US6497883B1 - Porcine circovirus recombinant poxvirus vaccine - Google Patents

Porcine circovirus recombinant poxvirus vaccine Download PDF

Info

Publication number
US6497883B1
US6497883B1 US09/583,545 US58354500A US6497883B1 US 6497883 B1 US6497883 B1 US 6497883B1 US 58354500 A US58354500 A US 58354500A US 6497883 B1 US6497883 B1 US 6497883B1
Authority
US
United States
Prior art keywords
leu
ile
lys
ser
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US09/583,545
Inventor
Michel Bublot
Jennifer M. Perez
Catherine E. Charreyre
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boehringer Ingelheim Animal Health France SAS
Original Assignee
Merial SAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US09/583,545 priority Critical patent/US6497883B1/en
Application filed by Merial SAS filed Critical Merial SAS
Priority to PT80055494T priority patent/PT1975235E/en
Priority to AU54189/00A priority patent/AU778520B2/en
Priority to PCT/IB2000/000882 priority patent/WO2000077216A2/en
Priority to DK08005549.4T priority patent/DK1975235T3/en
Priority to PT00938971T priority patent/PT1185660E/en
Priority to DE60044778T priority patent/DE60044778D1/en
Priority to BR0011737-4A priority patent/BR0011737A/en
Priority to CA2376600A priority patent/CA2376600C/en
Priority to BRPI0011737-4A priority patent/BRPI0011737B1/en
Priority to EP00938971A priority patent/EP1185660B1/en
Priority to JP2001503659A priority patent/JP4859316B2/en
Priority to KR1020017015883A priority patent/KR100837724B1/en
Priority to CNB00810560XA priority patent/CN1195854C/en
Priority to EP08005549.4A priority patent/EP1975235B1/en
Priority to HU0201689A priority patent/HU229051B1/en
Priority to ES08005549.4T priority patent/ES2560513T3/en
Priority to PL352201A priority patent/PL205032B1/en
Priority to AT00938971T priority patent/ATE476510T1/en
Priority to DK00938971.9T priority patent/DK1185660T3/en
Priority to MXPA01012723A priority patent/MXPA01012723A/en
Assigned to MERIAL reassignment MERIAL ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHARREYRE, CATHERINE E., PEREZ, JENNIFER, BUBLOT, MICHEL
Application granted granted Critical
Publication of US6497883B1 publication Critical patent/US6497883B1/en
Priority to CY20101100958T priority patent/CY1116483T1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/24011—Poxviridae
    • C12N2710/24041—Use of virus, viral particle or viral elements as a vector
    • C12N2710/24043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/10011—Circoviridae
    • C12N2750/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to vectors, such as recombinant vectors; for instance, recombinant viruses, such as poxviruses, e.g., modified poxviruses and to methods of making and using the same.
  • the invention relates to recombinant avipox viruses, such as canarypox viruses, e.g., ALVAC.
  • the invention further relates to such vectors, e.g., poxviruses, that express gene products, e.g., antigen(s), ORF(s), and/or epitope(s) of interest therefrom, of porcine circovirus 2 (PCV2); to immunological compositions or vaccines.
  • PCV2 porcine circovirus 2
  • the invention yet further relates to such vectors, e.g., poxviruses, that induce an immune response directed to or against PCV2 gene products and/or PCV2; and, to advantageously, such compositions that are immunological, immunogenic or vaccine compositions and/or confer protective immunity against infection by PCV2.
  • the invention yet further relates to the uses of and methods for making and using such vectors and compositions, as well as intermediates thereof, and said intermediates.
  • the invention relates to the products therefrom, e.g., from the uses and methods involving the inventive recombinant or poxvirus, such as antibodies from expression.
  • PMWS Postweaning multisystemic wasting syndrome
  • Circoviruses are single stranded circular DNA viruses found in a range of animal and plant species. Porcine circovirus was originally isolated as a contaminant from a continuous pig kidney cell line. The cell culture isolate has been designated PK-15 (Meehan et al., 1997). More recently, porcine circovirus obtained from pigs with PMWS has been compared to PK-15. Such viruses differ substantially from PK-15 at the nucleotide and protein sequence level, and have been designated PCV2 (Meehan et al., 1998; Hamel et al., 1998).
  • ORFs open reading frames
  • ORF2 (Meehan et al., 1998; corresponding to COL13 in the French patent application 98 03707), comprising nt 1381-1768 joined to 1-314 (GenBank accession number AF055392), may encode a protein with a predicted molecular weight of 27.8 kD.
  • ORF3 (Meehan et al., 1998; corresponding to COL7 in the French patent application 98 03707), comprising nt 1018-704 (GenBank accession number AF055392), may encode a protein with a predicted molecular weight of 11.9 kD.
  • ORF4 (Meehan et al., 1998; corresponding to COL10 in the French patent application 98 03707), comprising nt 912-733 (GenBank accession number AF055392), may encode a protein with a predicted molecular weight of 6.5 kD.
  • ORF1 of PCV2 is highly homologous (86% identity) to the ORF1 of the PK-15 isolate (Meehan et al., 1998).
  • the ORF1 protein of PK-15 has been partially characterized (Meehan et al., 1997; Mankertz et al., 1998a). It is known to be essential for virus replication, and is probably involved in the viral DNA replication.
  • Vaccinia virus has been used successfully to immunize against smallpox, culminating in the worldwide eradication of smallpox in 1980. With the eradication of smallpox, a new role for poxviruses became important, that of a genetically engineered vector for the expression of foreign genes (Panicali and Paoletti, 1982; Paoletti et al., 1984). Genes encoding heterologous antigens have been expressed in vaccinia, often resulting in protective immunity against challenge by the corresponding pathogen (reviewed in Tartaglia et al., 1990). A highly attenuated strain of vaccines, designated MVA, has also been used as a vector for poxvirus-based vaccines. Use of MVA is described in U.S. Pat. No. 5,185,146.
  • Fowlpox virus is the prototypic virus of the Avipox genus of the Poxvirus family. The virus causes an economically important disease of poultry which has been well controlled since the 1920's by the use of live attenuated vaccines.
  • avipox viruses Replication of the avipox viruses is limited to avian species (Matthews, 1982) and there are no reports in the literature of avipoxvirus causing a productive infection in any non-avian species including man. This host restriction provides an inherent safety barrier to transmission of the virus to other species and makes use of avipoxvirus based vaccine vectors in veterinary and human applications an attractive proposition.
  • FPV has been used advantageously as a vector expressing antigens from poultry pathogens.
  • the hemagglutinin protein of a virulent avian influenza virus was expressed in an FPV recombinant (Taylor et al., 1988c).
  • an immune response was induced which was protective against either a homologous or a heterologous virulent influenza virus challenge (Taylor et al., 1988c).
  • FPV recombinants expressing the surface glycoproteins of Newcastle Disease Virus have also been developed (Taylor et al., 1990; Edbauer et al., 1990).
  • Attenuated poxvirus vectors have been prepared by genetic modifications of wild type strains of virus.
  • the NYVAC vector derived by deletion of specific virulence and host-range genes from the Copenhagen strain of vaccinia (Tartaglia et al., 1992) has proven useful as a recombinant vector in eliciting a protective immune response against an expressed foreign antigen.
  • ALVAC derived from canarypox virus
  • ALVAC canarypox virus
  • ALVAC does not productively replicate in non-avian hosts, a characteristic thought to improve its safety profile (Taylor et al., 1991 & 1992).
  • Both ALVAC and NYVAC are BSL-1 vectors.
  • Recombinant poxviruses can be constructed in two steps known in the art and analogous to the methods for creating synthetic recombinants of poxviruses such as the vaccinia virus and avipox virus described in U.S. Pat. Nos. 4,769,330; 4,722,848; 4,603,112; 5,110,587; 5,174,993; 5,494,807; and 5,505,941, the disclosures of which are incorporated herein by reference.
  • PCV2 recombinant poxvirus and of compositions and products therefrom particularly ALVAC based PCV2 recombinants and compositions and products therefrom, especially such recombinants containing ORFs 1 and/or 2 of PCV2, and compositions and products therefrom would be a highly desirable advance over the current state of technology.
  • the present invention relates to an antigenic, immunological, immunogenic, or vaccine composition or a therapeutic composition for inducing an antigenic, immunogenic or immunological response in a host animal inoculated with the composition.
  • the composition advantageously includes a carrier or diluent and a recombinant virus, such as a recombinant poxvirus.
  • the recombinant virus or poxvirus contains and expresses an exogenous nucleic acid molecule encoding an ORF, antigen, immunogen, or epitope of interest from PCV2, or a protein that elicits an immunological response against PCV2 or conditions caused by PCV2, such as PMWS.
  • the recombinant virus can be a modified recombinant virus or poxvirus; for example, such a virus or poxvirus that has inactivated therein virus-encoded genetic functions, e.g., nonessential virus-encoded genetic functions, so that the recombinant virus has attenuated virulence and enhanced safety.
  • the invention further provides the viruses used in the composition, as well as methods for making and uses of the composition and virus.
  • the virus used in the composition according to the present invention is advantageously a poxvirus, particularly a vaccinia virus or an avipox virus, such as fowlpox virus or canarypox virus and more advantageously, ALVAC.
  • the modified recombinant virus can include, e.g., within a non-essential region of the virus genome, a heterologous DNA sequence which encodes an antigenic protein, e.g., derived from PCV2 ORFs, e.g., PCV2 ORF 1 and/or 2.
  • the present invention relates to an immunogenic composition containing a modified recombinant virus having inactivated nonessential virus-encoded genetic functions so that the recombinant virus has attenuated virulence and enhanced safety.
  • the modified recombinant virus includes, e.g., within a non-essential region of the virus genome, a heterologous DNA sequence which encodes an antigenic protein (e.g., derived from PCV2 ORFs, especially ORFS 1 and/or 2) wherein the composition, when administered to a host, is capable of inducing an immunological response specific to the antigen.
  • the present invention relates to a modified recombinant virus having nonessential virus-encoded genetic functions inactivated therein so that the virus has attenuated virulence, and wherein the modified recombinant virus further contains DNA from a heterologous source, e.g., in a nonessential region of the virus genome.
  • the DNA can code for PCV2 genes such as any or all of PCV2 ORF1, ORF2, ORF3, or ORF4 (Meehan et al., 1998), or epitope(s) of interest therefrom.
  • the genetic functions can be inactivated by deleting an open reading frame encoding a virulence factor or by utilizing naturally host-restricted viruses.
  • the virus used according to the present invention is advantageously a poxvirus, e.g., a vaccinia virus or an avipox virus, such as fowlpox virus or canarypox virus.
  • the open reading frame that is deleted from the poxvirus or virus geneome is selected from the group consisting of J2R, B13R+B14R, A26L, A56R, C7L ⁇ K1L, and I4L (by the terminology reported in Goebel et al., 1990); and, the combination thereof.
  • the open reading frame comprises a thymidine kinase gene, a hemorrhagic region, an A type inclusion body region, a hemagglutinin gene, a host range gene region or a large subunit, ribonucleotide reductase; or, the combination thereof.
  • a suitable modified Copenhagen strain of vaccinia virus is identified as NYVAC (Tartaglia et al., 1992), or a vaccinia virus from which has been deleted J2R, B13R+B14R, A26L, A56R, C7L ⁇ K11 and 14L or a thymidine kinase gene, a hemorrhagic region, an A type inclusion body region, a hemagglutinin gene, a host range region, and a large subunit, ribonucleotide reductase (See also U.S. Pat. Nos. 5,364,773, 5,494,807, and 5,762,938, with respect to NYVAC and vectors having additional deletions or inactivations from those of NYVAC that are also useful in the practice of this invention).
  • the poxvirus vector is an ALVAC or, a canarypox virus which was attenuated, for instance, through more than 200 serial passages on chick embryo fibroblasts (Rentschler vaccine strain), a master seed therefrom was subjected to four successive plague purifications under agar from which a plague clone was amplified through five additional passages.
  • ALVAC chick embryo fibroblasts
  • TROVAC an attenuated fowlpox virus useful in the practice of this invention
  • vectors useful with porcine hosts can include a poxvirus, including a vaccinia virus, an avipox virus, a canarypox virus, and a swinepox virus), as well as with respect to terms used and teachings herein such as “immunogenic composition”, “immunological composition”, “vaccine”, and “epitope of interest”, and dosages, routes of administration, formulations, adjuvants, and uses for recombinant viruses and expression products therefrom).
  • poxvirus including a vaccinia virus, an avipox virus, a canarypox virus, and a swinepox virus
  • the invention in yet a further aspect relates to the product of expression of the inventive recombinant poxvirus and uses therefor, such as to form antigenic, immunological or vaccine compositions for treatment, prevention, diagnosis or testing; and, to DNA from the recombinant poxvirus which is useful in constructing DNA probes and PCR primers.
  • FIG. 1 shows the nucleotide sequence of a 3.7 kilobase pair fragment of ALVAC DNA containing the C6 open reading frame.
  • FIG. 2 shows the map of pJP102 donor plasmid.
  • FIG. 3 shows the nucleotide sequence of the 2.5 kilobase pair fragment from pJP 102 donor plasmid from the KpnI (position 653) to the Sacl (position 3166) restriction sites.
  • FIG. 4 shows the map of pJP105 donor plasmid.
  • FIG. 5 shows the map of pJP107 donor plasmid.
  • FIG. 6 shows the nucleotide sequence of the 3.6 kilobase pair fragment from pJP107 donor plasmid from the KpnI (position 653) to the Sacl (position 4255) restriction sites.
  • the present invention relates to a recombinant virus, such as a recombinant poxvirus, containing therein a DNA sequence from PCV2, e.g., in a non-essential region of the poxvirus genome.
  • the poxvirus is advantageously an avipox virus, such as fowlpox virus, especially an attenuated fowlpox virus, or a canarypox virus, especially an attenuated canarypox virus, such as ALVAC.
  • the recombinant poxvirus expresses gene products of the foreign PCV2 gene.
  • Specific ORFs of PCV2 are inserted into the poxvirus vector, and the resulting recombinant poxvirus is used to infect an animal. Expression in the animal of PCV2 gene products results in an immune response in the animal to PCV2.
  • the recombinant poxvirus of the present invention may be used in an immunological composition or vaccine to provide a means to induce an immune response which may, but need not be, protective.
  • compositions of the invention such as immunological, antigenic or vaccine compositions or therapeutic compositions
  • parenteral route intradermal, intramuscular or subcutaneous.
  • Such an administration enables a systemic immune response, or humoral or cell-mediated responses.
  • inventive poxvirus-PCV2 recombinants, antigenic, immunological or vaccine poxvirus-PCV2 compositions or therapeutic compositions can be prepared in accordance with standard techniques well known to those skilled in the pharmaceutical or veterinary art. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical or veterinary arts taking into consideration such factors as the age, sex, weight, species and condition of the particular patient, and the route of administration.
  • the compositions can be administered alone, or can be co-administered or sequentially administered with compositions, e.g., with “other” immunological, antigenic or vaccine or therapeutic compositions thereby providing multivalent or “cocktail” or combination compositions of the invention and methods employing them.
  • ingredients and manner (sequential or co-administration) of administration, as well as dosages can be determined taking into consideration such factors as the age, sex, weight, species and condition of the particular patient, and, the route of administration.
  • compositions of the invention include liquid preparations for orifice, e.g., oral, nasal, anal, vaginal, peroral, intragastric, etc., administration such as suspensions, syrups or elixirs; and, preparations for parenteral, subcutaneous, intradermal, intramuscular or intravenous administration (e.g., injectable administration) such as sterile suspensions or emulsions.
  • parenteral, subcutaneous, intradermal, intramuscular or intravenous administration e.g., injectable administration
  • sterile suspensions or emulsions e.g., injectable administration
  • the recombinant poxvirus or antigens may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose or the like.
  • the compositions can also be lyophilized.
  • compositions can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, adjuvants, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering agents, adjuvants, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired.
  • Standard texts such as “REMINGTON'S PHARMACEUTICAL SCIENCE”, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation. Suitable dosages can also be based upon the Examples below.
  • compositions can contain at least one adjuvant compound chosen from the polymers of acrylic or methacrylic acid and the copolymers of maleic anhydride and alkenyl derivative.
  • the preferred adjuvant compounds are the polymers of acrylic or methacrylic acid which are cross-linked, especially with polyalkenyl ethers of sugars or polyalcohols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Persons skilled in the art can also refer to U.S. Pat. No. 2,909,462 (incorporated herein by reference) which describes such acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms.
  • the preferred radicals are those containing from 2 to 4 carbon atoms, e.g.
  • the unsaturated radicals may themselves contain other substituents, such as methyl.
  • the products sold under the name Carbopol® (BF Goodrich, Ohio, USA) are particularly appropriate. They are cross-linked with an allyl sucrose or with allyl pentaerythritol. Among then, there may be mentioned Carbopol® 974P, 934P and 971P.
  • copolymers of maleic anhydride and alkenyl derivative the copolymers EMA® (Monsanto) which are copolymers of maleic anhydride and ethylene, linear or cross-linked, for example cross-linked with divinyl ether, are preferred.
  • EMA® Monsanto
  • the polymers of acrylic or methacrylic acid and the copolymers EMA® are preferably formed of basic units of the following formula:
  • R 1 and R 2 which are identical or different, represent H or CH 3
  • a solution of adjuvant according to the invention is prepared in distilled water, preferably in the presence of sodium chloride, the solution obtained being at acidic pH.
  • This stock solution is diluted by adding it to the desired quantity (for obtaining the desired final concentration), or a substantial part thereof, of water charged with NaCl, preferably physiological saline (NaCL 9 g/l) all at once in several portions with concomitant or subsequent neutralization (pH 7.3 to 7.4), preferably with NaOH.
