US8323933B2 - Vector for transformation using transposons, microorganisms transformed by the vector, and method for producing L-lysine using the same - Google Patents

Vector for transformation using transposons, microorganisms transformed by the vector, and method for producing L-lysine using the same Download PDF

Info

Publication number
US8323933B2
US8323933B2 US12/867,649 US86764909A US8323933B2 US 8323933 B2 US8323933 B2 US 8323933B2 US 86764909 A US86764909 A US 86764909A US 8323933 B2 US8323933 B2 US 8323933B2
Authority
US
United States
Prior art keywords
lysine
vector
gene encoding
gene
corynebacterium glutamicum
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
US12/867,649
Other versions
US20100330624A1 (en
Inventor
Jae-Woo Jang
Sang-Jo Lim
Jong-Soo Choi
Chul-Ha Kim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CJ CheilJedang Corp
Original Assignee
CJ CheilJedang Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CJ CheilJedang Corp filed Critical CJ CheilJedang Corp
Assigned to CJ CHEILJEDANG CORPORATION reassignment CJ CHEILJEDANG CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHOI, JONG-SOO, JANG, JAE-WOO, KIM, CHUL-HA, LIM, SANG-JO
Publication of US20100330624A1 publication Critical patent/US20100330624A1/en
Application granted granted Critical
Publication of US8323933B2 publication Critical patent/US8323933B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/64General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/08Lysine; Diaminopimelic acid; Threonine; Valine

