/050673, filed on Oct. 27, 2008, which claims priority to EPO Application No. 07119351.0, filed on Oct. 26, 2007, and U.S. Provisional Application No. 61/000,670, filed on Oct. 26, 2007, the. The contents of which each of the above applications are hereby incorporated by reference in their entirety by this reference.
The invention relates to the fields of molecular biology and medicine. A muscle disorder is a disease that usually has a significant impact on the life of an individual. A muscle disorder can either have a genetic cause or a non-genetic cause. An important group of muscle diseases with a genetic cause are Becker Muscular Dystrophy (BMD) and Duchenne Muscular Dystrophy (DMD). These disorders are caused by defects in a gene for a muscle protein.
Becker Muscular Dystrophy and Duchenne Muscular Dystrophy are genetic muscular dystrophies with a relatively high incidence. In both Duchenne and Becker muscular dystrophy the muscle protein dystrophin is affected. In Duchenne dystrophin is absent, whereas in Becker some dystrophin is present but its production is most often not sufficient and/or the dystrophin present is abnormally formed. Both diseases are associated with recessive X-linked inheritance. DMD results from a frameshift mutation in the DMD gene. The frameshift in the DMD gene results in the production of a truncated non-functional dystrophin protein, resulting in progressive muscle wasting and weakness. BMD occurs as a mutation does not cause a frame-shift in the DMD gene. As in BMD some dystrophin is present in contrast to DMD where dystrophin is absent, BMD has less severe symptoms then DMD. The onset of DMD is earlier than BMD. DMD usually manifests itself in early childhood, BMD in the teens or in early adulthood. The progression of BMD is slower and less predictable than DMD. Patients with BMD can survive into mid to late adulthood. Patients with DMD rarely survive beyond their thirties.
Dystrophin plays an important structural role in the muscle fiber, connecting the extracellular matrix and the cytoskeleton. The N-terminal region binds actin, whereas the C-terminal end is part of the dystrophin glycoprotein complex (DGC), which spans the sarcolemma. In the absence of dystrophin, mechanical stress leads to sarcolemmal ruptures, causing an uncontrolled influx of calcium into the muscle fiber interior, thereby triggering calcium-activated proteases and fiber necrosis.
For most genetic muscular dystrophies no clinically applicable and effective therapies are currently available. Exon skipping techniques are nowadays explored in order to combat genetic muscular dystrophies. Promising results have recently been reported by us and others on a genetic therapy aimed at restoring the reading frame of the dystrophin pre-mRNA in cells from the mdx mouse and DMD patients1-11. By the targeted skipping of a specific exon, a DMD phenotype (lacking dystrophin) is converted into a milder BMD phenotype (partly to largely functional dystrophin). The skipping of an exon is preferably induced by the binding of antisense oligoribonucleotides (AONs) targeting either one or both of the splice sites, or exon-internal sequences. Since an exon will only be included in the mRNA when both the splice sites are recognised by the spliceosome complex, splice sites are obvious targets for AONs. Alternatively, or additionally, one or more AONs are used which are specific for at least part of one or more exonic sequences. Using exon-internal AONs specific for an exon 46 sequence, we were previously able to modulate the splicing pattern in cultured myotubes from two different DMD patients with an exon 45 deletion11. Following AON treatment, exon 46 was skipped, which resulted in a restored reading frame and the induction of dystrophin synthesis in at least 75% of the cells. We have recently shown that exon skipping can also efficiently be induced in human control and patient muscle cells for 39 different DMD exons using exon-internal AONs1,2,11-15.
Hence, exon skipping techniques applied on the dystrophin gene result in the generation of at least partially functional—albeit shorter—dystrophin protein in DMD patients. Since DMD is caused by a dysfunctional dystrophin protein, it would be expected that the symptoms of DMD are sufficiently alleviated once a DMD patient has been provided with functional dystrophin protein. However, the present invention provides the insight that, even though exon skipping techniques are capable of inducing dystrophin synthesis, DMD symptom(s) is/are still further alleviated by administering to a DMD patient an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival. According to the present invention, even when a dystrophin protein deficiency has been restored in a DMD patient, the presence of tissue inflammation and damaged muscle cells still continues to contribute to the symptoms of DMD. Hence, even though the cause of DMD—i.e. a dysfunctional dystrophin protein—is alleviated, treatment of DMD is still further improved by additionally using an adjunct therapy according to the present invention. Furthermore, the present invention provides the insight that a reduction of inflammation does not result in significant reduction of AON uptake by muscle cells. This is surprising because, in general, inflammation enhances the trafficking of cells, blood and other compounds. As a result, AON uptake/delivery is also enhanced during inflammation. Hence, before the present invention it would be expected that an adjunct therapy counteracting inflammation involves the risk of negatively influencing AON therapy. This, however, appears not to be the case.
The present invention therefore provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising:
administering to said individual a compound for providing said individual with a (at least partially) functional dystrophin protein, and
administering to said individual an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
In another preferred embodiment the method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual comprises administering to said individual an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
It has surprisingly been found that the skipping frequency of a dystrophin exon from a pre-mRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon, is enhanced if cells expressing said pre-mRNA are also provided with an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
The present invention further provides a method for enhancing skipping of an exon from a dystrophin pre-mRNA in cells expressing said pre-mRNA, said method comprising
    • contacting said pre-mRNA in said cells with an oligonucleotide for skipping said exon and,
    • contacting said cells with an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
As Duchenne and Becker muscular dystrophy have a pronounced phenotype in muscle cells, it is preferred that said cells are muscle cells. Preferably said cells comprise a gene encoding a mutant dystrophin protein. Preferably said cells are cells of an individual suffering from DMD or BMD.
The present invention further provides a method for enhancing skipping of an exon from a dystrophin pre-mRNA in cells expressing said pre-mRNA in an individual suffering from Duchenne Muscular Dystrophy or Becker Muscular Dystrophy, the method comprising:
    • administering to said individual a compound for providing said individual with a (at least partially) functional dystrophin protein, and
administering to said individual an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival
An individual is provided with a functional dystrophin protein in various ways. In one embodiment an exon skipping technique is applied. However, alternative methods are available, such as for instance stop codon suppression by gentamycin or PTC12416,17 (also known as 3-(5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl)benzoic acid), and/or adeno-associated virus (AAV)-mediated gene delivery of a functional mini- or micro-dystrophin gene18-20. PTC124™ is a registered trademark of PTC Therapeutics, Inc. South Plainfield, N.J.
As defined herein, a functional dystrophin is preferably a wild type dystrophin corresponding to a protein having the amino acid sequence as identified in SEQ ID NO: 1. A functional dystrophin is preferably a dystrophin, which has an actin binding domain in its N terminal part (first 240 amino acids at the N terminus), a cystein-rich domain (amino acid 3361 till 3685) and a C terminal domain (last 325 amino acids at the C terminus) each of these domains being present in a wild type dystrophin as known to the skilled person. The amino acids indicated herein correspond to amino acids of the wild type dystrophin being represented by SEQ ID NO:1. In other words, a functional dystrophin is a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin “At least to some extent” preferably means at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of a corresponding activity of a wild type functional dystrophin. In this context, an activity of a functional dystrophin is preferably binding to actin and to the dystrophin-associated glycoprotein complex (DGC)56. Binding of dystrophin to actin and to the DGC complex may be visualized by either co-immunoprecipitation using total protein extracts or immunofluorescence analysis of cross-sections, from a biopsy of a muscle suspected to be dystrophic, as known to the skilled person.
Individuals suffering from Duchenne muscular dystrophy typically have a mutation in the gene encoding dystrophin that prevent synthesis of the complete protein, i.e of a premature stop prevents the synthesis of the C-terminus. In Becker muscular dystrophy the dystrophin gene also comprises a mutation compared tot the wild type but the mutation does typically not include a premature stop and the C-terminus is typically synthesized. As a result a functional dystrophin protein is synthesized that has at least the same activity in kind as the wild type protein, not although not necessarily the same amount of activity. The genome of a BMD individual typically encodes a dystrophin protein comprising the N terminal part (first 240 amino acids at the N terminus), a cystein-rich domain (amino acid 3361 till 3685) and a C terminal domain (last 325 amino acids at the C terminus) but its central rod shaped domain may be shorter than the one of a wild type dystrophin56. Exon—skipping for the treatment of DMD is typically directed to overcome a premature stop in the pre-mRNA by skipping an exon in the rod-domain shaped domain to correct the reading frame and allow synthesis of remainder of the dystrophin protein including the C-terminus, albeit that the protein is somewhat smaller as a result of a smaller rod domain. In a preferred embodiment, an individual having DMD and being treated by a method as defined herein will be provided a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin. More preferably, if said individual is a Duchennes patient or is suspected to be a Duchennes patient, a functional dystrophin is a dystrophin of an individual having BMD: typically said dystrophin is able to interact with both actin and the DGC, but its central rod shaped domain may be shorter than the one of a wild type dystrophin (Aartsma-Rus et al (2006, ref 56). The central rod domain of wild type dystrophin comprises 24 spectrin-like repeats56. For example, a central rod shaped domain of a dystrophin as provided herein may comprise 5 to 23, 10 to 22 or 12 to 18 spectrin-like repeats as long as it can bind to actin and to DGC.
Alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual in a method of the invention may be assessed by any of the following assays: prolongation of time to loss of walking, improvement of muscle strength, improvement of the ability to lift weight, improvement of the time taken to rise from the floor, improvement in the nine-meter walking time, improvement in the time taken for four-stairs climbing, improvement of the leg function grade, improvement of the pulmonary function, improvement of cardiac function, improvement of the quality of life. Each of these assays is known to the skilled person. As an example, the publication of Manzur at al (2008, ref 58) gives an extensive explanation of each of these assays. For each of these assays, as soon as a detectable improvement or prolongation of a parameter measured in an assay has been found, it will preferably mean that one or more symptoms of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy has been alleviated in an individual using a method of the invention. Detectable improvement or prolongation is preferably a statistically significant improvement or prolongation as described in Hodgetts et al (2006, ref 57). Alternatively, the alleviation of one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy may be assessed by measuring an improvement of a muscle fiber function, integrity and/or survival as later defined herein.
An adjunct compound for reducing inflammation comprises any therapy which is capable of at least in part reducing inflammation, preferably inflammation caused by damaged muscle cells. Said adjunct compound is most preferably capable of reducing muscle tissue inflammation. Inflammation is preferably assessed by detecting an increase in the number of infiltrating immune cells such as neutrophils and/or mast cells and/or dendritic cells and/or lymphocytes in muscle tissue suspected to be dystrophic. This assessment is preferably carried out in cross-sections of a biopsy57 of muscle tissue suspected to be dystrophic after having specifically stained immune cells as identified above. The quantification is preferably carried out under the microscope. Reducing inflammation is therefore preferably assessed by detecting a decrease in the number of immune cells in a cross-section of muscle tissue suspected to be dystrophic. Detecting a decrease preferably means that the number of at least one sort of immune cells as identified above is decreased of at least 1%, 2%, 3%, 5%, 7%, 10%, 12%, 15%, 17%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the number of a corresponding immune cell in a same individual before treatment. Most preferably, no infiltrating immune cells are detected in cross-sections of said biopsy.
An adjunct compound for improving muscle fiber function, integrity and/or survival comprises any therapy which is capable of measurably enhancing muscle fiber function, integrity and/or survival as compared to an otherwise similar situation wherein said adjunct compound is not present. The improvement of muscle fiber function, integrity and/or survival may be assessed using at least one of the following assays: a detectable decrease of creatine kinase in blood, a detectable decrease of necrosis of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic, and/or a detectable increase of the homogeneity of the diameter of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic. Each of these assays is known to the skilled person.
Creatine kinase may be detected in blood as described in 57. A detectable decrease in creatine kinase may mean a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the concentration of creatine kinase in a same individual before treatment.
A detectable decrease of necrosis of muscle fibers is preferably assessed in a muscle biopsy, more preferably as described in 57 using biopsy cross-sections. A detectable decrease of necrosis may be a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the area wherein necrosis has been identified using biopsy cross-sections. The decrease is measured by comparison to the necrosis as assessed in a same individual before treatment.
A detectable increase of the homogeneity of the diameter of a muscle fiber is preferably assessed in a muscle biopsy cross-section, more preferably as described in 57.
A treatment in a method according to the invention is about at least one week, about at least one month, about at least several months, about at least one year, about at least 2, 3, 4, 5, 6 years or more.
In one embodiment an adjunct compound for increasing turnover of damaged muscle cells is used. An adjunct compound for increasing turnover of damaged muscle cells comprises any therapy which is capable of at least in part inducing and/or increasing turnover of damaged muscle cells. Damaged muscle cells are muscle cells which have significantly less clinically measurable functionality than a healthy, intact muscle cell. In the absence of dystrophin, mechanical stress leads to sarcolemmal ruptures, causing an uncontrolled influx of calcium into the muscle fiber interior, thereby triggering calcium-activated proteases and fiber necrosis, resulting in damaged muscle cells. Increasing turnover of damaged muscle cells means that damaged muscle cells are more quickly broken down and/or removed as compared to a situation wherein turnover of damaged muscle cells is not increased. Turnover of damaged muscle cells is preferably assessed in a muscle biopsy, more preferably as described in 57 using a cross-section of a biopsy. A detectable increase of turnover may be an increase of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the area wherein turnover has been identified using a biopsy cross-section. The increase is measured by comparison to the turnover as assessed in a same individual before treatment.
Without wishing to be bound to theory, it is believed that increasing turnover of muscle cells is preferred because this reduces inflammatory responses.
According to the present invention, a combination of a therapy for providing an individual with a functional dystrophin protein, together with an adjunct therapy for reducing inflammation, preferably for reducing muscle tissue inflammation in an individual, is particularly suitable for use as a medicament. Such combination is even better capable of alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy as compared to a sole therapy for providing an individual with a functional dystrophin protein. This embodiment also enhances the skipping frequency of a dystrophin exon from a pre-mRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
Further provided is therefore a combination of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation in said individual, for use as a medicament. Since said combination is particularly suitable for counteracting DMD, the invention also provides a use of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation in said individual, for the preparation of a medicament for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
Preferred adjunct compound for reducing inflammation include a steroid, a TNF□ inhibitor, a source of mIGF-1 and/or an antioxidant. However, any other compound able to reduce inflammation as defined herein is also encompassed within the present invention. Each of these compounds is later on extensively presented. Each of the compounds extensively presented may be used separately or in combination with each other and/or in combination with one or more of the adjunct compounds used for improving muscle fiber function, integrity and/or survival.
Furthermore, a combination of a therapy for providing an individual with a functional dystrophin protein, together with an adjunct therapy for improving muscle fiber function, integrity and/or survival in an individual is particularly suitable for use as a medicament. Such combination is even better capable of alleviating one or more symptom(s) of Duchenne Muscular Dystrophy as compared to a sole therapy for providing an individual with a functional dystrophin protein.
Further provided is therefore a combination of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for improving muscle fiber function, integrity and/or survival in said individual, for use as a medicament. This combination is also particularly suitable for counteracting DMD. A use of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for improving muscle fiber function, integrity and/or survival in said individual, for the preparation of a medicament for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy is therefore also provided. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
Preferred adjunct compounds for improving muscle fiber function, integrity and/or survival include a ion channel inhibitor, a protease inhibitor, L-arginine and/or an angiotensin II type I receptor blocker. However, any other compound able to improving muscle fiber function, integrity and/or survival as defined herein is also encompassed within the present invention. Each of these compounds is later on extensively presented. Each of the compounds extensively presented may be used separately or in combination with each other and/or in combination with one or more of the adjunct compounds used for reducing inflammation.
In one embodiment a pharmaceutical preparation is made which comprises at least one of the above mentioned combinations comprising a compound for providing an individual with a functional dystrophin protein together with an adjunct compound according to the invention. Further provided is therefore a pharmaceutical preparation comprising:
a compound for providing an individual with a functional dystrophin protein, and
an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation in said individual, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival in said individual, and
a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient. Examples of suitable carriers and adjuvants are well known in the art and for instance comprise a saline solution. Dose ranges of compounds used in a pharmaceutical preparation according to the invention are designed on the basis of rising dose studies in clinical trials for which rigorous protocol requirements exist.
In a particularly preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a steroid. As shown in the Examples, such combination results in significant alleviation of DMD symptoms. One preferred embodiment of the present invention therefore provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a steroid and a compound for providing said individual with a functional dystrophin protein. A combination of a steroid and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a steroid and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. This embodiment also enhances the skipping frequency of a dystrophin exon from a pre-mRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
A steroid is a terpenoid lipid characterized by a carbon skeleton with four fused rings, generally arranged in a 6-6-6-5 fashion. Steroids vary by the functional groups attached to these rings and the oxidation state of the rings. Steroids include hormones and drugs which are usually used to relieve swelling and inflammation, such as for instance prednisone, dexamethasone and vitamin D.
According to the present invention, supplemental effects of adjunct steroid therapy in DMD patients include reduction of tissue inflammation, suppression of cytotoxic cells, and improved calcium homeostasis. Most positive results are obtained in younger boys. Preferably the steroid is a corticosteroid (glucocorticosteroid). Preferably, prednisone steroids (such as prednisone, prednizolone or deflazacort) are used in a method according to the invention21. Dose ranges of (glucocortico)steroids to be used in the therapeutic applications as described herein are designed on the basis of rising dose studies in clinical trials for which rigorous protocol requirements exist. The usual doses are about 0.5-1.0 mg/kg/day, preferably about 0.75 mg/kg/day for prednisone and prednisolone, and about 0.4-1.4 mg/kg/day, preferably about 0.9 mg/kg/day for deflazacort.
In one embodiment, a steroid is administered to said individual prior to administering a compound for providing an individual with a functional dystrophin protein. In this embodiment, it is preferred that said steroid is administered at least one day, more preferred at least one week, more preferred at least two weeks, more preferred at least three weeks prior to administering a compound for providing said individual with a functional dystrophin protein.
In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a tumour necrosis factor-alpha (TNFα) inhibitor. Tumour necrosis factor-alpha (TNFα) is a pro-inflammatory cytokine that stimulates the inflammatory response. Pharmacological blockade of TNFα activity with the neutralising antibody infliximab (Remicade) is highly effective clinically at reducing symptoms of inflammatory diseases. In mdx mice, both infliximab and etanercept delay and reduce the necrosis of dystrophic muscle24,25, with additional physiological benefits on muscle strength, chloride channel function and reduced CK levels being demonstrated in chronically treated exercised adult mdx mice26. Such highly specific anti-inflammatory drugs designed for use in other clinical conditions, are attractive alternatives to the use of steroids for DMD. In one embodiment, the use of a TNFα inhibitor is limited to periods of intensive muscle growth in boys when muscle damage and deterioration are especially pronounced.
One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a TNFα inhibitor and a compound for providing said individual with a functional dystrophin protein. A combination of a TNFα inhibitor and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a TNFα inhibitor and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. A preferred TNFα inhibitor is a dimeric fusion protein consisting of the extracellular ligand-binding domain of the human p75 receptor of TNFα linked to the Fc portion of human IgGl. A more preferred TNFα inhibitor is ethanercept (Amgen, America)26. The usual doses of ethanercept is about 0.2 mg/kg, preferably about 0.5 mg/kg twice a week. The administration is preferably subcutaneous.
In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a source of mIGF-1. As defined herein, a source of IGF-1 preferably encompasses mIGF-1 itself, a compound able of enhancing mIGF-1 expression and/or activity. Enhancing is herein synonymous with increasing. Expression of mIGF-1 is synonymous with amount of mIGF-1. mIGF-1 promotes regeneration of muscles through increase in satellite cell activity, and reduces inflammation and fibrosis27. Local injury of muscle results in increased mIGF-1 expression. In transgenic mice with extra IGF-1 genes, muscle hypertrophy and enlarged muscle fibers are observed27. Similarly, transgenic mdx mice show reduced muscle fiber degeneration28. Upregulation of the mIGF-1 gene and/or administration of extra amounts of mIGF-1 protein or a functional equivalent thereof (especially the mIGF-1 Ea isoform [as described in 27, human homolog IGF-1 isoform 4: SEQ ID NO: 2]) thus promotes the effect of other, preferably genetic, therapies for DMD, including antisense-induced exon skipping. The additional mIGF-1 levels in the above mentioned transgenic mice do not induce cardiac problems nor promote cancer, and have no pathological side effects. One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a compound for providing said individual with a functional dystrophin protein, and providing said individual with a source of mIGF-1, preferably mIGF-1 itself, a compound able of increasing mIGF-1 expression and/or activity. As stated before, the amount of mIGF-1 is for instance increased by enhancing expression of the mIGF-1 gene and/or by administration of mIGF-1 protein and/or a functional equivalent thereof (especially the mIGF-1 Ea isoform [as described in 27, human homolog IGF-1 isoform 4: SEQ ID NO: 2]). A combination of mIGF-1, or a compound capable of enhancing mIGF-1 expression or an mIGF-1 activity, and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of mIGF-1, or a compound capable of enhancing mIGF-1 expression or mIGF-1 activity, and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, such combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
Within the context of the invention, an increased amount or activity of mIGF-1 may be reached by increasing the gene expression level of an IGF-1 gene, by increasing the amount of a corresponding IGF-1 protein and/or by increasing an activity of an IGF1-protein. A preferred mIGF-1 protein has been earlier defined herein. An increase of an activity of said protein is herein understood to mean any detectable change in a biological activity exerted by said protein or in the steady state level of said protein as compared to said activity or steady-state in a individual who has not been treated. Increased amount or activity of mIGF-1 is preferably assessed by detection of increased expression of muscle hypertrophy biomarker GATA-2 (as described in 27).
Gene expression level is preferably assessed using classical molecular biology techniques such as (real time) PCR, arrays or Northern analysis. A steady state level of a protein is determined directly by quantifying the amount of a protein. Quantifying a protein amount may be carried out by any known technique such as Western blotting or immunoassay using an antibody raised against a protein. The skilled person will understand that alternatively or in combination with the quantification of a gene expression level and/or a corresponding protein, the quantification of a substrate of a corresponding protein or of any compound known to be associated with a function or activity of a corresponding protein or the quantification of said function or activity of a corresponding protein using a specific assay may be used to assess the alteration of an activity or steady state level of a protein.
In a method of the invention, an activity or steady-state level of a said protein may be altered at the level of the protein itself, e.g. by providing a protein to a cell from an exogenous source.
Preferably, an increase or an upregulation of the expression level of a said gene means an increase of at least 5% of the expression level of said gene using arrays. More preferably, an increase of the expression level of said gene means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more. In another preferred embodiment, an increase of the expression level of said protein means an increase of at least 5% of the expression level of said protein using western blotting and/or using ELISA or a suitable assay. More preferably, an increase of the expression level of a protein means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more.
In another preferred embodiment, an increase of a polypeptide activity means an increase of at least 5% of a polypeptide activity using a suitable assay. More preferably, an increase of a polypeptide activity means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more. The increase is preferably assessed by comparison to corresponding activity in the individual before treatment.
A preferred way of providing a source of mIGF1 is to introduce a transgene encoding mIGF1, preferably an mIGF-1 Ea isoform (as described in 27, human homolog IGF-1 isoform 4: SEQ ID NO: 2), more preferably in an AAV vector as later defined herein. Such source of mIGF1 is specifically expressed in muscle tissue as described in mice in 27.
In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with an antioxidant. Oxidative stress is an important factor in the progression of DMD and promotes chronic inflammation and fibrosis29. The most prevalent products of oxidative stress, the peroxidized lipids, are increased by an average of 35% in Duchenne boys. Increased levels of the enzymes superoxide dismutase and catalase reduce the excessive amount of free radicals causing these effects. In fact, a dietary supplement Protandim® (LifeVantage) was clinically tested and found to increase levels of superoxide dismutase (up to 30%) and catalase (up to 54%), which indeed significantly inhibited the peroxidation of lipids in 29 healthy persons30. Such effective management of oxidative stress thus preserves muscle quality and so promotes the positive effect of DMD therapy. Idebenone is another potent antioxidant with a chemical structure derived from natural coenzyme Q10. It protects mitochondria where adenosine triphosphate, ATP, is generated by oxidative phosphorylation. The absence of dystrophin in DMD negatively affects this process in the heart, and probably also in skeletal muscle. Idebenone was recently applied in clinical trials in the US and Europe demonstrating efficacy on neurological aspects of Friedreich's Ataxia31. A phase-IIa double-blind, placebo-controlled randomized clinical trial with Idebenone has recently been started in Belgium, including 21 Duchenne boys at 8 to 16 years of age. The primary objective of this study is to determine the effect of Idebenone on heart muscle function. In addition several different tests will be performed to detect the possible functional benefit on muscle strength in the patients. When effective, Idebenone is a preferred adjunct compound for use in a method according to the present invention in order to enhance the therapeutic effect of DMD therapy, especially in the heart. One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual an antioxidant and a compound for providing said individual with a functional dystrophin protein. A combination of an antioxidant and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of an antioxidant and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. Depending on the identity of the antioxidant, the skilled person will know which quantities are preferably used. An antioxidant may include bacoside, silymarin, curcumin, a polyphenol, preferably epigallocatechin-3-gallate (EGCG). Preferably, an anti-oxidant is a mixture of antioxidants as the dietary supplement Protandim® (LifeVantage). A daily capsule of 675 mg of Protandim® comprises 150 mg of B. monniera (45% bacosides), 225 mg of S. marianum (70-80% silymarin), 150 mg of W. somnifera powder, 75 mg green tea (98% polyphenols wherein 45% EGCG) and 75 mg turmeric (95% curcumin).
In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with an ion channel inhibitor. The presence of damaged muscle membranes in DMD disturbs the passage of calcium ions into the myofibers, and the consequently disrupted calcium homeostasis activates many enzymes, e.g. proteases, that cause additional damage and muscle necrosis. Ion channels that directly contribute to the pathological accumulation of calcium in dystrophic muscle are potential targets for adjunct compounds to treat DMD. There is evidence that some drugs, such as pentoxifylline, block exercise-sensitive calcium channels32 and antibiotics that block stretch activated channels reduce myofibre necrosis in mdx mice and CK levels in DMD boys33. One embodiment thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual an ion channel inhibitor and a compound for providing said individual with a functional dystrophin protein. A combination of an ion channel inhibitor and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of an ion channel inhibitor and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
Preferably, ion channel inhibitors of the class of xanthines are used. More preferably, said xanthines are derivatives of methylxanthines, and most preferably, said methylxanthine derivates are chosen from the group consisting of pentoxifylline, furafylline, lisofylline, propentofylline, pentifylline, theophylline, torbafylline, albifylline, enprofylline and derivatives thereof. Most preferred is the use of pentoxifylline. Ion channel inhibitors of the class of xanthines enhance the skipping frequency of a dystrophin exon from a pre-mRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
Depending on the identity of the ion channel inhibitor, the skilled person will know which quantities are preferably used. Suitable dosages of pentoxifylline are between about 1 mg/kg/day to about 100 mg/kg/day, preferred dosages are between about 10 mg/kg/day to 50 mg/kg/day. Typical dosages used in humans are 20 mg/kg/day.
In one embodiment, an ion channel inhibitor is administered to said individual prior to administering a compound for providing an individual with a functional dystrophin protein. In this embodiment, it is preferred that said ion channel inhibitor is administered at least one day, more preferred at least one week, more preferred at least two weeks, more preferred at least three weeks prior to administering a compound for providing said individual with a functional dystrophin protein.
In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a protease inhibitor. Calpains are calcium activated proteases that are increased in dystrophic muscle and account for myofiber degeneration. Calpain inhibitors such as calpastatin, leupeptin34, calpeptin, calpain inhibitor III, or PD150606 are therefore applied to reduce the degeneration process. A new compound, BN 82270 (Ipsen) that has dual action as both a calpain inhibitor and an antioxidant increased muscle strength, decreased serum CK and reduced fibrosis of the mdx diaphragm, indicating a therapeutic effect with this new compound35. Another compound of Leupeptin/Carnitine (Myodur) has recently been proposed for clinical trials in DMD patients.
MG132 is another proteasomal inhibitor that has shown to reduce muscle membrane damage, and to ameliorate the histopathological signs of muscular dystrophy36. MG-132 (CBZ-leucyl-leucyl-leucinal) is a cell-permeable, proteasomal inhibitor (Ki=4 nM) which inhibits NFkappaB activation by preventing IkappaB degradation (IC50=3 □M). In addition, it is a peptide aldehyde that inhibits ubiquitin-mediated proteolysis by binding to and inactivating 20S and 26S proteasomes. MG-132 has shown to inhibit the proteasomal degradation of dystrophin-associated proteins in the dystrophic mdx mouse model36. This compound is thus also suitable for use as an adjunct pharmacological compound for DMD. Further provided is therefore a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a protease inhibitor and a compound for providing said individual with a functional dystrophin protein. A combination of a protease inhibitor and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a protease inhibitor and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. Depending on the identity of the protease inhibitor, the skilled person will know which quantities are preferably used.
In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with L-arginine. Dystrophin-deficiency is associated with the loss of the DGC-complex at the fiber membranes, including neuronal nitric oxide synthase (nNOS). Expression of a nNOS transgene in mdx mice greatly reduced muscle membrane damage. Similarly, administration of L-arginine (the substrate for nitric oxide synthase) increased NO production and upregulated utrophin expression in mdx mice. Six weeks of L-arginine treatment improved muscle pathology and decreased serum CK in mdx mice37. The use of L-arginine as an adjunct therapy in combination with a compound for providing said individual with a functional dystrophin protein has not been disclosed.
Further provided is therefore a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual L-arginine and a compound for providing said individual with a functional dystrophin protein. A combination of L-arginine and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of L-arginine and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with angiotensin II type 1 receptor blocker Losartan which normalizes muscle architecture, repair and function, as shown in the dystrophin-deficient mdx mouse model23. One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual angiotensin II type 1 receptor blocker Losartan, and a compound for providing said individual with a functional dystrophin protein. A combination of angiotensin II type 1 receptor blocker Losartan and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of angiotensin II type 1 receptor blocker Losartan and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. Depending on the identity of the angiotensin II type 1 receptor blocker, the skilled person will know which quantities are preferably used.
In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with an angiotensin-converting enzyme (ACE) inhibitor, preferably perindopril. ACE inhibitors are capable of lowering blood pressure. Early initiation of treatment with perindopril is associated with a lower mortality in DMD patients22. One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual an ACE inhibitor, preferably perindopril, and a compound for providing said individual with a functional dystrophin protein. A combination of an ACE inhibitor, preferably perindopril, and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of an ACE inhibitor, preferably perindopril, and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. The usual doses of an ACE inhibitor, preferably perindopril are about 2 to 4 mg/day22.
In a more preferred embodiment, an ACE inhibitor is combined with at least one of the previously identified adjunct compounds.
In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a compound which is capable of enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing. Small chemical compounds, such as for instance specific indole derivatives, have been shown to selectively inhibit spliceosome assembly and splicing38, for instance by interfering with the binding of serine- and arginine-rich (SR) proteins to their cognate splicing enhancers (ISEs or ESEs) and/or by interfering with the binding of splicing repressors to silencer sequences (ESSs or ISSs). These compounds are therefore suitable for applying as adjunct compounds that enhance exon skipping.
Further provided is therefore a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing, and a compound for providing said individual with a functional dystrophin protein. A combination of a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. Depending on the identity of the compound which is capable of enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing, the skilled person will know which quantities are preferably used. In a more preferred embodiment, a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing is combined with a ACE inhibitor and/or with any adjunct compounds as identified earlier herein.
A pharmaceutical preparation comprising a compound for providing an individual with a functional dystrophin protein, any of the above mentioned adjunct compounds, and a pharmaceutically acceptable carrier, filler, preservative, adjuvant, solubilizer, diluent and/or excipient is also provided. Such pharmaceutically acceptable carrier, filler, preservative, adjuvant, solubilizer, diluent and/or excipient may for instance be found in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, Md.: Lippincott Williams & Wilkins, 2000.
The invention thus provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said adjunct compound comprises a steroid, an ACE inhibitor (preferably perindopril), angiotensin II type 1 receptor blocker Losartan, a tumour necrosis factor-alpha (TNFα) inhibitor, a source of mIGF-1, preferably mIGF-1, a compound for enhancing mIGF-1 expression, a compound for enhancing mIGF-1 activity, an antioxidant, an ion channel inhibitor, a protease inhibitor, L-arginine and/or a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing.
As described herein before, an individual is provided with a functional dystrophin protein in various ways, for instance by stop codon suppression by gentamycin or PTC12416,17, or by adeno-associated virus (AAV)-mediated gene delivery of a functional mini- or micro-dystrophin gene18-20.
Preferably, however, said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, for at least in part decreasing the production of an aberrant dystrophin protein in said individual. Decreasing the production of an aberrant dystrophin mRNA, or aberrant dystrophin protein, preferably means that 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less of the initial amount of aberrant dystrophin mRNA, or aberrant dystrophin protein, is still detectable by RT PCR (mRNA) or immunofluorescence or western blot analysis (protein). An aberrant dystrophin mRNA or protein is also referred to herein as a non-functional dystrophin mRNA or protein. A non functional dystrophin protein is preferably a dystrophin protein which is not able to bind actin and/or members of the DGC protein complex. A non-functional dystrophin protein or dystrophin mRNA does typically not have, or does not encode a dystrophin protein with an intact C-terminus of the protein. Said oligonucleotide preferably comprises an antisense oligoribonucleotide. In a preferred embodiment an exon skipping technique is applied.
Exon skipping interferes with the natural splicing processes occurring within a eukaryotic cell. In higher eukaryotes the genetic information for proteins in the DNA of the cell is encoded in exons which are separated from each other by intronic sequences. These introns are in some cases very long. The transcription machinery of eukaryotes generates a pre-mRNA which contains both exons and introns, while the splicing machinery, often already during the production of the pre-mRNA, generates the actual coding region for the protein by splicing together the exons present in the pre-mRNA.
Exon-skipping results in mature mRNA that lacks at least one skipped exon. Thus, when said exon codes for amino acids, exon skipping leads to the expression of an altered product. Technology for exon-skipping is currently directed towards the use of antisense oligonucleotides (AONs). Much of this work is done in the mdx mouse model for Duchenne muscular dystrophy. The mdx mouse, which carries a non-sense mutation in exon 23 of the dystrophin gene, has been used as an animal model of DMD. Despite the mdx mutation, which should preclude the synthesis of a functional dystrophin protein, rare, naturally occurring dystrophin positive fibers have been observed in mdx muscle tissue. These dystrophin-positive fibers are thought to have arisen from an apparently naturally occurring exon-skipping mechanism, either due to somatic mutations or through alternative splicing. AONs directed to, respectively, the 3′ and/or 5′ splice sites of introns 22 and 23 in dystrophin pre-mRNA, have been shown to interfere with factors normally involved in removal of intron 23 so that also exon 23 was removed from the mRNA3,5,6,39,40.
