BACKGROUND OF THE INVENTION
The present invention relates to a new and distinct cultivar of flowering dogwood tree cultivar, which has fused bracts. This dogwood tree is botanically known as Cornus kousa and hereinafter referred to by the following cultivar name: ‘Pam's Mountain Bouquet’.
This new dogwood cultivar was discovered in a planting of seedlings within a cultivated area in Oak Ridge, Tenn. ‘Pam's Mountain Bouquet’ is a selection from the original seedlings grown in Oak Ridge, Tenn. from seed gifted by Polly Hill. Asexual reproduction of ‘Pam's Mountain Bouquet’ by rooting of harvested terminal cuttings and grafting of axillary buds onto seedling rootstocks in Oak Ridge, Tenn. and at a nursery located in Belvidere Tenn. have shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetative generations.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. Photograph of ‘Pam's Mountain Bouquet’. Colors in the photograph may differ from actual colors due to lighting and light reflectance.
FIGS. 2A and 2B. Close-up Photographs of ‘Pam's Mountain Bouquet’ bracts.
FIG. 3. Dendrogram illustrating the relatedness of “Pam's Mountain Bouquet” to other selected Cornus kousa cultivars using 11 microsatellite (SSR; Simple Sequence Repeat) markers. Note: Cultivar Beni Fuji is disclosed in U.S. Plant. Pat. No. 8,676.
DETAILED DESCRIPTION OF THE NEW VARIETY
A new and distinct cultivar of flowering dogwood tree cultivar, which has fused bracts is provided. This dogwood tree cultivar is botanically known as Cornus kousa and referred to by the following cultivar name: ‘Pam's Mountain Bouquet’. This cultivar appears to be resistant to powdery mildew caused by Erisphe pulchra and dogwood anthracnose caused by Discula destructiva.
This new and distinct dogwood tree cultivar was discovered in a planting of seedlings within a cultivated area in Oak Ridge, Tenn. and arose from seed gifted by Ms. Polly Hill. ‘Pam's Mountain Bouquet’ is a selection from the original seedlings. The instant cultivar was derived from open-pollinated seeds that were bulked from maternal parents ‘Big Apple’, ‘Snowbird’, ‘Steeple’ and an unnamed tree and the potential paternal parents ‘Big Apple’, ‘Julian’, ‘Steeple’ and another unnamed tree (Auge et al., 2002). Thus, it is not possible to ascertain the exact parentage. The subject dogwood tree cultivar differs from all of the potential parents in that the instant cultivar has fused bracts, whereas none of the potential parent cultivars show the same characteristic.
Asexual reproduction of ‘Pam's Mountain Bouquet’ by rooting of harvested terminal cuttings and grafting of axillary buds onto seedling rootstocks in Oak Ridge, Tenn. and at a nursery located in Belvidere, Tenn. has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive generations.
DETAILED BOTANICAL DESCRIPTION
The following observations, measurements and comparisons describe this cultivar grown in Oak Ridge, Tenn. Trees used for this description were about twenty (20) years old. Plant hardiness is expected to be zones 4-9. The color characteristic descriptions use color references to The Royal Horticultural Society (R.H.S.) Colour Chart (published 2001), except where general terms of ordinary dictionary significance are used. Measurements are provided as an average (with ranges also provided as indicated).