Definitions

  • the present invention relates to a vector for transformation using a transposon gene, a microorganism transformed with the said vector, and a preparation method of lysine using the said microorganism.
  • Corynebacterium is a Gram-positive microorganism used for the production of L-amino acid.
  • L-amino acid particularly L-lysine, has been widely used for the production of animal feeds, medicines for human, and cosmetics. This amino acid is generated by the fermentation using Corynebacterium.
  • the conventional production method of L-lysine has used Corynebacterium having enhanced L-lysine biosynthesis related gene.
  • Corynebacterium having enhanced L-lysine biosynthesis related gene.
  • U.S. Pat. No. 6,746,855 describes a production method of L-lysine by culturing Corynebacterium sp. which enhanced the lysine releasing carrier gene lysE and introduced with an additional gene selected from the group consisting of dapA encoding dihydrodipicolinate synthase, lysC encoding aspartate kinase, pyc encoding pyruvate carboxylase and dapB encoding dihydropicolinate reductase.
  • dapA encoding dihydrodipicolinate synthase
  • lysC encoding aspartate kinase
  • pyc encoding pyruvate carboxylase
  • dapB encoding dihydropicolinate reduct
  • 6,221,636 describes Corynebacteria transformed with recombinant DNA containing the DNA sequence encoding diaminopimelate dicarboxylase and the DNA sequence encoding aspartokinase which is substantially insensitive to feedback inhibition by L-lysine and L-threonine.
  • tandem repeat which inserts an additional gene into the right next to the intrinsic gene.
  • the other method is to insert an additional gene into one or more chromosome regions of Corynebacterium sp. (U.S. Pat. No. 7,160,711).
  • these methods are limited in gene insertion sites, indicating that it is very difficult to insert multiple genes.
  • To overcome this problem it has been attempted to insert target genes in the region of multiple copies of rDNA on the genome. It was reported that this method was more successful than the previous ones. Nevertheless, this method has still a limitation because the destruction of two or more rDNA copies can affect the growth of the microorganism.
  • Transposon is also called Insertional Sequence Element, which is the sequence that can be moved on chromosome or on plasmid. Transposon includes transposase, which shows the activity to recognize a specific sequence for the insertion. Up to date, hundreds of transposons have been reported in a variety of bacteria (TRANSPOSON-BASED STRATEGIES FOR MICROBIAL FUNCTIONAL GENOMICS AND PROTEOMICS (2003) Annual Review of Genetics 37: 3-29 Finbarr Hayes).
  • the present inventors have tried to develop a strain that can produce lysine at high concentration by using a vector for transformation available for insertion of two or more copies of a target gene regardless of location, without inhibiting the growth of the microorganism.
  • the present inventors completed this invention by confirming that the vector for transformation using a transposon gene was very useful for the insertion of a foreign gene.
  • the present invention provides a vector for transformation containing a transposon gene and a multicloning site.
  • the present invention also provides a Corynebacterium sp. microorganism having improved lysine productivity by being transformed with the said vector for transformation.
  • the present invention further provides a production method of lysine from the culture solution of the Corynebacterium sp. microorganism.
  • the present invention provides a Corynebacterium sp. microorganism capable of producing lysine at high concentration that has improved endogenous activity by inserting aspartate kinase gene (lysC), aspartate semialdehyde dihydrogenase gene (asd), dihydrodipicolinate synthase gene (dapA) and dihydropicolinate reductase gene (dapB) serially in the region of a transposon gene existing as multiple copies on the genome of the Corynebacterium sp. microorganism and at the same time has been endowed a novel activity by the additional insertion of fructokinase gene (srk) not existing in Corynebacteria in the region of the transposon gene.
  • lysC aspartate kinase gene
  • asd aspartate semialdehyde dihydrogenase gene
  • dapA dihydrodipicolinate synthase gene
  • FIG. 1 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn.
  • FIG. 2 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-lysC/asd.
  • FIG. 3 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-dapA/dapB.
  • FIG. 4 is a diagram illustrating pDZTn-srk vector.
  • the present invention provides a vector for transformation containing a transposon gene and a multicloning site.
  • the transposon gene can be originated from Corynebacterium sp.
  • Corynebacterium sp. microorganism has many different types of transposons.
  • Corynebacterium glutamicum ATCC13032 includes 24 transposons, which are classified into 9 groups (The complete Corynebacterium glutamicum ATCC 13032 genome sequence and its impact on the production of-aspartate-derived amino acids and vitamins (2003) Journal of Biotechnology 104, 5-25 Jorn Kalinowski et al).
  • ISCg1 and ISGg2 include 4 and 5 copies respectively and each copy shows at least 99% homology.
  • the transposon gene of the present invention is preferably a member of the group of ISCg1 (SEQ ID. NO: 22) among transposons originated from Corynebacterium glutamicum ATCC13032 (GenBank accession NO: NC — 003450, NCg11021), and particularly the one that has the nucleotide sequences represented by SEQ ID. NO: 1 and 2.
  • the said multicloning site is the nucleotide sequence artificially inserted to facilitate the recognition by many restriction enzymes, suggesting that it makes the target gene insertion easy.
  • genes that can be inserted in the said multicloning site are aspB (gene encoding aspartate aminotransferase), lysC (gene encoding aspartate kinase), asd (gene encoding aspartate semialdehyde dihydrogenase), dapA (gene encoding dihydrodipicolinate synthase), dapB (gene encoding dihydropicolinate reductase) and lysA (gene encoding diaminodipymalate dicarboxylase), which are endogenous genes of Corynebacterium sp. microorganisms involved in the production of L-amino acid.
  • the exogenous srk (gene encoding fructokinase) can also be inserted.
  • the said lysC, asd, dapA, and dapB genes have the nucleotide sequences respectively represented by SEQ ID. NOs: 17, 18, 19, and 20 originated from Corynebacterium glutamicum KCCM 10770Pb (GenBank accession number: NC — 003450, NCg10247 ⁇ 0248 and NCg11896 ⁇ 1898).
  • the foreign gene srk can be the one that has the nucleotide sequence represented by SEQ ID. NO: 21 originated from Clostridium acetylbutyricum ATCC 824 (GenBank accession number: NP — 347064).
  • genes inserted in the vector for transformation of the present invention can be integrated in the chromosome of Corynebacterium sp. microorganism by the secondary crossover.
  • the vector for transformation using the transposon gene of the present invention is not only able to amplify at least two copies of the endogenous gene but also suitable for the insertion of gene by crossover with high efficiency owing to the multiple transposons.
  • This vector can also be effective in producing a strain that can amplify different genes in a series with the same vector.
  • the transposon is the gene that does not affect the growth of a microorganism and is rather helpful to reduce gene instability. Moreover, it facilitates foreign gene insertion even without a specific target site and it can also be prepared in a series.
  • the present invention also provides a Corynebacterium sp. microorganism having improved lysine productivity by being transformed with the said vector for transformation.
  • the microorganism having lysine productivity that can be transformed by the vector for transformation of the present invention can be any of those Corynebacterium sp. microorganisms.
  • the Corynebacterium sp. microorganism that is available for this invention is Corynebacterium glutamicum ATCC 13032 or Corynebacterium thermoaminogenes FERM BP-1539.
  • the L-amino acid producing mutants or strains generated therefrom for example Corynebacterium glutamicum KFCC10881, Corynebacterium glutamicum KFCC 11001 and Corynebacterium glutamicum KCCM 10770 are also available.
  • the microorganism is Corynebacterium glutamicum KCCM 10770P.
  • the Corynebacterium sp. microorganism of the invention can be transformed by the vector for transformation pDZTn-lscC/asd, pDZTndapA/dapB or pDZTn-crk having the cleavage map of FIG. 2 , 3 , or 4 .
  • the said vector for transformation can be inserted in the Corynebacterium sp. microorganism orderly or simultaneously.
  • the insertion of the vector into chromosome can be performed by the method well-known to those in the art such as homologous recombination.
  • the present invention further provides a production method of lysine from the culture solution of the Corynebacterium sp. microorganism.
  • the culture of L-lysine using the Corynebacterium sp. microorganism can be performed by the conventional method well-known to those in the art.
  • the culture herein can be performed by fed batch or repeated fed batch process.
  • the medium used for the culture herein has to fit the condition required for the specific strain by a required process.
  • the culture medium for the Corynebacterium sp. strain is well informed (for example, Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981).
  • the usable glycogen is exemplified by carbohydrate such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose; oil and fat such as soybean oil, sunflower oil, castor oil and coconut oil; fatty acid such as palmitic acid, stearic acid, and linoleic acid; alcohol such as glycerol and ethanol; and organic acid such as acetic aid.
  • carbohydrate such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose
  • oil and fat such as soybean oil, sunflower oil, castor oil and coconut oil
  • fatty acid such as palmitic acid, stearic acid, and linoleic acid
  • alcohol such as glycerol and ethanol
  • organic acid such as acetic aid.
  • the usable nitrogen source is exemplified by such organic nitrogen source as peptone, yeast extract, gravy, malt extract, corn steep liquor and bean flour and such inorganic nitrogen source as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate.
  • organic nitrogen source as peptone, yeast extract, gravy, malt extract, corn steep liquor and bean flour
  • inorganic nitrogen source as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate.
  • urea ammonium sulfate
  • ammonium chloride ammonium phosphate
  • ammonium carbonate ammonium carbonate
  • ammonium nitrate ammonium nitrate
  • the medium herein can additionally include potassium dihydrogen phosphate, dipotassium hydrogen phosphate and corresponding sodium-containing salts as a phosphate source.
  • the medium can also include a metal salt such as magnesium sulfate or iron sulfate.
  • amino acids, vitamins and proper precursors can be added as well.
  • the medium or the precursor can be added to the culture by batch-type or continuously. pH of the culture can be adjusted during the cultivation by adding such a compound as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid.
  • the generation of air bubbles can be inhibited during the cultivation by using an antifoaming agent such as fatty acid polyglycol ester.
  • oxygen or oxygen-containing gas eg, air
  • the temperature of the culture is preferably 20-45° C., more preferably 25-40° C.
  • the cultivation can be continued until the production of L-amino acid reaches a wanted level, and the preferable culture time is 10-160 hours.
  • L-lysine is released in the culture medium or can be included in cells.
  • pDZ vector for the insertion of chromosome of Corynebacterium sp. microorganism was used as a basic vector to construct the vector pDZTn introduced with the transposon gene of Corynebacterium sp.
  • the construction process is as follows.
  • the nucleotide sequence information about the transposon gene (NCBI accession NO. NC — 003450, NCgI1021) of the total nucleotide sequence originated from Corynebacterium glutamicum ATCC13032 was obtained from NIH GenBank, from which two pairs of primers (Table 1, SEQ ID. NO: 3-6) were synthesized.
  • PCR was performed using the chromosome DNA of Corynebacterium glutamicum ATCC13032 as a template and using the oligonucleotides represented by SEQ ID. NO: 3-6 as primers.
  • PfuUltraTM high-confident DNA polymerase (Stratagene) was used as a polymerase. PCR conditions were as follows; denaturation at 96° C. for 30 seconds, annealing at 58° C. for 30 seconds, polymerization at 72° C. for 1 minute, and 30 cycles from denaturation to polymerization.
  • Tn-A transposon genes
  • Tn-B transposon genes containing approximately 500 bp long promoter region
  • Tn-A SEQ ID. NO: 1
  • Tn-B SEQ ID. NO: 2
  • the amplified products were cloned into pDZ vector pretreated with Sal I restriction enzyme using BD in-Fusion kit (BD), resulting in the construction of pDZTn vector.
  • BD BD in-Fusion kit
  • FIG. 1 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn.
  • the patent-granted lysine production strain was transformed with the pDZTn vector constructed by inserting the target gene (Tn-A and Tn-B) (using the transformation method of Appl. Microbiol. Biotechnol. (1999) 52:541-545). Then, the strain having the target gene inserted by gene homology on the chromosome was selected from the selection medium containing 25 mg/L of kanamycin. The successful insertion of the vector in the chromosome was confirmed by observing if the colony was blue on the solid medium containing X-gal (5-bromo-4-chloro-3-indolyl- ⁇ -D-galactoside).
  • the primary chromosome inserted strain was shaking-cultured in a nutrient medium (30° C., 8 hours), which was then diluted from 10 ⁇ 4 to 10 ⁇ 10 , followed by distribution on the solid medium containing X-gal. While most colonies were blue, there were some colonies that were white. Those low rate white colonies were selected, which proceeded to the selection of the strain whose vector sequence inserted on the chromosome was eliminated by the secondary crossover.
  • lysC/asd gene originated from Corynebacterium glutamicum KCCM10770P
  • nucleotide sequence information of lysC/asd was obtained from NIH GenBank, from which a pair of primers (Table 2, SEQ ID. NO: 7 and 8) was synthesized.
  • PCR was performed using the chromosome DNA of Corynebacterium glutamicum KCCM10770P as a template and using the oligonucleotides represented by SEQ ID. NO: 7 and 8 as primers.
  • PfuUltraTM high-confident DNA polymerase (Stratagene) was used as a polymerase. PCR conditions were as follows; denaturation at 96° C. for 30 seconds, annealing at 52° C. for 30 seconds, polymerization at 72° C. for 3 minutes, and 30 cycles from denaturation to polymerization.
  • FIG. 2 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-lysC/asd.
  • Corynebacterium glutamicum KCCM10770P the patent-granted lysine production strain was transformed with the constructed vector pDZTn-lysC/asd. After the secondary crossover, a copy of lysC/asd gene was additionally inserted in between transposons on the chromosome. As a result, the lysine production strain Corynebacterium glutamicum KCCM10770P-CJ1 having three copies of the gene was prepared. To confirm the strain, PCR was performed using primer 9 and primer 10 (Table 3) facilitating the amplification of the joining region between the transposon and lysC/asd gene.
  • dapA/dapB gene originated from Corynebacterium glutamicum KCCM 10770P by the same manner as described in example 2, nucleotide sequence information of dapA/dapB (NCBI accession NO. NC — 003450, Ncg11896 ⁇ 1898) was obtained from NIH GenBank. As a result, it was confirmed that dapA composed operon along with dapB, between which there was ORF (Ncg11987) whose functions had not been disclosed, yet. Therefore, to amplify the total gene dapB-ORF (Ncg11897)-dapA containing dapB promoter region, two pairs of primers were synthesized (Table 4, SEQ ID. NO: 11-12).
  • PCR was performed using the chromosome DNA of Corynebacterium glutamicum KCCM10770P as a template and using the oligonucleotides represented by SEQ ID. NO: 11-12 as primers.
  • PfuUltraTM high-confident DNA polymerase (Stratagene) was used as a polymerase. PCR conditions were as follows; denaturation at 96° C. for 30 seconds, annealing at 52° C. for 30 seconds, polymerization at 72° C. for 3 minutes, and 30 cycles from denaturation to polymerization.
  • FIG. 3 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-dapA/dapB.
  • the lysine production strain Corynebacterium glutamicum KCCM10770P-CJ1 prepared in example 2 was transformed with the constructed vector pDZTn-dapA/dapB. After the secondary crossover, a copy of dapA/dapB gene was additionally inserted in between transposons on the chromosome. As a result, the lysine production strain Corynebacterium glutamicum KCCM10770P-CJ2 having three copies of the gene was prepared. To confirm the strain, PCR was performed using primer 9 and primer 13 (Table 5) facilitating the amplification of the joining region between the transposon and dapA/dapB gene.
  • Corynebacterium glutamicum KCCM10770P-CJ2 was deposited at Korean Culture Center of Microorganisms, the international depository authority, located at 361-221, Hongje-1-dong, Seodaemun-gu, Seoul, Korea on Mar. 31, 2008 under the Accession number KCCM 10939P.
  • the nucleotide sequence of fructokinase gene originated from Clostridium acetobutylicum ATCC 824 has been well-known.
  • the present inventors obtained the gene information of fructokinase originated from Clostridium acetobutylicum ATCC 824 from NIH GenBank (Accession NO. NP 347064).
  • a pair of primers (Table 6, SEQ ID. NO: 14 and 15) was synthesized according to the obtained nucleotide sequence.
  • PCR was performed using the chromosome DNA of Clostridium acetobutylicum ATCC 824 as a template to amplify the gene. PCR conditions were as follows; denaturation at 94° C. for 20 seconds, annealing at 52° C. for 20 seconds, polymerization at 72° C. for 1 minute and 10 seconds, and 30 cycles from denaturation to polymerization.
  • FIG. 4 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-srk.
  • the patent-granted lysine production strain Corynebacterium glutamicum KCCM10770P was transformed with the constructed vector pDZTn-srk. After the secondary crossover, a copy of srk gene was inserted in between transposons on the chromosome. As a result, the lysine production strain Corynebacterium glutamicum KCCM10770P-CJ3 was prepared. To confirm the strain, PCR was performed using primer 9 and primer 16 (Table 7) facilitating the amplification of the joining region between the transposon and srk gene.
  • Aspartate kinase activity of the L-lysine production strain Corynebacterium glutamicum KCCM10770P-CJ2 was measured by using aspartyl hydroxamate (Pecher J-F, Capony J-P (1968) On the colorimetric determination of acyl phosphates. Anal Biochem 22: 536 ⁇ 539).
  • Corynebacterium glutamicum KCCM10770P-CJ2 demonstrated 2.1 times higher aspartate kinase activity than the mother strain Corynebacterium glutamicum KCCM10770P.
  • fructokinase was expressed in the cells from the fructokinase expression vector and whether or not there was fructokinase activity, by the known method (Andreas Pikis et al, Microbiology, 148, 843-852 (2002)).
  • Corynebacterium glutamicum KCCM10770P-CJ3 was cultured in LB for one day, followed by centrifugation to obtain the cells. The obtained cells were suspended in a proper buffer, followed by sonication to lysis the cells. Ultra-centrifugation was performed to obtain supernatant.
  • the obtained supernatant was reacted with the reaction solution containing fructose, phosphoglucose, isomerase, glucose-6-phosphate dihydrogenase, ATP and NADP + .
  • the generated NADPH was quantified by measuring OD 340 with a spectrophotomer, from which fructokinase activity was indirectly calculated.
  • Table 9 As shown in Table 11, Corynebacterium glutamicum KCCM10770P-CJ3 demonstrated the fructokinase activity at least double the activity of the mother strain Corynebacterium glutamicum KCCM10770P, suggesting that the fructokinase gene was expressed therein.
  • the L-lysine production strain Corynebacterium glutamicum KCCM10770P-CJ2 prepared in example 3 was cultured as follows for the production of L-lysine.
  • Corynebacterium glutamicum KCCM10770P-CJ2 and the mother strain Corynebacterium glutamicum KCCM10770P were inoculated in a 250 ml corner-baffled flask containing 25 ml of seed culture medium, followed by shaking-culture at 30° C. for 20 hours with 200 rpm. 1 ml of the seed culture medium was inoculated in a 250 ml corner-baffled flask containing 24 ml of production medium, followed by shaking-culture at 30° C. for 120 hours with 200 rpm.
  • L-lysine production was measured by the method using HPLC.
  • the amounts of L-lysine in culture solutions of Corynebacterium glutamicum KCCM10770P and Corynebacterium glutamicum KCCM10770P-CJ2 are shown in Table 10.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a vector for transformation using transposon genes, microorganisms transformed by the vector, and a method for producing L-lysine using the microorganisms.

