US9783788B2 - Porcine pseudorabies virus (PRV)-YF strain and its application - Google Patents

Porcine pseudorabies virus (PRV)-YF strain and its application Download PDF

Info

Publication number
US9783788B2
US9783788B2 US15/011,608 US201615011608A US9783788B2 US 9783788 B2 US9783788 B2 US 9783788B2 US 201615011608 A US201615011608 A US 201615011608A US 9783788 B2 US9783788 B2 US 9783788B2
Authority
US
United States
Prior art keywords
strain
prv
virus
porcine pseudorabies
preparation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US15/011,608
Other versions
US20160228538A1 (en
Inventor
Ruiai Chen
Hongliang Huang
Changbao Ren
Xiaoyu Xie
Zheng She
Xuanzi Zhan
Xiaoxiong Deng
Manhua Tang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
South China Agricultural University
Zhaoqing Dahuanong Biological Pharmaceutical Co Ltd
Original Assignee
South China Agricultural University
Zhaoqing Dahuanong Biological Pharmaceutical Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Agricultural University, Zhaoqing Dahuanong Biological Pharmaceutical Co Ltd filed Critical South China Agricultural University
Publication of US20160228538A1 publication Critical patent/US20160228538A1/en
Application granted granted Critical
Publication of US9783788B2 publication Critical patent/US9783788B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5252—Virus inactivated (killed)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16721—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16734—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16761—Methods of inactivation or attenuation
    • C12N2710/16763—Methods of inactivation or attenuation by chemical treatment

