CN118048320A

CN118048320A - Novel duck reovirus and application thereof in yolk antibody

Info

Publication number: CN118048320A
Application number: CN202410238396.7A
Authority: CN
Inventors: 杜新永; 刘军伟; 李晓娟; 李鹏; 杨笠琪
Original assignee: Qingdao Runda Biotechnology Co ltd
Current assignee: Qingdao Runda Biotechnology Co ltd
Filing date: 2024-03-04
Publication date: 2024-05-17

Abstract

The invention discloses a novel duck reovirus strain, wherein the preservation number of the novel duck reovirus strain RDQD-1 is CGMCC No.45765. The invention also provides an inactivated vaccine and a yolk antibody prepared by the strain. Compared with serum antibody, the yolk antibody of the invention can be purified to obtain the yolk antibody by collecting immune hyperimmune egg yolk and purifying without blood sampling; has good stability, heat resistance and acid resistance, and can still keep certain activity at normal temperature; obvious treatment effect, strong specificity and suitability for mass production; safe, high-efficiency, residue-free, mild and environment-friendly. The yolk antibody prepared by the novel reovirus RDQD-1 has better effect of resisting viruses compared with the yolk antibody of the reovirus purchased in the market.

Description

Novel duck reovirus and application thereof in yolk antibody

Technical Field

The invention relates to the technical field of biological products for animals, in particular to a novel duck reovirus and application thereof in egg yolk antibodies.

Background

In recent years, in China, the land ducks such as Shandong, hebei, henan, anhui and Jiangsu are exploded in a large scale and have infectious diseases with spleen necrosis as main symptoms, and the infectious diseases mainly cause spleen enlargement, bleeding and necrosis of the ducks at all ages, so that the egg laying and weight of the meat ducks are reduced, the feed conversion ratio is increased, the slaughtering qualification rate of the meat ducks is obviously reduced, and serious economic losses are caused for the meat ducks and the breeding ducks.

The research shows that the outbreak of the disease is caused by the infection of a novel duck reovirus, no prevention can be performed at present, and the existing commercial duck reovirus vaccine can not effectively prevent and control the disease.

The yolk antibody is used as an effective prevention and control means for epidemic diseases, has the characteristics of high safety, quick response and strong specificity, is always favored and paid attention to by local breeding users, but the problems of large quality difference of the antibody, high titer loss, low purity, large lipid substance residues and the like are particularly remarkable due to various extraction methods of the yolk antibody in China.

Therefore, there is an urgent need for a yolk antibody that is safe and highly potent in preventing the novel duck reovirus.

Disclosure of Invention

The invention aims to solve the problems and provides a novel duck reovirus and application thereof in egg yolk antibodies.

Specifically, the technical scheme provided by the application is as follows:

in a first aspect, the invention provides a novel duck reovirus strain, wherein the preservation number of the novel duck reovirus strain RDQD-1 is CGMCC No.45765.

In a second aspect, the invention provides an application of the novel duck reovirus strain RDQD-1 in preparing inactivated vaccine.

In a third aspect, the invention provides an inactivated vaccine, wherein the antigen in the inactivated vaccine comprises the novel duck reovirus strain RDQD-1 in the first aspect.

Further, the preparation method of the inactivated vaccine comprises the following steps:

S1: inoculating the novel duck reovirus strain of the first aspect with 8-day-old healthy SPF chick embryos according to the dose of 0.2 mL/piece, discarding dead chick embryos within 24 hours, collecting allantoic fluid of the dead chick embryos within 24-120 hours to obtain virus liquid, and preserving at-20 ℃;

s2: adding the virus liquid obtained in the step S1 into 10% formaldehyde solution, and stirring and inactivating for 24 hours at 37 ℃; sampling and detecting after inactivation, and storing at 2-8 ℃ for standby;

S3: preparing an antigen according to the ratio of 8:3 (V/V) of the mineral oil adjuvant to the inactivated virus liquid, placing 8 parts of the mineral oil adjuvant into a high-speed shearing instrument, stirring at 15000r/min, rapidly adding 3 parts of the inactivated virus liquid, and stirring for 2 minutes to fully emulsify the mixture; after emulsification, sterile operation is carried out, the mixture is packaged into 250ml sterile bottles, names, preparation time, loading amount and the like are marked on the outer walls of the bottles, and the bottles are preserved at the temperature of 2-8 ℃.