Description

THE CROSS-REFERENCE TO RELATED APPLICATIONS (INCORPORATION BY REFERENCE)
The present application is a national phase entry under 35 U.S.C. 371 of International Application No. PCT/KR2009/001845 filed on Apr. 10, 2009, which claims the benefit of Korean Patent Application No. 10-2008-0033054 filed on Apr. 10, 2008. The disclosures of said applications are incorporated by reference herein.
TECHNICAL FIELD
The present invention relates to a vector for transformation using a transposon gene, a microorganism transformed with the said vector, and a preparation method of lysine using the said microorganism.
Incorporated by reference herein in its entirety is the Sequence Listing entitled “Sequence.txt”, created Aug. 13, 2010, size of 14 kilobytes.
BACKGROUND ART
Corynebacterium, especially Corynebacterium glutamicum, is a Gram-positive microorganism used for the production of L-amino acid. L-amino acid, particularly L-lysine, has been widely used for the production of animal feeds, medicines for human, and cosmetics. This amino acid is generated by the fermentation using Corynebacterium.
The conventional production method of L-lysine has used Corynebacterium having enhanced L-lysine biosynthesis related gene. For example, U.S. Pat. No. 6,746,855 describes a production method of L-lysine by culturing Corynebacterium sp. which enhanced the lysine releasing carrier gene lysE and introduced with an additional gene selected from the group consisting of dapA encoding dihydrodipicolinate synthase, lysC encoding aspartate kinase, pyc encoding pyruvate carboxylase and dapB encoding dihydropicolinate reductase. And, U.S. Pat. No. 6,221,636 describes Corynebacteria transformed with recombinant DNA containing the DNA sequence encoding diaminopimelate dicarboxylase and the DNA sequence encoding aspartokinase which is substantially insensitive to feedback inhibition by L-lysine and L-threonine.
To enhance the said L-lysine biosynthesis related gene without an antibiotic-resistant sequence, either the number of gene copies is increased or the enzyme activity is increased by mutation. There are two methods reported so far to increase the number of gene copies.
One of the two methods to increase the number of copies is tandem repeat which inserts an additional gene into the right next to the intrinsic gene. The other method is to insert an additional gene into one or more chromosome regions of Corynebacterium sp. (U.S. Pat. No. 7,160,711). However, these methods are limited in gene insertion sites, indicating that it is very difficult to insert multiple genes. To overcome this problem, it has been attempted to insert target genes in the region of multiple copies of rDNA on the genome. It was reported that this method was more successful than the previous ones. Nevertheless, this method has still a limitation because the destruction of two or more rDNA copies can affect the growth of the microorganism.
Transposon is also called Insertional Sequence Element, which is the sequence that can be moved on chromosome or on plasmid. Transposon includes transposase, which shows the activity to recognize a specific sequence for the insertion. Up to date, hundreds of transposons have been reported in a variety of bacteria (TRANSPOSON-BASED STRATEGIES FOR MICROBIAL FUNCTIONAL GENOMICS AND PROTEOMICS (2003) Annual Review of Genetics 37: 3-29 Finbarr Hayes).
DISCLOSURE Technical Problem
The present inventors have tried to develop a strain that can produce lysine at high concentration by using a vector for transformation available for insertion of two or more copies of a target gene regardless of location, without inhibiting the growth of the microorganism. At last, the present inventors completed this invention by confirming that the vector for transformation using a transposon gene was very useful for the insertion of a foreign gene.
Therefore, it is an object of the present invention to provide a vector for transformation using a transposon gene.
It is another object of the present invention to provide a Corynebacterium sp. microorganism having improved lysine productivity by being transformed with the said vector for transformation.
It is further an object of the present invention to provide a production method of lysine from the culture solution of the Corynebacterium sp. microorganism.
Technical Solution
To achieve the above objects, the present invention provides a vector for transformation containing a transposon gene and a multicloning site.
The present invention also provides a Corynebacterium sp. microorganism having improved lysine productivity by being transformed with the said vector for transformation.
The present invention further provides a production method of lysine from the culture solution of the Corynebacterium sp. microorganism.
Advantageous Effect
The present invention provides a Corynebacterium sp. microorganism capable of producing lysine at high concentration that has improved endogenous activity by inserting aspartate kinase gene (lysC), aspartate semialdehyde dihydrogenase gene (asd), dihydrodipicolinate synthase gene (dapA) and dihydropicolinate reductase gene (dapB) serially in the region of a transposon gene existing as multiple copies on the genome of the Corynebacterium sp. microorganism and at the same time has been endowed a novel activity by the additional insertion of fructokinase gene (srk) not existing in Corynebacteria in the region of the transposon gene.
DESCRIPTION OF DRAWINGS
The above and other objects, features and advantages of the present invention will become apparent from the following description of preferred embodiments given in conjunction with the accompanying drawings, in which:
FIG. 1 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn.
FIG. 2 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-lysC/asd.
FIG. 3 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-dapA/dapB.
FIG. 4 is a diagram illustrating pDZTn-srk vector.
BEST MODE
The present invention provides a vector for transformation containing a transposon gene and a multicloning site.
The transposon gene can be originated from Corynebacterium sp. Corynebacterium sp. microorganism has many different types of transposons. For example, Corynebacterium glutamicum ATCC13032 includes 24 transposons, which are classified into 9 groups (The complete Corynebacterium glutamicum ATCC 13032 genome sequence and its impact on the production of-aspartate-derived amino acids and vitamins (2003) Journal of Biotechnology 104, 5-25 Jorn Kalinowski et al). Among them, ISCg1 and ISGg2 include 4 and 5 copies respectively and each copy shows at least 99% homology.
The transposon gene of the present invention is preferably a member of the group of ISCg1 (SEQ ID. NO: 22) among transposons originated from Corynebacterium glutamicum ATCC13032 (GenBank accession NO: NC003450, NCg11021), and particularly the one that has the nucleotide sequences represented by SEQ ID. NO: 1 and 2.
The said multicloning site is the nucleotide sequence artificially inserted to facilitate the recognition by many restriction enzymes, suggesting that it makes the target gene insertion easy.
The genes that can be inserted in the said multicloning site are aspB (gene encoding aspartate aminotransferase), lysC (gene encoding aspartate kinase), asd (gene encoding aspartate semialdehyde dihydrogenase), dapA (gene encoding dihydrodipicolinate synthase), dapB (gene encoding dihydropicolinate reductase) and lysA (gene encoding diaminodipymalate dicarboxylase), which are endogenous genes of Corynebacterium sp. microorganisms involved in the production of L-amino acid. In addition, the exogenous srk (gene encoding fructokinase) can also be inserted.
It is preferable to insert one or more genes selected from the group consisting of aspB, lysC, asd, dapA, dapB and lysA into the said multicloning site. It is also possible to insert the endogenous genes selected above and an exogenous gene together into the multicloning site. It is more preferred to serially insert lysC/asd and dapA/dapB into the multicloning site or possibly the exogenous srk gene that cannot be found in Corynebacterium sp. microorganisms is inserted.
In a preferred embodiment of the present invention, the said lysC, asd, dapA, and dapB genes have the nucleotide sequences respectively represented by SEQ ID. NOs: 17, 18, 19, and 20 originated from Corynebacterium glutamicum KCCM 10770Pb (GenBank accession number: NC003450, NCg10247˜0248 and NCg11896˜1898). The foreign gene srk can be the one that has the nucleotide sequence represented by SEQ ID. NO: 21 originated from Clostridium acetylbutyricum ATCC 824 (GenBank accession number: NP347064).
The genes inserted in the vector for transformation of the present invention can be integrated in the chromosome of Corynebacterium sp. microorganism by the secondary crossover.
The vector for transformation using the transposon gene of the present invention is not only able to amplify at least two copies of the endogenous gene but also suitable for the insertion of gene by crossover with high efficiency owing to the multiple transposons. This vector can also be effective in producing a strain that can amplify different genes in a series with the same vector. The transposon is the gene that does not affect the growth of a microorganism and is rather helpful to reduce gene instability. Moreover, it facilitates foreign gene insertion even without a specific target site and it can also be prepared in a series.
The present invention also provides a Corynebacterium sp. microorganism having improved lysine productivity by being transformed with the said vector for transformation.
In this invention, the microorganism having lysine productivity that can be transformed by the vector for transformation of the present invention can be any of those Corynebacterium sp. microorganisms. For example, the Corynebacterium sp. microorganism that is available for this invention is Corynebacterium glutamicum ATCC 13032 or Corynebacterium thermoaminogenes FERM BP-1539. Besides, the L-amino acid producing mutants or strains generated therefrom, for example Corynebacterium glutamicum KFCC10881, Corynebacterium glutamicum KFCC 11001 and Corynebacterium glutamicum KCCM 10770 are also available. Most preferably, the microorganism is Corynebacterium glutamicum KCCM 10770P.
In a preferred embodiment of the present invention, the Corynebacterium sp. microorganism of the invention can be transformed by the vector for transformation pDZTn-lscC/asd, pDZTndapA/dapB or pDZTn-crk having the cleavage map of FIG. 2, 3, or 4. The said vector for transformation can be inserted in the Corynebacterium sp. microorganism orderly or simultaneously. The insertion of the vector into chromosome can be performed by the method well-known to those in the art such as homologous recombination.
The present invention further provides a production method of lysine from the culture solution of the Corynebacterium sp. microorganism.
The culture of L-lysine using the Corynebacterium sp. microorganism can be performed by the conventional method well-known to those in the art. For example, the culture herein can be performed by fed batch or repeated fed batch process.
The medium used for the culture herein has to fit the condition required for the specific strain by a required process. The culture medium for the Corynebacterium sp. strain is well informed (for example, Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981).
The usable glycogen is exemplified by carbohydrate such as glucose, sucrose, lactose, fructose, maltose, starch, cellulose; oil and fat such as soybean oil, sunflower oil, castor oil and coconut oil; fatty acid such as palmitic acid, stearic acid, and linoleic acid; alcohol such as glycerol and ethanol; and organic acid such as acetic aid. One of these compounds or a mixture thereof can be used.
The usable nitrogen source is exemplified by such organic nitrogen source as peptone, yeast extract, gravy, malt extract, corn steep liquor and bean flour and such inorganic nitrogen source as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. One of these compounds or a mixture thereof can be used as a nitrogen source.
The medium herein can additionally include potassium dihydrogen phosphate, dipotassium hydrogen phosphate and corresponding sodium-containing salts as a phosphate source. The medium can also include a metal salt such as magnesium sulfate or iron sulfate. In addition, amino acids, vitamins and proper precursors can be added as well. The medium or the precursor can be added to the culture by batch-type or continuously. pH of the culture can be adjusted during the cultivation by adding such a compound as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid. The generation of air bubbles can be inhibited during the cultivation by using an antifoaming agent such as fatty acid polyglycol ester. To maintain aerobic condition of the culture, oxygen or oxygen-containing gas (eg, air) can be injected into the culture. The temperature of the culture is preferably 20-45° C., more preferably 25-40° C. The cultivation can be continued until the production of L-amino acid reaches a wanted level, and the preferable culture time is 10-160 hours. L-lysine is released in the culture medium or can be included in cells.
Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.
However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.
EXAMPLES Example 1 Construction of the Vector (pDZTn) Introduced with Transposon Gene and the Method for the Gene Insertion using the Vector
