US8173395B2 - Mussel bioadhesive - Google Patents

Mussel bioadhesive Download PDF

Info

Publication number
US8173395B2
US8173395B2 US12/565,066 US56506609A US8173395B2 US 8173395 B2 US8173395 B2 US 8173395B2 US 56506609 A US56506609 A US 56506609A US 8173395 B2 US8173395 B2 US 8173395B2
Authority
US
United States
Prior art keywords
seq
protein
mgfp
adhesive protein
adhesive
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime, expires
Application number
US12/565,066
Other versions
US20110033891A1 (en
Inventor
Hyung Joon Cha
Dong Soo Hwang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pohang University of Science and Technology Foundation
Posco Holdings Inc
Original Assignee
Posco Co Ltd
Pohang University of Science and Technology Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Posco Co Ltd, Pohang University of Science and Technology Foundation filed Critical Posco Co Ltd
Priority to US12/565,066 priority Critical patent/US8173395B2/en
Assigned to POSCO, POSTECH FOUNDATION reassignment POSCO ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHA, HYUNG JOON, HWANG, DONG SOO
Publication of US20110033891A1 publication Critical patent/US20110033891A1/en
Application granted granted Critical
Publication of US8173395B2 publication Critical patent/US8173395B2/en
Assigned to NATURE GLUETECH CO., LTD. reassignment NATURE GLUETECH CO., LTD. LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: POSCO, POSTECH FOUNDATION
Assigned to POSCO HOLDINGS INC. reassignment POSCO HOLDINGS INC. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: POSCO
Assigned to POSTECH FOUNDATION, POSCO CO., LTD reassignment POSTECH FOUNDATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: POSCO HOLDINGS INC., POSTECH FOUNDATION
Adjusted expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates

Definitions

  • the present invention relates to a bio-adhesive derived from mussel, and more particularly to a novel Mytilus galloprovincialis foot protein-5 (MGFP-5) and a recombinant protein that is a hybrid of MGFP-5 and foot protein-1(FP-1).
  • MGFP-5 Mytilus galloprovincialis foot protein-5
  • FP-1 foot protein-1
  • Mussels produce and secrete specialized water-resistant bioadhesives, and have been studied as a potential source of water-resistant bioadhesives. They adhere tightly to surfaces underwater using the byssus secreted from the foot of the mussel. At the end of each thread is an adhesive plaque containing a water-resistant glue that enables the plaque to anchor to wet solid surfaces (Waite, J. H., Biology Review. 58:209-231(1983). This strong and water-insoluble adhesion has attracted interest for potential use in biotechnological applications. Mussel adhesive proteins can also be used as medical adhesives as they are non-toxic to the human body and do not impose immunogenicity (Dove et al., Journal of American Dental Association. 112:879 (1986)). Moreover, their biodegradable properties make them environmentally friendly.
  • the byssus can be divided into distal and proximal parts.
  • the proximal part is connected to the stem gland of the mussel foot, while the distal part is connected to the adhesive plaques.
  • the adhesive plaque is composed of five distinct types of proteins: foot protein type 1 (FP-1) to type 5 (FP-5) (Deming, T. J., Current Opinion in Chemical Biology. 3:100-105 (1999)).
  • All of the mussel adhesive proteins contain high ratios of 3,4-dihydroxyphenyl-L-alanine (DOPA), which is derived from hydroxylation of tyrosine residues (Waite, J. H., Biology Review. 58:209-231 (1983)).
  • DOPA 3,4-dihydroxyphenyl-L-alanine
  • the adhesive proteins closest to the adhesion interface have the highest proportion of DOPA residues (Waite, J. H., Integr. Comp. Biol. 42:1172-1180 (2002)).
  • mussel adhesive protein analogs lacking DOPA show greatly reduced adhesion abilities (Yu et al., Journal of American Chemical Society. 121:5825-5826 (1999)).
  • DOPA residues can enable mussel adhesive protein molecules to cross-link with each other via oxidative conversion to o-quinone.
  • DOPA content of a mussel adhesive protein appears to be specifically related to its adhesive properties.
  • An objective of the present invention is to provide a novel adhesive protein gene from mussel and to overcome the aforementioned problems in the prior art.
  • Another objective of the present invention is to provide a novel adhesive protein from mussel.
  • Another objective of the present invention is to provide a method for mass-producing a mussel adhesive protein in a biologically active form.
  • Another objective of the present invention is to provide a recombinant adhesive protein that is a fusion of two or more adhesive proteins from mussel.
  • Another objective of the present invention is to provide an adhesive that contains a novel adhesive protein as an active component.
  • the present invention provides a novel adhesive protein extracted from Mytilus galloprovincialis and a polynucleotide encoding the protein.
  • the above adhesive protein preferably comprises the amino acid sequence shown in SEQ ID NO: 6.
  • An example of the above polynucleotide is the nucleotide sequence shown in SEQ ID NO: 5.
  • the present invention also provides a recombinant adhesive protein where some amino acid sequences from FP-1 is attached to the amino- and/or carboxy-termini of a mussel adhesive protein, and a polynucleotide encoding the recombinant adhesive protein.
  • An example of the recombinant adhesive protein is an amino acid sequence selected from the group consisting of the amino acid sequence shown in SEQ ID NO: 10, the amino acid sequence shown in SEQ ID NO: 12, the amino acid sequence shown in SEQ ID NO: 14, the amino acid sequence shown in SEQ ID NO: 18, the amino acid sequence shown in SEQ ID NO: 20, and the amino acid sequence shown in SEQ ID NO: 22.
  • nucleotide sequence encoding the recombinant adhesive protein is the nucleotide sequence shown in SEQ ID NO: 9, the nucleotide sequence shown in SEQ ID NO: 11, the nucleotide sequence shown in SEQ ID NO: 13, the nucleotide sequence shown in SEQ ID NO: 17, the nucleotide sequence shown in SEQ ID NO: 19, and the nucleotide sequence shown in SEQ ID NO: 21.
  • the present invention also provides a transformant which contains operably a nucleotide sequence encoding an adhesive protein.
  • the present invention also provides a method of producing an adhesive protein which comprises the steps of:
  • the present invention also provides a method of purifying an adhesive protein which comprises the steps of:
  • the present invention also provides an adhesive containing an adhesive protein as the active component.
  • the present invention also provides a method of adjusting the adhesive property of an adhesive comprising controlling the concentration of an adhesive protein which is an active component of the aforementioned adhesive, or treating the adhesive with one or more material selected from the group consisting of oxidant, filler and surfactant.
  • the present invention also provides a coating material containing an adhesive protein as an active component.
  • FIG. 1 is a picture of the electrophoresis of MGFP-5 cDNA fragments obtained by RT-PCR with RNA extracted from Mytilus galloprovincialis as the template.
  • FIG. 2 shows the procedure for inserting MGFP-5 cDNA into a pTrcHis vector to construct a pMDG05 vector.
  • FIG. 3 shows the FP-1 variant (referred to as “6 ⁇ AKPSYPPTYK” from hereon) where the peptide AKPSYPPTYK is tandemly attached 6 times, and the 4 oligomers KD-1, KD-2, KD-3, and KD-4 that were used in its synthesis.
  • FIG. 4 shows vector diagrams of various combinations that can simultaneously express the 6 ⁇ AKPSYPPTYK and the MGFP-5 gene.
  • FIG. 5 is a diagram showing the procedure for constructing the pMDG051 vector for making the recombinant MGFP-51 nucleotide sequence.
  • FIG. 6 is a diagram showing the procedure for constructing the pMDG150 vector for making the recombinant MGFP-15 nucleotide sequence.
  • FIG. 7 is a diagram showing the procedure for constructing the pMDG151 vector for making the recombinant MGFP-151 nucleotide sequence.
  • FIG. 8 is a diagram showing the procedure for constructing the pENG151 vector for making the recombinant MGFP-151 nucleotide sequence.
  • FIG. 9 is a photograph of the electrophoresis of each culture material of E. coli BL21/pMDG05 and E. coli BL21/pTrcHis ( E. coli BL21/pTrcHisA transformed with pTrcHisA)
  • FIG. 10 is a Western blot photograph of an SDS-PAGE of the whole cell pellet (WC), soluble upper fraction (I), and insoluble cell debris fraction (IS) isolated from E. coli BL21/pMDG05 culture solution, and negative control (N).
  • FIG. 11 is a photograph of silver-stained SDS-PAGE of affinity chromatography fractions for purification of recombinant MGFP-5 protein from E. coli BL21/pMDG05.
  • FIG. 12 is a mass spectrometry result of purified recombinant MGFP-5 protein.
  • FIG. 13 shows (A) Coomassie blue-stained SDS-PAGE and (B) Western blot analyses of recombinant MGFP-51 protein from E. coli BL21/pMDG051.
  • FIG. 14 shows (A) SDS-PAGE and (B) Western blot analyses of recombinant MGFP-15 protein from E. coli BL21/pMDG150.
  • FIG. 15 shows (A) SDS-PAGE and (B) Western blot analyses of recombinant MGFP-151 protein from E. coli BL21/pMDG151.
  • FIG. 16 shows the recovery rates of recombinant MGFP-151 protein expressed from E. coli BL21/pMDG151 according to the concentration of acetic acid solution.
  • FIG. 17 shows (A) SDS-PAGE and (B) Western blot analyses of chromatographic fractions of recombinant MGFP-151 protein.
  • FIG. 18 shows the results of coating slide glass, poly(methyl methacrylate) plate, and aluminum plate with recombinant MGFP-5 and recombinant MGFP-151 proteins after the tyrosine residues are modified to DOPA.
  • FIG. 19 shows the QCM analysis results of BSA, Cell-Tak, recombinant MGFP-5 protein, and recombinant MGFP-151 protein after treating the tyro sines.
  • FIG. 20 is a diagram of the measurement method of the adhesion force of recombinant adhesive proteins.
  • FIG. 21 shows the adhesion force of recombinant MGFP-1 and recombinant MGFP-5 proteins where the tyrosine residues have been modified.
  • FIG. 22 is a measurement of cell-adhesion property of recombinant adhesive proteins.
  • FIG. 23 is a measurement of cell-adhesion property of recombinant adhesive proteins with insect Drosophila S2 cells.
  • FIGS. 24A to C are photographs of a substrate surface coated with recombinant MGFP-5 and recombinant MGFP-151 proteins.
  • A is a 2500 ⁇ enlargement
  • B is a 10000 ⁇ enlargement
  • C is a 35000 ⁇ enlargement.
  • the inventors of the present invention have obtained a novel adhesion protein and its encoding gene from a type of mussel, Mytilus galloprovincialis , and they have established a system for the production of an adhesion protein that is translated from it. They have also established a recombinant adhesion protein that is a fusion of two or more mussel adhesion proteins, and a system for its production.
  • the adhesive protein of the present invention has the characteristic of attaching to a wide variety of substrates such as glass, metal, polymer resin, plastic or biological cell membranes such as prokaryotic membranes, eukaryotic membranes, and plant cell walls and lipids.
  • the adhesive protein of the present invention has at least 50% homology with the amino acid sequence shown in SEQ ID NO: 6, preferably 80%, more preferably 90%, and most preferably at least 95% homology, and at the same time can include amino acid sequences that have adhesive property, for example adhesive property that is similar to the amino acid sequence shown in SEQ ID NO: 6, or amino acid sequences that have 70 to 200% of the adhesive activity of the above.
  • MGFP-5 Mytilus galloprovincialis foot protein type 5
  • a nucleotide encoding MGFP-5 can be expressed as a variety of nucleotide sequences depending on the amino acid codon usage, such as the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 15.
  • the adhesive protein of the present invention can further contain a peptide at the amino- and/or carboxy-termini in order to improve the physicochemical properties of the adhesive protein.
  • the above peptide may be added for the purpose of improving for example, the solubility, adhesion force, degree of crosslinking, and the degree of expression, purification, and recovery of protein.
  • the above peptide can be a general reporter protein such as GST or a histidine tag for the purpose of improving the purification.
  • An example of a form where a peptide is further included for the purpose of purifying an adhesive protein is a protein containing the amino acid sequence shown in SEQ ID NO: 16.
  • the above peptide preferably contains an amino acid sequence derived from an adhesive protein, and more preferably contains an amino acid sequence derived from a mussel adhesive protein.
  • An example of the peptide is the amino acid sequence shown in SEQ ID NO: 25 is repeated 1 to 10 times in tandem.
  • a SEQ ID NO: 8 was constructed in which the amino acid sequence shown in SEQ ID NO: 25 is repeated 6 times in tandem, and attached to the amino- and/or carboxy-termini of the adhesive protein in the present invention.
  • the amino acid sequence shown in the SEQ ID NO: 25 is a part of the sequence of the FP-1 protein.
  • Examples of recombinant adhesive proteins where the sequence shown in SEQ ID NO: 25 is additionally attached are amino acid sequences shown in SEQ ID Nos: 10, 12, and 14.
  • the SEQ ID NO: 10 is where the sequence shown in SEQ ID NO: 25 is repeated 6 times in tandem and attached to the amino-terminus of the amino acid sequence shown in SEQ ID NO: 6.
  • SEQ ID NO: 12 is where the sequence shown in SEQ ID NO: 25 is repeated 6 times in tandem and attached to the carboxy-terminus of the amino acid sequence shown in SEQ ID NO: 6.
  • SEQ ID NO: 14 is where the sequence shown in SEQ ID NO: 25 is repeated 6 times in tandem and attached to the amino- and carboxy-termini of the amino acid sequence shown in SEQ ID NO: 6.
  • recombinant adhesive proteins containing the amino acid sequences shown in SEQ ID Nos: 10, 12, or 14 can additionally contain a peptide which has a purpose of facilitating purification.
  • the peptide may be located on the amino- and/or the carboxy-termini of a recombinant adhesive protein, and examples of the peptide are GST and histidine tag.
  • Recombinant adhesive proteins containing amino acid sequences as shown in SEQ ID Nos: 18, 20, or 22 are forms where a histidine tag is attached to the amino-terminus of a protein containing the amino acid sequences shown in SEQ ID Nos: 10, 12, or 14 respectively.
  • the adhesive protein of the present invention can further contain a peptide of 1 to 10 amino acids that are additionally inserted during cloning of the adhesive protein, at the amino-terminus, carboxy-terminus, or another kind of connective region of proteins.
  • the adhesive protein and recombinant adhesive protein of the present invention can be inserted into commonly used expression vectors constructed for expressing exogenous genes, and mass-produced through genetic engineering methods.
  • the above vector may be selected according to the type and characteristics of the host cell used in the production of protein, or it may be newly constructed.
  • Transforming the vector into the host cell and producing the recombinant protein from the transformant can easily be carried out through ordinarily employed methods. Selecting, constructing, transforming the vector and expressing the recombinant protein can be easily carried out by an ordinary person skilled in the art of the present invention, and partial variations in the ordinarily employed methods are also included in the present invention.
  • the sequence encoding an adhesive protein that is inserted into the vector is a sequence encoding an adhesive protein or a recombinant adhesive protein of the present invention, and is preferably selected from the group consisting of a nucleic acid encoding a protein that has at least 50% homology, preferably 80%, more preferably 90%, and most preferably at least 95% homology with the amino acid sequence shown in SEQ ID NOs: 6, 10, 12, or 14, a nucleic acid encoding a protein that has at least 50% homology, preferably 80%, more preferably 90%, and most preferably at least 95% homology with the amino acid sequence shown in SEQ ID NO: 6, 10, 12, or 14, where at least one sequence selected from the group consisting of SEQ ID NO:s 26 to 31 is tandemly repeated 1 to 10 times at the 5′ and/or 3′ ends of the nucleic acid, and the amino acid sequence shown in SEQ ID NO: 6, 10, 12, or 14, where 6 histidine residues are additionally attached at the amino-terminus. More preferably, a polyn
  • MGFP-5 sequence was cloned into a pGEM-T vector, and the sequence shown in SEQ ID NO: 7 (6 ⁇ AKPSYPPTYK which is 6 tandem repeats of the amino acid sequence shown in SEQ ID NO: 25) was cloned into pUC18. Afterwards, the MGFP-5 sequence was cloned into a pTrcHisA vector to construct a pMDG05 vector ( FIG. 4 ).
  • the above pTrcHisA vector is a widely known vector which contains a trcpromoter, which allows expression of exogenous protein by induction using IPTG(isopropylthio- ⁇ -D-galactoside), and which has 6 histidine sequences for protein purification by affinity chromatography at the 5′ end of the exogenous gene in order to facilitate protein purification.
  • the pMDG05 vector was deposited at the Korean Collection for Type Cultures (KCTC) at the Biological Resource Center of Korea located at Eouen-dong, Yuseong-gu, Daejon, Republic of Korea as of Jun. 20, 2002, and received an accession number of KCTC 10291BP.
  • the pENG151 vector was deposited as of Jan. 19, 2005 and given an accession number of KCTC 10766BP.
  • the expression vector for the adhesive protein and recombinant adhesive protein can be transformed into a host cell selected from the group consisting of prokaryotes, eukaryotes, and eukaryote-derived cells, in order to construct a transformant.
  • the prokaryote is selected from the group consisting of E. coli and Bacillus
  • the eukaryote is selected from the group consisting of yeast, insects, animals, and plants
  • the eukaryote-derived cells are plant cells, insect cells, and plants, but is not limited thereto.
  • pMDG05, pMDG150, pMDG051 and pMDG151 vectors were each transformed into E. coli BL21, to construct E. coli BL21/pMDG05, E. coli BL21/pMDG150, E. coli BL21/pMDG051 and E. coli BL21/pMDG151.
  • the aforementioned 4 types of transformants can be cultured in typical LB media, and IPTG can be added to induce protein expression.
  • the preferred method of expression of recombinant protein is to culture in LB media (5 g/liter yeast extract, 10 g/liter Tryptone, 10 g/liter NaCl), and adding 0.1 to 10 mM of IPTG when the optical density of the culture solution is 0.6 to 0.9 at 600 nm, then culturing for 2 to 12 hours.
  • LB media 5 g/liter yeast extract, 10 g/liter Tryptone, 10 g/liter NaCl
  • the recombinant protein expressed in the above method is expressed in a water-soluble and/or insoluble form within the transformant, so the isolation and purification depends on how it is expressed.
  • the recombinant protein can be purified by running the lysed cell supernatant through a chromatography column filled with an affinity resin such as a nickel resin.
  • the recombinant protein can be purified by suspending the lysed cell pellet in an acidic organic solvent, preferably an organic solvent with a pH of 3 to 6, then centrifuging the suspension to isolate the upper layer.
  • an acidic organic solvent preferably an organic solvent with a pH of 3 to 6, but is not limited thereto.
  • the acetic acid used can be 5 to 30 (v/v) %, and preferably the cell pellet is dissolved in 20 to 30 (v/v) % acetic acid solution.
  • the upper layer obtained through treatment with acidic organic solvent can further undergo gel filtration chromatography to further purify the recombinant protein.
  • MGFP-5 of at least 95% purity 2-3 mg/L of the recombinant adhesive protein MGFP-5 of at least 95% purity can be obtained, and around 5 mg/L of MGFP-151 of at least 95% purity can be obtained. While MGFP-5 and MGFP-151 display similar levels of adhesion force, the solubility of MGFP-151 is significantly higher compared to MGFP-5, and thus MGFP-151 is easier to obtain in a concentrated form.
  • MGFP-5 dissolves in a 5% acetic acid solution to a concentration of around 1 mg/mL
  • MGFP-151 dissolves in water to a concentration of around 110 mg/mL
  • a 5% acetic acid solution dissolves in a concentration of around 220 mg/mL.
  • the solubility of an adhesive protein is directly related to its ability to stay in highly concentrated forms, so the higher the solubility, the easier it is to make highly concentrated forms with high potential for industrial application. In this respect, it can be said that the adhesive protein MGFP-151 is more useful than MGFP-5.
  • the adhesive protein and the recombinant adhesive protein obtained through its expression in the present invention have adhesive activity and can be used as adhesives.
  • the adhesive activity was confirmed through the experiment of modifying the tyrosine residues in the protein to 3,4-dihydroxyphenyl-L-alanine (DOPA).
  • DOPA 3,4-dihydroxyphenyl-L-alanine
  • the adhesive protein of the present invention can not only be used as an adhesive for a wide variety of substrates, but also be used as a bioadhesive since it is harmless to the human body.
  • the present invention also provides an adhesive that contains adhesive protein as an active component.
  • the adhesive protein can be a form where 5 to 100% of its tyrosine residues are modified to DOPA, and the adhesive can additionally contain a substance that modifies the tyrosine residues in the protein to DOPA.
  • a typical example of the above substance is tyrosinase, but is not limited thereto.
  • the above adhesive can further contain 0.5 to 90% by weight of an excipient that is generally contained in bioadhesives or is pharmaceutically acceptable.
  • excipients include surfactants, oxidants, and fillers, but are not limited thereto (see: U.S. Pat. Application Publication No. 2003-65060 and U.S. Pat. No. 5,015,677).
  • the surfactant can be cationic, anionic, non-ionic, or amphoteric, where examples are sodium dodecylsulfate and sodium dodecylbenzensulfonate.
  • the oxidant can be selected from the group consisting of tyrosinase, catechol oxidase, glutaraldehyde, formaldehyde, bis(sulfosuccinimidyl) suberate, 3,3′-Dithiobis(sulfosuccinimidyl propionate), O 2 , Fe 3+ , H 2 O 2 and IO 4 ⁇ (see: Macromolecules 1998, 31, 4739-4745), and the filler can be selected from the group consisting of collagen, hyaluronic acid, condroitan sulfate, elastine, laminin, caseine, hydroxyapatite, albumin, fibronectin, and hybrin.
  • the adhesive of the present invention can be used to adhere or fix glass, plastic, polymer resin, or biological specimen, and the detailed mode and amount of usage, formulation and other such matters may follow Cell-Tak (BD Biosciences, Two Oak Park, Bedford, Mass., USA) which is currently available commercially.
  • the adhesive of the present invention can be a soluble, water-soluble, or insoluble formulation, and can be used in the amount of 0.01 to 100 ug/cm 2 for a substrate but is not limited thereto.
  • the mode of use follows the general mode of adhesive use, and the typical mode is coating.
  • the aforementioned biological specimen refers to any animal or plant categorized as a biological organism and any part derived from such animal or plant. For example, it refers to cells, tissues, organs, RNA, DNA, protein, peptide, polynucleotide, hormones, and compounds, but is not limited thereto.
  • Examples of application of the adhesive of the present invention are as follows, but not limited thereto: (1) adhesion of substrates under water (fresh or salt water); (2) orthopedic treatments such as treatment of bone, ligament, tendon, meniscus, and muscle, and implant of artificial materials; (3) treatment of perforations, lacerations, and cuts, and ophthalmic attachments such as corneal implants and artificial corneal implants; (4) dental attachments such as holding retainers, bridges, or crowns in place, securing loose teeth, repairing broken teeth, and holding fillers in place; (5) surgical treatments such as attachment of blood vessels, attachment of cellular tissue, artificial material implants, and closure of wounds; (6) plant attachments such as bonding of transplanted parts and wound healing; (7) drugs, hormones, biological factors, medications, physiological or metabolic monitoring equipment, antibiotics, and cell transplant (see: U.S. Pat. No. 5,015,677).
  • the present invention also provides a method of adjusting the adhesion force of the above adhesive by treating with a substance selected from the group consisting of surfactant, oxidant, and filler, or controlling the concentration of the adhesive protein which is an active component of the adhesive (see: U.S. Pat. No. 5,015,677).
  • a substance selected from the group consisting of surfactant, oxidant, and filler or controlling the concentration of the adhesive protein which is an active component of the adhesive (see: U.S. Pat. No. 5,015,677).
  • the surfactant, oxidant, and filler are the same as was described above.
  • the present invention also provides a coating agent which contains the above adhesive protein as an active component. Since the adhesive protein of the present invention has the characteristic of adhering to glass, plastic, polymer resin, or biological specimen, it can not only be used as a coating agent for these substrates, but also coat the surface of substrates that are used underwater to prevent oxidation of the substrates, since the adhesive protein is water-resistant and water-repellent. An example of application of the coating agent is to coat the motor propeller of ships to prevent corrosion, but is not limited thereto.
  • the above coating agent may consist solely of an adhesion protein, but can additionally contain commonly known adhesives, adhesive proteins other than the adhesive proteins of the present invention, resin contained in commonly known coating agents, organic solvents, surfactants, anticorrosive agents, or pigments.
  • the content of the additional components may be appropriately adjusted within the commonly accepted range depending on the kind of component and formulation of the coating agent.
  • the adhesive protein as an active component is contained in the coating agent at a level that maintains the adhesive activity, and can for example be contained in the coating agent at 0.1 to 80% by weight.
  • the coating agent of the present invention can be manufactured in the form of cream, aerosol (spray), solid, liquid, or emulsion, but is not limited to these formulations.