In a fourth aspect, the invention provides the use of a novel duck reovirus strain RDQD-1 as described in the first aspect for the preparation of a yolk antibody.

In a fifth aspect, the present invention provides a yolk antibody prepared using the novel duck reovirus strain RDQD-1 as described in the first aspect as an antigen.

Further, the preparation method of the yolk antibody comprises the following steps:

s1: preparing immune laying hens and collecting hyperimmune eggs;

S2: sterilizing eggshells and separating yolk;

S3: inactivation I: fully stirring the collected yolk to ensure that the yolk is in a uniform paste form, adding sterilized water for injection which is equal to the yolk in volume, uniformly stirring and mixing, and preserving (inactivating) the yolk at 60-65 ℃ for 30 minutes;

S4: acidifying and extracting: adding sterilized injection water with the volume 7 times of the original yolk into a sterile acidification tank, then transferring into inactivated yolk liquid, stirring while adding, keeping the temperature of the yolk liquid to be reduced to 4 ℃, standing overnight, and directly extracting the supernatant;

S5: inactivation II: adding octanoic acid with the final concentration of 0.1% into the extracted supernatant as an inactivating agent and an extracting agent, stirring, and standing at room temperature for 2-6 hours;

S6: concentrating: filtering the yolk liquid treated by adding octanoic acid by a cylinder type filter element with the aperture of 5 mu m and 1 mu m, and concentrating by a hollow fiber ultrafiltration column with the molecular weight cut-off of 100kD for 2-4 times;

s7: inactivation III: adding formaldehyde solution according to the final concentration of 0.1%, fully stirring and uniformly mixing, and sealing and inactivating for 2 hours;

S8: and (3) filtering and sterilizing: adjusting the pH value of the solution to 6.5-7.2, and filtering and sterilizing by using a cylinder type filter element with the thickness of 0.45 mu m and 0.22 mu m;

S9: antibody titer determination: the titer of neutralizing antibodies of the novel duck reovirus is not lower than 1:256;

S10: and (5) subpackaging: quantitatively packaging, sealing, and preserving at 2-8 ℃.

Further, S8: and (3) filtering and sterilizing: the pH value of the solution is regulated to 6.5-7.2, and the clarity and the neutralizing antibody titer bacteria of the yolk antibody solution obtained after regulating the pH value have good stability, and the clarity and the antibody titer of the yolk antibody solution obtained without regulating the pH value are unstable.

Furthermore, the method for preparing the immune laying hen and collecting the hyperimmune egg by the S1 comprises the following steps: the first immunization is carried out by subcutaneously injecting 1.0mL into each chicken neck, the second immunization is carried out after 15 days, the subcutaneous injection is carried out for 2.0mL into each chicken neck, the third immunization is carried out after 15 days after the second immunization, the subcutaneous injection is carried out for 2.0mL into each chicken neck, the boost immunization is carried out after 30 days after the third immunization, the subcutaneous injection is carried out for 2.0mL into each chicken neck, the 15 days after the boost immunization, and the titer of the novel duck reovirus neutralizing antibody is measured by collecting yolk and is not lower than 1: at 312, hyperimmune eggs are collected.

Further, the egg yolk antibody is used in a mode of pre-infection prevention and/or post-infection treatment.

Further, the injection dosage of the egg yolk antibody is 0.5-1.5 mL/egg yolk antibody.

The invention has the following beneficial effects:

1. The invention separates a novel reovirus RDQD-1 with strong specificity, the preservation number is CGMCC No.45765, and the antibody prepared by using the strain has good immune effect.