Definitions

  • the present invention relates to the technical field of porcine pseudorabies virus, and more particularly to a porcine pseudorabies virus (PRV)-YF strain, and also relates to the application of the porcine pseudorabies virus (PRV)-YF strain.
  • PRV porcine pseudorabies virus
  • a pseudorabies virus is a porcine herpesvirus type I in a Varicella virus of hepersviridae alpha-hepersririnae subfamily, capable of leading to serious porcine diseases.
  • the PRV frequently outbreaks epidemically, seriously endangers pregnant swine in particular, and often results in fetal death, abortion and fetal mummies.
  • Replacement gilts and non-pregnant sows infected with the PRV may be subjected to infertility, failure to observe oestrus, return to estrus and repeat breeder syndrome. Infected boars show such symptoms as testicular swelling, atrophy and loss of ability to inseminate.
  • Mass mortality of newborn piglets infected with the PRV may be caused, in which the death rate of newborn piglets aged within 15 days may reach up to 100%, and the death rate of newborn piglets aged 3-4 weeks may reach up to 30-40%.
  • Each of fattening swine infected with the PRV develops a fever, respiratory symptoms and growth retardation, resulting in affecting weight gain and reducing feed conversion.
  • pigs are natural host for the PRV and a source of infection to it. It may have a great significance to control the porcine pseudorabies on not only a pig industry, but also the smooth development of the culture of other animals.
  • Vaccine immunization is a radical measure for the prevention, control and elimination of the PRV.
  • PRV vaccines A majority of PRV vaccines currently sold on the market are live vaccines having differential diagnosis capabilities, including a vaccine product of naturally attenuated strain Bartha-K61 developed in Hungaria, a PRV live vaccine (SA215 strain) developed by professor Guo Wanzhu at Sichuan Agricultural University, and a PRV live vaccine (HB98 strain) developed by professor Chen Huanchun at Huazhong Agricultural University.
  • SA215 strain developed by professor Guo Wanzhu at Sichuan Agricultural University
  • HB98 strain a PRV live vaccine
  • PR mainly shows such symptoms that swinery gE antibody positive rate is significantly increased, sows produce weak piglets and dead fetuses, and the piglets may be subjected to neural symptoms, death and the like.
  • the piglets aged 2-3 days may be subjected to serious PR, with the time from onset to death for 5 hours only.
  • the PR has spread to a number of provinces and regions in China, has killed a lot of piglets, and has made great economic losses.
  • an epidemic (prevalent) strain is isolated clinically and is determined as porcine pseudorabies virus (PRV)-YF strain through a gene sequence analysis and an immune protection test; and BEI inactivation is performed after the propagation; an inactivated vaccine is prepared and the immune efficacy thereof is evaluated.
  • PRV pseudorabies virus
  • the aim I of the present invention is to provide a porcine pseudorabies virus (PRV)-YF strain.
  • the aim II of the present invention is to provide an application of the porcine pseudorabies virus (PRV)-YF strain in preparing an inactivated vaccine of the porcine pseudorabies virus.
  • PRV porcine pseudorabies virus
  • the aim III of the present invention is to provide an inactivated PRV vaccine containing the porcine pseudorabies virus (PRV)-YF strain.
  • the aim IV of the present invention is to provide a preparation method for the inactivated vaccine of the porcine pseudorabies virus, so as to enhance the immune protective efficacy or safety of the inactivated vaccine through optimization of technological parameters.
  • the porcine pseudorabies virus (PRV)-YF strain is obtained through the separation from brains, tonsils and other tissues of pathogenetic piglets and the subculture adaptation; the porcine pseudorabies virus (PRV)-YF is submitted to the organization authorized by the patent for preservation, the preservation name is porcine pseudorabies virus (PRV)-YF strain, the preservation organization is China Center for Type Culture Collection (CCTCC), the preservation date is Jan. 21, 2015, the preservation No. is V201502, and the preservation address is Wuhan University of China.
  • CTCC China Center for Type Culture Collection
  • TK, gE and gG genes are carried out on the isolated porcine pseudorabies virus (PRV)-YF strain, wherein 754 bp of TK gene segments and 578 bp of gE gene segments are respectively amplified in the tissue samples of tonsils and brains, which represents that the tonsils and the brains are PRV positive; after the PRV-YF strain is inoculated to Balb/C mice of 8-10 years old, the mice have the representations that the injected sites are pruritic, the hair is rough and disordered, and the spirit is depressed; nearly all the mice die, the symptoms such as pruritic injected sites, rough and disordered hair and depressed spirit are more obvious, the injected sites are scratched to be festered, the mice the one after another after 84 h, and the symptoms are more obvious. Therefore, the PRV-YF strain is determined to be a PRV clinical variant strain, and the existing live PRV vaccines do not completely protect immune animals against the PRV
  • porcine pseudorabies virus (PRV)-YF strain The application of the porcine pseudorabies virus (PRV)-YF strain in preparing the inactivated vaccine of the porcine pseudorabies virus is described as follows:
  • the inactivated vaccine of the porcine pseudorabies virus comprises an adjuvant and virus liquid containing the inactivated porcine pseudorabies virus (PRV)-YF strain in claim 1 .
  • the preparation method for the inactivated vaccine of the porcine pseudorabies virus comprises the following steps:
  • the virus content of the virus liquid prepared in Step 1) is not less than 10 7.0 TCID 50 /ml.
  • the inactivator described in Step 2) is pyrrole; and weighing by w/v, the pyrrole added in the virus liquid accounts for 0.1% to 1% of the total amount of the virus liquid.
  • the inactivation time is 12 to 60 h; and the inactivation temperature is 37° C.
  • the terminator described in Step 2) is sodium thiosulfate; and weighing by w/v, the sodium thiosulfate added in the virus liquid accounts for 0.1% to 5% of the total amount of the virus liquid.
  • the sodium thiosulfate added in the virus liquid accounts for 0.5% to 5% of the total amount of the virus liquid.
  • Step 3 comprises the following steps:
  • the present invention has the beneficial effects that:
  • the porcine pseudorabies virus (PRV)-YF strain isolated and identified in the brain, tonsil and other tissues of piglets has good immunogenicity.
  • the live vaccine of existing porcine pseudorabies cannot be used for fully protecting the immune animal against the strain, but can be used as the porcine pseudorabies inactivated vaccine for producing and inspecting the strain; and the immune efficacy evaluation and safety evaluation are carried out on the water-in-oil inactivated vaccine prepared with the pathological liquid in PRV-YF strain, and the experiment shows that the porcine pseudorabies virus (PRV)-YF strain prepared in the invention has good immune efficacy, and is safe for weaned piglets, replacement gilts and pregnant sows. Therefore, it can be used for preventing the sow reproduction disorder and infertility arisen from porcine pseudorabies virus and pseudorabies of other pigs.
  • FIG. 1 is a flow diagram of an embodiment of the present invention
  • FIG. 2 is the observation of lesion of Vero cells, wherein A indicates the normal control cells, B indicates the pathological cells after virus inoculation, and the arrow indicates the pathological Vero cells;
  • FIG. 3 indicates that the mice mainly show the pruritus after challenge, wherein A indicates the injection site that the mice scratch and bite, and B indicates that the injection site is bitten until to be ruptured;
  • FIG. 4 is an analysis diagram for evolution of gE whole gene of PRV-YF strain described in the present invention.
  • FIG. 5 is an analysis diagram evolution of gG whole gene of PRV-YF strain described in the present invention.
  • the Ra strain ( Study on proliferativen characteristics and pathogenicity of Ra strain of pseudorabies virus to different cells , Yu Wenlan, etc., China Animal Husbandry & Veterinary Medicine, Vol. 11, 2013) of typical virulent strain of Vero cell, PK15 cell and porcine pseudorabies virus are stored in the key laboratory created by the animal epidemic disease control biotechnology and product of Ministry of Agriculture of Zhaoqing Dahuanong Biotechnology Co., Ltd.; and the live vaccine (K-61 strain) of porcine pseudorabies is an product from Guangdong Dahuanong Animal Health Products Co., Ltd.
  • the fetal calf serum and DMEM medium are purchased from Gibco Company, the virus DNA/RNA extraction reagent kit is purchased from Biomiga Company, and LA Taq enzyme reagent kit is purchased from TaKaRa Company.
  • mice with 8-10 weeks of age are purchased Guangdong Medical Laboratory Animal Center.
  • the premier is designed and synthesized by referring to a whole genome sequence (NC_006151) of porcine pseudorabies virus, and used for amplifying PRV gE and gG whole genes.
  • the primer sequence and the size of expected PCR product are shown in Table 1, TKF/TKR and gEF/gER are PRV TK and gE gene detection primer (refer to the applied patent: 201210128876.5).
  • PCR primers for detecting PRV and amplifying PRV gE and gG whole genes Size/ Target Primer 5′-3′ bp segment TKF ATGCGCATCCTCCGGATCTACCT 754 TK gene TKR TTCCGCCTCAGAAGCCATAGAGC detection gEF ATGCGGCCCTTTCTGCTGCG 578 gE gene gER TGCAGCGTGTAGAGGCCCGT detection gE-CDSF ATGCGGCCCTTTCTGCTGCG 1742 gE whole gE-CDSR TTAAGCGGGGCGGGCATTCAA gene detection gG-CDSF CTCAACAATGAAGTGGGCAACG 1507 gG whole gG-CDSR TCAGGCGGAGGCCACGT gene ampli- fication
  • the tonsil and brain tissue of the pathogenetic piglets are added into a suspension prepared by grinding and blending sterile PBS by 1:3, repeatedly frozen and thawed for three times, and centrifuged for 15 min at 5000 r/min; and the supernate is taken, wherein a part is filtered through 0.45 ⁇ L and 0.22 ⁇ L microporous membrane respectively and stored at ⁇ 70° C.
  • virus DNA is extracted from the other part according to a virus DNA extraction reagent kit; then, PRV TK and gE genes are detected with primers TKF/TKR and gEF/gER in Table 1 respectively; the pathological material which is detected for being positive is used for the virus isolation, and PCR reaction system and reaction condition are as follows:
  • Genome DNA 1 ul 94° C. 3 min 1 cycle 2 ⁇ GC Buffer I (5 mM Mg2+ plus) 12.5 ul 98° C. 10 sec 30 cycles Upstream primer 0.5 ul 60° C. 30 sec Downstream primer 0.5 ul 72° C. 30 sec dNTP Mixture (2.5 mM each) 4 ul 72° C. 7 min 1 cycle TaKaRa LA Taq (5 U/ul) 0.5 ul dH2O 6 ul
  • the Vero cells are cultured according to a conventional method; and the single-layer dense Vero cells are digested the day before inoculating, inoculated into a 6-hole cell culture plate, with 2 ml for each hole, and cultured in 5% CO 2 at 37° C. until to the next day, wherein more than 80% cells are intersected.
  • 200 ⁇ L sterile viral suspensions of tissues are taken and inoculated into a Vero monolayer cell in the 6-hole plate, and replaced with a DMEM culture solution including 2% fetal calf serum after incubating for 1 h, and the cytopathic effect (CPE) is observed day by day. See FIG. 2 .
  • the toxin is received by freezing and thawing when about 90% cells have the CPE.
  • the plaque of a recombinant virus is purified according to the conventional method; the monolayer cell which is grown well is digested and inoculated into the 6-hole culture plate, and cultured in 5% CO 2 at 37° C. until to grow into a single layer; the virus liquid is diluted to 10 ⁇ 7 by 10 times; the latter four diluted viruses are taken, inoculated into the monolayer cell in the 6-hole plate, with one hole for each dilutability, and cultured in 5% CO 2 at 37° C.
  • phenol red-free DMEM including 2% low-melting-point agar and 0.01% neutral red
  • a variant strain of porcine pseudorabies virus is obtained by purifying for 2 times, and named as the PRV-YF strain.
  • the PRV-YF strain and the Ra strain are propagated according to the conventional method, namely, the viral suspension of the PRV-YF strain and the Ra strain is inoculated into a T175 culture flask to overgrow the monolayer Vero cells; and the virus liquid is received by freezing and thawing when culturing in 5% CO 2 at 37° C. till that the lesion is more than 90%.
  • the received virus liquid is diluted to 10 ⁇ 8 by 10 times, 8 holes are repeated for each dilutability, the virus liquid is inoculated into a 96-hole plate with the Vero cells synchronously and cultured in 5% CO 2 at 37° C.
  • TCID 50 of the PRV-YF strain is 10 7.43 /mL
  • TCID 50 of the Ra strain is 10 7.33 /mL.
  • TCID 50 10 6.43 /0.1 mL
  • PRV Ra strain 10 6.33 /0.1 mL
  • Number Total Total Lesion Number Total Total Lesion of Normal number normal rate of Normal number normal rate Dilutability lesion number of lesion number (%) lesion number of lesion number (%) 10 ⁇ 1 8 0 47 0 100 8 0 46 0 100 10 ⁇ 2 8 0 39 0 100 8 0 38 0 100 10 ⁇ 3 8 0 31 0 100 8 0 30 0 100 10 ⁇ 4 8 0 23 0 100 8 0 22 0 100 10 ⁇ 5 8 0 15 0 100 8 0 14 0 100 10 ⁇ 6 7 1 7 1 87.5 6 2 6 2 75 10 ⁇ 7 0 8 0 9 0 0 8 0 10 0 10 ⁇ 8 0 8 0 17 6 0 8 0 18 0