The following Table 1 shows microsatellite (SSR) markers used to perform unweighted pair group with arithmetic mean (UPGMA) cluster analysis of 29 cultivars and lines of Cornus kousa. GenBank accession numbers are given along with, locus designations, forward (F) and reverse (R) primer sequences (5′-3′ direction), and repeat motif:
| TABLE 1 |
| |
| GenBank |
|
|
|
| acces- |
|
|
|
| sion no. |
Locus |
Primer sequences (5'-3') |
Repeat |
| |
| EU544308 |
CK005 |
F:GCATTTGTCCTTTGTTTGACAT |
(AC)20 |
| |
|
(SEQ ID NO: 1) |
|
| |
| |
|
R:TTTTTCGCGAAGTGTTCTCTAC |
|
| |
|
(SEQ ID NO: 2) |
|
| |
| EU125522 |
CK007 |
F:GAGCCCAGAAGAAGAATATAGAC |
(AG)8 |
| |
|
(SEQ ID NO: 3) |
|
| |
| |
|
R:ATATAATTGGGTTGGGTTTTG |
|
| |
|
(SEQ ID NO: 4) |
|
| |
| EU125523 |
CK015 |
F:GTCAAATTTTTGATCTTTCTCTCT |
(CT)10 |
| |
|
(SEQ ID NO: 5) |
|
| |
| |
|
R:GGAGAGACAGAGTACAGTAGAGGT |
|
| |
|
(SEQ ID NO: 6) |
|
| |
| EU125524 |
CK029 |
F:AATTTAGGTTAAGGTTTTGATTTG |
(TC)8 |
| |
|
(SEQ ID NO: 7) |
|
| |
| |
|
R:AGAGAGAATAGGTTACAGCATCAT |
|
| |
|
(SEQ ID NO: 8) |
|
| |
| EU125525 |
CK031 |
F:TGTCACTGCTTACAGAAACAAT |
(CT)7 |
| |
|
(SEQ ID NO: 9) |
|
| |
| |
|
R:TATGACGAGATTGTATAAGTTGCT |
|
| |
|
(SEQ ID NO:10) |
|
| |
| EU125526 |
CK040 |
F:CCAAGTCAGTTTGGTAGTAATTC |
(GT)16 |
| |
|
(SEQ ID NO: 11) |
|
| |
| |
|
R:AGTGCAACTTTTACTTGCTATGT |
|
| |
|
(SEQ ID NO: 12) |
|
| |
| EU125529 |
CK048 |
F:ACCAACCAAAAGAAGTATAAAGAA |
(TA)6 |
| |
|
(SEQ ID NO: 13) |
|
| |
| |
|
R:CCTATAAATAAGGAGTGATTTGGT |
|
| |
|
(SEQ ID NO: 14) |
|
| |
| EU544309 |
CK058 |
F:CTTAAGTCACAAAGACAATGAAAT |
(GT)10 |
| |
|
(SEQ ID NO: 15) |
|
| |
| |
|
R:AAGAGAGTTCAGATTTATCTTTGC |
|
| |
|
(SEQ ID NO: 16) |
|
| |
| EU544310 |
CK070 |
F:CTTTTCTACACCCTTAACAAGTG |
(GT)9 |
| |
|
(SEQ ID NO: 17) |
|
| |
| |
|
R:TAGACAATATGTGCTTAATTGGTT |
|
| |
|
(SEQ ID NO: 18) |
|
| |
| EU544311 |
CK071 |
F:CTGCTCGGTTAAGGTATGTT |
(TG)9 |
| |
|
(SEQ ID NO: 19) |
|
| |
| |
|
R:TTTAAAGTGCGTTGTATACATAA |
|
| |
|
AT (SEQ ID NO: 20) |
|
| |
| EU544312 |
CK072 |
F:AGCACTCATAGTCCTTGCAC |
(GT)10 |
| |
|
(SEQ ID NO: 21) |
|
| |
| |
|
R:GTTAAAACGAAGAAGATACAACAA |
|
| |
|
(SEQ ID NO: 22) |
| |
| TABLE 2 |
| |
| Characteristics of Pam's Mountain Bouquet' |
| Color Descriptions are based upon the |
| Royal Horticultural Society's (RHS) colour chart, 2001. |
| |
|
|
|
Comparative |
| |
|
|
|
Variety |
| |
|
Generalized |
‘Pam's Mountain |
(Milky |
| |
Character |
Characteristics |
Bouquet’ |
Way Select) |
| |
| 1 |
Tree form |
upright |
spreading |
Spreading- |
| |
(observation) |
semi-upright |
|
to semi- |
| |
|
spreading |
|
upright |
| |
|
weeping |
|
|
| |
|
others |
|
|
| 2 |
Tree height |
dwarf |
low |
Medium |
| |
(observation) |
low |
(about 3-4 meters; |
|
| |
|
medium |