  • the mussel used for cloning the MGFP-5 gene was Mytilus galloprovincialis.
  • the primer shown in SEQ ID NO: 1 (5′-ggcctgcagcagttctgaagaatacaaggg-3) and the primer shown in SEQ ID NO: 2 (gtagatctatacgccggaccagtgaacag) were each synthesized. PCR was run 30 times using the mussel cDNA library, and a PCR product of 243 bp was obtained ( FIG. 1 ). The above PCR product was cloned in a pGEM-T vector (Promega).
  • nested PCR was executed using mussel ( M. galloprovincialis ) cDNA library.
  • the primers used were a T3 promoter primer of the ZAP vector (SEQ ID NO: 32) and the primer shown in SEQ ID NO: 3 (5′-cttgtattttccgctgttttt-3′).
  • An amplification product of around 300 bp was obtained through the PCR and it was cloned into a pGEM-T vector.
  • nested PCR was performed using SEQ ID NO: 4 (5′-aaaaacagcggaaaatacaag-3′) and T7 promoter primer (SEQ ID NO: 33).
  • SEQ ID NO: 4 5′-aaaaaacagcggaaaatacaag-3′
  • T7 promoter primer SEQ ID NO: 33.
  • the amplification product of 350 bp was obtained and cloned into a pGEM-T vector.
  • the MGFP-5 cDNA nucleotide sequence obtained from the above was analyzed, and the MGFP-5 nucleotide sequence excluding the secretion signal sequence is shown in SEQ ID NO: 5, and the amino acid sequence encoded therein is shown in SEQ ID NO: 6.
  • the MGFP-5 cDNA in the pGEM-T vector was isolated by using the restriction enzyme sites PstI and EcoRI, then inserted into a pTrcHis A vector (Invitrogen, USA) that was cleaved with PstI and EcoRI restriction enzymes to construct pMDG05(4630 bp).
  • the pMDG05 vector was deposited at the Korean Collection for Type Cultures (KCTC) at the Biological Resource Center of Korea located at Eoeun-dong, Yuseong-gu, Daejon, Republic of Korea as of Jun. 20, 2002, and received a accession number of KCTC 10291BP.
  • KCTC Korean Collection for Type Cultures
  • the pMDG05 vector contains a trc promoter for expression in E. coli , and allows induction of expression using IPTG (Sigma, USA). It also has 6 histidine residues at the 5′ end of the MGFP-5 gene for protein isolation and purification by affinity chromatography.
  • KD-1 to KD-4 described in FIG. 3 was each synthesized, and then annealed, to synthesize 6 ⁇ AKPSYPPTYK in SEQ ID NO: 8 encoding the FP-1 variant in SEQ ID NO: 7. Additionally, at the 5′ end of the 6 ⁇ AKPSYPPTYK, EdoRI and NheI restriction enzyme sites in the direction of 5′ to 3′ were placed, and a BamHI restriction enzyme site was placed at the 3′ end ( FIG. 3 ). The 6 ⁇ AKPSYPPTYK was inserted into a pUC18 vector using the NheI and BamHI restriction enzyme sites to construct the pAD501 vector (M. Kitamura, 1999, Journal of Polymer Science Part A: Polymer Chemistry 37, 729-736).
  • MGFP-5 is referred to as “MGFP-5”
  • MGFP-15 a hybrid where 6 ⁇ AKPSYPPTYK is attached to the N-terminus of MGFP-5
  • MGFP-51 a hybrid where 6 ⁇ AKPSYPPTYK is attached to the C-terminus of MGFP-5
  • MGFP-151 a hybrid where 6 ⁇ AKPSYPPTYK is attached to both the N- and C-termini of MGFP-5
  • the hybrids MGFP-15 shown in SEQ ID NO: 10, MGFP-51 shown in SEQ ID NO: 12, and MGFP-151 shown in SEQ ID NO: 14 were constructed, and they include histidine tags (6 ⁇ His) and other amino acid residues at the 5′ end and amino acid residues between the 6 ⁇ AKPSYPPTYK and MGFP-5 due to the design of the experiment.
  • each of the hybrids MGFP-5, MGFP-15, MGFP-51 and MGFP-151 the structures shown in SEQ ID Nos: 15, 17, 19, and 21 were inserted into a vector to respectively construct pMDG05, pMDG150, pMDG051, and pMDG151 of FIG. 4 .
  • expression is controlled by a trc promoter that is inducible by IPTG (Sigma, US), and there are 6 histidine residues at the 5′ region and a translation termination codon (TAA) at the 3′ end of each recombinant construct.
  • PCR was executed on the nucleotide sequence of MGFP-5 within the pMDG05 vector of Example 2 with the primer set shown in SEQ ID NOs: 1 and 2, then cleaved with PstI and EcoRI restriction enzymes, then inserted into a pTrcHis A vector (Invitrogen, USA) which was previously cleaved with the same enzymes, to construct pTEMP150(4630bp).
  • the 6 ⁇ AKPSYPPTYK in the pAD501 vector of Example 2 was amplified with the primer set shown in SEQ ID NO: 23 (5′-GGT ACC CGA ATT C GA ATT C GC TAA ACC G-3′) and 24 (5′-GGT CGA CTC AAG CTT ATC ATT TGT AAG TCG-3′), and cleaved with EcoRI and Hind III restriction enzymes. Then it was inserted into pTEMP150 which was previously cleaved with EcoRI and Hind III, to construct pMDG051 ( FIG. 5 ).
  • the 6 ⁇ AKPSYPPTYK in the pAD501 vector was isolated by treating with NheI and BamHI restriction enzymes, and inserted into a pMDG05 vector which was treated with the same enzymes to construct pMDG150 ( FIG. 6 ).
  • the 6 ⁇ AKPSYPPTYK in the pAD501 vector was isolated by treating with Nhe I and BamH I restriction enzymes, and inserted into a pTrcHis A vector (Invitrogen, USA) which was treated with the same enzymes, to construct pTEMP1(4523 bp). Then the nucleotide sequence of MGFP-5 within the pMDG05 vector was amplified with the primer set shown in SEQ ID NOs: 1 and 2, then cleaved with PstI and EcoRI restriction enzymes, then inserted into pTEMP1 which was treated with the same enzymes, to construct pTEMP2(4741 bp).
  • the 6 ⁇ AKPSYPPTYK in the pAD501 vector was amplified with the primer set shown in SEQ ID NOs: 23 and 24, then cleaved with EcoRI and Hind III restriction enzymes. Then it was inserted into pTEMP2 which was cleaved with EcoRI and Hind III, to construct pMDG151 (4927 bp) ( FIG. 7 ).
  • the MGFP-151 nucleotide was amplified from the pMDG 151 vector with the primers shown in SEQ ID NO: 34 (5′-CCT AAC ATA TGG GGG TTC TCA TCA TC-3′) and SEQ ID NO: 35 (5′-ATC CGC CAA AAC AGC CAA GCT T-3′).
  • the amplified product was inserted into a pET 22b(+) vector (Novagen, EMB Bioscience, Inc. 441 Charmany Dr. Madison, Wis. 53719 USA) using Nde I and Hind III restriction enzymes, to construct a pENG151 vector ( FIG. 8 ).
  • the pENG151 vector was transformed into E. coli , and deposited at the Korean Collection for Type Cultures (KCTC) at the Biological Resource Center of Korea as of Jan. 19, 2005 and given an accession number of KCTC 10766BP.
  • KCTC Korean Collection for Type Cultures
  • Competent cells of E. coli Top10 (F-mcrA(mrr-hsdRMS-mcrBC) ⁇ 801acZ ⁇ M15 ⁇ lacX74 deoR recAl araD139 ⁇ (ara-leu)7697 galU galK rpsL (Strr) endAl nup, Invitrogen) used for cloning
  • E. coli BL21 F-ompT hsdSB (rB-mB-) gal dc) used for protein expression were each prepared using CaCl 2 buffer.
  • Transformation of each of the pMDG05, pMDG051, pMDG150 and pMDG151 vectors in Example 4 into the competent cells were achieved by a heat shock method (leaving for 2 minutes at 42° C.). Then through a selection process using ampicillin (Sigma) the transformants E. coli Top10/pMDG05, E. coli Top10/pMDG051, E. coli Top10/pMDG150, E. coli Top10/pMDG151, E. coli BL21/pMDG05, E. coli BL21/pMDG051, E. coli BL21/pMDG150 and E. coli BL21/pMDG151 were each obtained.
  • E. coli BL21/pMDG05 was cultured in LB media (5 g/liter yeast extract, 10 g/liter Tryptone and 10 g/liter NaCl), and IPTG was added to a final concentration of 1 mM when the optical density of the culture solution was 0.7 to 0.8 at 600 nm, to induce expression of recombinant adhesive protein MGFP-5.
  • a culture solution in 10 mL of LB media (with 500 ⁇ g of added ampicillin) cultured for 12 hours in a sterile 50 mL tube was inoculated into 100 mL of LB media contained in a 500 mL flask.
  • the E. coli BL21/pMDG05 culture was centrifuged at 18,000 g for 4 to 10 minutes to obtain the cell pellet, and this was stored at ⁇ 80° C.
  • the cell pellet was resuspended in SDS-PAGE buffer (0.5 M Tris-HCl, pH 6.8, 10% glycerol, 5% SDS, 5% ⁇ -mercaptoethanol, 0.25% bromophenol blue) 100 ⁇ l, and denatured by boiling at 100° C. for 5 minutes.
  • SDS-PAGE buffer 0.5 M Tris-HCl, pH 6.8, 10% glycerol, 5% SDS, 5% ⁇ -mercaptoethanol, 0.25% bromophenol blue
  • the samples were electrphoresed on a 15% SDS-polyacylamide gel and then the protein bands detected using Coomassie blue staining (Bio-Rad) or silver staining (Bio-Rad, USA).
  • Western blot analysis the samples were electrphoresed on a 15% SDS-polyacylamide gel and then transferred onto a nitrocellulose membrane at 15 V.
  • the MGFP-5 protein transferred onto the nitrocellulose membrane was detected using a monoclon
  • FIG. 9 is an electrophoretic image of the culture product of E. coli BL21/pMDG05 and E. coli BL21/pTrcHis ( E. coli BL21/pTrcHisA transformed with pTrcHisA), where MW is a size marker, N is a control group, and WC is the culture product of E. coli BL21/pMDG05.
  • FIG. 9 confirmed the expression of MGFP-5 protein in E. coli BL21/pMDG05.
  • E. coli BL21/pMDG05 cell pellets were resuspended in 5 ml Buffer B (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0) per 1 gram cells, and were lysed by gentle shaking for 1 h at room temperature. The lysate was centrifuged at 14,000 rpm for 20 min to obtain the soluble supernatant and insoluble cell debris.
  • Buffer B 8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0
  • FIG. 10 is a Western blot image of the SDS-PAGE analysis of the cell pellet (WC), soluble supernatant (I), the insoluble cell debris (IS) isolated from the culture solution of E. coli BL21/pMDG05 and the negative control (N).
  • FIG. 10 shows that the MGFP-5 protein is detected at high levels in the soluble supernatant fraction, indicating that it is expressed in a soluble form inside the cell.
  • Immobilized metal affinity chromatography (IMAC) purification was performed using the Acta Prime Purification System (Amersham Biosciences) at room temperature at a 1 ml per min flow rate. 10 ml Ni-NTATM Agarose (Qiagen) charged with 0.1 M NiSO 4 (Samchun Chemicals) was used as the resin, and separation was performed under denaturing conditions. After the column was filled with the resin, it was equilibrated with buffer (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0).
  • soluble supernatant fraction was loaded onto the column, and then the column was eluted with Buffer A (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 6.3) and Buffer B (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 5.9).
  • Recombinant MGFP-5 protein was eluted with elution buffer (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 4.5), and eluted fractions were all collected and dialyzed in 5% acetic acid at 4° C. (Spectra/Por® molecular porous membrane tubing, Spectrum Laboratories, USA).
  • FIG. 11 is an image of silver-stained SDS-PAGE of affinity chromatography fraction samples during the purification of recombinant MGFP-5 protein from E. coli BL21/pMDG05.
  • M is a size marker
  • Lane 1 is the fraction that was adsorbed when the soluble supernatant fraction was loaded onto the column
  • Lane 2 is the eluted fraction obtained at the step of washing the column
  • Lane 3 is the eluted fraction separated by the elution buffer.
  • FIG. 11 shows that the recombinant is purified at a high level of purity.
  • MALDI-TOF Mass-assisted laser desorption ionization with time-of-flight
  • Sinapinic acid in 30% acetonitrile and 0.1% trifluoroacetic acid was used as matrix solution.
  • the recombinant MGFP-5 protein obtained from the above section 6-3 was diluted 1:25 with the matrix solution, then 1 ⁇ l was spotted onto gold plates and evaporated using a vacuum pump.
  • Mass spectra were acquired in positive ion mode using an accelerating voltage of 25,000 V, grid voltage at 70 to 80%, guide wire voltage at 0.3%, delay time of 200 to 500 ns and N 2 laser power at 1600 to 1900 (arbitrary units). Internal calibration was performed using BSA with [M+H] at 66.431 and [M+2H] 2+ at 33.216.
  • FIG. 12 is the result of mass spectrometry analysis of MGFP-5 recombinant protein.
  • E. coli BL21/pMDG051 was cultured and the cell pellet, cell debris and soluble supernatant fractions were each obtained in the same method as in Example 6. Afterwards, SDS-PAGE and Western blot was carried out on each of the above samples.
  • FIG. 13 shows photographs of SDS-PAGE analysis (A) and a Western blot analysis (B) of the expression of recombinant MGFP-51 protein from E. coli BL21/pMDG051.
  • W is cell pellet
  • S is soluble supernatant fraction
  • IS is insoluble cell debris.
  • FIG. 13 shows that the recombinant MGFP-5 protein is expressed within the cell in both soluble and insoluble forms.
  • E. coli BL21/pMDG150 was cultured and the cell pellet, cell debris and soluble supernatant fractions were each obtained in the same method as in Example 6. Afterwards, SDS-PAGE and Western blot was carried out on each of the above samples.
  • FIG. 14 shows photographs of SDS-PAGE analysis (A) and a Western blot analysis (B) of the expression of recombinant MGFP-15 protein from E. coli BL21/pMDG150.
  • M is a size marker
  • W is cell pellet
  • S is soluble supernatant fraction
  • IS is insoluble cell debris.
  • FIG. 14 shows that the recombinant MGFP-15 protein is expressed within the cell in both soluble and insoluble forms.
  • E. coli BL21/pMDG151 was cultured and the cell pellet, cell debris and soluble supernatant fractions were each obtained in the same method as in Example 6. Afterwards, SDS-PAGE and Western blot was carried out on each of the above samples.
  • FIG. 15 shows photographs of SDS-PAGE analysis (A) and a Western blot analysis (B) of the expression of MGFP-151 recombinant protein from E. coli BL21/pMDG151.
  • W is cell pellet
  • S is soluble supernatant fraction
  • IS is insoluble cell debris.
  • FIG. 15 shows that the MGFP-151 recombinant protein is expressed within the cell in soluble and insoluble forms.
  • Cell pellets were resuspended in 5 ml lysis buffer (10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0) per gram of cell pellet, then the cells were lysed at 20,000 PSI (Constant systems, Low March, UK). Cell lysates were centrifuged at 18,000 g and 4° C. for 20 min to collect the cell debris. The cell debris was resuspended in 20 ml of 5, 10, 15, 20, 25, 30, 22, 24, 26 and 28 (v/v) % acetic acid solutions per gram cell weight respectively and centrifuged under the same conditions. The supernatant was prepared into a chromatographic sample.
  • FIG. 16 shows that recombinant MGFP-151 protein is eluted at an acetic acid concentration of 20 to 30 (v/v) %. In particular, it was confirmed that dilution in 25% acetic acid solution showed the best results with 74% purity and 45% yield.
  • Cell pellets were resuspended in 5 ml lysis buffer (10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0) per gram of cell pellet, then the cells were lysed at 20,000 PSI (Constant systems, Low March, UK). Cell lysates were centrifuged at 18,000 g and 4° C. for 20 min to collect the cell debris. The cell debris was resuspended in 20 ml of 25% acetic acid solution per gram cell weight, and centrifuged under the same conditions. After the supernatant was freeze-dried, it was dissolved in 2 ml of 5% acetic acid and prepared into a chromatographic sample.
  • lysis buffer 10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0
  • FIG. 17 shows photographs of SDS-PAGE analysis (A) and a Western blot analysis (B) of the chromatographic fractions of MGFP-151 recombinant protein. recombinant MGFP-151 protein with 95.8% purity could be isolated by chromatography.
  • the purified recombinant MGFP-151 protein was confirmed to be the same at the initially designed MGFP-151 peptide, through analysis with MALDI-TOF mass spectrometer.
  • the MGFP-5, MGFP-51, MGFP-15 and MGFP-151 adhesive proteins purified in Examples 6 to 9 were each dissolved to a concentration of 1.44 mg/ml in 5% acetic acid buffer containing 25 mM ascorbic acid. Then after the addition of 50 ug/ml of tyrosinase, it was shaken for 6 hours at 25° C. Through this process, the tyrosine residues of the adhesive proteins were modified to DOPA. Furthermore, bovine serum albumin (BSA) was used as negative control, and the commercial product Cell-TakTM (BD Bioscience, Two Oak Park, Belford, Mass., USA) which consists of mussel adhesive proteins FP-1 and FP-2 was used as positive control.
  • BSA bovine serum albumin
  • FIG. 18 shows the result of coating the surfaces of glass slide, poly(methyl methacrylate) plate, and aluminum plate with recombinant MGFP-5 and MGFP-151 proteins after their tyrosine residues are modified to DOPA.
  • the recombinant MGFP-5 and MGFP-151 proteins adhered to glass, poly(methyl methacrylate), and aluminum even before modification of their tyrosine residues, and the adhesion force was found to be much higher when the tyrosine residues are modified to DOPA.
  • the quartz crystal used (Seiko EG & G) was a gold-coated AT-cut quartz 5 mm in diameter with a basic resonant frequency of 9 MHz.
  • a 5 ⁇ l drop of a 1.44 mg/ml protein solution (BSA, Cell-Tak, recombinant MGFP-5 protein, and recombinant MGFP-151 protein) was each placed onto the gold surface of the quartz crystal and kept at 25° C. in a constant-temperature water bath for 1 hour. After taking it out of the water bath and drying, the gold surface was rinsed thoroughly in double distilled water for 1 h with shaking and the water remaining on the quartz crystal was evaporated using a vacuum pump.
  • Dried quartz crystal was connected to an EQCM controller (QCA917; Seiko EG & G) and variations in resonance frequency were measured. Since the resonance frequency of the quartz crystal decreases as a function of increase in the mass adsorbed on its surface (G. Sauerbrey, 1959, Z. Phys, 155, 206), the increase in mass was calculated by Equation 1 (M. Thomson, 1991, Analyst, 116, 881-889) with the value for change in resonance frequency.
  • ⁇ mass is change in mass
  • ⁇ freq is change in resonance frequency
  • ⁇ q is AT-cut quartz crystal constant (2.947 ⁇ 1.011 g/cm/sec 2 )
  • P q is the quartz crystal density (2.648 g/cm 2 )
  • F q 2 is reference frequency (9.00 MHz)
  • A is quartz crystal surface area (0.196 cm 2 ).
  • FIG. 19 is the result of QCM analysis of BSA, Cell-Tak, recombinant MGFP-5 protein and recombinant MGFP-151 protein where the tyrosines were treated, showing the level of adsorption onto the gold surface as change in frequency.
  • recombinant MGFP-151 protein modified with tyrosinase showed the greatest change in frequency, indicating the greatest mass adsorbing to the gold surface of the quartz crystal.
  • Cell-TakTM adsorbed in a greater amount compared to BSA, its adhesion force was much lower compared to that of recombinant MGFP-5 protein.
  • the change in mass of recombinant MGFP-151 protein was 36%, that of recombinant MGFP-5 protein was 23.2%, and that of Cell-Tak was 10% or less.
  • the force-distance curve was obtained using AFM (SPA400; Seiko Instruments), and AFM cantilevers were done according to the technique of Ducker et al. (W. Ducker, Nature, 1991, 353, 239-241) ( FIG. 20 ).
  • the cantilevers used for the present experiments were Olympus oxide-sharpened silicon nitrate probes (Veeco & Seiko Instruments) and the spring constant was 0.57 or 11 N/m.
  • a glass bead (Park Science) of 20 ⁇ m diameter was attached to the tip of the cantilever using an epoxy resin (Vantico), and kept at room temperature for 24 h.
  • the AFM cantilevers with glass bead attached were mounted into the AFM, and the glass bead was immersed in 10 ⁇ l of tyrosinase-treated protein solutions (1.44 mg/ml BSA, Cell-TakTM, MGFP-1 or MGFP-5) (MGFP-5 or MGFP-151) for 10 min.
  • the glass bead was brought into contact with clean glass surface, and a force-distance curve was obtained. (Time required for one cycle of the force-distance curve measurement was 5 s. )
  • FIG. 21 shows the adhesion force of recombinant MGFP-151 and MGFP-5 proteins with modified tyrosines.
  • Recombinant mussel adhesive proteins MGFP-5 and MGFP-151 have average values of 540 nN and 500 nN respectively indicating strong adhesion force, whereas that of Cell-Talc was 250 nN, and that of BSA was around 30 nN. This result shows that tyrosinase-treated recombinant mussel adhesion proteins have strong adhesion ability.
  • Drosophila S2 cells (Invitrogen) were used.
  • S2 cells were grown at 27° C. in M3 medium (Shields and Sang M3 insect medium; Sigma, St. Louis, Mo.) containing 10% IMS (insect medium supplement), 1% antibiotic-antimycotic (Invitrogen), and hygromycin 3 ⁇ l/ml.
  • M3 medium Shids and Sang M3 insect medium; Sigma, St. Louis, Mo.
  • IMS insect medium supplement
  • IMS antibiotic-antimycotic
  • hygromycin 3 ⁇ l/ml hygromycin 3 ⁇ l/ml.
  • Tyrosinase-treated recombinant MGFP-5 protein, recombinant MGFP-151 protein, Cell-Talc, and BSA prepared from Example 10 were dropped onto sterilized slide glass (20 mm ⁇ 20 mm, Marienfeld, Germany) and incubated at 25° C. for 30 minutes in a laminar flow hood and then washed two times with PBS.
  • the coated slide glass was immersed in 100-mm cell culture dishes containing S2 cells at a concentration of 4 ⁇ 10 6 cells/ml showing 95% viability. After incubation at 27° C. for 1 hr to 7 days, unattached cells were rinsed away with PBS, and cell viability and location of adhered protein was checked by trypan blue staining.
  • the recombinant proteins MGFP-5 and MGFP-151 were each spotted onto glass and Cell-Talc was spotted on as control. After drying, it was immersed in a solution consisting of 5% acetic acid, 25% methanol, and 70% water, and heated for 20 minutes at 85° C. As a result, for the adhesive proteins coated on the surface of glass or acrylic plates, it was found that upon leaving at high temperatures under solvent conditions MGFP-5 became detached while MGFP-151 continued to stay attached.
  • FIGS. 24A to C are photographs of the substrate surfaces coated with recombinant MGFP-5 and MGFP-151 proteins, where A is a 2500 ⁇ enlargement, B is a 10000 ⁇ enlargement, and C is a 35000 ⁇ enlargement.
  • A is a 2500 ⁇ enlargement
  • B is a 10000 ⁇ enlargement
  • C is a 35000 ⁇ enlargement.
  • the surface coated with MGFP-151 was found to be smooth, whereas the surface coated with MGFP-5 was found to be a little bit rough. This difference is thought to be a difference in the degree of cross-linking.
  • SEQ ID Nos: 1 to 4 are primer sequences.
  • SEQ ID NO: 5 is the cDNA of MGFP-5 protein isolated from Mytilus galloprovincialis.
  • SEQ ID NO: 6 is the protein sequence of MGFP-5 protein isolated from Mytilus galloprovincialis.
  • SEQ ID NO: 7 is the nucleotide sequence of 6 tandem repeats of a partial sequence of MEFP-5 protein isolated from Mytilus edulis.
  • SEQ ID NO: 8 is the amino acid sequence of 6 tandem repeats of a partial sequence of MEFP-5 protein isolated from Mytilus edulis.
  • SEQ ID NO: 9 is the nucleotide sequence encoding the recombinant adhesive protein MGFP-15 constructed from FP-1 and MGFP-5.
  • SEQ ID NO: 10 is the amino acid sequence of the recombinant adhesive protein MGFP-15 constructed from FP-1 and MGFP-5.
  • SEQ ID NO: 11 is the nucleotide sequence encoding the recombinant adhesive protein MGFP-015 constructed from FP-1 and MGFP-5.
  • SEQ ID NO: 12 is the amino acid sequence of the recombinant adhesive protein MGFP-015 constructed from FP-1 and MGFP-5.
  • SEQ ID NO: 13 is the nucleotide sequence encoding the recombinant adhesive protein MGFP-151 constructed from FP-1 and MGFP-5.
  • SEQ ID NO: 14 is the amino acid sequence of the recombinant adhesive protein MGFP-151 constructed from FP-1 and MGFP-5.
  • SEQ ID NO: 15 is the nucleotide sequence of the construct inserted into the pMDG05 vector for the expression of MGFP-5.
  • SEQ ID NO: 16 is the amino acid sequence of the adhesive protein expressed from the construct inserted into the pMDG05 vector for the expression of MGFP-5.
  • SEQ ID NO: 17 is the nucleotide sequence of the construct inserted into the pMDG150 vector for the expression of MGFP-15.
  • SEQ ID NO: 18 is the amino acid sequence of the adhesive protein expressed from the construct inserted into the pMDG150 vector for the expression of MGFP-15.
  • SEQ ID NO: 19 is the nucleotide sequence of the construct inserted into the pMDG051 vector for the expression of MGFP-51.
  • SEQ ID NO: 20 is the amino acid sequence of the adhesive protein expressed from the construct inserted into the pMDG051 vector for the expression of MGFP-51.
  • SEQ ID NO: 21 is the nucleotide sequence of the construct inserted into the pMDG151 vector for the expression of MGFP-151.
  • SEQ ID NO: 22 is the amino acid sequence of the adhesive protein expressed from the construct inserted into the pMDG151 vector for the expression of MGFP-151.
  • SEQ ID Nos: 23 to 24 are primer sequences.
  • SEQ ID NO: 25 is a partial sequence of FP-1.
  • SEQ ID Nos: 26 to 31 are nucleotide sequences encoding AKPSYPPTYK which is a partial sequence of FP-1.
  • SEQ ID NO: 32 is the primer sequence of the T3 promoter.
  • SEQ ID NO: 33 is the primer sequence of the T7 promoter.
  • SEQ ID Nos: 34 to 35 are primer sequences.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Peptides Or Proteins (AREA)
  • Adhesives Or Adhesive Processes (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Dental Preparations (AREA)
  • Paints Or Removers (AREA)
  • Materials For Medical Uses (AREA)