  • NaCl physiological saline
  • This solution at physiological pH will be used as it is for mixing with the vaccine, which may be especially stored in freeze-dried, liquid or frozen form.
  • the polymer concentration in the final vaccine composition will be 0.01% to 2% w/v, more particularly 0.06 to 1% w/v, preferably 0.1 to 0.6% w/v.
  • the immunological compositions according to the invention may be associated to at least one live attenuated, inactivated, or sub-unit vaccine, or recombinant vaccine (e.g. poxvirus as vector or DNA plasmid) expressing at least one immunogen from another pig pathogen.
  • the invention encompasses vectors encoding and expressing equivalent nucleotide sequences, that is to say the sequences which change neither the functionality or the strain specificity (say strain of type 1 and strain of type 2) of the gene considered or those of the polypeptides encoded by this gene.
  • the sequences differing through the degeneracy of the code are, of course, included.
  • PCV-2 sequences used in the examples are derived from Meehan et al. (Strain Imp.1010; ORF1 nucleotides 398-1342; ORF2 nucleotides 1381-314; and correspond respectively to ORF4 and ORF13 in U.S. application Ser. No. 09/161,092 of Sep. 25 1998 and to COL4 and COL13 in WO-A-9918214).
  • Other PCV-2 strains and their sequences have been published in WO-A-9918214 and are called Imp1008, Imp999, Imp1011-48285 and Imp1011-48121, as well as in A.L. Hamel et al. J. Virol.
  • the invention also encompasses the equivalent sequences to those used herein and in documents cited herein; for instance, sequences that are capable of hybridizing to the nucleotide sequence under high stringency conditions (see, e.g., Sambrook et al. (1989).
  • sequences that are capable of hybridizing to the nucleotide sequence under high stringency conditions see, e.g., Sambrook et al. (1989).
  • equivalent sequences there may also be mentioned the gene fragments conserving the immunogenicity of the complete sequence, e.g., an epitope of interest.
  • the homology of the whole genome between PCV types 1 and 2 is about 75%. For ORF1, it is about 86%, and for ORF2, about 66%. On the contrary, homologies between genomes and between ORFs within type 2 are generally above 95%.
  • equivalent sequences useful in the practice of this present invention are those sequences having an homology equal or greater than 88%, advantageously 90% or greater, preferably 92% or 95% or greater with ORF1 of strain Imp1010, and for ORF2, are those sequences having an homology equal or greater than 80%, advantageously 85% or greater, preferably 90% or 95% or greater with ORF2 of strain Imp1010.
  • ORF1 and ORF2 according to Meehan 1998 has the potential to encode proteins with predicted molecular weights of 37.7 kD and 27.8 kD respectively.
  • ORF3 and ORF4 (according to Meehan et al. 1998, correspond to ORF7 and ORF10 respectively in WO-A-9918214) has the potential to encode proteins with predicted molecular weights of 11.9 and 6.5 kD respectively.
  • the sequence of these ORFs is also available in Genbank AF 055392. They can also be incorporated in plasmids and be used in accordance with the invention alone or in combination, e .g. with ORF1 and/or ORF2.
  • ORFs 1-3 and 5, 6, 8-9, 11-12 disclosed in U.S. application Ser. No. 09/161,092 of Sep. 25 1998 (COLs 1-3 and 5, 6, 8-9, 11-12 in WO-A-9918214), or region(s) thereof encoding an antigen or epitope of interest, may be used in the practice of this invention, e.g., alone or in combination or otherwise with each other or with the ORFs 1 and 2 or region(s) thereof encoding antigen(s) or epitope(s).
  • This invention also encompasses the use of equivalent sequences; for instance, from ORFs of various PCV-2 strains cited herein. For homology, one can determine that there are equivalent sequences which come from a PCV strain having an ORF2 and/or an ORF1 which have an homology as defined above with the corresponding ORF of strain 1010.
  • an equivalent sequence has homology thereto that is advantageously, for instance, equal or greater than 80%, for example 85% or greater, preferably 90% or 95% or greater with ORF3 of strain ImplO10.
  • an equivalent sequence has homology that is equal or greater than 86%, advantageously 90% or greater, preferably than 95% or greater with ORF4 of strain Imp1010.
  • Nucleotide sequence homology can be determined using the “Align” program of Myers and Miller, (“Optimal Alignments in Linear Space”, CABIOS 4, 11-17, 1988, incorporated herein by reference) and available at NCBI.
  • the term “homology” or “identity”, for instance, with respect to a nucleotide or amino acid sequence can indicate a quantitative measure of homology between two sequences.
  • the percent sequence homology can be calculated as (N ref -N dif )* 100N ref , wherein N dif is the total number of non-identical residues in the two sequences when aligned and wherein N ref is the number of residues in one of the sequences.
  • “homology” or “identity” with respect to sequences can refer to the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman, 1983 PNAS USA 80:726, incorporated herein by reference), for instance, using a window size of 20 nucleotides, a word length of 4 nucleotides, and a gap penalty of 4, and computer-assisted analysis and interpretation of the sequence data including alignment can be conveniently performed using commercially available programs (e.g., IntelligeneticsTMSuite, Intelligenetics Inc. CA).
  • thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence.
  • RNA sequences within the scope of the invention can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.
  • amino acid sequence similarity or identity or homology can be determined using the BlastP program (Altschul et al., Nucl. Acids Res. 25, 3389-3402, incorporated herein by reference) and available at NCBI.
  • the following references (each incorporated herein by reference) provide algorithms for comparing the relative identity or homology of amino acid residues of two proteins, and additionally or alternatively with respect to the foregoing, the teachings in these references can be used for determining percent homology or identity: Needleman S B and Wunsch C D, “A general method applicable to the search for similarities in the amino acid sequences of two proteins,” J. Mol. Biol.
  • female pigs are inoculated prior to breeding; and/or prior to serving, and/or during gestation.
  • at least one inoculation is done before serving and it is preferably followed by an inoculation to be performed during gestation, e.g., at about mid-gestation (at about 6-8 weeks of gestation) and/or at the end of gestation (at about 11-13 weeks of gestation).
  • an advantageous regimen is an inoculation before mating and/o serving and a booster inoculation during gestation.
  • reinoculation before each serving and/or during gestation at about mid-gestation and/or at the end of gestation. Preferably, reinoculations are during gestation.
  • Male pigs also can be inoculated, e.g., prior to mating.
  • Piglets such as piglets from vaccinated females (e.g., inoculated as herein discussed), are inoculated within the first weeks of life, e.g., inoculation at one and/or two and/or three and/or four and/or five weeks of life.
  • piglets are first inoculated within the first week of life or within the third week of life (e.g., at the time of weaning).
  • such piglets are then boosted two to four weeks later.
  • the present invention is additionally described by the following illustrative, non-limiting Examples.
  • the invention in a preferred embodiment is directed to recombinant poxviruses containing therein a DNA sequence from PCV2 in a nonessential region of the poxvirus genome.
  • the recombinant poxviruses express gene products of the foreign PCV2 gene.
  • ORF2 and ORF1 genes encoding PCV2 proteins were isolated, characterized and inserted into ALVAC (canarypox vector) recombinants.
  • ALVAC canarypox vector
  • Imp.1010-Stoon The strain of PCV2 designated Imp.1010-Stoon has been previously described (Meehan et al., 1998). It was isolated from mesenteric lymph node tissues from a diseased pig originating from Canada. Cloning of the PCV2 genome was described by Meehan et al. (1998). Plasmid pGem7Z-Imp1010-Stoon-EcoRI No. 14 contains the PCV2 genome as an EcoRI fragment inserted into the EcoRI site of plasmid pGem-7Z (Promega, Madison, Wis.). The complete nucleotide sequence of the Imp.1010-Stoon PCV2 strain has been determined by Meehan et al. (1998) and is available under the GenBank accession number AF055392.
  • the parental canarypox virus (Rentschler strain) is a vaccinal strain for canaries.
  • the vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts.
  • a master viral seed was subjected to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages after which the stock virus was used as the parental virus in in vitro recombination tests.
  • the plaque purified canarypox isolate is designated ALVAC.
  • ALVAC was deposited Nov. 14, 1996 under the terms of the Budapest Treaty at the American Type Culture Collection, ATCC accession number VR-2547.
  • the generation of poxvirus recombinants involves different steps: (1) construction of an insertion plasmid containing sequences (“arms”) flanking the insertion locus within the poxvirus genome, and multiple cloning site (MCS) localized between the two flanking arms (e.g., see Example 1); (2) construction of donor plasmids consisting of an insertion plasmid into the MCS of which a foreign gene expression cassette has been inserted (e.g.
  • PCV2 recombinant immunogens may be used in association with PCV1 immunogens, for immunization of animals against PMWS.
  • PCV1 immunogens may be used without PCV2 immunogens.
  • FIG. 1 is the sequence of a 3.7 kb segment of canarypox DNA. Analysis of the sequence revealed an ORF designated C6L initiated at position 377 and terminated at position 2254. The following describes a C6 insertion plasmid constructed by deleting the C6 ORF and replacing it with a multiple cloning site (MCS) flanked by transcriptional and translational termination signals.
  • MCS multiple cloning site flanked by transcriptional and translational termination signals.
  • a 380 bp PCR fragment was amplified from genomic canarypox DNA using oligonucleotide primers C6A1 (SEQ ID NO:2) and C6B1 (SEQ ID NO:3).
  • a 1155 bp PCR fragment was amplified from genomic canarypox DNA using oligonucleotide primers C6C1 (SEQ ID NO:4) and C6D1 (SEQ ID NO:5).
  • the 380 bp and 1155 bp fragments were fused together by adding them together as template and amplifying a 1613 bp PCR fragment using oligonucleotide primers C6A1 (SEQ ID NO:2) and C6D1 (SEQ ID NO:5).
  • This fragment was digested with SacI and KpnI, and ligated into pBluescript SK+ (Stratagene, La Jolla, Calif., USA) digested with SacI/KpnI.
  • the resulting plasmid, pC6L was confirmed by DNA sequence analysis. It consists of 370 bp of canarypox DNA upstream of C6 (“C6 left arm”), vaccinia early termination signal, translation stop codons in six reading frames, an MCS containing SmaI, PstI, XhoI and EcoRI sites, vaccinia early termination signal, translation stop codons in six reading frames and 1156 bp of downstream canary pox sequence (“C6 right arm”).
  • Plasmid pJP099 was derived from pC6L by ligating a cassette containing the vaccinia H6 promoter (described in Taylor et al. (1988c), Guo et al. (1989), and Perkus et al. (1989)) coupled to a foreign gene into the SmaI/EcoRI sites of pC6L.
  • This plasmid pJP099 contains a unique EcoRV site and a unique NruI site located at the 3′ end of the H6 promoter, and a unique SalI site located between the STOP codon of the foreign gene and the C6 left arm.
  • the ⁇ 4.5 kb EcoRV/SalI or NruI/SalI fragment from pJP099 contains therefore the plasmid sequence (pBluescript SK+; Stratagene, La Jolla, Calif., USA), the 2 C6 arms and the 5′ end of the H6 promoter until the EcoRV or NruI site.
  • the product of PCR J1304 was then digested with EcoRV/SalI and cloned as a ⁇ 750 bp fragment into a ⁇ 4.5 kb EcoRVISalI fragment from pJP099 (see above in Example 1).
  • the resulting plasmid was confirmed by sequence analysis and designated pJP102 (see the map of pJP102 in FIG. 2 and the sequence (SEQ ID NO:9) in FIG. 3 ).
  • the sequence of ORF 2 matches sequence available in GenBank, Accession Number AF055392.
  • the donor plasmid pJP102 (linearized with NotI) was used in an in vitro recombination (IVR) test to generate ALVAC recombinant vCP1614 (see Example 6).
  • JP760 (SEQ ID NO:7)
  • PCV2 ORF1 was amplified by PCR using primers JP774 (SEQ ID NO:9) and JP775 (SEQ ID NO:10) on plasmid pGem7Z-Imp1010-Stoon-EcoRI No. 14 resulting in PCR J1311.
  • Primer JP774 (SEQ ID NO:10) contains the 3′ end of the H6 promoter from NruI and the 5′ end of PCV2 ORF1.
  • Primer JP775 (SEQ ID NO:11) contains the 3′ end of PCV2 ORF1 followed by a SalI site.
  • the product of PCR J1311 ( ⁇ 1 Kb) was cloned into pCR2.1 (Invitrogen, Carlsbad, Calif.).
  • the resulting plasmid was confirmed by sequence analysis and designated pJP104.
  • the sequence of ORF1 matches sequence available in GenBank, Accession Number AF055392.
  • a ⁇ 970 bp NruIlSalI fragment was isolated from pJP104 and cloned into a ⁇ 4.5 kb NruI/SalI fragment from pJP099 (see Example 1), resulting in a plasmid which was confirmed by restriction analysis and designated pJP105 (see FIG. 4 ).
  • the donor plasmid pJP105 could be used in an in vitro recombination test (described in Example 6) to generate ALVAC recombinant expressing the PCV2 ORF1.
  • a ⁇ 838 bp BamHI/SalI from pJP102 was blunted using the Klenow fragment of DNA polymerase, and was cloned into the Klenow-blunted EcoRI site of pJP105. Clones were checked for orientation of insert by restriction analysis and a head-to-head orientation was chosen. This plasmid was confirmed by sequence analysis and designated pJP107 (see the map of pJP107 in FIG. 5 and the sequence (SEQ ID NO:11) in FIG. 6 ). The donor plasmid pJP107 (linearized with NotI) was used in an in vitro recombination 5 (IVR) test to generate the ALVAC recombinant vCP1615 (see Example 6).
  • IVR in vitro recombination 5
  • JP774 (SEQ ID NO:7)
  • JP775 (SEQ ID NO:12)
  • Plasmid pPCV1 (B. Meehan et al. J. Gen. Virol. 1997. 78. 221-227), containing the PCV1 genome as a PstI fragment in plasmid pGem-7Z, was used as a template to amplify the PCV1 ORF2.
  • the resulting plasmid was confirmed by sequence analysis and designated pJP113.
  • the sequence of ORF 2 matches sequence available in GenBank, Accession Number U49186.
  • the donor plasmid pJP113 (linearized with NotI) was used in an in vitro recombination (IVR) test to generate ALVAC recombinant vCP1621 (see Example 7).
  • Plasmid pPCV1 (see Example 4 above), containing the PCV1 genome as a PstI fragment in plasmid pGem-7Z, was digested with PstI, and a 1759 bp fragment was isolated and ligated.
  • Primers JP789 (SEQ ID NO:14) and JP790 (SEQ ID NO:15) were used to amplify PCV1 ORF1 from the 1759 bp ligated PstI fragment (see above), resulting in PCR J1316.
  • Primer JP789 (SEQ ID NO:14) contains the 3′ end of the H6 promoter from NruI and the 5′ end of PCV1 ORF1.
  • Primer JP790 (SEQ ID NO:15) contains the 3′ end of PCV1 ORF1 followed by a SalI site.
  • the product of PCR J1316 ( ⁇ 1 Kb) was cloned into pCR2.1 (Invitrogen, Carlsbad, Calif.).
  • the resulting plasmid was confirmed by sequence analysis and designated pJP114.
  • the sequence of ORF1 matches sequence available in GenBank, Accession Number U49186.
  • a ⁇ 970 bp NruI/SalI fragment was isolated from pJP114 and cloned into a ⁇ 4.5 kb NruI/SalI fragment from pJP099 (see Example 1), resulting in a plasmid which was confirmed by restriction analysis and designated pJP115.
  • the donor plasmid pJP115 could be used in an in vitro recombination test (described in Example 7) to generate ALVAC recombinant expressing the PCV1 ORF1.
  • a ⁇ 838 bp BamHI/SalI from pJP113 was blunted using the Klenow fragment of DNA polymerase, and was cloned into the Klenow-blunted EcoRI site of pJP115. Clones were checked for orientation of insert by restriction analysis and a head-to-head orientation was chosen. This plasmid was confirmed by sequence analysis and designated pJP117. The donor plasmid pJP117 (linearized with NotI) was used in an in vitro recombination (IVR) test to generate the ALVAC recombinant vCP1622 (see Example 7).
  • IVR in vitro recombination
  • Plasmids pJP102 (see Example 2 and FIG. 2) and pJP107 (see Example 3 and FIG. 5) were linearized with NotI and transfected into ALVAC infected primary CEF cells by using the calcium phosphate precipitation method previously described (Panicali and Paoletti, 1982; Piccini et al., 1987). Positive plaques were selected on the basis of hybridization to specific PCV2 radiolabeled probes and subjected to four sequential rounds of plaque purification until a pure population was achieved. One representative plaque from each IVR was then amplified and the resulting ALVAC recombinants were designated vCP1614 and vCP1615.
  • the vCP1614 virus is the result of recombination events between ALVAC and the donor plasmid pJP102, and it contains the PCV2 ORF2 inserted into the ALVAC C6 locus.
  • the vCP1615 virus is the result of recombination events between ALVAC and the donor plasmid pJP107, and it contains the PCV2 ORF2 and ORF1 inserted into the ALVAC C6 locus in a head-to-head orientation.
  • a recombinant ALVAC expressing only PCV2 ORF1 can be generated using the donor plasmid pJP105 described in Example 3.
  • Immunofluorescence In order to determine if the PCV2 proteins were expressed in ALVAC recombinant infected Vero cells, immunofluorescence (IF) analysis was performed. Infected Vero cells were washed with PBS 24 hrs after infection (m.o.i. of approx. 10) and fixed with 95% cold aceton for 3 minutes at room temperature. Five monoclonal antibody (MAb) preparations (hybridoma supernatant) specific for PCV2 ORF1 (PCV2 199 1D3GA & PCV2 210 7G5GD) or ORF2 (PCV2 190 4C7CF, PCV2 190 2B1BC & PCV2 190 3A8BC) were used as the first antibody.