spread about 4 -5 |
|
| |
|
high |
meters, and |
|
| |
|
very high |
dependent on age |
|
| |
|
|
and environment) |
|
| 3 |
Branch thickness |
thin |
medium |
Medium |
| |
(measurement) |
medium |
(age dependent) |
|
| |
Thickness in the |
thick |
|
|
| |
middle portion |
|
|
|
| |
of a plant |
|
|
|
| 4 |
Color of current |
Yellow |
Green |
Green |
| |
Shoot |
Yellow green |
143B |
143B |
| |
(observation) |
Green |
|
|
| |
current shoot |
Grayish green |
|
|
| |
color in the |
Purple |
|
|
| |
middle portion |
Crimson |
|
|
| |
of a plant |
Brown |
|
|
| |
|
Others |
|
|
| 5 |
Branch color |
Yellow |
Greyed; Green |
Greyed; |
| |
(observation) |
Yellow green |
198B |
Green |
| |
current branch |
Green |
|
198B |
| |
color in the |
Purplish |
|
|
| |
middle portion |
crimson |
|
|
| |
of a plant |
Crimson |
|
|
| |
second year+ |
Brown |
|
|
| |
|
Others |
|
|
| 6 |
Dark spots on |
Absent |
Absent |
Absent |
| |
Branch |
Present |
|
|
| |
(observation) |
|
|
|
| |
presence of dark |
|
|
|
| |
spots on the |
|
|
|
| |
branch |
|
|
|
| 7 |
Branching |
Low |
High |
Medium |
| |
(observation) |
Medium |
|
|
| |
density of |
High |
|
|
| |
branching |
|
|
|
| 8 |
Internode length |
Short |
Short |
Short |
| |
(measurement) |
medium |
|
|
| |
Internode length |
long |
|
|
| |
in the middle |
|
|
|
| |
portion of a plant |
|
|
|
| 9 |
whole shape of |
Lanceolate |
Obovate |
Obovate |
| |
leaves |
Oblanceolate |
|
|
| |
(observation) |
Oblong |
|
|
| |
see Fig. 1 whole |
Elliptical |
|
|
| |
shape of a leaf in |
Ovate |
|
|
| |
the middle |
Obovate |
|
|
| |
portion of a plant |
Orbicular |
|
|
| |
|
Others |
|
|
| 10 |
Shape of leaf |
Acuminate |
Acuminate |
Acuminate |
| |
tip(observation) |
Acute |
|
|
| |
see Fig. 2 Tip |
obtuse |
|
|
| |
shape of a leaf in |
Rotundate |
|
|
| |
the middle |
Others |
|
|
| |
portion of a plant |
|
|
|
| 11 |
Shape of leaf |
Acuminate |
Truncate |
Truncate |
| |
Base |
Acute |
|
|
| |
(observation) |
obtuse |
|
|
| |
see FIG. 2A |
Rotundate |
|
|
| |
and FIG. 2B |
Others |
|
|
| |
Base shape of a |
|
|
|
| |
leaf in the middle |
|
|
|
| |
portion of a plant |
|
|
|
| 12 |
Shape of leaf |
Entire |
Entire |
Entire |
| |
Margin |
others |
|
|
| |
(observation) |
|
|
|
| |
shape of a leaf |
|
|
|
| |
margin in the |
|
|
|
| |
middle portion of |
|
|
|
| |
a plant |
|
|
|
| 13 |
Leaf rolling |
Rolling inward |
Rolling inward |
Rolling |
| |
(observation) |
Flat |
|
inward |
| |
|
Rolling outward |
|
|
| 14 |
Leaf curvature |
In-curved |
Flat |
Flat |
| |
(observation) |
Flat |
|
|
| |
|
Out-curved |
|
|
| 15 |
Leaf margin |
None |
None |
None |
| |
Undulation |
presence |
|
|
| |
(observation) |
|
|
|
| 16 |
Leaf length |
Short |
Long |
Medium |
| |