By the targeted skipping of a specific exon, a DMD phenotype is converted into a milder BMD phenotype. The skipping of an exon is preferably induced by the binding of AONs targeting either one or both of the splice sites, or exon-internal sequences. An oligonucleotide directed toward an exon internal sequence typically exhibits no overlap with non-exon sequences. It preferably does not overlap with the splice sites at least not insofar as these are present in the intron. An oligonucleotide directed toward an exon internal sequence preferably does not contain a sequence complementary to an adjacent intron. Further provided is thus a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, for inhibiting inclusion of an exon of a dystrophin pre-mRNA into mRNA produced from splicing of said pre-mRNA. An exon skipping technique is preferably applied such that the absence of an exon from mRNA produced from dystrophin pre-mRNA generates a coding region for a functional—albeit shorter—dystrophin protein. In this context, inhibiting inclusion of an exon preferably means that the detection of the original, aberrant dystrophin mRNA is decreased of at least about 10% as assessed by RT-PCR or that a corresponding aberrant dystrophin protein is decreased of at least about 10% as assessed by immunofluorescence or western blot analysis. The decrease is preferably of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%.
Once a DMD patient is provided with a functional dystrophin protein, the cause of DMD is taken away. Hence, it would then be expected that the symptoms of DMD are sufficiently alleviated. However, as already described before, the present invention provides the insight that, even though exon skipping techniques are capable of providing a functional dystrophin protein, a symptom of DMD is still further alleviated by administering to a DMD patient an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival. Moreover, the present invention provides the insight that an adjunct therapy counteracting inflammation does not negatively influence AON therapy. The present invention further provides the insight that the skipping frequency of a dystrophin exon from a pre-mRNA comprising said exon is enhanced, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
Since an exon of a dystrophin pre-mRNA will only be included into the resulting mRNA when both the splice sites are recognised by the spliceosome complex, splice sites are obvious targets for AONs. One embodiment therefore provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, comprising a sequence which is complementary to a non-exon region of a dystrophin pre mRNA. In one embodiment an AON is used which is solely complementary to a non-exon region of a dystrophin pre mRNA. This is however not necessary: it is also possible to use an AON which comprises an intron-specific sequence as well as exon-specific sequence. Such AON comprises a sequence which is complementary to a non-exon region of a dystrophin pre mRNA, as well as a sequence which is complementary to an exon region of a dystrophin pre mRNA. Of course, an AON is not necessarily complementary to the entire sequence of a dystrophin exon or intron. AONs which are complementary to a part of such exon or intron are preferred. An AON is preferably complementary to at least part of a dystrohin exon and/or intron, said part having at least 13 nucleotides.
Splicing of a dystrophin pre-mRNA occurs via two sequential transesterification reactions. First, the 2′OH of a specific branch-point nucleotide within the intron that is defined during spliceosome assembly performs a nucleophilic attack on the first nucleotide of the intron at the 5′ splice site forming the lariat intermediate. Second, the 3′OH of the released 5′ exon then performs a nucleophilic attack at the last nucleotide of the intron at the 3′ splice site thus joining the exons and releasing the intron lariat. The branch point and splice sites of an intron are thus involved in a splicing event. Hence, an oligonucleotide comprising a sequence which is complementary to such branch point and/or splice site is preferably used for exon skipping. Further provided is therefore a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, comprising a sequence which is complementary to a splice site and/or branch point of a dystrophin pre mRNA.
Since splice sites contain consensus sequences, the use of an oligonucleotide or a functional equivalent thereof (herein also called an AON) comprising a sequence which is complementary of a splice site involves the risk of promiscuous hybridization. Hybridization of AONs to other splice sites than the sites of the exon to be skipped could easily interfere with the accuracy of the splicing process. To overcome these and other potential problems related to the use of AONs which are complementary to an intron sequence, one preferred embodiment provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, comprising a sequence which is complementary to a dystrophin pre-mRNA exon. Preferably, said AON is capable of specifically inhibiting an exon inclusion signal of at least one exon in said dystrophin pre-mRNA. Interfering with an exon inclusion signal (EIS) has the advantage that such elements are located within the exon. By providing an AON for the interior of the exon to be skipped, it is possible to interfere with the exon inclusion signal thereby effectively masking the exon from the splicing apparatus. The failure of the splicing apparatus to recognize the exon to be skipped thus leads to exclusion of the exon from the final mRNA. This embodiment does not interfere directly with the enzymatic process of the splicing machinery (the joining of the exons). It is thought that this allows the method to be more specific and/or reliable. It is thought that an EIS is a particular structure of an exon that allows splice acceptor and donor to assume a particular spatial conformation. In this concept it is the particular spatial conformation that enables the splicing machinery to recognize the exon. However, the invention is certainly not limited to this model. It has been found that agents capable of binding to an exon are capable of inhibiting an EIS. An AON may specifically contact said exon at any point and still be able to specifically inhibit said EIS.
Using exon-internal AONs specific for an exon 46 sequence, we were previously able to modulate the splicing pattern in cultured myotubes from two different DMD patients with an exon 45 deletion11. Following AON treatment, exon 46 was skipped, which resulted in a restored reading frame and the induction of dystrophin synthesis in at least 75% of the cells. We have recently shown that exon skipping can also efficiently be induced in human control and series of patients with different mutations, including deletions, duplications and point mutations, for 39 different DMD exons using exon-internal AONs1,2,11-15.
Within the context of the invention, a functional equivalent of an oligonucleotide preferably means an oligonucleotide as defined herein wherein one or more nucleotides have been substituted and wherein an activity of said functional equivalent is retained to at least some extent. Preferably, an activity of said functional equivalent is providing a functional dystrophin protein. Said activity of said functional equivalent is therefore preferably assessed by quantifying the amount of a functional dystrophin protein. A functional dystrophin is herein preferably defined as being a dystrophin able to bind actin and members of the DGC protein complex. The assessment of said activity of an oligonucleotide is preferably done by RT-PCR or by immunofluorescence or Western blot analyses. Said activity is preferably retained to at least some extent when it represents at least 50%, or at least 60%, or at least 70% or at least 80% or at least 90% or at least 95% or more of corresponding activity of said oligonucleotide the functional equivalent derives from. Throughout this application, when the word oligonucleotide is used it may be replaced by a functional equivalent thereof as defined herein.
Hence, the use of an oligonucleotide, or a functional equivalent thereof, comprising or consisting of a sequence which is complementary to a dystrophin pre-mRNA exon provides good anti-DMD results. In one preferred embodiment an oligonucleotide, or a functional equivalent thereof, is used which comprises or consists of a sequence which is complementary to at least part of dystrophin pre-mRNA exon 2, 8, 9, 17, 19, 29, 40-46, 48-53, 55 or 59, said part having at least 13 nucleotides. However, said part may also have at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides.
Most preferably an AON is used which comprises or consists of a sequence which is complementary to at least part of dystrophin pre-mRNA exon 51, 44, 45, 53, 46, 43, 2, 8, 50 and/or 52, said part having at least 13 nucleotides. However, said part may also have at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides. Most preferred oligonucleotides are identified by each of the following sequences SEQ ID NO: 3 to SEQ ID NO: 284. Accordingly, a most preferred oligonucleotide as used herein is represented by a sequence from SEQ ID NO:3 to SEQ ID NO:284. A most preferred oligonucleotide as used herein is selected from the group consisting of SEQ ID NO:3 to NO:284.
Said exons are listed in decreasing order of patient population applicability. Hence, the use of an AON comprising a sequence which is complementary to at least part of dystrophin pre-mRNA exon 51 is suitable for use in a larger part of the DMD patient population as compared to an AON comprising a sequence which is complementary to dystrophin pre-mRNA exon 44, et cetera.
In a preferred embodiment, an oligonucleotide of the invention which comprises a sequence that is complementary to part of dystrophin pre-mRNA is such that the complementary part is at least 50% of the length of the oligonucleotide of the invention, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90% or even more preferably at least 95%, or even more preferably 98% or more. In a most preferred embodiment, the oligonucleotide of the invention consists of a sequence that is complementary to part of dystrophin pre-mRNA as defined herein. For example, an oligonucleotide may comprise a sequence that is complementary to part of dystrophin pre-mRNA as defined herein and additional flanking sequences. In a more preferred embodiment, the length of said complementary part of said oligonucleotide is of at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides. Preferably, additional flanking sequences are used to modify the binding of a protein to the oligonucleotide, or to modify a thermodynamic property of the oligonucleotide, more preferably to modify target RNA binding affinity.
One preferred embodiment provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, which comprises:
a sequence which is complementary to a region of a dystrophin pre-mRNA exon that is hybridized to another part of a dystrophin pre-mRNA exon (closed structure), and
a sequence which is complementary to a region of a dystrophin pre-mRNA exon that is not hybridized in said dystrophin pre-mRNA (open structure).
For this embodiment, reference is made to our WO 2004/083432 patent application. RNA molecules exhibit strong secondary structures, mostly due to base pairing of complementary or partly complementary stretches within the same RNA. It has long since been thought that structures in the RNA play a role in the function of the RNA. Without being bound by theory, it is believed that the secondary structure of the RNA of an exon plays a role in structuring the splicing process. Through its structure, an exon is recognized as a part that needs to be included in the mRNA. Herein this signalling function is referred to as an exon inclusion signal. A complementary oligonucleotide of this embodiment is capable of interfering with the structure of the exon and thereby capable of interfering with the exon inclusion signal of the exon. It has been found that many complementary oligonucleotides indeed comprise this capacity, some more efficient than others. Oligonucleotides of this preferred embodiment, i.e. those with the said overlap directed towards open and closed structures in the native exon RNA, are a selection from all possible oligonucleotides. The selection encompasses oligonucleotides that can efficiently interfere with an exon inclusion signal. Without being bound by theory it is thought that the overlap with an open structure improves the invasion efficiency of the oligonucleotide (i.e. increases the efficiency with which the oligonucleotide can enter the structure), whereas the overlap with the closed structure subsequently increases the efficiency of interfering with the secondary structure of the RNA of the exon, and thereby interfere with the exon inclusion signal. It is found that the length of the partial complementarity to both the closed and the open structure is not extremely restricted. We have observed high efficiencies with oligonucleotides with variable lengths of complementarity in either structure. The term complementarity is used herein to refer to a stretch of nucleic acids that can hybridise to another stretch of nucleic acids under physiological conditions. It is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand. For instance, when designing the oligonucleotide one may want to incorporate for instance a residue that does not base pair with the base on the complementary strand. Mismatches may to some extent be allowed, if under the circumstances in the cell, the stretch of nucleotides is capable of hybridising to the complementary part. In a preferred embodiment a complementary part (either to said open or to said closed structure) comprises at least 3, and more preferably at least 4 consecutive nucleotides. The complementary regions are preferably designed such that, when combined, they are specific for the exon in the pre-mRNA. Such specificity may be created with various lengths of complementary regions as this depends on the actual sequences in other (pre-)mRNA in the system. The risk that also one or more other pre-mRNA will be able to hybridise to the oligonucleotide decreases with increasing size of the oligonucleotide. It is clear that oligonucleotides comprising mismatches in the region of complementarity but that retain the capacity to hybridise to the targeted region(s) in the pre-mRNA, can be used in the present invention. However, preferably at least the complementary parts do not comprise such mismatches as these typically have a higher efficiency and a higher specificity, than oligonucleotides having such mismatches in one or more complementary regions. It is thought that higher hybridisation strengths, (i.e. increasing number of interactions with the opposing strand) are favourable in increasing the efficiency of the process of interfering with the splicing machinery of the system. Preferably, the complementarity is between 90 and 100%. In general this allows for approximately 1 or 2 mismatch(es) in an oligonucleotide of around 20 nucleotides
The secondary structure is best analysed in the context of the pre-mRNA wherein the exon resides. Such structure may be analysed in the actual RNA. However, it is currently possible to predict the secondary structure of an RNA molecule (at lowest energy costs) quite well using structure-modelling programs. A non-limiting example of a suitable program is RNA mfold version 3.1 server41. A person skilled in the art will be able to predict, with suitable reproducibility, a likely structure of the exon, given the nucleotide sequence. Best predictions are obtained when providing such modelling programs with both the exon and flanking intron sequences. It is typically not necessary to model the structure of the entire pre-mRNA.
The open and closed structure to which the oligonucleotide is directed, are preferably adjacent to one another. It is thought that in this way the annealing of the oligonucleotide to the open structure induces opening of the closed structure whereupon annealing progresses into this closed structure. Through this action the previously closed structure assumes a different conformation. The different conformation results in the disruption of the exon inclusion signal. However, when potential (cryptic) splice acceptor and/or donor sequences are present within the targeted exon, occasionally a new exon inclusion signal is generated defining a different (neo) exon, i.e. with a different 5′ end, a different 3′ end, or both. This type of activity is within the scope of the present invention as the targeted exon is excluded from the mRNA. The presence of a new exon, containing part of the targeted exon, in the mRNA does not alter the fact that the targeted exon, as such, is excluded. The inclusion of a neo-exon can be seen as a side effect which occurs only occasionally. There are two possibilities when exon skipping is used to restore (part of) an open reading frame of dystrophin that is disrupted as a result of a mutation. One is that the neo-exon is functional in the restoration of the reading frame, whereas in the other case the reading frame is not restored. When selecting oligonucleotides for restoring dystrophin reading frames by means of exon-skipping it is of course clear that under these conditions only those oligonucleotides are selected that indeed result in exon-skipping that restores the dystrophin open reading frame, with or without a neo-exon.
Further provided is a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, which comprises a sequence that is complementary to a binding site for a serine-arginine (SR) protein in RNA of an exon of a dystrophin pre-mRNA. In our WO 2006/112705 patent application we have disclosed the presence of a correlation between the effectivity of an exon-internal antisense oligonucleotide (AON) in inducing exon skipping and the presence of a (for example by ESEfinder) predicted SR binding site in the target pre-mRNA site of said AON. Therefore, in one embodiment an oligonucleotide is generated comprising determining a (putative) binding site for an SR (Ser-Arg) protein in RNA of a dystrophin exon and producing an oligonucleotide that is complementary to said RNA and that at least partly overlaps said (putative) binding site. The term “at least partly overlaps” is defined herein as to comprise an overlap of only a single nucleotide of an SR binding site as well as multiple nucleotides of said binding site as well as a complete overlap of said binding site. This embodiment preferably further comprises determining from a secondary structure of said RNA, a region that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and subsequently generating an oligonucleotide that at least partly overlaps said (putative) binding site and that overlaps at least part of said closed structure and overlaps at least part of said open structure. In this way we increase the chance of obtaining an oligonucleotide that is capable of interfering with the exon inclusion from the pre-mRNA into mRNA. It is possible that a first selected SR-binding region does not have the requested open-closed structure in which case another (second) SR protein binding site is selected which is then subsequently tested for the presence of an open-closed structure. This process is continued until a sequence is identified which contains an SR protein binding site as well as a(n) (partly overlapping) open-closed structure. This sequence is then used to design an oligonucleotide which is complementary to said sequence.
Such a method for generating an oligonucleotide is also performed by reversing the described order, i.e. first generating an oligonucleotide comprising determining, from a secondary structure of RNA from a dystrophin exon, a region that assumes a structure that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and subsequently generating an oligonucleotide, of which at least a part of said oligonucleotide is complementary to said closed structure and of which at least another part of said oligonucleotide is complementary to said open structure. This is then followed by determining whether an SR protein binding site at least overlaps with said open/closed structure. In this way the method of WO 2004/083432 is improved. In yet another embodiment the selections are performed simultaneously.
Without wishing to be bound by any theory it is currently thought that use of an oligonucleotide directed to an SR protein binding site results in (at least partly) impairing the binding of an SR protein to the binding site of an SR protein which results in disrupted or impaired splicing.
Preferably, an open/closed structure and an SR protein binding site partly overlap and even more preferred an open/closed structure completely overlaps an SR protein binding site or an SR protein binding site completely overlaps an open/closed structure. This allows for an improved disruption of exon inclusion.
Besides consensus splice sites sequences, many (if not all) exons contain splicing regulatory sequences such as exonic splicing enhancer (ESE) sequences to facilitate the recognition of genuine splice sites by the spliceosome42,43. A subgroup of splicing factors, called the SR proteins, can bind to these ESEs and recruit other splicing factors, such as U1 and U2AF to (weakly defined) splice sites. The binding sites of the four most abundant SR proteins (SF2/ASF, SC35, SRp40 and SRp55) have been analyzed in detail and these results are implemented in ESEfinder, a web source that predicts potential binding sites for these SR proteins42,43. There is a correlation between the effectiveness of an AON and the presence/absence of an SF2/ASF, SC35 and SRp40 binding site. In a preferred embodiment, the invention thus provides a method, combination, use or pharmaceutical preparation as described above, wherein said SR protein is SF2/ASF or SC35 or SRp40.
In one embodiment a DMD patient is provided with a functional dystrophin protein by using an oligonucleotide, or a functional equivalent thereof, which is capable of specifically binding a regulatory RNA sequence which is required for the correct splicing of a dystrophin exon in a transcript. Several cis-acting RNA sequences are required for the correct splicing of exons in a transcript. In particular, supplementary elements such as intronic or exonic splicing enhancers (ISEs and ESEs) or silencers (ISSs and ESEs) are identified to regulate specific and efficient splicing of constitutive and alternative exons. Using sequence-specific antisense oligonucleotides (AONs) that bind to the elements, their regulatory function is disturbed so that the exon is skipped, as shown for DMD. Hence, in one preferred embodiment an oligonucleotide or functional equivalent thereof is used which is complementary to an intronic splicing enhancer (ISE), an exonic splicing enhancer (ESE), an intronic splicing silencer (ISS) and/or an exonic splicing silencer (ESS). As already described herein before, a dystrophin exon is in one preferred embodiment skipped by an agent capable of specifically inhibiting an exon inclusion signal of said exon, so that said exon is not recognized by the splicing machinery as a part that needs to be included in the mRNA. As a result, a mRNA without said exon is formed.
An AON used in a method of the invention is preferably complementary to a consecutive part of between 13 and 50 nucleotides of dystrophin exon RNA or dystrophin intron RNA. In one embodiment an AON used in a method of the invention is complementary to a consecutive part of between 16 and 50 nucleotides of a dystrophin exon RNA or dystrophin intron RNA. Preferably, said AON is complementary to a consecutive part of between 15 and 25 nucleotides of said exon RNA. More preferably, an AON is used which comprises a sequence which is complementary to a consecutive part of between 20 and 25 nucleotides of a dystrophin exon RNA or a dystrophin intron RNA.
Different types of nucleic acid may be used to generate the oligonucleotide. Preferably, said oligonucleotide comprises RNA, as RNA/RNA hybrids are very stable. Since one of the aims of the exon skipping technique is to direct splicing in subjects it is preferred that the oligonucleotide RNA comprises a modification providing the RNA with an additional property, for instance resistance to endonucleases and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, reduced toxicity, increased intracellular transport, tissue-specificity, etc. Preferably said modification comprises a 2′-O-methyl-phosphorothioate oligoribonucleotide modification. Preferably said modification comprises a 2′-O-methyl-phosphorothioate oligodeoxyribonucleotide modification. One embodiment thus provides a method, combination, use or pharmaceutical preparation according to the invention, wherein an oligonucleotide is used which comprises RNA which contains a modification, preferably a 2′-O-methyl modified ribose (RNA) or deoxyribose (DNA) modification.
In one embodiment the invention provides a hybrid oligonucleotide comprising an oligonucleotide comprising a 2′-O-methyl-phosphorothioate oligo(deoxy)ribonucleotide modification and locked nucleic acid. This particular combination comprises better sequence specificity compared to an equivalent consisting of locked nucleic acid, and comprises improved effectivity when compared with an oligonucleotide consisting of 2′-O-methyl-phosphorothioate oligo(deoxy)ribonucleotide modification.
With the advent of nucleic acid mimicking technology it has become possible to generate molecules that have a similar, preferably the same hybridisation characteristics in kind not necessarily in amount as nucleic acid itself. Such functional equivalents are of course also suitable for use in a method of the invention. Preferred examples of functional equivalents of an oligonucleotide are peptide nucleic acid and/or locked nucleic acid. Most preferably, a morpholino phosphorodiamidate is used. Suitable but non-limiting examples of equivalents of oligonucleotides of the invention can be found in44,50. Hybrids between one or more of the equivalents among each other and/or together with nucleic acid are of course also suitable. In a preferred embodiment locked nucleic acid is used as a functional equivalent of an oligonucleotide, as locked nucleic acid displays a higher target affinity and reduced toxicity and therefore shows a higher efficiency of exon skipping.
In one embodiment an oligonucleotide, or a functional equivalent thereof, which is capable of inhibiting inclusion of a dystrophin exon into dystrophin mRNA is combined with at least one other oligonucleotide, or functional equivalent thereof, that is capable of inhibiting inclusion of another dystrophin exon into dystrophin mRNA. This way, inclusion of two or more exons of a dystrophin pre-mRNA in mRNA produced from this pre-mRNA is prevented. This embodiment is further referred to as double- or multi-exon skipping2,15. In most cases double-exon skipping results in the exclusion of only the two targeted exons from the dystrophin pre-mRNA. However, in other cases it was found that the targeted exons and the entire region in between said exons in said pre-mRNA were not present in the produced mRNA even when other exons (intervening exons) were present in such region. This multi-skipping was notably so for the combination of oligonucleotides derived from the DMD gene, wherein one oligonucleotide for exon 45 and one oligonucleotide for exon 51 was added to a cell transcribing the DMD gene. Such a set-up resulted in mRNA being produced that did not contain exons 45 to 51. Apparently, the structure of the pre-mRNA in the presence of the mentioned oligonucleotides was such that the splicing machinery was stimulated to connect exons 44 and 52 to each other.
Further provided is therefore a method, combination, use or pharmaceutical preparation according to the invention, wherein a nucleotide sequence is used which comprises at least 8, preferably between 16 to 80, consecutive nucleotides that are complementary to a first exon of a dystrophin pre-mRNA and wherein a nucleotide sequence is used which comprises at least 8, preferably between 16 to 80, consecutive nucleotides that are complementary to a second exon of said dystrophin pre-mRNA.
In one preferred embodiment said first and said second exon are separated in said dystrophin pre-mRNA by at least one exon to which said oligonucleotide is not complementary.
It is possible to specifically promote the skipping of also the intervening exons by providing a linkage between the two complementary oligonucleotides. Hence, in one embodiment stretches of nucleotides complementary to at least two dystrophin exons are separated by a linking moiety. The at least two stretches of nucleotides are thus linked in this embodiment so as to form a single molecule. Further provided is therefore a method, combination, use or pharmaceutical preparation according to the invention wherein said oligonucleotide, or functional equivalent thereof, for providing said individual with a functional dystrophin protein is complementary to at least two exons in a dystrophin pre-mRNA, said oligonucleotide or functional equivalent comprising at least two parts wherein a first part comprises an oligonucleotide having at least 8, preferably between 16 to 80, consecutive nucleotides that are complementary to a first of said at least two exons and wherein a second part comprises an oligonucleotide having at least 8, preferably between 16 to 80, consecutive nucleotides that are complementary to a second exon in said dystrophin pre-mRNA. The linkage may be through any means but is preferably accomplished through a nucleotide linkage. In the latter case the number of nucleotides that do not contain an overlap between one or the other complementary exon can be zero, but is preferably between 4 to 40 nucleotides. The linking moiety can be any type of moiety capable of linking oligonucleotides. Preferably, said linking moiety comprises at least 4 uracil nucleotides. Currently, many different compounds are available that mimic hybridisation characteristics of oligonucleotides. Such a compound, called herein a functional equivalent of an oligonucleotide, is also suitable for the present invention if such equivalent comprises similar hybridisation characteristics in kind not necessarily in amount. Suitable functional equivalents are mentioned earlier in this description. As mentioned, oligonucleotides of the invention do not have to consist of only oligonucleotides that contribute to hybridisation to the targeted exon. There may be additional material and/or nucleotides added.
The DMD gene is a large gene, with many different exons. Considering that the gene is located on the X-chromosome, it is mostly boys that are affected, although girls can also be affected by the disease, as they may receive a bad copy of the gene from both parents, or are suffering from a particularly biased inactivation of the functional allele due to a particularly biased X chromosome inactivation in their muscle cells. The protein is encoded by a plurality of exons (79) over a range of at least 2.6 Mb. Defects may occur in any part of the DMD gene. Skipping of a particular exon or particular exons can, very often, result in a restructured mRNA that encodes a shorter than normal but at least partially functional dystrophin protein. A practical problem in the development of a medicament based on exon-skipping technology is the plurality of mutations that may result in a deficiency in functional dystrophin protein in the cell. Despite the fact that already multiple different mutations can be corrected for by the skipping of a single exon, this plurality of mutations, requires the generation of a large number of different pharmaceuticals as for different mutations different exons need to be skipped. An advantage of a compound capable of inducing skipping of two or more exons, is that more than one exon can be skipped with a single pharmaceutical. This property is not only practically very useful in that only a limited number of pharmaceuticals need to be generated for treating many different DMD or particular, severe BMD mutations. Another option now open to the person skilled in the art is to select particularly functional restructured dystrophin proteins and produce compounds capable of generating these preferred dystrophin proteins. Such preferred end results are further referred to as mild phenotype dystrophins.
Each compound, an oligonucleotide and/or an adjunct compound as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and/or an organ in vivo of individuals affected by or at risk of developing DMD or BMD, and may be administered directly in vivo, ex vivo or in vitro.
Alternatively, suitable means for providing cells with an oligonucleotide or equivalent thereof are present in the art. An oligonucleotide or functional equivalent thereof may for example be provided to a cell in the form of an expression vector wherein the expression vector encodes a transcript comprising said oligonucleotide. The expression vector is preferably introduced into the cell via a gene delivery vehicle. A preferred delivery vehicle is a viral vector such as an adeno-associated virus vector (AAV), or a retroviral vector such as a lentivirus vector4,51,52 and the like. Also plasmids, artificial chromosomes, plasmids suitable for targeted homologous recombination and integration in the human genome of cells may be suitably applied for delivery of an oligonucleotide as defined herein. Preferred for the current invention are those vectors wherein transcription is driven from PolIII promoters, and/or wherein transcripts are in the form fusions with U1 or U7 transcripts, which yield good results for delivering small transcripts. It is within the skill of the artisan to design suitable transcripts. Preferred are PolIII driven transcripts. Preferably in the form of a fusion transcript with an U1 or U7 transcript4,51,52. Such fusions may be generated as described53,54. The oligonucleotide may be delivered as is. However, the oligonucleotide may also be encoded by the viral vector. Typically this is in the form of an RNA transcript that comprises the sequence of the oligonucleotide in a part of the transcript.
Improvements in means for providing cells with an oligonucleotide or equivalent thereof, are anticipated considering the progress that has already thus far been achieved. Such future improvements may of course be incorporated to achieve the mentioned effect on restructuring of mRNA using a method of the invention. The oligonucleotide or equivalent thereof can be delivered as is to the cells. When administering the oligonucleotide or equivalent thereof to an individual, it is preferred that the oligonucleotide is dissolved in a solution that is compatible with the delivery method. For intravenous, subcutaneous, intramuscular, intrathecal and/or intraventricular administration it is preferred that the solution is a physiological salt solution. Particularly preferred for a method of the invention is the use of an excipient that will aid in delivery of a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound to a cell and into a cell, preferably a muscle cell. Preferred are excipients capable of forming complexes, vesicles and/or liposomes that deliver such a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound complexed or trapped in a vesicle or liposome through a cell membrane. Many of these excipients are known in the art. Suitable excipients comprise polyethylenimine (PEI), or similar cationic polymers, including polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives, ExGen 500, synthetic amphiphils (SAINT-18), Lipofectin™, DOTAP and/or viral capsid proteins that are capable of self assembly into particles that can deliver such compounds, preferably an oligonucleotide and optionally together with an adjunct compound as defined herein to a cell, preferably a muscle cell. Such excipients have been shown to efficiently deliver (oligonucleotide such as antisense) nucleic acids to a wide variety of cultured cells, including muscle cells. Their high transfection potential is combined with an excepted low to moderate toxicity in terms of overall cell survival. The ease of structural modification can be used to allow further modifications and the analysis of their further (in vivo) nucleic acid transfer characteristics and toxicity.
Lipofectin represents an example of a liposomal transfection agent. It consists of two lipid components, a cationic lipid N-[1-(2,3 dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) (cp. DOTAP which is the methylsulfate salt) and a neutral lipid dioleoylphosphatidylethanolamine (DOPE). The neutral component mediates the intracellular release. Another group of delivery systems are polymeric nanoparticles.
Polycations such like diethylaminoethylaminoethyl (DEAE)-dextran, which are well known as DNA transfection reagent can be combined with butylcyanoacrylate (PBCA) and hexylcyanoacrylate (PHCA) to formulate cationic nanoparticles that can deliver a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound across cell membranes into cells.
In addition to these common nanoparticle materials, the cationic peptide protamine offers an alternative approach to formulate a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound as colloids. This colloidal nanoparticle system can form so called proticles, which can be prepared by a simple self-assembly process to package and mediate intracellular release of a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound. The skilled person may select and adapt any of the above or other commercially available alternative excipients and delivery systems to package and deliver a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound for use in the current invention to deliver said compound for the treatment of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in humans.
In addition, a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound could be covalently or non-covalently linked to a targeting ligand specifically designed to facilitate the uptake in to the cell, cytoplasm and/or its nucleus. Such ligand could comprise (i) a compound (including but not limited to peptide (-like) structures) recognising cell, tissue or organ specific elements facilitating cellular uptake and/or (ii) a chemical compound able to facilitate the uptake in to cells and/or the intracellular release of an a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound from vesicles, e.g. endosomes or lysosomes.
Therefore, in a preferred embodiment, a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound are formulated in a medicament which is provided with at least an excipient and/or a targeting ligand for delivery and/or a delivery device of said compound to a cell and/or enhancing its intracellular delivery. Accordingly, the invention also encompasses a pharmaceutically acceptable composition comprising a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound and further comprising at least one excipient and/or a targeting ligand for delivery and/or a delivery device of said compound to a cell and/or enhancing its intracellular delivery.
It is to be understood that an oligonucleotide and an adjunct compound may not be formulated in one single composition or preparation. Depending on their identity, the skilled person will know which type of formulation is the most appropriate for each compound.
In a preferred embodiment the invention provides a kit of parts comprising a compound for providing an individual with a functional dystrophin protein and an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
In a preferred embodiment, a concentration of an oligonucleotide as defined herein, which is ranged between about 0.1 nM and about 1 μM is used. More preferably, the concentration used is ranged between about 0.3 to about 400 nM, even more preferably between about 1 to about 200 nM. If several oligonucleotides are used, this concentration may refer to the total concentration of oligonucleotides or the concentration of each oligonucleotide added. The ranges of concentration of oligonucleotide(s) as given above are preferred concentrations for in vitro or ex vivo uses. The skilled person will understand that depending on the oligonucleotide(s) used, the target cell to be treated, the gene target and its expression levels, the medium used and the transfection and incubation conditions, the concentration of oligonucleotide(s) used may further vary and may need to be optimised any further.
More preferably, a compound preferably an oligonucleotide and an adjunct compound to be used in the invention to prevent, treat DMD or BMD are synthetically produced and administered directly to a cell, a tissue, an organ and/or patients in formulated form in a pharmaceutically acceptable composition or preparation. The delivery of a pharmaceutical composition to the subject is preferably carried out by one or more parenteral injections, e.g. intravenous and/or subcutaneous and/or intramuscular and/or intrathecal and/or intraventricular administrations, preferably injections, at one or at multiple sites in the human body.
Besides exon skipping, it is also possible to provide a DMD patient with a functional dystrophin protein with a therapy based on read-through of stopcodons. Compounds capable of suppressing stopcodons are particularly suitable for a subgroup of DMD patients which is affected by nonsense mutations (˜7%) resulting in the formation of a stop codon within their dystrophin gene. In one embodiment said compound capable of suppressing stopcodons comprises the antibiotic gentamicin. In a recent study in mdx mice, gentamicin treatment induced novel dystrophin expression up to 20% of normal level, albeit with variability among animals. Human trials with gentamicin have however been inconclusive55. PTC124 belongs to a new class of small molecules that mimics at lower concentrations the readthrough activity of gentamicin. Administration of PTC124 resulted in the production of full-length and functionally active dystrophin both in vitro and in mdx mice16. Phase I/II trials with PTC124 are currently ongoing, not only for application in DMD but also for cystic fibrosis16,17. The references 16 and 17 also describe preferred dosages of the PCT124 compound for use in the present invention. Further provided is therefore a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises a compound for suppressing stop codons. Said compound for suppressing stop codons preferably comprises gentamicin, PTC124 or a functional equivalent thereof. Most preferably, said compound comprises PTC124.
In one embodiment an individual is provided with a functional dystrophin protein using a vector, preferably a viral vector, comprising a micro-mini-dystrophin gene. Most preferably, a recombinant adeno-associated viral (rAAV) vector is used. AAV is a single-stranded DNA parvovirus that is non-pathogenic and shows a helper-dependent life cycle. In contrast to other viruses (adenovirus, retrovirus, and herpes simplex virus), rAAV vectors have demonstrated to be very efficient in transducing mature skeletal muscle. Application of rAAV in classical DMD “gene addition” studies has been hindered by its restricted packaging limits (<5 kb). Therefore, rAAV is preferably applied for the efficient delivery of a much smaller micro- or mini-dystrophin gene. Administration of such micro- or mini-dystrophin gene results in the presence of a at least partially functional dystrophin protein. Reference is made to18-20.
A compound for providing an individual with a functional dystrophin protein and at least one adjunct compound according to the invention can be administered to an individual in any order. In one embodiment, said compound for providing an individual with a functional dystrophin protein and said at least one adjunct compound are administered simultaneously (meaning that said compounds are administered within 10 hours, preferably within one hour). This is however not necessary. In one embodiment at least one adjunct compound is administered to an individual in need thereof before administration of a compound for providing an individual with a functional dystrophin protein. Further provided is therefore a method according to the invention, comprising:
administering to an individual in need thereof an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or administering to said individual an adjunct compound for improving muscle fiber function, integrity and/or survival, and, subsequently,
administering to said individual a compound for providing said individual with a functional dystrophin protein.
In yet another embodiment, said compound for providing an individual with a functional dystrophin protein is administered before administration of said at least one adjunct compound.
Further provided is a method for at least in part increasing the production of a functional dystrophin protein in a cell, said cell comprising pre-mRNA of a dystrophin gene encoding aberrant dystrophin protein, the method comprising:
providing said cell with a compound for inhibiting inclusion of an exon into mRNA produced from splicing of said dystrophin pre-mRNA, and
providing said cell with an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or providing said cell with an adjunct compound for improving muscle fiber function, integrity and/or survival, the method further comprising allowing translation of mRNA produced from splicing of said pre-mRNA. In one embodiment said method is performed in vitro, for instance using a cell culture.
In this context, increasing the production of a functional dystrophin protein has been earlier defined herein.
Unless otherwise indicated each embodiment as described herein may be combined with another embodiment as described herein.
In this document and in its claims, the verb “to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb “to consist” may be replaced by “to consist essentially of” meaning that a compound or adjunct compound as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention.
In addition, reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article “a” or “an” thus usually means “at least one”.
The word “approximately” or “about” when used in association with a numerical value (approximately 10, about 10) preferably means that the value may be the given value of 10 more or less 1% of the value.