2. Compared with serum antibody, the egg yolk antibody of the invention has the following advantages:

(1) The yolk antibody can be purified by collecting immune hyperimmune egg yolk and purifying without blood sampling;

(2) Has good stability, heat resistance and acid resistance, and can still keep certain activity at normal temperature;

(3) Obvious treatment effect, strong specificity and suitability for mass production;

(4) Safe, high-efficiency, residue-free, mild and environment-friendly.

3. The yolk antibody prepared by the novel duck reovirus RDQD-1 has better effect of resisting viruses compared with the yolk antibody of the duck reovirus purchased in the market.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It is apparent that the drawings in the following description are only one embodiment of the present invention, and that other embodiments of the drawings may be derived from the drawings provided without inventive effort for a person skilled in the art.

Fig. 1: the sigma C gene genetic evolution analysis tree of the invention;

Fig. 2: the duck reovirus detection electrophoresis chart of the invention; wherein, lane 1: a Marker; lanes 2-4: a duck reovirus sample; lane 5: duck reo negative control (no band);

fig. 3: the invention discloses a novel duck reovirus RDQD-1 electron microscope image.

Detailed Description

The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments, and the following embodiments are only for illustrating the present invention and not limiting the scope of the present invention in any way. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to fall within the scope of the invention. The experimental methods used in the invention are conventional methods unless otherwise specified. Materials, reagents, and the like used in the present invention are commercially available unless otherwise specified. In addition, other terms used in the present invention generally have meanings commonly understood by those of ordinary skill in the art unless otherwise indicated.

Example 1: isolation, purification, identification and preservation of novel duck reovirus

1.1 Isolation and purification of viruses

(1) Taking spleen of a severe spleen necrosis symptom patient detected by farms in a plurality of areas such as Weifang, linyi and Qingdao in Shandong province, adding 5 times of physiological saline, fully grinding, repeatedly freezing and thawing for 3 times, centrifuging at 6000rpm for 10min, and taking supernatant for subsequent experiments.

(2) Filtering and sterilizing the supernatant by using a 0.22 mu m filter, inoculating 8-day-old SPF chick embryos to the yolk sac, placing the chick embryos in a 37 ℃ incubator for culture, observing the conditions of the chick embryos every day, discarding the dead chick embryos in 24 hours, collecting allantoic fluid of the dead chick embryos in 24-120 hours, and after three generations of blind transmission, collecting third-generation allantoic fluid for RT-PCR identification as positive, namely the separated NDRV, wherein the strain is RDQD-1.

1.2 Molecular biological identification

The NDRV sigma C protein is encoded by the S1 gene, is a minor component of the outer viral capsid, is the site of action of the virus to bind to cellular receptors, and is capable of inducing the production of neutralizing antibodies by the host. The sigma C protein is often used as a genetic marker for avian orthoreovirus isolates.

The strain RDQD-1 is subjected to sigma C gene sequence determination, and the nucleic acid sequence obtained by the determination is shown as SEQ ID NO by using MEGA7.0 software: 1 and published sigma C gene sequences on NCBI, genetic evolution analysis was performed by a contiguity method and a phylogenetic tree was constructed using 500 Bootstrap repeats, the reference strain information for constructing the phylogenetic tree is shown in table 1, the phylogenetic tree is shown in fig. 1, SEQ ID NO:1 is as follows:

CCTTTCGCTCTGCTATTATCTTAATACACCTTTCGAGTTTGGAATTGCCGCTATTGAGGGTCGTCCCGGTGACTATTATTTGCTGTTCGCTGGCAAGTCCAGTGATTCTAACTCGCGAGTATCTTTGTACGCTACGCGGCAAGCTGGTGACGATGGATCGCAACGAGGTGATACGCCTGATACTTTCCCTCCTCCCCTACCAGTCAAGCGACGTCGATCATTTGACGACACAGATCAAATCCCTCCAAAGCGCCGTCGACTCACTGAAAGAATCACAAGTGGTAGTGTTGAGACGCCTGACTACGATTACGTCGACGGTGGCGGATCTACAATCAACAACTGAATTGTTGACCTCACAGGTGGCAGGACTTAGTTCCCGTGTGGCTTCAGTGACTGATGAGGTAGTCCGTGTAAATTCAGTGATTGGAACTACGATCACTAATCTTGACAGTGTCCGGTCCGAGCTATCCTCTCTCTCCTCCCAAGTCTCGTCGCAGACGTCCACTCTAACGAATCTTACATCAACCGTTTCATCCCAGTCTCTTGCGATTTCTGATCTCCAGCGACGAGTTACGGCCTTAGAACGATCGGGTGGTGCGCCGATGCAATTTGAAGCTCCCTTGCACCTACAAAACGGAGTCGTCTCACTTCAAGCATCTCCCTCTTTCTGTTC TTTGTCTCCGATCCTCTCCGGACCTGCTGATGCTGCTGTCTTTAAGGTTGGTGAGTGGCTGGGAACTGTCATATCTGG

Table 1: reference strain information

As can be seen from FIG. 1, the sigma C gene fragment of strain RDQD-1 is located in a relatively independent branch, indicating that the newly isolated strain RDQD-1 is different from other avian reoviruses and is 1 individual species of the genus orthoreovirus.

SEQ ID NO: 1: σcf: ACTCGTGGCGTCTTATATC; sigma CR: TGGCGGAATAGTGAATACAT; the size of the target fragment is 997bp; PCR procedure: 95 ℃ for 5min;95 ℃ 40s,52 ℃ 40s,72 ℃ 80s,32 cycles; 72 ℃ for 10min;4 ℃.

1.3, Observation and identification by an electron microscope:

dropping 20 mu L of liquid containing virus on a copper net, naturally precipitating for 15min, sucking redundant liquid from the side face by using filter paper, adding a drop of 2% phosphotungstic acid (PTA) on the copper net to dye phage for 10min, sucking the dyed liquid from the side face by using filter paper, and observing the virus form by using an electron microscope after a sample is dried, wherein an electron microscopic image of the strain is shown as 3.

1.4 Preservation of strains

The novel duck reovirus RDQD-1 strain obtained in the separation and purification of the 1.1 virus is preserved in China general microbiological culture Collection center (CHINA GENERAL Microbiological Culture Collection Center, CGMCC for short) at the 12 th month 25 of 2023, and the preservation address is: the preservation number of the Qingyang area North Star Xili No. 1 and 3 of Beijing is CGMCC No.45765.

Example 2: antigen preparation

2.1 Virus propagation procedure

The novel duck reovirus strain isolated and preserved in the example 1 is inoculated with 8-day-old healthy SPF chick embryos according to the dosage of 0.2 mL/piece, dead chick embryos are discarded within 24 hours, allantoic fluid of the dead chick embryos within 24-120 hours is collected, and virus liquid is obtained and stored at the temperature of minus 20 ℃.

The novel duck reovirus strain isolated and deposited in example 1 was inoculated with 8-day-old SPF chick embryos (0.2 mL/piece) and 8-day-old duck embryos (0.2 mL/piece) via yolk sac, and sterile PBS was used as a negative control. Discarding the dead chick embryo and duck embryo within 24 hours, collecting allantoic fluid of the dead chick embryo and duck embryo for 24-120 hours, and carrying out RT-PCR detection and ELD ₅₀ determination.

Experimental results show that the collected allantoic fluid of the chick embryo and the duck embryo is positive through RT-PCR detection; ELD ₅₀ was measured as 10 ^-5.25/0.2 mL for allantoic fluid collected from chick embryos, and ELD ₅₀ was measured as 10 ^-2.63/0.2 mL for allantoic fluid collected from duck embryos. Therefore, SPF chick embryos were subsequently used to vaccinate the novel duck reovirus in this experiment.