(measurement) |
Medium |
(about 10-14 cm) |
|
| |
Length from the |
long |
|
|
| |
tip to the base of |
|
|
|
| |
mature leaf |
|
|
|
| 17 |
Leaf width |
Narrow |
Narrow |
Medium |
| |
(measurement) |
Medium |
(about 4-5 cm) |
|
| |
The maximum |
wide |
|
|
| |
width of mature |
|
|
|
| |
leaf |
|
|
|
| 18 |
Leaf thickness |
Thin |
Medium |
Medium |
| |
(observation) |
Medium |
|
|
| |
Thickness of |
Thick |
|
|
| |
mature leaf |
|
|
|
| 19 |
Bud color |
Yellowish |
Grayish green |
Grayish |
| |
(observation) |
white |
179A |
Green |
| |
Color of bud just |
Yellow |
|
191A |
| |
after sprouting |
Yellow green |
|
|
| |
|
Green |
|
|
| |
|
Grayish green |
|
|
| |
|
Crimson |
|
|
| |
|
Others |
|
|
| 20 |
Immature leaf |
Yellowish |
Light Green |
Light Green |
| |
color |
white |
135B |
135B |
| |
(observation) |
Yellow |
|
|
| |
|
Yellow green |
|
|
| |
|
Green |
|
|
| |
|
Grayish green |
|
|
| |
|
pink |
|
|
| |
|
Crimson |
|
|
| |
|
others |
|
|
| 21 |
Presence of |
Absent |
Absent |
Absent |
| |
anthocyanin |
present |
|
|
| |
(observation) |
|
|
|
| |
Coloration by |
|
|
|
| |
anthocyanin on |
|
|
|
| |
the immature leaf |
|
|
|
| |
upperside |
|
|
|
| 22 |
Color of leaf |
Yellow |
Green |
Green |
| |
upperside |
Yellow green |
143B |
146A |
| |
(observation) |
Green |
|
|
| |
Color of mature |
Grayish green |
|
|
| |
leaf upperside |
Purplish |
|
|
| |
|
crimson |
|
|
| |
|
Crimson |
|
|
| |
|
others |
|
|
| 23 |
Color of leaf |
Yellow |
Light Green |
Medium |
| |
lowerside |
Yellow green |
146B |
Green |
| |
(observation) |
Light green |
|
137A |
| |
Color of mature |
Green |
|
|
| |
leaf lowerside |
Dark green |
|
|
| |
|
Grayish green |
|
|
| |
|
Purplish |
|
|
| |
|
crimson |
|
|
| |
|
others |
|
|
| 24 |
Seasonal change |
Unchanged |
Changed |
Changed |
| |
of a mature leaf |
changed |
|
|
| |
(observation) |
|
|
|
| 25 |
Color of leaves in |
Yellow |
Red |
Dull Red to |
| |
autumn |
Orange |
10C -46A |
maroon |
| |
(observation) |
Crimson |
|
61B |
| |
|
others |
|
|
| 26 |
Leaf variegation |
Not variegated |
Not variegated |
Not |
| |
(observation) |
variegated |
|
variegated |
| |
Variegation on |
|
|
|
| |
leaf upperside |
|
|
|
| 27 |
Variegation |
Spotted |
NA |
NA |
| |
pattern |
Splashed |
|
|
| |
(observation) |
Margined |
|
|
| |
Pattern of |
Centered |
|
|
| |
variegation on a |
Blotched |
|
|
| |
leaf upperside |
others |
|
|
| 28 |
Variegation color |
White |
NA |
NA |
| |
(observation) |
Yellowish |
|
|
| |
|
white |
|
|
| |
|
Greenish white |
|
|
| |
|
Yellow |
|
|
| |
|
Yellow Green |
|
|
| |
|
Green |
|
|
| |
|
Crimson |
|
|
| |
|
others |
|
|
| 29 |
seasonal change |
Unchanged |
NA |
NA |
| |
of variegation |
changed |
|
|
| |
color |
|
|
|
| |