All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.
The invention is further explained in the following examples. These examples do not limit the scope of the invention, but merely serve to clarify the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A-1B. Schematic Representation of Exon Skipping.
In a patient with Duchenne's muscular dystrophy who has a deletion of exon 50, an out-of-frame transcript is generated in which exon 49 is spliced to exon 51 (A). As a result, a stop codon is generated in exon 51, which prematurely aborts dystrophin synthesis. The sequence-specific binding of the exon-internal antisense oligonucleotide PRO051 interferes with the correct inclusion of exon 51 during splicing so that the exon is actually skipped (B). This restores the open reading frame of the transcript and allows the synthesis of a dystrophin similar to that in patients with Becker's muscular dystrophy (BMD).
FIGS. 2A-2E. Prescreening Studies of the Four Patients.
Magnetic resonance images of the lower legs of the four patients (the left leg of Patient 3 and right legs of the other three patients) show the adequate condition of the tibialis anterior muscle (less than 50% fat infiltration and fibrosis) (A). The diagnosis of Duchenne's muscular dystrophy in these patients was confirmed by diaminobenzidine tetrahydrochloride staining of cross sections of biopsy specimens obtained previously from the quadriceps muscle (B). No dystrophin expression was observed, with the exception of one dystrophin-positive, or revertant, fiber in Patient 2 (arrow). Reverse-transcriptase-polymerase chain-reaction (RT-PCR) analysis of the transcript region flanking the patients' mutations and exon 51 confirmed both the individual mutations in nontreated myotubes (NT) and the positive response to PRO051 (i.e., exon 51 skipping) in treated myotubes (T) on the RNA level (C). The efficiencies of exon skipping were 49% for Patient 1, 84% for Patient 2, 58% for Patient 3, and 90% for Patient 4. A cryptic splice site within exon 51 is sometimes activated by PRO051 in cell culture, resulting in an extra aberrant splicing product, as seen in the treated sample from Patient 4. Lane M shows a 100-bp size marker, and lane C RNA from healthy control muscle. Sequence analysis of the RT-PCR fragments from treated and untreated myotubes identified the precise skipping of exon 51 for each patient (D). The new in-frame transcripts led to substantial dystrophin synthesis, as detected by immunofluorescence analysis of treated myotubes with the use of monoclonal antibody NCL-DYS2 (E).
No dystrophin was detected before treatment.
FIG. 3. RT-PCR Analysis of RNA Isolated from Serial Sections of Biopsy Specimens from the Patients.
After treatment with PRO051, reverse-transcriptase-polymerase-chain-reaction (RT-PCR) analysis shows novel, shorter transcript fragments for each patient. Both the size and sequence of these fragments confirm the precise skipping of exon 51. No additional splice variants were observed. At 28 days, still significant in-frame RNA transcripts were detected, suggesting prolonged persistence of PRO051 in muscle. Owing to the small amount of section material, high-sensitivity PCR conditions were used; this process precluded the accurate quantification of skipping efficiencies and the meaningful correlation between levels of RNA and protein. M denotes size marker, and C control.
FIGS. 4A-4B. Dystrophin-Restoring Effect of a Single Intramuscular Dose of PRO051. Immuno fluorescence analysis with the use of the dystrophin antibody MANDYS106 clearly shows dystrophin expression at the membranes of the majority of fibers throughout the biopsy specimen obtained from each patient (B). Western blot analysis of total protein extracts isolated from the patients' biopsy specimens with the use of NCL-DYS1 antibody show restored dystrophin expression in all patients (A).
FIG. 5. Exon 23 skipping levels on RNA level in different muscle groups (Q: quadriceps muscle; TA: tibialis anterior muscle; DIA: diaphragm muscle) in mdx mice (two mice per group) treated with PS49 alone (group 3) or with PS49 and prednisolone (group 4).
FIGS. 6A-6B. In muscle cells, DMD gene exon 44 (A) or exon 45 (B) skipping levels are enhanced with increasing concentrations of pentoxyfilline (from 0 to 0.5 mg/ml). FIG. 6C Exon 23 skipping levels on RNA level in different muscle groups (Q: quadriceps muscle; TA: tibialis anterior muscle; Tri: triceps muscle; HRT: heart muscle) in mdx mice (two mice per group) treated with PS49 alone (group 3) or with PS49 and pentoxyfilline (group 4).
FIGS. 7A-7B. Dystrophin (DMD) gene amino acid sequence
FIG. 8. Human IGF-1 Isoform 4 amino acid sequence.
FIGS. 9A-9M. Various oligonucleotides directed against the indicated exons of the dystrophin 20 (DMD)
EXAMPLES Example 1
In a recent clinical study the local safety, tolerability, and dystrophin-restoring effect of antisense compound PRO051 was assessed. The clinical study was recently published. The content of the publication is reproduced herein under example 1A. In brief, PRO051 is a synthetic, modified RNA molecule with sequence 5′-UCA AGG AAG AUG GCA UUU CU-3′, and designed to specifically induce exon 51 skipping59. It carries full-length 2′-O-methyl substituted ribose moieties and phosphorothioate internucleotide linkages. Four DMD patients with different specific DMD gene deletions correctable by exon 51 skipping were included. At day 0, a series of safety parameters was assessed. The patient's leg (i.e. tibialis anterior muscle) was fixed with a tailor-made plastic mould and its position was carefully recorded. A topical anesthetic (EMLA) was used to numb the skin Four injections of PRO051 were given along a line of 1.5 cm between two small skin tattoos, using a 2.5 cm electromyographic needle (MyoJect Disposable Hypodermic Needle Electrode, TECA Accessories) to ensure intramuscular delivery. Each injection volume was 200 μl, containing 200 μg PRO051, dispersed in equal portions at angles of approximately 30 degrees. At day 28, the same series of safety parameters was assessed again. The leg was positioned using the patient's own mould, and a semi-open muscle biopsy was taken between the tattoos under local anesthesia using a forceps with two sharp-edged jaws (Blakesley Conchotoma, DK Instruments). The biopsy was snap-frozen in liquid nitrogen-cooled 2-methylbutane. Patients were treated sequentially. At the time of study, two patients (nr. 1 and 2) were also on corticosteroids (prednisone or deflazacort), one had just stopped steroid treatment (nr. 4) and one patient never used steroids (nr. 3) (see Table 1). This latter patient was also the one who lost ambulance at the youngest age when compared to the other three patients. The biopsy was analysed, for detection of specific exon skipping on RNA level (RT-PCR analysis, not shown) and novel expression of dystrophin on protein level (immunofluorescence and western blot analyses, summarized in Table 1). Assessment of the series of safety parameters (routine plasma and urine parameters for renal and liver function, electrolyte levels, blood cell counts, hemoglobin, aPTT, AP50 and CH50 values) before and after treatment, indicated that the PRO051 compound was locally safe and well tolerated. For immunofluorescence analysis, acetone-fixed cross-sections of the biopsy were incubated for 90 minutes with monoclonal antibodies against the central rod domain (MANDYS106, Dr. G. Morris, UK, 1:60), the C-terminal domain (NCL-DYS2, Novocastra Laboratories Ltd., 1:30) or, as reference, laminin-α2 (Chemicon International, Inc, 1:150), followed by Alexa Fluor 488 goat anti-mouse IgG (H+L) (Molecular Probes, Inc, 1:250) antibody for one hour. Sections were mounted with Vectashield Mounting Medium (Vector Laboratories Inc.). For quantitative image analysis the ImageJ software (W. Rasband, NIH, USA; http://rsb.info.nih.gov/ij) was used as described60,61. Entire cross-sections were subdivided into series of 6-10 adjacent images, depending on section size. To ensure reliable measurements, staining of the sections and recording of all images was performed in one session, using fixed exposure settings, and avoiding pixel saturation. The lower intensity threshold was set at Duchenne muscular dystrophy background, and positive fluorescence was quantified for each section (area percentage), both for dystrophin and laminin-α2. Western blot analysis was performed as described1, using pooled homogenates from sets of four serial 50 μm sections throughout the biopsy. For the patients 30 and 60 μg total protein was applied and for the control sample 3 μg. The blot was incubated overnight with dystrophin monoclonal antibody NCL-DYS1 (Novocastra Laboratories, 1:125), followed by goat anti-mouse IgG-HRP (Santa Cruz Biotechnology, 1:10.000) for one hour Immuno-reactive bands were visualized using the ECL Plus Western Blotting Detection System (GE Healthcare) and Hyperfilm ECL (Amersham, Biosciences). Signal intensities were measured using ImageJ. Novel dystrophin protein expression at the sarcolemma was detected in the majority of muscle fibers in the treated area in all four patients. The fibers in each section were manually counted after staining for laminin-α2, a basal lamina protein unaffected by dystrophin deficiency. The individual numbers varied, consistent with the biopsy size and the quality of the patients' muscles. In the largest sections, patient 2 had 726 fibers, of which 620 were dystrophin-positive, while patient 3 had 120 fibers, of which 117 were dystrophin-positive. The dystrophin intensities were typically lower than those in a healthy muscle biopsy. Western blot analysis confirmed the presence of dystrophin in varying amounts. The dystrophin signals were scanned and correlated to the control (per μg total protein). The amounts varied from 3% in patient 3 with the most dystrophic muscle, to 12% in patient 2 with the best preserved muscle. Since such comparison based on total protein does not correct for the varying amounts of fibrotic and adipose tissue in Duchenne muscular dystrophy patients, we also quantified the dystrophin fluorescence signal relative to that of the similarly-located laminin-α2 in each section, by ImageJ analysis. When this dystrophin/laminin-α2 ratio was set at 100% for the control section, the two patients that were co-treated with corticosteroids showed the highest percentages of dystrophin, 32% in patient 1 and 35% in patient 2 (Table 1). The lowest percentage of dystrophin was detected in patient 3, 17%. In patient 4 an intermediate percentage of 25% was observed. These percentages correlated to the relative quality of the target muscle, which was best in patients nr. 1 and 2, and worst in patient nr. 3.
TABLE 1
Patient 1 Patient 2 Patient 3 Patient 4
Age (yrs) 10 13 13 11
Age at Loss of  9 11  7 10
Ambulation (yrs)
Steroid Treatment Yes Yes Never Until
January
2006
Ratio Dystrophin/ 32% 35% 17% 25%
laminin-alpha2
Conclusion: the effect of the PRO051 antisense compound was more prominent in those patients that were also subjected to corticosteroids.
Example 1A
Reproduced from Van Deutekom J C et al, (2007) Antisense Oligonucleotide PRO051 Restores Local Dystrophin in DMD Patients. N Engl J. Med., 357(26): 2677-86.
Methods
Patients and Study Design
Patients with Duchenne's muscular dystrophy who were between the ages of 8 and 16 years were eligible to participate in the study. All patients had deletions that were correctable by exon-51 skipping and had no evidence of dystrophin on previous diagnostic muscle biopsy. Concurrent glucocorticoid treatment was allowed. Written informed consent was obtained from the patients or their parents, as appropriate. During the prescreening period (up to 60 days), each patient's mutational status and positive exon-skipping response to PRO051 in vitro were confirmed, and the condition of the tibialis anterior muscle was determined by T1-weighted magnetic resonance imaging (MRI).62 For patients to be included in the study, fibrotic and adipose tissue could make up no more than 50% of their target muscle.
During the baseline visit, safety measures were assessed. In each patient, the leg that was to be injected was fixed with a tailor-made plastic mold and its position was recorded. A topical eutectic mixture of local anesthetics (EMLA) was used to numb the skin. Four injections of PRO051 were given along a line measuring 1.5 cm running between two small skin tattoos with the use of a 2.5-cm electromyographic needle (MyoJect Disposable Hypodermic Needle Electrode, TECA Accessories) to ensure intramuscular delivery. The volume of each injection was 200 μl containing 200 μg of PRO051, which was dispersed in equal portions at angles of approximately 30 degrees.
At day 28, safety measures were assessed again. The leg that had been injected was positioned with the use of the patient's own mold, and a semiopen muscle biopsy was performed between the tattoos under local anesthesia with a forceps with two sharp-edged jaws (Blakesley Conchotoma, DK Instruments).63 The biopsy specimen was snap-frozen in 2-methylbutane cooled in liquid nitrogen.
Patients were treated sequentially from May 2006 through March 2007 and in compliance with Good Clinical Practice guidelines and the provisions of the Declaration of Helsinki. The study was approved by the Dutch Central Committee on Research Involving Human Subjects and by the local institutional review board at Leiden University Medical Center. All authors contributed to the study design, participated in the collection and analysis of the data, had complete and free access to the data, jointly wrote the manuscript, and vouch for the completeness and accuracy of the data and analyses presented.
Description of PRO051
PRO051 is a synthetic, modified RNA molecule with sequence 5′-UCAAGGAAGAUGGCAUUUCU-3′.12 It carries full-length 2′-O-methyl-substituted ribose molecules and phosphorothioate internucleotide linkages. The drug was provided by Prosensa B.V. in vials of 1 mg of freeze-dried material with no excipient. It was dissolved and administered in sterile, unpreserved saline (0.9% sodium chloride). PRO051 was not found to be mutagenic by bacterial Ames testing. In regulatory Good Laboratory Practice safety studies, rats that received a single administration of up to 8 mg per kilogram of body weight intramuscularly and 50 mg per kilogram intravenously showed no adverse effects; monkeys receiving PRO051 for 1 month appeared to tolerate doses up to 16 mg per kilogram per week when the drug was administered by intravenous 1-hour infusion or by subcutaneous injection, without clinically relevant adverse effects.
In Vitro Prescreening
A preexisting primary myoblast culture1 was used for the prescreening of Patient 4. For the other three patients, fibroblasts were converted into myogenic cells after infection with an adenoviral vector containing the gene for the myogenic transcription factor (MyoD) as described previously.1,64,65 Myotube cultures were transfected with PRO051 (100 nM) and polyethylenimine (2 μl per microgram of PRO051), according to the manufacturer's instructions for ExGen500 (MBI Fermentas). RNA was isolated after 48 hours. Reverse transcriptase-polymerase chain reaction (RT-PCR), immunofluorescence, and Western blot analyses were performed as reported previously1,12 PCR fragments were analyzed with the use of the 2100 Bioanalyzer (Agilent) and isolated for sequencing by the Leiden Genome Technology Center.
Safety Assessment
At baseline and at 2 hours, 1 day, and 28 days after injection, all patients received a full physical examination (including the measurement of vital signs) and underwent electrocardiography. In addition, plasma and urine were obtained to determine renal and liver function, electrolyte levels, complete cell counts, the activated partial-thromboplastin time, and complement activity values in the classical (CH50) and alternative (AP50) routes. The use of concomitant medications was recorded. At baseline and on day 28, the strength of the tibialis anterior muscle was assessed with the use of the Medical Research Council scale66 to evaluate whether the procedures had affected muscle performance. (On this scale, a score of 0 indicates no movement and a score of 5 indicates normal muscle strength.) Since only a small area of the muscle was treated, clinical benefit in terms of increased muscle strength was not expected. At each visit, adverse events were recorded.
RNA Assessment
Serial sections (50 μm) of the frozen muscle-biopsy specimen were homogenized in RNA-Bee solution (Campro Scientific) and MagNA Lyser Green Beads (Roche Diagnostics). Total RNA was isolated and purified according to the manufacturer's instructions. For complementary DNA, synthesis was accomplished with Transcriptor reverse transcriptase (Roche Diagnostics) with the use of 500 ng of RNA in a 20-μl reaction at 55° C. for 30 minutes with human exon 53 or 54 specific reverse primers. PCR analyses were performed as described previously.1,12 Products were analyzed on 2% agarose gels and sequenced. In addition, RT-PCR with the use of a primer set for the protein-truncation test67 was used to rapidly screen for aspecific aberrant splicing events throughout the DMD gene.
Assessment of Protein Level
For immunofluorescence analysis, acetone-fixed sections were incubated for 90 minutes with monoclonal antibodies against the central rod domain (MANDYS106, Dr. G. Morris, United Kingdom) at a dilution of 1:60, the C-terminal domain (NCL-DYS2, Novocastra Laboratories) at a dilution of 1:30, or (as a reference) laminin (Chemicon International), a basal lamina protein that is unaffected by dystrophin deficiency, at a dilution of 1:150, followed by Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody (Molecular Probes) at a dilution of 1:250 for 1 hour. Sections were mounted with Vectashield Mounting Medium (Vector Laboratories). ImageJ software (W. Rasband, National Institutes of Health, http://rsb.info.nih.gov/ij) was used for quantitative image analysis as described previously.60,61 Entire cross sections were subdivided into series of 6 to 10 adjacent images, depending on the size of the section. To ensure reliable measurements, staining of the sections and recording of all images were performed during one session with the use of fixed exposure settings and the avoidance of pixel saturation. The lower-intensity threshold was set at background for Duchenne's muscular dystrophy, and positive fluorescence was quantified for each section (area percentage), both for dystrophin and laminin α2.
Western blot analysis was performed as described previously1 with the use of pooled homogenates from sets of four serial 50-μm sections throughout the biopsy specimen. For each patient, two amounts of total protein—30 μg and 60 μg—were applied, and for the control sample, 3 μg. The Western blot was incubated overnight with dystrophin monoclonal antibody NCL-DYS1 (Novocastra Laboratories) at a dilution of 1:125, followed by horseradish-peroxidase-labeled goat antimouse IgG (Santa Cruz Biotechnology) at a dilution of 1:10,000 for 1 hour. Immunoreactive bands were visualized with the use of the ECL Plus Western blotting detection system (GE Healthcare) and Hyperfilm ECL (Amersham Biosciences). Signal intensities were measured with the use of ImageJ software.
Results
Prescreening of Patients
The study was planned to include four to six patients. Six patients were invited to participate, and one declined. The remaining five patients were prescreened. First, the condition of the tibialis anterior muscle was evaluated on MRI. The muscle condition of four patients was deemed to be adequate for the study (FIG. 2B), and the absence of dystrophin was confirmed in the patients' original biopsy specimens (FIG. 2B). Second, the mutational status and positive exon-skipping response to PRO051 of these four patients were confirmed in fibroblast cultures. PRO051 treatment generated a novel, shorter fragment of messenger RNA for each patient, representing 46% (in Patient 4) to 90% (in Patient 1) of the total RT-PCR product (FIG. 2C). Precise exon-51 skipping was confirmed by sequencing (FIG. 2D). No other transcript regions were found to be altered. Immunofluorescence analyses showed a preponderance of dystrophin-positive myotubes (FIG. 2E), a finding that was confirmed by Western blot analysis (not shown). Thus, the four patients were judged to be eligible for PRO051 treatment. Their baseline characteristics are shown in Table 2.
Safety and Adverse Events
All patients had one or more adverse events. However, only one patient reported mild local pain at the injection site, which was considered to be an adverse event related to the study drug. Other events included mild-to-moderate pain after the muscle biopsy. Two patients had blistering under the bandages used for wound closure. In the period between injection and biopsy, two patients reported a few days of flulike symptoms, and one patient had mild diarrhea for 1 day. At baseline, the muscle-strength scores of the treated tibialis anterior muscle in Patients 1, 2, 3, and 4 were 4, 2, 3, and 4, respectively, on the Medical Research Council scale. None of the patients showed changes in the strength of this muscle during the study or significant alterations in standard laboratory measures or increased measures of complement split products or activated partial-thromboplastin time. No local inflammatory or toxic response was detected in the muscle sections of the patients (data not shown). Patient 3 successfully underwent preplanned surgery for scoliosis in the month after the study was completed.
RNA and Protein Level
At day 28, a biopsy of the treated area was performed in each patient. Total muscle RNA was isolated from serial sections throughout the biopsy specimen. In all patients, RT-PCR identified a novel, shorter fragment caused by exon-51 skipping, as confirmed by sequencing (FIG. 3). Further transcript analysis showed no other alterations (data not shown). Immunofluorescence analyses of sections throughout the biopsy specimen of each patient showed clear sarcolemmal dystrophin signals in the majority of muscle fibers (FIGS. 4A and 4B). Dystrophin antibodies proximal and distal to the deletions that were used included MANDYS106 (FIGS. 4A and 4B) and NCL-DYS2 (similar to MANDYS106, not shown). The fibers in each section were manually counted after staining for laminin α2.68 The individual numbers varied, consistent with the size of the biopsy specimen and the quality of the muscle. In the largest sections, Patient 2 had 726 fibers, of which 620 were dystrophin-positive, whereas Patient 3 had 120 fibers, of which 117 were dystrophin-positive (Data not shown). The dystrophin intensities were typically lower than those in a healthy muscle biopsy specimen (Data not shown). The single fibers with a more intense dystrophin signal in Patients 2 and 3 could well be revertant fibers (Data not shown).
Western blot analysis confirmed the presence of dystrophin in varying amounts (FIG. 4A). The dystrophin signals were scanned and correlated to the control (per microgram of total protein). The amounts varied from 3% in Patient 3, who had the most-dystrophic muscle, to 12% in Patient 2, who had the best-preserved muscle. Since such comparison on the basis of total protein does not correct for the varying amounts of fibrotic and adipose tissue in patients with Duchenne's muscular dystrophy, we also quantified the dystrophin fluorescence signal (Data not shown) relative to that of the similarly located laminin α2 in each section by ImageJ analysis. When the ratio of dystrophin to laminin α2 was set at 100 for the control section, Patients 1, 2, 3, and 4 had ratios of 33, 35, 17, and 25, respectively (Table 1).
Discussion
Our study showed that local intramuscular injection of PRO051, a 2OMePS antisense oligoribonucleotide complementary to a 20-nucleotide sequence within exon 51, induced exon-51 skipping, corrected the reading frame, and thus introduced dystrophin in the muscle in all four patients with Duchenne's muscular dystrophy who received therapy. Dystrophin-positive fibers were found throughout the patients' biopsy specimens, indicating dispersion of the compound in the injected area. Since no delivery-enhancing excipient was used, PRO051 uptake did not seem to be a major potentially limiting factor. We cannot rule out that increased permeability of the dystrophic fiber membrane had a favorable effect. The patients produced levels of dystrophin that were 3 to 12% of the level in healthy control muscle, as shown on Western blot analysis of total protein. Since the presence of fibrosis and fat may lead to some underestimation of dystrophin in total protein extracts, we determined the ratio of dystrophin to laminin α2 in the cross sections, which ranged from 17 to 35, as compared with 100 in control muscle. The dystrophin-restoring effect of PRO051 was limited to the treated area, and no strength improvement of the entire muscle was observed. Future systemic treatment will require repeated administration to increase and maintain dystrophin expression at a higher level and to obtain clinical efficacy.
Because of medical-ethics regulations regarding interventions in minors, we could not obtain a biopsy specimen from the patients' contralateral muscles that had not been injected. However, the patients showed less than 1% of revertant fibers in the original diagnostic biopsy specimens obtained 5 to 9 years before the initiation of the study (Table 2 and FIG. 2B). We consider it very likely that the effects we observed were related to the nature and sequence of the PRO051 reagent rather than to a marked increase in revertant fibers. Indeed, a single, possibly revertant fiber that had an increased dystrophin signal was observed in both Patient 2 and Patient 3 (FIG. 4B).
In summary, our study showed that local administration of PRO051 to muscle in four patients with Duchenne' s muscular dystrophy restored dystrophin to levels ranging from 3 to 12% or 17 to 35%, depending on quantification relative to total protein or myofiber content. Consistent with the distinctly localized nature of the treatment, functional improvement was not observed. The consistently poorer result in Patient 3, who had the most advanced disease, suggests the importance of performing clinical trials in patients at a relatively young age, when relatively little muscle tissue has been replaced by fibrotic and adipose tissue. Our findings provide an indication that antisense-mediated exon skipping may be a potential approach to restoring dystrophin synthesis in the muscles of patients with Duchenne's muscular dystrophy.
Example 2
In a pre-clinical study in mdx mice (animal model for DMD) the effect of adjunct compound prednisone on AON-induced exon skipping was assessed.
Mdx mice (C57Bl/10ScSn-mdx/J) were obtained from Charles River Laboratories (The Netherlands). These mice are dystrophin-deficient due to a nonsense mutation in exon 23. AON-induced exon 23 skipping is therapeutic in mdx mice by removing the nonsense mutation and correction of the open reading frame. Two mdx mice per group were injected subcutaneously with: Group 1) physiologic salt (wk 1-8), Group 2) prednisolone (1 mg/kg, wk 1-8), Group 3) mouse-specific antisense oligonucleotide PS49 designed to specifically induce exon 23 skipping (100 mg/kg, wk 4 (5 times), week 5-8 (2 times), Group 4) prednisolone (1 mg/kg, wk 1-8)+PS49 (100 mg/kg, wk 4 (5 times), week 5-8 (2 times). PS49 (5′ GGCCAAACCUCGGCUUACCU 3′) has a full-length phosphorothioate backbone and 2′O-methyl modified ribose molecules.
All mice were sacrificed at 1 week post-last-injection. Different muscles groups, including quadriceps, tibialis anterior, and diaphragm muscles were isolated and frozen in liquid nitrogen-cooled 2-methylbutane. For RT-PCR analysis, the muscle samples were homogenized in the RNA-Bee solution (Campro Scientific, The Netherlands). Total RNA was isolated and purified according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics, The Netherlands), 300 ng of RNA was used in a 20 μl reaction at 55° C. for 30 min, reverse primed with mouse DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94° C. (40 sec), 60° C. (40 sec), and 72° C. (60 sec). One μl of this reaction (diluted 1:10) was then re-amplified using nested primer combinations in the exons directly flanking exon 23, with 30 cycles of 94° C. (40 sec), 60° C. (40 sec), and 72° C. (60 sec). PCR products were analysed on 2% agarose gels. Skipping efficiencies were determined by quantification of PCR products using the DNA 1000 LabChip® Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands). No exon 23 skipping was observed in the muscles from mice treated with physiologic salt or prenisolone only (groups 1 and 2). Levels of exon 23 skipping were detected and per muscle group compared between mice treated with PS49 only (group 3) and mice treated with PS49 and adjunct compound prednisolone (group 4). In the quadriceps (Q), tibialis anterior (TA), and diaphragm (DIA) muscles, exon 23 skipping levels were typically higher in group 4 when compared to group 3 (FIG. 5). This indicates that adjunct compound prednisolone indeed enhances exon 23 skipping levels in mdx mice treated with PS49.
Example 3
A., B. Differentiated muscle cell cultures (myotubes) derived from a healthy control individual were transfected with 250 nM PS188 ([5′ UCAGCUUCUGUUAGCCACUG 3′; SEQ ID NO:10] an AON optimized to specifically skip exon 44) or 250 nM PS221 ([5′ AUUCAAUGUUCUGACAACAGUUUGC 3′; SEQ ID NO: 60] an AON optimized to specifically skip exon 45) in the presence of 0 to 0.5 mg/ml pentoxifylline, using the transfection reagent polymer UNIFectylin (2.0 μl UNIFectylin per μg AON in 0.15M NaCl). UNIFectylin interacts electrostatically with nucleic acids, provided that the nucleic acid is negatively charged (such as 2′-O-methyl phosphorothioate AONs). Pentoxyfillin (Sigma Aldrich) was dissolved in water. Total RNA was isolated 24 hrs after transfection in RNA-Bee solution (Campro Scientific, The Netherlands) according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics, The Netherlands), 500 ng of RNA was used in a 20 μl reaction at 55° C. for 30 min, reverse primed with DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94° C. (40 sec), 60° C. (40 sec), and 72° C. (60 sec). One μl of this reaction (diluted 1:10) was then re-amplified using nested primer combinations in the exons directly flanking exon 44 or 45, with 30 cycles of 94° C. (40 sec), 60° C. (40 sec), and 72° C. (60 sec). PCR products were analysed on 2% agarose gels. Skipping efficiencies were determined by quantification of PCR products using the DNA 1000 LabChip® Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands).
Both with PS188 and PS221, increasing levels of exon 44 or 45 skipping were obtained with increasing concentrations of the adjunct compound pentoxifylline when compared to those obtained in cells that were not co-treated with pentoxyfilline (see FIG. 6). These results indicate that pentoxifylline enhances exon skipping levels in the muscle cells.
C.
In a pre-clinical study in mdx mice (animal model for DMD) the effect of adjunct compound pentoxyfilline on AON-induced exon skipping was assessed. Mdx mice (C57Bl/10ScSn-mdx/J) were obtained from Charles River Laboratories (The Netherlands). These mice are dystrophin-deficient due to a nonsense mutation in exon 23. AON-induced exon 23 skipping is therapeutic in mdx mice by removing the nonsense mutation and correction of the open reading frame. Two mdx mice per group were injected subcutaneously with: Group 1) pentoxyfilline (50 mg/kg, wk 1-2), Group 2) mouse-specific antisense oligonucleotide PS49 designed to specifically induce exon 23 skipping (100 mg/kg, wk 2 (2 times), Group 3) pentoxyfilline (50 mg/kg, wk 1-2)+PS49 (100 mg/kg, wk 2 (2 times). PS49 (5′ GGCCAAACCUCGGCUUACCU 3′) has a full-length phosphorothioate backbone and 2′O-methyl modified ribose molecules.
All mice were sacrificed at 1 week post-last-injection. Different muscles groups, including quadriceps, tibialis anterior, triceps and heart muscles were isolated and frozen in liquid nitrogen-cooled 2-methylbutane. For RT-PCR analysis, the muscle samples were homogenized in the RNA-Bee solution (Campro Scientific, The Netherlands). Total RNA was isolated and purified according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics, The Netherlands), 300 ng of RNA was used in a 20 μl reaction at 55° C. for 30 min, reverse primed with mouse DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94° C. (40 sec), 60° C. (40 sec), and 72° C. (60 sec). One μl of this reaction (diluted 1:10) was then re-amplified using nested primer combinations in the exons directly flanking exon 23, with 30 cycles of 94° C. (40 sec), 60° C. (40 sec), and 72° C. (60 sec). PCR products were analysed on 2% agarose gels. Skipping efficiencies were determined by quantification of PCR products using the DNA 1000 LabChip® Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands). No exon 23 skipping was observed in the muscles from mice treated with pentoxyfilline only (groups 1). Levels of exon 23 skipping were detected and per muscle group compared between mice treated with PS49 only (group 2) and mice treated with PS49 and adjunct compound pentoxyfilline (group 3). In the quadriceps (Q), tibialis anterior (TA), triceps (Tri) and heart (HRT) muscles, exon 23 skipping levels were typically higher in group 3 when compared to group 2 (FIG. 6c). This indicates that adjunct compound pentoxyfilline indeed enhances exon 23 skipping levels in mdx mice treated with PS49.
TABLE 2
Baseline characteristics of the DMD patients
Patient
1 Patient 2 Patient 3 Patient 4
Age (yrs)   10   13  13   11
Deletion Exon 50 Exons Exons Exon 52
48-50 49-50
Age at Loss of    9   11   7   10
Ambulation (yrs)
Scoliosis No No Yes Yes
Creatine Kinase 5823 2531 717 4711
Levels (U/I)1
Steroid treatment Yes Yes Never Until
January
2006
Strength TA    4    2   3    4
muscle (MRC
scale)
MRI status TA Moderate2 Moderate2 Moderate2 Moderate2
muscle
% Revertant N.D. <1% N.D.
fibers
1normal level: <200 U/I
2less than 50% fat infiltration and/or fibrosis [Mercuri et al., 2005)
REFERENCES
  • 1. Aartsma-Rus A, Janson A A, Kaman W E, et al. Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet. 2003; 12(8):907-14.
  • 2. Aartsma-Rus A, Janson A A, Kaman W E, et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet. 2004; 74(1):83-92.
  • 3. Alter J, Lou F, Rabinowitz A, et al. Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat Med 2006; 12(2):175-7.
  • 4. Goyenvalle A, Vulin A, Fougerousse F, et al. Rescue of dystrophic muscle through U7 snRNA-mediated exon skipping. Science 2004; 306(5702):1796-9.
  • 5. Lu Q L, Mann C J, Lou F, et al. Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse. Nat Med 2003; 6:6.
  • 6. Lu Q L, Rabinowitz A, Chen Y C, et al. Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci USA 2005; 102(1):198-203.
  • 7. McClorey G, Fall A M, Moulton H M, et al. Induced dystrophin exon skipping in human muscle explants. Neuromuscul Disord 2006; 16(9-10):583-90.
  • 8. McClorey G, Moulton H M, Iversen P L, et al. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther 2006; 13(19):1373-81.
  • 9. Pramono Z A, Takeshima Y, Alimsardjono H, Ishii A, Takeda S, Matsuo M. Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem Biophys Res Commun 1996; 226(2):445-9.
  • 10. Takeshima Y, Yagi M, Wada H, et al. Intravenous infusion of an antisense oligonucleotide results in exon skipping in muscle dystrophin mRNA of Duchenne muscular dystrophy. Pediatr Res 2006; 59(5):690-4.
  • 11. van Deutekom J C, Bremmer-Bout M, Janson A A, et al. Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells. Hum Mol Genet. 2001; 10(15):1547-54.
  • 12. Aartsma-Rus A, Bremmer-Bout M, Janson A, den Dunnen J, van Ommen G, van Deutekom J. Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. Neuromuscul Disord 2002; 12 Suppl:S71-S77.
  • 13. Aartsma-Rus A, De Winter C L, Janson A A, et al. Functional analysis of 114 exon-internal AONs for targeted DMD exon skipping: indication for steric hindrance of SR protein binding sites. Oligonucleotides 2005; 15(4):284-97.
  • 14. Aartsma-Rus A, Janson A A, Heemskerk J A, CL de Winter, G J Van Ommen, J C Van Deutekom. Therapeutic Modulation of DMD Splicing by Blocking Exonic Splicing Enhancer Sites with Antisense Oligonucleotides. Annals of the New York Academy of Sciences 2006; 1082:74-6.
  • 15. Aartsma-Rus A, Kaman W E, Weij R, den Dunnen J T, van Ommen G J, van Deutekom J C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol Ther 2006; 14(3):401-7.
  • 16. Welch E M, Barton E R, Zhuo J, et al. PTC124 targets genetic disorders caused by nonsense mutations. Nature 2007; 447(7140):87-91.
  • 17. Hirawat S, Welch E M, Elfring G L, et al. Safety, tolerability, and pharmacokinetics of PTC124, a nonaminoglycoside nonsense mutation suppressor, following single- and multiple-dose administration to healthy male and female adult volunteers. Journal of clinical pharmacology 2007; 47(4):430-44.
  • 18. Wang B, Li J, Xiao X. Adeno-associated virus vector carrying human minidystrophin genes effectively ameliorates muscular dystrophy in mdx mouse model. Proc Natl Acad Sci USA 2000; 97(25):13714-9.
  • 19. Fabb S A, Wells D J, Serpente P, Dickson G. Adeno-associated virus vector gene transfer and sarcolemmal expression of a 144 kDa micro-dystrophin effectively restores the dystrophin-associated protein complex and inhibits myofibre degeneration in nude/mdx mice. Hum Mol Genet. 2002; 11(7):733-41.
  • 20. Wang Z, Kuhr C S, Allen J M, et al. Sustained AAV-mediated dystrophin expression in a canine model of Duchenne muscular dystrophy with a brief course of immunosuppression. Mol Ther 2007; 15(6):1160-6.
  • 21. Manzur AY, Kuntzer T, Pike M, Swan A. Glucocorticoid corticosteroids for Duchenne muscular dystrophy. Cochrane Database Syst Rev 2004; 2.
  • 22. Duboc D, Meune C, Pierre B, et al. Perindopril preventive treatment on mortality in Duchenne muscular dystrophy: 10 years' follow-up. American heart journal 2007; 154(3):596-602.
  • 23. Cohn R D, van Erp C, Habashi J P, et al. Angiotensin II type 1 receptor blockade attenuates TGF-beta-induced failure of muscle regeneration in multiple myopathic states. Nat Med 2007; 13(2):204-10.
  • 24. Grounds M D, Torrisi J. Anti-TNFalpha (Remicade) therapy protects dystrophic skeletal muscle from necrosis. Faseb J 2004; 18(6):676-82.
  • 25. Hodgetts S, Radley H, Davies M, Grounds M D. Reduced necrosis of dystrophic muscle by depletion of host neutrophils, or blocking TNFalpha function with Etanercept in mdx mice. Neuromuscul Disord 2006; 16(9-10):591-602.
  • 26. Pierno S, Nico B, Burdi R, et al. Role of tumour necrosis factor alpha, but not of cyclo-oxygenase-2-derived eicosanoids, on functional and morphological indices of dystrophic progression in mdx mice: a pharmacological approach. Neuropathology and applied neurobiology 2007; 33(3):344-59.
  • 27. Musaro A, McCullagh K, Paul A, et al. Localized Igf-1 transgene expression sustains hypertrophy and regeneration in senescent skeletal muscle. Nat Genet. 2001; 27(2):195-200.
  • 28. Barton E R, Morris L, Musaro A, Rosenthal N, Sweeney H L. Muscle-specific expression of insulin-like growth factor I counters muscle decline in mdx mice. J Cell Biol 2002; 157(1):137-48.
  • 29. Disatnik M H, Dhawan J, Yu Y, et al. Evidence of oxidative stress in mdx mouse muscle: studies of the pre-necrotic state. J Neurol Sci 1998; 161(1):77-84.
  • 30. Nelson S K, Bose S K, Grunwald G K, Myhill P, McCord J M. The induction of human superoxide dismutase and catalase in vivo: a fundamentally new approach to antioxidant therapy. Free radical biology & medicine 2006; 40(2):341-7.
  • 31. Hart P E, Lodi R, Rajagopalan B, et al. Antioxidant treatment of patients with Friedreich ataxia: four-year follow-up. Archives of neurology 2005; 62(4):621-6.
  • 32. Rolland J F, De Luca A, Burdi R, Andreetta F, Confalonieri P, Conte Camerino D. Overactivity of exercise-sensitive cation channels and their impaired modulation by IGF-1 in mdx native muscle fibers: beneficial effect of pentoxifylline. Neurobiol Dis 2006; 24(3):466-74.
  • 33. Whitehead N P, Streamer M, Lusambili L I, Sachs F, Allen D G. Streptomycin reduces stretch-induced membrane permeability in muscles from mdx mice. Neuromuscul Disord 2006; 16(12):845-54.
  • 34. Badalamente M A, Stracher A. Delay of muscle degeneration and necrosis in mdx mice by calpain inhibition. Muscle Nerve 2000; 23(1):106-11.
  • 35. Burdi R, Didonna M P, Pignol B, et al. First evaluation of the potential effectiveness in muscular dystrophy of a novel chimeric compound, BN 82270, acting as calpain-inhibitor and anti-oxidant. Neuromuscul Disord 2006; 16(4):237-48.
  • 36. Bonuccelli G, Sotgia F, Schubert W, et al. Proteasome inhibitor (MG-132) treatment of mdx mice rescues the expression and membrane localization of dystrophin and dystrophin-associated proteins. Am J Pathol 2003; 163(4):1663-75.
  • 37. Voisin V, Sebrie C, Matecki S, et al. L-arginine improves dystrophic phenotype in mdx mice. Neurobiol Dis 2005; 20(1):123-30.
  • 38. Soret J, Bakkour N, Maire S, et al. Selective modification of alternative splicing by indole derivatives that target serine-arginine-rich protein splicing factors. Proc Natl Acad Sci USA 2005; 102(24):8764-9.
  • 39. Mann C J, Honeyman K, McClorey G, Fletcher S, Wilton S D. Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. J Gene Med 2002; 4(6):644-54.
  • 40. Graham I R, Hill V J, Manoharan M, Inamati G B, Dickson G. Towards a therapeutic inhibition of dystrophin exon 23 splicing in mdx mouse muscle induced by antisense oligoribonucleotides (splicomers): target sequence optimisation using oligonucleotide arrays. J Gene Med 2004; 6(10):1149-58.
  • 41. Mathews D H, Sabina J, Zuker M, Turner D H. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 1999; 288(5):911-40.
  • 42. Cartegni L, Chew S L, Kramer A R. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet. 2002; 3(4):285-98.
  • 43. Cartegni L, Wang J, Zhu Z, Zhang M Q, Krainer A R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res 2003; 31(13):3568-71.
  • 44. Braasch D A, Corey D R. Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chem Biol 2001; 8(1):1-7.
  • 45. Braasch D A, Corey D R. Novel antisense and peptide nucleic acid strategies for controlling gene expression. Biochemistry 2002; 41(14):4503-10.
  • 46. Elayadi A N, Corey D R. Application of PNA and LNA oligomers to chemotherapy. Curr Opin Investig Drugs 2001; 2(4):558-61.
  • 47. Larsen H J, Bentin T, Nielsen P E. Antisense properties of peptide nucleic acid. Biochim Biophys Acta 1999; 1489 (1):159-66.
  • 48. Summerton J. Morpholino antisense oligomers: the case for an RNase H-independent structural type. Biochim Biophys Acta 1999; 1489(1):141-58.
  • 49. Summerton J, Weller D. Morpholino antisense oligomers: design, preparation, and properties. Antisense Nucleic Acid Drug Dev 1997; 7(3):187-95.
  • 50. Wahlestedt C, Salmi P, Good L, et al. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci USA 2000; 97(10):5633-8.
  • 51. De Angelis F G, Sthandier O, Berarducci B, et al. Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc Natl Acad Sci USA 2002; 99(14):9456-61.
  • 52. Denti M A, Rosa A, D'Antona G, et al. Chimeric adeno-associated virus/antisense U1 small nuclear RNA effectively rescues dystrophin synthesis and muscle function by local treatment of mdx mice. Hum Gene Ther 2006; 17(5):565-74.
  • 53. Gorman L, Suter D, Emerick V, Schumperli D, Kole R. Stable alteration of pre-mRNA splicing patterns by modified U7 small nuclear RNAs. Proc Natl Acad Sci USA 1998; 95(9):4929-34.
  • 54. Suter D, Tomasini R, Reber U, Gorman L, Kole R, Schumperli D. Double-target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta-thalassemic mutations. Hum Mol Genet. 1999; 8(13):2415-23.
  • 55. Wagner K R, Hamed S, Hadley D W, et al. Gentamicin treatment of Duchenne and Becker muscular dystrophy due to nonsense mutations. Ann Neurol 2001; 49(6):706-11.
  • 56. Aartsma-Rus A et al, (2006), Entries in the leiden Duchenne Muscular Dystrophy mutation database: an overview of mutation types and paradoxical cases that confirm the reading-frame rule, Muscle Nerve, 34: 135-144.
  • 57. Hodgetts S., et al, (2006), Neuromuscular Disorders, 16:591-602.
  • 58. Manzur A Y et al, (2008), Glucocorticoid corticosteroids for Duchenne muscular dystrophy (review), Wiley publishers, The Cochrane collaboration.
  • 59. Van Deutekom J C et al, (2007) Antisense Oligonucleotide PRO051 Restores Local Dystrophin in DMD Patients. N Engl J. Med., 357(26): 2677-86.
  • 60. Yuan H, Takeuchi E, Taylor G A, McLaughlin M, Brown D, Salant D J. Nephrin dissociates from actin, and its expression is reduced in early experimental membranous nephropathy. J Am Soc Nephrol 2002; 13:946-56.
  • 61. Koop K, Bakker R C, Eikmans M, et al. Differentiation between chronic rejection and chronic cyclosporine toxity by analysis of renal cortical mRNA. Kindney Int 2004; 66:2038-46.
  • 62. Mercuri E, Bushby K, Ricci e., et al. Muscle MRI findings in patients with limb girdle muscular dystrophy with calpain 3 deficiency (LGMD2A) and early contractures. Neuromuscul Disord 2005; 15:164-71.
  • 63. Dorph C, Nennesmo I, Lundberg I E. Percutaneous conchotome muscle biopsy: a useful diagnostic and assessment tool. J Rheumatol 2001; 28:1591-9.
  • 64. Havenga M J, Lemckert A A, Ophorst O J, et al. Exploiting the natural diversity in adenovirus tropism for therapy and prevention of disease. J Virol 2002; 76:4612-20.
  • 65. Roest P A, van der Tuijn A C, Ginjaar H B, et al. Application of in vitro Myo-differentation of non-muscle cells to enhance gene expression and facilitate analysis of muscle proteins. Neuromuscul Disord 1996; 6:195-202.
  • 66. John J. Grading of muscular power: comparison of MRC and analogue scales by physiotherapists. Int J Rehabil Res 1984; 7:173-81.
  • 67. Roest P A, Roberts R G, van der Tuijn A C, Heikoop J C, van Ommen G J, den Dunnen J T. Protein truncation test (PTT) to rapidly screen the DMD gene for translation terminating mutations. Neuromuscul Disord 1993; 3:391-4.
  • 68. Cullen M J, Walsh J, Roberds S L, Campbell K P. Ultra-structural localization of adhalin, alpha-dystroglycan and merosin in normal and dystrophic muscle. Neuropathol Appl Neurobiol 1996; 22:30-7.

