USPP15792P3 - Black walnut tree named ‘Beineke 8’ - Google Patents
Black walnut tree named ‘Beineke 8’ Download PDFInfo
- Publication number
- USPP15792P3 USPP15792P3 US10/141,092 US14109202V USPP15792P3 US PP15792 P3 USPP15792 P3 US PP15792P3 US 14109202 V US14109202 V US 14109202V US PP15792 P3 USPP15792 P3 US PP15792P3
- Authority
- US
- United States
- Prior art keywords
- black walnut
- beineke
- tree
- selection
- progeny
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime, expires
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/54—Leguminosae or Fabaceae, e.g. soybean, alfalfa or peanut
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/08—Fruits
Definitions
- BW420 a seedling progeny of BW 205 (unpatented) which is a progeny of BW 97 (unpatented) in records maintained by the applicant on the performance of the selection and grafts made from the selection and will be known henceforth as ‘Beineke 8’.
- the male parent is unknown, as is generally the case with black walnut trees (Beineke, 1989).
- a new and distinct cultivar of black walnut tree ( Juglans nigra L.) is distinctly characterized by rapid growth rate and fairly strong central stem tendency, thereby producing good timber qualities, the trait of commercial interest. ‘Beineke 8’ was 22 years old when described at a location near West Lafayette, Ind.
- FIG. 1 is a photograph showing the timber form of ‘Beineke 8’.
- FIG. 2 is a photograph showing the leaves of ‘Beineke 8’.
- FIG. 3 is a photograph showing the nuts of ‘Beineke 8’.
- Diameter depends on age and size of tree, varies from 1 ⁇ 2′′ to 12′′, bark color varies from grays to browns.
- DNA was isolated from the leaves of ‘Beineke 8.’
- DNA was isolated from the leaves of 10 black walnut trees obtained from Walter Beineke using CTAB extraction buffer (50 mM TRIS-HCL, pH 8.0, 20 mM EDTA, pH 8.0, 0.7 M NaCl, 0.4 M LiCl, 2% SDS, 2% TAB, nd 1% PVP). After isolation the DNA from each tree was quantified and diluted with nanopure distilled water to a final concentration of 5 ng/ ⁇ L. The samples were stored in 96-well plates at 20° C.
- PCR amplification was for 30 cycles of 94° C. for 20 sec, 55° C.
- Electrophoresis was at 3,000 V, 60 mA, 200 Watts, 50° C. for hours using an ABI377 (Perkin Elmer) with 36 cm plates and 0.2 mm spacers. The resulting data was analyzed using ABI's GeneScan 3.1.2 and Genotyper 2.5 (Perkin Elmer). Microsatellite sizes were checked against previously published standards and verified by a second independent analysis. The “fingerprint” is the collection of microsatellite allele sizes at each locus for each tree.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Physiology (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A new and distinct cultivar of black walnut tree (Juglans nigra L.) which is distinctly characterized by rapid growth rate, fairly strong central stem tendency, thereby producing good timber qualities. The new variety has good nut bearing qualities. Nut crops are abundant and annual. This new variety of black walnut tree (Juglans nigra L.) was discovered by the applicant near West Lafayette, Ind. in a black walnut planting of seedling progeny from a previously selected tree for outstanding timber producing potential. This selection, has been designated as BW420, a seedling progeny of BW 205 (unpatented) which is a progeny of BW 97 (unpatented) in records maintained by the applicant on the performance of the selection and grafts made from the selection will be known henceforth as ‘Beineke 8’.
Description
Latin name of the genus and species: Juglans nigra L.
A new variety of black walnut tree (Juglans nigra L.) was discovered by the applicant near West Lafayette, Ind. in a black walnut planting of seedling progeny from previously selected trees for outstanding timber producing potential. This selection has been designated as BW420, a seedling progeny of BW 205 (unpatented) which is a progeny of BW 97 (unpatented) in records maintained by the applicant on the performance of the selection and grafts made from the selection and will be known henceforth as ‘Beineke 8’. The male parent is unknown, as is generally the case with black walnut trees (Beineke, 1989).
A new and distinct cultivar of black walnut tree (Juglans nigra L.) is distinctly characterized by rapid growth rate and fairly strong central stem tendency, thereby producing good timber qualities, the trait of commercial interest. ‘Beineke 8’ was 22 years old when described at a location near West Lafayette, Ind.