  • MAb monoclonal antibody
  • Monoclonal antibodies were obtained from Merial-Lyon. Monoclonal antibodies can also be obtained following the teachings of documents cited herein, e.g. WO-A-99 18214, 1998, French applications Nos. 97/12382, 98/00873, 98/03707, filed Oct. 3, 1997, Jan. 22, 1998, and Mar. 20, 1998, and WO99/29717, incorporated herein by reference. The IF reaction was performed as described by Taylor et al. (1990).
  • PCV2 specific immunofluorescence with the three ORF2-specific antibodies could be detected in cells infected with vCP1614 and cells infected with vCP1615.
  • PCV2 specific immunofluorescence with the two ORF1 -specific antibodies could be detected in cells infected with vCP1615 only.
  • Plasmids pJP113 (see Example 4) and pJP117 (see Example 5) were linearized with NotI and transfected into ALVAC infected primary CEF cells by using the calcium phosphate precipitation method previously described (Panicali and Paoletti, 1982; Piccini et al., 1987). Positive plaques were selected on the basis of hybridization to specific PCV1 radiolabeled probes and subjected to four sequential rounds of plaque purification until a pure population was achieved. One representative plaque from each IVR was then amplified and the resulting ALVAC recombinants were designated vCP1621 and vCP1622.
  • the vCP1621 virus is the result of recombination events between ALVAC and the donor plasmid pJP113, and it contains the PCV1 ORF2 inserted into the ALVAC C6 locus.
  • the vCP1622 virus is the result of recombination events between ALVAC and the donor plasmid pJP117, and it contains the PCV1 ORF2 and ORF1 inserted into the ALVAC C6 locus in a head-to-head orientation.
  • a recombinant ALVAC expressing only PCV1 ORF1 can be generated using the donor plasmid pJP115 described in Example 5.
  • Immunofluorescence In order to determine if the PCV1 proteins were expressed in ALVAC recombinant infected Vero cells, immunofluorescence (IF) analysis was performed. Infected Vero cells were washed with PBS 24 hrs after infection (m.o.i. of approx. 10) and fixed with 95% cold aceton efor 3 minutes at room temperature. A specific anti-PCV1 pig polyclonal serum (Allan G. et al. Vet. Microbiol. 1999. 66: 115-123) was used as the first antibody. The IF reaction was performed as described by Taylor et al. (1990).
  • PCV1 specific immunofluorescence could be detected in cells infected with vCP1621 and cells infected with vCP1622. These results indicated that, as expected, vCP1621 and vCP1622 express PCV1-specific products. No fluorescence was detected with a PCV2-specific pig polyclonal serum in cells infected with vCP1621 and in cells infected with vCP1622. No fluorescence was detected in parental ALVAC infected Vero cells, nor in uninfected Vero cells.
  • recombinant canarypox viruses vCP1614 and vCP1615 can be mixed with solutions of carbomer.
  • recombinant canarypox viruses vCP1621 and vCP1622 can be mixed with solutions of carbomer.
  • the carbomer component used for vaccination of pigs according to the present invention is the CarbopolTM 974P manufactured by the company BF Goodrich (molecular weight of # 3,000,000).
  • a 1.5 % CarbopolTM 974P stock solution is first prepared in distilled water containing 1 g/l of sodium chloride.
  • This stock solution is then used for manufacturing a 4 mg/ml CarbopolTM 974P solution in physiological water.
  • the stock solution is mixed with the required volume of physiological water, either in one step or in several successive steps, adjusting the pH value at each step with a 1N (or more concentrated) sodium hydroxide solution to get a final pH value of 7.3-7.4.
  • This final CarbopolTM 974P solution is a ready-to-use solution for reconstituting a lyophilized recombinant virus or for diluting a concentrated recombinant virus stock.
  • Vaccine viral suspensions are prepared by dilution of recombinant viruses stocks in sterile physiological water (NaCl 0.9 %). Suitable ranges for viral suspensions can be determined empiracally, but will generally range from 10 6 to 10 10 , and preferably about 10 10 , pfu/dose. Vaccine solutions can also be prepared by mixing the recombinant virus suspension with a solution of CarbopolTM 974P, as described in Example 8.
  • Piglets are vaccinated either with:
  • Recombinant virus vCP1614 mixed with Carbopol (4 mg/ml solution); or
  • Recombinant virus vCP1615 mixed with Carbopol (4 mg/ml solution).
  • the viral suspensions contain 10 8 plaque forming units (pfu) per dose. Each viral suspension is injected by intramuscular route under a volume of 1 ml. The intramuscular injection is administered into the muscles of the neck.
  • Two injections of viral suspensions are administered at Day 2 and Day 14 of the experiment.
  • a challenge is done on Day 21 by an oronasal administration of a viral suspension prepared from a culture of PCV-2 virulent strain.
  • piglets are monitored during 3 weeks for clinical signs specific of the post-weaning multisystemic syndrome. The following signs are scored:
  • Rectal temperature daily monitoring for 2 weeks post-challenge, then 2 measures of rectal temperature during the third week.
  • Weight piglets are weighed right before the challenge, and then weekly during the first 3 weeks post-challenge.
  • Blood samples are taken at Day 2, day 14, Day 21, Day 28, Day 35 and Day 42 of the experiment in order to monitor viremia levels and anti-PCV-2 specific antibody titers.
  • Necropsies at Day 42, all surviving piglets are humanely euthanized and necropsied to look for specific PWMS macroscopic lesions. Tissue samples are prepared from liver, lymph nodes, spleen, kidneys and thymus in order to look for specific histological lesions.
  • Vaccine viral suspensions are prepared by dilution of recombinant viruses stocks in sterile physiological water (NaCl 0.9%).
  • Vaccine solutions can also be prepared by mixing the recombinant virus suspension with a solution of CarbopolTM 974P, as described in Example 8.
  • Piglets are vaccinated either with:
  • Recombinant virus vCP1614 mixed with Carbopol (4 mg/ml solution); or
  • Recombinant virus vCP1615 mixed with Carbopol (4 mg/ml solution).
  • the viral suspensions contain 10 8 plaque forming units (pfu) per dose.
  • Each viral suspension is injected by intramuscular route under a volume of 2 ml. The intramuscular injection is administered into the muscles of the neck. Two injections of the viral suspensions are administered at Day 0 and Day 21 of the experiment.
  • a challenge is done at Day 35 by an oronasal administration of a viral suspension prepared from a culture of PCV-2 virulent strain.
  • piglets are monitored during 8 weeks for clinical signs specific of the post-weaning multisystemic syndrome. The clinical monitoring is identical to the one described in Example 9.1. except that total duration of monitoring is 8 weeks instead of 3 weeks.
  • Necropsies are done throughout the experiment for piglets dying from the challenge and at the end of the experiment (Day 97) for all surviving piglets. Tissue samples are the same as described in Example 9.1.
  • Day 2 the piglets are vaccinated with 10 8 pfu of vCP1614, vCP1615 or parental ALVAC vector in 1 ml of PBS by intramuscular route on the side of the neck.
  • a second injection of vaccine or placebo is administered at day 14.
  • Vaccination with ALVAC recombinant is well tolerated by piglets and no evidence of adverse reaction to vaccination is noted.
  • the piglets are challenged day 21 by oronasal administration of a PCV-2 viral suspension, 1 ml in each nostril. Day 45 necropsies are performed and samples of tissues are collected for virus isolation. Necropsy results:
  • Bronchial lymphadenopathy for PCV-2 is a prominent gross finding. A significant reduction of the lymph nodes lesion in relation to control group is observed after immunization with vCP 1614 and vCP1615 (p ⁇ 0.05).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

What is described is a recombinant poxvirus, such as avipox virus, containing foreign DNA from porcine circovirus 2. What are also described are immunological compositions containing the recombinant poxvirus for inducing an immunological response in a host animal to which the immunological composition is administered. Also described are methods of treating or preventing disease caused by porcine circovirus 2 by administering the immunological compositions of the invention to an animal in need of treatment or susceptible to infection by porcine circovirus 2.

Description

CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority from U.S. application Ser. No. 60/138,478, filed Jun. 10, 1999. Reference is made to WO-A-99 18214, 1998, French applications Nos. 97/12382, 98/00873, 98/03707, filed Oct. 3, 1997, Jan. 22, 1998, and Mar. 20, 1998, and WO99/29717. Each of the aforementioned U.S., PCT and French applications, and each document cited in the text and the record or prosecution of each of the aforementioned U.S., PCT and French applications (“application cited documents”) and each document referenced or cited in each of the application cited documents, is hereby incorporated herein by reference; and, technology in each of the aforementioned U.S., PCT and French applications, and each document cited in the text and the record or prosecution of each of the aforementioned U.S., PCT and French applications can be used in the practice of this invention.
Several publications are referenced in this application. Full citation to these documents is found at the end of the specification preceding the claims, and/or where the document is cited. These documents pertain to the field of this invention; and, each of the documents cited or referenced in this application (“herein cited documents”) and each document cited or referenced in herein cited documents are hereby incorporated herein by reference.
FIELD OF THE INVENTION
The present invention relates to vectors, such as recombinant vectors; for instance, recombinant viruses, such as poxviruses, e.g., modified poxviruses and to methods of making and using the same. In some embodiments, the invention relates to recombinant avipox viruses, such as canarypox viruses, e.g., ALVAC. The invention further relates to such vectors, e.g., poxviruses, that express gene products, e.g., antigen(s), ORF(s), and/or epitope(s) of interest therefrom, of porcine circovirus 2 (PCV2); to immunological compositions or vaccines. The invention yet further relates to such vectors, e.g., poxviruses, that induce an immune response directed to or against PCV2 gene products and/or PCV2; and, to advantageously, such compositions that are immunological, immunogenic or vaccine compositions and/or confer protective immunity against infection by PCV2. The invention yet further relates to the uses of and methods for making and using such vectors and compositions, as well as intermediates thereof, and said intermediates. And, the invention relates to the products therefrom, e.g., from the uses and methods involving the inventive recombinant or poxvirus, such as antibodies from expression.
BACKGROUND OF THE INVENTION
Postweaning multisystemic wasting syndrome (PMWS) is a recently recognized disease of young pigs. PMWS is characterized clinically by progressive weight loss and other symptoms such as tachypnea, dyspnea and jaundice. Pathologically, lymphocytic and granulomatous infiltrates, lymphadenopathy, and, more rarely, lymphocytic and granulomatous hepatitis and nephritis have been observed (Clark, 1997; Harding, 1997).
This disease has been described in different European countries as well as in North America. Treatment and prevention of this disease are not currently available.
Several lines of evidence point to porcine circovirus as the etiologic agent of PMWS (Ellis et al., 1998). Circoviruses have been recovered from pigs with PMWS, and antibodies to porcine circovirus have been demonstrated in pigs with the disease.
Circoviruses are single stranded circular DNA viruses found in a range of animal and plant species. Porcine circovirus was originally isolated as a contaminant from a continuous pig kidney cell line. The cell culture isolate has been designated PK-15 (Meehan et al., 1997). More recently, porcine circovirus obtained from pigs with PMWS has been compared to PK-15. Such viruses differ substantially from PK-15 at the nucleotide and protein sequence level, and have been designated PCV2 (Meehan et al., 1998; Hamel et al., 1998).
As many as thirteen open reading frames (ORFs) have been identified in the PCV2 genome (COL1 to COL13 in the French patent application 98 03707). Four of these ORFs share substantial homology with analogous ORFs within the genome of PK-15. ORF1 (Meehan et al., 1998; corresponding to COL4 in the French patent application 98 03707), comprising nt 398-1342 (GenBank accession number AF055392), has the potential to encode a protein with a predicted molecular weight of 37.7 kD. ORF2 (Meehan et al., 1998; corresponding to COL13 in the French patent application 98 03707), comprising nt 1381-1768 joined to 1-314 (GenBank accession number AF055392), may encode a protein with a predicted molecular weight of 27.8 kD. ORF3 (Meehan et al., 1998; corresponding to COL7 in the French patent application 98 03707), comprising nt 1018-704 (GenBank accession number AF055392), may encode a protein with a predicted molecular weight of 11.9 kD. ORF4 (Meehan et al., 1998; corresponding to COL10 in the French patent application 98 03707), comprising nt 912-733 (GenBank accession number AF055392), may encode a protein with a predicted molecular weight of 6.5 kD.
ORF1 of PCV2 is highly homologous (86% identity) to the ORF1 of the PK-15 isolate (Meehan et al., 1998). The ORF1 protein of PK-15 has been partially characterized (Meehan et al., 1997; Mankertz et al., 1998a). It is known to be essential for virus replication, and is probably involved in the viral DNA replication.
Protein sequence identity between the respective ORF2s was lower (66% identity) than that of the ORF1s but each of the ORF2s shared a highly conserved basic N-terminal region, similar to that observed in the N-terminal region of the major structural protein of the avian circovirus chicken anemia virus (CAV) (Meehan et al., 1998). Recently, Mankertz et al. (1998b) has suggested that the ORF2 of the PK-15 isolate (designated ORF 1 in Mankertz et al., 1998b) codes for a capsid protein.
Greater differences were observed between the respective ORF3s and ORF4s of the PK-15 isolate and PCV2. In each case, there was a deletion of the C-terminal region of PCV2 ORF4 and ORF3 compared to the corresponding ORFs present in the genome of the PK-15 isolate. The highest protein sequence homology was observed at the N-terminal regions of both ORF3 and ORF4 (Meehan et al., 1998).
The transcription analysis of the genome of PCV2 has not been published yet. Recent data obtained with the PK-15 isolate indicated that the ORF2 transcript is spliced (Mankertz et al., 1998b).
Vaccinia virus has been used successfully to immunize against smallpox, culminating in the worldwide eradication of smallpox in 1980. With the eradication of smallpox, a new role for poxviruses became important, that of a genetically engineered vector for the expression of foreign genes (Panicali and Paoletti, 1982; Paoletti et al., 1984). Genes encoding heterologous antigens have been expressed in vaccinia, often resulting in protective immunity against challenge by the corresponding pathogen (reviewed in Tartaglia et al., 1990). A highly attenuated strain of vaccines, designated MVA, has also been used as a vector for poxvirus-based vaccines. Use of MVA is described in U.S. Pat. No. 5,185,146.
Two additional vaccine vector systems involve the use of naturally host-restricted poxviruses, avipox viruses. Both fowlpoxvirus (FPV; Taylor et al. 1988a, b) and canarypoxvirus (CPV; Taylor et al., 1991 & 1992) have been engineered to express foreign gene products. Fowlpox virus (FPV) is the prototypic virus of the Avipox genus of the Poxvirus family. The virus causes an economically important disease of poultry which has been well controlled since the 1920's by the use of live attenuated vaccines. Replication of the avipox viruses is limited to avian species (Matthews, 1982) and there are no reports in the literature of avipoxvirus causing a productive infection in any non-avian species including man. This host restriction provides an inherent safety barrier to transmission of the virus to other species and makes use of avipoxvirus based vaccine vectors in veterinary and human applications an attractive proposition.
FPV has been used advantageously as a vector expressing antigens from poultry pathogens. The hemagglutinin protein of a virulent avian influenza virus was expressed in an FPV recombinant (Taylor et al., 1988c). After inoculation of the recombinant into chickens and turkeys, an immune response was induced which was protective against either a homologous or a heterologous virulent influenza virus challenge (Taylor et al., 1988c). FPV recombinants expressing the surface glycoproteins of Newcastle Disease Virus have also been developed (Taylor et al., 1990; Edbauer et al., 1990).
Other attenuated poxvirus vectors have been prepared by genetic modifications of wild type strains of virus. The NYVAC vector, derived by deletion of specific virulence and host-range genes from the Copenhagen strain of vaccinia (Tartaglia et al., 1992) has proven useful as a recombinant vector in eliciting a protective immune response against an expressed foreign antigen.
Another engineered poxvirus vector is ALVAC, derived from canarypox virus (ALVAC was deposited with American Type Culture Collection, P.O. Box 1549, Manassas, Va. 20108, USA, under the terms of the Budapest Treaty on Nov. 14, 1996, and is designated as Accession Number VR-2547). ALVAC does not productively replicate in non-avian hosts, a characteristic thought to improve its safety profile (Taylor et al., 1991 & 1992). Both ALVAC and NYVAC are BSL-1 vectors.
One approach to the development of a subunit PCV2 vaccine is the use of live viral vectors to express relevant PCV2 ORFs. Recombinant poxviruses can be constructed in two steps known in the art and analogous to the methods for creating synthetic recombinants of poxviruses such as the vaccinia virus and avipox virus described in U.S. Pat. Nos. 4,769,330; 4,722,848; 4,603,112; 5,110,587; 5,174,993; 5,494,807; and 5,505,941, the disclosures of which are incorporated herein by reference. It can thus be appreciated that provision of a PCV2 recombinant poxvirus, and of compositions and products therefrom particularly ALVAC based PCV2 recombinants and compositions and products therefrom, especially such recombinants containing ORFs 1 and/or 2 of PCV2, and compositions and products therefrom would be a highly desirable advance over the current state of technology.
OBJECTS AND SUMMARY OF THE INVENTION
It is therefore an object of this invention to provide compositions and methods for treatment and prophylaxis of infection with PCV2. It is also an object to provide a means to treat or prevent PMWS.