(observation) |
|
|
|
| 30 |
Hair on leaf |
None |
None |
None |
| |
upperside |
Low |
|
|
| |
(observation) |
Medium |
|
|
| |
hair density on a |
high |
|
|
| |
mature leaf |
|
|
|
| |
upperside |
|
|
|
| 31 |
Hair on leaf |
None |
None |
None |
| |
lowerside |
Low |
|
|
| |
(observation) |
Medium |
|
|
| |
hair density on a |
high |
|
|
| |
mature leaf |
|
|
|
| |
lowerside |
|
|
|
| 32 |
Petiole length |
Short |
Short |
Medium |
| |
(measurement) |
Medium |
(about 1.5-2.5 |
|
| |
Length from |
Long |
cm.) |
|
| |
the base of blade |
Very long |
|
|
| |
to the base |
|
|
|
| |
petiole |
|
|
|
| 33 |
Petiole width |
Narrow |
Medium |
Medium |
| |
(measurement) |
Medium |
(<8 mm) |
|
| |
The maximum |
wide |
|
|
| |
width of a |
|
|
|
| |
mature leaf |
|
|
|
| |
petiole |
|
|
|
| 34 |
Petiole color |
Yellowish white |
Green |
Green |
| |
(observation) |
Yellow Green |
143B |
143B |
| |
|
Green |
|
|
| |
|
Crimson |
|
|
| |
|
others |
|
|
| 35 |
Inflorescence |
Corymb |
Umbel |
Umbel |
| |
type |
Umbel |
|
|
| |
(observation) |
Head |
|
|
| |
|
others |
|
|
| 36 |
Inflorescence |
Upright |
Upright |
Upright |
| |
direction |
Horizontal |
|
|
| |
(observation) |
pendulous |
|
|
| 37 |
Inflorescence |
Small |
Medium |
Medium |
| |
diameter |
Medium |
(diagonal mean |
|
| |
(observation) |
large |
length including |
|
| |
|
|
bracts = 7.4 cm.; |
|
| |
|
|
mean width not |
|
| |
|
|
including bracts = |
|
| |
|
|
5.3 cm) |
|
| 38 |
Flower diameter |
Small |
Small |
Small |
| |
(measurement) |
Medium |
|
|
| |
|
Large |
|
|
| |
|
Very large |
|
|
| 39 |
Floret diameter |
Small |
Small |
Small |
| |
(measurement) |
Medium |
|
|
| |
|
Large |
|
|
| 40 |
Floret color |
White |
Yellow |
Greenish |
| |
(observation) |
Yellowish white |
150C |
yellow |
| |
|
Greenish yellow |
|
150C |
| |
|
Light Green |
|
|
| |
|
others |
|
|
| 41 |
Bract type |
Single |
83% are FUSED; |
Single and |
| |
(observation) |
Semi-double |
17% are Single |
unfused |
| |
|
Full-double |
(see Table 3) |
|
| |
|
others |
|
|
| 42 |
Uniformity of |
Not uniform |
Not uniform |
Uniform |
| |
bract size |
uniform |
|
|
| |
(observation) |
|
|
|
| 43 |
Bract over- |
Not overlap |
No overlap -- |
Slightly |
| |
lapping |
Slightly |
fused |
overlap |
| |
(observation) |
overlap |
|
|
| |
|
overlap |
|
|
| 44 |
Bract orientation |
Ascending |
Recurved, |
Horizontal |
| |
(observation) |
Horizontal |
Reflexed, or Flat |
|
| |
|
arching |
|
|
| 45 |
Bract rolling |
Rolling inward |
Varies (may roll |
Horizontal |
| |
(observation) |
Horizontal |
inward or |
|
| |
|
Rolling outward |
outward |
|
| 46 |
Degree of bract |
Weak |
strong |
Weak |
| |
rolling |
Medium |
|
|
| |
(observation) |
strong |
|
|
| 47 |
Bract curvature |