After the original clone was selected, and assigned an identity number of BW420 the aforesaid tree was reproduced by collecting scions from it and grafting these onto common black walnut rootstocks at American Forestry Technologies, Inc., West Point, Ind. These asexual reproductions ran true to the originally discovered tree and to each other in all respects. Because neither BW 97 nor BW 205 were planted on the same site and were no longer available, further comparisons with the parent tree were not possible.
Color values used were from the Munsell Color Chart for Plant Tissues. However, color is too dependent on weather conditions and fertilization to be consistent or distinctive. For example, leaves can be made a deeper green by applying nitrogen. Walnut tree leaves turn yellow as the season progresses, especially if there is a lack of rainfall. As black walnut meats dry, they become darker. Simply being on the ground for a week causes the outer shell to darken. Bark color involves many shades of gray through brown and black.
‘Beineke 8’ is hardy in zones 4, 5, 6, 7, and 8.
The botanical details of this new and distinct variety of walnut tree are as follows:
- Tree:
-
- Size.—Large, 67 ft. at 22 years; crown diameter is 26 ft.
- Vigor.—Vigorous.
- Growth rate.—Very rapid, 20% larger in diameter than the average of Purdue 1 (U.S. Plant Pat. No. 4,543) grafts, respectively, planted the same year on the same land. Diameter growth rate (at 4½ feet above the ground) averages 0.546 inches per year, over 22 years about 12 inches.
- Form.—Good timber form, not as good as Purdue 1, (U.S. Plant Pat. No. 4,543) 34% poorer than average of the entire planting, on a rating scale of 1 (excellent) to 5 (very poor) — ‘Beineke 8’ averages 2. 33% straighter than the first generation of the parent tree, BW 97 and the same straightness as second generation parent tree BW 205. Stem form was obtained by subjectively rating the straightness of the main stem on a scale of 1 to 5 with 1 representing a perfectly straight stem; 2, slight crook or deviation of the central stem; 3, about average straightness; 4, several severe crooks or a single fork; and 5, a very crooked, forked and/or leaning central stem. The trees of the present invention are grown in plantations, not open fields (not natural stands). In plantations, trees are upright and have no distinctive or characteristic crown shape because all branches are seeking to grow upwards.
-
- Branches:
Diameter depends on age and size of tree, varies from ½″ to 12″, bark color varies from grays to browns.
- Leaves:
-
- Compound leaves.—Size — Much shorter than average; average length — 11.83″.
- Leaflets.—Size — Average; average length — 3.83″; average leaf width — 3.10″; average number of leaflets — 15.0 — lanceolate; acutely pointed; rounded; petioles are short.
- Thickness.—Thin; Texture — smooth; Margin — serrated; Color — Topside — dark green, 2.5 G 4/4 on the Munsell Color Chart for Plant Tissues; Underside — light green, about 5 GY 5/4 on the Munsell Color Chart for Plant Tissues.
- Anthracnose resistance.—Good.
-
- Nut:
-
- Size.—Medium; average length — 1.22″; average diameter in suture plane — 1.20″; average diameter cheek to cheek — 1.42″.
- Uniformity of size.—Not much variation.
- Form.—Rounded; flattened in suture plane; see FIG. 3.
- Blossom end.—Flattened.
- Basal end.—Rounded.
- Thickness of shell.—Very thick.
- Ridges.—Rounded off; not sharp.
- Color.—Mottled, 5 YR 3/2 and 2/5 YR 3/4 on the Munsell Color Chart for Plant Tissues.
-
- Flowering habit:
-
- Age at which trees start producing catkins.—Early. It takes about 4-5 years to flower but the flower number varies with the age of the tree.
- Number of catkins produced.—Abundant.
- Age at which tree starts producing pistillate flowers.—Early, 4-5 years.
- Number of pistillate flowers produced by young trees.—Abundant.
- Number of pistillate flowers produced by mature trees.—Abundant.
- Lateral shoots producing pistillate flowers.—None.
- Number of pistillate flowers per inflorescence.—2 to 6.
-
- Flower season:
Flowers typically in May in Indiana. There are probably 1 - million pollen per catkin. Female flowers are about 1/16″ long and grow to two “pollen pick up points” which subsequently break apart. Pollen exits as “dust” which is not feasible to quantitate.