2.2 Inactivation

The collected virus solution was added to a 10% formaldehyde solution to give a final concentration of 0.1%, and the mixture was inactivated by stirring at 37℃for 24 hours (from the rise of the antigen temperature to 37 ℃). After the inactivation is finished, sampling is carried out respectively, the inactivation test is carried out, and the inactivated virus liquid is preserved at the temperature of 2-8 ℃ for standby.

2.3 Preparation of antigens

The antigen is prepared according to the ratio of 8:3 (V/V) of mineral oil adjuvant and inactivated virus liquid. 8 parts of mineral oil adjuvant is taken and placed in a high-speed shearing instrument, 3 parts of inactivated virus liquid is rapidly added while stirring at 15000r/min, and the mixture is fully emulsified after stirring for 2 minutes. After emulsification, sterile operation is carried out, the mixture is packaged into 250ml sterile bottles, names, preparation time, loading amount and the like are marked on the outer walls of the bottles, and the bottles are preserved at the temperature of 2-8 ℃.

2.4 Antigen assay

The preparation of the inactivated vaccine comprises the following steps: the quality inspection of dosage form, stability, viscosity and sterility and safety is carried out, and the specific method is referred to the pharmacopoeia of the people's republic of China (2015 edition).

The results were as follows: the preparation form of the inactivated vaccine prepared by the invention is water-in-oil (W/0); stability, viscosity and sterility and safety checks meet the requirements of the pharmacopoeia of the people's republic of China (2015 edition).

Example 3: preparation of novel duck reovirus yolk antibody

3.1 Immunization program

The prepared novel duck reovirus inactivated vaccine is used for immunizing laying hens, 1.0mL of each chicken neck is subcutaneously injected for the first time, the second immunization is carried out after 15 days, 2.0mL of each chicken neck is subcutaneously injected, the third immunization is carried out after 15 days after the second immunization, 2.0mL of each chicken neck is subcutaneously injected, the boosting immunization is carried out after 30 days after the third immunization, 2.0mL of each chicken neck is subcutaneously injected, 15 days after the boosting immunization, and the titer of the novel duck reovirus neutralizing antibodies is measured by collecting yolk and is not lower than 1: at 312, hyperimmune eggs are collected.

3.2 Preparation of egg yolk antibody

(1) Eggshell sterilization: the eggshells are seriously polluted, the eggshells are singly selected and cleaned, and are soaked into a 0.1% new Jieer water solution together with other clean eggs for sterilization for 15 minutes after being washed clean by clean water, taken out and dried, and then fumigated by formaldehyde for 30 minutes.

(2) Separation of egg yolk: manually or mechanically whisking eggs. Egg white, blastoderm and lacing should be removed sufficiently during egg breaking, and yolk is collected.

(3) Inactivation I: fully stirring the collected yolk to make the yolk into uniform paste, adding sterilized water for injection which is equal to the yolk in volume, uniformly stirring and mixing, and preserving (inactivating) the yolk at 60-65 ℃ for 30 minutes.

(4) Acidifying and extracting: the sterilized water for injection (pH 3.0 was adjusted in advance with hydrochloric acid for sterilization water for injection) was added to the sterilized acidification tank at a volume of 7 times the original yolk, and cooled to 4 ℃. Then transferring into the inactivated yolk liquid, stirring while adding, keeping the temperature and standing overnight when the temperature of the yolk liquid is reduced to 4 ℃, and directly extracting the supernatant.

(5) Inactivation II: adding octanoic acid with the final concentration of 0.1% into the extracted supernatant as an inactivating agent and an extracting agent, stirring and standing at room temperature for 2-6 hours.

(6) Concentrating: filtering the yolk liquid treated by adding octanoic acid by a cylinder type filter element with the aperture of 5 mu m and 1 mu m, and concentrating by a hollow fiber ultrafiltration column with the molecular weight cut-off of 100kD for 2-4 times.

(7) Inactivation III: adding formaldehyde solution according to the final concentration of 0.1%, fully stirring and uniformly mixing, and sealing and inactivating for 2 hours.