In-curved |
Varies |
Horizontal |
| |
(observation) |
Horizontal |
(can be recurved, |
|
| |
|
Out-curved |
flat, or reflexed) |
|
| 48 |
Bract twisting |
None |
None |
None |
| |
(observation) |
Weak |
|
|
| |
|
Medium |
|
|
| |
|
strong |
|
|
| 49 |
Whole shape of |
Oblong |
Obovate |
|
| |
bracts |
Elliptical |
Ovate |
|
| |
(observation) |
Ovate |
|
|
| |
|
Obovate |
|
|
| |
|
Orbicular |
|
|
| |
|
others |
|
|
| 50 |
Shape of bract |
Acuminate |
Acuminate |
|
| |
apex |
Acute |
Acuminate |
|
| |
(observation) |
Abtuse |
|
|
| |
|
Rotundate |
|
|
| |
|
Emarginated |
|
|
| |
|
others |
|
|
| 51 |
Bract length |
Short |
Medium |
Medium |
| |
(measurement) |
Medium |
|
|
| |
|
Long |
|
|
| 52 |
Bract width |
Narrow |
FUSED |
Medium |
| |
(measurement) |
Medium |
|
|
| |
|
wide |
|
|
| 53 |
Number of bracts |
Few |
FUSED, but 4 |
Medium(4) |
| |
(measurement) |
Medium(4) |
|
|
| |
|
Many(over 10) |
|
|
| 54 |
Bract color |
(color of bract |
155A |
155A |
| |
(measurement) |
in full bloom) |
(immature: 157A) |
|
| 55 |
Bract variegation |
Not variegated |
Not variegated |
Not |
| |
(observation) |
variegated |
|
variegated |
| 56 |
Variegation |
Margined |
NA |
NA |
| |
pattern |
Splashed |
|
|
| |
(observation) |
Bi-colored |
|
|
| |
|
Spotted |
|
|
| |
|
shaded |
|
|
| |
|
others |
|
|
| 57 |
Variegation |
(Color of |
NA |
NA |
| |
color |
variegation |
|
|
| |
(measurement) |
pattern of a |
|
|
| |
|
bract in full |
|
|
| |
|
bloom) |
|
|
| 58 |
Pistil color |
White |
Yellow green |
Yellow |
| |
(observation) |
Yellowish |
Not coded |
green |
| |
|
white |
|
Not coded |
| |
|
Greenish white |
|
|
| |
|
Yellow green |
|
|
| |
|
Green |
|
|
| |
|
others |
|
|
| 59 |
Stigma color |
White |
Dark Green |
Green |
| |
(observation) |
Yellowish |
(Not Coded) |
(Not |
| |
|
white |
|
Coded) |
| |
|
Greenish white |
|
|
| |
|
Yellow green |
|
|
| |
|
Green |
|
|
| |
|
others |
|
|
| 60 |
Peduncle |
Thin |
Medium |
Medium |
| |
thickness |
Medium |
|
|
| |
(measurement) |
thick |
|
|
| 61 |
Peduncle length |
Short |
Long |
Medium |
| |
(measurement) |
Medium |
(mean of 6.8 cm) |
|
| |
|
long |
|
|
| 62 |
Peduncle color |
Yellowish white |
Yellow green |
Yellow |
| |
(observation) |
yellow |
144B |
green |
| |
|
Yellow green |
|
144B |
| |
|
Green |
|
|
| |
|
Crimson |
|
|
| |
|
brown |
|
|
| |
|
others |
|
|
| 63 |
Fruit shape |
Elliptical |
Globose |
Globose |
| |
(observation) |
Ovate |
|
|
| |
|
Obovate |
|
|
| |
|
Globose |
|
|
| |
|
others |
|
|
| 64 |
Fruit length |
Short |
Medium |
Medium |
| |
(measurement) |
Medium |
(about 4 cm) |
|
| |
|
long |
|
|
| 65 |
Fruit width |
Narrow |
Medium |
Medium |
| |
(measurement) |
Medium |
(about 4 cm) |
|
| |
|
wide |
|
|
| 66 |