In this example, pDZ vector for the insertion of chromosome of Corynebacterium sp. microorganism was used as a basic vector to construct the vector pDZTn introduced with the transposon gene of Corynebacterium sp. The construction process is as follows.
To obtain transposon gene, the nucleotide sequence information about the transposon gene (NCBI accession NO. NC003450, NCgI1021) of the total nucleotide sequence originated from Corynebacterium glutamicum ATCC13032 was obtained from NIH GenBank, from which two pairs of primers (Table 1, SEQ ID. NO: 3-6) were synthesized.
PCR was performed using the chromosome DNA of Corynebacterium glutamicum ATCC13032 as a template and using the oligonucleotides represented by SEQ ID. NO: 3-6 as primers. PfuUltra™ high-confident DNA polymerase (Stratagene) was used as a polymerase. PCR conditions were as follows; denaturation at 96° C. for 30 seconds, annealing at 58° C. for 30 seconds, polymerization at 72° C. for 1 minute, and 30 cycles from denaturation to polymerization.
TABLE 1
SEQ
ID.
Primer Sequence NO:
Tn-A-F atcctctagagtcgaccatcgctgacaccatctgcc 3
Tn-A-R gggcccactagtctcgagttcaccgcgggagccaag  4
cc
Tn-B-F ctcgagactagtgggccctggattccaaggctacgc 5
c
Tn-B-R atgcctgcaggtcgaccctgaatggataaggcaccg 6
As a result, two pairs of transposon genes (Tn-A, Tn-B) containing approximately 500 bp long promoter region were obtained. Tn-A (SEQ ID. NO: 1) was amplified by using the sequences represented by SEQ ID. NO: 3 and 4 as primers, while Tn-B (SEQ ID. NO: 2) was amplified by using the sequences represented by SEQ ID. NO: 5 and 6 as primers. The amplified products were cloned into pDZ vector pretreated with Sal I restriction enzyme using BD in-Fusion kit (BD), resulting in the construction of pDZTn vector. There are numbers of restriction enzyme recognition sites which is artificially inserted during the primer construction in between the two amplified products.
FIG. 1 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn.
Corynebacterium glutamicum KCCM10770P, the patent-granted lysine production strain was transformed with the pDZTn vector constructed by inserting the target gene (Tn-A and Tn-B) (using the transformation method of Appl. Microbiol. Biotechnol. (1999) 52:541-545). Then, the strain having the target gene inserted by gene homology on the chromosome was selected from the selection medium containing 25 mg/L of kanamycin. The successful insertion of the vector in the chromosome was confirmed by observing if the colony was blue on the solid medium containing X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside). The primary chromosome inserted strain was shaking-cultured in a nutrient medium (30° C., 8 hours), which was then diluted from 10−4 to 10−10, followed by distribution on the solid medium containing X-gal. While most colonies were blue, there were some colonies that were white. Those low rate white colonies were selected, which proceeded to the selection of the strain whose vector sequence inserted on the chromosome was eliminated by the secondary crossover.
Example 2 Cloning of lysC/asd Originated from the Lysine Production Strain Corynebacterium glutamicum KCCM10770P, Construction of the Recombinant Vector (pDZTn-lysC/asd), and Development of the lysC/asd Inserted Strain
To obtain lysC/asd gene originated from Corynebacterium glutamicum KCCM10770P, nucleotide sequence information of lysC/asd (NCBI accession NO. NC003450, Ncg10247˜0248) was obtained from NIH GenBank, from which a pair of primers (Table 2, SEQ ID. NO: 7 and 8) was synthesized.
PCR was performed using the chromosome DNA of Corynebacterium glutamicum KCCM10770P as a template and using the oligonucleotides represented by SEQ ID. NO: 7 and 8 as primers. PfuUltra™ high-confident DNA polymerase (Stratagene) was used as a polymerase. PCR conditions were as follows; denaturation at 96° C. for 30 seconds, annealing at 52° C. for 30 seconds, polymerization at 72° C. for 3 minutes, and 30 cycles from denaturation to polymerization.
TABLE 2
SEQ ID.
Primer Sequence NO:
lysC-F1 tgtcgggcccactagttcccagggtagttgacta 7
(SpeI) aag
asd-R1 gaatgagttcctcgagtatcaacgcgtcggtaga 8
(XhoI)
As a result, lysC/asd gene containing 2,805 bp long promoter region was separated. The amplified product was cloned into pDZTn vector pretreated with Spe I and Xho I using BD in-Fusion kit, resulting in the construction of the recombination vector pDZTn-lysC/asd. FIG. 2 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-lysC/asd.
Corynebacterium glutamicum KCCM10770P, the patent-granted lysine production strain was transformed with the constructed vector pDZTn-lysC/asd. After the secondary crossover, a copy of lysC/asd gene was additionally inserted in between transposons on the chromosome. As a result, the lysine production strain Corynebacterium glutamicum KCCM10770P-CJ1 having three copies of the gene was prepared. To confirm the strain, PCR was performed using primer 9 and primer 10 (Table 3) facilitating the amplification of the joining region between the transposon and lysC/asd gene.
TABLE 3
SEQ ID.
Primer Sequence NO:
Tn-A-F gctaccgctgcaccaacccc 9
asd-1 ttcacgccgaattcgacaaggcaatcaccg 10
Example 3 Cloning of dapA/dapB Originated from the Lysine Production Strain Corynebacterium glutamicum KCCM10770P, Construction of the Recombinant Vector (pDZTn-dapA/dapB), and Development of the dapA/dapB Inserted Strain
To obtain dapA/dapB gene originated from Corynebacterium glutamicum KCCM 10770P by the same manner as described in example 2, nucleotide sequence information of dapA/dapB (NCBI accession NO. NC003450, Ncg11896˜1898) was obtained from NIH GenBank. As a result, it was confirmed that dapA composed operon along with dapB, between which there was ORF (Ncg11987) whose functions had not been disclosed, yet. Therefore, to amplify the total gene dapB-ORF (Ncg11897)-dapA containing dapB promoter region, two pairs of primers were synthesized (Table 4, SEQ ID. NO: 11-12).
PCR was performed using the chromosome DNA of Corynebacterium glutamicum KCCM10770P as a template and using the oligonucleotides represented by SEQ ID. NO: 11-12 as primers. PfuUltra™ high-confident DNA polymerase (Stratagene) was used as a polymerase. PCR conditions were as follows; denaturation at 96° C. for 30 seconds, annealing at 52° C. for 30 seconds, polymerization at 72° C. for 3 minutes, and 30 cycles from denaturation to polymerization.
TABLE 4
SEQ
ID.
Primer Sequence NO:
dapA-F tgtcgggcccactagttcattggcgtttccggatcc 11
(SpeI)
dapA-R gaatgagttcctcgagacaagcgccaaggaactacc 12
(XhoI)
As a result, dapA/dapB gene containing 3,210 bp long promoter region was separated. The amplified product was cloned into pDZTn vector pretreated with Spe I and Xho I using BD in-Fusion kit, resulting in the construction of the recombination vector pDZTn-dapA/dapB. FIG. 3 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-dapA/dapB.
The lysine production strain Corynebacterium glutamicum KCCM10770P-CJ1 prepared in example 2 was transformed with the constructed vector pDZTn-dapA/dapB. After the secondary crossover, a copy of dapA/dapB gene was additionally inserted in between transposons on the chromosome. As a result, the lysine production strain Corynebacterium glutamicum KCCM10770P-CJ2 having three copies of the gene was prepared. To confirm the strain, PCR was performed using primer 9 and primer 13 (Table 5) facilitating the amplification of the joining region between the transposon and dapA/dapB gene.
The said Corynebacterium glutamicum KCCM10770P-CJ2 was deposited at Korean Culture Center of Microorganisms, the international depository authority, located at 361-221, Hongje-1-dong, Seodaemun-gu, Seoul, Korea on Mar. 31, 2008 under the Accession number KCCM 10939P.
TABLE 5
Primer Sequence SEQ ID. NO:
Tn-A-F gctaccgctgcaccaacccc 9
dapA-1 acaagcgccaaggaactacc 13
Example 4 Cloning of srk Originated from Clostridium acetobutylicum, Construction of the Recombinant Vector (pDZTn-srk) and Development of the srk Inserted Strain
The nucleotide sequence of fructokinase gene originated from Clostridium acetobutylicum ATCC 824 has been well-known. The present inventors obtained the gene information of fructokinase originated from Clostridium acetobutylicum ATCC 824 from NIH GenBank (Accession NO. NP 347064). A pair of primers (Table 6, SEQ ID. NO: 14 and 15) was synthesized according to the obtained nucleotide sequence. PCR was performed using the chromosome DNA of Clostridium acetobutylicum ATCC 824 as a template to amplify the gene. PCR conditions were as follows; denaturation at 94° C. for 20 seconds, annealing at 52° C. for 20 seconds, polymerization at 72° C. for 1 minute and 10 seconds, and 30 cycles from denaturation to polymerization.
TABLE 6 
SEQ ID.
Primer Sequence NO:
Srk-F tgtcgggcccactagtcatatgaataatgttttat 14
(SpeI) gtatgggagaa
srk-R gaatgagttcctcgagataccattctagagggctt 15
(XhoI) aaagctaccgg
As a result, srk gene containing 1,200 bp long promoter region was separated. The amplified product was cloned into pDZTn vector pretreated with Spe I and Xho I using BD in-Fusion kit, resulting in the construction of the recombination vector pDZTn-srk. FIG. 4 is a diagram illustrating the Corynebacterium chromosome insertion vector pDZTn-srk.
The patent-granted lysine production strain Corynebacterium glutamicum KCCM10770P was transformed with the constructed vector pDZTn-srk. After the secondary crossover, a copy of srk gene was inserted in between transposons on the chromosome. As a result, the lysine production strain Corynebacterium glutamicum KCCM10770P-CJ3 was prepared. To confirm the strain, PCR was performed using primer 9 and primer 16 (Table 7) facilitating the amplification of the joining region between the transposon and srk gene.
TABLE 7
Primer Sequence SEQ ID. NO:
Tn-A-F gctaccgctgcaccaacccc 9
Srk-1 ataccattctagagggcttaaagctaccgg 16
Example 5 Measurement of Aspartate Kinase Activity of the L-Lysine Biosynthesis Gene Multiple-Inserted Strain
Aspartate kinase activity of the L-lysine production strain Corynebacterium glutamicum KCCM10770P-CJ2 was measured by using aspartyl hydroxamate (Pecher J-F, Capony J-P (1968) On the colorimetric determination of acyl phosphates. Anal Biochem 22: 536˜539). As a result, Corynebacterium glutamicum KCCM10770P-CJ2 demonstrated 2.1 times higher aspartate kinase activity than the mother strain Corynebacterium glutamicum KCCM10770P.
TABLE 8
Activity Times
KCCM10770P 26.77 1.00
KCCM10770P-CJ2 56.25 2.10
Example 6 Measurement of Fructokinase Activity of the srk Gene Inserted Strain
It was investigated whether or not fructokinase was expressed in the cells from the fructokinase expression vector and whether or not there was fructokinase activity, by the known method (Andreas Pikis et al, Microbiology, 148, 843-852 (2002)). Corynebacterium glutamicum KCCM10770P-CJ3 was cultured in LB for one day, followed by centrifugation to obtain the cells. The obtained cells were suspended in a proper buffer, followed by sonication to lysis the cells. Ultra-centrifugation was performed to obtain supernatant. The obtained supernatant was reacted with the reaction solution containing fructose, phosphoglucose, isomerase, glucose-6-phosphate dihydrogenase, ATP and NADP+. The generated NADPH was quantified by measuring OD340 with a spectrophotomer, from which fructokinase activity was indirectly calculated. The results are shown in Table 9. As shown in Table 11, Corynebacterium glutamicum KCCM10770P-CJ3 demonstrated the fructokinase activity at least double the activity of the mother strain Corynebacterium glutamicum KCCM10770P, suggesting that the fructokinase gene was expressed therein.
TABLE 9
Test Strain KCCM10770P KCCM10770P-CJ3
Activitya 5.14 12.13
anmol (generated fructose-6-phosphate) min−1mg (protein)−1
Example 7 Production of L-Lysine in the L-Lysine Biosynthesis Gene Multiple-Inserted Strain
The L-lysine production strain Corynebacterium glutamicum KCCM10770P-CJ2 prepared in example 3 was cultured as follows for the production of L-lysine.
Corynebacterium glutamicum KCCM10770P-CJ2 and the mother strain Corynebacterium glutamicum KCCM10770P were inoculated in a 250 ml corner-baffled flask containing 25 ml of seed culture medium, followed by shaking-culture at 30° C. for 20 hours with 200 rpm. 1 ml of the seed culture medium was inoculated in a 250 ml corner-baffled flask containing 24 ml of production medium, followed by shaking-culture at 30° C. for 120 hours with 200 rpm.
Upon completion of the culture, L-lysine production was measured by the method using HPLC. The amounts of L-lysine in culture solutions of Corynebacterium glutamicum KCCM10770P and Corynebacterium glutamicum KCCM10770P-CJ2 are shown in Table 10.
TABLE 10
Lysine (g/L)
Strain Batch 1 Batch 2 Batch 3
KCCM10770P 46.1 45.8 45.4
KCCM10770P-CJ2 51.8 51.2 51.7
Seed Culture Medium (pH 7.0)
raw sugar 20 g, pepton 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4.7H2O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenate 2000 μg, nicotinamide 2000 μg (in distilled water 1 L)
Production Medium (pH 7.0)
glucose 100 g, (NH4)2SO4 40 g, soybean protein 2.5 g, corn steep solids 5 g, urea 3 g, KH2PO4 1 g, MgSO4.7H2O 0.5 g, biotin 100 μg, thiamine hydrochloride 1000 μg, calcium-pantothenate 2000 μg, nicotinamide 3000 μg, CaCO3 30 g (in distilled water 1 L)
As shown in Table 10, lysine production by Corynebacterium glutamicum KCCM10770P-CJ2 which is inserted two lysine biosynthesis genes was increased 10% from that of the mother strain KCCM 10770P.
Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.