In one aspect, the present invention relates to an antigenic, immunological, immunogenic, or vaccine composition or a therapeutic composition for inducing an antigenic, immunogenic or immunological response in a host animal inoculated with the composition. The composition advantageously includes a carrier or diluent and a recombinant virus, such as a recombinant poxvirus. The recombinant virus or poxvirus contains and expresses an exogenous nucleic acid molecule encoding an ORF, antigen, immunogen, or epitope of interest from PCV2, or a protein that elicits an immunological response against PCV2 or conditions caused by PCV2, such as PMWS. For instance, the recombinant virus can be a modified recombinant virus or poxvirus; for example, such a virus or poxvirus that has inactivated therein virus-encoded genetic functions, e.g., nonessential virus-encoded genetic functions, so that the recombinant virus has attenuated virulence and enhanced safety. And, the invention further provides the viruses used in the composition, as well as methods for making and uses of the composition and virus.
The virus used in the composition according to the present invention is advantageously a poxvirus, particularly a vaccinia virus or an avipox virus, such as fowlpox virus or canarypox virus and more advantageously, ALVAC. The modified recombinant virus can include, e.g., within a non-essential region of the virus genome, a heterologous DNA sequence which encodes an antigenic protein, e.g., derived from PCV2 ORFs, e.g., PCV2 ORF 1 and/or 2.
In yet another aspect, the present invention relates to an immunogenic composition containing a modified recombinant virus having inactivated nonessential virus-encoded genetic functions so that the recombinant virus has attenuated virulence and enhanced safety. The modified recombinant virus includes, e.g., within a non-essential region of the virus genome, a heterologous DNA sequence which encodes an antigenic protein (e.g., derived from PCV2 ORFs, especially ORFS 1 and/or 2) wherein the composition, when administered to a host, is capable of inducing an immunological response specific to the antigen.
In a still further aspect, the present invention relates to a modified recombinant virus having nonessential virus-encoded genetic functions inactivated therein so that the virus has attenuated virulence, and wherein the modified recombinant virus further contains DNA from a heterologous source, e.g., in a nonessential region of the virus genome. The DNA can code for PCV2 genes such as any or all of PCV2 ORF1, ORF2, ORF3, or ORF4 (Meehan et al., 1998), or epitope(s) of interest therefrom. The genetic functions can be inactivated by deleting an open reading frame encoding a virulence factor or by utilizing naturally host-restricted viruses. The virus used according to the present invention is advantageously a poxvirus, e.g., a vaccinia virus or an avipox virus, such as fowlpox virus or canarypox virus.
Advantageously, the open reading frame that is deleted from the poxvirus or virus geneome is selected from the group consisting of J2R, B13R+B14R, A26L, A56R, C7L−K1L, and I4L (by the terminology reported in Goebel et al., 1990); and, the combination thereof. In this respect, the open reading frame comprises a thymidine kinase gene, a hemorrhagic region, an A type inclusion body region, a hemagglutinin gene, a host range gene region or a large subunit, ribonucleotide reductase; or, the combination thereof.
A suitable modified Copenhagen strain of vaccinia virus is identified as NYVAC (Tartaglia et al., 1992), or a vaccinia virus from which has been deleted J2R, B13R+B14R, A26L, A56R, C7L−K11 and 14L or a thymidine kinase gene, a hemorrhagic region, an A type inclusion body region, a hemagglutinin gene, a host range region, and a large subunit, ribonucleotide reductase (See also U.S. Pat. Nos. 5,364,773, 5,494,807, and 5,762,938, with respect to NYVAC and vectors having additional deletions or inactivations from those of NYVAC that are also useful in the practice of this invention).
Preferably, the poxvirus vector is an ALVAC or, a canarypox virus which was attenuated, for instance, through more than 200 serial passages on chick embryo fibroblasts (Rentschler vaccine strain), a master seed therefrom was subjected to four successive plague purifications under agar from which a plague clone was amplified through five additional passages. (See also U.S. Pat. Nos. 5,756,103 and 5,766,599 with respect to ALVAC and TROVAC (an attenuated fowlpox virus useful in the practice of this invention); and U.S. Pat. Nos. 6,004,777, 5,990,091, 5,770,212, 6,033,904, 5,869,312, 5,382,425, and WO 95/30018, with respect to vectors that also can be used in the practice of this invention, such as vectors having enhanced expression, vectors having functions deleted therefrom and vectors useful with respect to porcine hosts (for instance, vectors useful with porcine hosts can include a poxvirus, including a vaccinia virus, an avipox virus, a canarypox virus, and a swinepox virus), as well as with respect to terms used and teachings herein such as “immunogenic composition”, “immunological composition”, “vaccine”, and “epitope of interest”, and dosages, routes of administration, formulations, adjuvants, and uses for recombinant viruses and expression products therefrom).
The invention in yet a further aspect relates to the product of expression of the inventive recombinant poxvirus and uses therefor, such as to form antigenic, immunological or vaccine compositions for treatment, prevention, diagnosis or testing; and, to DNA from the recombinant poxvirus which is useful in constructing DNA probes and PCR primers.
These and other embodiments are disclosed or are obvious from and encompassed by the following detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
A better understanding of the present invention will be had by referring to the accompanying drawings, incorporated herein by reference, in which:
FIG. 1 (SEQ ID NOS:1 and 2) shows the nucleotide sequence of a 3.7 kilobase pair fragment of ALVAC DNA containing the C6 open reading frame.
FIG. 2 shows the map of pJP102 donor plasmid.
FIG. 3 (SEQ ID NOS:8 9 and 10) shows the nucleotide sequence of the 2.5 kilobase pair fragment from pJP 102 donor plasmid from the KpnI (position 653) to the Sacl (position 3166) restriction sites.
FIG. 4 shows the map of pJP105 donor plasmid.
FIG. 5 shows the map of pJP107 donor plasmid.
FIG. 6 (SEQ ID NOs: 14 and 15) shows the nucleotide sequence of the 3.6 kilobase pair fragment from pJP107 donor plasmid from the KpnI (position 653) to the Sacl (position 4255) restriction sites.
DETAILED DESCRIPTION
In one aspect, the present invention relates to a recombinant virus, such as a recombinant poxvirus, containing therein a DNA sequence from PCV2, e.g., in a non-essential region of the poxvirus genome. The poxvirus is advantageously an avipox virus, such as fowlpox virus, especially an attenuated fowlpox virus, or a canarypox virus, especially an attenuated canarypox virus, such as ALVAC.
According to the present invention, the recombinant poxvirus expresses gene products of the foreign PCV2 gene. Specific ORFs of PCV2 are inserted into the poxvirus vector, and the resulting recombinant poxvirus is used to infect an animal. Expression in the animal of PCV2 gene products results in an immune response in the animal to PCV2. Thus, the recombinant poxvirus of the present invention may be used in an immunological composition or vaccine to provide a means to induce an immune response which may, but need not be, protective.
The administration procedure for recombinant poxvirus-PCV2 or expression product thereof, compositions of the invention such as immunological, antigenic or vaccine compositions or therapeutic compositions, can be via a parenteral route (intradermal, intramuscular or subcutaneous). Such an administration enables a systemic immune response, or humoral or cell-mediated responses.
More generally, the inventive poxvirus-PCV2 recombinants, antigenic, immunological or vaccine poxvirus-PCV2 compositions or therapeutic compositions can be prepared in accordance with standard techniques well known to those skilled in the pharmaceutical or veterinary art. Such compositions can be administered in dosages and by techniques well known to those skilled in the medical or veterinary arts taking into consideration such factors as the age, sex, weight, species and condition of the particular patient, and the route of administration. The compositions can be administered alone, or can be co-administered or sequentially administered with compositions, e.g., with “other” immunological, antigenic or vaccine or therapeutic compositions thereby providing multivalent or “cocktail” or combination compositions of the invention and methods employing them. Again, the ingredients and manner (sequential or co-administration) of administration, as well as dosages can be determined taking into consideration such factors as the age, sex, weight, species and condition of the particular patient, and, the route of administration. In this regard, reference is made to U.S. Pat. No. 5,843,456, incorporated herein by reference, and directed to rabies compositions and combination compositions and uses thereof.
Examples of compositions of the invention include liquid preparations for orifice, e.g., oral, nasal, anal, vaginal, peroral, intragastric, etc., administration such as suspensions, syrups or elixirs; and, preparations for parenteral, subcutaneous, intradermal, intramuscular or intravenous administration (e.g., injectable administration) such as sterile suspensions or emulsions. In such compositions the recombinant poxvirus or antigens may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose or the like. The compositions can also be lyophilized. The compositions can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, adjuvants, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired. Standard texts, such as “REMINGTON'S PHARMACEUTICAL SCIENCE”, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation. Suitable dosages can also be based upon the Examples below.
The compositions can contain at least one adjuvant compound chosen from the polymers of acrylic or methacrylic acid and the copolymers of maleic anhydride and alkenyl derivative.
The preferred adjuvant compounds are the polymers of acrylic or methacrylic acid which are cross-linked, especially with polyalkenyl ethers of sugars or polyalcohols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Persons skilled in the art can also refer to U.S. Pat. No. 2,909,462 (incorporated herein by reference) which describes such acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms. The preferred radicals are those containing from 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as methyl. The products sold under the name Carbopol® (BF Goodrich, Ohio, USA) are particularly appropriate. They are cross-linked with an allyl sucrose or with allyl pentaerythritol. Among then, there may be mentioned Carbopol® 974P, 934P and 971P.
Among the copolymers of maleic anhydride and alkenyl derivative, the copolymers EMA® (Monsanto) which are copolymers of maleic anhydride and ethylene, linear or cross-linked, for example cross-linked with divinyl ether, are preferred. Reference may be made to J. Fields et al., Nature, 186: 778-780, 4 June 1960, incorporated herein by reference.
From the point of view of their structure, the polymers of acrylic or methacrylic acid and the copolymers EMA® are preferably formed of basic units of the following formula:
Figure US06497883-20021224-C00001
in which:
R1 and R2, which are identical or different, represent H or CH3
x=0or 1, preferably x=1
y=1 or 2, with x+y=2
For the copolymers EMA®, x=0 and y=2. For the carbomers, x=y=1.
The dissolution of these polymers in water leads to an acid solution which will be neutralized, preferably to physiological pH, in order to give the adjuvant solution into which the vaccine itself will be incorporated. The carboxyl groups of the polymer are then partly in COO− form.
Preferably, a solution of adjuvant according to the invention, especially of carbomer, is prepared in distilled water, preferably in the presence of sodium chloride, the solution obtained being at acidic pH. This stock solution is diluted by adding it to the desired quantity (for obtaining the desired final concentration), or a substantial part thereof, of water charged with NaCl, preferably physiological saline (NaCL 9 g/l) all at once in several portions with concomitant or subsequent neutralization (pH 7.3 to 7.4), preferably with NaOH. This solution at physiological pH will be used as it is for mixing with the vaccine, which may be especially stored in freeze-dried, liquid or frozen form.
The polymer concentration in the final vaccine composition will be 0.01% to 2% w/v, more particularly 0.06 to 1% w/v, preferably 0.1 to 0.6% w/v. The immunological compositions according to the invention may be associated to at least one live attenuated, inactivated, or sub-unit vaccine, or recombinant vaccine (e.g. poxvirus as vector or DNA plasmid) expressing at least one immunogen from another pig pathogen.
The invention encompasses vectors encoding and expressing equivalent nucleotide sequences, that is to say the sequences which change neither the functionality or the strain specificity (say strain of type 1 and strain of type 2) of the gene considered or those of the polypeptides encoded by this gene. The sequences differing through the degeneracy of the code are, of course, included.
The PCV-2 sequences used in the examples are derived from Meehan et al. (Strain Imp.1010; ORF1 nucleotides 398-1342; ORF2 nucleotides 1381-314; and correspond respectively to ORF4 and ORF13 in U.S. application Ser. No. 09/161,092 of Sep. 25 1998 and to COL4 and COL13 in WO-A-9918214). Other PCV-2 strains and their sequences have been published in WO-A-9918214 and are called Imp1008, Imp999, Imp1011-48285 and Imp1011-48121, as well as in A.L. Hamel et al. J. Virol. June 1998, vol 72, 6: 5262-5267 (GenBank AF027217) and in I. Morozov et al. J. Clinical Microb. September 1998 vol. 36, 9: 2535-2541, as well as GenBank AF086834, AF086835 and AF086836, and give access to equivalent ORF sequences. These sequences, or ORFs therefrom, or regions thereof encoding an antigen or epitope of interest can also be used in the practice of this invention.
The invention also encompasses the equivalent sequences to those used herein and in documents cited herein; for instance, sequences that are capable of hybridizing to the nucleotide sequence under high stringency conditions (see, e.g., Sambrook et al. (1989). Among the equivalent sequences, there may also be mentioned the gene fragments conserving the immunogenicity of the complete sequence, e.g., an epitope of interest.
The homology of the whole genome between PCV types 1 and 2 is about 75%. For ORF1, it is about 86%, and for ORF2, about 66%. On the contrary, homologies between genomes and between ORFs within type 2 are generally above 95%.
Also, equivalent sequences useful in the practice of this present invention, for ORF1, are those sequences having an homology equal or greater than 88%, advantageously 90% or greater, preferably 92% or 95% or greater with ORF1 of strain Imp1010, and for ORF2, are those sequences having an homology equal or greater than 80%, advantageously 85% or greater, preferably 90% or 95% or greater with ORF2 of strain Imp1010.
ORF1 and ORF2 according to Meehan 1998 has the potential to encode proteins with predicted molecular weights of 37.7 kD and 27.8 kD respectively. ORF3 and ORF4 (according to Meehan et al. 1998, correspond to ORF7 and ORF10 respectively in WO-A-9918214) has the potential to encode proteins with predicted molecular weights of 11.9 and 6.5 kD respectively. The sequence of these ORFs is also available in Genbank AF 055392. They can also be incorporated in plasmids and be used in accordance with the invention alone or in combination, e .g. with ORF1 and/or ORF2.
The other ORFs 1-3 and 5, 6, 8-9, 11-12 disclosed in U.S. application Ser. No. 09/161,092 of Sep. 25 1998 (COLs 1-3 and 5, 6, 8-9, 11-12 in WO-A-9918214), or region(s) thereof encoding an antigen or epitope of interest, may be used in the practice of this invention, e.g., alone or in combination or otherwise with each other or with the ORFs 1 and 2 or region(s) thereof encoding antigen(s) or epitope(s).
This invention also encompasses the use of equivalent sequences; for instance, from ORFs of various PCV-2 strains cited herein. For homology, one can determine that there are equivalent sequences which come from a PCV strain having an ORF2 and/or an ORF1 which have an homology as defined above with the corresponding ORF of strain 1010.
For ORF3 according to Meehan, an equivalent sequence has homology thereto that is advantageously, for instance, equal or greater than 80%, for example 85% or greater, preferably 90% or 95% or greater with ORF3 of strain ImplO10. For ORF4 according to Meehan 1998, advantageously an equivalent sequence has homology that is equal or greater than 86%, advantageously 90% or greater, preferably than 95% or greater with ORF4 of strain Imp1010.
From the genomic nucleotide sequence, e.g. those disclosed in WO-A-99 18214, it is routine art to determine the ORFs using a standard software, such as MacVector®. Also, alignment of genomes with that of strain 1010 and comparison with strain 1010 ORFs allows the one skilled in the art to readily determine the ORFs of the genome of another strain (e.g. other strains disclosed in WO-A-99 18214 or in other herein cited documents).
Using software or making sequence alignment is not undue experimentation and provides direct access to equivalent ORFs or nucleic acid molecules.
Nucleotide sequence homology can be determined using the “Align” program of Myers and Miller, (“Optimal Alignments in Linear Space”, CABIOS 4, 11-17, 1988, incorporated herein by reference) and available at NCBI. Alternatively or additionally, the term “homology” or “identity”, for instance, with respect to a nucleotide or amino acid sequence, can indicate a quantitative measure of homology between two sequences. The percent sequence homology can be calculated as (Nref-Ndif)* 100Nref, wherein Ndif is the total number of non-identical residues in the two sequences when aligned and wherein Nref is the number of residues in one of the sequences. Hence, the DNA sequence AGTCAGTC will have a sequence similarity of 75% with the sequence AATCAATC (Nref=8; Ndif=2).
Alternatively or additionally, “homology” or “identity” with respect to sequences can refer to the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman, 1983 PNAS USA 80:726, incorporated herein by reference), for instance, using a window size of 20 nucleotides, a word length of 4 nucleotides, and a gap penalty of 4, and computer-assisted analysis and interpretation of the sequence data including alignment can be conveniently performed using commercially available programs (e.g., Intelligenetics™Suite, Intelligenetics Inc. CA).. When RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence.
RNA sequences within the scope of the invention can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.
Additionally or alternatively, amino acid sequence similarity or identity or homology can be determined using the BlastP program (Altschul et al., Nucl. Acids Res. 25, 3389-3402, incorporated herein by reference) and available at NCBI. The following references (each incorporated herein by reference) provide algorithms for comparing the relative identity or homology of amino acid residues of two proteins, and additionally or alternatively with respect to the foregoing, the teachings in these references can be used for determining percent homology or identity: Needleman S B and Wunsch C D, “A general method applicable to the search for similarities in the amino acid sequences of two proteins,” J. Mol. Biol. 48:444-453 (1970); Smith T F and Waterman M S, “Comparison of Bio-sequences,” Advances in Applied Mathematics 2:482-489 (1981); Smith T F, Waterman M S and Sadler J R, “Statistical characterization of nucleic acid sequence functional domains,” Nucleic Acids Res., 11:2205-2220 (1983); Feng D F and Dolittle R F, “Progressive sequence alignment as a prerequisite to correct phylogenetic trees,” J. of Molec. Evol., 25:351-360 (1987); Higgins D G and Sharp P M, “Fast and sensitive multiple sequence alignment on a microcomputer,” CABIOS, 5: 151-153 (1989); Thompson J D, Higgins D G and Gibson T J, “ClusterW: improving the sensitivity of progressive multiple sequence alignment through sequence weighing, positions-specific gap penalties and weight matrix choice, Nucleic Acid Res., 22:4673-480 (1994); and, Devereux J, Haeberlie P and Smithies O, “A comprehensive set of sequence analysis program for the VAX,” Nucl. Acids Res., 12: 387-395 (1984).