  • Balb/C mice with 8-10 weeks of age are randomly divided into 13 groups, 6 mice in each group; the viral suspensions of the PRV-YF strain and the Ra strain are diluted to 10 6.0 , 10 5.0 , 10 4.0 , 10 3.0 , 10 2.0 and 10 1.0 TCID 50 /0.5 mL respectively, wherein each dose is provided for one group of Balb/C mice, totally 12 groups, and the other group is the blank control group.
  • the situation of the mice and the number of deaths are observed every day after inoculating, and LD 50 is calculated according to the Reed-Muench method.
  • mice No any abnormality is presented in the control group by continuously observing for 120 h after inoculating. All toxic mice are normal in 36 h after inoculating; 5 mice die in 10 6.0 TCID 50 group of the PRV-YF strain in 36 h to 48 h, the mice in 10 5.0 , 10 4.0 and 10 3.0 TCID 50 groups show the pruritus of injection site, coarse and messy hair and depressed spirit; no death is presented in the toxic group of the Ra strain, but the high dose group also shows the pruritus of injection site, coarse and messy hair, depressed spirit and other symptoms; the mice has the most intense reaction in 48 h to 72 h; the mice in 10 3.0 TCID 50 group and above almost die completely, the pruritus of injection site, coarse and messy hair, depressed spirit and other symptoms are more obvious, and the injection site is scratched to fester, as shown in FIG.
  • mice die continuously after 84 h, and the symptom is obvious.
  • the death of the mice is shown in Table 3 according to the time accumulation, LD50 of the PRV-YF strain is 10 2.25 TCID 50 , and LD 50 of the Ra strain is 10 2.12 TCID 50 ; and no obvious difference is presented by LD 50 of the two strains, but in combination with the time of symptom expression of mice and death time, it can be seen that the virulence of the PRV-YF strain is slightly enhanced compared with that of the Ra strain.
  • Balb/C mice with 8-10 weeks of age are randomly divided into 5 groups, 6 mice for each group.
  • Two groups are live vaccine (K-61 strain) of immune porcine pseudorabies, other groups are not immunized, and the secondary immunization is carried out after 3 weeks of primary immunization.
  • the blood sampling is carried out in 2 weeks after the secondary immunization, a neutralizing antibody of PRV is detected with PK15 cells according to the conventional method, the neutralizing antibody of the immunized mice is not less than 1:20, the neutralizing antibody of the mice in the control group is less than 1:4, and the result is shown in Table 4.
  • mice in the two groups are virulently attacked with the PRV-YF strain and the Ra strain respectively, the dose is 100 LD 50 /PCS, and at the same time, the toxic control group is provided, and a blank control group is provided.
  • Table 4 The result is shown in Table 4, and after challenge for 120 h, the mice in the non-immunized and non-attack control group are normal, and the mice in the toxic control group die completely; after the mice immunized by the vaccine attacks the PRV Ra strain, the individual mice have slight pruritus only, and others are healthy and living completely; and after the mice immunized by the vaccine attacks the PRV-YF strain, 3 mice die, and others have slight pruritus.
  • a PRV genome is extracted from the purified virus suspension of the PRV-YF strain with the virus gene extraction reagent kit; then, PRV gE and gG whole genes are amplified with the primers gECDSF/gECDSR and gGCDSF/gGCDSR in Table 1 respectively; the pathological material which is detected for being positive is used for the virus isolation, and PCR reaction system and reaction condition are as follows:
  • Genome DNA 1 ul 94° C. 3 min 1 cycle 2 x GC Buffer I (5 mM Mg2+ plus) 12.5 u1 98° C. 10 sec 30 cycles Upstream primer 0.5 u1 50° C. 30 sec Downstream primer 0.5 u1 72° C. 2 min dNTP Mixture (2.5 mM each) 4 u1 72° C. 7 min 1 cycle TaKaRa LA Taq (5 U/ul) 0.5 u1 dH 2 O 6 u1
  • DNA star MegAlign software is adopted for the molecular evolution analysis of gE and gG whole genes.
  • gE whole-genome sequence is shown in SEQ ID No. 1, and the evolution analysis is shown in FIG. 4 ; and gG whole-genome sequence is shown in SEQ ID No. 2, and the evolution analysis is shown in FIG. 5 .
  • a porcine pseudorabies virus is isolated from the tonsil and the brain tissue of the clinical pathological material according to the present invention, and named as the porcine pseudorabies virus (PRV)-YF strain; and through the sequence analysis of gE and gG genes and analysis for antigenic variation of virus, the PRV-YF strain is determined as the clinical variant strain of porcine pseudorabies virus, and the live vaccine of existing porcine pseudorabies cannot be used for fully protecting the immune animal against the strain.
  • PRV porcine pseudorabies virus
  • the porcine pseudorabies virus (PRV)-YF strain is prepared in Embodiment 1 and the Vero cells are stored in the key laboratory created by the animal epidemic disease control biotechnology and product of Ministry of Agriculture of Zhaoqing Dahuanong Biotechnology Co., Ltd.
  • the fetal calf serum and DMEM medium are purchased from Gibco Company; the white oil is purchased from Mobil Corporation, and the Tween-80 and Span-80 are purchased from Guangdong Zhaoqing Chaoneng Industrial Co., Ltd.; 2-bromoethyl amine hydrobromide is purchased from TCI (shanghai) Development Co., Ltd.; and sodium thiosulfate is domestic and analytically pure.
  • the viral suspension of the PRV-YF strain is inoculated into 80% fused Vero cells according to the conventional method of pseudorabies virus multiplication, its TCID 50 is determined according to the conventional method when culturing until that lesion reaches 100%, and the result is shown in Table 5.
  • TCID 50 of the PRV-YF strain is 10 7.57 /mL, which indicates that the multiplication of the PRIG-YF strain is good.
  • TCID 50 10 6.57 /0.1 ml
  • TCID 50 10 6.57 /0.1 ml
  • Diluta- Number of Normal Total number Total normal Lesion rate bility lesion number of lesion number (%) 10 ⁇ 1 8 0 49 0 100 10 ⁇ 2 8 0 41 0 100 10 ⁇ 3 8 0 33 0 100 10 ⁇ 4 8 0 25 0 100 10 ⁇ 5 8 0 17 0 100 10 ⁇ 6 8 0 9 0 100 10 ⁇ 7 1 7 1 7 12.5 10 ⁇ 8 0 8 0 15 0
  • 2-bromoethyl amine hydrobromide (BEA) powder is added into 0.2 mol/L sodium hydroxide solution prepared newly, placed in water bath at 37° C., and shaken out once every 10 min; cyclizing is stopped when a pH value is reduced to 8.0 after 30 min to 60 min; and pyrrole (BEI) with the final concentration of 0.2 mol/L is prepared, and placed at 2 to 8° C. for storage and standby after aseptic filtration.
  • BEA 2-bromoethyl amine hydrobromide
  • the inactivated sample is inoculated into the Vero cells, the situation of cytopathic effect is observed, the non-pathological cells are subjected to the blind passage for 3 generations and observed continuously, and the results are shown in Table 7.
  • the inactivation condition of the PRV-YF strain is determined to inactivate in BEI with the final concentration of 0.002M at 37° C. for 24 h.
  • the virus liquid of the PRV-YE strain is inactivated with 0.002M BEI for 24 h at 37° C., and the activity of BEI is stopped with the Na 2 S 2 O with the final concentration (W/V) for 0.01% to 5%.
  • BEI inactivates the virus mainly by acting on the viral nucleic acid, and the residual BEI is able to act on the cells while the inactivation inspection, thus, causing the cell death or poor growth, therefore, the activity of BEI is stopped before the inactivation inspection.
  • TCID 50 of the PRV-YF strain is determined according to the conventional method after the viral multiplication, and the content of 1 ml virus is not less than 10 7.0 TCID 50 .
  • the inactivated virus liquid is inoculated into the Vero cells by 10% synchronously for continuous passage for 3 times, without the cytopathic effect.
  • the sterility test is carried out in accordance with the current appendix of Chinese Veterinaty Pharmacopoeia and no bacterial growth is provided.
  • the inactivated antigen of the PRV-YF strain which passes the inspection is taken and added into Tween-80 with the final concentration of 0.75% (taking the milliliter as the unit), and mixed while adding until Tween-80 is thoroughly dissolved; and the water phase is prepared.
  • the water phase is added into the oil phase slowly, sheared after homogenizing for 1-3 min; and a homogeneous emulsion is prepared, i.e. inactivated gene vaccine of porcine pseudorabies.
  • the water-in-oil milk white emulsion is dripped on the surface of cold water and not dispersed, the vaccine is centrifuged for 15 min at 3000 r/min, no water phase is separated out at the bottom of a pipe, and the viscosity is 27.5 cP.
  • the sterility test is carried out in accordance with the current appendix of Chinese Veterinary Pharmacopoeia , and no bacterial growth is provided.
  • the YF strain and Vero cells of porcine pseudorabies virus are stored in the key laboratory created by the animal epidemic disease control biotechnology and product of Ministry of Agriculture of Zhaoqing Dahuanong Biotechnology Co., Ltd.
  • Balb/C female mice with 4-6 weeks of age are purchased from Guangdong Medical Laboratory Animal Center, and used for evaluating the immune efficacy of inactivated vaccine of porcine pseudorabies (PRV-YF strain).
  • the fetal calf serum and DMEM medium are purchased from Gibco Company.
  • the secondary immunization is carried out in 4 weeks after the primary immunization. In 2 weeks after the secondary immunization, 100 LD 50 (about 10 4.25 TCID 50 ) PRV-YF strain is used for attacking, and the continuous observation is carried out for 14 days after the challenge.
  • mice in the non-immune toxic control group show the pruritus, neurological symptom, anorexia and coarse and messy hair; the death is presented after 60 h, until that 6 mice in the whole group die completely in 96 h; and in the whole observation period after the challenge, all immunized mice are normal, which indicates that the inactivated vaccine of porcine pseudorabies (PRV-YF strain) in the present invention has good immune protective efficacy.
  • PRV-YF strain porcine pseudorabies
  • Test solution the reaction situation of the pig is carefully observed after immunizing neck muscles according to the above solution, and continuous observation is carried out for 21 days.
  • the results show that, the weaned piglets with 25 days old are subjected to the primary inoculation of vaccine with single dose, primary inoculation with super times of dose and repeated inoculation with single dose.
  • the inoculation site of immunized piglets is not swollen, no abnormality is provided in the whole body, and all piglets are healthy and living. All experimental pigs are grown normally in the process of feeding, and have no accidental death and disease. Meanwhile, the young replacement gilts with 6 months of age are subjected to the primary inoculation of vaccine with single dose, primary inoculation with super times of dose and repeated inoculation with single dose.
  • the inoculation site of immunized pigs is not swollen, no abnormality is provided in the whole body, and all pigs are healthy and living. All experimental pigs are grown normally in the process of feeding, and have no accidental death and disease. The results show that, the vaccine provided by the present invention is safe for the young replacement gilts with 6 months of age, regardless of primary inoculation with single dose, primary inoculation with super times of dose and repeated inoculation with single dose.
  • the results in Table 12 show that, one sow is aborted after inoculating for 15 days in the experimental group that the pregnant sows are subjected to the primary inoculation with single dose; and the control group that the primary inoculation with super times of dose, repeated inoculation with single dose and repeated injection of normal saline with single dose are carried out has no abnormal reaction.
  • the aborted fetus is detected, PRV is not separated, and after analysis, the reason of abortion shall be attributed to the mechanical stimulation in the process of injecting the vaccine and grasping the pigs or other reasons, rather than the vaccine itself.
  • the vaccine is safe for the pregnant sows. All experimental pigs are grown normally in the process of feeding, and have no accidental death and disease. The results show that, the vaccine provided by the present invention is safe for the pregnant sows.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Communicable Diseases (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to the technical field of porcine pseudorabies virus, and more particularly to a porcine pseudorabies virus (PRV)-YF strain, with the preservation No. of CCTCC No. V201502. The present invention also provides an application of the porcine pseudorabies virus (PRV)-YF strain in preparing an inactivated vaccine of the porcine pseudorabies virus, the inactivated vaccine of the porcine pseudorabies virus and a preparation method thereof. It is proved through an immune efficacy evaluating test and a safety test that the inactivated vaccine of the porcine pseudorabies virus has good immune protective efficacy and is safe for weaned piglets, replacement gilts, pregnant sows and the like.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a continuation of, and claims priority to, Chinese Patent Application No. 201510075712.4 with a filing date of Feb. 11, 2015. The content of the aforementioned application, including any intervening amendments thereto, is incorporated herein by reference.