(8) And (3) filtering and sterilizing: adding proper amount of sodium hydroxide solution to regulate pH value to 6.5-7.2, and filtering and sterilizing with 0.45 micron and 0.22 micron cylinder filter element.

(9) Antibody titer determination: the titer of neutralizing antibodies of the novel duck reovirus should be no less than 1:256.

(10) And (5) subpackaging: quantitatively packaging, sealing, and preserving at 2-8 ℃.

3.3 Preparation of egg yolk antibodies different process stability analysis

Separating yolk from the same batch of hyperimmune eggs, extracting, inactivating, dividing into two groups, adding a proper amount of sodium hydroxide solution into group A to adjust the pH value to 6.5-7.2, filtering and sterilizing to obtain yolk antibody solution; and B, directly filtering and sterilizing the egg yolk antibody solution without regulating the pH value. The stability of the two groups of egg yolk antibody solutions was compared by observing the clarity of the solution and determining the antibody titer. The results are shown in tables 2 and 3, and the A-group egg yolk antibody has good stability and the B-group egg yolk antibody has unstable clarity and antibody titer.

TABLE 2 clarity of different groups of egg yolk antibodies for different time periods

TABLE 3 neutralizing antibody titers of different groups of egg yolk antibodies were maintained for different times

Example 4: antibody titer detection and duckling protection experiments

Determination of the number of half-cell infections (TCID ₅₀) of 4.1RDQD23-1 Strain

The novel duck reovirus is subjected to 10-time gradient dilution, inoculated into 96-well plates with LMH cells in a monolayer, each dilution is inoculated into 8 wells, each well is inoculated with 0.1mL, and normal cell control is set. 120h were observed daily and the results recorded. TCID ₅₀ of the virus was calculated per 0.1mL of cell culture medium according to Reed-Mueneh method, and the results are shown in Table 4.

Table 4: inoculated LMH cell infection Rate and TCID of RDQD-23-1 Strain ₅₀

4.2 Determination of neutralizing antibody titers

The antibody is diluted by 2 times of sterilized normal saline, four dilutions of 1:64, l:128, 1:256 and 1:512 are respectively mixed with the equivalent novel duck reovirus (200 TCID ₅₀/0.1 ml), the mixture is neutralized for 1 hour at 37 ℃, each dilution is inoculated with 8 holes of 96-hole cell plates containing LMH cells with good growth state, 0.1ml of each hole is supplemented with cell maintenance solution to 0.2m1, meanwhile, 8 holes of virus control and 8 holes of normal cell control are arranged, the mixture is cultured in a 37 ℃ 5% CO ₂ incubator for 120 hours, daily observation is carried out, and CPE conditions are recorded.

The results show that: all virus control cells are diseased, all normal control cells are healthy, and the neutralizing antibody titer is calculated according to a Reed-Muench method and is 1:312.

4.3 Duckling protection experiments

40 Ducklings (novel duck reovirus maternal antibodies are < 1:4) at 1 day of age are randomly divided into A, B, C, D groups of 10. Group A is a prophylaxis group, and each neck is subcutaneously or intramuscularly injected with 0.5ml of the yolk antibody prepared in example 3; group B is a toxicity counteracting control group, and each neck is injected with 0.5ml of physiological saline subcutaneously or intramuscularly; group C is an antibody blank group, and each neck is injected with 0.5ml of the yolk antibody prepared in example 3 subcutaneously or intramuscularly; group D is a healthy control group, without any injection of any items. The 4 groups are kept separately, 7 days after antibody injection, A, B groups of novel duck reovirus liquid which is diluted 10 times by normal saline is used for intramuscular injection, each group of novel duck reovirus liquid is 0.5ml, the continuous observation is carried out for 10 days, and the morbidity and mortality of duckling in each group are recorded.

Results: 10/10 protection (protection rate 100%) after group A virus attack; group B begins to attack after 12 hours of toxin attack, 8 deaths (death rate 80%) are within 10 days; group C and group D, all healthy.