This invention not only allows for administration to adult pigs, but also to the young and to gestating females; in the latter case, this makes it possible, in particular, to confer passive immunity onto the newborns (maternal antibodies). Preferably, female pigs are inoculated prior to breeding; and/or prior to serving, and/or during gestation. Advantageously, at least one inoculation is done before serving and it is preferably followed by an inoculation to be performed during gestation, e.g., at about mid-gestation (at about 6-8 weeks of gestation) and/or at the end of gestation (at about 11-13 weeks of gestation). Thus, an advantageous regimen is an inoculation before mating and/o serving and a booster inoculation during gestation. Thereafter, there can be reinoculation before each serving and/or during gestation at about mid-gestation and/or at the end of gestation. Preferably, reinoculations are during gestation. Male pigs also can be inoculated, e.g., prior to mating.
Piglets, such as piglets from vaccinated females (e.g., inoculated as herein discussed), are inoculated within the first weeks of life, e.g., inoculation at one and/or two and/or three and/or four and/or five weeks of life. Preferably, piglets are first inoculated within the first week of life or within the third week of life (e.g., at the time of weaning). Advantageously, such piglets are then boosted two to four weeks later.
The present invention is additionally described by the following illustrative, non-limiting Examples.
EXAMPLES
The invention in a preferred embodiment is directed to recombinant poxviruses containing therein a DNA sequence from PCV2 in a nonessential region of the poxvirus genome. The recombinant poxviruses express gene products of the foreign PCV2 gene. In particular, ORF2 and ORF1 genes encoding PCV2 proteins were isolated, characterized and inserted into ALVAC (canarypox vector) recombinants. The molecular biology techniques used are the ones described by Sambrook et al. (1989).
Cell Lines and Virus Strains. The strain of PCV2 designated Imp.1010-Stoon has been previously described (Meehan et al., 1998). It was isolated from mesenteric lymph node tissues from a diseased pig originating from Canada. Cloning of the PCV2 genome was described by Meehan et al. (1998). Plasmid pGem7Z-Imp1010-Stoon-EcoRI No. 14 contains the PCV2 genome as an EcoRI fragment inserted into the EcoRI site of plasmid pGem-7Z (Promega, Madison, Wis.). The complete nucleotide sequence of the Imp.1010-Stoon PCV2 strain has been determined by Meehan et al. (1998) and is available under the GenBank accession number AF055392.
The parental canarypox virus (Rentschler strain) is a vaccinal strain for canaries. The vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts. A master viral seed was subjected to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages after which the stock virus was used as the parental virus in in vitro recombination tests. The plaque purified canarypox isolate is designated ALVAC. ALVAC was deposited Nov. 14, 1996 under the terms of the Budapest Treaty at the American Type Culture Collection, ATCC accession number VR-2547.
The generation of poxvirus recombinants involves different steps: (1) construction of an insertion plasmid containing sequences (“arms”) flanking the insertion locus within the poxvirus genome, and multiple cloning site (MCS) localized between the two flanking arms (e.g., see Example 1); (2) construction of donor plasmids consisting of an insertion plasmid into the MCS of which a foreign gene expression cassette has been inserted (e.g. see Examples 2 to 5); (3) in vitro recombination in cell culture between the arms of the donor plasmid and the genome of the parental poxvirus allowing the insertion of the foreign gene expression cassette into the appropriate locus of the poxvirus genome, and plaque purification of the recombinant virus (e.g. see Example 6).
PCV2 recombinant immunogens may be used in association with PCV1 immunogens, for immunization of animals against PMWS. In a least preferred approach, PCV1 immunogens may be used without PCV2 immunogens.
Example 1
Construction of Canarypox Insertion Plasmid at C6 Locus
FIG. 1 (SEQ ID NO:1) is the sequence of a 3.7 kb segment of canarypox DNA. Analysis of the sequence revealed an ORF designated C6L initiated at position 377 and terminated at position 2254. The following describes a C6 insertion plasmid constructed by deleting the C6 ORF and replacing it with a multiple cloning site (MCS) flanked by transcriptional and translational termination signals. A 380 bp PCR fragment was amplified from genomic canarypox DNA using oligonucleotide primers C6A1 (SEQ ID NO:2) and C6B1 (SEQ ID NO:3). A 1155 bp PCR fragment was amplified from genomic canarypox DNA using oligonucleotide primers C6C1 (SEQ ID NO:4) and C6D1 (SEQ ID NO:5). The 380 bp and 1155 bp fragments were fused together by adding them together as template and amplifying a 1613 bp PCR fragment using oligonucleotide primers C6A1 (SEQ ID NO:2) and C6D1 (SEQ ID NO:5). This fragment was digested with SacI and KpnI, and ligated into pBluescript SK+ (Stratagene, La Jolla, Calif., USA) digested with SacI/KpnI. The resulting plasmid, pC6L was confirmed by DNA sequence analysis. It consists of 370 bp of canarypox DNA upstream of C6 (“C6 left arm”), vaccinia early termination signal, translation stop codons in six reading frames, an MCS containing SmaI, PstI, XhoI and EcoRI sites, vaccinia early termination signal, translation stop codons in six reading frames and 1156 bp of downstream canary pox sequence (“C6 right arm”).
Plasmid pJP099 was derived from pC6L by ligating a cassette containing the vaccinia H6 promoter (described in Taylor et al. (1988c), Guo et al. (1989), and Perkus et al. (1989)) coupled to a foreign gene into the SmaI/EcoRI sites of pC6L. This plasmid pJP099 contains a unique EcoRV site and a unique NruI site located at the 3′ end of the H6 promoter, and a unique SalI site located between the STOP codon of the foreign gene and the C6 left arm. The ˜4.5 kb EcoRV/SalI or NruI/SalI fragment from pJP099 contains therefore the plasmid sequence (pBluescript SK+; Stratagene, La Jolla, Calif., USA), the 2 C6 arms and the 5′ end of the H6 promoter until the EcoRV or NruI site.
Sequences of the Primers
Primer C6A1 (SEQ ID NO:3)
ATCATCGAGCTCGCGGCCGCCTATCAAAAGTCTTAATGAGTT
Primer C6B1 (SEQ ID NO:4)
GAATTCCTCGAGCTGCAGCCCGGGTTTTTATAGCTAATTAGTCATTTTTTCGTAAGTA AGTATTTTTATTTAA
Primer C6C1 (SEQ ID NO:5)
CCCGGGCTGCAGCTCGAGGAATTCTTTTTATTGATTAACTAGTCAAATGAGTATATA TAATTGAAAAAGTAA
Primer C6D1 (SEQ ID NO:6)
GATGATGGTACCTTCATAAATACAAGTTTGATTAAACTTAAGTTG
Example 2
Construction of ALVACC Donor Plasmid for PCV2 0RF2
Plasmid pGem7Z-Imp1010-Stoon-EcoRI No. 14, containing the PCV2 genome as an EcoRI fragment in plasmid pGem-7Z, was digested with EcoRI, and a 1768 bp fragment was isolated and ligated.
In order to insert PCV2 ORF 2 into an appropriate ALVAC insertion vector: Primers JP760 (SEQ ID NO:6) and JP773 (SEQ ID NO:7) were used to amplify PCV2 ORF 2 from the 1768 bp ligated EcoRI fragment (see above) resulting in PCR J1304. Primer JP760 (SEQ ID NO:7) contains the 3′ end of the H6 promoter from EcoRV and the 5′ end of PCV2 ORF 2. Primer JP773 (SEQ ID NO:8) contains the 3′ end of PCV2 ORF 2 followed by a SalI site. The product of PCR J1304 was then digested with EcoRV/SalI and cloned as a ˜750 bp fragment into a ˜4.5 kb EcoRVISalI fragment from pJP099 (see above in Example 1). The resulting plasmid was confirmed by sequence analysis and designated pJP102 (see the map of pJP102 in FIG. 2 and the sequence (SEQ ID NO:9) in FIG. 3). The sequence of ORF 2 matches sequence available in GenBank, Accession Number AF055392. The donor plasmid pJP102 (linearized with NotI) was used in an in vitro recombination (IVR) test to generate ALVAC recombinant vCP1614 (see Example 6).
Sequence of the Primers
JP760 (SEQ ID NO:7)
CAT-CAT-CAT-GAT-ATC-CGT-TAA-GTT-TGT-ATC-GTA-ATG-ACG-TAT-CCA-AGG-AGG-CG
JP773 (SEQ ID NO:8)
TAC-TAC-TAC-GTC-GAC-TTA-GGG-TTT-AAG-TGG-GGG-GTC
Example 3
Construction of an ALVACC Donor Plasmid for PCV2 0RF2 and ORF1
PCV2 ORF1 was amplified by PCR using primers JP774 (SEQ ID NO:9) and JP775 (SEQ ID NO:10) on plasmid pGem7Z-Imp1010-Stoon-EcoRI No. 14 resulting in PCR J1311. Primer JP774 (SEQ ID NO:10) contains the 3′ end of the H6 promoter from NruI and the 5′ end of PCV2 ORF1. Primer JP775 (SEQ ID NO:11) contains the 3′ end of PCV2 ORF1 followed by a SalI site. The product of PCR J1311 (˜1 Kb) was cloned into pCR2.1 (Invitrogen, Carlsbad, Calif.). The resulting plasmid was confirmed by sequence analysis and designated pJP104. The sequence of ORF1 matches sequence available in GenBank, Accession Number AF055392. A ˜970 bp NruIlSalI fragment was isolated from pJP104 and cloned into a ˜4.5 kb NruI/SalI fragment from pJP099 (see Example 1), resulting in a plasmid which was confirmed by restriction analysis and designated pJP105 (see FIG. 4). The donor plasmid pJP105 could be used in an in vitro recombination test (described in Example 6) to generate ALVAC recombinant expressing the PCV2 ORF1.
A ˜838 bp BamHI/SalI from pJP102 (see Example 2) was blunted using the Klenow fragment of DNA polymerase, and was cloned into the Klenow-blunted EcoRI site of pJP105. Clones were checked for orientation of insert by restriction analysis and a head-to-head orientation was chosen. This plasmid was confirmed by sequence analysis and designated pJP107 (see the map of pJP107 in FIG. 5 and the sequence (SEQ ID NO:11) in FIG. 6). The donor plasmid pJP107 (linearized with NotI) was used in an in vitro recombination 5 (IVR) test to generate the ALVAC recombinant vCP1615 (see Example 6).
Sequence of the Primers
JP774 (SEQ ID NO:7)
CAT-CAT-CAT-TCG-CGA-TAT-CCG-TTA-AGT-TTG-TAT-CGT-AAT-GCC-CAG-CAA-GAA-GAA-TGG
JP775 (SEQ ID NO:12)
TAC-TAC-TAC-GTC-GAC-TCA-GTA-ATT-TAT-TTC-ATA-TGG
Example 4
Construction of ALVACC Donor Plasmid for PCV1 RF2
Plasmid pPCV1 (B. Meehan et al. J. Gen. Virol. 1997. 78. 221-227), containing the PCV1 genome as a PstI fragment in plasmid pGem-7Z, was used as a template to amplify the PCV1 ORF2.
In order to insert PCV2 ORF 2 into an appropriate ALVAC insertion vector: Primers JP787 (SEQ ID NO:16) and JP788 (SEQ ID NO:17) were used to amplify PCV1 ORF 2 from plasmid pPCV1 (see above) resulting in PCR J1315. Primer JP787 (SEQ ID NO:16) contains the 3′ end of the H6 promoter from EcoRV and ORF 2 followed by a SalI site. The product of PCR J1315 was then digested with EcoRV/SalI and cloned as a ˜750 bp fragment into a ˜4.5 kb EcoRV/SalI fragment from pJP099 (see above in Example 1). The resulting plasmid was confirmed by sequence analysis and designated pJP113. The sequence of ORF 2 matches sequence available in GenBank, Accession Number U49186. The donor plasmid pJP113 (linearized with NotI) was used in an in vitro recombination (IVR) test to generate ALVAC recombinant vCP1621 (see Example 7).
Sequence of the Primers
JP787 (SEQ ID NO:17)
CAT-CAT-CAT-GAT-ATC-CGT-TAA-GTT-TGT-ATC-GTA-ATG-ACG-TGG-CCA-AGG-AGG-CG
JP788 (SEQ ID NO:13)
TAC-TAC-TAC-GTC-GAC-TTA-TTT-ATT-TAG-AGG-GTC-TTT-TAG-G
Example 5
Construction of an ALVACC Donor Plasmid for PCV1 RF2 and ORF1
Plasmid pPCV1 (see Example 4 above), containing the PCV1 genome as a PstI fragment in plasmid pGem-7Z, was digested with PstI, and a 1759 bp fragment was isolated and ligated.
Primers JP789 (SEQ ID NO:14) and JP790 (SEQ ID NO:15) were used to amplify PCV1 ORF1 from the 1759 bp ligated PstI fragment (see above), resulting in PCR J1316. Primer JP789 (SEQ ID NO:14) contains the 3′ end of the H6 promoter from NruI and the 5′ end of PCV1 ORF1. Primer JP790 (SEQ ID NO:15) contains the 3′ end of PCV1 ORF1 followed by a SalI site. The product of PCR J1316 (˜1 Kb) was cloned into pCR2.1 (Invitrogen, Carlsbad, Calif.). The resulting plasmid was confirmed by sequence analysis and designated pJP114. The sequence of ORF1 matches sequence available in GenBank, Accession Number U49186. A ˜970 bp NruI/SalI fragment was isolated from pJP114 and cloned into a ˜4.5 kb NruI/SalI fragment from pJP099 (see Example 1), resulting in a plasmid which was confirmed by restriction analysis and designated pJP115. The donor plasmid pJP115 could be used in an in vitro recombination test (described in Example 7) to generate ALVAC recombinant expressing the PCV1 ORF1.
A ˜838 bp BamHI/SalI from pJP113 (see Example 4) was blunted using the Klenow fragment of DNA polymerase, and was cloned into the Klenow-blunted EcoRI site of pJP115. Clones were checked for orientation of insert by restriction analysis and a head-to-head orientation was chosen. This plasmid was confirmed by sequence analysis and designated pJP117. The donor plasmid pJP117 (linearized with NotI) was used in an in vitro recombination (IVR) test to generate the ALVAC recombinant vCP1622 (see Example 7).
Sequence of the Primers
JP789 (SEQ ID NO:18)
CAT-CAT-CAT-TCG-CGA-TAT-CCG-TTA-AGT-TTG-TAT-CGT-AAT-GCC-AAG-CAA-GAA-AAG-CGG
JP790 (SEQ ID NO:19)
TAC-TAC-TAC-GTC-GAC-TCA-GTA-ATT-TAT-TTT-ATA-TGG
Example 6
Generation of ALVAC-PCV2 RECOMBINANTS
Plasmids pJP102 (see Example 2 and FIG. 2) and pJP107 (see Example 3 and FIG. 5) were linearized with NotI and transfected into ALVAC infected primary CEF cells by using the calcium phosphate precipitation method previously described (Panicali and Paoletti, 1982; Piccini et al., 1987). Positive plaques were selected on the basis of hybridization to specific PCV2 radiolabeled probes and subjected to four sequential rounds of plaque purification until a pure population was achieved. One representative plaque from each IVR was then amplified and the resulting ALVAC recombinants were designated vCP1614 and vCP1615. The vCP1614 virus is the result of recombination events between ALVAC and the donor plasmid pJP102, and it contains the PCV2 ORF2 inserted into the ALVAC C6 locus. The vCP1615 virus is the result of recombination events between ALVAC and the donor plasmid pJP107, and it contains the PCV2 ORF2 and ORF1 inserted into the ALVAC C6 locus in a head-to-head orientation.
In a similar fashion, a recombinant ALVAC expressing only PCV2 ORF1 can be generated using the donor plasmid pJP105 described in Example 3.
Immunofluorescence. In order to determine if the PCV2 proteins were expressed in ALVAC recombinant infected Vero cells, immunofluorescence (IF) analysis was performed. Infected Vero cells were washed with PBS 24 hrs after infection (m.o.i. of approx. 10) and fixed with 95% cold aceton for 3 minutes at room temperature. Five monoclonal antibody (MAb) preparations (hybridoma supernatant) specific for PCV2 ORF1 (PCV2 199 1D3GA & PCV2 210 7G5GD) or ORF2 (PCV2 190 4C7CF, PCV2 190 2B1BC & PCV2 190 3A8BC) were used as the first antibody. These specific monoclonal antibodies were obtained from Merial-Lyon. Monoclonal antibodies can also be obtained following the teachings of documents cited herein, e.g. WO-A-99 18214, 1998, French applications Nos. 97/12382, 98/00873, 98/03707, filed Oct. 3, 1997, Jan. 22, 1998, and Mar. 20, 1998, and WO99/29717, incorporated herein by reference. The IF reaction was performed as described by Taylor et al. (1990).