SEQUENCE LISTING
This application contains, as a separate part of the disclosure, a Sequence Listing in computer-readable form (filename: D_ZQDX_00301_UUS_ST25.txt; created: Jan. 24, 2016: 4901 bytes—ASCII text file) which is incorporated by reference in its entirety.
TECHNICAL FIELD
The present invention relates to the technical field of porcine pseudorabies virus, and more particularly to a porcine pseudorabies virus (PRV)-YF strain, and also relates to the application of the porcine pseudorabies virus (PRV)-YF strain.
BACKGROUND
A pseudorabies virus (PRV) is a porcine herpesvirus type I in a Varicella virus of hepersviridae alpha-hepersririnae subfamily, capable of leading to serious porcine diseases. The PRV frequently outbreaks epidemically, seriously endangers pregnant swine in particular, and often results in fetal death, abortion and fetal mummies. Replacement gilts and non-pregnant sows infected with the PRV may be subjected to infertility, failure to observe oestrus, return to estrus and repeat breeder syndrome. Infected boars show such symptoms as testicular swelling, atrophy and loss of ability to inseminate. Mass mortality of newborn piglets infected with the PRV may be caused, in which the death rate of newborn piglets aged within 15 days may reach up to 100%, and the death rate of newborn piglets aged 3-4 weeks may reach up to 30-40%. Each of fattening swine infected with the PRV develops a fever, respiratory symptoms and growth retardation, resulting in affecting weight gain and reducing feed conversion. Meanwhile, pigs are natural host for the PRV and a source of infection to it. It may have a great significance to control the porcine pseudorabies on not only a pig industry, but also the smooth development of the culture of other animals. Vaccine immunization is a radical measure for the prevention, control and elimination of the PRV. A majority of PRV vaccines currently sold on the market are live vaccines having differential diagnosis capabilities, including a vaccine product of naturally attenuated strain Bartha-K61 developed in Hungaria, a PRV live vaccine (SA215 strain) developed by professor Guo Wanzhu at Sichuan Agricultural University, and a PRV live vaccine (HB98 strain) developed by professor Chen Huanchun at Huazhong Agricultural University. Those vaccines that have been put on the market for use for many years play an important role in prevention and control of the porcine pseudorabies. There are some reports on virus isolation occasionally, but the porcine pseudorabies has been effectively controlled in general.
However, since 2011, suspected PR has occurred epidemically on a number of large-scale pig farms in which gene deleted live vaccines are used for immunity. PR mainly shows such symptoms that swinery gE antibody positive rate is significantly increased, sows produce weak piglets and dead fetuses, and the piglets may be subjected to neural symptoms, death and the like. In particular, the piglets aged 2-3 days may be subjected to serious PR, with the time from onset to death for 5 hours only. Currently, the PR has spread to a number of provinces and regions in China, has killed a lot of piglets, and has made great economic losses.
Therefore, in the present invention, an epidemic (prevalent) strain is isolated clinically and is determined as porcine pseudorabies virus (PRV)-YF strain through a gene sequence analysis and an immune protection test; and BEI inactivation is performed after the propagation; an inactivated vaccine is prepared and the immune efficacy thereof is evaluated.
SUMMARY
In order to overcome the defects of the prior art, the aim I of the present invention is to provide a porcine pseudorabies virus (PRV)-YF strain.
The aim II of the present invention is to provide an application of the porcine pseudorabies virus (PRV)-YF strain in preparing an inactivated vaccine of the porcine pseudorabies virus.
The aim III of the present invention is to provide an inactivated PRV vaccine containing the porcine pseudorabies virus (PRV)-YF strain.
The aim IV of the present invention is to provide a preparation method for the inactivated vaccine of the porcine pseudorabies virus, so as to enhance the immune protective efficacy or safety of the inactivated vaccine through optimization of technological parameters.
In order to solve the above problems, the aims of the present invention are realized through the following technical solution:
In the present invention, the porcine pseudorabies virus (PRV)-YF strain is obtained through the separation from brains, tonsils and other tissues of pathogenetic piglets and the subculture adaptation; the porcine pseudorabies virus (PRV)-YF is submitted to the organization authorized by the patent for preservation, the preservation name is porcine pseudorabies virus (PRV)-YF strain, the preservation organization is China Center for Type Culture Collection (CCTCC), the preservation date is Jan. 21, 2015, the preservation No. is V201502, and the preservation address is Wuhan University of China.
Sequence analysis and antigenic variation analysis on TK, gE and gG genes are carried out on the isolated porcine pseudorabies virus (PRV)-YF strain, wherein 754 bp of TK gene segments and 578 bp of gE gene segments are respectively amplified in the tissue samples of tonsils and brains, which represents that the tonsils and the brains are PRV positive; after the PRV-YF strain is inoculated to Balb/C mice of 8-10 years old, the mice have the representations that the injected sites are pruritic, the hair is rough and disordered, and the spirit is depressed; nearly all the mice die, the symptoms such as pruritic injected sites, rough and disordered hair and depressed spirit are more obvious, the injected sites are scratched to be festered, the mice the one after another after 84 h, and the symptoms are more obvious. Therefore, the PRV-YF strain is determined to be a PRV clinical variant strain, and the existing live PRV vaccines do not completely protect immune animals against the PRV-YF strain.
The application of the porcine pseudorabies virus (PRV)-YF strain in preparing the inactivated vaccine of the porcine pseudorabies virus is described as follows:
The inactivated vaccine of the porcine pseudorabies virus comprises an adjuvant and virus liquid containing the inactivated porcine pseudorabies virus (PRV)-YF strain in claim 1.
The preparation method for the inactivated vaccine of the porcine pseudorabies virus comprises the following steps:
1) culturing the above-mentioned porcine pseudorabies virus (PRV)-YF strain of claim 1 to obtain a virus liquid;
2) adding an inactivator in the virus liquid for inactivating the virus; and then, adding a terminator for terminating inactivation to obtain an inactivated virus liquid of the PRV-YF strain; and
3) preparing a water phase and an oil phase and emulsifying to obtain the inactivated vaccine of the porcine pseudorabies virus.
Specifically, as an embodiment of the present invention, the virus content of the virus liquid prepared in Step 1) is not less than 107.0 TCID50/ml.
Specifically, as an embodiment of the present invention, the inactivator described in Step 2) is pyrrole; and weighing by w/v, the pyrrole added in the virus liquid accounts for 0.1% to 1% of the total amount of the virus liquid.
Specifically, as an embodiment of the present invention, the inactivation time is 12 to 60 h; and the inactivation temperature is 37° C.
Specifically, as an embodiment of the present invention, the terminator described in Step 2) is sodium thiosulfate; and weighing by w/v, the sodium thiosulfate added in the virus liquid accounts for 0.1% to 5% of the total amount of the virus liquid.
Specifically, as an embodiment of the present invention, weighing by w/v, the sodium thiosulfate added in the virus liquid accounts for 0.5% to 5% of the total amount of the virus liquid.
Specifically, as an embodiment of the present invention, Step 3) comprises the following steps:
A. Preparation of water phase: taking the inactivated virus liquid of the PRV-YF strain prepared in Step 2) and adding the same into Span-80 with the final concentration of 075%, mixing while adding until Span-80 is thoroughly dissolved, and preparing the water phase;
B. Preparation of oil phase: taking 141.75 parts of white oil, adding 7.5 parts of Span-80, fully mixing, sterilizing for 30 min at 121° C., cooling to room temperature for standby, and preparing the oil phase;
C. Emulsifying the oil phase and the water phase by 1.5:1; adding the water phase into the oil phase slowly, shearing after homogenizing for 1-3 min, and preparing a homogeneous emulsion, i.e., the inactivated vaccine of porcine pseudorabies.
Compared with the prior art, the present invention has the beneficial effects that:
The porcine pseudorabies virus (PRV)-YF strain isolated and identified in the brain, tonsil and other tissues of piglets has good immunogenicity. The live vaccine of existing porcine pseudorabies cannot be used for fully protecting the immune animal against the strain, but can be used as the porcine pseudorabies inactivated vaccine for producing and inspecting the strain; and the immune efficacy evaluation and safety evaluation are carried out on the water-in-oil inactivated vaccine prepared with the pathological liquid in PRV-YF strain, and the experiment shows that the porcine pseudorabies virus (PRV)-YF strain prepared in the invention has good immune efficacy, and is safe for weaned piglets, replacement gilts and pregnant sows. Therefore, it can be used for preventing the sow reproduction disorder and infertility arisen from porcine pseudorabies virus and pseudorabies of other pigs.
The present invention will be further described in detail below in combination with the drawings and specific embodiments.
DESCRIPTION OF DRAWINGS
FIG. 1 is a flow diagram of an embodiment of the present invention;
FIG. 2 is the observation of lesion of Vero cells, wherein A indicates the normal control cells, B indicates the pathological cells after virus inoculation, and the arrow indicates the pathological Vero cells;
FIG. 3 indicates that the mice mainly show the pruritus after challenge, wherein A indicates the injection site that the mice scratch and bite, and B indicates that the injection site is bitten until to be ruptured;
FIG. 4 is an analysis diagram for evolution of gE whole gene of PRV-YF strain described in the present invention; and
FIG. 5 is an analysis diagram evolution of gG whole gene of PRV-YF strain described in the present invention.
 DETAILED DESCRIPTION OF EMBODIMENTS
Unless otherwise specified, all scientific and technical terminologies in the present application have the same meanings as those usually understood by those skilled in the art of the present invention. The following embodiments aim to further describe specific ways for realizing the present invention by examples, not interpreted as a limitation to the present invention. The technical solutions obtained by changing the present invention will fall into the scope of the claims of the present invention without departing from the spirit and the principle of the present invention.
Embodiment 1 Isolation and Identification of Variant Train of Porcine Pseudorabies Virus
1. Material
1.1 Cell, Virus and Vaccine
The Ra strain (Study on proliferativen characteristics and pathogenicity of Ra strain of pseudorabies virus to different cells, Yu Wenlan, etc., China Animal Husbandry & Veterinary Medicine, Vol. 11, 2013) of typical virulent strain of Vero cell, PK15 cell and porcine pseudorabies virus are stored in the key laboratory created by the animal epidemic disease control biotechnology and product of Ministry of Agriculture of Zhaoqing Dahuanong Biotechnology Co., Ltd.; and the live vaccine (K-61 strain) of porcine pseudorabies is an product from Guangdong Dahuanong Animal Health Products Co., Ltd.
1.2 Pathological Material
Tonsil and brain tissue of piglets in a pig farm in Xinxing County, Yunfu City.
1.3 Medium and Other Reagents
The fetal calf serum and DMEM medium are purchased from Gibco Company, the virus DNA/RNA extraction reagent kit is purchased from Biomiga Company, and LA Taq enzyme reagent kit is purchased from TaKaRa Company.
1.4 Experimental Animal
Balb/C mice with 8-10 weeks of age are purchased Guangdong Medical Laboratory Animal Center.
1.5 Primer
The premier is designed and synthesized by referring to a whole genome sequence (NC_006151) of porcine pseudorabies virus, and used for amplifying PRV gE and gG whole genes. The primer sequence and the size of expected PCR product are shown in Table 1, TKF/TKR and gEF/gER are PRV TK and gE gene detection primer (refer to the applied patent: 201210128876.5).
TABLE 1
PCR primers for detecting PRV and amplifying PRV 
gE and gG whole genes
Size/ Target
Primer 5′-3′ bp segment
TKF ATGCGCATCCTCCGGATCTACCT  754 TK gene
TKR TTCCGCCTCAGAAGCCATAGAGC detection
gEF ATGCGGCCCTTTCTGCTGCG  578 gE gene
gER TGCAGCGTGTAGAGGCCCGT detection
gE-CDSF ATGCGGCCCTTTCTGCTGCG 1742 gE whole
gE-CDSR TTAAGCGGGGCGGGCATTCAA gene
detection
gG-CDSF CTCAACAATGAAGTGGGCAACG 1507 gG whole
gG-CDSR TCAGGCGGAGGCCACGT gene ampli-
fication
2. Disposal of Pathological Material and PRV Detection