- Nut crop:
-
- Bearing.—Annual.
- Productivity.—Heavy.
- Ripening period.—Very early.
- Evenness of maturity (period between first and last nuts are ready for harvest).—Uneven.
- Quality.—Good.
- Distribution of nuts on tree.—Throughout.
- Color.—Mottled, 5YR.
-
DNA “fingerprint” for identification of ‘Beineke 8:’
DNA was isolated from the leaves of ‘Beineke 8.’ For purposes of DNA fingerprinting, nine highly polymorphic loci from a suite of microsatellites developed by Woeste et al. (2002) were chosen. Microsatellites sizes were checked against previously published standards and verified by a second independent analysis. The “fingerprint” is the collection of microsatellite allele sizes at each locus for ‘Beineke 8.’
DNA was isolated from the leaves of 10 black walnut trees obtained from Walter Beineke using CTAB extraction buffer (50 mM TRIS-HCL, pH 8.0, 20 mM EDTA, pH 8.0, 0.7 M NaCl, 0.4 M LiCl, 2% SDS, 2% TAB, nd 1% PVP). After isolation the DNA from each tree was quantified and diluted with nanopure distilled water to a final concentration of 5 ng/μL. The samples were stored in 96-well plates at 20° C.
For purposes of DNA fingerprinting, nine highly polymorphic loci from a suite of microsatellites developed by Woeste et al. (2002) were chosen. Amplification of each locus was performed with an MJ Research Tetrad Thermocycler (Waltham, Mass.) using 10 μL reactions in 96-well plates. The PCR reaction mix contained 2 μL of the aforementioned black walnut DNA, 5 μL Sigma Taq ReadyMix (Sigma Aldrich, St. Louis, Mo.), 0.4 μL of a 20 pmol mixture of forward and reverse fluorescence labeled primer, and 3 μL PCR grade water supplied with the Sigma ReadyMix. PCR amplification was for 30 cycles of 94° C. for 20 sec, 55° C. for 30 sec, and 72° C. for 1 min. All primers were annealed at 55° C. The products were then held at 4° C. until aliquots could be loaded into 6% Long Ranger (polyacrylamide) denaturing gels (BMA, Rockland, Me.). For each individual 0.5 μL PCR product was added to 0.75 μL blue dextran and 0.25 μL of CXR 350 bp Ladder Standard (Promega, Fitchburg Center, Wis.) in a new 96-well 1 late. The samples were denatured for 2 min at 95° C. and located onto a CAL96 96-well laminated membrane comb (The Gel Company, San Francisco, Calif.). Electrophoresis was at 3,000 V, 60 mA, 200 Watts, 50° C. for hours using an ABI377 (Perkin Elmer) with 36 cm plates and 0.2 mm spacers. The resulting data was analyzed using ABI's GeneScan 3.1.2 and Genotyper 2.5 (Perkin Elmer). Microsatellite sizes were checked against previously published standards and verified by a second independent analysis. The “fingerprint” is the collection of microsatellite allele sizes at each locus for each tree.
| Primer Sequences |
| Locus | Forward | Reverse |
| WGA2 | GACGACGAAGGTGTACGGAT | GTACGGCTCTCCTTGCAGTC |
| (SEQ ID NO:1) | (SEQ ID NO:10) | |
| WGA6 | CCATGAAACTTCATGCGTTG | CATCCCAAGCGAAGGTTG |
| (SEQ ID NO:2) | (SEQ ID NO:11) | |
| WGA24 | TCCCCCTGAAATCTTCTCCT | TTCTCGTGGTGCTTGTTGAG |
| (SEQ ID NO:3) | (SEQ ID NO:12) | |
| WGA32 | CTCGGTAAGCCACACCAATT | ACGGGCAGTGTATGCATGTA |
| (SEQ ID NO:4) | (SEQ ID NO:13) | |
| WG33 | TGGTCTGCGAAGACACTGTC | GGTTCGTCGTTTGTTGACCT |
| (SEQ ID NO:5) | (SEQ ID NO:14) | |
| WGA86 | ATGCCTCATCTCCATTCTGG | TGAGTGGCAATCACAAGGAA |
| (SEQ ID NO:6) | (SEQ ID NO:15) | |
| WGA89 | ACCCATCTTTCACGTGTGTG | TGCCTAATTAGCAATTTCCA |
| (SEQ ID NO:7) | (SEQ ID NO:16) | |
| WGA90 | CTTGTAATCGCCCTCTGCTC | TACCTGCAACCCGTTACACA |
| (SEQ ID NO:8) | (SEQ ID NO:17) | |
| WGA97 | GGAGAGGAAAGGAATCCAAA | TTGAACAAAAGGCCGTTTTC |
| (SEQ ID NO:9) | (SEQ ID NO:18) | |
The best interpretation of the current data indicates that the probability that any other black walnut tree would have the collection of microsatellite allele sizes listed below is less than 1 in 10−17.