Claims (14)

1. A vector for transformation comprising two nucleotide sequences derived from a transposon gene and a multicloning site between said nucleotide sequences, wherein the first nucleotide sequence comprises the sequence represented by SEQ ID NO: 1 and the second nucleotide sequence comprises the sequence represented by SEQ ID NO: 2.
2. The vector for transformation according to claim 1, wherein one or more genes selected from the group consisting of lysC gene encoding aspartate kinase, asd gene encoding aspartate semialdehyde dihydrogenase, dapA gene encoding dihydrodipicolinate synthase, and dapB gene encoding dihydropicolinate are inserted in the multicloning site.
3. The vector for transformation according to claim 1, wherein foreign srk gene encoding fructokinase obtained from Clostridium acetobutylicum ATCC 824 is inserted in the multicloning site.
4. A Corynebacterium glutamicum having L-lysine productivity, which is transformed with a vector for transformation comprising two nucleotide sequences derived from a transposon gene and a multicloning site between said nucleotide sequences, wherein the first nucleotide sequence comprises the sequence represented by SEQ ID NO: 1 and the second nucleotide sequence comprises the sequence represented by SEQ ID NO: 2.
5. The Corynebacterium glutamicum according to claim 4, wherein the Corynebacterium glutamicum is Corynebacterium glutamicum KCCM10770P-CJ2 (Accession NO: KCCM10939P).
6. The Corynebacterium glutamicum having L-lysine productivity according to claim 4, wherein the gene inserted in the multicloning site of the vector for transformation is integrated in the chromosome by the secondary crossover.
7. A method for producing L-lysine containing the steps of culturing a Corynebacterium glutamicum having L-lysine productivity, which is characteristically transformed with a vector for transformation comprising two nucleotide sequences derived from a transposon gene and a multicloning site between said nucleotide sequences, wherein the first nucleotide sequence comprises the sequence represented by SEQ ID NO: 1 and the second nucleotide sequence comprises the sequence represented by SEQ ID NO: 2 to produce L-lysine in cells or a culture; and recovering lysine from the cells or from the culture.
8. The Corynebacterium glutamicum having L-lysine productivity of claim 4 wherein one or more genes selected from the group consisting of lysC gene encoding aspartate kinase, asd gene encoding aspartate semialdehyde dihydrogenase, dapA gene encoding dihydrodipicolinate synthase, and dapB gene encoding dihydropicolinate are inserted in the multicloning site.
9. The Corynebacterium glutamicum having L-lysine productivity of claim 4 wherein foreign srk gene encoding fructokinase obtained from Clostridium acetobutylicum ATCC 824 is inserted in the multicloning site.
10. The method for producing L-lysine of claim 7 wherein the transformed microorganism is Corynebacterium glutamicum KCCM10770P.
11. The method for producing L-lysine of claim 7 wherein the Corynebacterium glutamicum is Corynebacterium glutamicum KCCM10770P-CJ2 (Accession NO: KCCM10939P).
12. The method for producing L-lysine of claim 7 wherein the gene inserted in the multicloning site of the vector for transformation is integrated in the chromosome by the secondary crossover.
13. The method for producing L-lysine of claim 7 wherein one or more genes selected from the group consisting of lysC gene encoding aspartate kinase, asd gene encoding aspartate semialdehyde dihydrogenase, dapA gene encoding dihydrodipicolinate synthase, and dapB gene encoding dihydropicolinate originated from Corynebacterium sp, microorganism are inserted in the multicloning site.
14. The method for producing L-lysine of claim 7 wherein srk gene encoding foreign fructokinase obtained from Clostridium acetobutylicum ATCC 824 is additionally inserted in the multicloning site.
US12/867,649 2008-04-10 2009-04-10 Vector for transformation using transposons, microorganisms transformed by the vector, and method for producing L-lysine using the same Active US8323933B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
KR1020080033054A KR101126041B1 (en) 2008-04-10 2008-04-10 A transformation vector using transposon, a microorganism transformed with the vector and method of producing l-lysine using the microorganism
KR10-2008-0033054 2008-04-10
PCT/KR2009/001845 WO2009125992A2 (en) 2008-04-10 2009-04-10 Vector for transformation using transposons, microorganisms transformed by the vector, and method for producing l-lysine using the same

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2009/001845 A-371-Of-International WO2009125992A2 (en) 2008-04-10 2009-04-10 Vector for transformation using transposons, microorganisms transformed by the vector, and method for producing l-lysine using the same