Claims (42)

The invention claimed is:
1. A composition comprising:
a first compound that increases the level of a functional dystrophin protein produced in a muscle cell of a Duchenne Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) individual,
wherein said first compound is an antisense oligonucleotide that induces skipping of exon 51 of human dystrophin pre-mRNA of said individual;
and a second compound comprising a steroid;
wherein, upon administration to a DMD or BMD patient, the composition increases the ratio of said dystrophin to laminin-α2 in muscle tissue of said patient as compared to the ratio of said dystrophin to laminin-α2 in muscle tissue of a patient administered with said first compound and not said second compound; and
wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 13 to 50 nucleotides in length and wherein said oligonucleotide comprises a non naturally-occurring modification.
2. The composition of claim 1, wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 14 to 25 nucleotides in length.
3. The composition of claim 1, wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 20 to 25 nucleotides in length.
4. The composition of claim 1, wherein said oligonucleotide comprises one or more ribonucleotides, and wherein a said ribonucleotide contains a modification.
5. The composition of claim 4, wherein said modification is a 2′-O-methyl modified ribose.
6. The composition of claim 1, wherein said modification is selected from the group consisting of at least one of a peptide nucleic acid, a locked nucleic acid, and morpholino phosphorodiamidate.
7. A method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising administering to a DMD or BMD patient:
a first compound that increases the level of a functional dystrophin protein produced in a muscle cell of said individual in said individual,
wherein said first compound is an antisense oligonucleotide that induces skipping of exon 51 of dystrophin pre-mRNA of said individual, and
a second compound, comprising a steroid;
wherein, upon administration to a DMD or BMD patient, the composition increases the ratio of said dystrophin to laminin-α2 in muscle tissue of said patient as compared to the ratio of said dystrophin to laminin-α2 in muscle tissue of a patient administered with said first compound and not said second compound; and
wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 13 to 50 nucleotides in length and wherein said oligonucleotide comprises a non naturally-occurring modification.
8. The method of claim 7, wherein said oligonucleotide comprises one or more ribonucleotides, and wherein a said ribonucleotide contains a modification.
9. The method of claim 8, wherein said modification is selected from the group consisting of a 2′-O-methyl modified ribose.
10. The method of claim 7, wherein said modification is selected from the group consisting of at least one of a peptide nucleic acid, a locked nucleic acid, and morpholino phosphorodiamidate.
11. A method for increasing the production of a functional dystrophin protein in a cell, said cell comprising pre-mRNA of a dystrophin gene encoding an aberrant dystrophin protein comprising:
providing said cell with a first compound for inhibiting inclusion of exon 51 into mRNA produced from splicing of said dystrophin pre-mRNA, wherein said first compound is an antisense oligonucleotide that induces the skipping of exon 51 of the human dystrophin pre-mRNA, and providing said cell with a second compound comprising a steroid,
said method further comprising allowing translation of mRNA produced from splicing of said pre-mRNA;
wherein, upon administration to a DMD or BMD patient, the composition increases the ratio of said dystrophin to laminin-α2 in muscle tissue of said patient as compared to the ratio of said dystrophin to laminin-α2 in muscle tissue of a patient administered with said first compound and not said second compound; and
wherein said antisense oligonucleotide is 100% complementary to a portion of exon 51 that is 13 to 50 nucleotides in length and wherein said oligonucleotide comprises a non naturally-occurring modification.
12. A pharmaceutical preparation comprising:
said first compound according to claim 1,
said second compound according to claim 1, comprising a steroid,
and a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient.
13. A kit comprising:
said first compound according to claim 1,
and said second compound according to claim 1.
14. The kit of claim 13, further comprising a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient.
15. The kit of claim 13, further comprising packaging means thereof.
16. The composition according to claim 1, wherein the oligonucleotide comprises a phosphorothioate internucleotide linkage, a 2′-O-methyl ribose and/or a LNA.
17. The kit according to claim 13, wherein the oligonucleotide comprises a phosphorothioate internucleotide linkage, a 2′-O-methyl ribose and/or a LNA.
18. A pharmaceutical composition comprising the composition of claim 1 and a pharmaceutically acceptable carrier, adjuvant, diluent, and/or excipient.
19. The method of claim 7 wherein said steroid is a glucocorticosteroid.
20. The method of claim 19 wherein said glucocorticosteroid is selected from a group consisting of prednisone, dexamethasone, prednizolone and deflazacort.
21. The method of claim 20 wherein said prednisone is present at a dosage of 0.5-1.0 mg/kg.
22. The method of claim 20 wherein said deflazacort is present at a dosage of 0.4-1.4 mg/kg.
23. A method for alleviating one or more symptoms of Duchenne muscular dystrophy in a human patient, comprising administering to the patient an antisense oligonucleotide that is: (a) 100% complementary to a portion of exon 51 of the human dystrophin pre-mRNA and (b) 30 nucleotides in length,
wherein the antisense oligonucleotide comprises the sequence 5′-CUC CAA CAU CAA GGA AGA UGG CAU UUC UAG-3′ (SEQ ID NO:193),
wherein the antisense oligonucleotide is a morpholino phosphorodiamidate,
wherein the antisense oligonucleotide is administered intravenously,
wherein the antisense oligonucleotide induces skipping of exon 51 of dystrophin pre-mRNA, and
wherein the patient is receiving glucocorticosteroid treatment.
24. The method of claim 23, wherein the patient was receiving the glucocorticosteroid treatment prior to the administration of the antisense oligonucleotide.
25. The method of claim 24, wherein the prior glucocorticosteroid treatment was for a period of at least three weeks.
26. The method of claim 23, wherein the glucocorticosteroid is selected from the group consisting of prednisone, dexamethasone, prednisolone, and deflazacort.
27. The method of claim 26, wherein the glucocorticosteroid is prednisone.
28. The method of claim 27, wherein the patient is receiving the prednisolone at a dose of about 0.5 mg/kg/day to about 1.0 mg/kg/day.
29. The method of claim 26, wherein the glucocorticosteroid is deflazacort.
30. The method of claim 29, wherein the patient is receiving the deflazacort at a dose of about 0.4 mg/kg/day to about 1.4 mg/kg/day.
31. The method of claim 23, wherein the method increases the ratio of dystrophin to laminin-α2 in muscle tissue of the patient as compared to the ratio of dystrophin to laminin-α2 in muscle tissue of a similar patient treated with the antisense oligonucleotide and not the glucocorticosteroid.
32. A method for alleviating one or more symptoms of Duchenne muscular dystrophy in a human patient, comprising administering to the patient an antisense oligonucleotide that is: (a) 100% complementary to a portion of exon 51 of the human dystrophin pre-mRNA and (b) 30 nucleotides in length,
wherein the antisense oligonucleotide is a functional equivalent of an oligonucleotide comprising the sequence 5′-CUC CAA CAU CAA GGA AGA UGG CAU UUC UAG-3′ (SEQ ID NO:193),
wherein the antisense oligonucleotide is a morpholino phosphorodiamidate,
wherein the antisense oligonucleotide is administered intravenously,
wherein the antisense oligonucleotide induces skipping of exon 51 of dystrophin pre-mRNA, and
wherein the patient is receiving glucocorticosteroid treatment.
33. A method for alleviating one or more symptoms of Duchenne muscular dystrophy in a human patient, comprising administering to the patient an antisense oligonucleotide that is 100% complementary to the portion of exon 51 of the human dystrophin pre-mRNA to which the sequence 5′-CUC CAA CAU CAA GGA AGA UGG CAU UUC UAG-3′ (SEQ ID NO:193) is complementary,
wherein the antisense oligonucleotide is 30 nucleotides in length,
wherein the antisense oligonucleotide is a morpholino phosphorodiamidate,
wherein the antisense oligonucleotide is administered intravenously,
wherein the antisense oligonucleotide induces skipping of exon 51 of dystrophin pre-mRNA, and
wherein the patient is receiving glucocorticosteroid treatment.
34. The method of claim 33, wherein the patient has received the glucocorticosteroid treatment prior to the administration of the antisense oligonucleotide.
35. The method of claim 34, wherein the prior glucocorticosteroid treatment was for a period of at least three weeks.
36. The method of claim 33, wherein the glucocorticosteroid is selected from the group consisting of prednisone, dexamethasone, prednisolone, and deflazacort.
37. The method of claim 36, wherein the glucocorticosteroid is prednisone.
38. The method of claim 37, wherein the patient is receiving the prednisone at a dose of about 0.5 mg/kg/day to about 1.0 mg/kg/day.
39. The method of claim 36, wherein the glucocorticosteroid is deflazacort.
40. The method of claim 39, wherein the patient is receiving the deflazacort at a dose of about 04. Mg/kg/day to about 1.4 mg/kg/day.
41. The method of claim 33, wherein the method increases the ratio of dystrophin to laminin-α2 in muscle tissue of the patient as compared to the ratio of dystrophin to laminin-α2 in muscle tissue of a similar patient treated with the antisense oligonucleotide and not the glucocorticosteroid.
42. A method for alleviating one or more symptoms of Duchenne muscular dystrophy in a human patient, comprising administering to the patient an antisense oligonucleotide that is 100% complementary to the portion of exon 51 of the human dystrophin pre-mRNA to which the sequence 5′-CUC CAA CAU CAA GGA AGA UGG CAU UUC UAG-3′ (SEQ ID NO:193) is complementary,
wherein the antisense oligonucleotide is 30 nucleotides in length,
wherein the antisense oligonucleotide is a morpholino phosphorodiamidate,
wherein the antisense oligonucleotide is administered intravenously,
wherein the antisense oligonucleotide induces skipping of exon 51 of dystrophin pre-mRNA,
wherein the patient is receiving glucocorticosteroid treatment, wherein the glucocorticosteroid is selected from prednisone and deflazacort, and
wherein the method increases the ratio of dystrophin to laminin-α2 in muscle tissue of the patient as compared to the ratio of dystrophin to laminin-α2 in muscle tissue of a similar patient treated with the antisense oligonucleotide and not the glucocorticosteroid.
US15/881,574 2007-10-26 2018-01-26 Means and methods for counteracting muscle disorders Active USRE48468E1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/881,574 USRE48468E1 (en) 2007-10-26 2018-01-26 Means and methods for counteracting muscle disorders