The tonsil and brain tissue of the pathogenetic piglets are added into a suspension prepared by grinding and blending sterile PBS by 1:3, repeatedly frozen and thawed for three times, and centrifuged for 15 min at 5000 r/min; and the supernate is taken, wherein a part is filtered through 0.45 μL and 0.22 μL microporous membrane respectively and stored at −70° C. for standby, and virus DNA is extracted from the other part according to a virus DNA extraction reagent kit; then, PRV TK and gE genes are detected with primers TKF/TKR and gEF/gER in Table 1 respectively; the pathological material which is detected for being positive is used for the virus isolation, and PCR reaction system and reaction condition are as follows:
PCR reaction system and reaction condition of TK and gE gene detection
Genome DNA
  1 ul 94° C. 3 min  1 cycle
2 × GC Buffer I (5 mM Mg2+ plus) 12.5 ul 98° C. 10 sec 30 cycles
Upstream primer  0.5 ul 60° C. 30 sec
Downstream primer  0.5 ul 72° C. 30 sec
dNTP Mixture (2.5 mM each)   4 ul 72° C. 7 min  1 cycle
TaKaRa LA Taq (5 U/ul)  0.5 ul
dH2O   6 ul
The results show that, 754 bp TK gene segment and 578 bp gE gene segment are amplified by tonsil and brain tissue samples respectively, which indicates that the tonsil and the brain tissue are PRV positive.
3. Virus Isolation
The Vero cells are cultured according to a conventional method; and the single-layer dense Vero cells are digested the day before inoculating, inoculated into a 6-hole cell culture plate, with 2 ml for each hole, and cultured in 5% CO2 at 37° C. until to the next day, wherein more than 80% cells are intersected. 200 μL sterile viral suspensions of tissues are taken and inoculated into a Vero monolayer cell in the 6-hole plate, and replaced with a DMEM culture solution including 2% fetal calf serum after incubating for 1 h, and the cytopathic effect (CPE) is observed day by day. See FIG. 2. The toxin is received by freezing and thawing when about 90% cells have the CPE.
4. Virus Purification
The plaque of a recombinant virus is purified according to the conventional method; the monolayer cell which is grown well is digested and inoculated into the 6-hole culture plate, and cultured in 5% CO2 at 37° C. until to grow into a single layer; the virus liquid is diluted to 10−7 by 10 times; the latter four diluted viruses are taken, inoculated into the monolayer cell in the 6-hole plate, with one hole for each dilutability, and cultured in 5% CO2 at 37° C. for 1 h to 2 h; the virus liquid is sucked and abandoned, and washed for 3 times with DMEM; and 1.5 ml phenol red-free including 2% to 5% serum and 2% low-melting-point agar is covered and cultured in 5% CO2 at 37° C. till to observe the obvious lesion. The second layer of agar, i.e. phenol red-free DMEM including 2% low-melting-point agar and 0.01% neutral red, is covered and incubated in 5% CO2 at 37° C., the obvious plaque is seen with naked eyes, and the plaque is picked as required. A variant strain of porcine pseudorabies virus is obtained by purifying for 2 times, and named as the PRV-YF strain.
5. Propagation of PRV-YF Strain and Ra Strain and Determination of TCID50
The PRV-YF strain and the Ra strain are propagated according to the conventional method, namely, the viral suspension of the PRV-YF strain and the Ra strain is inoculated into a T175 culture flask to overgrow the monolayer Vero cells; and the virus liquid is received by freezing and thawing when culturing in 5% CO2 at 37° C. till that the lesion is more than 90%. The received virus liquid is diluted to 10−8 by 10 times, 8 holes are repeated for each dilutability, the virus liquid is inoculated into a 96-hole plate with the Vero cells synchronously and cultured in 5% CO2 at 37° C. until that the number of pathological holes is not changed; the number of pathological holes in each dilutability is read, and TCID50 is calculated according to Reed-Muench method. The result is shown in Table 2, TCID50 of the PRV-YF strain is 107.43/mL, and TCID50 of the Ra strain is 107.33/mL.
TABLE 2
Determination of TCID50 of PRV-YF strain and Ra strain
PRV-YF strain (TCID50 = 106.43/0.1 mL) PRV Ra strain (TCID50 = 106.33/0.1 mL)
Number Total Total Lesion Number Total Total Lesion
of Normal number normal rate of Normal number normal rate
Dilutability lesion number of lesion number (%) lesion number of lesion number (%)
10−1 8 0 47 0 100 8 0 46 0 100
10−2 8 0 39 0 100 8 0 38 0 100
10−3 8 0 31 0 100 8 0 30 0 100
10−4 8 0 23 0 100 8 0 22 0 100
10−5 8 0 15 0 100 8 0 14 0 100
10−6 7 1 7 1 87.5 6 2 6 2 75
10−7 0 8 0 9 0 0 8 0 10 0
10−8 0 8 0 17 6 0 8 0 18 0
6. Determination of Virulence and Antigenic Variation of Mice
6.1 Determination of Virulence of Mice
78 Balb/C mice with 8-10 weeks of age are randomly divided into 13 groups, 6 mice in each group; the viral suspensions of the PRV-YF strain and the Ra strain are diluted to 106.0, 105.0, 104.0, 103.0, 102.0 and 101.0 TCID50/0.5 mL respectively, wherein each dose is provided for one group of Balb/C mice, totally 12 groups, and the other group is the blank control group. The situation of the mice and the number of deaths are observed every day after inoculating, and LD50 is calculated according to the Reed-Muench method.
TABLE 3
Virulence test of Porcine pseudorabies virus (PRV) -YF strain and Ra strain to mice
(TCID50)
Challenge
viral
dosage Number of accumulative deaths
Virus (TCID50) 24 h 36 h 48 h 60 h 72 h 84 h 96 h 108 h 120 h
PRV-YF strain 106.0 0/6 0/6 5/6 6/6
LD50 = 102.25TCl 105.0 0/6 0/6 0/6 5/6 6/6
D50 104.0 0/6 0/6 0/6 5/6 6/6
103.0 0/6 0/6 0/6 1/6 4/6 6/6
102.0 0/6 0/6 0/6 0/6 0/6 0/6 1/6 2/6
101.0 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6
PRV Ra strain 106.0 0/6 0/6 0/6 6/6
LD50 = 102.12TCl 105.0 0/6 0/6 0/6 2/6 4/6 6/6
D50 104.0 0/6 0/6 0/6 0/6 5/6 6/6
103.0 0/6 0/6 0/6 0/6 0/6 3/6 5/6
102.0 0/6 0/6 0/6 0/6 0/6 3/6
101.0 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6
Control group 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6 0/6
Note: 0/6 indicates that 6 mice do not die; 2/6 indicates that 2 in 6 mice die, and others are analogized.
No any abnormality is presented in the control group by continuously observing for 120 h after inoculating. All toxic mice are normal in 36 h after inoculating; 5 mice die in 106.0 TCID50 group of the PRV-YF strain in 36 h to 48 h, the mice in 105.0, 104.0 and 103.0 TCID50 groups show the pruritus of injection site, coarse and messy hair and depressed spirit; no death is presented in the toxic group of the Ra strain, but the high dose group also shows the pruritus of injection site, coarse and messy hair, depressed spirit and other symptoms; the mice has the most intense reaction in 48 h to 72 h; the mice in 103.0 TCID50 group and above almost die completely, the pruritus of injection site, coarse and messy hair, depressed spirit and other symptoms are more obvious, and the injection site is scratched to fester, as shown in FIG. 3; and the mice die continuously after 84 h, and the symptom is obvious. The death of the mice is shown in Table 3 according to the time accumulation, LD50 of the PRV-YF strain is 102.25 TCID50, and LD50 of the Ra strain is 102.12 TCID50; and no obvious difference is presented by LD50 of the two strains, but in combination with the time of symptom expression of mice and death time, it can be seen that the virulence of the PRV-YF strain is slightly enhanced compared with that of the Ra strain.
6.2 Analysis of Antigenic Variation
30 Balb/C mice with 8-10 weeks of age are randomly divided into 5 groups, 6 mice for each group. Two groups are live vaccine (K-61 strain) of immune porcine pseudorabies, other groups are not immunized, and the secondary immunization is carried out after 3 weeks of primary immunization. The blood sampling is carried out in 2 weeks after the secondary immunization, a neutralizing antibody of PRV is detected with PK15 cells according to the conventional method, the neutralizing antibody of the immunized mice is not less than 1:20, the neutralizing antibody of the mice in the control group is less than 1:4, and the result is shown in Table 4. After the blood sampling, the immunized mice in the two groups are virulently attacked with the PRV-YF strain and the Ra strain respectively, the dose is 100 LD50/PCS, and at the same time, the toxic control group is provided, and a blank control group is provided. The result is shown in Table 4, and after challenge for 120 h, the mice in the non-immunized and non-attack control group are normal, and the mice in the toxic control group die completely; after the mice immunized by the vaccine attacks the PRV Ra strain, the individual mice have slight pruritus only, and others are healthy and living completely; and after the mice immunized by the vaccine attacks the PRV-YF strain, 3 mice die, and others have slight pruritus.
TABLE 4
Detection of neutralizing antibody after immunization of live vaccine (K-61
strain) of porcine pseudorabies and number of death of mice after challenge
Detection of neutralizing
antibody in 2 weeks after
Challenge Vaccine the secondary Number of accumulative deaths
virulence immunity immunization after challenge for 120 h
PRV-YF K-61 strain 1:25, 1:22, 1:25, 1:30, 3 mice die, and others show
strain 1:26, 1:32 the slight pruritus.
Non-immunized The neutralizing antibody 6 mice die completely
of 6 mice is less than 1:4
PRV Ra K-61 strain 1:20, 1:24, 1:26, 1:22, 6 mice are healthy and living;
strain 1:33, 1:24 and the individual mice only
have slight pruritus.
Non-immunized The neutralizing antibody 6 mice die completely
of 6 mice is less than 1:4
Non-immunized and The neutralizing antibody 6 mice are normal
non-attack control group of 6 mice is less than 1:4
7. Amplification and Analysis of gE and gG Whole-Genome Sequence
A PRV genome is extracted from the purified virus suspension of the PRV-YF strain with the virus gene extraction reagent kit; then, PRV gE and gG whole genes are amplified with the primers gECDSF/gECDSR and gGCDSF/gGCDSR in Table 1 respectively; the pathological material which is detected for being positive is used for the virus isolation, and PCR reaction system and reaction condition are as follows:
PCR reaction system and reaction condition of
gE and gG whole gene amplification
Genome DNA
  1 ul 94° C. 3 min  1 cycle
2 x GC Buffer I (5 mM Mg2+ plus) 12.5 u1 98° C. 10 sec 30 cycles
Upstream primer  0.5 u1 50° C. 30 sec
Downstream primer  0.5 u1 72° C. 2 min
dNTP Mixture (2.5 mM each)   4 u1 72° C. 7 min  1 cycle
TaKaRa LA Taq (5 U/ul)  0.5 u1
dH2O   6 u1
DNA star MegAlign software is adopted for the molecular evolution analysis of gE and gG whole genes.
gE whole-genome sequence is shown in SEQ ID No. 1, and the evolution analysis is shown in FIG. 4; and gG whole-genome sequence is shown in SEQ ID No. 2, and the evolution analysis is shown in FIG. 5.
The results of the molecular evolution analysis show that gE gene and gG gene of the PRV-YF strain have high homology with domestic strain, but are located in independent subbranches, and not located in the same branch with a Bartha K-61 strain of vaccine strain and an Ea strain of female parent strain of an HB98 strain, which indicates that the PRV-YF strain isolated clinically is indeed different from a typical strain.
8. Conclusion
A porcine pseudorabies virus is isolated from the tonsil and the brain tissue of the clinical pathological material according to the present invention, and named as the porcine pseudorabies virus (PRV)-YF strain; and through the sequence analysis of gE and gG genes and analysis for antigenic variation of virus, the PRV-YF strain is determined as the clinical variant strain of porcine pseudorabies virus, and the live vaccine of existing porcine pseudorabies cannot be used for fully protecting the immune animal against the strain.
Embodiment 2 Preparation of Inactivated Vaccine of Porcinepseudorabies (PRV-YF Strain)
1. Material
1.1 Virus and Cell
The porcine pseudorabies virus (PRV)-YF strain is prepared in Embodiment 1 and the Vero cells are stored in the key laboratory created by the animal epidemic disease control biotechnology and product of Ministry of Agriculture of Zhaoqing Dahuanong Biotechnology Co., Ltd.
1.2 Medium and Other Reagents
The fetal calf serum and DMEM medium are purchased from Gibco Company; the white oil is purchased from Mobil Corporation, and the Tween-80 and Span-80 are purchased from Guangdong Zhaoqing Chaoneng Industrial Co., Ltd.; 2-bromoethyl amine hydrobromide is purchased from TCI (shanghai) Development Co., Ltd.; and sodium thiosulfate is domestic and analytically pure.
2. Proliferation of Porcine Pseudorabies Virus (PRV)-YF Strain
The viral suspension of the PRV-YF strain is inoculated into 80% fused Vero cells according to the conventional method of pseudorabies virus multiplication, its TCID50 is determined according to the conventional method when culturing until that lesion reaches 100%, and the result is shown in Table 5. TCID50 of the PRV-YF strain is 107.57/mL, which indicates that the multiplication of the PRIG-YF strain is good.
TABLE 5
Determination of TCID50 of PRV-YF strain
PRV-YF strain (TCID50 = 106.57/0.1 ml)
Diluta- Number of Normal Total number Total normal Lesion rate
bility lesion number of lesion number (%)
10−1 8 0 49 0 100
10−2 8 0 41 0 100
10−3 8 0 33 0 100
10−4 8 0 25 0 100
10−5 8 0 17 0 100
10−6 8 0 9 0 100
10−7 1 7 1 7 12.5
10−8 0 8 0 15 0
3. Determination of Inactivation Condition of Porcine Pseudorabies Virus (PRV)-YF Strain
3.1 Preparation of Inactivator:
2-bromoethyl amine hydrobromide (BEA) powder is added into 0.2 mol/L sodium hydroxide solution prepared newly, placed in water bath at 37° C., and shaken out once every 10 min; cyclizing is stopped when a pH value is reduced to 8.0 after 30 min to 60 min; and pyrrole (BEI) with the final concentration of 0.2 mol/L is prepared, and placed at 2 to 8° C. for storage and standby after aseptic filtration.
3.2 Determination of Inactivation Condition of BEI
The test is carried out in accordance with the following solution. See Table 6:
TABLE 6
Probe test solution of inactivation condition of inactivator BEI
Inactivation Concentration of
temperature (° C.) inactivator (M) Inactivation time (h)
37 0.001 12, 20, 24, 30, 36, 48
0.002
0.005
32 0.001 12, 20, 24, 30, 36, 48
0.002
0.005
After testing the virus liquid of the PRV-YF strain according to the above solution, the inactivated sample is inoculated into the Vero cells, the situation of cytopathic effect is observed, the non-pathological cells are subjected to the blind passage for 3 generations and observed continuously, and the results are shown in Table 7. In order to ensure the vaccine quality and guarantee that the viral antigen in the vaccine is fully inactivated, the inactivation condition of the PRV-YF strain is determined to inactivate in BEI with the final concentration of 0.002M at 37° C. for 24 h.
TABLE 7
Test result of inactivation condition of inactivator BEI
Inactivation
37° C. 32° C.
time (h) 0.001 M 0.002 M 0.005 M 0.001 M 0.002 M 0.005 M
12 + − − + + −
20 + − − + + −
24 − − − + − −
30 − − − + − −
36 − − − + − −
48 − − − + − −
Note: + indicates the cytopathic effect, and − indicates no cytopathic effect.
3.3 Determination of Terminator Sodium Thiosulfate (Na2S2O3)
The virus liquid of the PRV-YE strain is inactivated with 0.002M BEI for 24 h at 37° C., and the activity of BEI is stopped with the Na2S2O with the final concentration (W/V) for 0.01% to 5%. BEI inactivates the virus mainly by acting on the viral nucleic acid, and the residual BEI is able to act on the cells while the inactivation inspection, thus, causing the cell death or poor growth, therefore, the activity of BEI is stopped before the inactivation inspection. The results show that, the activity of BEI cannot be fully neutralized when the final concentration of Na2S2O3 is less than 0.5%, and after the inactivation is stopped and the Vero cells are inoculated into an antigen solution, the cells are grown slowly, and the continuous passage is impossible; and when the final concentration of Na2S2O3 is not less than 0.5%, the activity of BEI can be fully neutralized, and after the inactivation is stopped and the Vero cells are inoculated into the antigen solution, the cells are grown normally, and the continuous passage is normal. Therefore, the final concentration of terminator Na2S2O3 is determined to be not less than 0.5%.
4. Inspection of Semi-Finished Product
4.1 Inspection of Virus Content
TCID50 of the PRV-YF strain is determined according to the conventional method after the viral multiplication, and the content of 1 ml virus is not less than 107.0 TCID50.
4.2 Inactivation Inspection
The inactivated virus liquid is inoculated into the Vero cells by 10% synchronously for continuous passage for 3 times, without the cytopathic effect.
4.3 Sterility Test
The sterility test is carried out in accordance with the current appendix of Chinese Veterinaty Pharmacopoeia and no bacterial growth is provided.
5. Preparation of Inactivated Vaccine of Porcine Pseudorabies PRS-YF Strain)
5.1 Preparation of Water Phase
The inactivated antigen of the PRV-YF strain which passes the inspection is taken and added into Tween-80 with the final concentration of 0.75% (taking the milliliter as the unit), and mixed while adding until Tween-80 is thoroughly dissolved; and the water phase is prepared.
5.2 Preparation of Oil Phase
141.75 parts of white oil (taking the milliliter as the unit) are taken, added into 7.5 parts of Span-80 (taking the milliliter as the unit), fully mixed, sterilized for 30 min at 121° C., and cooled to room temperature for standby.
5.3 Emulsification by the Proportion of the Oil Phase to the Water Phase as 1.5:1
The water phase is added into the oil phase slowly, sheared after homogenizing for 1-3 min; and a homogeneous emulsion is prepared, i.e. inactivated gene vaccine of porcine pseudorabies.
6. Finished Product Inspection of Vaccine
6.1 Nature Inspection
The water-in-oil milk white emulsion is dripped on the surface of cold water and not dispersed, the vaccine is centrifuged for 15 min at 3000 r/min, no water phase is separated out at the bottom of a pipe, and the viscosity is 27.5 cP.
6.2 Sterility Test
The sterility test is carried out in accordance with the current appendix of Chinese Veterinary Pharmacopoeia, and no bacterial growth is provided.
Embodiment 3 Detection for Immune Efficacy and Safety of Inactivated Vaccine of Porcine Pseudorabies (PRV-YF Strain)
I. Evaluation of Immune Efficacy of Inactivated Vaccine of Porcine Pseudorabies (PRV-YF Strain) with Mice
As pesudorabies virus can cause the obvious clinical symptom and death of the mice, it is convenient for clearly judging the immune efficacy of inactivated vaccine of porcine pseudorabies (PRV-YF strain).
1. Material
1.1 Virus and Cell
The YF strain and Vero cells of porcine pseudorabies virus are stored in the key laboratory created by the animal epidemic disease control biotechnology and product of Ministry of Agriculture of Zhaoqing Dahuanong Biotechnology Co., Ltd.
1.2 Experimental Animal
Balb/C female mice with 4-6 weeks of age are purchased from Guangdong Medical Laboratory Animal Center, and used for evaluating the immune efficacy of inactivated vaccine of porcine pseudorabies (PRV-YF strain).
1.3 Reagent
The fetal calf serum and DMEM medium are purchased from Gibco Company.
2. Determination of Immune Efficacy of Inactivated Vaccine of Porcine Pseudorabies (PRV-YF Strain)
2.1 Test Solution
Totally, 36 Balb/C female mice with 4-6 weeks of age are divided into 6 groups, 6 mice in each group. The specific solution is shown in Table 8:
TABLE 8
Test solution of immune efficacy
Immunizing dose Number
(ml/PCS) Times of immunization of animals
0.5 Primary immunization 6
Secondary immunization 6
1.0 Primary immunization 6
Secondary immunization 6
Non-immune toxic 6
control group
Blank control group 6
The secondary immunization is carried out in 4 weeks after the primary immunization. In 2 weeks after the secondary immunization, 100 LD50 (about 104.25 TCID50) PRV-YF strain is used for attacking, and the continuous observation is carried out for 14 days after the challenge.
2.2 Test Result
As shown in Table 9, all immunized mice are normal after the immunization; after the challenge for 48 h, the mice in the non-immune toxic control group show the pruritus, neurological symptom, anorexia and coarse and messy hair; the death is presented after 60 h, until that 6 mice in the whole group die completely in 96 h; and in the whole observation period after the challenge, all immunized mice are normal, which indicates that the inactivated vaccine of porcine pseudorabies (PRV-YF strain) in the present invention has good immune protective efficacy.
TABLE 9
Experimental result of immune efficacy
Immunizing Number Number of
dose Times of of accumulative deaths
(ml/PCS) immunization animals 48 h 72 h 96 h 120 h 144 h
0.5 Primary 6 −/6 −/6 −/6 −/6 −/6
immunization
Secondary 6 −/6 −/6 −/6 −/6 −/6
immunization
1.0 Primary 6 −/6 −/6 −/6 −/6 −/6
immunization
Secondary 6 −/6 −/6 −/6 −/6 −/6
immunization
Non-immune 6 −/6 5/6 6/6
toxic control
group
Blacnk 6 −/6 −/6 −/6 −/6 −/6
control
group
Note: −/6 indicates no death; 1/6 indicates that one mouse dies in 6 mice, and others are analogized.
II. Safety Evaluation of Inactivated Vaccine of Porcine Pseudorabies (PRV-YF Strain)
1. Experimental Animal
30 weaned piglets with negative porcine pseudorabies virus antibody, 30 replacement gilts and 30 pregnant sows are respectively purchased from the pig breeding farm of Wens Group.
2. Test solution: the reaction situation of the pig is carefully observed after immunizing neck muscles according to the above solution, and continuous observation is carried out for 21 days.
TABLE 10
Test solution of safety evaluation
Inoculation Number of
Animal Inoculation method dose animals
Weaned Primary inoculation with 2 ml/pig 5 pigs
piglets single dose
Repeated inoculation 2 ml/pig, interval 5 pigs
with single dose of 3 weeks
Primary inoculation with 4 ml/pig 5 pigs
super times of dose
Control 5 pigs
Replacement Primary inoculation with 2 ml/pig 5 pigs
gilts single dose
Repeated inoculation 2 ml/pig, interval 5 pigs
with single dose of 2 weeks
Primary inoculation with 4 ml/pig 5 pigs
super times of dose
Control 5 pigs
Pregnant Primary inoculation with 2 ml/pig 5 pigs
sows single dose
Repeated inoculation 2 ml/pig, interval 5 pigs
with single dose of 2 weeks
Primary inoculation with 4 ml/pig 5 pigs
super times of dose
Control 5 pigs
2. Safety Evaluation Test Result
As shown in Table 11, the results show that, the weaned piglets with 25 days old are subjected to the primary inoculation of vaccine with single dose, primary inoculation with super times of dose and repeated inoculation with single dose. The inoculation site of immunized piglets is not swollen, no abnormality is provided in the whole body, and all piglets are healthy and living. All experimental pigs are grown normally in the process of feeding, and have no accidental death and disease. Meanwhile, the young replacement gilts with 6 months of age are subjected to the primary inoculation of vaccine with single dose, primary inoculation with super times of dose and repeated inoculation with single dose. The inoculation site of immunized pigs is not swollen, no abnormality is provided in the whole body, and all pigs are healthy and living. All experimental pigs are grown normally in the process of feeding, and have no accidental death and disease. The results show that, the vaccine provided by the present invention is safe for the young replacement gilts with 6 months of age, regardless of primary inoculation with single dose, primary inoculation with super times of dose and repeated inoculation with single dose.
The results in Table 12 show that, one sow is aborted after inoculating for 15 days in the experimental group that the pregnant sows are subjected to the primary inoculation with single dose; and the control group that the primary inoculation with super times of dose, repeated inoculation with single dose and repeated injection of normal saline with single dose are carried out has no abnormal reaction. The aborted fetus is detected, PRV is not separated, and after analysis, the reason of abortion shall be attributed to the mechanical stimulation in the process of injecting the vaccine and grasping the pigs or other reasons, rather than the vaccine itself. Thus, it can be seen that, the vaccine is safe for the pregnant sows. All experimental pigs are grown normally in the process of feeding, and have no accidental death and disease. The results show that, the vaccine provided by the present invention is safe for the pregnant sows.
TABLE 11
Results of safety test of weaned piglets and replacement gilts
Age Observation items
in Inoculation Injection Times of General Injection
Animal Immunization way Quantity days route dose immunization reaction site Result
Weaned Primary inoculation 5 pigs 25 Neck muscle 2 ml/pig 1 No No 5/5 is health
piglets with single dose injection abnormality swelling and living
Primary inoculation with 5 pigs 25 Neck muscle 4 ml/pig 1 No No 5/5 is health
super times of dose injection abnormality swelling and living
Repeated inoculation 5 pigs 25 Neck muscle 2 ml/pig 2 No No 5/5 is health
with single dose injection abnormality swelling and living
Control 5 pigs 25 Neck muscle 2 ml/pig 2 No No 5/5 is health
injection abnormality swelling and living
Replacement Primary inoculation 5 pigs 180 Neck muscle 2 ml/pig 1 No No 5/5 is health
gilts with single dose injection abnormality swelling and living
Primary inoculation with 5 pigs 180 Neck muscle 4 ml/pig 1 No No 5/5 is health
super times of dose injection abnormality swelling and living
Repeated inoculation 5 pigs 180 Neck muscle 2 ml/pig 2 No No 5/5 is health
with single dose injection abnormality swelling and living
Control 5 pigs 180 Neck muscle 2 ml/pig 2 No No 5/5 is health
injection abnormality swelling and living
TABLE 12
Result of safety test of pregnant sows
Observation items
Inoculation Inoculation Injection Times of General Injection
Animal way Quantity route dose immunization reaction site Result
Pregnant Primary 5 pigs Neck muscle 2 ml/pig 1 No No 5/5 of sows are healthy
sows inoculation injection abnormality swelling and living; one sow is
with single accidentally aborted
dose due to the mechanical
stimulation and others
are delivered normally;
and the borne piglets
are normal
Primary 5 pigs Neck muscle 4 ml/pig 1 No No 5/5 of sows are healthy
inoculation injection abnormality swelling and living, and delivered
with super normally; and the borne
times of dose piglets are normal
Repeated 5 pigs Neck muscle 2 ml/pig 2 No No 5/5 of sows is healthy
inoculation injection abnormality swelling and living, and delivered
with single normally; and the borne
dose piglets are normal
Control 5 pigs Neck muscle 2 ml/pig 2 No No 5/5 of sows is healthy
injection abnormality swelling and living, and delivered
normally; and the borne
piglets are normal