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/683,096 Continuation-In-Part US8932861B2 (en) 2008-04-10 2012-11-21 Transformation vector comprising transposon, microorganisms transformed with the vector, and method for producing L-lysine using the microorganism

Publications (2)

Publication Number Publication Date
US20100330624A1 US20100330624A1 (en) 2010-12-30
US8323933B2 true US8323933B2 (en) 2012-12-04

Family

ID=41162404

Family Applications (1)

Application Number Title Priority Date Filing Date
US12/867,649 Active US8323933B2 (en) 2008-04-10 2009-04-10 Vector for transformation using transposons, microorganisms transformed by the vector, and method for producing L-lysine using the same

Country Status (7)

Country Link
US (1) US8323933B2 (en)
JP (1) JP5412446B2 (en)
KR (1) KR101126041B1 (en)
CN (1) CN102027119B (en)
BR (1) BRPI0908450A2 (en)
DE (1) DE112009000453T5 (en)
WO (1) WO2009125992A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130157370A1 (en) * 2008-04-10 2013-06-20 Cj Cheiljedang Corporation Transformation Vector Comprising Transposon, Microorganisms Transformed with the Vector, and Method for Producing L-Lysine Using the Microorganism
US20140099680A1 (en) * 2011-04-01 2014-04-10 Cj Cheiljedang Corporation Corynebacterium sp. transformed with a fructokinase gene derived from escherichia sp. and process for preparing l-amino acid using the same

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100838038B1 (en) * 2006-12-29 2008-06-12 씨제이제일제당 (주) L-lysine production method using microorganisms of Corynebacterium with improved L-lysine production capacity
KR100838035B1 (en) * 2006-12-29 2008-06-12 씨제이제일제당 (주) L-lysine production method using microorganisms of Corynebacterium with improved L-lysine production capacity
KR100830826B1 (en) * 2007-01-24 2008-05-19 씨제이제일제당 (주) Method for producing fermentation products from carbon source including glycerol using corynebacteria
MY164858A (en) 2012-01-10 2018-01-30 Cj Cheiljedang Corp Microorganisms of corynebacterium which can utilize xylose and method for producing l-lysine using same
KR101498630B1 (en) * 2013-10-28 2015-03-04 씨제이제일제당 주식회사 A microorganism of corynebacterium genus having enhanced L-lysine productivity and a method for producing L-lysine using the same
KR101601404B1 (en) 2014-04-09 2016-03-09 씨제이제일제당 (주) A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same
MY181148A (en) 2014-04-25 2020-12-19 Cj Cheiljedang Corp Microorganisms for producing diamine and process for producing diamine using them
KR101732788B1 (en) 2014-04-25 2017-05-10 씨제이제일제당 (주) Microorganisms for producing diamine and process for producing diamine using them
KR101813759B1 (en) 2015-06-24 2018-01-02 씨제이제일제당 (주) Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
KR101735935B1 (en) 2015-07-20 2017-05-16 씨제이제일제당 (주) Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them
KR102011394B1 (en) 2017-07-19 2019-10-22 씨제이제일제당 주식회사 Microorganism producing putrescine and method of producing putrescine using the microorganism
KR101968317B1 (en) 2018-02-23 2019-04-11 씨제이제일제당 주식회사 Novel L-tryptophan export protein and the method of producing L-tryptophan usingthe same
KR102003911B1 (en) 2018-02-23 2019-07-25 씨제이제일제당 주식회사 A microorganism for producing a Mycosporine-like amino acid and a method for preparing a Mycosporine-like amino acid using the same
KR102175112B1 (en) 2019-04-22 2020-11-06 씨제이제일제당 주식회사 Microorganisms with enhanced ability to produce L-threonine and methods for producing L-threonine using the same
KR102183209B1 (en) 2019-09-09 2020-11-26 씨제이제일제당 주식회사 Variants of L-threonine efflux protein and methods for producing L-threonine using them
KR102246288B1 (en) 2020-08-13 2021-04-29 씨제이제일제당 주식회사 Microorganisms for producing putrescine and process for producing putrescine using them
KR102616694B1 (en) 2020-12-09 2023-12-20 씨제이제일제당 (주) Shewanella atlantica-Drived Protein Expressing Microorganism and Method of L-Amino Acid Production Using the Same
KR102617168B1 (en) 2020-12-09 2023-12-21 씨제이제일제당 (주) Shewanella oneidensis-Drived Protein Expressing Microorganism and Method of L-Amino Acid Production Using the Same
WO2022191357A1 (en) * 2021-03-09 2022-09-15 대상 주식회사 Corynebacterium glutamicum variant having improved l-lysine production ability, and method for producing l-lysine using same
KR20240113674A (en) 2023-01-13 2024-07-23 씨제이제일제당 (주) A novel L-ligase and preparation method of L-carnosine using the same

Citations (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS6279788A (en) 1985-10-04 1987-04-13 Kyowa Hakko Kogyo Co Ltd Production of amino acid
WO1992002627A1 (en) 1990-08-08 1992-02-20 Centre National De La Recherche Scientifique (Cnrs) Corynebacteria integron, method of transformation of corynebacteria by said integron, and corynebacteria obtained
JPH07121228A (en) 1993-10-22 1995-05-12 Mazda Motor Corp Method for confirming production information of production facility
US5457040A (en) 1993-03-12 1995-10-10 Rhone-Poulenc Chimie Production of itaconic acid by fermentation
EP0733710A1 (en) 1993-12-08 1996-09-25 Ajinomoto Co., Inc. Process for producing l-lysine by fermentation
JPH0970291A (en) 1995-06-30 1997-03-18 Ajinomoto Co Inc Gene amplification method using artificial transposon
US5633154A (en) 1992-03-19 1997-05-27 Degussa Aktiengesellschaft Method for location of insertion elements
CN1187540A (en) 1996-12-05 1998-07-15 味之素株式会社 Method for producing L-lysine
JPH10215883A (en) 1996-12-05 1998-08-18 Ajinomoto Co Inc Method for producing L-lysine
US5804414A (en) 1995-06-30 1998-09-08 Ajinomoto Co., Inc. Method of amplifying genes using artificial transposons in coryneform bacteria
JP2001037495A (en) 1999-07-07 2001-02-13 Degussa Huels Ag L-lysine-producing coryneform bacteria, DNA capable of replication therein, a method for producing L-lysine, and E. coli. E. coli and Corynebacterium glutamicum strains
US6200785B1 (en) 1998-08-11 2001-03-13 Degussa-Huls Aktiengesellschaft L-lysine-producing corynebacteria and process for the preparation of l-lysine
US6221636B1 (en) 1996-12-05 2001-04-24 Ajinomoto Co., Inc. Method for producing L-lysine
KR100313134B1 (en) 1999-06-18 2001-11-05 윤덕용 Method for Manufacturing Succinic Acid Using Glycerol
JP2002508921A (en) 1997-10-04 2002-03-26 フォルシュングスツェントルム・ユーリッヒ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング Method for producing aspartic acid- and / or glutamic acid-based amino acids by microorganism and agents usable in this method
US20020055153A1 (en) 1999-05-07 2002-05-09 Degussa-Huls Aktiengesellschaft L-lysine-producing corynebacteria and process for the preparation of lysine
WO2002053707A1 (en) 2000-12-30 2002-07-11 Cheil Jedang Corporation Microorganism producing l-lysine and processes for producing l-lysine using the same
DE10110760A1 (en) 2001-01-30 2002-08-01 Degussa New nucleotide sequences encoding the otsA gene
US20020192674A1 (en) 2001-01-30 2002-12-19 Degussa Ag Nucleotide sequence coding for the OtsA protein
US20020197605A1 (en) 1999-12-16 2002-12-26 Satoshi Nakagawa Novel Polynucleotides
JP2003503006A (en) 1998-12-23 2003-01-28 マサチューセッツ インスティテュート オブ テクノロジー Pyruvate carboxylase from Corynebacterium mglutamicum
US20030055232A1 (en) 1999-12-30 2003-03-20 Archer-Daniels-Midland Company Polynucleotide constructs for increased lysine production
US6740742B2 (en) 2000-03-23 2004-05-25 Degussa Ag Nucleotide sequences encoding the dapC gene and process for the production of L-lysine
US6746855B2 (en) 1999-07-07 2004-06-08 Dégussa-Hüls Aktiengesellschaft L-lysine-producing corynebacteria and process for the preparation of L-lysine
US6872553B2 (en) 1999-10-20 2005-03-29 Degussa Ag Nucleotide sequences which code for the pck gene
KR20050065712A (en) 2003-12-23 2005-06-30 씨제이 주식회사 Corynebaterium sp. transformed with a heterogenous fructokinase gene and method for producing l-lysine using the same
US6913909B2 (en) 1999-09-01 2005-07-05 Degussa Ag Nucleotide sequences coding for the thrE gene and process for the enzymatic production of L-threonine using coryneform bacteria
US20050153402A1 (en) 1999-06-25 2005-07-14 Basf Ag Corynebacterium glutamicum genes encoding regulatory proteins
US6962989B1 (en) 1999-07-08 2005-11-08 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding novel proteins
US20050255568A1 (en) 2003-05-30 2005-11-17 Bailey Richard B Methods and compositions for amino acid production
WO2005121349A2 (en) 2003-12-18 2005-12-22 Basf Aktiengesellschaft Methods for the preparation of a fine chemical by fermentation
JP2006512922A (en) 2003-01-21 2006-04-20 トランスジェンアールエックス,インコーポレイテッド Administration of transposon vectors to the reproductive organs
US20060084152A1 (en) 1999-06-25 2006-04-20 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding metabolic pathway proteins
KR20060068505A (en) 2004-12-16 2006-06-21 씨제이 주식회사 Novel promoter sequences derived from Corynebacterium spp., Expression cassettes and vectors comprising the same, host cells comprising the vector and methods of expressing genes using the same
WO2006071099A1 (en) 2004-12-30 2006-07-06 Cj Corporation Novel l-lysine-inducible promoter
EP1715055A2 (en) 2005-04-22 2006-10-25 Degussa GmbH Process for the production of L-amino acids using improved Enterobacteriaceae strains
US7160711B2 (en) 2001-08-06 2007-01-09 Degussa Ag Coryneform bacteria which produce chemical compounds I
WO2007039532A2 (en) 2005-10-05 2007-04-12 Evonik Degussa Gmbh Method for the fermentative production of l-amino acids with the aid of coryneform bacteria capable of using glycerin as the only carbon source
KR20080025355A (en) 2006-09-15 2008-03-20 씨제이제일제당 (주) Corynebacteria with improved L-lysine production and L-lysine production method using the same
US20100015673A1 (en) 2006-12-29 2010-01-21 Cj Cheiljedang Corporation Microorganism Of Corynebacterium Genus Having Enhanced L-Lysine Productivity And A Method Of Producing L-Lysine Using The Same
US20100028957A1 (en) 2006-12-29 2010-02-04 Cj Cheiljedang Corporation Microorganism Of Corynebacterium Genus Having Enhanced L-Lysine Productivity And A Method Of Producing L-Lysine Using The Same
US20100129884A1 (en) 2007-01-24 2010-05-27 Cj Cheiljedang Corporation Process for Producing Fermentation Product from Carbon Sources Containing Glycerol using Corynebacteria