Sizes (bp) of microsatellites at 9 loci used to fingerprint ‘Beineke 8’ (2 alleles at each locus)
| WGA2 | WGA6 | WGA24 | WGA32 | WGA90 |
| 132 | 164 | 140 | 158 | 234 | 242 | 181 | 187 | 152 | 156 |
| WGA86 | WGA97 | WGA33 | WGA89 |
| 216 | 238 | 155 | 159 | 232 | 232 | 201 | 213 |
Beineke, Walter F. (1989) Twenty years of black walnut genetic improvement at Purdue University North. J. Appl. For. 6:68-71.
Woeste, K., Burns, R., Rhodes, O., and Michler, C. (2002) Thirty polymorphic nuclear microsatellite loci from black walnut. Journal of Heredity, 93(1):58-60.
Claims (1)
1. A new and distinct variety of black walnut tree named ‘Beineke 8’ substantially as illustrated and described, which has good timber quality, is flat growing, has fairly strong central stem tendency, no sweep, and few crooks.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/141,092 USPP15792P3 (en) | 2002-05-08 | 2002-05-08 | Black walnut tree named ‘Beineke 8’ |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/141,092 USPP15792P3 (en) | 2002-05-08 | 2002-05-08 | Black walnut tree named ‘Beineke 8’ |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| US20030213033P1 US20030213033P1 (en) | 2003-11-13 |
| USPP15792P3 true USPP15792P3 (en) | 2005-06-14 |
Family
ID=29399570
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/141,092 Expired - Lifetime USPP15792P3 (en) | 2002-05-08 | 2002-05-08 | Black walnut tree named ‘Beineke 8’ |
Country Status (1)
| Country | Link |
|---|---|
| US (1) | USPP15792P3 (en) |
Citations (34)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4132A (en) * | 1845-08-04 | Manufacture of keyed buckles | ||
| US4388A (en) * | 1846-02-20 | Mode of operating safety-valves | ||
| US4389A (en) * | 1846-02-20 | brummonb | ||
| US4405A (en) * | 1846-03-07 | Improvement | ||
| US4543A (en) * | 1846-05-28 | olute | ||
| US4542A (en) * | 1846-05-28 | Balancing valves of steam-engines | ||
| US4614A (en) * | 1846-07-02 | Cooking-stove | ||
| US4954A (en) * | 1847-02-05 | Floating dry-dock | ||
| US4955A (en) * | 1847-02-05 | Machinery for planing slats | ||
| US4964A (en) * | 1847-02-09 | Mariner s time-compass | ||
| US4966A (en) * | 1847-02-10 | Barbel machinery | ||
| US4968A (en) * | 1847-02-13 | Spinal elevator | ||
| US4971A (en) * | 1847-02-20 | Fire-escape | ||
| US6973A (en) * | 1849-12-25 | Improvement in breech-loading fire-arms | ||
| US9906A (en) * | 1853-08-02 | Machinery foe | ||
| US9924A (en) * | 1853-08-09 | Cojrn-sheller | ||
| US9925A (en) * | 1853-08-09 | Printing-press | ||
| USPP4132P (en) | 1977-01-04 | 1977-10-25 | Olan R. Genn | Walnut tree |
| USPP4389P (en) | 1978-04-21 | 1979-02-27 | The Regents Of The University Of California | Walnut tree |
| USPP4388P (en) | 1978-04-21 | 1979-02-27 | The Regents Of The University Of California | Walnut tree |
| USPP4405P (en) | 1978-04-21 | 1979-04-10 | The Regents Of The University Of California | Walnut tree |
| USPP4543P (en) | 1978-09-05 | 1980-06-10 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4542P (en) | 1978-09-05 | 1980-06-10 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4614P (en) | 1978-09-05 | 1981-01-06 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4955P (en) | 1981-04-16 | 1982-11-23 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4954P (en) | 1981-04-16 | 1982-11-23 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4964P (en) | 1981-04-16 | 1982-12-14 | Purdue Research Foundation | Black walnut tree |