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US667007P 2007-10-26 2007-10-26
EP07119351 2007-10-26
EP07119351 2007-10-26
PCT/NL2008/050673 WO2009054725A2 (en) 2007-10-26 2008-10-27 Means and methods for counteracting muscle disorders
US12/767,702 US9243245B2 (en) 2007-10-26 2010-04-26 Means and methods for counteracting muscle disorders
US15/881,574 USRE48468E1 (en) 2007-10-26 2018-01-26 Means and methods for counteracting muscle disorders

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US12/767,702 Reissue US9243245B2 (en) 2007-10-26 2010-04-26 Means and methods for counteracting muscle disorders

Publications (1)

Publication Number Publication Date
USRE48468E1 true USRE48468E1 (en) 2021-03-16

Family

ID=74865474

Family Applications (1)

Application Number Title Priority Date Filing Date
US15/881,574 Active USRE48468E1 (en) 2007-10-26 2018-01-26 Means and methods for counteracting muscle disorders

Country Status (1)

Country Link
US (1) USRE48468E1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11168141B2 (en) 2018-08-02 2021-11-09 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11369689B2 (en) 2018-08-02 2022-06-28 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11679161B2 (en) 2021-07-09 2023-06-20 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US11771776B2 (en) 2021-07-09 2023-10-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11787869B2 (en) 2018-08-02 2023-10-17 Dyne Therapeutics, Inc. Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness
US12128109B2 (en) 2021-07-09 2024-10-29 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating dystrophinopathies
US12331293B2 (en) 2018-11-02 2025-06-17 Biomarin Technologies B.V. Bispecific antisense oligonucleotides for dystrophin exon skipping
US12440575B2 (en) 2021-07-09 2025-10-14 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies

Citations (160)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
EP0438512A1 (en) 1988-10-11 1991-07-31 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Process for analysing length polymorphisms in dna domains
WO1993001286A2 (en) 1991-06-28 1993-01-21 Massachusetts Institute Of Technology Localized oligonucleotide therapy
EP0558697A1 (en) 1991-06-28 1993-09-08 Massachusetts Institute Of Technology Localized oligonucleotide therapy
EP0614977A2 (en) 1993-03-05 1994-09-14 The General Hospital Corporation Huntingtin DNA, protein and uses thereof
US5418139A (en) 1993-02-10 1995-05-23 University Of Iowa Research Foundation Method for screening for cardiomyopathy
WO1995016718A1 (en) 1993-12-14 1995-06-22 Buna Sow Leuna Olefinverbund Gmbh Functionalized olefinic homo- and copolymers
WO1995021184A1 (en) 1994-02-01 1995-08-10 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
WO1995030774A1 (en) 1994-05-05 1995-11-16 Beckman Instruments, Inc. Oligonucleotide repeat arrays
US5541308A (en) 1986-11-24 1996-07-30 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
WO1997012899A1 (en) 1995-10-06 1997-04-10 The Trustees Of Columbia University In The City Of New York S-dC28 AS AN ANTIRESTENOSIS AGENT AFTER BALLOON INJURY
US5624803A (en) 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US5627263A (en) 1993-11-24 1997-05-06 La Jolla Cancer Research Foundation Integrin-binding peptides
US5658764A (en) 1992-01-28 1997-08-19 North Shore University Hospital Research Corp. Method and kits for detection of fragile X specific, GC-rich DNA sequences
WO1997030067A1 (en) 1996-02-14 1997-08-21 Isis Pharmaceuticals, Inc. Sugar-modified gapped oligonucleotides
US5741645A (en) 1993-06-29 1998-04-21 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
WO1998018920A1 (en) 1996-10-30 1998-05-07 Srl, Inc. cDNA FRAGMENTS OF GENE CAUSATIVE OF SPINOCEREBELLAR ATAXIA TYPE 2
US5766847A (en) 1988-10-11 1998-06-16 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Process for analyzing length polymorphisms in DNA regions
EP0850300A1 (en) 1995-08-04 1998-07-01 HYBRIDON, Inc. Method of modulating gene expression with reduced immunostimulatory response
WO1998043993A2 (en) 1997-03-31 1998-10-08 Yale University Nucleic acid catalysts
WO1998049345A1 (en) 1997-04-29 1998-11-05 Trustees Of Boston University Methods and compositions for targeted dna differential display
WO1998053804A1 (en) 1997-05-29 1998-12-03 Auburn University Methods and compositions for targeting compounds to muscle
US5853995A (en) 1997-01-07 1998-12-29 Research Development Foundation Large scale genotyping of diseases and a diagnostic test for spinocerebellar ataxia type 6
US5869252A (en) 1992-03-31 1999-02-09 Abbott Laboratories Method of multiplex ligase chain reaction
WO1999016871A2 (en) 1997-09-22 1999-04-08 Max-Planck-Gesellschaft Zur Forderung Der Wissensc Nucleic acid catalysts with endonuclease activity
US5916808A (en) 1993-05-11 1999-06-29 The University Of North Carolina At Chapel Hill Antisense oligonucleotides which combat aberrant splicing and methods of using the same
US5962332A (en) 1994-03-17 1999-10-05 University Of Massachusetts Detection of trinucleotide repeats by in situ hybridization
WO1999055857A2 (en) 1998-04-29 1999-11-04 Ribozyme Pharmaceuticals, Inc. Nucleoside triphosphates and their incorporation into ribozymes
WO1999063975A2 (en) 1998-06-10 1999-12-16 Biognostik Gesellschaft für Biomolekulare Diagnostik mbH A method for stimulating the immune system
WO2000024885A2 (en) 1998-10-26 2000-05-04 Avi Biopharma, Inc. p53 MORPHOLINO-BASED ANTISENSE
US6124100A (en) 1998-02-26 2000-09-26 Samsung Fine Chemicals Co. Ltd. Diagnostic method and kit for neuropsychiatric diseases using trinucleotide repeats sequence
US6130207A (en) 1997-11-05 2000-10-10 South Alabama Medical Science Foundation Cell-specific molecule and method for importing DNA into a nucleus
US6133031A (en) 1999-08-19 2000-10-17 Isis Pharmaceuticals Inc. Antisense inhibition of focal adhesion kinase expression
EP1054058A1 (en) 1999-05-21 2000-11-22 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of Duchenne muscular dystrophy
WO2000076554A1 (en) 1999-06-15 2000-12-21 Isis Pharmaceuticals, Inc. Ligand-conjugated oligomeric compounds
US6165786A (en) 1999-11-03 2000-12-26 Isis Pharmaceuticals, Inc. Antisense modulation of nucleolin expression
US6172208B1 (en) 1992-07-06 2001-01-09 Genzyme Corporation Oligonucleotides modified with conjugate groups
US6172216B1 (en) 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
WO2001016312A2 (en) 1999-08-31 2001-03-08 Ribozyme Pharmaceuticals, Inc. Nucleic acid based modulators of gene expression
US6210892B1 (en) 1998-10-07 2001-04-03 Isis Pharmaceuticals, Inc. Alteration of cellular behavior by antisense modulation of mRNA processing
US6251589B1 (en) 1996-07-18 2001-06-26 Srl, Inc. Method for diagnosing spinocerebellar ataxia type 2 and primers therefor
WO2001059102A2 (en) 2000-02-08 2001-08-16 Ribozyme Pharmaceuticals, Inc. Nucleozymes with endonuclease activity
US6280938B1 (en) 1997-08-19 2001-08-28 Regents Of The University Of Minnesota SCA7 gene and method of use
EP1133993A1 (en) 2000-03-10 2001-09-19 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Substances for the treatment of spinal muscular atrophy
US6300060B1 (en) 1995-11-09 2001-10-09 Dana-Farber Cancer Institute, Inc. Method for predicting the risk of prostate cancer morbidity and mortality
WO2001079283A1 (en) 2000-04-13 2001-10-25 University Of British Columbia Modulating cell survival by modulating huntingtin function
CA2319149A1 (en) 2000-04-26 2001-10-26 Jcr Pharmaceuticals Co., Ltd. Medicament for treatment of duchenne muscular dystrophy
WO2001083503A2 (en) 2000-05-01 2001-11-08 Hybridon, Inc. MODULATION OF OLIGONUCLEOTIDE CpG-MEDIATED IMMUNE STIMULATION BY POSITIONAL MODIFICATION OF NUCLEOSIDES
WO2001083695A2 (en) 2000-04-28 2001-11-08 Xiao Xiao Dna sequences encoding dystrophin minigenes and methods of use thereof
US6322978B1 (en) 1998-04-20 2001-11-27 Joslin Diabetes Center, Inc. Repeat polymorphism in the frataxin gene and uses therefore
WO2002002406A1 (en) 2000-07-03 2002-01-10 Shaposhnikov Valery Gennadievi Method and system of devices for producing shaped and packed candy floss products
US6355690B1 (en) 1998-01-26 2002-03-12 Niigata University Remedy for CAG repeat expansion diseases
US6355481B1 (en) 1999-06-18 2002-03-12 Emory University Hybridoma cell line and monoclonal antibody for huntingtin protein
EP1191098A2 (en) 2000-08-25 2002-03-27 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of duchenne muscular dystrophy
EP1191097A1 (en) 2000-09-21 2002-03-27 Leids Universitair Medisch Centrum Induction of exon skipping in eukaryotic cells
WO2002026812A1 (en) 2000-06-07 2002-04-04 Shanghai Biowindow Gene Development Inc. A novel peptide---human dna cgg repeated associative protein 16.17 and the polynucleotide coding this novel peptide
US6369038B1 (en) 1991-04-25 2002-04-09 Genset Closed antisense and sense oligonucleotides and their applications
WO2002029056A2 (en) 2000-10-06 2002-04-11 Regents Of The University Of Michigan Mini-dystrophin nucleic acid and peptide sequences
WO2002029006A2 (en) 2000-10-02 2002-04-11 Keck Graduate Institute Methods for parallel measurement of genetic variations
US20020049173A1 (en) 1999-03-26 2002-04-25 Bennett C. Frank Alteration of cellular behavior by antisense modulation of mRNA processing
US6379698B1 (en) 1999-04-06 2002-04-30 Isis Pharmaceuticals, Inc. Fusogenic lipids and vesicles
US6399575B1 (en) 1998-11-10 2002-06-04 Auburn University Methods and compositions for targeting compounds to the central nervous system
US20020109476A1 (en) 2001-02-13 2002-08-15 Lg Electronics Inc. Method for reducing torque ripple of switched reluctance motor
US20020115824A1 (en) 2000-11-30 2002-08-22 Engler Jeffrey A. Receptor-mediated uptake of peptides that bind the human transferrin receptor
US20020165150A1 (en) 1998-09-25 2002-11-07 Children's Medical Center Corporation Tissue remodeling
JP2002325582A (en) 2000-08-25 2002-11-12 Masafumi Matsuo Therapeutic agent for duchenne muscular dystrophy
WO2003002739A1 (en) 2001-05-24 2003-01-09 Yissum Research Development Company Of The Hebrew University Of Jerusalem Antisense oligonucleotide against human acetylcholinesterase (ache) and uses thereof
US6514755B1 (en) 1998-08-18 2003-02-04 Regents Of The University Of Minnesota SCA7 gene and methods of use
WO2003013437A2 (en) 2001-08-07 2003-02-20 University Of Delaware Compositions and methods for the prevention and treatment of huntington's disease
WO2003014145A2 (en) 2001-08-10 2003-02-20 Novartis Ag Peptides that bind to atherosclerotic lesions
US20030045488A1 (en) 1999-04-08 2003-03-06 Brown Bob D. Antisense oligonucleotides comprising universal and/or degenerate bases
US20030073215A1 (en) 1997-03-31 2003-04-17 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
WO2003037172A2 (en) 2001-11-01 2003-05-08 Gpc Biotech Inc. Endothelial-cell binding peptides for diagnosis and therapy
KR20030035047A (en) 2001-10-29 2003-05-09 (주)바이오코돈 Use of BMP-4 gene and its gene product for treatment and diagnosis of Lichen Planus
US20030124523A1 (en) 2000-06-22 2003-07-03 Asselbergs Fredericus Alphonsus Maria Organic compounds
US20030130224A1 (en) 1995-10-11 2003-07-10 Monahan Sean D. Expression of zeta negative and zeta positive nucleic acids using a dystrophin gene
US20030134790A1 (en) 2002-01-11 2003-07-17 University Of Medicine And Dentistry Of New Jersey Bone Morphogenetic Protein-2 And Bone Morphogenetic Protein-4 In The Treatment And Diagnosis Of Cancer
WO2003062258A1 (en) 2002-01-22 2003-07-31 The Cleveland Clinic Foundation Rnase l activator-antisense complexes
US6623927B1 (en) 2000-11-08 2003-09-23 Council Of Scientific And Industrial Research Method of detection of allelic variants of SCA2 gene
WO2003095647A2 (en) 2002-05-08 2003-11-20 Universitá Degli Studi Di Roma CHIMERIC snRNA MOLECULES CARRYING ANTISENSE SEQUENCES AGAINST THE SPLICE JUNCTIONS OF THE DYSTROPHIN GENE AND THEIR THERAPEUTIC APPLICATIONS
US20030236214A1 (en) 1999-06-09 2003-12-25 Wolff Jon A. Charge reversal of polyion complexes and treatment of peripheral occlusive disease
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
EP1380644A1 (en) 2002-07-08 2004-01-14 Kylix B.V. The use of specified TCF target genes to identify drugs for the treatment of cancer, in particular colorectal cancer, in which TCF/beta-catenin/WNT signalling plays a central role
WO2004011060A2 (en) 2002-07-26 2004-02-05 Mirus Corporation Delivery of molecules and complexes to mammalian cells in vivo
WO2004015106A1 (en) 2002-08-12 2004-02-19 UNIVERSITé DE SHERBROOKE Methods to reprogram splice site selection in pre-messenger rnas
WO2004016787A1 (en) 2002-08-16 2004-02-26 University Of Leicester Modified tailed oligonucleotides
WO2004037854A1 (en) 2002-10-23 2004-05-06 Centre For Research And Technology Hellas/Institute Of Agrobiotechnology In.A Prion protein-binding peptide sequences
US20040101852A1 (en) 2002-11-21 2004-05-27 Isis Pharmaceuticals Inc. Modulation of CGG triplet repeat binding protein 1 expression
WO2004048570A1 (en) 2002-11-25 2004-06-10 Nonprofit Organization Translational Research Organization Of Duchenne Muscular Dystrophy ENA NUCLEIC ACID DRUGS MODIFYING SPLICING IN mRNA PRECURSOR
WO2004047741A2 (en) 2002-11-22 2004-06-10 Isis Pharmaceuticals, Inc. Modulation of iap-like expression
US20040132684A1 (en) 2000-05-09 2004-07-08 Sampath Umashanker Polymeric nucleoside prodrugs
US6794192B2 (en) 2000-06-29 2004-09-21 Pfizer Inc. Target
WO2004083446A2 (en) 2003-03-21 2004-09-30 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US20040219565A1 (en) 2002-10-21 2004-11-04 Sakari Kauppinen Oligonucleotides useful for detecting and analyzing nucleic acids of interest
US20040226056A1 (en) 1998-12-22 2004-11-11 Myriad Genetics, Incorporated Compositions and methods for treating neurological disorders and diseases
CA2526893A1 (en) 2003-05-14 2004-11-25 Japan Science And Technology Agency Inhibition of the expression of huntingtin gene
WO2004108157A2 (en) 2003-06-02 2004-12-16 Wyeth Use of myostatin (gdf8) inhibitors in conjunction with corticosteroids for treating neuromuscular disorders
EP1487493A2 (en) 2002-03-01 2004-12-22 The Administrators of The Tulane Educational Fund Conjugates of therapeutic or cytotoxic agents and biologically active peptides
EP1495769A1 (en) 2003-07-11 2005-01-12 LBR Medbiotech B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
US20050048495A1 (en) 2003-08-29 2005-03-03 Baker Brenda F. Isoform-specific targeting of splice variants
WO2005019453A2 (en) 2001-05-18 2005-03-03 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
WO2005023836A2 (en) 2003-09-08 2005-03-17 E. I. Du Pont De Nemours And Company Peptide-based diblock and triblock dispersants and diblock polymers
US6875736B2 (en) 1999-10-04 2005-04-05 Ptc Therapeutics, Inc. Methods for identifying RNA binding compounds
WO2005035550A2 (en) 2003-10-14 2005-04-21 Kernel Biopharma Inc. Dual phase-pna conjugates for the delivery of pna through the blood brain barrier
US20050096284A1 (en) 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US6902896B2 (en) 2001-05-11 2005-06-07 Regents Of The University Of Minnesota Intron associated with myotonic dystrophy type 2 and methods of use
EP1567667A1 (en) 2002-12-02 2005-08-31 Amarin Neuroscience Limited Treatment of huntington's disease with epa
WO2005085476A1 (en) 2004-03-01 2005-09-15 Biocept, Inc. Detection of strp, such as fragile x syndrome
WO2005086768A2 (en) 2004-03-11 2005-09-22 Albert Einstein College Of Medicine Of Yeshiva University Enhanced production of functional proteins from defective genes
US20050246794A1 (en) 2002-11-14 2005-11-03 Dharmacon Inc. Functional and hyperfunctional siRNA
WO2005105995A2 (en) 2004-04-14 2005-11-10 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED TREATMENT OF POLYGLUTAMINE (POLYQ) REPEAT EXPANSION DISEASES USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2005115439A2 (en) 2004-05-27 2005-12-08 Acceleron Pharma Inc. Cerberus/coco derivatives and uses thereof
WO2005116204A1 (en) 2004-05-11 2005-12-08 Rnai Co., Ltd. Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same
WO2005115479A2 (en) 2004-05-24 2005-12-08 Avi Biopharma, Inc. Peptide conjugated, inosine-substituted antisense oligomer compound and method
US20050277133A1 (en) 2001-05-18 2005-12-15 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US6982150B2 (en) 2002-02-11 2006-01-03 Sheetz Michael P System and method for identifying proteins involved in force-initiated signal transduction
WO2006000057A1 (en) 2004-06-28 2006-01-05 SMITHKLINE BEECHAM CORPORATION, doing business as GLAXOSMITHKLINE Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20060003322A1 (en) 2002-11-14 2006-01-05 Isaac Bentwich Bioinformatically detectable group of novel regulatory genes and uses thereof
WO2006007910A1 (en) 2004-07-20 2006-01-26 Santhera Pharmaceuticals (Schweiz) Ag Use of non-glucocorticoid steroids for the treatment of muscular dystrophy
US20060024715A1 (en) 2004-07-02 2006-02-02 Affymetrix, Inc. Methods for genotyping polymorphisms in humans
WO2006017522A2 (en) 2004-08-03 2006-02-16 University Of Utah Research Foundation Use of antisense oligonucleotides to effect translation modulation
US7001994B2 (en) 2001-01-18 2006-02-21 Genzyme Corporation Methods for introducing mannose 6-phosphate and other oligosaccharides onto glycoproteins
WO2006031267A2 (en) 2004-06-02 2006-03-23 University Of Iowa Research Foundation Rna interference suppression of neurodegenerative diseases and methods of use thereof
US20060074034A1 (en) 2001-09-17 2006-04-06 Collins Douglas A Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof
US7034009B2 (en) 1995-10-26 2006-04-25 Sirna Therapeutics, Inc. Enzymatic nucleic acid-mediated treatment of ocular diseases or conditions related to levels of vascular endothelial growth factor receptor (VEGF-R)
US20060099612A1 (en) 2004-09-02 2006-05-11 Suntory Limited Method for analyzing genes of industrial yeasts
WO2006054262A2 (en) 2004-11-18 2006-05-26 Universita Degli Studi Di Roma 'tor Vergata' Use of phage display technique for identifying peptides capable of binding progenitor/stem cells, peptides thereby obtained and uses thereof
US20060148740A1 (en) 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
US20060160121A1 (en) 2004-10-05 2006-07-20 Wyeth Probe arrays for detecting multiple strains of different species
WO2006083800A2 (en) 2005-01-31 2006-08-10 University Of Iowa Research Foundation Nucleic acid silencing of huntington's disease gene
WO2006108052A2 (en) 2005-04-06 2006-10-12 Genzyme Corporation Peg and polysialic lysosomal enzyme conjugates via acid labile linkers for therapeutic targeting
WO2006112705A2 (en) 2005-04-22 2006-10-26 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the binding of sr proteins and by interfering with secondary rna structure.
WO2006121277A1 (en) 2005-05-09 2006-11-16 Korea Research Institute Of Standards And Science Fret probes for fluorescent detection of the epsps gene
WO2006121960A2 (en) 2005-05-06 2006-11-16 Medtronic, Inc. Methods and sequences to suppress primate huntington gene expression
WO2007002904A2 (en) 2005-06-28 2007-01-04 Medtronic, Inc. Methods and sequences to preferentially suppress expression of mutated huntingtin
WO2007004979A1 (en) 2005-07-01 2007-01-11 Index Pharmaceuticals Ab Method for modulating responsiveness to steroids
US20070021360A1 (en) 2001-04-24 2007-01-25 Nyce Jonathan W Compositions, formulations and kit with anti-sense oligonucleotide and anti-inflammatory steroid and/or obiquinone for treatment of respiratory and lung disesase
US7189530B2 (en) 1998-09-01 2007-03-13 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US7202210B2 (en) 2001-02-08 2007-04-10 Wyeth Modified and stabilized GDF propeptides and uses thereof
WO2007044362A2 (en) 2005-09-30 2007-04-19 University Of Massachusetts Allele-specific rna interference
US20070141628A1 (en) 2005-12-15 2007-06-21 Cunningham Scott D Polyethylene binding peptides and methods of use
US7250404B2 (en) 1989-03-21 2007-07-31 Vical Incorporated Lipid-mediated polynucleotide administration to deliver a biologically active peptide and to induce a cellular immune response
WO2007089611A2 (en) 2006-01-26 2007-08-09 Isis Pharmaceuticals Inc. Compositions and their uses directed to huntingtin
WO2007117438A2 (en) 2006-03-30 2007-10-18 Ptc Therapeutics, Inc. Methods for the production of functional protein from dna having a nonsense mutation and the treatment of disorders associated therewith
WO2007123402A2 (en) 2006-04-20 2007-11-01 Academisch Ziekenhuis Leiden Therapeutic intervention in a genetic disease in an individual by modifying expression of an aberrantly or abnormally expressed gene
EP1857548A1 (en) 2006-05-19 2007-11-21 Academisch Ziekenhuis Leiden Means and method for inducing exon-skipping
US20070275914A1 (en) 2003-03-07 2007-11-29 Muthiah Manoharan Therapeutic Compositions
US20070292408A1 (en) 2004-12-03 2007-12-20 University Of Massachusetts Spinal Muscular Atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
WO2008011170A2 (en) 2006-07-19 2008-01-24 Regents Of The University Of California Methods for detecting the presence of expanded cgg repeats in the fmr1 gene 5' untranslated region
US7355018B2 (en) 2003-09-30 2008-04-08 Regeneron Pharmaceuticals, Inc. Modified IGF1 polypeptides with increased stability and potency
WO2008043561A2 (en) 2006-10-11 2008-04-17 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Influenza targets
US7405193B2 (en) 2000-05-31 2008-07-29 Serono Genetics Institute S.A. Use of Acrp30 globular head to promote increases in muscle mass and muscle differentiation
US20080249294A1 (en) 2001-05-18 2008-10-09 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of Gene Expression Using Short Interfering Nucleic Acid (siNA)
US7514551B2 (en) 2003-04-03 2009-04-07 Enzo Life Sciences, Inc. Multisignal labeling reagents, and processes and uses therefor
US7655785B1 (en) 2002-11-14 2010-02-02 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
US20100099750A1 (en) 2002-02-20 2010-04-22 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF MUSCARINIC COLINERGIC RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20100286235A1 (en) 2001-07-06 2010-11-11 Topigen Pharmaceutique Inc. Methods for increasing in vivo efficacy of oligonucleotides and inhibiting inflammation in mammals
US8324371B2 (en) 2008-09-11 2012-12-04 Royal Holloway and Bedford New College, University of London Oligomers
US8637483B2 (en) 2009-11-12 2014-01-28 The University Of Western Australia Antisense molecules and methods for treating pathologies