PCV2 specific immunofluorescence with the three ORF2-specific antibodies could be detected in cells infected with vCP1614 and cells infected with vCP1615. PCV2 specific immunofluorescence with the two ORF1 -specific antibodies could be detected in cells infected with vCP1615 only. These results indicated that, as expected, vCP1614 expresses only ORF2, whereas vCP1615 expresses both ORF1 and ORF2. No fluorescence was detected in parental ALVAC infected Vero cells, nor in uninfected Vero cells.
Example 7
Generation of ALVAC-PCV1 Recombinants
Plasmids pJP113 (see Example 4) and pJP117 (see Example 5) were linearized with NotI and transfected into ALVAC infected primary CEF cells by using the calcium phosphate precipitation method previously described (Panicali and Paoletti, 1982; Piccini et al., 1987). Positive plaques were selected on the basis of hybridization to specific PCV1 radiolabeled probes and subjected to four sequential rounds of plaque purification until a pure population was achieved. One representative plaque from each IVR was then amplified and the resulting ALVAC recombinants were designated vCP1621 and vCP1622. The vCP1621 virus is the result of recombination events between ALVAC and the donor plasmid pJP113, and it contains the PCV1 ORF2 inserted into the ALVAC C6 locus. The vCP1622 virus is the result of recombination events between ALVAC and the donor plasmid pJP117, and it contains the PCV1 ORF2 and ORF1 inserted into the ALVAC C6 locus in a head-to-head orientation.
In a similar fashion, a recombinant ALVAC expressing only PCV1 ORF1 can be generated using the donor plasmid pJP115 described in Example 5.
Immunofluorescence. In order to determine if the PCV1 proteins were expressed in ALVAC recombinant infected Vero cells, immunofluorescence (IF) analysis was performed. Infected Vero cells were washed with PBS 24 hrs after infection (m.o.i. of approx. 10) and fixed with 95% cold aceton efor 3 minutes at room temperature. A specific anti-PCV1 pig polyclonal serum (Allan G. et al. Vet. Microbiol. 1999. 66: 115-123) was used as the first antibody. The IF reaction was performed as described by Taylor et al. (1990).
PCV1 specific immunofluorescence could be detected in cells infected with vCP1621 and cells infected with vCP1622. These results indicated that, as expected, vCP1621 and vCP1622 express PCV1-specific products. No fluorescence was detected with a PCV2-specific pig polyclonal serum in cells infected with vCP1621 and in cells infected with vCP1622. No fluorescence was detected in parental ALVAC infected Vero cells, nor in uninfected Vero cells.
Example 8
Formulation of Recombinant Canarypox Viruses with Carbopol™ 974P
For the preparation of vaccines, recombinant canarypox viruses vCP1614 and vCP1615 (Example 6) can be mixed with solutions of carbomer. In the same fashion, recombinant canarypox viruses vCP1621 and vCP1622 (Example 7) can be mixed with solutions of carbomer. The carbomer component used for vaccination of pigs according to the present invention is the Carbopol™ 974P manufactured by the company BF Goodrich (molecular weight of # 3,000,000). A 1.5 % Carbopol™ 974P stock solution is first prepared in distilled water containing 1 g/l of sodium chloride. This stock solution is then used for manufacturing a 4 mg/ml Carbopol™ 974P solution in physiological water. The stock solution is mixed with the required volume of physiological water, either in one step or in several successive steps, adjusting the pH value at each step with a 1N (or more concentrated) sodium hydroxide solution to get a final pH value of 7.3-7.4. This final Carbopol™ 974P solution is a ready-to-use solution for reconstituting a lyophilized recombinant virus or for diluting a concentrated recombinant virus stock. For example, to get a final viral suspension containing 10e8 pfu per dose of 2 ml, one can dilute 0,1 ml of a 10e9 pfU/ml stock solution into 1,9 ml of the above Carbopol™ 974P 4 mg/ml ready-to-use solution. In the same fashion, Carbopol™ 974P 2 mg/ml ready-to-use solutions can also be prepared.
Example 9
Immunization of Pigs and Subsequent Challenge
9.1. Immunization of 1 Day-Old Piglets
Groups of piglets, caesarian-derived at Day 0, are placed into isolators. The piglets are vaccinated by intramuscular route at Day 2 with various vaccine solutions. Vaccine viral suspensions are prepared by dilution of recombinant viruses stocks in sterile physiological water (NaCl 0.9 %). Suitable ranges for viral suspensions can be determined empiracally, but will generally range from 106 to 1010, and preferably about 1010, pfu/dose. Vaccine solutions can also be prepared by mixing the recombinant virus suspension with a solution of Carbopol™ 974P, as described in Example 8.
Piglets are vaccinated either with:
Recombinant virus vCP1614 (Example 2);
Recombinant virus vCP1615 (Example 3);
Recombinant virus vCP1614 mixed with Carbopol (4 mg/ml solution); or
Recombinant virus vCP1615 mixed with Carbopol (4 mg/ml solution).
The viral suspensions contain 108 plaque forming units (pfu) per dose. Each viral suspension is injected by intramuscular route under a volume of 1 ml. The intramuscular injection is administered into the muscles of the neck.
Two injections of viral suspensions are administered at Day 2 and Day 14 of the experiment. A challenge is done on Day 21 by an oronasal administration of a viral suspension prepared from a culture of PCV-2 virulent strain. After challenge, piglets are monitored during 3 weeks for clinical signs specific of the post-weaning multisystemic syndrome. The following signs are scored:
Rectal temperature: daily monitoring for 2 weeks post-challenge, then 2 measures of rectal temperature during the third week.
Weight: piglets are weighed right before the challenge, and then weekly during the first 3 weeks post-challenge.
Blood samples are taken at Day 2, day 14, Day 21, Day 28, Day 35 and Day 42 of the experiment in order to monitor viremia levels and anti-PCV-2 specific antibody titers.
Necropsies: at Day 42, all surviving piglets are humanely euthanized and necropsied to look for specific PWMS macroscopic lesions. Tissue samples are prepared from liver, lymph nodes, spleen, kidneys and thymus in order to look for specific histological lesions.
9.2. Immunization OF 5-7 Week-Old Piglets
5-7 week-old piglets, free of anti-PCV-2 specific maternal antibodies, are vaccinated by intramuscular route with various vaccine solutions. Vaccine viral suspensions are prepared by dilution of recombinant viruses stocks in sterile physiological water (NaCl 0.9%). Vaccine solutions can also be prepared by mixing the recombinant virus suspension with a solution of Carbopol™ 974P, as described in Example 8.
Piglets are vaccinated either with:
Recombinant virus vCP1614 (Example 2);
Recombinant virus vCP1615 (Example 3);
Recombinant virus vCP1614 mixed with Carbopol (4 mg/ml solution); or
Recombinant virus vCP1615 mixed with Carbopol (4 mg/ml solution).
The viral suspensions contain 108 plaque forming units (pfu) per dose. Each viral suspension is injected by intramuscular route under a volume of 2 ml. The intramuscular injection is administered into the muscles of the neck. Two injections of the viral suspensions are administered at Day 0 and Day 21 of the experiment. A challenge is done at Day 35 by an oronasal administration of a viral suspension prepared from a culture of PCV-2 virulent strain. After challenge, piglets are monitored during 8 weeks for clinical signs specific of the post-weaning multisystemic syndrome. The clinical monitoring is identical to the one described in Example 9.1. except that total duration of monitoring is 8 weeks instead of 3 weeks.
Necropsies are done throughout the experiment for piglets dying from the challenge and at the end of the experiment (Day 97) for all surviving piglets. Tissue samples are the same as described in Example 9.1.
9.3. Immunization of Newborn Piglets
Groups of 3 or 4 piglets, caesarian-delivered day Oare placed into isolators. Day 2 the piglets are vaccinated with 108 pfu of vCP1614, vCP1615 or parental ALVAC vector in 1 ml of PBS by intramuscular route on the side of the neck. A second injection of vaccine or placebo is administered at day 14. Vaccination with ALVAC recombinant is well tolerated by piglets and no evidence of adverse reaction to vaccination is noted. The piglets are challenged day 21 by oronasal administration of a PCV-2 viral suspension, 1 ml in each nostril. Day 45 necropsies are performed and samples of tissues are collected for virus isolation. Necropsy results:
PMWS is characterized generally by lymphadenopathy and more rarely by hepatitis or nephritis. So the gross findings in lymph nodes are scored for each piglet in the following manner: 0=no visible enlargement of lymph nodes; 1=mild lymph nodes enlargement, restricted to bronchial lymph nodes; 2=moderate lymph nodes enlargement, restricted to bronchial lymph nodes; 3=severe lymph nodes enlargement, extended to bronchial, submandibullar prescapular and inguinal lymph nodes.
Groups Scores
vCP 1614 0.5
0.0
0.0
1.0
mean 0.38
standard deviation 0.48
vCP 1615 0.0
0.5
0.5
1.0
mean 0.5
standard deviation 0.41
Controls 2.0
2.5
2.5
2.5
mean 2.38
standard deviation 0.25
Bronchial lymphadenopathy for PCV-2 is a prominent gross finding. A significant reduction of the lymph nodes lesion in relation to control group is observed after immunization with vCP 1614 and vCP1615 (p≦0.05).
Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the appended claims is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.
REFERENCES
1. Clark, E. G. Proc. Amer. Assoc. Swine Pract., pp. 499-501 (1997).
2. Edbauer, C., R. Weinberg, J. Taylor, A. Rey-Senelonge, J. F. Bouquet, P. Desmettre and E. Paoletti, Virology 179, 901-904 (1990).
3. Ellis, J., L. Hassard, E. Clark, J. Harding, G. Allan, P. Willson, J. Strakappe, K. Martin, F. McNeilly, B. Meehan, D. Todd, D. Haines, Can. Vet. J. 39, 44-51 (1998).
4. Goebel, S. J., G. P. Johnson, M. E. Perkus, S. W. Davis, J. P. Winslow, E. Paoletti, Virology 179, 247-266, 517-563 (1990).
5. Guo, P., S. Goebel, S. Davis, M. E. Perkus, B. Languet, P. Desmettre, G. Allen, and E. Paoletti, J. Virol. 63, 4189-4198 (1989).
6. Hamel, A. L., L. L. Lin and G. P. S. Nayar, J. Virol. 72, 5262-5267 (1998).
7. Harding J. C., Proc. Am. Assoc. Swine Pract. 28, 503 (1997).
8. Mankertz, A., J. Mankertz, K. Wolf, H.-J. Buhk, Gen. Virol. 79, 381-384 (1998a).
9. Mankertz, J., H.-J. Buhk, G. Blaess, A. Mankertz, Virus Gene 16, 267-276 (1998b).
10. Matthews, R. E. F., Intervirology 17, 42-44 (1982).
11. Meehan, B. M., J. L. Creelan, M. S. McNulty, D. Todd, J. Gen. Virol. 78, 221-227 (1997).
12. Meehan, B. M., F. McNeilly, D. Todd, S. Kennedy, V. A. Jewhurst, J. A. Ellis, L. E. Hassard, E. G. Clark, D. M. Haines, G. M. Allan, J. Gen. Virol. 79, 2171-2179 (1998).
13. Nayar, G. P. S., A. Hamel and L. Lin. Can. Vet. J. 38, 385-386 (1997).
14. Panicali, D. and E. Paoletti, Proc. Natl. Acad. Sci. USA 79, 4927-4931 (1982).
15. Paoletti, E., B. R. Lipinskaks, C. Samsonoff, S. Mercer, and D. Panicali, Proc. Natl. Acad. Sci. U.S.A. 81, 193-197 (1984).
16. Perkus, M. E., K. Limbach, and E. Paoletti, J. Virol. 63, 3829-3836 (1989).
17. Piccini, A., M. E. Perkus, and E. Paoletti, In Methods in Enzymology, Vol. 153, eds. Wu, R., and Grossman, L., (Academic Press) pp. 545-563 (1987).
18. Sambrook, J., E. F. Fritsch, and T. Maniatis, In Molecular cloning: A laboratory manual, 2nd edition, (Cold Spring Harbor Press, NY) (1989).
19. Tartaglia, J., J. Winslow, S. Goebel, G. P. Johnson, J. Taylor, and E. Paoletti, J. Gen. Virol. 71, 1517-1524 (1990).
20. Tartaglia, J., Perkus M E, Taylor J, Norton E K, Audonnet J C, Cox W I, Davis S W, van der Hoeven J, Meignier B, Riviere M, and E. Paoletti, Virology 188, 217-32 (1992).
21. Taylor, J., R. Weinberg, B. Languet, P h. Desmettre and E. Paoletti, Vaccine 6, 497-503 (1988a).
22. Taylor, J. and E. Paoletti, Vaccine 6, 466-468 (1988b).
23. Taylor, J., R. Weinberg, Y. Kawaoka, R. Webster and E. Paoletti, Vaccine 6, 504-508 (1988c).
24. Taylor, J., C. Edbauer, A. Rey-Senelonge, J. F. Bouquet, E. Norton, S. Goebel, P. Desmettre and E. Paoletti, J. Virol. 64, 1441-1450 (1990).
25. Taylor, J., C. Trimarchi, R. Weinberg, B. Languet, F. Guillemin, P. Desmettre and E. Paoletti, Vaccine 9, 190-193 (1991).
26. Taylor J, Weinberg R, Tartaglia J, Richardson C, Alkhatib G, Briedis D, Appel M, Norton E, Paoletti E., Virologyl87, 321-328 (1992).
27. Todd, D., F. D. Niagro, B. W. Ritchie, W. Curran, G. M. Allan, P. D. Lukert, K. S. Latimer, W. L. Steffens, M. S. McNulty, Arch. Virol. 117, 129-135 (1991).