| USPP4966P (en) | 1981-04-16 | 1982-12-21 | Purdue Research Foundation | Black walnut tree |
| USPP4968P (en) | 1981-04-16 | 1982-12-28 | Purdue Research Foundation | Black walnut tree |
| USPP4971P (en) | 1981-04-16 | 1983-01-04 | Purdue Research Foundation | Black walnut tree |
| USPP6973P (en) | 1988-09-14 | 1989-08-08 | Walnut tree named Vester | |
| USPP9906P (en) | 1996-03-18 | 1997-06-03 | Hammons Products | Black walnut tree named HPC-148 |
| USPP9924P (en) | 1996-03-18 | 1997-06-17 | Charles Sheppard | Black walnut tree names STW-13 |
| USPP9925P (en) | 1996-03-18 | 1997-06-17 | Hammons Products | Black walnut tree named HPC-120 |
-
2002
- 2002-05-08 US US10/141,092 patent/USPP15792P3/en not_active Expired - Lifetime
Patent Citations (34)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4132A (en) * | 1845-08-04 | Manufacture of keyed buckles | ||
| US4388A (en) * | 1846-02-20 | Mode of operating safety-valves | ||
| US4389A (en) * | 1846-02-20 | brummonb | ||
| US4405A (en) * | 1846-03-07 | Improvement | ||
| US4543A (en) * | 1846-05-28 | olute | ||
| US4542A (en) * | 1846-05-28 | Balancing valves of steam-engines | ||
| US4614A (en) * | 1846-07-02 | Cooking-stove | ||
| US4954A (en) * | 1847-02-05 | Floating dry-dock | ||
| US4955A (en) * | 1847-02-05 | Machinery for planing slats | ||
| US4964A (en) * | 1847-02-09 | Mariner s time-compass | ||
| US4966A (en) * | 1847-02-10 | Barbel machinery | ||
| US4968A (en) * | 1847-02-13 | Spinal elevator | ||
| US4971A (en) * | 1847-02-20 | Fire-escape | ||
| US6973A (en) * | 1849-12-25 | Improvement in breech-loading fire-arms | ||
| US9906A (en) * | 1853-08-02 | Machinery foe | ||
| US9924A (en) * | 1853-08-09 | Cojrn-sheller | ||
| US9925A (en) * | 1853-08-09 | Printing-press | ||
| USPP4132P (en) | 1977-01-04 | 1977-10-25 | Olan R. Genn | Walnut tree |
| USPP4389P (en) | 1978-04-21 | 1979-02-27 | The Regents Of The University Of California | Walnut tree |
| USPP4388P (en) | 1978-04-21 | 1979-02-27 | The Regents Of The University Of California | Walnut tree |
| USPP4405P (en) | 1978-04-21 | 1979-04-10 | The Regents Of The University Of California | Walnut tree |
| USPP4543P (en) | 1978-09-05 | 1980-06-10 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4542P (en) | 1978-09-05 | 1980-06-10 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4614P (en) | 1978-09-05 | 1981-01-06 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4955P (en) | 1981-04-16 | 1982-11-23 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4954P (en) | 1981-04-16 | 1982-11-23 | Purdue Research Foundation | Distinct variety of black walnut tree |
| USPP4964P (en) | 1981-04-16 | 1982-12-14 | Purdue Research Foundation | Black walnut tree |
| USPP4966P (en) | 1981-04-16 | 1982-12-21 | Purdue Research Foundation | Black walnut tree |
| USPP4968P (en) | 1981-04-16 | 1982-12-28 | Purdue Research Foundation | Black walnut tree |
| USPP4971P (en) | 1981-04-16 | 1983-01-04 | Purdue Research Foundation | Black walnut tree |
| USPP6973P (en) | 1988-09-14 | 1989-08-08 | Walnut tree named Vester | |