Fruit color |
Yellow |
Unripe:143B; |
Ripe: 33B |
| |
(observation) |
Orange |
Ripe 33B to 43A. |
to 44A |
| |
|
Crimson |
Highly variable |
Highly |
| |
|
Purplish black |
depending on |
variable |
| |
|
Black |
ripeness |
depending |
| |
|
others |
|
on ripeness |
| 67 |
Fragrance |
Absent |
Absent |
Absent |
| |
(observation) |
present |
|
|
| 68 |
Seed fertility |
Sterile |
High |
High |
| |
(observation) |
Low |
|
|
| |
|
Medium |
|
|
| |
|
high |
|
|
| 69 |
Time to the first |
Early |
Medium |
Medium |
| |
flowering |
Medium |
(April-mid-May) |
|
| |
(observation) |
late |
|
|
| 70 |
Blooming habit |
Few |
Many |
Many |
| |
(observation) |
Medium |
|
|
| |
|
many |
|
|
| 71 |
Flowering |
One season |
One season |
One season |
| |
season |
flowering |
flowering |
flowering |
| |
(observation) |
Recurrent |
|
|
| |
|
blooming |
|
|
| |
|
others |
|
|
| 72 |
Flowering time |
Early |
Medium |
Medium |
| |
(observation) |
Medium |
|
|
| |
|
late |
|
|
| 73 |
Deciduous or |
Deciduous |
Deciduous |
Deciduous |
| |
evergreen |
Half-deciduous |
|
|
| |
(observation) |
evergreen |
|
|
| 74 |
Cold hardiness |
Weak |
Medium |
Medium |
| |
(observation) |
Medium |
(to −20° C.—no |
|
| |
|
strong |
effect) |
|
| 75 |
Heat tolerance |
Weak |
Strong |
Strong |
| |
(observation) |
Medium |
(to 40° C.—no |
|
| |
|
strong |
effect) |
|
| 76 |
Pest resistance |
Weak |
Strong |
Strong |
| |
(observation) |
Medium |
(no specific pests |
|
| |
|
strong |
noted; resistant to |
|
| |
|
|
dogwood |
|
| |
|
|
anthracnose and |
|
| |
|
|
powdery mildew) |
|
| 77 |
Disease |
Weak |
Strong |
Strong |
| |
resistance |
Medium |
|
|
| |
(observation) |
strong |
|
|
| 78 |
|
|
|
|
| 79 |
Bark color |
n/a |
Grayed-Green |
Not |
| |
|
|
198B |
observed |
| 80 |
Bark texture |
n/a |
Smooth |
Not |
| |
|
|
|
observed |
| 81 |
Angle of |
n/a |
20°-30° from |
Not |
| |
Emerging |
|
vertical stem |
observed |
| |
Branches |
|
|
|
| 82 |
Time to first leaf |
n/a |
Mid- to late-April |
Not |
| |
bud burst |
|
|
observed |
| 83 |
Leaf Vein color |
n/a |
Green-Greyed |
Not |
| |
|
|
192A |
observed |
| 84 |
Immature Leaf |
n/a |
Similar to fully |
Not |
| |
color |
|
expanded leaf |
observed |
| |
|
|
color |
|
| 85 |
Bract base |
n/a |
Truncate |
Not |
| |
|
|
|
observed |
| 86 |
Bract margin |
n/a |
Entire |
Not |
| |
|
|
|
observed |
| 87 |
Vestiture |
n/a |
Puberulous, |
Not |
| |
|
|
reticulate |
observed |
| 88 |
Flower/ |
n/a |
Mean = 34 |
Not |
| |
inflorescensce |
|
|
observed |
| |
number |
|
|
|
| 89 |
Seed shape |
n/a |
Flattened along |
Not |
| |
|
|
length |
observed |
| 90 |
Seed color |
n/a |
Greyed Yellow |
Not |
| |
|
|
162D |
observed |
| 91 |
Seed number |
n/a |
0-17 per fruit |
Not |
| |
|
|