19 1 3701 DNA Canarypox virus CDS (377)..(2251) 1 aagcttctat caaaagtctt aatgagttag gtgtagatag tatagatatt actacaaagg 60 tattcatatt tcctatcaat tctaaagtag atgatattaa taactcaaag atgatgatag 120 tagataatag atacgctcat ataatgactg caaatttgga cggttcacat tttaatcatc 180 acgcgttcat aagtttcaac tgcatagatc aaaatctcac taaaaagata gccgatgtat 240 ttgagagaga ttggacatct aactacgcta aagaaattac agttataaat aatacataat 300 ggattttgtt atcatcagtt atatttaaca taagtacaat aaaaagtatt aaataaaaat 360 acttacttac gaaaaa atg tca tta tta caa aaa cta tat ttt aca gaa caa 412 Met Ser Leu Leu Gln Lys Leu Tyr Phe Thr Glu Gln 1 5 10 tct ata gta gag tcc ttt aag agt tat aat tta aaa gat aac cat aat 460 Ser Ile Val Glu Ser Phe Lys Ser Tyr Asn Leu Lys Asp Asn His Asn 15 20 25 gta ata ttt acc aca tca gat gat gat act gtt gta gta ata aat gaa 508 Val Ile Phe Thr Thr Ser Asp Asp Asp Thr Val Val Val Ile Asn Glu 30 35 40 gat aat gta ctg tta tct aca aga tta tta tca ttt gat aaa att ctg 556 Asp Asn Val Leu Leu Ser Thr Arg Leu Leu Ser Phe Asp Lys Ile Leu 45 50 55 60 ttt ttt aac tcc ttt aat aac ggt tta tca aaa tac gaa act att agt 604 Phe Phe Asn Ser Phe Asn Asn Gly Leu Ser Lys Tyr Glu Thr Ile Ser 65 70 75 gat aca ata tta gat ata gat act cat aat tat tat ata cct agt tct 652 Asp Thr Ile Leu Asp Ile Asp Thr His Asn Tyr Tyr Ile Pro Ser Ser 80 85 90 tct tct ttg tta gat att cta aaa aaa aga gcg tgt gat tta gaa tta 700 Ser Ser Leu Leu Asp Ile Leu Lys Lys Arg Ala Cys Asp Leu Glu Leu 95 100 105 gaa gat cta aat tat gcg tta ata gga gac aat agt aac tta tat tat 748 Glu Asp Leu Asn Tyr Ala Leu Ile Gly Asp Asn Ser Asn Leu Tyr Tyr 110 115 120 aaa gat atg act tac atg aat aat tgg tta ttt act aaa gga tta tta 796 Lys Asp Met Thr Tyr Met Asn Asn Trp Leu Phe Thr Lys Gly Leu Leu 125 130 135 140 gat tac aag ttt gta tta ttg cgc gat gta gat aaa tgt tac aaa cag 844 Asp Tyr Lys Phe Val Leu Leu Arg Asp Val Asp Lys Cys Tyr Lys Gln 145 150 155 tat aat aaa aag aat act ata ata gat ata ata cat cgc gat aac aga 892 Tyr Asn Lys Lys Asn Thr Ile Ile Asp Ile Ile His Arg Asp Asn Arg 160 165 170 cag tat aac ata tgg gtt aaa aat gtt ata gaa tac tgt tct cct ggc 940 Gln Tyr Asn Ile Trp Val Lys Asn Val Ile Glu Tyr Cys Ser Pro Gly 175 180 185 tat ata tta tgg tta cat gat cta aaa gcc gct gct gaa gat gat tgg 988 Tyr Ile Leu Trp Leu His Asp Leu Lys Ala Ala Ala Glu Asp Asp Trp 190 195 200 tta aga tac gat aac cgt ata aac gaa tta tct gcg gat aaa tta tac 1036 Leu Arg Tyr Asp Asn Arg Ile Asn Glu Leu Ser Ala Asp Lys Leu Tyr 205 210 215 220 act ttc gag ttc ata gtt ata tta gaa aat aat ata aaa cat tta cga 1084 Thr Phe Glu Phe Ile Val Ile Leu Glu Asn Asn Ile Lys His Leu Arg 225 230 235 gta ggt aca ata att gta cat cca aac aag ata ata gct aat ggt aca 1132 Val Gly Thr Ile Ile Val His Pro Asn Lys Ile Ile Ala Asn Gly Thr 240 245 250 tct aat aat ata ctt act gat ttt cta tct tac gta gaa gaa cta ata 1180 Ser Asn Asn Ile Leu Thr Asp Phe Leu Ser Tyr Val Glu Glu Leu Ile 255 260 265 tat cat cat aat tca tct ata ata ttg gcc gga tat ttt tta gaa ttc 1228 Tyr His His Asn Ser Ser Ile Ile Leu Ala Gly Tyr Phe Leu Glu Phe 270 275 280 ttt gag acc act att tta tca gaa ttt att tct tca tct tct gaa tgg 1276 Phe Glu Thr Thr Ile Leu Ser Glu Phe Ile Ser Ser Ser Ser Glu Trp 285 290 295 300 gta atg aat agt aac tgt tta gta cac ctg aaa aca ggg tat gaa gct 1324 Val Met Asn Ser Asn Cys Leu Val His Leu Lys Thr Gly Tyr Glu Ala 305 310 315 ata ctc ttt gat gct agt tta ttt ttc caa ctc tct act aaa agc aat 1372 Ile Leu Phe Asp Ala Ser Leu Phe Phe Gln Leu Ser Thr Lys Ser Asn 320 325 330 tat gta aaa tat tgg aca aag aaa act ttg cag tat aag aac ttt ttt 1420 Tyr Val Lys Tyr Trp Thr Lys Lys Thr Leu Gln Tyr Lys Asn Phe Phe 335 340 345 aaa gac ggt aaa cag tta gca aaa tat ata att aag aaa gat agt cag 1468 Lys Asp Gly Lys Gln Leu Ala Lys Tyr Ile Ile Lys Lys Asp Ser Gln 350 355 360 gtg ata gat aga gta tgt tat tta cac gca gct gta tat aat cac gta 1516 Val Ile Asp Arg Val Cys Tyr Leu His Ala Ala Val Tyr Asn His Val 365 370 375 380 act tac tta atg gat acg ttt aaa att cct ggt ttt gat ttt aaa ttc 1564 Thr Tyr Leu Met Asp Thr Phe Lys Ile Pro Gly Phe Asp Phe Lys Phe 385 390 395 tcc gga atg ata gat ata cta ctg ttt gga ata ttg cat aag gat aat 1612 Ser Gly Met Ile Asp Ile Leu Leu Phe Gly Ile Leu His Lys Asp Asn 400 405 410 gag aat ata ttt tat ccg aaa cgt gtt tct gta act aat ata ata tca 1660 Glu Asn Ile Phe Tyr Pro Lys Arg Val Ser Val Thr Asn Ile Ile Ser 415 420 425 gaa tct atc tat gca gat ttt tac ttt ata tca gat gtt aat aaa ttc 1708 Glu Ser Ile Tyr Ala Asp Phe Tyr Phe Ile Ser Asp Val Asn Lys Phe 430 435 440 agt aaa aag ata gaa tat aaa act atg ttt cct ata ctc gca gaa aac 1756 Ser Lys Lys Ile Glu Tyr Lys Thr Met Phe Pro Ile Leu Ala Glu Asn 445 450 455 460 tac tat cca aaa gga agg ccc tat ttt aca cat aca tct aac gaa gat 1804 Tyr Tyr Pro Lys Gly Arg Pro Tyr Phe Thr His Thr Ser Asn Glu Asp 465 470 475 ctt ctg tct atc tgt tta tgc gaa gta aca gtt tgt aaa gat ata aaa 1852 Leu Leu Ser Ile Cys Leu Cys Glu Val Thr Val Cys Lys Asp Ile Lys 480 485 490 aat cca tta tta tat tct aaa aag gat ata tca gca aaa cga ttc ata 1900 Asn Pro Leu Leu Tyr Ser Lys Lys Asp Ile Ser Ala Lys Arg Phe Ile 495 500 505 ggt tta ttt aca tct gtc gat ata aat acg gct gtt gag tta aga gga 1948 Gly Leu Phe Thr Ser Val Asp Ile Asn Thr Ala Val Glu Leu Arg Gly 510 515 520 tat aaa ata aga gta ata gga tgt tta gaa tgg cct gaa aag ata aaa 1996 Tyr Lys Ile Arg Val Ile Gly Cys Leu Glu Trp Pro Glu Lys Ile Lys 525 530 535 540 ata ttt aat tct aat cct aca tac att aga tta tta cta aca gaa aga 2044 Ile Phe Asn Ser Asn Pro Thr Tyr Ile Arg Leu Leu Leu Thr Glu Arg 545 550 555 cgt tta gat att cta cat tcc tat ctg ctt aaa ttt aat ata aca gag 2092 Arg Leu Asp Ile Leu His Ser Tyr Leu Leu Lys Phe Asn Ile Thr Glu 560 565 570 gat ata gct acc aga gat gga gtc aga aat aat tta cct ata att tct 2140 Asp Ile Ala Thr Arg Asp Gly Val Arg Asn Asn Leu Pro Ile Ile Ser 575 580 585 ttt atc gtc agt tat tgt aga tcg tat act tat aaa tta cta aat tgc 2188 Phe Ile Val Ser Tyr Cys Arg Ser Tyr Thr Tyr Lys Leu Leu Asn Cys 590 595 600 cat atg tac aat tcg tgt aag ata aca aag tgt aaa tat aat cag gta 2236 His Met Tyr Asn Ser Cys Lys Ile Thr Lys Cys Lys Tyr Asn Gln Val 605 610 615 620 ata tat aat cct ata taggagtata tataattgaa aaagtaaaat ataaatcata 2291 Ile Tyr Asn Pro Ile 625 taataatgaa acgaaatatc agtaatagac aggaactggc agattcttct tctaatgaag 2351 taagtactgc taaatctcca aaattagata aaaatgatac agcaaataca gcttcattca 2411 acgaattacc ttttaatttt ttcagacaca ccttattaca aactaactaa gtcagatgat 2471 gagaaagtaa atataaattt aacttatggg tataatataa taaagattca tgatattaat 2531 aatttactta acgatgttaa tagacttatt ccatcaaccc cttcaaacct ttctggatat 2591 tataaaatac cagttaatga tattaaaata gattgtttaa gagatgtaaa taattatttg 2651 gaggtaaagg atataaaatt agtctatctt tcacatggaa atgaattacc taatattaat 2711 aattatgata ggaatttttt aggatttaca gctgttatat gtatcaacaa tacaggcaga 2771 tctatggtta tggtaaaaca ctgtaacggg aagcagcatt ctatggtaac tggcctatgt 2831 ttaatagcca gatcatttta ctctataaac attttaccac aaataatagg atcctctaga 2891 tatttaatat tatatctaac aacaacaaaa aaatttaacg atgtatggcc agaagtattt 2951 tctactaata aagataaaga tagtctatct tatctacaag atatgaaaga agataatcat 3011 ttagtagtag ctactaatat ggaaagaaat gtatacaaaa acgtggaagc ttttatatta 3071 aatagcatat tactagaaga tttaaaatct agacttagta taacaaaaca gttaaatgcc 3131 aatatcgatt ctatatttca tcataacagt agtacattaa tcagtgatat actgaaacga 3191 tctacagact caactatgca aggaataagc aatatgccaa ttatgtctaa tattttaact 3251 ttagaactaa aacgttctac caatactaaa aataggatac gtgataggct gttaaaagct 3311 gcaataaata gtaaggatgt agaagaaata ctttgttcta taccttcgga ggaaagaact 3371 ttagaacaac ttaagtttaa tcaaacttgt atttatgaac actataaaaa aattatggaa 3431 gatacaagta aaagaatgga tgttgaatgt cgtagtttag aacataacta tacggctaac 3491 ttatataaag tgtacggaca aaacgaatat atgattactt atatactagc tctcataagt 3551 aggattaata atattataga aactttaaaa tataatctgg tggggctaga cgaatctaca 3611 atacgtaata taaattatat aatttcacaa agaacaaaaa aaaatcaagt ttctaatacc 3671 ttatagataa actatatttt ttaccactga 3701 2 625 PRT Canarypox virus 2 Met Ser Leu Leu Gln Lys Leu Tyr Phe Thr Glu Gln Ser Ile Val Glu 1 5 10 15 Ser Phe Lys Ser Tyr Asn Leu Lys Asp Asn His Asn Val Ile Phe Thr 20 25 30 Thr Ser Asp Asp Asp Thr Val Val Val Ile Asn Glu Asp Asn Val Leu 35 40 45 Leu Ser Thr Arg Leu Leu Ser Phe Asp Lys Ile Leu Phe Phe Asn Ser 50 55 60 Phe Asn Asn Gly Leu Ser Lys Tyr Glu Thr Ile Ser Asp Thr Ile Leu 65 70 75 80 Asp Ile Asp Thr His Asn Tyr Tyr Ile Pro Ser Ser Ser Ser Leu Leu 85 90 95 Asp Ile Leu Lys Lys Arg Ala Cys Asp Leu Glu Leu Glu Asp Leu Asn 100 105 110 Tyr Ala Leu Ile Gly Asp Asn Ser Asn Leu Tyr Tyr Lys Asp Met Thr 115 120 125 Tyr Met Asn Asn Trp Leu Phe Thr Lys Gly Leu Leu Asp Tyr Lys Phe 130 135 140 Val Leu Leu Arg Asp Val Asp Lys Cys Tyr Lys Gln Tyr Asn Lys Lys 145 150 155 160 Asn Thr Ile Ile Asp Ile Ile His Arg Asp Asn Arg Gln Tyr Asn Ile 165 170 175 Trp Val Lys Asn Val Ile Glu Tyr Cys Ser Pro Gly Tyr Ile Leu Trp 180 185 190 Leu His Asp Leu Lys Ala Ala Ala Glu Asp Asp Trp Leu Arg Tyr Asp 195 200 205 Asn Arg Ile Asn Glu Leu Ser Ala Asp Lys Leu Tyr Thr Phe Glu Phe 210 215 220 Ile Val Ile Leu Glu Asn Asn Ile Lys His Leu Arg Val Gly Thr Ile 225 230 235 240 Ile Val His Pro Asn Lys Ile Ile Ala Asn Gly Thr Ser Asn Asn Ile 245 250 255 Leu Thr Asp Phe Leu Ser Tyr Val Glu Glu Leu Ile Tyr His His Asn 260 265 270 Ser Ser Ile Ile Leu Ala Gly Tyr Phe Leu Glu Phe Phe Glu Thr Thr 275 280 285 Ile Leu Ser Glu Phe Ile Ser Ser Ser Ser Glu Trp Val Met Asn Ser 290 295 300 Asn Cys Leu Val His Leu Lys Thr Gly Tyr Glu Ala Ile Leu Phe Asp 305 310 315 320 Ala Ser Leu Phe Phe Gln Leu Ser Thr Lys Ser Asn Tyr Val Lys Tyr 325 330 335 Trp Thr Lys Lys Thr Leu Gln Tyr Lys Asn Phe Phe Lys Asp Gly Lys 340 345 350 Gln Leu Ala Lys Tyr Ile Ile Lys Lys Asp Ser Gln Val Ile Asp Arg 355 360 365 Val Cys Tyr Leu His Ala Ala Val Tyr Asn His Val Thr Tyr Leu Met 370 375 380 Asp Thr Phe Lys Ile Pro Gly Phe Asp Phe Lys Phe Ser Gly Met Ile 385 390 395 400 Asp Ile Leu Leu Phe Gly Ile Leu His Lys Asp Asn Glu Asn Ile Phe 405 410 415 Tyr Pro Lys Arg Val Ser Val Thr Asn Ile Ile Ser Glu Ser Ile Tyr 420 425 430 Ala Asp Phe Tyr Phe Ile Ser Asp Val Asn Lys Phe Ser Lys Lys Ile 435 440 445 Glu Tyr Lys Thr Met Phe Pro Ile Leu Ala Glu Asn Tyr Tyr Pro Lys 450 455 460 Gly Arg Pro Tyr Phe Thr His Thr Ser Asn Glu Asp Leu Leu Ser Ile 465 470 475 480 Cys Leu Cys Glu Val Thr Val Cys Lys Asp Ile Lys Asn Pro Leu Leu 485 490 495 Tyr Ser Lys Lys Asp Ile Ser Ala Lys Arg Phe Ile Gly Leu Phe Thr 500 505 510 Ser Val Asp Ile Asn Thr Ala Val Glu Leu Arg Gly Tyr Lys Ile Arg 515 520 525 Val Ile Gly Cys Leu Glu Trp Pro Glu Lys Ile Lys Ile Phe Asn Ser 530 535 540 Asn Pro Thr Tyr Ile Arg Leu Leu Leu Thr Glu Arg Arg Leu Asp Ile 545 550 555 560 Leu His Ser Tyr Leu Leu Lys Phe Asn Ile Thr Glu Asp Ile Ala Thr 565 570 575 Arg Asp Gly Val Arg Asn Asn Leu Pro Ile Ile Ser Phe Ile Val Ser 580 585 590 Tyr Cys Arg Ser Tyr Thr Tyr Lys Leu Leu Asn Cys His Met Tyr Asn 595 600 605 Ser Cys Lys Ile Thr Lys Cys Lys Tyr Asn Gln Val Ile Tyr Asn Pro 610 615 620 Ile 625 3 42 DNA Canarypox virus 3 atcatcgagc tcgcggccgc ctatcaaaag tcttaatgag tt 42 4 73 DNA Canarypox virus 4 gaattcctcg agctgcagcc cgggttttta tagctaatta gtcatttttt cgtaagtaag 60 tatttttatt taa 73 5 72 DNA Canarypox virus 5 cccgggctgc agctcgagga attcttttta ttgattaact agtcaaatga gtatatataa 60 ttgaaaaagt aa 72 6 45 DNA Canarypox virus 6 gatgatggta ccttcataaa tacaagtttg attaaactta agttg 45 7 53 DNA Canarypox virus 7 catcatcatg atatccgtta agtttgtatc gtaatgacgt atccaaggag gcg 53 8 36 DNA ALVAC 8 tactactacg tcgacttagg gtttaagtgg ggggtc 36 9 2520 DNA ALVAC CDS (1402)..