Example 5: group test

The method comprises the steps of selecting a disease-causing duck farm of a certain white feather duck farm of a Weifang as a test area, dividing the duck farm into A, B duck houses, and respectively breeding 5000 white feather ducks of 5 days old. Meat ducks of the two duck sheds are treated, and the duck shed in the area A: injecting 1.5 mL/duck reovirus egg yolk antibody purchased in the market; zone B duck shed: the RDQD-1 strain virus egg yolk antibody is injected for 1.5 mL/duck, and the death condition of the meat duck is recorded after continuous observation for 10 days.

Results: the protection rate of the meat ducks in the area A is 82% after treatment, and the protection rate of the meat ducks in the area B is 95% after treatment. The yolk antibody prepared from the novel duck reovirus liquid can effectively resist viruses, and the prepared antibody has a good effect.

It will be understood that equivalents and modifications will occur to those skilled in the art in light of the present teachings and concepts, and all such modifications and substitutions are intended to be included within the scope of the present invention as defined in the accompanying claims.

Claims

1. The novel duck reovirus strain is characterized in that the preservation number of the novel duck reovirus strain RDQD-1 is CGMCC No.45765.

2. The use of a novel duck reovirus strain RDQD-1 as claimed in claim 1 for the preparation of an inactivated vaccine.

3. An inactivated vaccine, wherein the antigen in the inactivated vaccine comprises the novel duck reovirus strain RDQD-1 of claim 1.

4. An inactivated vaccine according to claim 3, wherein the inactivated vaccine is prepared by the method comprising:

s1: inoculating the novel duck reovirus strain of claim 1 into 8-day-old healthy SPF chick embryos according to the dose of 0.2 mL/piece, discarding dead chick embryos within 24 hours, collecting allantoic fluid of the dead chick embryos within 24-120 hours to obtain virus liquid, and preserving at-20 ℃;

S3: mineral oil adjuvant and inactivated virus liquid 8:3 (V/V), 8 parts of mineral oil adjuvant is taken and placed in a high-speed shearing instrument, 3 parts of inactivated virus liquid is rapidly added while stirring at 15000r/min, stirring is carried out for 2 minutes to fully emulsify the mixture, and the mixture is preserved at 2-8 ℃.

5. The use of a novel duck reovirus strain RDQD-1 as claimed in claim 1 for the preparation of egg yolk antibodies.

6. A yolk antibody, which is prepared by using the novel duck reovirus strain RDQD-1 as an antigen.

7. The egg yolk antibody according to claim 6, wherein the egg yolk antibody is prepared by the following method:

s1: preparing immune laying hens and collecting hyperimmune eggs;

S2: sterilizing eggshells and separating yolk;

S3: inactivation I: fully stirring the collected yolk to make the yolk into uniform paste, adding sterilized injection water with the same volume as the yolk, uniformly stirring and mixing, and inactivating for 30 minutes at 60-65 ℃;

s9: antibody titer determination: the titer of the novel duck reovirus neutralizing antibody is not lower than 1:256;

8. The egg yolk antibody according to claim 7, wherein the method for preparing immune laying hens and collecting hyperimmune eggs by S1 comprises the following steps: the first immunization is carried out by subcutaneously injecting 1.0mL into each chicken neck, carrying out the second immunization after 15 days, subcutaneously injecting 2.0mL into each chicken neck, carrying out the third immunization after 15 days after the second immunization, subcutaneously injecting 2.0mL into each chicken neck, carrying out the boost immunization after 30 days after the third immunization, subcutaneously injecting 2.0mL into each chicken neck, collecting yolk, and measuring the titer of the novel reovirus neutralizing antibody to be not lower than 1: at 312, hyperimmune eggs are collected.

9. A yolk antibody according to claim 6, wherein the yolk antibody is used in a pre-infection prophylaxis and/or post-infection treatment.

10. A yolk antibody according to claim 9, wherein the yolk antibody is injected in an amount of 0.5-1.5 mL/min.