Abstract

The present invention relates to a bioadhesive derived from mussel. In particular, it relates to a novel Mytilus galloprovincialis foot protein type 5 (MGFP-5) and a recombinant protein that is a hybrid of MGFP-5 and foot protein type 1 (FP-1), where an adhesive protein with adhesive activity can be economically mass-produced to be used in place of chemical adhesives through the present invention.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS
The present application is a divisional of U.S. application Ser. No. 10/599,313, filed Sep. 25, 2006 now U.S. Pat. No. 7,622,550, which is allowed, the contents of which are incorporated by reference herewith in their entirety.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to a bio-adhesive derived from mussel, and more particularly to a novel Mytilus galloprovincialis foot protein-5 (MGFP-5) and a recombinant protein that is a hybrid of MGFP-5 and foot protein-1(FP-1).
2. Background of the Invention
Mussels produce and secrete specialized water-resistant bioadhesives, and have been studied as a potential source of water-resistant bioadhesives. They adhere tightly to surfaces underwater using the byssus secreted from the foot of the mussel. At the end of each thread is an adhesive plaque containing a water-resistant glue that enables the plaque to anchor to wet solid surfaces (Waite, J. H., Biology Review. 58:209-231(1983). This strong and water-insoluble adhesion has attracted interest for potential use in biotechnological applications. Mussel adhesive proteins can also be used as medical adhesives as they are non-toxic to the human body and do not impose immunogenicity (Dove et al., Journal of American Dental Association. 112:879 (1986)). Moreover, their biodegradable properties make them environmentally friendly.
The byssus can be divided into distal and proximal parts. The proximal part is connected to the stem gland of the mussel foot, while the distal part is connected to the adhesive plaques. The adhesive plaque is composed of five distinct types of proteins: foot protein type 1 (FP-1) to type 5 (FP-5) (Deming, T. J., Current Opinion in Chemical Biology. 3:100-105 (1999)).
All of the mussel adhesive proteins contain high ratios of 3,4-dihydroxyphenyl-L-alanine (DOPA), which is derived from hydroxylation of tyrosine residues (Waite, J. H., Biology Review. 58:209-231 (1983)). The adhesive proteins closest to the adhesion interface have the highest proportion of DOPA residues (Waite, J. H., Integr. Comp. Biol. 42:1172-1180 (2002)). In contrast, mussel adhesive protein analogs lacking DOPA show greatly reduced adhesion abilities (Yu et al., Journal of American Chemical Society. 121:5825-5826 (1999)). Indeed, a biochemical study showed that DOPA residues can enable mussel adhesive protein molecules to cross-link with each other via oxidative conversion to o-quinone. Thus, the DOPA content of a mussel adhesive protein appears to be specifically related to its adhesive properties.
Currently Cell-Tak, a naturally extracted mussel adhesive protein product, is commercially available. This adhesive is mainly composed of FP-1 and FP-2 type proteins, with a minor portion of FP-3. However, the natural extraction process is labor-intensive and inefficient, requiring around 10,000 mussels for 1 mg of protein (Morgan, D., The Scientist. 4:1-6 (1990)).
Therefore, researchers have sought to produce recombinant mussel adhesive proteins, for example FP-1, in expression systems such as Escherichia coli and yeast. However, these previous studies failed to express functional and economical mussel adhesive proteins due to a number of complications, including a highly biased amino acid composition (5 amino acid types comprise ˜89% of the total amino acids in FP-1), different codon usage preferences between mussel and other expression systems (tRNA utilization problems) and low protein yields (U.S. Pat. No. 5,242,808, Filpula et al., Biotechnol. Prog. 6:171-177 (1990), Salerno et al., Applied Microbiology and Biotechnology 58:209-214 (1993), Kitamura et al., Journal of Polymer Science Part A: Polymer Chemistry, 37:729-736 (1999)).
SUMMARY OF THE INVENTION
An objective of the present invention is to provide a novel adhesive protein gene from mussel and to overcome the aforementioned problems in the prior art.
Another objective of the present invention is to provide a novel adhesive protein from mussel.
Another objective of the present invention is to provide a method for mass-producing a mussel adhesive protein in a biologically active form.
Another objective of the present invention is to provide a recombinant adhesive protein that is a fusion of two or more adhesive proteins from mussel.
Another objective of the present invention is to provide an adhesive that contains a novel adhesive protein as an active component.
The present invention provides a novel adhesive protein extracted from Mytilus galloprovincialis and a polynucleotide encoding the protein. The above adhesive protein preferably comprises the amino acid sequence shown in SEQ ID NO: 6. An example of the above polynucleotide is the nucleotide sequence shown in SEQ ID NO: 5.
The present invention also provides a recombinant adhesive protein where some amino acid sequences from FP-1 is attached to the amino- and/or carboxy-termini of a mussel adhesive protein, and a polynucleotide encoding the recombinant adhesive protein. An example of the recombinant adhesive protein is an amino acid sequence selected from the group consisting of the amino acid sequence shown in SEQ ID NO: 10, the amino acid sequence shown in SEQ ID NO: 12, the amino acid sequence shown in SEQ ID NO: 14, the amino acid sequence shown in SEQ ID NO: 18, the amino acid sequence shown in SEQ ID NO: 20, and the amino acid sequence shown in SEQ ID NO: 22. An example of the nucleotide sequence encoding the recombinant adhesive protein is the nucleotide sequence shown in SEQ ID NO: 9, the nucleotide sequence shown in SEQ ID NO: 11, the nucleotide sequence shown in SEQ ID NO: 13, the nucleotide sequence shown in SEQ ID NO: 17, the nucleotide sequence shown in SEQ ID NO: 19, and the nucleotide sequence shown in SEQ ID NO: 21.
The present invention also provides a vector which contains operably a nucleotide sequence encoding an adhesive protein.
The present invention also provides a transformant which contains operably a nucleotide sequence encoding an adhesive protein.
The present invention also provides a method of producing an adhesive protein which comprises the steps of:
    • (a) constructing a vector which contains operably a nucleotide sequence encoding an adhesive protein;
    • (b) constructing a transformant by transforming a host cell with the vector; and
    • (c) producing a recombinant adhesive protein by culturing the transformant.
The present invention also provides a method of purifying an adhesive protein which comprises the steps of:
    • (a) lysing the transformants, and then centrifuging it to separate the supernatant and the pellet;
    • (b) making a suspension by adding an acidic organic solvent to the pellet; and
    • (c) centrifuging the suspension to separate the supernatant.
The present invention also provides an adhesive containing an adhesive protein as the active component.
The present invention also provides a method of adjusting the adhesive property of an adhesive comprising controlling the concentration of an adhesive protein which is an active component of the aforementioned adhesive, or treating the adhesive with one or more material selected from the group consisting of oxidant, filler and surfactant.
The present invention also provides a coating material containing an adhesive protein as an active component.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a picture of the electrophoresis of MGFP-5 cDNA fragments obtained by RT-PCR with RNA extracted from Mytilus galloprovincialis as the template.
FIG. 2 shows the procedure for inserting MGFP-5 cDNA into a pTrcHis vector to construct a pMDG05 vector.
FIG. 3 shows the FP-1 variant (referred to as “6×AKPSYPPTYK” from hereon) where the peptide AKPSYPPTYK is tandemly attached 6 times, and the 4 oligomers KD-1, KD-2, KD-3, and KD-4 that were used in its synthesis.
FIG. 4 shows vector diagrams of various combinations that can simultaneously express the 6×AKPSYPPTYK and the MGFP-5 gene.
FIG. 5 is a diagram showing the procedure for constructing the pMDG051 vector for making the recombinant MGFP-51 nucleotide sequence.
FIG. 6 is a diagram showing the procedure for constructing the pMDG150 vector for making the recombinant MGFP-15 nucleotide sequence.
FIG. 7 is a diagram showing the procedure for constructing the pMDG151 vector for making the recombinant MGFP-151 nucleotide sequence.
FIG. 8 is a diagram showing the procedure for constructing the pENG151 vector for making the recombinant MGFP-151 nucleotide sequence.
FIG. 9 is a photograph of the electrophoresis of each culture material of E. coli BL21/pMDG05 and E. coli BL21/pTrcHis (E. coli BL21/pTrcHisA transformed with pTrcHisA)
FIG. 10 is a Western blot photograph of an SDS-PAGE of the whole cell pellet (WC), soluble upper fraction (I), and insoluble cell debris fraction (IS) isolated from E. coli BL21/pMDG05 culture solution, and negative control (N).
FIG. 11 is a photograph of silver-stained SDS-PAGE of affinity chromatography fractions for purification of recombinant MGFP-5 protein from E. coli BL21/pMDG05.
FIG. 12 is a mass spectrometry result of purified recombinant MGFP-5 protein.
FIG. 13 shows (A) Coomassie blue-stained SDS-PAGE and (B) Western blot analyses of recombinant MGFP-51 protein from E. coli BL21/pMDG051.
FIG. 14 shows (A) SDS-PAGE and (B) Western blot analyses of recombinant MGFP-15 protein from E. coli BL21/pMDG150.
FIG. 15 shows (A) SDS-PAGE and (B) Western blot analyses of recombinant MGFP-151 protein from E. coli BL21/pMDG151.
FIG. 16 shows the recovery rates of recombinant MGFP-151 protein expressed from E. coli BL21/pMDG151 according to the concentration of acetic acid solution.
FIG. 17 shows (A) SDS-PAGE and (B) Western blot analyses of chromatographic fractions of recombinant MGFP-151 protein.
FIG. 18 shows the results of coating slide glass, poly(methyl methacrylate) plate, and aluminum plate with recombinant MGFP-5 and recombinant MGFP-151 proteins after the tyrosine residues are modified to DOPA.
FIG. 19 shows the QCM analysis results of BSA, Cell-Tak, recombinant MGFP-5 protein, and recombinant MGFP-151 protein after treating the tyro sines.
FIG. 20 is a diagram of the measurement method of the adhesion force of recombinant adhesive proteins.
FIG. 21 shows the adhesion force of recombinant MGFP-1 and recombinant MGFP-5 proteins where the tyrosine residues have been modified.
FIG. 22 is a measurement of cell-adhesion property of recombinant adhesive proteins.
FIG. 23 is a measurement of cell-adhesion property of recombinant adhesive proteins with insect Drosophila S2 cells.
FIGS. 24A to C are photographs of a substrate surface coated with recombinant MGFP-5 and recombinant MGFP-151 proteins. A is a 2500× enlargement, B is a 10000× enlargement, and C is a 35000× enlargement.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The inventors of the present invention have obtained a novel adhesion protein and its encoding gene from a type of mussel, Mytilus galloprovincialis, and they have established a system for the production of an adhesion protein that is translated from it. They have also established a recombinant adhesion protein that is a fusion of two or more mussel adhesion proteins, and a system for its production.
The adhesive protein of the present invention has the characteristic of attaching to a wide variety of substrates such as glass, metal, polymer resin, plastic or biological cell membranes such as prokaryotic membranes, eukaryotic membranes, and plant cell walls and lipids.
The adhesive protein of the present invention has at least 50% homology with the amino acid sequence shown in SEQ ID NO: 6, preferably 80%, more preferably 90%, and most preferably at least 95% homology, and at the same time can include amino acid sequences that have adhesive property, for example adhesive property that is similar to the amino acid sequence shown in SEQ ID NO: 6, or amino acid sequences that have 70 to 200% of the adhesive activity of the above.
For example, there is a protein that contains the amino acid sequence shown in SEQ ID NO: 6. An adhesive protein that contains the amino acid sequence as shown in the above SEQ ID NO: 6 is referred to as “MGFP-5” (Mytilus galloprovincialis foot protein type 5) from hereon.
A nucleotide encoding MGFP-5 can be expressed as a variety of nucleotide sequences depending on the amino acid codon usage, such as the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 15.
Also, the adhesive protein of the present invention can further contain a peptide at the amino- and/or carboxy-termini in order to improve the physicochemical properties of the adhesive protein. The above peptide may be added for the purpose of improving for example, the solubility, adhesion force, degree of crosslinking, and the degree of expression, purification, and recovery of protein. For example, the above peptide can be a general reporter protein such as GST or a histidine tag for the purpose of improving the purification.
An example of a form where a peptide is further included for the purpose of purifying an adhesive protein is a protein containing the amino acid sequence shown in SEQ ID NO: 16.
The above peptide preferably contains an amino acid sequence derived from an adhesive protein, and more preferably contains an amino acid sequence derived from a mussel adhesive protein. An example of the peptide is the amino acid sequence shown in SEQ ID NO: 25 is repeated 1 to 10 times in tandem. In an embodiment of the present invention, a SEQ ID NO: 8 was constructed in which the amino acid sequence shown in SEQ ID NO: 25 is repeated 6 times in tandem, and attached to the amino- and/or carboxy-termini of the adhesive protein in the present invention. The amino acid sequence shown in the SEQ ID NO: 25 is a part of the sequence of the FP-1 protein.
Examples of recombinant adhesive proteins where the sequence shown in SEQ ID NO: 25 is additionally attached, are amino acid sequences shown in SEQ ID Nos: 10, 12, and 14. The SEQ ID NO: 10 is where the sequence shown in SEQ ID NO: 25 is repeated 6 times in tandem and attached to the amino-terminus of the amino acid sequence shown in SEQ ID NO: 6. SEQ ID NO: 12 is where the sequence shown in SEQ ID NO: 25 is repeated 6 times in tandem and attached to the carboxy-terminus of the amino acid sequence shown in SEQ ID NO: 6. SEQ ID NO: 14 is where the sequence shown in SEQ ID NO: 25 is repeated 6 times in tandem and attached to the amino- and carboxy-termini of the amino acid sequence shown in SEQ ID NO: 6.
Furthermore, recombinant adhesive proteins containing the amino acid sequences shown in SEQ ID Nos: 10, 12, or 14 can additionally contain a peptide which has a purpose of facilitating purification. The peptide may be located on the amino- and/or the carboxy-termini of a recombinant adhesive protein, and examples of the peptide are GST and histidine tag. Recombinant adhesive proteins containing amino acid sequences as shown in SEQ ID Nos: 18, 20, or 22 are forms where a histidine tag is attached to the amino-terminus of a protein containing the amino acid sequences shown in SEQ ID Nos: 10, 12, or 14 respectively.
The adhesive protein of the present invention can further contain a peptide of 1 to 10 amino acids that are additionally inserted during cloning of the adhesive protein, at the amino-terminus, carboxy-terminus, or another kind of connective region of proteins.
The adhesive protein and recombinant adhesive protein of the present invention can be inserted into commonly used expression vectors constructed for expressing exogenous genes, and mass-produced through genetic engineering methods. The above vector may be selected according to the type and characteristics of the host cell used in the production of protein, or it may be newly constructed. Transforming the vector into the host cell and producing the recombinant protein from the transformant can easily be carried out through ordinarily employed methods. Selecting, constructing, transforming the vector and expressing the recombinant protein can be easily carried out by an ordinary person skilled in the art of the present invention, and partial variations in the ordinarily employed methods are also included in the present invention.
The sequence encoding an adhesive protein that is inserted into the vector is a sequence encoding an adhesive protein or a recombinant adhesive protein of the present invention, and is preferably selected from the group consisting of a nucleic acid encoding a protein that has at least 50% homology, preferably 80%, more preferably 90%, and most preferably at least 95% homology with the amino acid sequence shown in SEQ ID NOs: 6, 10, 12, or 14, a nucleic acid encoding a protein that has at least 50% homology, preferably 80%, more preferably 90%, and most preferably at least 95% homology with the amino acid sequence shown in SEQ ID NO: 6, 10, 12, or 14, where at least one sequence selected from the group consisting of SEQ ID NO:s 26 to 31 is tandemly repeated 1 to 10 times at the 5′ and/or 3′ ends of the nucleic acid, and the amino acid sequence shown in SEQ ID NO: 6, 10, 12, or 14, where 6 histidine residues are additionally attached at the amino-terminus. More preferably, a polynucleotide containing a sequence selected from the group consisting of SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19 and 21 can be inserted into the vector.
In an embodiment of the present invention, MGFP-5 sequence was cloned into a pGEM-T vector, and the sequence shown in SEQ ID NO: 7 (6×AKPSYPPTYK which is 6 tandem repeats of the amino acid sequence shown in SEQ ID NO: 25) was cloned into pUC18. Afterwards, the MGFP-5 sequence was cloned into a pTrcHisA vector to construct a pMDG05 vector (FIG. 4). Furthermore, in order to construct a vector that expresses a recombinant protein having a structure shown in Table 1 below, the sequences of MGFP-5 and SEQ ID NO: 7 were cloned into a pTrcHisA vector to construct pMDG150, pMDG051 and pMDG151 vectors (FIGS. 7 to 9).
TABLE 1
Hybrid adhesive
protein Structure (5′ to 3′) Vector
MGFP-15 6 x AKPSYPPTYK-MGFP-5 pMDG150
MGFP-51 MGFP-5-6 x AKPSYPPTYK pMDG051
MGFP-151 6 x AKPSYPPTYK-MGFP-5-6 x pMDG151
AKPSYPPTYK pENG151
The above pTrcHisA vector is a widely known vector which contains a trcpromoter, which allows expression of exogenous protein by induction using IPTG(isopropylthio-β-D-galactoside), and which has 6 histidine sequences for protein purification by affinity chromatography at the 5′ end of the exogenous gene in order to facilitate protein purification. In the present invention, the pMDG05 vector was deposited at the Korean Collection for Type Cultures (KCTC) at the Biological Resource Center of Korea located at Eouen-dong, Yuseong-gu, Daejon, Republic of Korea as of Jun. 20, 2002, and received an accession number of KCTC 10291BP. The pENG151 vector was deposited as of Jan. 19, 2005 and given an accession number of KCTC 10766BP.