Patent Citations (234)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5541308A (en) 1986-11-24 1996-07-30 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
EP0438512A1 (en) 1988-10-11 1991-07-31 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Process for analysing length polymorphisms in dna domains
US5766847A (en) 1988-10-11 1998-06-16 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Process for analyzing length polymorphisms in DNA regions
US7250404B2 (en) 1989-03-21 2007-07-31 Vical Incorporated Lipid-mediated polynucleotide administration to deliver a biologically active peptide and to induce a cellular immune response
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US6369038B1 (en) 1991-04-25 2002-04-09 Genset Closed antisense and sense oligonucleotides and their applications
WO1993001286A2 (en) 1991-06-28 1993-01-21 Massachusetts Institute Of Technology Localized oligonucleotide therapy
EP0558697A1 (en) 1991-06-28 1993-09-08 Massachusetts Institute Of Technology Localized oligonucleotide therapy
US5593974A (en) 1991-06-28 1997-01-14 Massachusetts Institute Of Technology Localized oligonucleotide therapy
US5658764A (en) 1992-01-28 1997-08-19 North Shore University Hospital Research Corp. Method and kits for detection of fragile X specific, GC-rich DNA sequences
US5869252A (en) 1992-03-31 1999-02-09 Abbott Laboratories Method of multiplex ligase chain reaction
US6172208B1 (en) 1992-07-06 2001-01-09 Genzyme Corporation Oligonucleotides modified with conjugate groups
US5418139A (en) 1993-02-10 1995-05-23 University Of Iowa Research Foundation Method for screening for cardiomyopathy
EP0614977A2 (en) 1993-03-05 1994-09-14 The General Hospital Corporation Huntingtin DNA, protein and uses thereof
US5976879A (en) 1993-05-11 1999-11-02 The University Of North Carolina At Chapel Hill Antisense oligonucleotides which combat aberrant splicing and methods of using the same
US5916808A (en) 1993-05-11 1999-06-29 The University Of North Carolina At Chapel Hill Antisense oligonucleotides which combat aberrant splicing and methods of using the same
US5741645A (en) 1993-06-29 1998-04-21 Regents Of The University Of Minnesota Gene sequence for spinocerebellar ataxia type 1 and method for diagnosis
US5624803A (en) 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US5627263A (en) 1993-11-24 1997-05-06 La Jolla Cancer Research Foundation Integrin-binding peptides
WO1995016718A1 (en) 1993-12-14 1995-06-22 Buna Sow Leuna Olefinverbund Gmbh Functionalized olefinic homo- and copolymers
WO1995021184A1 (en) 1994-02-01 1995-08-10 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5962332A (en) 1994-03-17 1999-10-05 University Of Massachusetts Detection of trinucleotide repeats by in situ hybridization
WO1995030774A1 (en) 1994-05-05 1995-11-16 Beckman Instruments, Inc. Oligonucleotide repeat arrays
US5968909A (en) 1995-08-04 1999-10-19 Hybridon, Inc. Method of modulating gene expression with reduced immunostimulatory response
EP0850300A1 (en) 1995-08-04 1998-07-01 HYBRIDON, Inc. Method of modulating gene expression with reduced immunostimulatory response
WO1997012899A1 (en) 1995-10-06 1997-04-10 The Trustees Of Columbia University In The City Of New York S-dC28 AS AN ANTIRESTENOSIS AGENT AFTER BALLOON INJURY
US20030130224A1 (en) 1995-10-11 2003-07-10 Monahan Sean D. Expression of zeta negative and zeta positive nucleic acids using a dystrophin gene
US7034009B2 (en) 1995-10-26 2006-04-25 Sirna Therapeutics, Inc. Enzymatic nucleic acid-mediated treatment of ocular diseases or conditions related to levels of vascular endothelial growth factor receptor (VEGF-R)
US6300060B1 (en) 1995-11-09 2001-10-09 Dana-Farber Cancer Institute, Inc. Method for predicting the risk of prostate cancer morbidity and mortality
WO1997030067A1 (en) 1996-02-14 1997-08-21 Isis Pharmaceuticals, Inc. Sugar-modified gapped oligonucleotides
US6251589B1 (en) 1996-07-18 2001-06-26 Srl, Inc. Method for diagnosing spinocerebellar ataxia type 2 and primers therefor
WO1998018920A1 (en) 1996-10-30 1998-05-07 Srl, Inc. cDNA FRAGMENTS OF GENE CAUSATIVE OF SPINOCEREBELLAR ATAXIA TYPE 2
EP1015628A1 (en) 1997-01-07 2000-07-05 Research Development Foundation Large scale genotyping of diseases and a diagnostic test for spinocerebellar ataxia type 6
US5853995A (en) 1997-01-07 1998-12-29 Research Development Foundation Large scale genotyping of diseases and a diagnostic test for spinocerebellar ataxia type 6
WO1998043993A2 (en) 1997-03-31 1998-10-08 Yale University Nucleic acid catalysts
US20030073215A1 (en) 1997-03-31 2003-04-17 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20030082766A1 (en) 1997-03-31 2003-05-01 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20030082763A1 (en) 1997-03-31 2003-05-01 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
WO1998049345A1 (en) 1997-04-29 1998-11-05 Trustees Of Boston University Methods and compositions for targeted dna differential display
US6329501B1 (en) 1997-05-29 2001-12-11 Auburn University Methods and compositions for targeting compounds to muscle
WO1998053804A1 (en) 1997-05-29 1998-12-03 Auburn University Methods and compositions for targeting compounds to muscle
US7118893B2 (en) 1997-08-19 2006-10-10 Regents Of The University Of Minnesota SCA7 gene and methods of use
US6280938B1 (en) 1997-08-19 2001-08-28 Regents Of The University Of Minnesota SCA7 gene and method of use
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
WO1999016871A2 (en) 1997-09-22 1999-04-08 Max-Planck-Gesellschaft Zur Forderung Der Wissensc Nucleic acid catalysts with endonuclease activity
US6130207A (en) 1997-11-05 2000-10-10 South Alabama Medical Science Foundation Cell-specific molecule and method for importing DNA into a nucleus
US6355690B1 (en) 1998-01-26 2002-03-12 Niigata University Remedy for CAG repeat expansion diseases
US6124100A (en) 1998-02-26 2000-09-26 Samsung Fine Chemicals Co. Ltd. Diagnostic method and kit for neuropsychiatric diseases using trinucleotide repeats sequence
US6322978B1 (en) 1998-04-20 2001-11-27 Joslin Diabetes Center, Inc. Repeat polymorphism in the frataxin gene and uses therefore
WO1999055857A2 (en) 1998-04-29 1999-11-04 Ribozyme Pharmaceuticals, Inc. Nucleoside triphosphates and their incorporation into ribozymes
WO1999063975A2 (en) 1998-06-10 1999-12-16 Biognostik Gesellschaft für Biomolekulare Diagnostik mbH A method for stimulating the immune system
US6514755B1 (en) 1998-08-18 2003-02-04 Regents Of The University Of Minnesota SCA7 gene and methods of use
US7189530B2 (en) 1998-09-01 2007-03-13 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20020165150A1 (en) 1998-09-25 2002-11-07 Children's Medical Center Corporation Tissue remodeling
US6172216B1 (en) 1998-10-07 2001-01-09 Isis Pharmaceuticals Inc. Antisense modulation of BCL-X expression
US6210892B1 (en) 1998-10-07 2001-04-03 Isis Pharmaceuticals, Inc. Alteration of cellular behavior by antisense modulation of mRNA processing
WO2000024885A2 (en) 1998-10-26 2000-05-04 Avi Biopharma, Inc. p53 MORPHOLINO-BASED ANTISENSE
US6399575B1 (en) 1998-11-10 2002-06-04 Auburn University Methods and compositions for targeting compounds to the central nervous system
US20040226056A1 (en) 1998-12-22 2004-11-11 Myriad Genetics, Incorporated Compositions and methods for treating neurological disorders and diseases
US20020049173A1 (en) 1999-03-26 2002-04-25 Bennett C. Frank Alteration of cellular behavior by antisense modulation of mRNA processing
US6379698B1 (en) 1999-04-06 2002-04-30 Isis Pharmaceuticals, Inc. Fusogenic lipids and vesicles
US20030045488A1 (en) 1999-04-08 2003-03-06 Brown Bob D. Antisense oligonucleotides comprising universal and/or degenerate bases
US20010056077A1 (en) 1999-05-21 2001-12-27 Jcr Pharmaceuticals Co., Ltd Pharmaceutical composition for treatment of duchenne muscular dystrophy
US6653466B2 (en) 1999-05-21 2003-11-25 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of duchenne muscular dystrophy
EP1054058A1 (en) 1999-05-21 2000-11-22 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of Duchenne muscular dystrophy
US20030236214A1 (en) 1999-06-09 2003-12-25 Wolff Jon A. Charge reversal of polyion complexes and treatment of peripheral occlusive disease
WO2000076554A1 (en) 1999-06-15 2000-12-21 Isis Pharmaceuticals, Inc. Ligand-conjugated oligomeric compounds
US6355481B1 (en) 1999-06-18 2002-03-12 Emory University Hybridoma cell line and monoclonal antibody for huntingtin protein
US6133031A (en) 1999-08-19 2000-10-17 Isis Pharmaceuticals Inc. Antisense inhibition of focal adhesion kinase expression
WO2001016312A2 (en) 1999-08-31 2001-03-08 Ribozyme Pharmaceuticals, Inc. Nucleic acid based modulators of gene expression
US6875736B2 (en) 1999-10-04 2005-04-05 Ptc Therapeutics, Inc. Methods for identifying RNA binding compounds
WO2001032832A2 (en) 1999-11-03 2001-05-10 Isis Pharmaceuticals, Inc. Antisense inhibition of nucleolin expression
US6165786A (en) 1999-11-03 2000-12-26 Isis Pharmaceuticals, Inc. Antisense modulation of nucleolin expression
WO2001059102A2 (en) 2000-02-08 2001-08-16 Ribozyme Pharmaceuticals, Inc. Nucleozymes with endonuclease activity
EP1133993A1 (en) 2000-03-10 2001-09-19 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Substances for the treatment of spinal muscular atrophy
WO2001079283A1 (en) 2000-04-13 2001-10-25 University Of British Columbia Modulating cell survival by modulating huntingtin function
CA2319149A1 (en) 2000-04-26 2001-10-26 Jcr Pharmaceuticals Co., Ltd. Medicament for treatment of duchenne muscular dystrophy
JP2002010790A (en) 2000-04-26 2002-01-15 Masafumi Matsuo Therapeutic agent for duchenne muscular dystrophy
EP1160318A2 (en) 2000-04-26 2001-12-05 Jcr Pharmaceuticals Co., Ltd. Medicament for treatment of Duchenne muscular dystrophy
US6653467B1 (en) 2000-04-26 2003-11-25 Jcr Pharmaceutical Co., Ltd. Medicament for treatment of Duchenne muscular dystrophy
EP1544297A2 (en) 2000-04-26 2005-06-22 JCR Pharmaceuticals Co., Ltd. Medicament for treatment of Duchenne muscular dystrophy
WO2001083695A2 (en) 2000-04-28 2001-11-08 Xiao Xiao Dna sequences encoding dystrophin minigenes and methods of use thereof
WO2001083503A2 (en) 2000-05-01 2001-11-08 Hybridon, Inc. MODULATION OF OLIGONUCLEOTIDE CpG-MEDIATED IMMUNE STIMULATION BY POSITIONAL MODIFICATION OF NUCLEOSIDES
US20100081627A1 (en) 2000-05-09 2010-04-01 Reliable Biopharmaceutical, Inc. Polymeric nucleoside prodrugs
US20040132684A1 (en) 2000-05-09 2004-07-08 Sampath Umashanker Polymeric nucleoside prodrugs
US7405193B2 (en) 2000-05-31 2008-07-29 Serono Genetics Institute S.A. Use of Acrp30 globular head to promote increases in muscle mass and muscle differentiation
WO2002026812A1 (en) 2000-06-07 2002-04-04 Shanghai Biowindow Gene Development Inc. A novel peptide---human dna cgg repeated associative protein 16.17 and the polynucleotide coding this novel peptide
US20030124523A1 (en) 2000-06-22 2003-07-03 Asselbergs Fredericus Alphonsus Maria Organic compounds
US6794192B2 (en) 2000-06-29 2004-09-21 Pfizer Inc. Target
WO2002002406A1 (en) 2000-07-03 2002-01-10 Shaposhnikov Valery Gennadievi Method and system of devices for producing shaped and packed candy floss products
US20030175389A1 (en) 2000-07-03 2003-09-18 Shaposhnikov Valery Gennadievich Method and system of devices for producing shaped and packed candy floss products
EP1191098B9 (en) 2000-08-25 2006-06-28 JCR Pharmaceuticals Co., Ltd. Pharmaceutical composition comprising dystrophin exon 45 for treatment of duchenne muscular dystrophy
US6727355B2 (en) 2000-08-25 2004-04-27 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of Duchenne muscular dystrophy
US20020055481A1 (en) 2000-08-25 2002-05-09 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of Duchenne muscular dystrophy
JP2002325582A (en) 2000-08-25 2002-11-12 Masafumi Matsuo Therapeutic agent for duchenne muscular dystrophy
EP1191098A2 (en) 2000-08-25 2002-03-27 Jcr Pharmaceuticals Co., Ltd. Pharmaceutical composition for treatment of duchenne muscular dystrophy
EP1619249A1 (en) 2000-09-21 2006-01-25 Academisch Ziekenhuis Leiden Induction of exon skipping in eukaryotic cells
EP1191097A1 (en) 2000-09-21 2002-03-27 Leids Universitair Medisch Centrum Induction of exon skipping in eukaryotic cells
US20030235845A1 (en) 2000-09-21 2003-12-25 Van Ommen Garrit-Jan Boudewijn Induction of exon skipping in eukaryotic cells
WO2002024906A1 (en) 2000-09-21 2002-03-28 Academisch Ziekenhuis Leiden Induction of exon skipping in eukaryotic cells
WO2002029006A2 (en) 2000-10-02 2002-04-11 Keck Graduate Institute Methods for parallel measurement of genetic variations
WO2002029056A2 (en) 2000-10-06 2002-04-11 Regents Of The University Of Michigan Mini-dystrophin nucleic acid and peptide sequences
US6623927B1 (en) 2000-11-08 2003-09-23 Council Of Scientific And Industrial Research Method of detection of allelic variants of SCA2 gene
US20020115824A1 (en) 2000-11-30 2002-08-22 Engler Jeffrey A. Receptor-mediated uptake of peptides that bind the human transferrin receptor
US7001994B2 (en) 2001-01-18 2006-02-21 Genzyme Corporation Methods for introducing mannose 6-phosphate and other oligosaccharides onto glycoproteins
US7202210B2 (en) 2001-02-08 2007-04-10 Wyeth Modified and stabilized GDF propeptides and uses thereof
US20020109476A1 (en) 2001-02-13 2002-08-15 Lg Electronics Inc. Method for reducing torque ripple of switched reluctance motor
US20070021360A1 (en) 2001-04-24 2007-01-25 Nyce Jonathan W Compositions, formulations and kit with anti-sense oligonucleotide and anti-inflammatory steroid and/or obiquinone for treatment of respiratory and lung disesase
US7442782B2 (en) 2001-05-11 2008-10-28 Regents Of The University Of Minnesota Intron associated with myotonic dystrophy type 2 and methods of use
US6902896B2 (en) 2001-05-11 2005-06-07 Regents Of The University Of Minnesota Intron associated with myotonic dystrophy type 2 and methods of use
WO2005019453A2 (en) 2001-05-18 2005-03-03 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
US20050277133A1 (en) 2001-05-18 2005-12-15 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20080249294A1 (en) 2001-05-18 2008-10-09 Sirna Therapeutics, Inc. RNA Interference Mediated Inhibition of Gene Expression Using Short Interfering Nucleic Acid (siNA)
WO2003002739A1 (en) 2001-05-24 2003-01-09 Yissum Research Development Company Of The Hebrew University Of Jerusalem Antisense oligonucleotide against human acetylcholinesterase (ache) and uses thereof
US20100286235A1 (en) 2001-07-06 2010-11-11 Topigen Pharmaceutique Inc. Methods for increasing in vivo efficacy of oligonucleotides and inhibiting inflammation in mammals
WO2003013437A2 (en) 2001-08-07 2003-02-20 University Of Delaware Compositions and methods for the prevention and treatment of huntington's disease
US20030109476A1 (en) 2001-08-07 2003-06-12 Kmiec Eric B. Compositions and methods for the prevention and treatment of Huntington's disease
WO2003014145A2 (en) 2001-08-10 2003-02-20 Novartis Ag Peptides that bind to atherosclerotic lesions
US20060074034A1 (en) 2001-09-17 2006-04-06 Collins Douglas A Cobalamin mediated delivery of nucleic acids, analogs and derivatives thereof
KR20030035047A (en) 2001-10-29 2003-05-09 (주)바이오코돈 Use of BMP-4 gene and its gene product for treatment and diagnosis of Lichen Planus
WO2003037172A2 (en) 2001-11-01 2003-05-08 Gpc Biotech Inc. Endothelial-cell binding peptides for diagnosis and therapy
US20030134790A1 (en) 2002-01-11 2003-07-17 University Of Medicine And Dentistry Of New Jersey Bone Morphogenetic Protein-2 And Bone Morphogenetic Protein-4 In The Treatment And Diagnosis Of Cancer
WO2003062258A1 (en) 2002-01-22 2003-07-31 The Cleveland Clinic Foundation Rnase l activator-antisense complexes
US6982150B2 (en) 2002-02-11 2006-01-03 Sheetz Michael P System and method for identifying proteins involved in force-initiated signal transduction
US20050096284A1 (en) 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20100099750A1 (en) 2002-02-20 2010-04-22 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF MUSCARINIC COLINERGIC RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP1487493A2 (en) 2002-03-01 2004-12-22 The Administrators of The Tulane Educational Fund Conjugates of therapeutic or cytotoxic agents and biologically active peptides
US7771727B2 (en) 2002-03-01 2010-08-10 The Administrators Of The Tulane Educational Fund Conjugates of therapeutic or cytotoxic agents and biologically active peptides
WO2003095647A2 (en) 2002-05-08 2003-11-20 Universitá Degli Studi Di Roma CHIMERIC snRNA MOLECULES CARRYING ANTISENSE SEQUENCES AGAINST THE SPLICE JUNCTIONS OF THE DYSTROPHIN GENE AND THEIR THERAPEUTIC APPLICATIONS
EP1501931A2 (en) 2002-05-08 2005-02-02 Universita' Degli Studi Di Roma "La Sapienza" Chimeric snrna molecules carrying antisense sequences against the splice junctions of the dystrophin gene and their therapeutic applications
EP1380644A1 (en) 2002-07-08 2004-01-14 Kylix B.V. The use of specified TCF target genes to identify drugs for the treatment of cancer, in particular colorectal cancer, in which TCF/beta-catenin/WNT signalling plays a central role
WO2004011060A2 (en) 2002-07-26 2004-02-05 Mirus Corporation Delivery of molecules and complexes to mammalian cells in vivo
WO2004015106A1 (en) 2002-08-12 2004-02-19 UNIVERSITé DE SHERBROOKE Methods to reprogram splice site selection in pre-messenger rnas
WO2004016787A1 (en) 2002-08-16 2004-02-26 University Of Leicester Modified tailed oligonucleotides
US20040219565A1 (en) 2002-10-21 2004-11-04 Sakari Kauppinen Oligonucleotides useful for detecting and analyzing nucleic acids of interest
WO2004037854A1 (en) 2002-10-23 2004-05-06 Centre For Research And Technology Hellas/Institute Of Agrobiotechnology In.A Prion protein-binding peptide sequences
US20050246794A1 (en) 2002-11-14 2005-11-03 Dharmacon Inc. Functional and hyperfunctional siRNA
US7655785B1 (en) 2002-11-14 2010-02-02 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory oligonucleotides and uses thereof
US20070134655A1 (en) 2002-11-14 2007-06-14 Itzhak Bentwich Bioinformatically detectable group of novel regulatory genes and uses thereof
US20060003322A1 (en) 2002-11-14 2006-01-05 Isaac Bentwich Bioinformatically detectable group of novel regulatory genes and uses thereof
US20040101852A1 (en) 2002-11-21 2004-05-27 Isis Pharmaceuticals Inc. Modulation of CGG triplet repeat binding protein 1 expression
WO2004047741A2 (en) 2002-11-22 2004-06-10 Isis Pharmaceuticals, Inc. Modulation of iap-like expression
US20070082861A1 (en) 2002-11-25 2007-04-12 Masafumi Matsuo Ena nucleic acid drugs modifying splicing in mrna precursor
US7902160B2 (en) 2002-11-25 2011-03-08 Masafumi Matsuo ENA nucleic acid drugs modifying splicing in mRNA precursor
WO2004048570A1 (en) 2002-11-25 2004-06-10 Nonprofit Organization Translational Research Organization Of Duchenne Muscular Dystrophy ENA NUCLEIC ACID DRUGS MODIFYING SPLICING IN mRNA PRECURSOR
EP1568769A1 (en) 2002-11-25 2005-08-31 Matsuo, Masafumi ENA NUCLEIC ACID DRUGS MODIFYING SPLICING IN mRNA PRECURSOR
EP1567667A1 (en) 2002-12-02 2005-08-31 Amarin Neuroscience Limited Treatment of huntington's disease with epa
US20070275914A1 (en) 2003-03-07 2007-11-29 Muthiah Manoharan Therapeutic Compositions
WO2004083432A1 (en) 2003-03-21 2004-09-30 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
WO2004083446A2 (en) 2003-03-21 2004-09-30 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the secondary rna structure
US7534879B2 (en) 2003-03-21 2009-05-19 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US20060147952A1 (en) 2003-03-21 2006-07-06 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US20060099616A1 (en) 2003-03-21 2006-05-11 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mRNA by interfering with the secondary RNA structure
US7514551B2 (en) 2003-04-03 2009-04-07 Enzo Life Sciences, Inc. Multisignal labeling reagents, and processes and uses therefor
CA2526893A1 (en) 2003-05-14 2004-11-25 Japan Science And Technology Agency Inhibition of the expression of huntingtin gene
US7589189B2 (en) 2003-05-14 2009-09-15 Japan Science And Technology Agency Inhibition of the expression of huntingtin gene
US20080015158A1 (en) 2003-05-14 2008-01-17 Kanazawa Ichiro Inhibition of the Expression of Huntingtin Gene
WO2004101787A1 (en) 2003-05-14 2004-11-25 Japan Science And Technology Agency Inhibition of the expression of huntington gene
WO2004108157A2 (en) 2003-06-02 2004-12-16 Wyeth Use of myostatin (gdf8) inhibitors in conjunction with corticosteroids for treating neuromuscular disorders
EP1495769A1 (en) 2003-07-11 2005-01-12 LBR Medbiotech B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
US20050048495A1 (en) 2003-08-29 2005-03-03 Baker Brenda F. Isoform-specific targeting of splice variants
WO2005021727A2 (en) 2003-08-29 2005-03-10 Isis Pharmaceuticals, Inc. Isoform-specific targeting of splice variants
WO2005023836A2 (en) 2003-09-08 2005-03-17 E. I. Du Pont De Nemours And Company Peptide-based diblock and triblock dispersants and diblock polymers
US7355018B2 (en) 2003-09-30 2008-04-08 Regeneron Pharmaceuticals, Inc. Modified IGF1 polypeptides with increased stability and potency
WO2005035550A2 (en) 2003-10-14 2005-04-21 Kernel Biopharma Inc. Dual phase-pna conjugates for the delivery of pna through the blood brain barrier
US20050222009A1 (en) 2003-10-14 2005-10-06 Itschak Lamensdorf Dual phase - PNA conjugates for the delivery of PNA through the blood brain barrier
WO2005085476A1 (en) 2004-03-01 2005-09-15 Biocept, Inc. Detection of strp, such as fragile x syndrome
WO2005086768A2 (en) 2004-03-11 2005-09-22 Albert Einstein College Of Medicine Of Yeshiva University Enhanced production of functional proteins from defective genes
US20080207538A1 (en) 2004-03-11 2008-08-28 Lawrence David S Enhanced Production of Functional Proteins From Defective Genes
WO2005105995A2 (en) 2004-04-14 2005-11-10 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED TREATMENT OF POLYGLUTAMINE (POLYQ) REPEAT EXPANSION DISEASES USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20080113351A1 (en) 2004-05-11 2008-05-15 Alphagen Co., Ltd. Polynucleotides for causing RNA interference and method for inhibiting gene expression using the same
WO2005116204A1 (en) 2004-05-11 2005-12-08 Rnai Co., Ltd. Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same
WO2005115479A2 (en) 2004-05-24 2005-12-08 Avi Biopharma, Inc. Peptide conjugated, inosine-substituted antisense oligomer compound and method
US20050288246A1 (en) 2004-05-24 2005-12-29 Iversen Patrick L Peptide conjugated, inosine-substituted antisense oligomer compound and method
WO2005115439A2 (en) 2004-05-27 2005-12-08 Acceleron Pharma Inc. Cerberus/coco derivatives and uses thereof
WO2006031267A2 (en) 2004-06-02 2006-03-23 University Of Iowa Research Foundation Rna interference suppression of neurodegenerative diseases and methods of use thereof
US8476423B2 (en) 2004-06-28 2013-07-02 The University of Western Austrailia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20120029059A1 (en) 2004-06-28 2012-02-02 The University Of Western Australia Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof
US8486907B2 (en) 2004-06-28 2013-07-16 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20120029057A1 (en) 2004-06-28 2012-02-02 The University Of Western Australia Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof
US8455634B2 (en) 2004-06-28 2013-06-04 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8455635B2 (en) 2004-06-28 2013-06-04 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8524880B2 (en) 2004-06-28 2013-09-03 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8455636B2 (en) 2004-06-28 2013-06-04 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20120029060A1 (en) 2004-06-28 2012-02-02 The University Of Western Australia Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof
US8450474B2 (en) 2004-06-28 2013-05-28 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20130253033A1 (en) 2004-06-28 2013-09-26 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20130116310A1 (en) 2004-06-28 2013-05-09 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US8232384B2 (en) 2004-06-28 2012-07-31 University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US7807816B2 (en) 2004-06-28 2010-10-05 University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20120041050A1 (en) 2004-06-28 2012-02-16 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20130253180A1 (en) 2004-06-28 2013-09-26 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20130274313A1 (en) 2004-06-28 2013-10-17 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20120029058A1 (en) 2004-06-28 2012-02-02 The University Of Western Australia Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof
WO2006000057A1 (en) 2004-06-28 2006-01-05 SMITHKLINE BEECHAM CORPORATION, doing business as GLAXOSMITHKLINE Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20120022145A1 (en) 2004-06-28 2012-01-26 The University Of Western Australia Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof
US20120022144A1 (en) 2004-06-28 2012-01-26 The University Of Western Australia Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof
US20110263686A1 (en) 2004-06-28 2011-10-27 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US7960541B2 (en) 2004-06-28 2011-06-14 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20110046203A1 (en) 2004-06-28 2011-02-24 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20110015258A1 (en) 2004-06-28 2011-01-20 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20110015253A1 (en) 2004-06-28 2011-01-20 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20130217755A1 (en) 2004-06-28 2013-08-22 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
US20060024715A1 (en) 2004-07-02 2006-02-02 Affymetrix, Inc. Methods for genotyping polymorphisms in humans
WO2006007910A1 (en) 2004-07-20 2006-01-26 Santhera Pharmaceuticals (Schweiz) Ag Use of non-glucocorticoid steroids for the treatment of muscular dystrophy
WO2006017522A2 (en) 2004-08-03 2006-02-16 University Of Utah Research Foundation Use of antisense oligonucleotides to effect translation modulation
US20060099612A1 (en) 2004-09-02 2006-05-11 Suntory Limited Method for analyzing genes of industrial yeasts
US20060160121A1 (en) 2004-10-05 2006-07-20 Wyeth Probe arrays for detecting multiple strains of different species
WO2007018563A2 (en) 2004-10-05 2007-02-15 Wyeth Probe arrays for detecting multiple strains of different species
WO2006054262A2 (en) 2004-11-18 2006-05-26 Universita Degli Studi Di Roma 'tor Vergata' Use of phage display technique for identifying peptides capable of binding progenitor/stem cells, peptides thereby obtained and uses thereof
US20070292408A1 (en) 2004-12-03 2007-12-20 University Of Massachusetts Spinal Muscular Atrophy (SMA) treatment via targeting of SMN2 splice site inhibitory sequences
US20060148740A1 (en) 2005-01-05 2006-07-06 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
WO2006083800A2 (en) 2005-01-31 2006-08-10 University Of Iowa Research Foundation Nucleic acid silencing of huntington's disease gene
WO2006108052A2 (en) 2005-04-06 2006-10-12 Genzyme Corporation Peg and polysialic lysosomal enzyme conjugates via acid labile linkers for therapeutic targeting
WO2006112705A2 (en) 2005-04-22 2006-10-26 Academisch Ziekenhuis Leiden Modulation of exon recognition in pre-mrna by interfering with the binding of sr proteins and by interfering with secondary rna structure.
WO2006121960A2 (en) 2005-05-06 2006-11-16 Medtronic, Inc. Methods and sequences to suppress primate huntington gene expression
WO2006121277A1 (en) 2005-05-09 2006-11-16 Korea Research Institute Of Standards And Science Fret probes for fluorescent detection of the epsps gene
WO2007002904A2 (en) 2005-06-28 2007-01-04 Medtronic, Inc. Methods and sequences to preferentially suppress expression of mutated huntingtin
WO2007004979A1 (en) 2005-07-01 2007-01-11 Index Pharmaceuticals Ab Method for modulating responsiveness to steroids
WO2007044362A2 (en) 2005-09-30 2007-04-19 University Of Massachusetts Allele-specific rna interference
US20070141628A1 (en) 2005-12-15 2007-06-21 Cunningham Scott D Polyethylene binding peptides and methods of use
US20070299027A1 (en) 2006-01-26 2007-12-27 Gene Hung Compositions and their uses directed to huntingtin
WO2007089584A2 (en) 2006-01-26 2007-08-09 Isis Pharmaceuticals, Inc. Compositions and their uses directed to huntingtin
WO2007089611A2 (en) 2006-01-26 2007-08-09 Isis Pharmaceuticals Inc. Compositions and their uses directed to huntingtin
US20080039418A1 (en) 2006-01-26 2008-02-14 Freier Susan M Compositions and their uses directed to huntingtin
WO2007117438A2 (en) 2006-03-30 2007-10-18 Ptc Therapeutics, Inc. Methods for the production of functional protein from dna having a nonsense mutation and the treatment of disorders associated therewith
WO2007123402A2 (en) 2006-04-20 2007-11-01 Academisch Ziekenhuis Leiden Therapeutic intervention in a genetic disease in an individual by modifying expression of an aberrantly or abnormally expressed gene
WO2007135105A1 (en) 2006-05-19 2007-11-29 Academisch Ziekenhuis Leiden Means and method for inducing exon-skipping
EP1857548A1 (en) 2006-05-19 2007-11-21 Academisch Ziekenhuis Leiden Means and method for inducing exon-skipping
WO2008011170A2 (en) 2006-07-19 2008-01-24 Regents Of The University Of California Methods for detecting the presence of expanded cgg repeats in the fmr1 gene 5' untranslated region
WO2008043561A2 (en) 2006-10-11 2008-04-17 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Influenza targets
US8324371B2 (en) 2008-09-11 2012-12-04 Royal Holloway and Bedford New College, University of London Oligomers
US8637483B2 (en) 2009-11-12 2014-01-28 The University Of Western Australia Antisense molecules and methods for treating pathologies

Non-Patent Citations (392)