Claims (8)

We claim:
1. A vaccine of porcine pseudorabies virus (PRV), comprising an adjuvant and a virus liquid containing an inactivated porcine pseudorabies virus PRV-YF strain; wherein the PRV-YF strain is isolated from tonsils and brain tissues of pathogenetic piglets; the preservation name is porcine pseudorabies virus PRV-YF strain; the preservation organization is China Center for Type Culture Collection (CCTCC); the preservation date is Jan. 21, 2015; and the preservation number is CCTCC No. V201502.
2. A preparation method for the vaccine of the porcine pseudorabies virus according to claim 1, comprising the following steps:
1) culturing the porcine pseudorabies virus PRV-YF strain to obtain a virus liquid;
2) adding an inactivator in the virus liquid for inactivating the virus; and then, adding a terminator for terminating inactivation to obtain an inactivated virus liquid of the PRV-YF strain; and
3) preparing a water phase and an oil phase and emulsifying to obtain the vaccine of the porcine pseudorabies virus.
3. The preparation method according to claim 2, characterized in that: the virus content of the virus liquid prepared in Step 1) is not less than 107.0 TCID50/ml.
4. The preparation method according to claim 2, characterized in that: the inactivator described in Step 2) is pyrrole; and weighing by w/v, the pyrrole added in the virus liquid accounts for 0.1% to 1% of the total amount of the virus liquid.
5. The preparation method according to claim 2, characterized in that: the inactivation time is 12 to 60 h; and the inactivation temperature is 37° C.
6. The preparation method according to claim 2, characterized in that: the terminator described in Step 2) is sodium thiosulfate; and weighing by w/v, the sodium thiosulfate added in the virus liquid accounts for 0.1% to 5% of the total amount of the virus liquid.
7. The preparation method according to claim 2, characterized in that: weighing by w/v, the sodium thiosulfate added in the virus liquid accounts for 0.5% to 5% of the total amount of the virus liquid.
8. The preparation method according to claim 2, characterized in that: Step 3) comprises the following steps:
A. Preparation of water phase: taking the inactivated virus liquid of the PRV-YP strain prepared in Step 2) and adding the same into Span-80 with the final concentration of 0.75%, mixing while adding until Span-80 is thoroughly dissolved, thereby generating the water phase;
B. Preparation of oil phase: taking 141.75 parts of white oil, adding 7.5 parts of Span-80, fully mixing, sterilizing for 30 min at 121° C., cooling to room temperature for standby, thereby generating the oil phase;
C. Emulsifying the oil phase and the water phase by 1.5:1; adding the water phase into the oil phase slowly, shearing after homogenizing for 1-3 min, thereby generating a homogeneous emulsion.
US15/011,608 2015-02-11 2016-01-31 Porcine pseudorabies virus (PRV)-YF strain and its application Active US9783788B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN201510075712.4 2015-02-11
CN201510075712.4A CN104774811B (en) 2015-02-11 2015-02-11 A kind of porcine pseudorabies virus PRV-YF plants and its application
CN201510075712 2015-02-11