| USPP9906P (en) | 1996-03-18 | 1997-06-03 | Hammons Products | Black walnut tree named HPC-148 |
| USPP9924P (en) | 1996-03-18 | 1997-06-17 | Charles Sheppard | Black walnut tree names STW-13 |
| USPP9925P (en) | 1996-03-18 | 1997-06-17 | Hammons Products | Black walnut tree named HPC-120 |
Non-Patent Citations (9)
| Title |
|---|
| Appleton, Bonnie, et al. (2000) "Trees for problem Landscape Sites-The Walnut Tree: Allelopathic Effects and Tolerant Plants" Virginia State University Publication No. 430-021. |
| Beineke, Walter F. (1989) "Twenty Years of Black Walnut Genetic Improvement at Purdue University" NJAF 6:68-71. |
| Coladonato, Milo (1991) "Juglans Nigra" 1-11. |
| Esser, Lora. (1993) "Juglans Californica" 1-11. |
| Pavek, Diane S. (1993) "Juglans Major" 1-13. |
| Tirmenstein, D.S. (1990) "Juglans Microcarpa" 1-11. |
| Website: http://virual.clemson.edu/groups/FieldOps/Cgs/walnut.htm: printed Aug. 30, 2001: pp. 1-3. |
| Website: http://www.treeguide.com/naspecies.asp?treeid=junigrl: printed Aug. 30, 2001: pp. 1-11. |
| Woeste, K., et al. (2002) "Thirty Polymorphic Nuclear Microsatellite Loci From Black Walnut" The Journal of Heredity 93(1):58-60. |
Also Published As
| Publication number | Publication date |
|---|---|
| US20030213033P1 (en) | 2003-11-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mehlenbacher et al. | Hazelnut breeding | |
| Sansavini et al. | Sweet cherry breeding programs in Europe and Asia | |
| Moreno et al. | The performance of Adara as a cherry rootstock | |
| Pal et al. | The influence of rootstock on the growth and fructification of cherry cultivars in a high density cultivation system | |
| USPP9906P (en) | Black walnut tree named HPC-148 | |
| Conner et al. | Muscadine grape breeding | |
| USPP14777P3 (en) | Black walnut tree named ‘Beineke 4’ | |
| Hormaza et al. | Pistachio | |
| USPP14839P3 (en) | Black walnut tree named ‘Beineke 10’ | |
| USPP14978P3 (en) | Black walnut tree named ‘Beineke 6’ | |
| USPP14829P3 (en) | Black walnut tree named ‘Beineke 5’ | |
| USPP15079P3 (en) | Black walnut tree named ‘Beineke 1’ | |
| Khanazarov et al. | Genetic resources of Pistacia vera L. in Central Asia | |
| USPP15792P3 (en) | Black walnut tree named ‘Beineke 8’ | |
| USPP15728P3 (en) | Black walnut tree named ‘Beineke 9’ | |
| USPP17125P3 (en) | Black walnut tree named “Beineke 12” | |
| USPP15284P3 (en) | Black walnut tree named ‘Beineke 3’ | |
| USPP17507P3 (en) | Black walnut tree named ‘Beineke 11’ | |
| USPP15283P3 (en) | Black walnut tree named ‘Beineke 2’ | |
| USPP17358P3 (en) | Black walnut tree named ‘Beineke 14’ | |
| USPP17124P3 (en) | Black walnut tree named ‘Beineke 13’ | |
| USPP15238P3 (en) | Black walnut tree named ‘Beineke 7’ | |
| USPP9511P (en) | Hops named `Furano No. 18` | |
| Stafne et al. | Grapevine breeding in the southern United States | |
| BUJDOSÓ et al. | Evalation of the novel bred persian walnut genotypes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: AMERICAN FORESTRY TECHNOLOGIES, INC., INDIANA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:BEINEKE, WALTER F.;REEL/FRAME:012959/0184 Effective date: 20020528 |
|
| AS | Assignment |
Owner name: ARBORAMERICA, INC., INDIANA Free format text: CHANGE OF NAME;ASSIGNOR:AMERICAN FORESTRY TECHNOLOGIES, INC.;REEL/FRAME:019122/0816 Effective date: 20061117 |