* Cited by examiner, † Cited by third party
Title
Aarstsma-Rus et al., "Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations," Hum. Mutat. 30(3):293-299 (2009).
Aartsma-Rus et al. Am. J. Hu. Genet. 74: 83-92, 2004. *
Aartsma-Rus et al. Molecular Therapy. vol. 17, No. 3. pp. 548-551. *
Aartsma-Rus et al., "Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy," BMC Med. Genet. 8:43 (2007).
Aartsma-Rus et al., "Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense," Am. J. Hum. Genet. 74(1):83-92 (2004) (Epub Dec. 16, 2003).
Aartsma-Rus et al., "Antisense-mediated exon skipping: a versatile tool with therapeutic and research applications ," RNA 13(10):1609-1624 (2007).
Aartsma-Rus et al., "Comparative analysis of antisense oligonucleotide analogs for targeted DMD exon 46 skipping in muscle cells," Gene Ther. 11(18):1391-1398 (2004).
Aartsma-Rus et al., "Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons," Mol. Ther. 14(3):401-407 (2006) (Epub Jun. 6, 2006).
Aartsma-Rus et al., "Functional analysis of 114 exon-internal AONs for targeted DMD exon skipping: indication for steric hindrance of SR protein binding sites," Oligonucleotides 15(4):284-297 (2005).
Aartsma-Rus et al., "Guidelines for antisense oligonucleotide design and insight into splice-modulating mechanisms," Mol. Ther. 17(3):548-553 (2009) (Epub Sep. 23, 2008).
Aartsma-Rus et al., "Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy," Neuromuscul. Disord. 12 Suppl:S71-S77 (2002).
Aartsma-Rus et al., "Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients," Hum. Mol. Genet. 12(8):907-914 (2003).
Aartsma-Rus et at, "Therapeutic modulation of DMD splicing by blocking exonic splicing enhancer sites with antisense oligonucleotides," Ann. NY Acad. Sci. 1082:74-76 (2006).
Aartsma-Rus, et al., Exploring the Frontiers of Therapeutic Exon Skipping for Duchenne Muscular Dystrophy by Double Targeting Within One or Multiple Exons, Molecular Therapy, 2006, pp. 1-7.
Abbs et al., "A convenient multiplex PCR system for the detection of dystrophin gene deletions: a comparative analysis with cDNA hybridisation shows mistypings by both methods," J. Med. Genet. 28(5):304-311 (1991).
Abdel-Salam et al (Pharmacological Research 47 (2003) 331-340). *
Abdel-Salam et al., "The anti-inflammatory effects of the phosphodiesterase inhibitor pentoxifylline in the rat," Pharmacol. Res. 47(4):331-340 (2003).
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden List of Exhibits (as of Apr. 3, 2015) 18 pages, filed Apr. 3, 2015 [Patent Inference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden List of Exhibits (as of Apr. 3, 2015) 18 pages, filed Apr. 3, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden List of Exhibits (as of Feb. 17, 2015), 18 pages, filed Feb. 17, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden Opposition 1 (35 U.S. C. § 112(a)), 93 pages, filed Feb. 17, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden Opposition 2 (Indefiniteness), 31 pages, filed Feb. 17, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden Opposition 3 (Standing Order ¶ 203.1 and 37 C.F.R. § 41.202(a) and (e)), 20 pages, filed Feb. 17, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden Reply 1 (For Judgment that UWA's Claims are Unpatentable Under U.S.C. §§ 102 and 103) 17 pages, filed Apr. 3, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden Reply 2 (to Deny the Benefit of AU 2004903474) 11 pages, filed Apr. 3, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden Reply 3 (for Judgment of Unpatentability based on Myriad) 12 pages, filed Apr. 3, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden Reply 4 (In Support of Responsive Motion 4 to Add Two New Claims) 17 pages, filed Apr. 3, 2015, [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden Request for Oral Argument, 3 pages, filed Apr. 10, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden Responsive Motion 4 (to Add Two New Claims), 65 pages, filed Dec. 23, 2014 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden's List of Proposed Motions, 6 pages, filed Sep. 10, 2014 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden's Substantive Motion 1 (for Judgment that UWA Claims are Unpatentable Under 35 U.S.C. §§ 102 and 103) 69 pages, filed Nov. 18, 2014 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), Academisch Ziekenhuis Leiden's Substantive Motion 3 (for Judgment of Unpatentability based on Myriad), 19 pages, filed Nov. 18, 2014 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), AZL Substantive Motion 2 (To Deny UWA the Benefit of AU 2004903474), 23 pages, filed Nov. 18, 2014 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Opposition 1 (Regarding Patentability Under 35 U.S. C. § 102/103), 38 pages, filed Feb. 17, 2015 [Patent Interference No. 106,007 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495)[Patent Interference No. 106,007 (RES)] and University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210) [Patent Interference No. 106,008 (RES)], 3rd Declaration of Erik J. Sontheimer, Ph.D. 123 pages, filed Feb. 17, 2015 [Patent Interference Nos. 106,007 and 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495)[Patent Interference No. 106,007 (RES)] and University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210)[Patent Interference No. 106,008 (RES)], Declaration of Judith Van Deutekom, 45 pages, filed Feb. 17, 2015 [Patent Interference Nos. 106,007 and 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,486,907) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 14/198,992) Academisch Ziekenhuis Leiden List of Exhibits (as of Feb. 17, 2015) 3 pages, filed Feb. 17, 2015 [Patent Interference No. 106,013 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. No. 8,486,907) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 14/198,992), Academisch Ziekenhuis Leiden Opposition 1 (Standing Order ¶ 203.1 and 37 C.F.R. § 41.202 (a) and (e)) 20 pages, filed Feb. 17, 2015 [Patent Interference No. 106,013 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden List of Exhibits (as of Feb. 17, 2015) 18 pages, filed Feb. 17, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden Opposition 1 (35 U.S.C. § 112(a)), 83 pages, filed Feb. 17, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden Opposition 2 (Indefiniteness), 32 pages, filed Feb. 17, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden Opposition 3 (U.S.C. § 135(b )), 44 pages, filed Feb. 17, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden Request for Oral Argument, 3 pages, filed Apr. 10, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden Responsive Motion 4 (to Add Two New Claims), 57 pages, filed Dec. 23, 2014 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Second Declaration of Erik Sontheimer, Ph.D., 44 pages, filed Dec. 23, 2014 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816J v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden List of Exhibits (as of Apr. 3, 2015) 18 pages, filed Apr. 3, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816J v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden Reply 1 (For Judgment that UWA's Claims are Unpatentable Under 35 U.S.C. §§ 102 and 103) 17 pages, filed Apr. 3, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816J v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden Reply 2 (To Deny the Benefit of AU 2004903474) 12 pages, filed Apr. 3, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816J v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden Reply 3 (For Judgment of Unpatentability based on Myriad) 13 pages, filed Apr. 3, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816J v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden Reply 4 (In Support of Responsive Motion 4 to Add Two New Claims) 17 pages, filed Apr. 3, 2015 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541, 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden's List of Proposed Motions, 8 pages, filed Sep. 10, 2014 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541, 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden's Substantive Motion 1 (for Judgment that UWA's Claims are Unpatentable Under 35 U.S.C. §§ 102 and 103) 69 pages, filed Nov. 18, 2014 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541, 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden's Substantive Motion 2 (to Deny UWA the Benefit of AU2004903474, 24 pages, filed Nov. 18, 2014 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541, 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Academisch Ziekenhuis Leiden's Substantive Motion 3 (for Judgment of Unpatentability Based on Myriad), 20 pages, filed Nov. 18, 2014 [Patent Interference No. 106,008 (RES)].
Academisch Ziekenhuis Leiden, University of Western Australia (U.S. Pat. Nos. 7,960,541, 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), Declaration of Erik Sontheimer, Ph.D., 112 pages, filed Nov. 17, 2014 [Patent Interference No. 106,008 (RES)].
Agrawal and Kandimalla, "Antisense therapeutics: is it as simple as complementary base recognition?" Mol. Med. Today 6(2):72-81 (2000).
Alter et al (Nature Med. 12(2): 175-177, 2006). *
Alter et al., "Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology," Nat. Med. 12(2):175-177 (2006) (Epub Jan. 29, 2006).
Alter et al., "Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology," Nat. Med. 12(2):175-177 (2006).
Anderson et al., "Correlated NOS-Imu and myf5 expression by satellite cells in mdx mouse muscle regeneration during NOS manipulation and deflazacort treatment," Neuromuscul. Disord. 13(5):388-396 (2003).
Anthony et al., "Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials 2011," Brain 134(12):3547-3559 (2011).
Arap et al., "Steps toward mapping the human vasculature by phage display," Nat. Med. 8(2):121-127 (2002).
Arechavala-Gomeza et al., "Comparative analysis of antisense oligonucleotide sequences for targeted skipping of exon 51 during dystrophin pre-mRNA splicing in human muscle," Hum. Gene Ther. 18(9):798-810 (2007).
Arruda, "The role of immunosuppression in gene- and cell-based treatments for duchenne muscular dystrophy," Mol. Ther. 15(6):1040-1041 (2007).
Arzumanov et al., "Inhibition of HIV-1 Tat-dependent trans activation by steric block chimeric 2′-O-methyl/LNA oligoribonucleotides," Biochemistry 40(48):14645-14654 (2001).
Austin et al., "Cloning and characterization of alternatively spliced isoforms of Dp71," Hum. Mol. Genet. 4(9):1475-1483 (1995).
Austin et al., "Expression and synthesis of alternatively spliced variants of Dp71 in adult human brain," Neuromuscul. Disord. 10(3):187-193 (2000).
Australian Office Action for AU 2009240879, dated Jun. 22, 2011.
Barabino et al., "Antisense probes targeted to an internal domain in U2 snRNP specifically inhibit the second step of pre-mRNA splicing," Nucleic Acids Res. 20(17):4457-4464 (1992).
Barany, "The ligase chain reaction in a PCR world," PCR Methods Appl. 1(1):5-16 (1991).
Beenakker et al., "Intermittent prednisone therapy in Duchenne muscular dystrophy: a randomized controlled trial," Arch. Neurol. 62(1):128-132 (2005).
Beggs et al., "Detection of 98% of DMD/BMD gene deletions by polymerase chain reaction," Hum. Genet. 86(1):45-48 (1990).
Bernasconi et al., "Cortisol increases transfection efficiency of cells," FEBS Lett. 419(1):103-106 (1997).
Biggar et al., "Deflazacort in Duchenne muscular dystrophy: a comparison of two different protocols," Neuromuscul. Disord. 14(8-9):476-482 (2004).
Bijvoet et al., "Recombinant human acid alpha-glucosidase: high level production in mouse milk, biochemical characteristics, correction of enzyme deficiency in GSDII KO mice," Hum. Mol. Genet. 7(11):1815-1824 (1998).
BioMarin Press Release, "BioMarin Announces Withdrawal of Market Authorization Application for Kyndrisa™ (drisapersen) in Europe," May 31, 2016.
Bionity.Com NEWS-Center, Leiden University Medical Center and Prosensa B.V. Announce First Successful Clinical Study with RNA-based Therapeutic PR0051, dated Jan. 3, 2008, <http://www.bionity. com/news/e/76185>.
Bionity.Com NEWS-Center, Leiden University Medical Center and Prosensa B.V. Announce First Successful Clinical Study with RNA-based Therapeutic PRO051, dated Jan. 3, 2008, <http://www.bionity.com/news/e/76185>.
Biopharmaceutiques, Merging Pharma & Biotech, Edition 48, Jan. 10, 2008. <http://www.biopharmaceutiques.com/en/num>, visited Jan. 11, 2008.
Bolli et al. "Bicyclo-DNA: A Hoogsteen-Selective Pairing System", Chemistry & Biology, 3(3): 197-206, Mar. 1996.
Braasch et al. Novel antisense and peptide nucleic acid strategies for controlling gene expression, Biochemistry 2002; 41(14):4503-10.
Braun et al., "In vitro and in vivo effects of glucocorticoids on gene transfer to skeletal muscle," FEBS Lett. 454(3):277-282 (1999).
Bremmer-Bout et al., "Targeted exon skipping in transgenic hDMD mice: A model for direct preclinical screening of human-specific antisense oligonucleotides," Mol. Ther. 10(2):232-240 (2004).
Brett et al., "EST comparison indicates 38% of human mRNAs contain possible alternative splice forms," FEBS Lett. 474(1):83-86 (2000).
Brown et al., "Gene delivery with synthetic (non viral) carriers," Int. J. Pharm. 229(1-2):1-21 (2001). (Abstract).
Brown et al., "Structure and mutation of the dystrophin gene" in Dystrophin: Gene, protein and cell biology, (Brown and Lucy, eds). Cambridge University Press, Cambridge, 1997, pp. 1-16.
Buck et al., "Design strategies and performance of custom DNA sequencing primers," Biotechniques 27(3):528-536 (1999).
Burnett et al., "DNA sequence-specific polyamides alleviate transcription inhibition associated with long GAA.TTC repeats in Friedreich's ataxia," Proc. Natl. Acad. Sci. U.S.A. 103(31):11497-11502 (2006) (Epub Jul. 20, 2006).
Bushby et al., "145th ENMC International Workshop: planning for an International Trial of Steroid Dosage Regimes in DMD (for DMD), Oct. 22-24, 2006, Naarden, The Netherlands," Neuromuscul. Disord. 17(5):423-428 (2007) (Epub Apr. 11, 2007).
Bushby et al., "Report on the 124th ENMC International Workshop. Treatment of Duchenne muscular dystrophy; defining the gold standards of management in the use of corticosteroids. Apr. 2-4, 2004, Naarden, The Netherlands," Neuromuscul. Disord. 14(8-9):526-534 (2004).
Cambridge University Press, Cambridge, 1997, pp. 1-16.
Canadian Office Action for CA 2,524,255, dated Jul. 6, 2011.
Caplen et al., "Rescue of polyglutamine-mediated cytotoxicity by double-stranded RNA-mediated RNA interference," Hum. Mol. Genet. 11(2):175-184 (2002).
Cartegni et al. "Correction of Disease-Associated Exon Skipping by Synthetic Exon-Specific Activators", Nature Structural Biology, 10(2): 120-125, Feb. 2003.
Cartegni et al. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res 2003; 31 (13):3568-71.
Cartegni et al., "Listening to silence and understanding nonsense: exonic mutations that affect splicing," Nat. Rev. Genet. 3(4):285-298 (2002). (Abstract).
Chamberlain (Basic Appl Myol. 7 (3&4): 257-255, 7997). *
Chamberlain, "Dystrophin Levels Required for Genetic Correction of Duchenne Muscular Dystrophy," Basic Appl Myol. 7(3&4):251-255 (1997).
Chan et al., "Antisense oligonucleotides: from design to therapeutic application," Clin. Exp. Pharmacol. Physiol. 33(5-6):533-540 (2006).
Chaubourt et al., "Muscular nitric oxide synthase (muNOS) and utrophin," J. Physiol. Paris 96(1-2):43-52 (2002).
Cirak et al., "Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study," Lancet 378 (9791)595-605 (2011) (Epub Jul. 23, 2011).
Coulter et al., "Identification of a new class of exonic splicing enhancers by in vivo selection," Mol. Cell. Biol. 17(4):2143-2150 (1997).
Crooke. In Basic Principles of Antisense Therapeutics, Springer-Verlag, Eds, NewYork, 1998, pp. 1-50.
Dahlqvist et al., "Functional Notch signaling is required for BMP4-induced inhibition of myogenic differentiation," Development 130(24):6089-6099 (2003).
De Angelis et al., "Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells," Proc. Natl. Acad. Sci. U.S.A. 99(14):9456-9461 (2002) (Epub Jun. 20, 2002).
De Luca et al., "Beneficial Effects of Pentoxifylline on Dystrophie Progression of MDX Mice," Acta Pharmacologica Sinica, P090015, Supp. 1, vol. 27, p. 138, 2006.
Declaration of Dr. Adrian Kramer (submitted in Third Party's Stmt for JP Appl. No. 2002-529499, dated Oct. 29, 2010.
Denny et al., "Oligo-riboprobes. Tools for in situ hybridisation," Histochemistry 89(5):481-493 (1988).
Denti et al. Chimeric adenoassociated virus/antisense UI small nuclear RNA effectively rescues dystrophin synthesis and muscle function by local treatment of mdx mice. Hum Gene Ther 2006; 17(5): 565-74.
Dickson, et al., "Screening for antisense modulation of dystrophin pre-mRNA splicing," Neuromuscul. Disord. Suppl 1:S67-S70 (2002).
Dirkson et al., "Mapping the SF2/ASF binding sites in the bovine growth hormone exonic splicing enhancer," J. Biol. Chem. 275(37):29170-29177 (2000).
Dorchies et al (Am J Physiol Cell Physiol 290: C616-C625, 2006). *
Dorchies et al., "Green tea extract and its major polyphenol (−)-epigallocatechin gallate improve muscle function in a mouse model for Duchenne muscular dystrophy," Am. J. Physiol. Cell Physiol. 290(2): C616-C625 (2006).
Duboc et al (J. Am. Coll. Cardiol. 45(6): 2005). *
Duboc et al., "Effect of perindopril on the onset and progression of left ventricular dysfunction in Duchenne muscular dystrophy," J. Am. Coll. Cardiol. 45(6):855-857 (2005).
Dubowitz "Foreword", Neuromuscular Disorders, 12: S1-S2, 2002.
Dubowitz "Special Centennial Workshop—101st ENMC International Workshop:Therapeutic Possibilities in Duchenne Muscular Dystrophy, Nov. 30-Dec. 2, 2001, Naarden, The Netherlands", Neuromuscular Disorders, 12: 421-431, 2002.
Dunckley et al., "Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides," Hum. Mol. Genet. 5(1):1083-1090 (1995).
Dunckley et at, "Modulation of Splicing in the DMD Gene by Antisense Oligoribonucleotides," Nucleosides & Nucleotides 16(7-9):1665-1668 (1997).
El-Andaloussi et al., "Induction of splice correction by cell-penetrating peptide nucleic acids," J. Gene Med. 8(10):1262-1273 (2006). (Abstract).
EPO—Munich, Translation of Japanese Patent Application No. 2000-125448 (D64).
EPO—Munich, Translation of Japanese Patent Application No. 2000-256547(D66).
Erba et al., "Structure, chromosome location, and expression of the human gamma-actin gene: differential evolution, location, and expression of the cytoskeletal beta- and gamma-actin genes," Mol. Cell. Biol. 8(4):1775-1789 (1988).
Errington et al., "Target selection for antisense oligonucleotide induced exon skipping in the dystrophin gene," J. Gene Med. 5(6):518-527 (2003).
European Patent Office Action dated Jan. 29, 2007.
European Patent Office Action regarding European Patent Application No. EP 05 076 770.6 dated Jan. 29, 2007, 5 pages.
European Search Report Annex for EP 03077205 dated Nov. 19, 2003.
European Search Report for EP 03077205 dated Oct. 12, 2003.
Exondys 51™ prescribing information highlights (eteplirsen label) (dated Sep. 2016).
FDA News Release, "FDA grants accelerated approval to first drug for Duchenne muscular dystrophy," Sep. 19, 2016.
Feener et al., Alternative splicing of human dystrophin mRNA generates isoforms at the carboxy terminus. Nature, 338 (6215): 509-511 (1989).
Fernandes et al., "Pentoxifylline reduces pro-inflammatory and increases anti-inflammatory activity in patients with coronary artery disease—a randomized placebo-controlled study," Atherosclerosis 196(1):434-442 (2008) (Epub Dec. 28, 2006).
Fernandez et al (Atherosclerosis 196 (2008) 434-442). *
Fluiter et al., "In vivo tumor growth inhibition and biodistribution studies of locked nucleic acid (LNA) antisense oligonucleotides," Nucleic Acids Res. 31(3):953-962 (2003).
Fu et al., "An unstable triplet repeat in a gene related to myotonic muscular dystrophy," Science 255(5049):1256-1258 (1992).
Furling et al., "Viral vector producing antisense RNA restores myotonic dystrophy myoblast functions," Gene Ther. 10(9):795-802 (2003).
Galderisi et al., "Antisense Oligonucleotides as Therapeutic Agents", Journal of Cellular Physiology, 181: 251-257, 1999.
Galderisi et al., "Myotonic dystrophy: antisense oligonucleotide inhibition of DMPK gene expression in vitro," Biochem. Biophys. Res. Commun. 221(3):750-754 (1996).
Garcia-Blanco et al., "Alternative splicing in disease and therapy," Nat. Biotechnol. 22(5):535-546 (2004).
Gen Bank accession No. AZ993191.1, 2M0278E12F mouse 10kb plasmid UUGC2M library Mus muscu genomic clone UUGC2M0278E12F, genomic survey sequence, entry created and last updated on Apr. 27, 2001.
Genbank accession No. EW162121.1, rfat0126_k17.y1 fat Sus scrofa cDNA5-, mRNA sequence, entry created on Aug. 13, 2007, last updated on Mar. 3, 2011.
Genes VII, Jan. 2000, Benjamin Lewin, Chapter 22, Nuclear Splicing, pp. 704-705.
Ghosh et al., "Mannose 6-phosphate receptors: new twists in the tale," Nat. Rev. Mol. Cell Biol. 4(3):202-212 (2003).
Ginjaar et al. "Dystrophin Nonsense Mutation Induces Different Levels of Exon 29Skipping and Leads to Variable Phenotypes Within One BMD Family", European Journal ofHuman Genetics, 8: 793-796, 2000.
Ginjaar et al., "Dystrophin nonsense mutation induces different levels of exon 29 skipping and leads to variable phenotypes within one BMD family," Eur. J. Hum. Genet. 8(10):793-796 (2000).
Goemans et al., "Comparison of ambulatory capacity and disease progression of Duchenne muscular dystrophy subjects enrolled in the drisapersen DMD114673 study with a matched natural history cohort of subjects on daily corticosteroids," Neuromuscul. Disord. 27(3):203-213 (2017) (Epub Nov. 25, 2016).
Goemans et al., "Systemic administration of PRO051 in Duchenne's muscular dystrophy," N. Engl. J. Med. 364(16):1513-1522 (2011) (Epub Mar. 23, 2011).
Gollins et al., "High-efficiency plasmid gene transfer into dystrophic muscle," Gene Ther. 10(6):504-512 (2003).
Gorman et al. Stable alteration of pre-mRNA splicing patterns by modified U7 small nuclear RNAs. Proc Natl Acad Sci USA 1998; 95(9):4929-34.
Goto et al. "Targeted Skipping of A Single Exon Harboring a Premature Termination Codon Mutation: ImGOplications and Potential for Gene Correction Therapy for Selective Dystrophic Epidermolysis Bullosa Patients", Journal of Investigative Dermatology, 126(12): 2614-2620, Published Online Jun. 15, 2006.
Goyenvalle et al. Rescue of dystrophic muscle through U7 snRNA-mediated exon skipping. Science 2004; 306 (5702): 1796-9.
Grady, Promising Dystrophy Drug Clears Early Test, The New York Times, Dec. 27, 2007.
Graham et al. Towards a therapeutic inhibition of dystrophin exon 23 splicing in mdx mouse muscle induced by antisense oligoribonucleotides ( splicomers ): target sequence optimisation using oligonucleotide arrays. J Gene Med 2004; 6(10):1149-58.
Granchelli et al., "Pre-clinical screening of drugs using the mdx mouse," Neuromuscul. Disord. 10(4-5):235-239 (2000).
Gryaznov, "Oligonucleotide N3′-→P5′ phosphoramidates as potential therapeutic agents," Biochem. Biophys. Acta 1489(1):131-140 (1999).
Hagiwara et al., "A novel point mutation (G-1 to T) in a 5′ splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker muscular dystrophy," Am. J. Hum Genet. 54(1):53-61 (1994).
Handa et al., "The AUUCU repeats responsible for spinocerebellar ataxia type 10 form unusual RNA hairpins," J. Biol. Chem. 280(32):29340-29345 (2005) (Epub Jun. 20, 2005).
Hardiman et al., "Methylprednisolone selectively affects dystrophin expression in human muscle cultures," Neurology 43(2):342-345 (1993).
Harding et al., "The Influence of Antisense Oligonucleotide Length on DystrophinExon Skipping", Molecular Therapy, 15(1): 157-166, Jan. 2007.
Hasholt et al., "Antisense downregulation of mutant huntingtin in a cell model," J. Gene Med. 5(6):528-538 (2003).
Hassan, "Keys to the Hidden Treasures of the Mannose 6-Phosphate/Insulin-Like Growth Factor 2 Receptor," Am. J. Pathol. 162(1):3-6 (2003).
Heemskerk et al., "Development of Antisense-Mediated Exon Skipping as a Treatment forDuchenne Muscular Dystrophy", Ann NY Acad Sci vol. 1175 pp. 71-79 (2009).
Heemskerk et al., "In vivo comparison of 2′-O-methyl phosphorothioate and morpholino antisense oligonucleotides for Duchenne muscular dystrophy exon skipping," J. Gene Med. 11(3):257-266 (2009).
Highfield "Science: Boffin log", The Daily Telegraph, http://www.telegraph.co.uk/science/science-news/3320286/Science-Boffin-log.html, (Hope for Muscular Dystrophy Drug) Jan. 1, 2008.
Hoffman et al., "Somatic reversion/suppression of the mouse mdx phenotype in vivo," J. Neurol. Sci. 99(1):9-25 (1990).
Hoffman, "Skipping toward personalized molecular medicine," N. Engl. J. Med. 357(26):2719-2722 (2007).
Hope for muscular dystrophy drug, The Daily Telegraph, Dec. 28, 2007.
Hussein et al., "The effects of glucocorticoid therapy on the inflammatory and dendritic cells in muscular dystrophies," Int. J. Exp. Pathol. 87(6):451-461 (2006).
Hussey et al., "Analysis of five Duchenne muscular dystrophy exons and gender determination using conventional duplex polymerase chain reaction on single cells," Mol. Hum. Reprod. 5(11):1089-1094 (1999).
Iezzi et al., "Deacetylase inhibitors increase muscle cell size by promoting myoblast recruitment and fusion through induction of follistatin," Dev. Cell 6(5):673-684 (2004).
Ikezawa et al., "Dystrophin gene analysis on 130 patients with Duchenne muscular dystrophy with a special reference to muscle mRNA analysis," Brain Dev. 20(3):165-168 (1998).
International Preliminary Examination Report, International Application No. PCT/NL01/00697, dated Aug. 1, 2002.
International Preliminary Report on Patentability and Written Opinion for PCT/EP2007/054842, dated Nov. 21, 2008, 8 pages.
International Search Report dated Feb. 9, 2009, corresponding to PCT/NL2008/050673.
International Search Report for PCT/EP2007/054842, dated Aug. 21, 2007, 3 pages.
International Search Report for PCT/NL2009/050006 dated Jul. 31, 2009.
International Search Report for PCT/NL2009/050113 dated Jun. 30, 2010.
International Search Report, International Application No. PCT/NL 2008/050470, dated Jul. 2, 2009.
International Search Report, International Application No. PCT/NL 2008/050475, dated Jun. 25, 2009.
International Search Report, International Application No. PCT/NL01/00697, dated Dec. 21, 2002.
International Search Report, International Application No. PCT/NL2004/000196, dated Oct. 28, 2004.
International Search Report, International Application No. PCT/NL2006/000209, dated Oct. 5, 2006.
Ito et al. "Identification of Splicing Enhancer Sequences Within Exon Sequences ofDystrophin Gene", 42nd convention of Japanese Society for Inherited Metabolic Diseases,Kagoshima, Japan, Nov. 11-13, 1999, Journal of Japanese Society for Inherited MetabolicDiseases, 15(2): # 100, Nov. 1999.
Ito et al., "Purine-rich exon sequences are not necessarily splicing enhancer sequence in the dystrophin gene," Kobe J. Med. Sci. 47(5):193-202 (2001).
Ittig et al. "Nuclear Antisense Effects in Cyclophilin A Pre-mRNA Splicing byOligonucleotides: A Comparison of Tricyclo-DNA With LNA", Nucleic Acids Research, 32(1):346-353, Published Online Jan. 15, 2004.
Karras et al., "Deletion of individual exons and induction of soluble murine interleukin-5 receptor-alpha chain expression through antisense oligonucleotide-mediated redirection of pre-mRNA splicing," Mol. Pharmacol. 58(2):380-387 (2000).
Kendall et al (Sci Transl Med 4, 164ra160 (2012)). *
Kendall et al., "Dantrolene Enhances Antisense-Mediated Exon Skipping in Human and Mouse Models of Duchenne Muscular Dystrophy," Sci. Transl. Med. 4:164ra160 (2012).
Kerr et al., "BMP regulates skeletal myogenesis at two steps," Molecular and Cellular Proteomics, American Society for Biochemistry and Molecular Biology 2(9):976 (2003).
Khan, "Corticosteroid therapy in Duchenne muscular dystrophy," J. Neurol. Sci. 120(1):8-14 (1993).
Kinali et al., "Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, proof-of-concept study," Lancet Neurol. 8(10):918-928 (2009) (Epub Aug. 25, 2009).
Kuhihara et al., "Muscular Disorders," Review/Advances in Neurological Therapeutics, 4 pages, 2000 (English Translation).
Kuhihara et al., "Muscular Disorders," Review/Advances in Neurological Therapeutics, 5 pages, 2000.
Kurrek et al., "Design of antisense oligonucleotides stabilized by locked nucleic acids," Nucleic Acids Res. 30(9):1911-1918 (2002).
Langlois et al., "Hammerhead ribozyme-mediated destruction of nuclear foci in myotonic dystrophy myoblasts," Mol. Ther. 7(5 Pt 1):670-680 (2003).
Laptev et al., "Specific inhibition of expression of a human collagen gene (COL1A1) with modified antisense oligonucleotides. The most effective target sites are clustered in double-stranded regions of the predicted secondary structure for the mRNA," Biochemistry 33(36):11033-11039 (1994).
Larsen et al. Anti sense properties of peptide nucleic acid. Biochim Biophys Acta 1999; 1489 (1):159-66.
Lee et al., "Receptor mediated uptake of peptides that bind the human transferrin receptor," Eur. J. Biochem. 268(7):2004-2012 (2001).
Leiden Muscular Dystrophy pages: DMD (dystrophin), 2004. Retrieved from the Internet on Jun. 26, 2018. URL: http://www.dmd.nl/DMD_home.html.
Leiden University Medical Center and Prosensa B.V. Announce New England Journal of Medicine Publication of First Successful Clinical Study with RNA-based Therapeutic PRO051 in Duchenne Muscular Dystrophy, Dec. 27, 2007.
Letter from Katholieke Universiteit Leuven to Dr. N. Goemans, Child Neurology, UZ dated Jan. 22, 2008, regarding a Phase 1/11, open label, escalating dose, pilot study to assess the effect, safety, tolerability and pharmacokinetics of multiple subcutaneous doses of PR0051 in patients with Duchenne muscular dystrophy. PR0051-02 (translation provided).
Letter from Prosensa Therapeutics B.V. to Federal Agency for Medicines and Health Products dated Jan. 9, 2008, regarding A Phase 1/11, open label, escalating dose, pilot study to assess the effect, safety, tolerability and pharmacokinetics of multiple subcutaneous doses of PRO051 in patients with Duchenne muscular dystrophy.
Liu et al., "A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes," Nat. Genet. 27(1):55-58 (2001).
Liu et al., "Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins," Genes Dev. 12(13):1998-2012 (1998).
Liu et al., "Specific inhibition of Huntington's disease gene expression by siRNAs in cultured cells," Proc. Japan Acad. 79(Ser. B):293-298 (2003).
Lu et al., "Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse," Nat. Med. 9(8):1009-1014 (2003) (Epub Jul. 6, 2003).
Lu et al., "Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion," J. Cell Biol. 148(5):985-996 (2000).
Lu et al., "Non-viral gene delivery in skeletal muscle: a protein factory," Gene Ther. 10(2):131-142 (2003).
Lu et al., "Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles," Proc. Natl. Acad. Sci. U.S.A. 102(1):198-203 (2005) (Epub Dec. 17, 2004).
Lu, et al., Massive Idiosyncratic Exon Skipping Corrects the Non-sense Mutation in Dystrophic Mouse Muscle and Produces Functional Revertant Fibers by Clonal Expansion, The Journal Cell Biology, Mar. 6, 2000, pp. 985-995, vol. 148, No. 5.
LUMC and Prosensa report positive results of DMD study, Pharmaceutical Business Review Online, dated Dec. 28, 2007, <http://www.pharmaceutical-business-review.com/article_news_ rint.as?uid=8462FD44-F35D-4EOB-BC>.
Mann et al., "Antisense-induced exon skipping and synthesis of dystrophin in the mdx mouse," Proc. Natl. Acad. Sci. U.S.A. 98(1):42-47 (2001).
Mann et al., "Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy," J. Gene Med. 4(6):644-654 (2002).
Manning et al., "What has the mdx mouse model of Duchenne muscular dystrophy contributed to our understanding of this disease?" J. Muscle Res. Cell. Motil. 36(2):155-167 (2015) (Epub Feb. 11, 2015).
Manzur et al., "Glucocorticoid corticosteroids for Duchenne muscular dystrophy (Review)," Cochrane Database of Systematic Reviews 1:1-74 (2008).
Martiniuk et al., "Correction of glycogen storage disease type II by enzyme replacement with a recombinant human acid maltase produced by over-expression in a CHO-DHFR(neg) cell line," Biochem. Biophys. Res. Commun. 276(3):917-923 (2000). (Abstract).
Mathews et al. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 1999; 288(5):911-40.
Matsuo et al., "Exon skipping during splicing of dystrophin mRNA precursor due to an intraexon deletion in the dystrophin gene of Duchenne muscular dystrophy kobe," J. Clin. Invest. 87(6):2127-2131 (1991).
Matsuo et al., "Partial deletion of a dystrophin gene leads to exon skipping and to loss of an intra-exon hairpin structure from the predicted mRNA precursor," Biochem. Biophys. Res. Commun. 182(2):495-500 (1992).
Matsuo, "Duchenne and Becker Muscular Dystrophy: From Gene Diagnosis to Molecular Therapy", IUBMB Life, 53: 147-152, 2002.
Matsuo, et al., "Duchenne/Becker muscular dystrophy: from molecular diagnosis to gene therapy," Brain Dev. 18(3):167-172 (1996).
McClorey et al., "Antisense Oligonucleotide-Induced Exon Skipping RestoresDystrophin Expression in Vitro in A Canine Model of DMD", Gene Therapy, 13: 1373-1381,Published Online May 25, 2006.
McClorey et al., "Induced dystrophin exon skipping in human muscle explants," Neuromuscul. Disord. 16(9-10):583-590 (2006) (Epub Aug. 21, 2006).
Merlini & Sabatelli, "Improving clinical trial design for Duchenne," BMC Neurology 15:153 (2015).
Monaco et al., "An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus," Genomics 2(1):90-95 (1988).
Moon et. al., "Target site search and effective inhibition of leukaemic cell growth by a covalently closed multiple anti-sense oligonucleotide to c-myb," Biochem. J. 346 Pt 2:295-303 (2000).
Morita et al. "2′-O,4′-C-Ethylene-Bridged Nucleic Acids (ENA) With Nuclease-Resistance and High Affinity for RNA", Nucleic Acids Research, Suppl.1: 241-242, 2001.
Moxley et al., "Practice parameter: corticosteroid treatment of Duchenne dystrophy: report of the Quality Standards Subcommittee of the American Academy of Neurology and the Practice Committee of the Child Neurology Society," Neurology 64(1):13-20 (2005).
Munroe, "Antisense RNA inhibits splicing of pre-mRNA in vitro," EMBO J. 7(8):2523-2532 (1988).
Muntoni et al., "128th ENMC International Workshop on ‘Preclinical optimization and Phase I/II Clinical Trials Using Antisense Oligonucleotides in Duchenne Muscular Dystrophy’ Oct. 22-24, 2004, Naarden, The Netherlands," Neuromuscul. Disord. 15(6):450-457 (2005).
Muntoni et al., "A mutation in the dystrophin gene selectively affecting dystrophin expression in the heart," J. Clin Invest. 96(2):693-699 (1995).
Muntoni et al., "Steroids in Duchenne muscular dystrophy: from clinical trials to genomic research," Neuromuscul. Disord. 12 Suppl 1:S162-S165 (2002).
Nang et al. "Sustained AAV-Mediated Dystrophin Expression in A Canine Model ofDuchenne Muscular Dystrophy With A Brief Course of Immunosuppression", Molecular Therapy, 15(6): 1160-1166, Jun. 2007.
New Clinical Trial Results Show How Personalized Medicine Will Alter Treatment of Genetic Disorders, Medical News Today, Dec. 29, 2007 <http://www.medicalnewstodav.com/article/92777.PhP>.
Nishio et al., "Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter," J. Clin. Invest. 94(3):1037-1042 (1994).
Notice of Opposition filed against EP 1 619 249 B, dated Jun. 23, 2009.
Office Action for U.S. Appl. No. 10/395,031, dated Apr. 2, 2009.
Office Action for U.S. Appl. No. 10/395,031, dated Aug. 23, 2007.
Office Action for U.S. Appl. No. 10/395,031, dated Feb. 6, 2006.
Office Action for U.S. Appl. No. 10/395,031, dated Jul. 8, 2005.
Office Action for U.S. Appl. No. 10/395,031, dated May 30, 2008.
Office Action for U.S. Appl. No. 10/395,031, dated Nov. 30, 2006.
Office Action for U.S. Appl. No. 10/395,031, dated Oct. 16, 2009.
Office Action for U.S. Appl. No. 11/233,495, dated Dec. 1, 2008.
Office Action for U.S. Appl. No. 11/233,495, dated Jun. 25, 2009.
Office Action for U.S. Appl. No. 11/233,507, dated Jun. 15, 2007.
Office Action for U.S. Appl. No. 11/233,507, dated Mar. 19, 2008.
Office Action for U.S. Appl. No. 11/233,507, dated May 29, 2009.
Office Action for U.S. Appl. No. 11/233,507, dated Nov. 12, 2008.
Office Action for U.S. Appl. No. 11/982,285, dated May 4, 2009.
Office Action for U.S. Appl. No. 11/982,285, dated Sep. 18, 2009.
Onlo Nederlandsch Octrooibureau, Alignments of AON exon 53, EP1619249, 1 page, Jan. 8, 2013.
Onlo Nederlandsch Octrooibureau, Grounds of Appeal,—EP1619249, 16 pages, Aug. 23, 2013.
Onlo Nederlandsch Octrooibureau, List of all submitted documents—EP1619249, 4 pages, Aug. 23, 2013.
Onlo, "Comparative analysis of AONs for inducing the skipping of exon 45 and 53 from the dystrophin gene in human control muscle cells," EP1619249, 3 pages, Aug. 23, 2013.
Onlo, "Comparative Analysis of AONs for inducing the skipping of exon 53 from the dystrophin gene in human control muscle cells," EP1619249, 3 pages, Jan. 8, 2014.
Opalinska and Gewirtz, "Nucleic-acid therapeutics: basic principles and recent applications," Nat. Rev. Drug. Discov. 1(7):503-514 (2002).
Opalinska and Gewirtz. "Nucleic-acid therapeutics: basic principles and recent applications." Nature Reviews Drug Discovery, 2002, vol. 1, pp. 503-514.
Opalinska et al. "Oxetane Modified, Conformationally Constrained, Antisense Oligodeoxyribonucleotides Function Eddiciently as Gene Silencing Molecules", Nucleic Acids Research, 32(19): 5791-5799, Published Online Oct. 28, 2004.
O'Shaughnessy et al (Journal of Clinical Oncology, vol. 20, No. 12 Jun. 15, 2002). *
O'Shaughnessy et al., "Superior survival with capecitabine plus docetaxel combination therapy in anthracycline-pretreated patients with advanced breast cancer: phase III trial results," J. Clin. Oncol. 20(12):2812-2823 (2002).
Oxford Dictionary of English, 2nd Edition, Revised, Oxford University Press, p. 158.
Patel et al., "The function of Myostatin and strategies of Myostatin blockade-new hope for therapies aimed at promoting growth of skeletal muscle," Neuromuscul. Disord. 15(2):117-126 (2005) (Epub Jan. 11, 2005).
Patentee's response during prosecution of opposed patent, dated Jan. 27, 2010.
Politano et al (Acta Myologica 22: 15-21, 2003). *
Politano et al., "Gentamicin administration in Duchenne patients with premature stop codon. Preliminary results," Acta Myol. 22(1):15-21 (2003) (Epub Jan. 29, 2006).
Pramono et al., "Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence," Biochem. Biophys. Res. Commun. 226(2):445-449 (1996). (Abstract).
Priority document EP 07119351.0, filed Oct. 26, 2007.
Priority document U.S. Appl. No. 61/000,670, filed Oct. 26, 2007.
Radley et al., "Duchenne muscular dystrophy: focus on pharmaceutical and nutritional interventions," Int. J. Biochem. Cell Biol. 39(3):469-477 (2007) (Epub Oct. 10, 2006).
Rando, "Oligonucleotide-mediated gene therapy for muscular dystrophies," Neuromuscul. Disord. 12 Suppl 1:S55-S60 (2002).
Reitter, "Deflazacort vs. prednisone in Duchenne muscular dystrophy: trends of an ongoing study," Brain Dev. 17(suppl):39-43 (1995).
Reitter. Brain & Development. 1995, 17 (suppl): 39-43. *
Request for an Opinion under Section 74(A) in relation to Patent No. EP (UK) 1 619 249B in the name of Academisch Ziekenhuis Leiden, opinion issued on Jun. 4, 2009.
Request for UK IPO Opinion (Section 74A & Rule 93)—EP(UK) 1619249 dated Mar. 9, 2009.
Reuser et al., "Uptake and stability of human and bovine acid alpha-glucosidase in cultured fibroblasts and skeletal muscle cells from glycogenosis type II patients," Exp. Cell Res. 155(1):178-189 (1984).
Roberts et al., "Exon structure of the human dystrophin gene," Genomics 16(2):536-538 (1993).
Roberts et al., "Exon structure of the human dystrophin gene," Lancet 336(8730):1523-1526 (1990).
Roberts et al., "Searching for the 1 in 2,400,000: a review of dystrophin gene point mutations," Hum. Mutat. 4(1):1-11 (1994).
Roberts et al., Direct detection of dystrophin gene rearrangements by analysis of dystrophin mRNA in peripheral blood lymphocytes. Am. J. Hum. Genet. 49(2): 298-310 (1991).
Rolland et al (Neurobiology of Disease 24 (2006) 466-474. *
Rolland et at, "Overactivity of exercise-sensitive cation channels and their impaired modulation by IGF-1 in mdx native muscle fibers: beneficial effect of pentoxifylline," Neurobiol. Dis. 24(3):466-474 (2006) (Epub Sep. 28, 2006).
Rosen et al (Cancer 35: 622-630, 1975). *
Rosen et al., "Combination chemotherapy and radiation therapy in the treatment of metastatic osteogenic sarcoma," Cancer 35(3):622-630 (1975).
Rosen et al., "Effect of perindopril on the onset and progression of left ventricular dysfunction in Duchenne muscular dystrophy," Cancer 35(3):622-630 (1975).
Ryanodine receptor. Retrieved from http://en.wikipedia.org/wiki/Ryanodine_receptor on Jun. 6, 2014. *
Samoylova et al., "Elucidation of muscle-binding peptides by phage display screening," Muscle Nerve 22(4):460-466 (1999).
Sarepta Therapeutics, Inc., "Sarepta Therapeutics and University of Western Australia Announce Exclusive Worldwide Licensing Agreement for Exon-Skipping Program in Duchenne Muscular Dystrophy," News Release, EP1619249, 3 pages, Apr. 11, 2013.
Scanlon, "Anti-genes: siRNA, ribozymes and antisense," Curr. Pharm. Biotechnol. 5(5):415-420 (2004).
Ségalat et al., "CAPON expression in skeletal muscle is regulated by position, repair, NOS activity, and dystrophy," Exp. Cell Res. 302(2):170-179 (2005).
Sertić et al., "Deletion screening of the Duchenne/Becker muscular dystrophy gene in Croatian population," Coll. Antropol. 21(1):151-156 (1997).
Shapiro and Senapathy, "RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression," Nucleic Acids Res. 15(17):7155-7174 (1987).
Sherratt et al., "Exon skipping and translation in patients with frameshift deletions in the dystrophin gene," Am. J. Hum. Genet. 53(5):1007-1015 (1993).
Shiga et al., "Disruption of the splicing enhancer sequence within exon 27 of the dystrophin gene by a nonsense mutation induces partial skipping of the exon and is responsible for Becker muscular dystrophy," J. Clin. Invest. 100(9):2204-2210 (1997).
Simões-Wüst et al., "Bcl-xl antisense treatment induces apoptosis in breast carcinoma cells," Int. J. Cancer 87(4):582-590 (2000).
Sironi et al., "Silencer elements as possible inhibitors of pseudoexon splicing", Nucleic Acids Research, 2004, vol. 32, No. 4, pp. 1783-1791.
Sironi, et al., "The Dystrophin Gene is Alternatively Spliced Throughout its Coding DSequence," FEBS Letters, 2002, vol. 517 (1-3), pp. 163-166.
Smith et al., "Muscle-specific peptide #5", Mar. 23, 1999. From http://www.ebi.ac.uk/cgi-bin/epo/epofetch?AAW89659, downloaded Jul. 16, 2007.
Squires, "An Introduction to Nucleoside and Nucleotide Analogues," Antivir. Ther. 6 (Suppl 3):1-14 (2001).
Sterrenburg et al., "Gene expression profiling highlights defective myogenesis in DMD patients and a possible role for bone morphogenetic protein 4," Neurobiol. Dis. 23(1):228-236 (2006) (Epub May 6, 2006).
Summerton "Morpholino Antisense Oligomers: The Case for An RNase H-IndependentStructural Type", Biochimica et Biophysica Acta, 1489(1): 141-158, Dec. 10, 1999.
Summerton et al., "Morpholino Antisense Oligomers: Design, Preparation, and Properties," Antisense Nucleic Acid Drug Dev. 7(3):187-195 (1997).
Surono et al., "Chimeric RNA/ethylene-bridged nucleic acids promote dystrophin expression in myocytes of duchenne muscular dystrophy by inducing skipping of the nonsense mutation-encoding exon," Hum. Gene Ther. 15(8):749-757 (2004).
Surono et al., "Six novel transcripts that remove a huge intron ranging from 250 to 800 kb are produced by alternative splicing of the 5′ region of the dystrophin gene in human skeletal muscle," Biochem. Biophys. Res. Commun. 239(3):895-899 (1997).
Suter et al., "Double-target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta-thalassemic mutations," Hum. Mol. Genet. 8(13):2415-2423 (1999).
Suwanmanee et al., "Restoration of human beta-globin gene expression in murine and human IVS2-654 thalassemic erythroid cells by free uptake of antisense oligonucleotides," Mol. Pharmacol. 62(3):545-553 (2002).
Takashima et al., "Oligonucleotides against a splicing enhancer sequence led to dystrophin production in muscle cells from a Duchenne muscular dystrophy patient," Brain Dev. 23(8):788-790 (2001).
Takeshima et al., "Basic research for treatment of Duchene muscular dystrophy using induction of exon skipping by means of antisense oligo DNA: effect of in vivo administration in mice," Park IP Translations, vol. 15, No. 2, 6 pages, Nov. 2009.
Takeshima et al., "Expression of Dystrophin Protein in Cultured Duchenne Muscular Dystrophy Cells by Exon Skipping Induced by Antisense Oligonucleotide" (Abstract); Abstract of the Japan Society of Human Genetics General Meeting Program, Nov. 17-19, 1999.
Takeshima et al., "Intravenous infusion of an antisense oligonucleotide results in exon skipping in muscle dystrophin mRNA of Duchenne muscular dystrophy," Pediatr. Res. 59(5):690-694 (2006).
Takeshima et al., "Modulation of in vitro splicing of the upstream intron by modifying an intra-exon sequence which is deleted from the dystrophin gene in dystrophin Kobe.," J. Clin. Invest. 95(2):515-520 (1995).
Takeshima. Pediatric Research. vol. 59, Bo. 5, 2006. pp. 690-694. *
Tanaka et al., "Polypurine sequences within a downstream exon function as a splicing enhancer," Mol. Cell. Biol. 14(2):1347-1354 (1994).
Thanh et al., "Characterization of revertant muscle fibers in Duchenne muscular dystrophy, using exon-specific monoclonal antibodies against dystrophin," Am. J. Hum. Genet. 56(3):725-731 (1995).
Third Party's Statement for Japan Appl. No. 2002-529499, dated Oct. 29, 2010.
Thomsen, et al., "Dramatically improved RNA in situ hybridization signals using LNA-Dmodified probes," RNA, vol. 11, pp. 1745-1748, 2005.
Tian and Kole, "Selection of novel exon recognition elements from a pool of random sequences," Mol. Cell. Biol. 15(11):6291-6298 (1995).
TREAT-NMD Neuromuscular Network, Jan. 11, 2008.
Tsuchida, "The role of myostatin and bone morphogenetic proteins in muscular disorders," Expert Opin. Biol. Ther. 6(2):147-153 (2006).
U.S. Food and Drug Administration (FDA) Briefing Document to the Peripheral and Central Nervous System Drugs Advisory Committee Meeting, Nov. 24, 2015, NDA 206031, Drisapersen.
United States Patent and Trademark Office Final Office Action for U.S. Appl. No. 14/990,712, dated Jul. 21, 2017 (20 pages).
United States Patent and Trademark Office Non-Final Office Action for U.S. Appl. No. 14/990,712, dated Nov. 14, 2016 (20 pages).
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495 University of Western Australia Exhibit List, 10 pages, filed Apr. 10, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495 University of Western Australia Miscellaneous Motion 4 (to exclude evidence), 21 pages, filed Apr. 10, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495 University of Western Australia Request for Oral Argument, 4 pages, filed Apr. 10, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495) University of Western Australia Objections (to Opposition Evidence) 15 pages, filed Feb. 24, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Exhibit List as of Feb. 17, 2015, 8 pages, filed Feb. 17, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Exhibit List, 10 pages, filed Apr. 3, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia List of Proposed Motions, 7 pages, filed Sep. 10, 2014 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Motion 1 (for Judgment Under 35 U.S.C. §112(a)), 40 pages, filed Nov. 18, 2014 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Motion 2 (for Judgment Under 35 U.S.C. §112(b)), 34 pages, filed Nov. 18, 2014 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Motion 3 (Requesting an Additional Interference Between UWA U.S. Pat. No. 8,455,636 and Academisch Ziekenhuis Leiden's U.S. Appl. No. 14/248,279), 36 pages, filed Nov. 18, 2014 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Opposition 2 (to Retain UWA's Benefit of AU 2004903474), 37 pages, filed Feb. 17, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Opposition 3 (Regarding Patentability Under 35 U.S.C. § 101), 22 pages, filed Feb. 17, 2015 [Patent Interference No. 106,007 (Res)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Opposition 4 (to deny entry of AZL's Proposed New Claims 104 and 105), 36 pages, filed Feb. 17, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Reply 1 (to AZL Opposition 1) 28 pages, filed Apr. 3, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Reply 2 (to AZL Opposition 2) 22 pages, filed Apr. 3, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495), University of Western Australia Reply 3 (to Institute an Interference) 17 pages, filed Apr. 3, 2015 [Patent Interference No. 106,007 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,455,636) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 11/233,495)[Patent Interference No. 106,007 (RES)] and University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210) [Patent Interference No. 106,008 (RES)], Second Declaration of Matthew J.A. Wood, M.D., D. Phil., 78 pages, filed Feb. 17, 2015.
University of Western Australia, University of Western Australia (U.S. Pat. No. 8,486,907) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 14/198,992),University of Western Australia Motion 1 (to Maintain Interference Between UWA U.S. Pat. No. 8,486,907 and Academisch Ziekenhuis Leiden's U.S. Appl. No. 14/198,992), 45 pages, filed Nov. 18, 2014 [Patent Interference No. 106,013 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210) University of Western Australia Opposition 2 (To Retain UWA's Benefit of AU 2004903474), 31 pages, filed Feb. 17, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Exhibit List as of Feb. 17, 2015, 8 pages, filed Feb. 17, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Exhibit List, 10 pages, filed Apr. 10, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Exhibit List, 10 pages, filed Apr. 3, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Miscellaneous Motion 4 (to exclude evidence), 21 pages, filed Apr. 10, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Motion 1 (for Judgment Under 35 U.S.C. §112(a)), 38 pages, filed Nov. 18, 2014 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Motion 2 (for Judgment Under 35 U.S.C. §112(b)), 32 pages, filed Nov. 18, 2014 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Motion 3 (for judgment that Claims 11-12, 14-15, and 17-29 of U.S. Appl. No. 13/550,210 are barred under 35 U.S.C. §135(b)); 25 pages, filed Nov. 18, 2014 [Patent Interference No. 106,008].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Objections (to Opposition Evidence) 15 pages, filed Feb. 24, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Opposition 3 (Regarding Patentability Under 35 U.S.C. § 101), 22 pages, filed Feb. 17, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Opposition 4 (To deny entry of AZL's Proposed New Claims 30 and 31), 36 pages, filed Feb. 17, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Reply 1 (to AZL Opposition 1) 28 pages, filed Apr. 3, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Reply 2 (to AZL Opposition 2) 22 pages, filed Apr. 3, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Reply 3 (for judgment under 35 U.S.C. §135(b)) 19 pages, filed Apr. 3, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Request for Oral Argument, 4 pages, filed Apr. 10, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541 and 7,807,816) v.Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia Opposition 1 (Regarding Patentability Under 35 U.S.C. § 102/103), 39 pages, filed Feb. 17, 2015 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 7,960,541, 7,807,816) v. Academisch Ziekenhuis Leiden (U.S. Appl. No. 13/550,210), University of Western Australia List of Proposed Motions, 6 pages, filed Sep. 10, 2014 [Patent Interference No. 106,008 (RES)].
University of Western Australia, University of Western Australia (U.S. Pat. Nos. 8,455,636, 7,960,541, 7,807,816, 8,486,907) v. Academisch Ziekenhuis Leiden (U.S. Appl. Nos. 11/233,495, 13/550,210, 14/198,992), Declaration of Matthew J.A. Wood, M.D.,D. Phil.—UVA Exhibit 2081, 184 pages, filed Sep. 19, 2014 [Patent Interference Nos. 106,007, 106,008, 106,113 (RES)].
USAN Council Statement for Drisapersen.
Van Deutekom et al., "Advances in Duchenne muscular dystrophy gene therapy," Nat. Rev. Genet. 4(10):774-783 (2003).
Van Deutekom et al., "Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells," Hum. Mol. Genet. 10(15):1547-54. (2001).
Van Deutekom et al., "Local dystrophin restoration with antisense oligonucleotide PRO051," N. Engl. J. Med. 357(26):2677-2686 (2007).
van Deutekon et al. Human Molecular Genetics, 2001, vol. 10, No. 15. a547-1554. *
Van Ommen, "The Therapeutic Potential of Antisense-Mediated Exon-Skipping," Curr. Opin. Mol. Ther. 10(2):140-149 (2008).
Van Vliet et al., "Assessment of the feasibility of exon 45-55 multiexon skipping for Duchenne muscular dystrophy," BMC Med. Genet. 9:105 (2008).
Varani et al. "The G.U. wobble base pair: A fundamental building block of RNA structure crucial to RNA function in diverse biological systems." EMBO Reports 1:18-23 (2000).
Verhaart et al., "Prednisolone treatment does not interfere with 2′-0-methyl phosphorothioate antisense-mediated exon skipping in Duchenne muscular dystrophy," Hum. Gene Ther. 23(3):262-273 (2012) (Epub Jan. 26, 2012).
Verreault et al., "Gene silencing in the development of personalized cancer treatment: the targets, the agents and the delivery systems.," Curr. Gene Ther. 6(4):505-533 (2006).
Vickers et al., "Efficient reduction of target RNAs by small interfering RNA and RNase H-dependent antisense agents. A comparative analysis," J. Biol. Chem. 278(9):7108-7118 (2003) (Epub Dec. 23, 2002).
Wahlestedt et al. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci USA 2000; 97(10):5633-8.
Wang et al., "Adeno-associated virus vector carrying human minidystrophin genes effectively ameliorates muscular dystrophy in mdx mouse model," Proc. Natl. Acad. Sci. U.S.A. 97(25):13714-13719 (2000).
Watakabe et al., "The role of exon sequences in splice site selection," Genes Dev. 7(3):407-418 (1993).
Wehling-Henricks et al., "Prednisolone decreases cellular adhesion molecules required for inflammatory cell infiltration in dystrophin-deficient skeletal muscle," Neuromuscul. Disord. 14:483-490 (2004).
Weisbart et al., "Cell type specific targeted intracellular delivery into muscle of a monoclonal antibody that binds myosin Ilb," Mol. Immunol. 39(13):783-789 (2003). (Abstract).
Welch et al., "PTC124 targets genetic disorders caused by nonsense mutations," 447(7140):87-91 (2007) (Epub Apr. 22, 2007).
Wells et al., "Enhanced in vivo delivery of antisense oligonucleotides to restore dystrophin expression in adult mdx mouse muscle," FEBS Lett. 552(2-3):145-149 (2003).
Wenk et al., "Quantitation of Mr 46000 and Mr 300000 mannose 6-phosphate receptors in human cells and tissues," Biochem. Int. 23(4):723-731 (1991) (Abstract).
Wheway and Roberts, "The dystrophin lymphocyte promoter revisited: 4.5-megabase intron, or artifact?" Neuromuscul. Disord. 13(1):17-20 (2003).
Wilton and Fletcher, "Antisense oligonucleotides, exon skipping and the dystrophin gene transcript," Acta Myol. 24(3):222-229 (2005).
Wilton et al., "Antisense oligonucleotide-induced exon skipping across the human dystrophin gene transcript," Mol. Ther. 15(7):1288-1296 (2007) (Epub Feb. 6, 2007).
Wilton et al., "Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides," Neuromuscul. Disord. 9(5):330-338 (1999).
Wilton. *
Wilton. Acta Myologica. 2005, XXIV. p. 222-229. *
Wuebbles et al., "Levels of α7 integrin and laminin-α2 are increased following prednisone treatment in the mdx mouse and GRMD dog models of Duchenne muscular dystrophy," Dis. Model Mech. 6(5):1175-1184 (2013).
Xu et al (Ann N Y Acad Sci. Sep. 16, 1998;853:130-48). *
Xu et al., "Potential for pharmacology of ryanodine receptor/calcium release channels," Ann. NY Acad. Sci. 853:130-148 (1998).
Yagi et al. "Chimeric RNA and 2′-O, 4′-C-Ethylene-Bridged Nucleic Acids Have Stronger Activity than Phosphorothioate Oligodeoxynucleotides in Induction of Exon 19 Skipping in Systrophin mRNA," Oligonucleotides 14 (1):33-40, 2004.
Yen et al., "Sequence-specific cleavage of Huntingtin mRNA by catalytic DNA," Ann. Neurol. 46(3):366-373 (1999).
Yin et al., "Effective exon skipping and restoration of dystrophin expression by peptide nucleic acid antisense oligonucleotides in mdx mice," Mol. Ther. 16(1):38-45 (2008) (Epub Oct. 30, 2007).
Yokota et al., "Optimizing exon skipping therapies for DMD," Acta Myol. 26(3): 179-184 (2007).
Zhang et al., "Efficient expression of naked dna delivered intraarterially to limb muscles of nonhuman primates," Hum. Gene Ther. 12(4):427-438 (2001). (Abstract).
Zhou et al., "Current understanding of dystrophin-related muscular dystrophy and therapeutic challenges ahead," Chin. Med. J. (Engl.) 119(16):1381-1391 (2006).