The expression vector for the adhesive protein and recombinant adhesive protein can be transformed into a host cell selected from the group consisting of prokaryotes, eukaryotes, and eukaryote-derived cells, in order to construct a transformant. The prokaryote is selected from the group consisting of E. coli and Bacillus, the eukaryote is selected from the group consisting of yeast, insects, animals, and plants, and the eukaryote-derived cells are plant cells, insect cells, and plants, but is not limited thereto.
As an embodiment, pMDG05, pMDG150, pMDG051 and pMDG151 vectors were each transformed into E. coli BL21, to construct E. coli BL21/pMDG05, E. coli BL21/pMDG150, E. coli BL21/pMDG051 and E. coli BL21/pMDG151. The aforementioned 4 types of transformants can be cultured in typical LB media, and IPTG can be added to induce protein expression. The preferred method of expression of recombinant protein is to culture in LB media (5 g/liter yeast extract, 10 g/liter Tryptone, 10 g/liter NaCl), and adding 0.1 to 10 mM of IPTG when the optical density of the culture solution is 0.6 to 0.9 at 600 nm, then culturing for 2 to 12 hours.
The recombinant protein expressed in the above method is expressed in a water-soluble and/or insoluble form within the transformant, so the isolation and purification depends on how it is expressed. When it is expressed in a water-soluble form, the recombinant protein can be purified by running the lysed cell supernatant through a chromatography column filled with an affinity resin such as a nickel resin.
When it is expressed in a water-insoluble form, the recombinant protein can be purified by suspending the lysed cell pellet in an acidic organic solvent, preferably an organic solvent with a pH of 3 to 6, then centrifuging the suspension to isolate the upper layer. Examples of the acidic organic solvent are acetic acid, citric acid, and lactic acid, but is not limited thereto. The acetic acid used can be 5 to 30 (v/v) %, and preferably the cell pellet is dissolved in 20 to 30 (v/v) % acetic acid solution. The upper layer obtained through treatment with acidic organic solvent can further undergo gel filtration chromatography to further purify the recombinant protein.
Through the method of the present invention, 2-3 mg/L of the recombinant adhesive protein MGFP-5 of at least 95% purity can be obtained, and around 5 mg/L of MGFP-151 of at least 95% purity can be obtained. While MGFP-5 and MGFP-151 display similar levels of adhesion force, the solubility of MGFP-151 is significantly higher compared to MGFP-5, and thus MGFP-151 is easier to obtain in a concentrated form. In particular, MGFP-5 dissolves in a 5% acetic acid solution to a concentration of around 1 mg/mL, while MGFP-151 dissolves in water to a concentration of around 110 mg/mL, and dissolves in a 5% acetic acid solution to a concentration of around 220 mg/mL. The solubility of an adhesive protein is directly related to its ability to stay in highly concentrated forms, so the higher the solubility, the easier it is to make highly concentrated forms with high potential for industrial application. In this respect, it can be said that the adhesive protein MGFP-151 is more useful than MGFP-5.
The adhesive protein and the recombinant adhesive protein obtained through its expression in the present invention have adhesive activity and can be used as adhesives. The adhesive activity was confirmed through the experiment of modifying the tyrosine residues in the protein to 3,4-dihydroxyphenyl-L-alanine (DOPA). Thus, the adhesive protein of the present invention can not only be used as an adhesive for a wide variety of substrates, but also be used as a bioadhesive since it is harmless to the human body.
The present invention also provides an adhesive that contains adhesive protein as an active component. The adhesive protein can be a form where 5 to 100% of its tyrosine residues are modified to DOPA, and the adhesive can additionally contain a substance that modifies the tyrosine residues in the protein to DOPA. A typical example of the above substance is tyrosinase, but is not limited thereto.
The above adhesive can further contain 0.5 to 90% by weight of an excipient that is generally contained in bioadhesives or is pharmaceutically acceptable. Examples of excipients include surfactants, oxidants, and fillers, but are not limited thereto (see: U.S. Pat. Application Publication No. 2003-65060 and U.S. Pat. No. 5,015,677). The surfactant can be cationic, anionic, non-ionic, or amphoteric, where examples are sodium dodecylsulfate and sodium dodecylbenzensulfonate. The oxidant can be selected from the group consisting of tyrosinase, catechol oxidase, glutaraldehyde, formaldehyde, bis(sulfosuccinimidyl) suberate, 3,3′-Dithiobis(sulfosuccinimidyl propionate), O2, Fe3+, H2O2 and IO4 (see: Macromolecules 1998, 31, 4739-4745), and the filler can be selected from the group consisting of collagen, hyaluronic acid, condroitan sulfate, elastine, laminin, caseine, hydroxyapatite, albumin, fibronectin, and hybrin.
The adhesive of the present invention can be used to adhere or fix glass, plastic, polymer resin, or biological specimen, and the detailed mode and amount of usage, formulation and other such matters may follow Cell-Tak (BD Biosciences, Two Oak Park, Bedford, Mass., USA) which is currently available commercially. For example, the adhesive of the present invention can be a soluble, water-soluble, or insoluble formulation, and can be used in the amount of 0.01 to 100 ug/cm2 for a substrate but is not limited thereto. Furthermore, the mode of use follows the general mode of adhesive use, and the typical mode is coating.
The aforementioned biological specimen refers to any animal or plant categorized as a biological organism and any part derived from such animal or plant. For example, it refers to cells, tissues, organs, RNA, DNA, protein, peptide, polynucleotide, hormones, and compounds, but is not limited thereto.
Examples of application of the adhesive of the present invention are as follows, but not limited thereto: (1) adhesion of substrates under water (fresh or salt water); (2) orthopedic treatments such as treatment of bone, ligament, tendon, meniscus, and muscle, and implant of artificial materials; (3) treatment of perforations, lacerations, and cuts, and ophthalmic attachments such as corneal implants and artificial corneal implants; (4) dental attachments such as holding retainers, bridges, or crowns in place, securing loose teeth, repairing broken teeth, and holding fillers in place; (5) surgical treatments such as attachment of blood vessels, attachment of cellular tissue, artificial material implants, and closure of wounds; (6) plant attachments such as bonding of transplanted parts and wound healing; (7) drugs, hormones, biological factors, medications, physiological or metabolic monitoring equipment, antibiotics, and cell transplant (see: U.S. Pat. No. 5,015,677).
The present invention also provides a method of adjusting the adhesion force of the above adhesive by treating with a substance selected from the group consisting of surfactant, oxidant, and filler, or controlling the concentration of the adhesive protein which is an active component of the adhesive (see: U.S. Pat. No. 5,015,677). The surfactant, oxidant, and filler are the same as was described above.
The present invention also provides a coating agent which contains the above adhesive protein as an active component. Since the adhesive protein of the present invention has the characteristic of adhering to glass, plastic, polymer resin, or biological specimen, it can not only be used as a coating agent for these substrates, but also coat the surface of substrates that are used underwater to prevent oxidation of the substrates, since the adhesive protein is water-resistant and water-repellent. An example of application of the coating agent is to coat the motor propeller of ships to prevent corrosion, but is not limited thereto. The above coating agent may consist solely of an adhesion protein, but can additionally contain commonly known adhesives, adhesive proteins other than the adhesive proteins of the present invention, resin contained in commonly known coating agents, organic solvents, surfactants, anticorrosive agents, or pigments. The content of the additional components may be appropriately adjusted within the commonly accepted range depending on the kind of component and formulation of the coating agent. Where an additional component is included, the adhesive protein as an active component is contained in the coating agent at a level that maintains the adhesive activity, and can for example be contained in the coating agent at 0.1 to 80% by weight.
The coating agent of the present invention can be manufactured in the form of cream, aerosol (spray), solid, liquid, or emulsion, but is not limited to these formulations.
Embodiments of the present invention are described below. The following embodiments are merely illustrative of the present invention and the present invention is not limited to the following embodiments.
In the following, the mussel used for cloning the MGFP-5 gene was Mytilus galloprovincialis.
Example 1 Cloning of the MGFP-5 Gene
In order to clone MGFP-5, the primer shown in SEQ ID NO: 1 (5′-ggcctgcagcagttctgaagaatacaaggg-3) and the primer shown in SEQ ID NO: 2 (gtagatctatacgccggaccagtgaacag) were each synthesized. PCR was run 30 times using the mussel cDNA library, and a PCR product of 243 bp was obtained (FIG. 1). The above PCR product was cloned in a pGEM-T vector (Promega).
To obtain the upstream signal sequence of MGFP-5, nested PCR was executed using mussel (M. galloprovincialis) cDNA library. The primers used were a T3 promoter primer of the ZAP vector (SEQ ID NO: 32) and the primer shown in SEQ ID NO: 3 (5′-cttgtattttccgctgttttt-3′). An amplification product of around 300 bp was obtained through the PCR and it was cloned into a pGEM-T vector.
To obtain the C-terminal poly-A tail region of MGFP-5, nested PCR was performed using SEQ ID NO: 4 (5′-aaaaacagcggaaaatacaag-3′) and T7 promoter primer (SEQ ID NO: 33). The amplification product of 350 bp was obtained and cloned into a pGEM-T vector.
The MGFP-5 cDNA nucleotide sequence obtained from the above was analyzed, and the MGFP-5 nucleotide sequence excluding the secretion signal sequence is shown in SEQ ID NO: 5, and the amino acid sequence encoded therein is shown in SEQ ID NO: 6.
Example 2 Construction of the Vector for Genetically Engineered Production of MGFP-5
The MGFP-5 cDNA in the pGEM-T vector was isolated by using the restriction enzyme sites PstI and EcoRI, then inserted into a pTrcHis A vector (Invitrogen, USA) that was cleaved with PstI and EcoRI restriction enzymes to construct pMDG05(4630 bp). The pMDG05 vector was deposited at the Korean Collection for Type Cultures (KCTC) at the Biological Resource Center of Korea located at Eoeun-dong, Yuseong-gu, Daejon, Republic of Korea as of Jun. 20, 2002, and received a accession number of KCTC 10291BP.
The pMDG05 vector contains a trc promoter for expression in E. coli, and allows induction of expression using IPTG (Sigma, USA). It also has 6 histidine residues at the 5′ end of the MGFP-5 gene for protein isolation and purification by affinity chromatography.
Example 3 Construction of the Peptide (6×AKPSYPPTYK) Derived from FP-1
From the amino acid sequence of FP-1 (Genbank No. Q27409 or S23760), an FP-1 derivative as shown in SEQ ID NO: 25 where the peptide “AKPSYPPTYK” is tandemly repeated 6 times (referred to as “6×AKPSYPPTYK”) was constructed.
That is, KD-1 to KD-4 described in FIG. 3 was each synthesized, and then annealed, to synthesize 6×AKPSYPPTYK in SEQ ID NO: 8 encoding the FP-1 variant in SEQ ID NO: 7. Additionally, at the 5′ end of the 6×AKPSYPPTYK, EdoRI and NheI restriction enzyme sites in the direction of 5′ to 3′ were placed, and a BamHI restriction enzyme site was placed at the 3′ end (FIG. 3). The 6×AKPSYPPTYK was inserted into a pUC18 vector using the NheI and BamHI restriction enzyme sites to construct the pAD501 vector (M. Kitamura, 1999, Journal of Polymer Science Part A: Polymer Chemistry 37, 729-736).
In FIG. 3, the “ACTAT” located at the 5′ side of the BamHI site in the polynucleotide was inserted to preserve the ORF.
Example 4 Construction of Recombinant Hybrids of FP-1 and MGFP-5
From hereon, MGFP-5 is referred to as “MGFP-5”, a hybrid where 6×AKPSYPPTYK of Example 3 is attached to the N-terminus of MGFP-5 is referred to as “MGFP-15”, a hybrid where 6×AKPSYPPTYK is attached to the C-terminus of MGFP-5 is referred to as “MGFP-51”, and a hybrid where 6×AKPSYPPTYK is attached to both the N- and C-termini of MGFP-5 is referred to as “MGFP-151” (see Table 1 above).
The hybrids MGFP-15 shown in SEQ ID NO: 10, MGFP-51 shown in SEQ ID NO: 12, and MGFP-151 shown in SEQ ID NO: 14 were constructed, and they include histidine tags (6×His) and other amino acid residues at the 5′ end and amino acid residues between the 6×AKPSYPPTYK and MGFP-5 due to the design of the experiment.
In order to express each of the hybrids MGFP-5, MGFP-15, MGFP-51 and MGFP-151, the structures shown in SEQ ID Nos: 15, 17, 19, and 21 were inserted into a vector to respectively construct pMDG05, pMDG150, pMDG051, and pMDG151 of FIG. 4. In the above 4 vectors, expression is controlled by a trc promoter that is inducible by IPTG (Sigma, US), and there are 6 histidine residues at the 5′ region and a translation termination codon (TAA) at the 3′ end of each recombinant construct.
The method of construction for each vector is as follows.
PCR was executed on the nucleotide sequence of MGFP-5 within the pMDG05 vector of Example 2 with the primer set shown in SEQ ID NOs: 1 and 2, then cleaved with PstI and EcoRI restriction enzymes, then inserted into a pTrcHis A vector (Invitrogen, USA) which was previously cleaved with the same enzymes, to construct pTEMP150(4630bp). Also, the 6×AKPSYPPTYK in the pAD501 vector of Example 2 was amplified with the primer set shown in SEQ ID NO: 23 (5′-GGT ACC CGA ATT CGA ATT CGC TAA ACC G-3′) and 24 (5′-GGT CGA CTC AAG CTT ATC ATT TGT AAG TCG-3′), and cleaved with EcoRI and Hind III restriction enzymes. Then it was inserted into pTEMP150 which was previously cleaved with EcoRI and Hind III, to construct pMDG051 (FIG. 5).
The 6×AKPSYPPTYK in the pAD501 vector was isolated by treating with NheI and BamHI restriction enzymes, and inserted into a pMDG05 vector which was treated with the same enzymes to construct pMDG150 (FIG. 6).
The 6×AKPSYPPTYK in the pAD501 vector was isolated by treating with Nhe I and BamH I restriction enzymes, and inserted into a pTrcHis A vector (Invitrogen, USA) which was treated with the same enzymes, to construct pTEMP1(4523 bp). Then the nucleotide sequence of MGFP-5 within the pMDG05 vector was amplified with the primer set shown in SEQ ID NOs: 1 and 2, then cleaved with PstI and EcoRI restriction enzymes, then inserted into pTEMP1 which was treated with the same enzymes, to construct pTEMP2(4741 bp). Also, the 6×AKPSYPPTYK in the pAD501 vector was amplified with the primer set shown in SEQ ID NOs: 23 and 24, then cleaved with EcoRI and Hind III restriction enzymes. Then it was inserted into pTEMP2 which was cleaved with EcoRI and Hind III, to construct pMDG151 (4927 bp) (FIG. 7).
Also, in order to express the MGFP-151 nucleotide at a high level, the MGFP-151 nucleotide was amplified from the pMDG 151 vector with the primers shown in SEQ ID NO: 34 (5′-CCT AAC ATA TGG GGG TTC TCA TCA TC-3′) and SEQ ID NO: 35 (5′-ATC CGC CAA AAC AGC CAA GCT T-3′). The amplified product was inserted into a pET 22b(+) vector (Novagen, EMB Bioscience, Inc. 441 Charmany Dr. Madison, Wis. 53719 USA) using Nde I and Hind III restriction enzymes, to construct a pENG151 vector (FIG. 8). The pENG151 vector was transformed into E. coli, and deposited at the Korean Collection for Type Cultures (KCTC) at the Biological Resource Center of Korea as of Jan. 19, 2005 and given an accession number of KCTC 10766BP.
Example 5 Construction of Transformant Producing MGFP-5 and Hybrids
Competent cells of E. coli Top10 (F-mcrA(mrr-hsdRMS-mcrBC)Φ801acZΔM15 ΔlacX74 deoR recAl araD139 Δ(ara-leu)7697 galU galK rpsL (Strr) endAl nup, Invitrogen) used for cloning, and E. coli BL21 (F-ompT hsdSB (rB-mB-) gal dc) used for protein expression were each prepared using CaCl2 buffer. Transformation of each of the pMDG05, pMDG051, pMDG150 and pMDG151 vectors in Example 4 into the competent cells were achieved by a heat shock method (leaving for 2 minutes at 42° C.). Then through a selection process using ampicillin (Sigma) the transformants E. coli Top10/pMDG05, E. coli Top10/pMDG051, E. coli Top10/pMDG150, E. coli Top10/pMDG151, E. coli BL21/pMDG05, E. coli BL21/pMDG051, E. coli BL21/pMDG150 and E. coli BL21/pMDG151 were each obtained.
Example 6 Expression and Purification of MGFP-5 from E. coli BL21/pMDG05
6-1. Culture of E. coli BL21/pMDG05
E. coli BL21/pMDG05 was cultured in LB media (5 g/liter yeast extract, 10 g/liter Tryptone and 10 g/liter NaCl), and IPTG was added to a final concentration of 1 mM when the optical density of the culture solution was 0.7 to 0.8 at 600 nm, to induce expression of recombinant adhesive protein MGFP-5. At this time, a culture solution in 10 mL of LB media (with 500 μg of added ampicillin) cultured for 12 hours in a sterile 50 mL tube was inoculated into 100 mL of LB media contained in a 500 mL flask. The E. coli BL21/pMDG05 culture was centrifuged at 18,000 g for 4 to 10 minutes to obtain the cell pellet, and this was stored at −80° C.
6-2. Confirmation of MGFP-5 Expression
The cell pellet was resuspended in SDS-PAGE buffer (0.5 M Tris-HCl, pH 6.8, 10% glycerol, 5% SDS, 5% β-mercaptoethanol, 0.25% bromophenol blue) 100 μl, and denatured by boiling at 100° C. for 5 minutes. For SDS-PAGE analysis, the samples were electrphoresed on a 15% SDS-polyacylamide gel and then the protein bands detected using Coomassie blue staining (Bio-Rad) or silver staining (Bio-Rad, USA). For Western blot analysis, the samples were electrphoresed on a 15% SDS-polyacylamide gel and then transferred onto a nitrocellulose membrane at 15 V. The MGFP-5 protein transferred onto the nitrocellulose membrane was detected using a monoclonal anti-histidine ligand antibody (R&D Systems, USA) and a colorimetric reaction.
FIG. 9 is an electrophoretic image of the culture product of E. coli BL21/pMDG05 and E. coli BL21/pTrcHis (E. coli BL21/pTrcHisA transformed with pTrcHisA), where MW is a size marker, N is a control group, and WC is the culture product of E. coli BL21/pMDG05. FIG. 9 confirmed the expression of MGFP-5 protein in E. coli BL21/pMDG05.