Patent Citations (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS6279788A (en) 1985-10-04 1987-04-13 Kyowa Hakko Kogyo Co Ltd Production of amino acid
WO1992002627A1 (en) 1990-08-08 1992-02-20 Centre National De La Recherche Scientifique (Cnrs) Corynebacteria integron, method of transformation of corynebacteria by said integron, and corynebacteria obtained
US5633154A (en) 1992-03-19 1997-05-27 Degussa Aktiengesellschaft Method for location of insertion elements
US5457040A (en) 1993-03-12 1995-10-10 Rhone-Poulenc Chimie Production of itaconic acid by fermentation
JPH07121228A (en) 1993-10-22 1995-05-12 Mazda Motor Corp Method for confirming production information of production facility
EP0733710A1 (en) 1993-12-08 1996-09-25 Ajinomoto Co., Inc. Process for producing l-lysine by fermentation
US5804414A (en) 1995-06-30 1998-09-08 Ajinomoto Co., Inc. Method of amplifying genes using artificial transposons in coryneform bacteria
JPH0970291A (en) 1995-06-30 1997-03-18 Ajinomoto Co Inc Gene amplification method using artificial transposon
EP0854189A2 (en) 1996-12-05 1998-07-22 Ajinomoto Co., Inc. Method for producing L-lysine
JPH10215883A (en) 1996-12-05 1998-08-18 Ajinomoto Co Inc Method for producing L-lysine
US6221636B1 (en) 1996-12-05 2001-04-24 Ajinomoto Co., Inc. Method for producing L-lysine
CN1187540A (en) 1996-12-05 1998-07-15 味之素株式会社 Method for producing L-lysine
JP2002508921A (en) 1997-10-04 2002-03-26 フォルシュングスツェントルム・ユーリッヒ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツング Method for producing aspartic acid- and / or glutamic acid-based amino acids by microorganism and agents usable in this method
US6200785B1 (en) 1998-08-11 2001-03-13 Degussa-Huls Aktiengesellschaft L-lysine-producing corynebacteria and process for the preparation of l-lysine
JP2003503006A (en) 1998-12-23 2003-01-28 マサチューセッツ インスティテュート オブ テクノロジー Pyruvate carboxylase from Corynebacterium mglutamicum
US20020055153A1 (en) 1999-05-07 2002-05-09 Degussa-Huls Aktiengesellschaft L-lysine-producing corynebacteria and process for the preparation of lysine
KR100313134B1 (en) 1999-06-18 2001-11-05 윤덕용 Method for Manufacturing Succinic Acid Using Glycerol
US20060084152A1 (en) 1999-06-25 2006-04-20 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding metabolic pathway proteins
US20050153402A1 (en) 1999-06-25 2005-07-14 Basf Ag Corynebacterium glutamicum genes encoding regulatory proteins
US6746855B2 (en) 1999-07-07 2004-06-08 Dégussa-Hüls Aktiengesellschaft L-lysine-producing corynebacteria and process for the preparation of L-lysine
JP2001037495A (en) 1999-07-07 2001-02-13 Degussa Huels Ag L-lysine-producing coryneform bacteria, DNA capable of replication therein, a method for producing L-lysine, and E. coli. E. coli and Corynebacterium glutamicum strains
US6861246B2 (en) 1999-07-07 2005-03-01 Degussa Ag L-lysine-producing corynebacteria and process for the preparation of lysine
US6962989B1 (en) 1999-07-08 2005-11-08 Basf Aktiengesellschaft Corynebacterium glutamicum genes encoding novel proteins
US6913909B2 (en) 1999-09-01 2005-07-05 Degussa Ag Nucleotide sequences coding for the thrE gene and process for the enzymatic production of L-threonine using coryneform bacteria
US6872553B2 (en) 1999-10-20 2005-03-29 Degussa Ag Nucleotide sequences which code for the pck gene
US20020197605A1 (en) 1999-12-16 2002-12-26 Satoshi Nakagawa Novel Polynucleotides
US20030055232A1 (en) 1999-12-30 2003-03-20 Archer-Daniels-Midland Company Polynucleotide constructs for increased lysine production
US6740742B2 (en) 2000-03-23 2004-05-25 Degussa Ag Nucleotide sequences encoding the dapC gene and process for the production of L-lysine
WO2002053707A1 (en) 2000-12-30 2002-07-11 Cheil Jedang Corporation Microorganism producing l-lysine and processes for producing l-lysine using the same
DE10110760A1 (en) 2001-01-30 2002-08-01 Degussa New nucleotide sequences encoding the otsA gene
US20020192674A1 (en) 2001-01-30 2002-12-19 Degussa Ag Nucleotide sequence coding for the OtsA protein
US7160711B2 (en) 2001-08-06 2007-01-09 Degussa Ag Coryneform bacteria which produce chemical compounds I
JP2006512922A (en) 2003-01-21 2006-04-20 トランスジェンアールエックス,インコーポレイテッド Administration of transposon vectors to the reproductive organs
US20050255568A1 (en) 2003-05-30 2005-11-17 Bailey Richard B Methods and compositions for amino acid production
WO2005121349A2 (en) 2003-12-18 2005-12-22 Basf Aktiengesellschaft Methods for the preparation of a fine chemical by fermentation
KR20050065712A (en) 2003-12-23 2005-06-30 씨제이 주식회사 Corynebaterium sp. transformed with a heterogenous fructokinase gene and method for producing l-lysine using the same
WO2006065095A1 (en) 2004-12-16 2006-06-22 Cj Corporation Novel promoter nucleic acid derived from corynebacterium genus bacteria, expression cassette comprising the promoter and vector comprising the cassette, host cell comprising the vector and method for expressing a gene using the cell
KR20060068505A (en) 2004-12-16 2006-06-21 씨제이 주식회사 Novel promoter sequences derived from Corynebacterium spp., Expression cassettes and vectors comprising the same, host cells comprising the vector and methods of expressing genes using the same
WO2006071099A1 (en) 2004-12-30 2006-07-06 Cj Corporation Novel l-lysine-inducible promoter
EP1715055A2 (en) 2005-04-22 2006-10-25 Degussa GmbH Process for the production of L-amino acids using improved Enterobacteriaceae strains
WO2007039532A2 (en) 2005-10-05 2007-04-12 Evonik Degussa Gmbh Method for the fermentative production of l-amino acids with the aid of coryneform bacteria capable of using glycerin as the only carbon source
US20080293100A1 (en) 2005-10-05 2008-11-27 Degussa Gmbh Method for the Fermentative Production of L-Amino Acids With the Aid of Coryneform Bacteria Capable of Using Glycerin as the Only Carbon Source
WO2008033001A1 (en) * 2006-09-15 2008-03-20 Cj Cheiljedang Corporation A corynebacteria having enhanced l-lysine productivity and a method of producing l-lysine using the same
KR20080025355A (en) 2006-09-15 2008-03-20 씨제이제일제당 (주) Corynebacteria with improved L-lysine production and L-lysine production method using the same
US20100015673A1 (en) 2006-12-29 2010-01-21 Cj Cheiljedang Corporation Microorganism Of Corynebacterium Genus Having Enhanced L-Lysine Productivity And A Method Of Producing L-Lysine Using The Same
US20100028957A1 (en) 2006-12-29 2010-02-04 Cj Cheiljedang Corporation Microorganism Of Corynebacterium Genus Having Enhanced L-Lysine Productivity And A Method Of Producing L-Lysine Using The Same
US8048650B2 (en) 2006-12-29 2011-11-01 Cj Cheiljedang Corporation Microorganism of Corynebacterium genus having enhanced L-lysine productivity and a method of producing L-lysine using the same
US8058036B2 (en) 2006-12-29 2011-11-15 Cj Cheiljedang Corporation Microorganism of Corynebacterium genus having enhanced L-lysine productivity and a method of producing L-lysine using the same
US20100129884A1 (en) 2007-01-24 2010-05-27 Cj Cheiljedang Corporation Process for Producing Fermentation Product from Carbon Sources Containing Glycerol using Corynebacteria

Non-Patent Citations (47)