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11795233B2 (en) 2018-08-02 2023-10-24 Dyne Therapeutics, Inc. Muscle-targeting complex comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11795234B2 (en) 2018-08-02 2023-10-24 Dyne Therapeutics, Inc. Methods of producing muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US11369689B2 (en) 2018-08-02 2022-06-28 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11497815B2 (en) 2018-08-02 2022-11-15 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11633496B2 (en) 2018-08-02 2023-04-25 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12478687B2 (en) 2018-08-02 2025-11-25 Dyne Therapeutics, Inc. United states
US11168141B2 (en) 2018-08-02 2021-11-09 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11787869B2 (en) 2018-08-02 2023-10-17 Dyne Therapeutics, Inc. Methods of using muscle targeting complexes to deliver an oligonucleotide to a subject having facioscapulohumeral muscular dystrophy or a disease associated with muscle weakness
US11248056B1 (en) 2018-08-02 2022-02-15 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11833217B2 (en) 2018-08-02 2023-12-05 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12173079B2 (en) 2018-08-02 2024-12-24 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US12357703B2 (en) 2018-08-02 2025-07-15 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping
US12263225B2 (en) 2018-08-02 2025-04-01 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and methods of use thereof to target dystrophin and to treat Duchenne muscular dystrophy
US12005124B2 (en) 2018-08-02 2024-06-11 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12012460B2 (en) 2018-08-02 2024-06-18 Dyne Therapeutics, Inc. Muscle-targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide
US12329825B1 (en) 2018-08-02 2025-06-17 Dyne Therapeutics, Inc. Muscle targeting complexes comprising an anti-transferrin receptor antibody linked to an oligonucleotide and method of use thereof to induce exon skipping of exon 44 of dystrophin in a subject
US12331293B2 (en) 2018-11-02 2025-06-17 Biomarin Technologies B.V. Bispecific antisense oligonucleotides for dystrophin exon skipping
US11771776B2 (en) 2021-07-09 2023-10-03 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12144867B2 (en) 2021-07-09 2024-11-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12144868B2 (en) 2021-07-09 2024-11-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US12128109B2 (en) 2021-07-09 2024-10-29 Dyne Therapeutics, Inc. Muscle targeting complexes and formulations for treating dystrophinopathies
US11986537B2 (en) 2021-07-09 2024-05-21 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11844843B2 (en) 2021-07-09 2023-12-19 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy
US12440575B2 (en) 2021-07-09 2025-10-14 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating dystrophinopathies
US11679161B2 (en) 2021-07-09 2023-06-20 Dyne Therapeutics, Inc. Muscle targeting complexes and uses thereof for treating facioscapulohumeral muscular dystrophy

Similar Documents

Publication Publication Date Title
US9243245B2 (en) Means and methods for counteracting muscle disorders
US11634714B2 (en) Oligonucleotide comprising an inosine for treating DMD
HK1245670B (en) Means and methods for counteracting muscle disorders
HK1186377A (en) Means and methods for counteracting muscle disorders
HK1186377B (en) Means and methods for counteracting muscle disorders
HK1150972A (en) Means and methods for counteracting muscle disorders
HK1167433B (en) Oligonucleotide comprising an inosine for treating dmd

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

AS Assignment

Owner name: PROSENSA TECHNOLOGIES B.V., NETHERLANDS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DE KIMPE, JOSEPHUS JOHANNES;PLATENBURG, GERARD JOHANNES;VAN DEUTEKOM, JUDITH CHRISTINA THEODORA;AND OTHERS;REEL/FRAME:047213/0284

Effective date: 20100629

Owner name: BIOMARIN TECHNOLOGIES B.V., NETHERLANDS

Free format text: CHANGE OF NAME;ASSIGNOR:PROSENSA TECHNOLOGIES B.V.;REEL/FRAME:047264/0210

Effective date: 20150908

Owner name: ACADEMISCH ZIEKENHUIS LEIDEN, NETHERLANDS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DE KIMPE, JOSEPHUS JOHANNES;PLATENBURG, GERARD JOHANNES;VAN DEUTEKOM, JUDITH CHRISTINA THEODORA;AND OTHERS;REEL/FRAME:049447/0351

Effective date: 20100629

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 8