To confirm the expressed form of recombinant MGFP-5 in the cell sample, SDS-PAGE and Western blot was carried out on each of the cell debris and soluble supernatant obtained from lysis of the cell pellet, and the cell pellet.
That is, E. coli BL21/pMDG05 cell pellets were resuspended in 5 ml Buffer B (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0) per 1 gram cells, and were lysed by gentle shaking for 1 h at room temperature. The lysate was centrifuged at 14,000 rpm for 20 min to obtain the soluble supernatant and insoluble cell debris.
FIG. 10 is a Western blot image of the SDS-PAGE analysis of the cell pellet (WC), soluble supernatant (I), the insoluble cell debris (IS) isolated from the culture solution of E. coli BL21/pMDG05 and the negative control (N). FIG. 10 shows that the MGFP-5 protein is detected at high levels in the soluble supernatant fraction, indicating that it is expressed in a soluble form inside the cell.
6-3. Purification of Recombinant MGFP-5 Protein
In order to isolate and purify recombinant MGFP-5 which is expressed in a soluble form within E. coli BL21/pMDG05, affinity chromatography utilizing the histidine affinity ligand contained in the pMDG05 vector was carried out.
Immobilized metal affinity chromatography (IMAC) purification was performed using the Acta Prime Purification System (Amersham Biosciences) at room temperature at a 1 ml per min flow rate. 10 ml Ni-NTA™ Agarose (Qiagen) charged with 0.1 M NiSO4 (Samchun Chemicals) was used as the resin, and separation was performed under denaturing conditions. After the column was filled with the resin, it was equilibrated with buffer (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0). Then the soluble supernatant fraction was loaded onto the column, and then the column was eluted with Buffer A (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 6.3) and Buffer B (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 5.9). Recombinant MGFP-5 protein was eluted with elution buffer (8M urea, 10 mM Tris-Cl, 100 mM sodium phosphate, pH 4.5), and eluted fractions were all collected and dialyzed in 5% acetic acid at 4° C. (Spectra/Por® molecular porous membrane tubing, Spectrum Laboratories, USA).
FIG. 11 is an image of silver-stained SDS-PAGE of affinity chromatography fraction samples during the purification of recombinant MGFP-5 protein from E. coli BL21/pMDG05. M is a size marker, Lane 1 is the fraction that was adsorbed when the soluble supernatant fraction was loaded onto the column, Lane 2 is the eluted fraction obtained at the step of washing the column, and Lane 3 is the eluted fraction separated by the elution buffer. FIG. 11 shows that the recombinant is purified at a high level of purity.
6-4. Analysis of MGFP-5 Recombinant Protein
MALDI-TOF (Matrix-assisted laser desorption ionization with time-of-flight) mass spectrometry analysis was performed using a PerSeptive Voyager DE instrument (Perkin-Elmer).
Sinapinic acid in 30% acetonitrile and 0.1% trifluoroacetic acid was used as matrix solution. The recombinant MGFP-5 protein obtained from the above section 6-3 was diluted 1:25 with the matrix solution, then 1 μl was spotted onto gold plates and evaporated using a vacuum pump. Mass spectra were acquired in positive ion mode using an accelerating voltage of 25,000 V, grid voltage at 70 to 80%, guide wire voltage at 0.3%, delay time of 200 to 500 ns and N2 laser power at 1600 to 1900 (arbitrary units). Internal calibration was performed using BSA with [M+H] at 66.431 and [M+2H]2+ at 33.216.
FIG. 12 is the result of mass spectrometry analysis of MGFP-5 recombinant protein.
Example 7 Expression and Purification of MGFP-51 from E. coli BL21/pMDG051
E. coli BL21/pMDG051 was cultured and the cell pellet, cell debris and soluble supernatant fractions were each obtained in the same method as in Example 6. Afterwards, SDS-PAGE and Western blot was carried out on each of the above samples.
FIG. 13 shows photographs of SDS-PAGE analysis (A) and a Western blot analysis (B) of the expression of recombinant MGFP-51 protein from E. coli BL21/pMDG051. W is cell pellet, S is soluble supernatant fraction, and IS is insoluble cell debris. FIG. 13 shows that the recombinant MGFP-5 protein is expressed within the cell in both soluble and insoluble forms.
Example 8 Expression and Purification of MGFP-15 from E. coli BL21/pMDG150
E. coli BL21/pMDG150 was cultured and the cell pellet, cell debris and soluble supernatant fractions were each obtained in the same method as in Example 6. Afterwards, SDS-PAGE and Western blot was carried out on each of the above samples.
FIG. 14 shows photographs of SDS-PAGE analysis (A) and a Western blot analysis (B) of the expression of recombinant MGFP-15 protein from E. coli BL21/pMDG150. M is a size marker, W is cell pellet, S is soluble supernatant fraction, and IS is insoluble cell debris. FIG. 14 shows that the recombinant MGFP-15 protein is expressed within the cell in both soluble and insoluble forms.
Example 9 Expression and Purification of MGFP-151 from E. coli BL21/pMDG151
9-1. Expression of MGFP-151
E. coli BL21/pMDG151 was cultured and the cell pellet, cell debris and soluble supernatant fractions were each obtained in the same method as in Example 6. Afterwards, SDS-PAGE and Western blot was carried out on each of the above samples.
FIG. 15 shows photographs of SDS-PAGE analysis (A) and a Western blot analysis (B) of the expression of MGFP-151 recombinant protein from E. coli BL21/pMDG151. W is cell pellet, S is soluble supernatant fraction, and IS is insoluble cell debris. FIG. 15 shows that the MGFP-151 recombinant protein is expressed within the cell in soluble and insoluble forms.
9-2. Purification I of Recombinant MGFP-151 Protein
Cell pellets were resuspended in 5 ml lysis buffer (10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0) per gram of cell pellet, then the cells were lysed at 20,000 PSI (Constant systems, Low March, UK). Cell lysates were centrifuged at 18,000 g and 4° C. for 20 min to collect the cell debris. The cell debris was resuspended in 20 ml of 5, 10, 15, 20, 25, 30, 22, 24, 26 and 28 (v/v) % acetic acid solutions per gram cell weight respectively and centrifuged under the same conditions. The supernatant was prepared into a chromatographic sample.
A 40 cm×2.6 cm column was filled with Sephacryl S-300 HR (Pharmacia), and equilibrated with 5% acetic acid. Afterwards, 2 ml of sample was loaded, and then the sample was eluted with the concentrations of acetic acid that were used to resuspend each sample to collect the eluted fractions. The degree of purification of MGFP-151 in each concentration of acetic acid elution fraction was confirmed by SDS-polyacylamide gel electrophoresis and then staining by Coomassie blue (FIG. 16). FIG. 16 shows that recombinant MGFP-151 protein is eluted at an acetic acid concentration of 20 to 30 (v/v) %. In particular, it was confirmed that dilution in 25% acetic acid solution showed the best results with 74% purity and 45% yield.
9-3. Purification II of Recombinant MGFP-151 Protein
Cell pellets were resuspended in 5 ml lysis buffer (10 mM Tris-Cl, 100 mM sodium phosphate, pH 8.0) per gram of cell pellet, then the cells were lysed at 20,000 PSI (Constant systems, Low March, UK). Cell lysates were centrifuged at 18,000 g and 4° C. for 20 min to collect the cell debris. The cell debris was resuspended in 20 ml of 25% acetic acid solution per gram cell weight, and centrifuged under the same conditions. After the supernatant was freeze-dried, it was dissolved in 2 ml of 5% acetic acid and prepared into a chromatographic sample.
A 40 cm×2.6 cm column was filled with Sephacryl S-300 HR (Pharmacia), and equilibrated with 5% acetic acid. Afterwards, 2 ml of sample was loaded, and the sample was eluted with 5 (v/v) % acetic acid and eluted fractions I and II were collected. The degree of purification of MGFP-151 in eluted fractions I and II was confirmed by SDS-polyacylamide gel electrophoresis and then staining by Coomassie blue (FIG. 17). FIG. 17 shows photographs of SDS-PAGE analysis (A) and a Western blot analysis (B) of the chromatographic fractions of MGFP-151 recombinant protein. recombinant MGFP-151 protein with 95.8% purity could be isolated by chromatography.
The purified recombinant MGFP-151 protein was confirmed to be the same at the initially designed MGFP-151 peptide, through analysis with MALDI-TOF mass spectrometer.
Example 10 Modification of the Adhesive Protein's Tyrosine Residues
The MGFP-5, MGFP-51, MGFP-15 and MGFP-151 adhesive proteins purified in Examples 6 to 9 were each dissolved to a concentration of 1.44 mg/ml in 5% acetic acid buffer containing 25 mM ascorbic acid. Then after the addition of 50 ug/ml of tyrosinase, it was shaken for 6 hours at 25° C. Through this process, the tyrosine residues of the adhesive proteins were modified to DOPA. Furthermore, bovine serum albumin (BSA) was used as negative control, and the commercial product Cell-Tak™ (BD Bioscience, Two Oak Park, Belford, Mass., USA) which consists of mussel adhesive proteins FP-1 and FP-2 was used as positive control.
Example 11 Verification of the Ability of the Recombinant MGFP-5 and MGFP-151 Proteins to Coat Various Surfaces
The abilities of recombinant MGFP-5 and MGFP-151 proteins to coat the surfaces of glass slide, poly(methyl methacrylate) plate, and aluminum plate were measured. Each material surface was cleaned by washing with water several times and drying with nitrogen gas. A 5 μl drop of 1.44 mg/ml protein solution was spotted onto each surface and kept for 12 h at 25° C. After drying, each surface was washed thoroughly with double distilled water for 2 h with shaking, and the water remaining on each surface was evaporated with a vacuum pump. After drying, the protein coated on the surface was visualized using Coomassie blue staining. This result is shown in FIG. 18.
FIG. 18 shows the result of coating the surfaces of glass slide, poly(methyl methacrylate) plate, and aluminum plate with recombinant MGFP-5 and MGFP-151 proteins after their tyrosine residues are modified to DOPA. The recombinant MGFP-5 and MGFP-151 proteins adhered to glass, poly(methyl methacrylate), and aluminum even before modification of their tyrosine residues, and the adhesion force was found to be much higher when the tyrosine residues are modified to DOPA.
Example 12 Measurement of Adsorption of Recombinant Adhesive Protein using QCM (Quartz Crystal Microbalance)
The quartz crystal used (Seiko EG & G) was a gold-coated AT-cut quartz 5 mm in diameter with a basic resonant frequency of 9 MHz. A 5 μl drop of a 1.44 mg/ml protein solution (BSA, Cell-Tak, recombinant MGFP-5 protein, and recombinant MGFP-151 protein) was each placed onto the gold surface of the quartz crystal and kept at 25° C. in a constant-temperature water bath for 1 hour. After taking it out of the water bath and drying, the gold surface was rinsed thoroughly in double distilled water for 1 h with shaking and the water remaining on the quartz crystal was evaporated using a vacuum pump. Dried quartz crystal was connected to an EQCM controller (QCA917; Seiko EG & G) and variations in resonance frequency were measured. Since the resonance frequency of the quartz crystal decreases as a function of increase in the mass adsorbed on its surface (G. Sauerbrey, 1959, Z. Phys, 155, 206), the increase in mass was calculated by Equation 1 (M. Thomson, 1991, Analyst, 116, 881-889) with the value for change in resonance frequency.
Δ mass = - Δ freq × A × μ q × ρ q 2 × F q 2 ( Equation 1 )
In the above Equation 1, Δmass is change in mass, Δfreq is change in resonance frequency, μq is AT-cut quartz crystal constant (2.947×1.011 g/cm/sec2), Pq is the quartz crystal density (2.648 g/cm2), Fq 2 is reference frequency (9.00 MHz), and A is quartz crystal surface area (0.196 cm2).
FIG. 19 is the result of QCM analysis of BSA, Cell-Tak, recombinant MGFP-5 protein and recombinant MGFP-151 protein where the tyrosines were treated, showing the level of adsorption onto the gold surface as change in frequency. In FIG. 19, recombinant MGFP-151 protein modified with tyrosinase showed the greatest change in frequency, indicating the greatest mass adsorbing to the gold surface of the quartz crystal. Although Cell-Tak™ adsorbed in a greater amount compared to BSA, its adhesion force was much lower compared to that of recombinant MGFP-5 protein. The change in mass of recombinant MGFP-151 protein was 36%, that of recombinant MGFP-5 protein was 23.2%, and that of Cell-Tak was 10% or less.
Example 13 Measurement of Adhesion Force of Recombinant Adhesion Protein Using AFM (Atomic Force Microscopy)
The force-distance curve was obtained using AFM (SPA400; Seiko Instruments), and AFM cantilevers were done according to the technique of Ducker et al. (W. Ducker, Nature, 1991, 353, 239-241) (FIG. 20). The cantilevers used for the present experiments were Olympus oxide-sharpened silicon nitrate probes (Veeco & Seiko Instruments) and the spring constant was 0.57 or 11 N/m. A glass bead (Park Science) of 20 μm diameter was attached to the tip of the cantilever using an epoxy resin (Vantico), and kept at room temperature for 24 h. The AFM cantilevers with glass bead attached were mounted into the AFM, and the glass bead was immersed in 10 μl of tyrosinase-treated protein solutions (1.44 mg/ml BSA, Cell-Tak™, MGFP-1 or MGFP-5) (MGFP-5 or MGFP-151) for 10 min. The glass bead was brought into contact with clean glass surface, and a force-distance curve was obtained. (Time required for one cycle of the force-distance curve measurement was 5 s.
Figure US08173395-20120508-P00001
)
FIG. 21 shows the adhesion force of recombinant MGFP-151 and MGFP-5 proteins with modified tyrosines. Recombinant mussel adhesive proteins MGFP-5 and MGFP-151 have average values of 540 nN and 500 nN respectively indicating strong adhesion force, whereas that of Cell-Talc was 250 nN, and that of BSA was around 30 nN. This result shows that tyrosinase-treated recombinant mussel adhesion proteins have strong adhesion ability.
Example 14 Measurement of Cell Adhesion Property
Drosophila S2 cells (Invitrogen) were used.
S2 cells were grown at 27° C. in M3 medium (Shields and Sang M3 insect medium; Sigma, St. Louis, Mo.) containing 10% IMS (insect medium supplement), 1% antibiotic-antimycotic (Invitrogen), and hygromycin 3 μl/ml. Tyrosinase-treated recombinant MGFP-5 protein, recombinant MGFP-151 protein, Cell-Talc, and BSA prepared from Example 10 were dropped onto sterilized slide glass (20 mm×20 mm, Marienfeld, Germany) and incubated at 25° C. for 30 minutes in a laminar flow hood and then washed two times with PBS. After washing, the coated slide glass was immersed in 100-mm cell culture dishes containing S2 cells at a concentration of 4×106 cells/ml showing 95% viability. After incubation at 27° C. for 1 hr to 7 days, unattached cells were rinsed away with PBS, and cell viability and location of adhered protein was checked by trypan blue staining.
As a result, S2 cells were found to attach to regions where recombinant MGFP-5 and MGFP-151 proteins were coated, and the attached S2 cells survived for 7 days or more (FIGS. 22 and 23).
Example 15 Examination of the Chemical Adhesive Stability of MGFP-5 and MGFP-151
The recombinant proteins MGFP-5 and MGFP-151 were each spotted onto glass and Cell-Talc was spotted on as control. After drying, it was immersed in a solution consisting of 5% acetic acid, 25% methanol, and 70% water, and heated for 20 minutes at 85° C. As a result, for the adhesive proteins coated on the surface of glass or acrylic plates, it was found that upon leaving at high temperatures under solvent conditions MGFP-5 became detached while MGFP-151 continued to stay attached.
Also, each was coated onto glass or acrylic plates and adhesive stability was measured through SEM.
FIGS. 24A to C are photographs of the substrate surfaces coated with recombinant MGFP-5 and MGFP-151 proteins, where A is a 2500× enlargement, B is a 10000× enlargement, and C is a 35000× enlargement. On observation, the surface coated with MGFP-151 was found to be smooth, whereas the surface coated with MGFP-5 was found to be a little bit rough. This difference is thought to be a difference in the degree of cross-linking.
[Sequence List Pretext]
SEQ ID NOs: 1 to 4 are primer sequences.
SEQ ID NO: 5 is the cDNA of MGFP-5 protein isolated from Mytilus galloprovincialis.
SEQ ID NO: 6 is the protein sequence of MGFP-5 protein isolated from Mytilus galloprovincialis.
SEQ ID NO: 7 is the nucleotide sequence of 6 tandem repeats of a partial sequence of MEFP-5 protein isolated from Mytilus edulis.
SEQ ID NO: 8 is the amino acid sequence of 6 tandem repeats of a partial sequence of MEFP-5 protein isolated from Mytilus edulis.
SEQ ID NO: 9 is the nucleotide sequence encoding the recombinant adhesive protein MGFP-15 constructed from FP-1 and MGFP-5.
SEQ ID NO: 10 is the amino acid sequence of the recombinant adhesive protein MGFP-15 constructed from FP-1 and MGFP-5.
SEQ ID NO: 11 is the nucleotide sequence encoding the recombinant adhesive protein MGFP-015 constructed from FP-1 and MGFP-5.
SEQ ID NO: 12 is the amino acid sequence of the recombinant adhesive protein MGFP-015 constructed from FP-1 and MGFP-5.
SEQ ID NO: 13 is the nucleotide sequence encoding the recombinant adhesive protein MGFP-151 constructed from FP-1 and MGFP-5.
SEQ ID NO: 14 is the amino acid sequence of the recombinant adhesive protein MGFP-151 constructed from FP-1 and MGFP-5.
SEQ ID NO: 15 is the nucleotide sequence of the construct inserted into the pMDG05 vector for the expression of MGFP-5.
SEQ ID NO: 16 is the amino acid sequence of the adhesive protein expressed from the construct inserted into the pMDG05 vector for the expression of MGFP-5.
SEQ ID NO: 17 is the nucleotide sequence of the construct inserted into the pMDG150 vector for the expression of MGFP-15.
SEQ ID NO: 18 is the amino acid sequence of the adhesive protein expressed from the construct inserted into the pMDG150 vector for the expression of MGFP-15.
SEQ ID NO: 19 is the nucleotide sequence of the construct inserted into the pMDG051 vector for the expression of MGFP-51.
SEQ ID NO: 20 is the amino acid sequence of the adhesive protein expressed from the construct inserted into the pMDG051 vector for the expression of MGFP-51.
SEQ ID NO: 21 is the nucleotide sequence of the construct inserted into the pMDG151 vector for the expression of MGFP-151.
SEQ ID NO: 22 is the amino acid sequence of the adhesive protein expressed from the construct inserted into the pMDG151 vector for the expression of MGFP-151.
SEQ ID Nos: 23 to 24 are primer sequences.
SEQ ID NO: 25 is a partial sequence of FP-1.
SEQ ID Nos: 26 to 31 are nucleotide sequences encoding AKPSYPPTYK which is a partial sequence of FP-1.
SEQ ID NO: 32 is the primer sequence of the T3 promoter.
SEQ ID NO: 33 is the primer sequence of the T7 promoter.
SEQ ID Nos: 34 to 35 are primer sequences.