* Cited by examiner, † Cited by third party
Title
Accession AX121271. May 11, 2001. *
Accession AXBX248360, Nov. 2006.
Beijer et al. (1992) FEMS Microbiology Letters 100:217-220, "Utilisation of glycerol and glycerol 3-phosphate is differently affected by the phosphotransferase system in Bacillus subtilis".
Beijer et al. (Feb. 1993) Journal of General Microbiology, 139(2):349-359, "The glpP and glpF genes of the glycerol regulon in Bacillus subtilis".
Biebl (1998) Appl Microbiol Biotechnol. 50:24-29, "Fermentation of glycerol to 1,3-propanediol and 2,3-butanediol by Klebsiella pneumonia".
Cerdeno-Tarraga et al. (2003) Nucleic Acids Research 31(22):6516-6523 , "The complete genome sequence and analysis of Corynebacterium diphtheriae NCTC13129".
Contador C.A. et al., "Ensemble modeling for strain development of l-lysine-producing Escherichia coli," Metabolic Engineering, Jul. 1, 2009, pp. 221-233, vol. 11, No. 4-5, Academic Press.
Database UnitProt [Online] Jul. 5, 2004, "SubName: Full=Putative uncharacterized protein".
Doleyres et al. (2005) Appl Microbiol Biotechnol. 68:467-474, "Production of 3-hydroxypropionaldehyde using a two-step process with Lactobacillus reuteri".
Eggeling (1994) Amino Acids 6:261-272, "Biology of L-lysine overproduction by Corynebacterium glutamicum".
European Search Report issued Dec. 30, 2009 in PCT/KR2007/006935.
Extended European Search Report dated Jan. 5, 2010, for European Patent Application No. 07808268.
GenBank Accession No. BA000036.3, (2009).
González-Pajuelo et al. (2004) J Ind Microbiol Biotechnol. 31:442-446, "Production of 1,3-propanediol by Clostridium butyricum VPI 3266 using a synthetic medium and raw glycerol".
Hayashi et al. Applied Microbiology and Biotechnology (2006), 72(4), 783-789. *
Hayes, Finbarr (2003) Annu. Rev. Genet. 37:3-29, "Transposon-Based Strategies for Microbial Functional Genomics and Proteomics".
Heller et al. (Oct. 1980) Journal of Bacteriology 144(1):274-278, "Substrate Specificity and Transport Properties of the Glycerol Facilitator of Escherichia coli".
Himmi et al. (2000) Appl Microbiol Biotechnol 53:435-440, "Propionic acid fermentation of glycerol and glucose by Propionbacterium acidipropionici and Propionibacterium freudenreichii ssp. shennanii".
Ikeda et al. (Aug. 2003) App. Microbiol. and Biotechnol. 62( 2-3, 1): 99-109, "The Corynebacterium glutamicum genome: Features and impacts on biotechnological processes".
International Search Report and Written Opinion dated May 16, 2008 from PCT/KR2008/000391.
International Search Report dated Jan. 2, 2008, for PCT International Patent Application No. PCT/KR2007/004478.
International Search Report issued in PCT/KR2009/001845 mailed Nov. 27, 2009.
Ito et al. (2005) Journal of Bioscience and Bioengineering 100(3):260-265, "Hydrogen and Ethanol Production from Glycerol-Containing Wastes Discharged after Biodiesel Manufacturing Process".
Kawaguchi et al. (May 2006) Applied and Environmental Microbiology 72(5):3418-3428, "Engineering of a Xylose Metabolic Pathway in Corynebacterium glutamicum".
Koffas Mattheos A.G. et al., "Effect of pyruvate carboxylase overexpression on the physiology of Corynebacterium glutamicum," Applied and Environmental Microbiology, Nov. 2002, pp. 5422-5428, vol. 68, No. 11.
Liebl, W. "Transfer of Brevibacterium divaricatum DSM 20297T, "Brevibacterium flavum" DSM 20411, "Brevibacterium lactofermenturn" DSM 20412 and DSM 1412, and Corynebacteriumlilium DSM 20137T to Corynebacteriurn glutamicum and Their Distinction by rRNA Gene Restriction Patterns" International Journal of Systematic Bacteriology, 1991, vol. 41, pp. 255-260.
Lin et al. (1976) Ann. Rev. Microbiol. 30:535-578, "Glycerol Dissimilation and its Regulation in Bacteria".
Menzel (1997) Enzyme and Microbial Technology 20:82-86, "High Concentration and Productivity of 1,3-propanediol from continuous fermentation of glycerol by Klebsiella pneumoniae".
Mitsuhashi et al. (Nov. 2006) Biosci., Biotechnol., and Biochem. 70(11): 2803-2806, "Disruption of malate:quinone oxidoreductase increases L-lysine production by Corynebacterium glutamicum".
Moon, et al. (2005) FEMS Microbiology Letters, "Analyses of enzyme II gene mutants for sugar transport and heterologous express of fructokinase gene in Corynebacterium glutamicum ATCC 13032," vo. 244, p. 259-266.
Mormann (Aug. 10, 2006) BMC Genomics, 7:205, doi:10.1186/1471-2164-205, "Random mutagenesis in Corynebacterium glutamicum ATCC 13032 using an IS6100-based transposon vector identified the last unknown gene in the histidine biosynthesis pathway".
Nishise et al. (1985) Agri. Biol. Chem. 49(3):629-636, "Glycerol Dehydrogenase and Glycerol Dissimilation in Cellulomonas sp. NT3060t".
Office Action issued Jan. 12, 2011 in U.S. Appl. No. 12/518,578.
Office Action issued Jan. 7, 2011 in U.S. Appl. No. 12/518,572.
Office action issued Jul. 11, 2011 in U.S. Appl. No. 12/518,578.
Office Action issued Jul. 6, 2011 in U.S. Appl. No. 12/518,572.
Parche et al. (Jul. 2001) J. Mol. Microbiol. Biotechnol. 3(3):415-422, "Corynebacterium diphtheriae: a PTS View to the Genome".
Paulsen et al. (Oct. 2000) Microbiology146:2343-2344, "Functional genomic studies of dihydroxyacetone utilization in Escherichia coli".
PCT International Preliminary Report on Patentability issued Oct. 12, 2010 and Written Opinion for PCT/KR2009/001845.
Peters-Wendisch et al. (Nov. 2005) Applied and Environmental Microbiology, 71(11):7139-7144, "Metabolic Engineering of Corynebacterium glutamicum for L-Serine Production".
Talarico et al. (Dec. 1988) Antimicrobial Agents and Chemotherapy 32(12):1854-1858, "Production and Isolation of Reuterin, a Growth Inhibitor Produced by Lactobacillus reuteri".
Tangney et al. Journal of Molecular Microbiology and Biotechnology (2000), 2(1), 71-80 (Abstract). *
Tsuge et al. (2005) Microbiology 151:501-508, "A New Insertion Sequence, ISI4999, from Corynebacterium glutamicum".
Tzvetkov et al. (Jul. 2003) Microbiology 149(7):1659-1673, "Genetic dissection of trehalose biosynthesis in Corynebacterium glutamicum: Inactivation of trehalose production leads to impaired growth and altered cell wall lipid composition".
Vertes, A.A. "Transposon Mutagenesis of Coryneform Bacteria" Mol.Gen.Genet., 1994,vol. 245, pp. 397-405.
Voegele (Feb. 1993) Journal of Bacteriology, 175(4):1087-1094, "Glycerol Kinase of Escherichia coli Is Activated by Interaction with the Glycerol Facilitator".
Wang et al. (2001) Biotechnology Advances 19:201-223, "Glycerol production by microbial fermentation: A review".

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130157370A1 (en) * 2008-04-10 2013-06-20 Cj Cheiljedang Corporation Transformation Vector Comprising Transposon, Microorganisms Transformed with the Vector, and Method for Producing L-Lysine Using the Microorganism
US8932861B2 (en) * 2008-04-10 2015-01-13 Cj Cheiljedang Corporation Transformation vector comprising transposon, microorganisms transformed with the vector, and method for producing L-lysine using the microorganism
US20140099680A1 (en) * 2011-04-01 2014-04-10 Cj Cheiljedang Corporation Corynebacterium sp. transformed with a fructokinase gene derived from escherichia sp. and process for preparing l-amino acid using the same
US9267161B2 (en) * 2011-04-01 2016-02-23 Cj Cheiljedang Corporation Corynebacterium sp. transformed with a fructokinase gene derived from Escherichia sp. and process for preparing L-amino acid using the same

Also Published As

Publication number Publication date
DE112009000453T5 (en) 2010-12-30
JP5412446B2 (en) 2014-02-12
US20100330624A1 (en) 2010-12-30
KR20090107665A (en) 2009-10-14
KR101126041B1 (en) 2012-03-19
JP2011512155A (en) 2011-04-21
BRPI0908450A2 (en) 2015-08-18
WO2009125992A3 (en) 2010-01-21
CN102027119B (en) 2014-03-05
CN102027119A (en) 2011-04-20
WO2009125992A2 (en) 2009-10-15

Similar Documents

Publication Publication Date Title
US8323933B2 (en) Vector for transformation using transposons, microorganisms transformed by the vector, and method for producing L-lysine using the same
JP6695308B2 (en) Corynebacterium genus having improved L-lysine production ability and L-lysine production method using the same
US9938546B2 (en) Method for producing L-lysine using microorganisms having ability to produce L-lysine
US9556463B2 (en) Genes encoding biofilm formation inhibitory proteins and a method for producing L-lysine using a bacterial strain with the inactivated genes
US8426577B2 (en) Promoter and a production method for L-lysine using the same
US9758771B2 (en) Microorganism with enhanced L-lysine productivity and method for producing L-lysine by using same
JP2012532603A (en) Method for producing L-lysine of Corynebacterium that has acquired the activity of glyceraldehyde-3-phosphate dehydrogenase derived from a foreign species
US20200347420A1 (en) Corynebacterium genus microorganism for producing l-lysine and method for producing l-lysine by using the same
US8932861B2 (en) Transformation vector comprising transposon, microorganisms transformed with the vector, and method for producing L-lysine using the microorganism
KR20020003519A (en) Bacterium producing L-glutamic acid and method for producing L-glutamic acid
KR101269810B1 (en) A microorganism having enhanced L-lysine productivity and a method of producing L-lysine using the same
US9290771B2 (en) Recombinant microorganism having an enhanced ability to produce putrescine and a method for producing putrescine using the same
EP2430152B1 (en) Microorganism with enhanced l-lysine productivity and method for producing l-lysine using the same
BR122018011810B1 (en) VECTOR FOR TRANSFORMATION USING TRANSPOSONS, MICROORGANISMS TRANSFORMED BY THE VECTOR AND METHOD FOR PRODUCING L-LYSINE

Legal Events

Date Code Title Description
AS Assignment

Owner name: CJ CHEILJEDANG CORPORATION, KOREA, REPUBLIC OF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:JANG, JAE-WOO;LIM, SANG-JO;CHOI, JONG-SOO;AND OTHERS;REEL/FRAME:024835/0877

Effective date: 20100812

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

STCF Information on status: patent grant

Free format text: PATENTED CASE

FPAY Fee payment

Year of fee payment: 4

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 8

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 12TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1553); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 12