|
observed |
| 92 |
Bloom duration |
n/a |
3-5 weeks |
Not |
| |
|
|
(dried, dead |
observed |
| |
|
|
bracts are retained |
|
| |
|
|
as a “collar” on |
|
| |
|
|
peduncle until |
|
| |
|
|
fruit fall in |
|
| |
|
|
Autumn) |
|
| 93 |
Time of Fruit |
n/a |
Begins mid- to |
Not |
| |
Ripening |
|
late-August |
observed |
| |
|
|
through October |
|
| 94 |
Trunk diameter |
n/a |
18 cm at 15 years |
Not |
| |
(at approximately |
|
of age |
observed |
| |
breast height) |
|
|
|
| 95 |
Anther color |
n/a |
Greyed-purple |
Not |
| |
|
|
N186 |
observed |
| 96 |
Flower petal |
n/a |
Yellow-green |
Not |
| |
color |
|
145C |
observed |
| 97 |
Style/Stigma |
n/a |
Inconspicuous |
Not |
| |
description |
|
|
observed |
| |
- Botanical classification: Cornus kousa ‘Pam's Mountain Bouquet’.
- Unique features: This tree features heavy flowering and exhibits fused bracts. About 82% of all bracts on the cultivar exhibit some degree of fusion (one side, two sides or three to four sides being fused; see data in Table 3).
| TABLE 3 |
| |
| Cornus kousa ‘Pam's Mountain Bouquet’ |
| bract characteristics. |
| |
|
One side |
Two sides |
3-4 sides |
| Year |
Not fused |
fused |
fused |
fused |
| |
| 2008 (n = 50) |
7 |
(14%) |
3 (6%) |
12 |
(24%) |
28 (56%) |
| 2009 (n = 50) |
10 |
(20%) |
1 (2%) |
4 |
(8%) |
35 (70%) |
| 2011 (n = 50) |
9 |
(18%) |
5 (10%) |
9 |
(18%) |
27 (54%) |
| Mean |
9 |
(18%) |
3 (6%) |
8 |
(16%) |
30 (60%) |
| |
- All categories of fused bracts=82%.
- Disease susceptibility: None noted. Powdery mildew caused by Erisphe pulchra and dogwood anthracnose Discula destructiva were not observed. Nearby C. florida (flowering dogwood) trees were heavily infested with powdery mildew, but not dogwood anthracnose.
- Insect damage: None noted.
REFERENCES
- Auge, R. M., M. T. Windham, J. L. Moore, W. T. Witte, E. Kubikova, W. E. Klingeman, R. M. Evans, J. H. Reiss, P. C. Flanagan, and A. M. Saxton. 2002. Leaf curl and water relations of kousa dogwoods showing resistance to summer stress. J. Environ. Hort. 20 (3):143-147.
- Wadl, P. A., X. Wang, A. N. Trigiano, J. A. Skinner, M. T. Windham, T. A. Rinehart, S. M. Reed, V. R. Pantalone and R N. Trigiano. 2008. Molecular identification key for cultivars and lines of Cornus florida and C. kousa based on microsatellite loci. J. Amer. Soc. Hort. Sci. 133 (6): 783-793.
- Wadl, P. W., X. Wang, B. E. Scheffler, T. A. Rinehart, and R. N. Trigiano. 2008. Microsatellites from kousa dogwood (Cornus kousa). Molec. Ecol. Res. 8:780-782. DOI:10.1111/j.1471-8286.2007.0262.x.
- Wadl, P. W., Windham, M. T., Evans, R., Trigiano, R. N. 2014. Three New Cultivars of Cornus kousa: Empire, Pam's Mountain Bouquet, and Red Steeple. HortScience 49 (9):1230-1233.