Claims (17)

1. A polynucleotide comprising a nucleotide sequence encoding an isolated adhesive protein comprising SEQ ID NO:6.
2. The polynucleotide of claim 1, wherein the nucleotide sequence encoding the adhesive protein comprises a nucleotide sequence comprising SEQ ID NO:5.
3. The polynucleotide of claim 1, wherein the nucleotide sequence encoding the adhesive protein further comprises a nucleotide sequence encoding a peptide for improving a physicochemical property selected from the group consisting of solubility, adhesion force, cross-linking, and improvement in protein expression, purification, and recovery rate of the adhesive protein, and is attached to a carboxy- and/or amino-termini of the adhesive protein consisting of SEQ ID NO:6.
4. The polynucleotide of claim 3, wherein the peptide comprises SEQ ID NO:25 tandemly repeated 1 to 10 times.
5. The polynucleotide of claim 4, wherein the nucleotide sequence encoding the peptide comprises SEQ ID NOS:26 to 31 tandemly repeated 1 to 10 times.
6. The polynucleotide of claim 4, wherein the polynucleotide is selected from the group consisting of SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO:13.
7. The polynucleotide of claim 1, wherein the nucleotide sequence encoding the adhesive protein further comprises a nucleotide sequence encoding a peptide comprising 6 histidine tags.
8. The polynucleotide of claim 7, wherein the nucleotide sequence encoding the adhesive protein is selected from the group consisting of SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, and SEQ ID NO:21.
9. A vector that comprises a nucleotide sequence encoding an adhesive protein comprising an amino acid sequences selected from the group consisting of SEQ ID NO:10, SEQ ID NO:12 and SEQ ID NO:14.
10. A transformant transformed with the vector according to claim 9, wherein the transformant is selected from the group consisting of prokaryotes, eukaryotes, and eukaryote-derived cells.
11. The transformant of claim 10, wherein the eukaryote-derived cells are selected from the group consisting of plant cells, insect cells, and mammalian cells.
12. A method of producing an adhesive protein comprising the steps of:
(a) constructing a vector that comprises a nucleotide sequence encoding the adhesive protein comprising SEQ ID NO:6;
(b) constructing a transformant by transforming the vector into a host cell; and
(c) producing recombinant adhesive protein by culturing the transformant.
13. The method of claim 12, wherein the adhesive protein further comprises a peptide for improving a physicochemical property selected from the group consisting of solubility, adhesion force, cross-linking, and improvement in protein expression, purification, and recovery rate of the adhesive protein attached to a carboxy- and/or amino-termini of the protein.
14. The method of claim 13, wherein the peptide is isolated from an adhesive protein.
15. The method of claim 14, wherein the adhesive protein is isolated from a mussel adhesive protein.
16. The method of claim 13, wherein the peptide further comprises SEQ ID NO:25 tandemly repeated 1 to 10 times.
17. A method of producing an adhesive protein comprising the steps of:
(a) constructing a vector that comprises a nucleotide sequence encoding the adhesive protein selected from the group consisting of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, and SEQ ID NO:22;
(b) constructing a transformant by transforming the vector into a host cell; and
(c) producing recombinant adhesive protein by culturing the transformant.
US12/565,066 2004-03-26 2009-09-23 Mussel bioadhesive Expired - Lifetime US8173395B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/565,066 US8173395B2 (en) 2004-03-26 2009-09-23 Mussel bioadhesive

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US55680504P 2004-03-26 2004-03-26
PCT/KR2005/000888 WO2005092920A1 (en) 2004-03-26 2005-03-25 Mussel bioadhesive
US12/565,066 US8173395B2 (en) 2004-03-26 2009-09-23 Mussel bioadhesive

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/KR2005/000888 Division WO2005092920A1 (en) 2004-03-26 2005-03-25 Mussel bioadhesive
US11/599,313 Division US7736862B2 (en) 2000-04-07 2006-11-15 Human T2R63 receptor and related assays for identifying human bitter taste modulators

Publications (2)

Publication Number Publication Date
US20110033891A1 US20110033891A1 (en) 2011-02-10
US8173395B2 true US8173395B2 (en) 2012-05-08

Family

ID=35056143

Family Applications (2)

Application Number Title Priority Date Filing Date
US10/599,313 Active 2026-03-19 US7622550B2 (en) 2004-03-26 2005-03-25 Mussel bioadhesive
US12/565,066 Expired - Lifetime US8173395B2 (en) 2004-03-26 2009-09-23 Mussel bioadhesive

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/599,313 Active 2026-03-19 US7622550B2 (en) 2004-03-26 2005-03-25 Mussel bioadhesive

Country Status (15)