Publications (2)

Publication Number Publication Date
US20160228538A1 US20160228538A1 (en) 2016-08-11
US9783788B2 true US9783788B2 (en) 2017-10-10

Family

ID=53616585

Family Applications (1)

Application Number Title Priority Date Filing Date
US15/011,608 Active US9783788B2 (en) 2015-02-11 2016-01-31 Porcine pseudorabies virus (PRV)-YF strain and its application

Country Status (2)

Country Link
US (1) US9783788B2 (en)
CN (1) CN104774811B (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107653230A (en) * 2017-08-31 2018-02-02 浙江大学 A kind of II type pseudoabies poison strain and its application
CN108048413B (en) * 2017-12-20 2021-06-25 哈药集团生物疫苗有限公司 Pseudorabies virus canine animal isolate, inactivated vaccine prepared from pseudorabies virus canine animal isolate and application of pseudorabies virus canine animal isolate
CN110105447A (en) * 2019-04-30 2019-08-09 成都天邦生物制品有限公司 A kind of preparation method of porcine pseudorabies virus hyper-immune serum
CN110241090B (en) * 2019-05-07 2023-10-13 江苏南农高科技股份有限公司 Method for producing porcine pseudorabies virus antigen by full suspension cell culture
CN111035756B (en) * 2019-12-23 2023-08-15 武汉科前生物股份有限公司 Porcine pseudorabies virus and porcine epidemic diarrhea virus combined inactivated vaccine and preparation method thereof
CN120173900A (en) * 2025-03-18 2025-06-20 中国兽医药品监察所 A pseudorabies virus inactivated antigen standard, preparation method and application thereof, and a high performance liquid chromatography detection method for antigens in pseudorabies virus inactivated vaccines

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102344912B (en) * 2011-09-20 2013-08-14 哈药集团生物疫苗有限公司 Porcine pseudorabies virus strain and porcine pseudorabies inactivated vaccine prepared by using same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
GenBank: EF552427.1 . Suid herpesvirus 1 strain GDSH glycoprotein gE (gE) gene, complete cds. May 19, 2007. *

Also Published As

Publication number Publication date
CN104774811B (en) 2018-10-19
CN104774811A (en) 2015-07-15
US20160228538A1 (en) 2016-08-11

Similar Documents

Publication Publication Date Title
US9783788B2 (en) Porcine pseudorabies virus (PRV)-YF strain and its application
RS62414B1 (en) Novel vaccine compositions for porcine epidemic diarrhea virus
CN106148287B (en) Porcine epidemic diarrhea virus strain and vaccine composition, preparation method and application thereof
CN105816868B (en) Inactivated vaccine for mycoplasma synoviae
CN107184969A (en) A kind of A types Sai Nika paddy viral inactivation vaccines and its preparation method and application
CN111808826B (en) Porcine Senecavirus A SVA/CH-Fuj Strain and Its Application
CN111748529B (en) Porcine pseudorabies virus strain and application thereof
US10633637B2 (en) Pestivirus vaccines for congenital tremors
CN105441368B (en) One plant of Mycoplasma bovis and its application
Matsiela et al. Safety and immunogenicity of inactivated Rift Valley Fever Smithburn viral vaccine in sheep
CN118048320A (en) A novel duck reovirus and its application in egg yolk antibody
CN102727883B (en) Combined live vaccine against porcine reproductive and respiratory syndrome and swine fever, and application thereof
RU2436296C2 (en) Improved method of obtaining bird's eggs and birds, free of specific microorganisms
CN113491767A (en) Triple inactivated vaccine for duck circovirus disease, novel duck reovirus disease and duck viral hepatitis and preparation method thereof
CN112063596A (en) Pigeon Paramyxovirus Type 1 PPMV-1/BJ-C Strain and Its Application
CN104288760A (en) Vaccine composition, and preparation method and application thereof
CN105770881A (en) Mycoplasma gallisepticum (MG) and mycoplasma synoviae (MS) combined inactivate vaccine
CN105641693A (en) Preparation method of combined bovine viral diarrhea(BVD)/mucosal disease-infectious bovine rhinotracheitis(IBR) inactivated vaccine
CN108118032A (en) The culture of 2 type strain of Porcine epidemic diarrhea virus and the development of inactivated vaccine
CN106190991A (en) A kind of avian encephalomyclitis virus, inactivated vaccine and preparation method thereof
TWI306404B (en) Method of vaccination against testicular bvdv infection
CN101380470A (en) Pig parvovirus live vaccine
CN102727882A (en) Combined live vaccine against porcine reproductive and respiratory syndrome, swine fever and pseudorabies, and preparation method thereof
Sharma et al. Viral infections of pig: Signs, prevention, and control
CN104906570A (en) Newcastle disease and H9 subtype bird flu combined inactivate vaccine and preparing method thereof

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: SURCHARGE FOR LATE PAYMENT, SMALL ENTITY (ORIGINAL EVENT CODE: M2554); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 4

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 8