Country Link
US (2) US7622550B2 (en)
EP (1) EP1727830B1 (en)
JP (1) JP4478714B2 (en)
KR (1) KR100872847B1 (en)
CN (1) CN1989152A (en)
AT (1) ATE494300T1 (en)
AU (1) AU2005226595B2 (en)
BR (1) BRPI0509203A (en)
CA (1) CA2561377C (en)
DE (1) DE602005025741D1 (en)
DK (1) DK1727830T3 (en)
IL (1) IL178322A0 (en)
MX (1) MXPA06011039A (en)
RU (1) RU2349599C2 (en)
WO (1) WO2005092920A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9359547B2 (en) 2013-01-31 2016-06-07 Halliburton Energy Services, Inc. Wellbore servicing compositions and methods of making and using same
US20220071918A1 (en) * 2018-12-21 2022-03-10 POSTECH Research and Business Development Foundation Mussel adhesive protein-based photothermal agent and photothermal- responsive adhesive nanoparticles
US12215172B2 (en) 2019-10-14 2025-02-04 Postech Academy-Industry Foundation Bio-responsive adhesive antibody delivery platform for immunotherapy and preparation method thereof

Families Citing this family (54)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102004031258A1 (en) * 2004-06-29 2006-02-09 Jennissen, Herbert P., Prof. Dr. Protein hybrids with polyhydroxyaromatic amino acid epitopes
WO2006038866A1 (en) * 2004-10-01 2006-04-13 Bio Polymer Products Of Sweden Ab Improved coating comprising a bioadhesive polyphenolic protein derived from a byssus-forming mussel
KR100916722B1 (en) 2007-10-13 2009-09-14 민병호 Artificial Teeth Formation Method Using Mussel Bonds
US8722617B2 (en) 2007-12-31 2014-05-13 Postech Academy-Industry Foundation Mussel adhesive protein derived vectors for gene delivery
JP2012526155A (en) 2009-08-25 2012-10-25 ポステック アカデミー−インダストリー ファンデーション Coacervate containing anionic polymer in mussel adhesion protein or its variant
CA2804826C (en) * 2010-07-16 2016-10-18 Biopolymer Technology Of Sweden Ab Corrosion inhibiting coating based on cerium oxide and a catecholic polymer
CN102344488A (en) * 2010-07-30 2012-02-08 浙江海洋学院 Extraction method and rapid detection method of polyphenol protein in the foot gland of mussel thick shell
KR101412773B1 (en) * 2011-04-06 2014-06-30 포항공과대학교 산학협력단 Mussel adhesive proteins obtained from tyrosinase co-expression
CA2888626C (en) 2011-11-28 2021-03-30 Boxin ZHAO Method and apparatus for adhesive bonding in an aqueous medium
CN102433357A (en) * 2011-12-21 2012-05-02 西北大学 Method for plant expression of mussel adhesive protein Mefp-5
KR101578522B1 (en) 2012-08-23 2015-12-17 포항공과대학교 산학협력단 Mussel adhesive protein-based bioadhesive hydrogel
DE102012110664A1 (en) * 2012-11-07 2014-05-08 Henkel Ag & Co. Kgaa Peptides which can be used in coating compositions, adhesion promoters or adhesives for oxidic surfaces
US20140271500A1 (en) * 2013-03-14 2014-09-18 Safewhite Llc Methods and materials for providing teeth with a white appearance
JP6202669B2 (en) * 2013-04-26 2017-09-27 国立研究開発法人国立循環器病研究センター Peptide and complex thereof, scaffold for tissue repair and surface treatment method thereof, and surface treatment solution or set of treatment solutions
CN103520766A (en) * 2013-09-25 2014-01-22 高敏 Mussel mucoprotein liquid product as well as preparation method and application thereof
WO2015126480A2 (en) 2013-11-13 2015-08-27 Massachusetts Institute Of Technology Self-assembling underwater adhesives
KR101652263B1 (en) * 2014-06-13 2016-08-30 (주)콜로디스 바이오사이언스 Adhesive Protein Comprising Antimicrobial Peptide and Antimicrobial Coating Composition Comprising the Same
US9801972B2 (en) 2014-10-02 2017-10-31 Postech Academy-Industry Foundation Mussel-inspired bioactive surface coating composition generating silica nanoparticles
CN104446311B (en) * 2014-12-11 2016-06-08 山东瑞国环保科技有限公司 A kind of weather-resistant and high-strength degree color steel water paint and preparation method
US20180079940A1 (en) * 2015-03-23 2018-03-22 The Chugoku Electric Power Co., Inc. Adhesive molecules
JP6063097B1 (en) * 2015-03-23 2017-01-18 中国電力株式会社 Adhesive molecule
KR102424889B1 (en) * 2015-06-08 2022-07-25 콜로디스 바이오사이언스, 인코포레이티드 Biofunctional Adhesive Composition
KR101865451B1 (en) * 2015-08-26 2018-07-13 윤원준 Protein adhesive for providing adhesion to or coating for surface of inorganic materials
JP6717937B2 (en) 2015-10-30 2020-07-08 イー インク コーポレイション Method for sealing microcell container with phenethylamine mixture
CA2914315C (en) * 2015-12-09 2023-04-25 Nova Chemicals Corp. Hot fill process with closures made from high density unimodal polyethylene
CA2914353C (en) * 2015-12-10 2023-01-24 Nova Chemicals Corp. Hot fill process with closures made from high density polyethylene compositions
WO2018052245A1 (en) * 2016-09-13 2018-03-22 윤원준 Composition and method for cell adhesion
KR102601138B1 (en) 2016-10-28 2023-11-10 주식회사 포스코 Antibiotic bioadhesive film composition and antibiotic bioadhesive film prepared using the same
CN106916564B (en) * 2017-03-15 2018-08-10 吉林大学 A kind of composite bionic binder and preparation method thereof based on oxidized form of glutathione Yu inorganic multi-metal oxygen cluster
WO2018174307A1 (en) * 2017-03-20 2018-09-27 콜로디스 바이오사이언스, 인코포레이티드 Method for separating and purifying mussel adhesive protein
EP3381932A1 (en) * 2017-03-28 2018-10-03 Technische Universität Berlin Modified mussel proteins, uses thereof and related compounds
KR102488119B1 (en) 2017-05-17 2023-01-12 삼성전자주식회사 Bio sensor and manufacturing method thereof
EP3656785B1 (en) 2017-07-18 2024-09-11 POSCO Co., Ltd Antimicrobial adhesive protein, antimicrobial nanoparticle, antimicrobial composition comprising same nanoparticle, and preparation method for same composition
US10610458B2 (en) 2017-09-08 2020-04-07 Ormco Corporation Orthodontic adhesives and methods of using same
KR102010051B1 (en) 2017-09-20 2019-08-12 주식회사 포스코 Coacervate formed from catechol conjugated anionic polymer, and adhesive comprising thereof and method for preparing the same
KR102870505B1 (en) 2017-12-06 2025-10-15 주식회사 아모라이프사이언스 A process of manufactuaring for adhesive mussel proteins
CN108395483A (en) * 2018-02-13 2018-08-14 天津大学 A kind of synthetic method of the multi-functional fusion protein of three block based on mussel attachment proteins/amphoteric ion polypeptide and application
CN108503712A (en) * 2018-03-14 2018-09-07 天津大学 With the difunctional mussel attachment proteins/amphoteric ion polypeptide amalgamation protein of adherency-anti-pollution and synthetic method
US11530245B2 (en) 2018-08-31 2022-12-20 Washington University Split intein mediated polymerization and production of mussel foot adhesive protein materials
US20220332993A1 (en) * 2019-09-30 2022-10-20 Spiber Inc. Protein Adhesive, Joined Body, and Method for Producing the Same
KR102372226B1 (en) 2019-12-19 2022-03-08 주식회사 포스코 Polyphenol-conjugated mussel adhesive protein, and use thereof
CN110959562B (en) * 2019-12-25 2021-11-09 上海海洋大学 Application of oyster peptide in promoting adhesion of Shewanella maritima induced Mytilus coruscus larvae
US11753567B2 (en) 2020-01-08 2023-09-12 Nano And Advanced Materials Institute Limited Adhesive material with improved bonding performance to a wet substrate and methods for preparing the same
WO2022052745A1 (en) * 2020-09-09 2022-03-17 Shanghaitech University Programming living glue systems to perform autonomous mechanical repairs
CN112409974B (en) * 2020-11-19 2021-12-21 江南大学 An amphiphilic bio-based degradable underwater adhesive and its preparation method and application
CN112898900A (en) * 2021-01-20 2021-06-04 中国科学院海洋研究所 Steel surface coating and preparation method thereof
CN114349836B (en) * 2022-01-20 2024-02-09 成都英普博集生物科技有限公司 Mussel-like mucin with strong adhesion and preparation method thereof
KR102720344B1 (en) 2022-10-04 2024-10-22 포항공과대학교 산학협력단 Conductive hydrogel comprising mussel adhesive protein and preparaiton method thereof
EP4674871A1 (en) 2023-02-28 2026-01-07 Novelgen Co., Ltd. Recombinant protein having adhesiveness and functionality, and composition comprising same
CN117447611B (en) * 2023-12-26 2024-04-05 英特菲尔(成都)生物制品有限责任公司 Recombinant mussel mucin with natural activity and preparation method and application thereof
WO2025162417A1 (en) * 2024-01-31 2025-08-07 Shenzhen Pam2L Biotechnologies Co., Ltd. Methods and compositions for protein expressions
KR20250133816A (en) 2024-02-29 2025-09-09 (주)네이처글루텍 Injectable formulation based on biocompatible cationic polymer and uses thereof
CN117964785B (en) * 2024-04-01 2024-06-25 深圳易致生物科技有限公司 Recombinant collagen mussel mucin and its expression method and application
KR20260003467A (en) * 2024-06-28 2026-01-07 (주)네이처글루텍 Composition comprising anti-aging peptide and anti-oxidant

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5202236A (en) * 1984-09-13 1993-04-13 Enzon Labs Inc. Method of producing bioadhesive protein
JPS6323670A (en) 1986-04-25 1988-01-30 バイオ−ポリマ−ズ インコ−ポレ−テツド Adhesive coating composition and its production
JPH08266281A (en) * 1995-03-31 1996-10-15 Kaiyo Bio Technol Kenkyusho:Kk Mussel adhesive protein gene
EP0794251B1 (en) * 1995-09-13 2005-06-08 Daiichi Fine Chemical Co., Ltd. D-pantolactone hydrolase and gene encoding the same
AU5910099A (en) * 1998-09-09 2000-04-03 United States Surgical Corporation Recombinant bioadhesive protein analogs comprising hydroxyproline
ES2292060T3 (en) 1999-12-17 2008-03-01 Biopolymer Products Of Sweden Ab MOVING BIOADHESIVE COMPOSITION INCLUDING A POLYPHENOLIC PROTEIN, A POLYMER THAT INCLUDES CARBOHYDRATE GROUPS, FINE PHARMACEUTICAL ACCEPTANCE FILMS AND ITS USES.

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Mytilus galloprovincialis foot protein-5 mRNA sequence, GenBank Accession No. AY521220, p. 1. Accessed Dec. 7, 2011. *
Waite JH and Qin X, "Polyphosphoprotein from the Adhesive Pads of Mytilus edulis," Biochemistry, 2001, 40: 2887-2893. *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9359547B2 (en) 2013-01-31 2016-06-07 Halliburton Energy Services, Inc. Wellbore servicing compositions and methods of making and using same
US20220071918A1 (en) * 2018-12-21 2022-03-10 POSTECH Research and Business Development Foundation Mussel adhesive protein-based photothermal agent and photothermal- responsive adhesive nanoparticles
US12171886B2 (en) * 2018-12-21 2024-12-24 POSTECH Research and Business Development Foundation Mussel adhesive protein-based photothermal agent and photothermal-responsive adhesive nanoparticles
US12215172B2 (en) 2019-10-14 2025-02-04 Postech Academy-Industry Foundation Bio-responsive adhesive antibody delivery platform for immunotherapy and preparation method thereof

Also Published As

Publication number Publication date
RU2349599C2 (en) 2009-03-20
US7622550B2 (en) 2009-11-24
JP2008504016A (en) 2008-02-14
KR20060134111A (en) 2006-12-27
RU2006134336A (en) 2008-05-10
CA2561377A1 (en) 2005-10-06
DE602005025741D1 (en) 2011-02-17
DK1727830T3 (en) 2011-03-28
WO2005092920A1 (en) 2005-10-06
JP4478714B2 (en) 2010-06-09
BRPI0509203A (en) 2007-08-28
US20090151600A1 (en) 2009-06-18
US20110033891A1 (en) 2011-02-10
IL178322A0 (en) 2007-02-11
AU2005226595A1 (en) 2005-10-06
EP1727830A4 (en) 2007-08-22
KR100872847B1 (en) 2008-12-10
MXPA06011039A (en) 2007-03-21
EP1727830B1 (en) 2011-01-05
ATE494300T1 (en) 2011-01-15
EP1727830A1 (en) 2006-12-06
CA2561377C (en) 2013-07-30
AU2005226595B2 (en) 2008-09-11
CN1989152A (en) 2007-06-27

Similar Documents

Publication Publication Date Title
US8173395B2 (en) Mussel bioadhesive
US7947806B2 (en) Mussel bioadhesive
Hwang et al. Practical recombinant hybrid mussel bioadhesive fp-151
US5955343A (en) Stable macroscopic membranes formed by self-assembly of amphiphilic peptides and uses therefor
US20120202748A1 (en) Recombinant mussel adhesive protein fp-131
AU2001236185A1 (en) Method of treating a surface of an object with a hydrophobin-containing solution
JP4423542B2 (en) Antibacterial polypeptide and use thereof
KR101412773B1 (en) Mussel adhesive proteins obtained from tyrosinase co-expression
HU221416B1 (en) Hil-4mutant proteins used as antagonists or partial agonists of human interleukin 4
US8765682B2 (en) Method for in vivo residue-specific DOPA incorporation into mussel adhesive proteins
KR101234361B1 (en) Fusion protein using for bone and teeth regeneration
CN113512094A (en) A collagen biomimetic material formed by self-assembly of covalently photocrosslinked polypeptides and covalently photocrosslinked polypeptides
CN108948208A (en) A kind of underwater albumen of injectable selfreparing and application thereof
US6335172B1 (en) Cloned tetrodotoxin-sensitive sodium channel α-subunit and a splice variant thereof
CA2226121A1 (en) Parevins and tachytegrins
US8961984B2 (en) Surface-coated structures and methods
US9096775B2 (en) Surface-coated structures and methods
KR20130131128A (en) Novel protein and use thereof
Hwang et al. Mussel-derived adhesive biomaterials
WO2016180762A1 (en) Microbial nano-tool
JP2013135740A (en) Medical material
WO2002036762A1 (en) Process for producing peptide
Anderson Part I. Single molecule mechanical testing of elastomeric molecules using AFM. Part II. Genetically directed synthesis of a biomimetic adhesive protein
JP2006087435A (en) New polypeptide and dna encoding the same
WO2002070701A9 (en) Novel human gnrh receptor

Legal Events

Date Code Title Description
AS Assignment

Owner name: POSTECH FOUNDATION, KOREA, REPUBLIC OF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHA, HYUNG JOON;HWANG, DONG SOO;REEL/FRAME:023384/0681

Effective date: 20060822

Owner name: POSCO, KOREA, REPUBLIC OF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHA, HYUNG JOON;HWANG, DONG SOO;REEL/FRAME:023384/0681

Effective date: 20060822

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

STCF Information on status: patent grant

Free format text: PATENTED CASE

FPAY Fee payment

Year of fee payment: 4

AS Assignment

Owner name: NATURE GLUETECH CO., LTD., KOREA, REPUBLIC OF

Free format text: LICENSE;ASSIGNORS:POSTECH FOUNDATION;POSCO;REEL/FRAME:042160/0470

Effective date: 20170202

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 8

AS Assignment

Owner name: POSCO HOLDINGS INC., KOREA, REPUBLIC OF

Free format text: CHANGE OF NAME;ASSIGNOR:POSCO;REEL/FRAME:061562/0041

Effective date: 20220302

AS Assignment

Owner name: POSTECH FOUNDATION, KOREA, REPUBLIC OF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:POSCO HOLDINGS INC.;POSTECH FOUNDATION;REEL/FRAME:063254/0876

Effective date: 20221228

Owner name: POSCO CO., LTD, KOREA, REPUBLIC OF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:POSCO HOLDINGS INC.;POSTECH FOUNDATION;REEL/FRAME:063254/0876

Effective date: 20221228

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 12TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1553); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 12