(2100) 9 ggtaccttca taaatacaag tttgattaaa cttaagttgt tctaaagttc tttcctccga 60 aggtatagaa caaagtattt cttctacatc cttactattt attgcagctt ttaacagcct 120 atcacgtatc ctatttttag tattggtaga acgttttagt tctaaagtta aaatattaga 180 cataattggc atattgctta ttccttgcat agttgagtct gtagatcgtt tcagtatatc 240 actgattaat gtactactgt tatgatgaaa tatagaatcg atattggcat ttaactgttt 300 tgttatacta agtctagatt ttaaatcttc tagtaatatg ctatttaata taaaagcttc 360 cacgtttttg tatacatttc tttccatatt agtagctact actaaatgat tatcttcttt 420 catatcttgt agataagata gactatcttt atctttatta gtagaaaata cttctggcca 480 tacatcgtta aatttttttg ttgttgttag atataatatt aaatatctag aggatcctat 540 tatttgtggt aaaatgttta tagagtaaaa tgatctggct attaaacata ggccagttac 600 catagaatgc tgcttcccgt tacagtgttt taccataacc atagatctgc ctgtattgtt 660 gatacatata acagctgtaa atcctaaaaa attcctatca taattattaa tattaggtaa 720 ttcatttcca tgtgaaagat agactaattt tatatccttt acctccaaat aattatttac 780 atctcttaaa caatctattt taatatcatt aactggtatt ttataatatc cagaaaggtt 840 tgaaggggtt gatggaataa gtctattaac atcgttaagt aaattattaa tatcatgaat 900 ctttattata ttatacccat aagttaaatt tatatttact ttctcatcat ctgacttagt 960 tagtttgtaa taaggtgtgt ctgaaaaaat taaaaggtaa ttcgttgaat gaagctgtat 1020 ttgctgtatc atttttatct aattttggag atttagcagt acttacttca ttagaagaag 1080 aatctgccag ttcctgtcta ttactgatat ttcgtttcat tattatatga tttatatttt 1140 actttttcaa ttatatatac tcatttgact agttaatcaa taaaaagaat tcctgcagcc 1200 ctgcagctaa ttaattaagc tacaaatagt ttcgttttca ccttgtctaa taactaatta 1260 attaaggatc ccccagcttc tttattctat acttaaaaag tgaaaataaa tacaaaggtt 1320 cttgagggtt gtgttaaatt gaaagcgaga aataatcata aattatttca ttatcgcgat 1380 atccgttaag tttgtatcgt a atg acg tat cca agg agg cgt tac cgc aga 1431 Met Thr Tyr Pro Arg Arg Arg Tyr Arg Arg 1 5 10 aga aga cac cgc ccc cgc agc cat ctt ggc cag atc ctc cgc cgc cgc 1479 Arg Arg His Arg Pro Arg Ser His Leu Gly Gln Ile Leu Arg Arg Arg 15 20 25 ccc tgg ctc gtc cac ccc cgc cac cgc tac cgt tgg aga agg aaa aat 1527 Pro Trp Leu Val His Pro Arg His Arg Tyr Arg Trp Arg Arg Lys Asn 30 35 40 ggc atc ttc aac acc cgc ctc tcc cgc acc ttc gga tat act gtc aag 1575 Gly Ile Phe Asn Thr Arg Leu Ser Arg Thr Phe Gly Tyr Thr Val Lys 45 50 55 cgt acc aca gtc aca acg ccc tcc tgg gcg gtg gac atg atg aga ttt 1623 Arg Thr Thr Val Thr Thr Pro Ser Trp Ala Val Asp Met Met Arg Phe 60 65 70 aaa att gac gac ttt gtt ccc ccg gga ggg ggg acc aac aaa atc tct 1671 Lys Ile Asp Asp Phe Val Pro Pro Gly Gly Gly Thr Asn Lys Ile Ser 75 80 85 90 ata ccc ttt gaa tac tac aga ata aga aag gtt aag gtt gaa ttc tgg 1719 Ile Pro Phe Glu Tyr Tyr Arg Ile Arg Lys Val Lys Val Glu Phe Trp 95 100 105 ccc tgc tcc ccc atc acc cag ggt gat agg gga gtg ggc tcc act gct 1767 Pro Cys Ser Pro Ile Thr Gln Gly Asp Arg Gly Val Gly Ser Thr Ala 110 115 120 gtt att cta gat gat aac ttt gta aca aag gcc aca gcc cta acc tat 1815 Val Ile Leu Asp Asp Asn Phe Val Thr Lys Ala Thr Ala Leu Thr Tyr 125 130 135 gac cca tat gta aac tac tcc tcc cgc cat aca atc ccc caa ccc ttc 1863 Asp Pro Tyr Val Asn Tyr Ser Ser Arg His Thr Ile Pro Gln Pro Phe 140 145 150 tcc tac cac tcc cgt tac ttc aca ccc aaa cct gtt ctt gac tcc act 1911 Ser Tyr His Ser Arg Tyr Phe Thr Pro Lys Pro Val Leu Asp Ser Thr 155 160 165 170 att gat tac ttc caa cca aat aac aaa agg aat cag ctt tgg ctg aga 1959 Ile Asp Tyr Phe Gln Pro Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg 175 180 185 cta caa acc tct gga aat gtg gac cac gta ggc ctc ggc gct gcg ttc 2007 Leu Gln Thr Ser Gly Asn Val Asp His Val Gly Leu Gly Ala Ala Phe 190 195 200 gaa aac agt aaa tac gac cag gac tac aat atc cgt gta acc atg tat 2055 Glu Asn Ser Lys Tyr Asp Gln Asp Tyr Asn Ile Arg Val Thr Met Tyr 205 210 215 gta caa ttc aga gaa ttt aat ctt aaa gac ccc cca ctt aaa ccc 2100 Val Gln Phe Arg Glu Phe Asn Leu Lys Asp Pro Pro Leu Lys Pro 220 225 230 taagtcgacc ccgggttttt atagctaatt agtcattttt tcgtaagtaa gtatttttat 2160 ttaatacttt ttattgtact tatgttaaat ataactgatg ataacaaaat ccattatgta 2220 ttatttataa ctgtaatttc tttagcgtag ttagatgtcc aatctctctc aaatacatcg 2280 gctatctttt tagtgagatt ttgatctatg cagttgaaac ttatgaacgc gtgatgatta 2340 aaatgtgaac cgtccaaatt tgcagtcatt atatgagcgt atctattatc tactatcatc 2400 atctttgagt tattaatatc atctacttta gaattgatag gaaatatgaa tacctttgta 2460 gtaatatcta tactatctac acctaactca ttaagacttt tgataggcgg ccgcgagctc 2520 10 233 PRT ALVAC 10 Met Thr Tyr Pro Arg Arg Arg Tyr Arg Arg Arg Arg His Arg Pro Arg 1 5 10 15 Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro 20 25 30 Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg 35 40 45 Leu Ser Arg Thr Phe Gly Tyr Thr Val Lys Arg Thr Thr Val Thr Thr 50 55 60 Pro Ser Trp Ala Val Asp Met Met Arg Phe Lys Ile Asp Asp Phe Val 65 70 75 80 Pro Pro Gly Gly Gly Thr Asn Lys Ile Ser Ile Pro Phe Glu Tyr Tyr 85 90 95 Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr 100 105 110 Gln Gly Asp Arg Gly Val Gly Ser Thr Ala Val Ile Leu Asp Asp Asn 115 120 125 Phe Val Thr Lys Ala Thr Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr 130 135 140 Ser Ser Arg His Thr Ile Pro Gln Pro Phe Ser Tyr His Ser Arg Tyr 145 150 155 160 Phe Thr Pro Lys Pro Val Leu Asp Ser Thr Ile Asp Tyr Phe Gln Pro 165 170 175 Asn Asn Lys Arg Asn Gln Leu Trp Leu Arg Leu Gln Thr Ser Gly Asn 180 185 190 Val Asp His Val Gly Leu Gly Ala Ala Phe Glu Asn Ser Lys Tyr Asp 195 200 205 Gln Asp Tyr Asn Ile Arg Val Thr Met Tyr Val Gln Phe Arg Glu Phe 210 215 220 Asn Leu Lys Asp Pro Pro Leu Lys Pro 225 230 11 57 DNA ALVAC 11 catcatcatt cgcgatatcc gttaagtttg tatcgtaatg cccagcaaga agaatgg 57 12 36 DNA ALVAC 12 tactactacg tcgactcagt aatttatttc atatgg 36 13 3609 DNA ALVAC 13 ggtaccttca taaatacaag tttgattaaa cttaagttgt tctaaagttc tttcctccga 60 aggtatagaa caaagtattt cttctacatc cttactattt attgcagctt ttaacagcct 120 atcacgtatc ctatttttag tattggtaga acgttttagt tctaaagtta aaatattaga 180 cataattggc atattgctta ttccttgcat agttgagtct gtagatcgtt tcagtatatc 240 actgattaat gtactactgt tatgatgaaa tatagaatcg atattggcat ttaactgttt 300 tgttatacta agtctagatt ttaaatcttc tagtaatatg ctatttaata taaaagcttc 360 cacgtttttg tatacatttc tttccatatt agtagctact actaaatgat tatcttcttt 420 catatcttgt agataagata gactatcttt atctttatta gtagaaaata cttctggcca 480 tacatcgtta aatttttttg ttgttgttag atataatatt aaatatctag aggatcctat 540 tatttgtggt aaaatgttta tagagtaaaa tgatctggct attaaacata ggccagttac 600 catagaatgc tgcttcccgt tacagtgttt taccataacc atagatctgc ctgtattgtt 660 gatacatata acagctgtaa atcctaaaaa attcctatca taattattaa tattaggtaa 720 ttcatttcca tgtgaaagat agactaattt tatatccttt acctccaaat aattatttac 780 atctcttaaa caatctattt taatatcatt aactggtatt ttataatatc cagaaaggtt 840 tgaaggggtt gatggaataa gtctattaac atcgttaagt aaattattaa tatcatgaat 900 ctttattata ttatacccat aagttaaatt tatatttact ttctcatcat ctgacttagt 960 tagtttgtaa taaggtgtgt ctgaaaaaat taaaaggtaa ttcgttgaat gaagctgtat 1020 ttgctgtatc atttttatct aattttggag atttagcagt acttacttca ttagaagaag 1080 aatctgccag ttcctgtcta ttactgatat ttcgtttcat tattatatga tttatatttt 1140 actttttcaa ttatatatac tcatttgact agttaatcaa taaaaagaat ttcgacttag 1200 ggtttaagtg gggggtcttt aagattaaat tctctgaatt gtacatacat ggttacacgg 1260 atattgtagt cctggtcgta tttactgttt tcgaacgcag cgccgaggcc tacgtggtcc 1320 acatttccag aggtttgtag tctcagccaa agctgattcc ttttgttatt tggttggaag 1380 taatcaatag tggagtcaag aacaggtttg ggtgtgaagt aacgggagtg gtaggagaag 1440 ggttggggga ttgtatggcg ggaggagtag tttacatatg ggtcataggt tagggctgtg 1500 gcctttgtta caaagttatc atctagaata acagcagtgg agcccactcc cctatcaccc 1560 tgggtgatgg gggagcaggg ccagaattca accttaacct ttcttattct gtagtattca 1620 aagggtatag agattttgtt ggtcccccct cccgggggaa caaagtcgtc aattttaaat 1680 ctcatcatgt ccaccgccca ggagggcgtt gtgactgtgg tacgcttgac agtatatccg 1740 aaggtgcggg agaggcgggt gttgaagatg ccatttttcc ttctccaacg gtagcggtgg 1800 cgggggtgga cgagccaggg gcggcggcgg aggatctggc caagatggct gcgggggcgg 1860 tgtcttcttc tgcggtaacg cctccttgga tacgtcatta cgatacaaac ttaacggata 1920 tcgcgataat gaaataattt atgattattt ctcgctttca atttaacaca accctcaaga 1980 acctttgtat ttattttcac tttttaagta tagaataaag aagctggggg atcaattcct 2040 gcagccctgc agctaattaa ttaagctaca aatagtttcg ttttcacctt gtctaataac 2100 taattaatta aggatccccc agcttcttta ttctatactt aaaaagtgaa aataaataca 2160 aaggttcttg agggttgtgt taaattgaaa gcgagaaata atcataaatt atttcattat 2220 cgcgatatcc gttaagtttg tatcgtaatg cccagcaaga agaatggaag aagcggaccc 2280 caaccacata aaaggtgggt gttcacgctg aataatcctt ccgaagacga gcgcaagaaa 2340 atacgggagc tcccaatctc cctatttgat tattttattg ttggcgagga gggtaatgag 2400 gaaggacgaa cacctcacct ccaggggttc gctaattttg tgaagaagca aacttttaat 2460 aaagtgaagt ggtatttggg tgcccgctgc cacatcgaga aagccaaagg aactgatcag 2520 cagaataaag aatattgcag taaagaaggc aacttactta ttgaatgtgg agctcctcga 2580 tctcaaggac aacggagtga cctgtctact gctgtgagta ccttgttgga gagcgggagt 2640 ctggtgaccg ttgcagagca gcaccctgta acgtttgtca gaaatttccg cgggctggct 2700 gaacttttga aagtgagcgg gaaaatgcag aagcgtgatt ggaagaccaa tgtacacgtc 2760 attgtggggc cacctgggtg tggtaaaagc aaatgggctg ctaattttgc agacccggaa 2820 accacatact ggaaaccacc tagaaacaag tggtgggatg gttaccatgg tgaagaagtg 2880 gttgttattg atgactttta tggctggctg ccgtgggatg atctactgag actgtgtgat 2940 cgatatccat tgactgtaga gactaaaggt ggaactgtac cttttttggc ccgcagtatt 3000 ctgattacca gcaatcagac cccgttggaa tggtactcct caactgctgt cccagctgta 3060 gaagctctct atcggaggat tacttccttg gtattttgga agaatgctac agaacaatcc 3120 acggaggaag ggggccagtt cgtcaccctt tcccccccat gccctgaatt tccatatgaa 3180 ataaattact gagtcgaccc cgggttttta tagctaatta gtcatttttt cgtaagtaag 3240 tatttttatt taatactttt tattgtactt atgttaaata taactgatga taacaaaatc 3300 cattatgtat tatttataac tgtaatttct ttagcgtagt tagatgtcca atctctctca 3360 aatacatcgg ctatcttttt agtgagattt tgatctatgc agttgaaact tatgaacgcg 3420 tgatgattaa aatgtgaacc gtccaaattt gcagtcatta tatgagcgta tctattatct 3480 actatcatca tctttgagtt attaatatca tctactttag aattgatagg aaatatgaat 3540 acctttgtag taatatctat actatctaca cctaactcat taagactttt gataggcggc 3600 cgcgagctc 3609 14 236 PRT ALVAC 14 Pro Lys Leu Pro Pro Asp Lys Leu Asn Phe Glu Arg Phe Gln Val Tyr 1 5 10 15 Met Thr Val Arg Ile Asn Tyr Asp Gln Asp Tyr Lys Ser Asn Glu Phe 20 25 30 Ala Ala Tyr Leu Tyr Val His Asp Val His Asp Val Asn Tyr Ser Thr 35 40 45 Gln Leu Arg Leu Trp Leu Gln Asn Arg Lys Asn Asn Pro Gln Phe Tyr 50 55 60 Asp Ile Thr Ser Asp Leu Val Pro Lys Pro Thr Phe Tyr Arg Ser His 65 70 75 80 Tyr Ser Phe Pro Gln Pro Ile Thr His Arg Ser Ser Tyr Gln Val Tyr 85 90 95 Pro Asp Tyr Thr Leu Ala Thr Ala Lys Thr Val Phe Gln Asp Asp Leu 100 105 110 Ile Val Ala Thr Ser Gly Val Gly Arg Asp Gly Gln Thr Ile Pro Ser 115 120 125 Cys Pro Trp Phe Glu Val Lys Val Lys Arg Ile Arg Tyr Tyr Glu Phe 130 135 140 Pro Ile Ser Ile Lys Gln Thr Gly Gly Gly Pro Pro Val Phe Asp Asp 145 150 155 160 Ile Lys Phe Arg Met Met Asp Val Ala Trp Ser Pro Thr Thr Val Thr 165 170 175 Thr Arg Lys Val Thr Tyr Gly Phe Thr Arg Ser Leu Arg Thr Asn Phe 180 185 190 Ile Gly Asn Lys Arg Arg Trp Arg Tyr Arg His Arg Pro His Val Leu 195 200 205 Trp Pro Arg Arg Arg Leu Ile Gln Gly Leu His Ser Arg Pro Arg His 210 215 220 Arg Arg Arg Arg Tyr Arg Arg Arg Pro Tyr Thr Met 225 230 235 15 314 PRT ALVAC 15 Met Pro Ser Lys Lys Gln Gly Arg Ser Gly Pro Gln Pro His Lys Arg 1 5 10 15 Trp Val Phe Thr Leu Asn Asn Pro Ser Glu Asp Glu Arg Lys Lys Ile 20 25 30 Arg Glu Leu Pro Ile Ser Leu Phe Asp Tyr Phe Ile Val Gly Glu Glu 35 40 45 Gly Asn Glu Glu Gly Arg Thr Pro His Leu Gln Gly Phe Ala Asn Phe 50 55 60 Val Lys Lys Gln Thr Phe Asn Lys Val Lys Arg Tyr Leu Gly Ala Arg 65 70 75 80 Cys His Ile Glu Lys Ala Lys Gly Thr Asp Gln Gln Asn Lys Glu Tyr 85 90 95 Cys Ser Lys Glu Gly Asn Leu Leu Ile Glu Cys Gly Ala Pro Arg Ser 100 105 110 Gln Gly Gln Arg Ser Asp Leu Ser Thr Ala Val Ser Thr Leu Leu Glu 115 120 125 Ser Gly Ser Leu Val Thr Val Ala Glu Gln His Pro Val Thr Phe Val 130 135 140 Arg Asn Phe Arg Gly Leu Ala Glu Leu Leu Lys Val Ser Gly Lys Met 145 150 155 160 Gln Lys Arg Asp Trp Lys Thr Asn Val His Val Ile Val Gly Pro Pro 165 170 175 Gly Cys Gly Lys Ser Lys Trp Ala Ala Asn Phe Ala Asp Pro Glu Thr 180 185 190 Thr Tyr Trp Lys Pro Pro Arg Asn Lys Trp Trp Asp Gly Tyr His Gly 195 200 205 Glu Glu Val Val Val Ile Asp Asp Phe Tyr Gly Trp Leu Pro Trp Asn 210 215 220 Asp Leu Leu Arg Leu Cys Asp Arg Tyr Pro Leu Thr Val Glu Thr Lys 225 230 235 240 Gly Gly Thr Val Pro Phe Leu Ala Arg Ser Ile Leu Ile Thr Ser Asn 245 250 255 Gln Thr Pro Leu Glu Trp Tyr Ser Ser Thr Ala Val Pro Ala Val Glu 260 265 270 Ala Leu Tyr Arg Arg Ile Thr Ser Leu Val Phe Trp Lys Asn Ala Thr 275 280 285 Glu Gln Ser Thr Glu Glu Gly Gly Gln Phe Val Thr Leu Ser Pro Pro 290 295 300 Cys Pro Glu Phe Pro Tyr Glu Ile Asn Tyr 305 310 16 53 DNA ALVAC 16 catcatcatg atatccgtta agtttgtatc gtaatgacgt ggccaaggag gcg 53 17 40 DNA ALVAC 17 tactactacg tcgacttatt tatttagagg gtcttttagg 40 18 57 DNA ALVAC 18 catcatcatt cgcgatatcc gttaagtttg tatcgtaatg ccaagcaaga aaagcgg 57 19 36 DNA ALVAC 19 tactactacg tcgactcagt aatttatttt atatgg 36

Claims (26)

What is claimed is:
1. A recombinant poxvirus comprising an isolated DNA molecule selected from the group consisting of ORFs 1 to 13 of porcine circovirus type II, wherein the poxvirus is:
ALVA C, or
a poxvirus having all the identifying characteristics of ALVAC.
2. The recombinant poxvirus of claim 1 wherein the recombinant poxvirus is a recombinant ALVAC canarypox virus.
3. The recombinant poxvirus of claim 2 wherein the isolated DNA molecule is in the C6 locus of the ALVAC canarypox virus genome.
4. The recombinant poxvirus of claim 1 wherein the isolated DNA molecule comprises PCV2 ORF1, PCV2 ORF2, or PCV2 ORF1 and PCV2 ORF2.
5. The recombinant poxvirus of claim 4 wherein the isolated DNA molecule is in the C6 locus of the ALVAC canarypox virus genome.
6. An immunological composition comprising the recombinant poxvirus of any one of claims 1 to 3, 4 or 5, and a carrier.
7. The immunological composition of claim 6, which contains an adjuvant.
8. The immunological composition of claim 7, wherein the adjuvant is a carbomer.
9. A method of expressing a porcine circovirus ORF in a cell cultured in vitro comprising introducing into the cell the recombinant poxvirus as claimed in any one of claims 1 to 3, 4 or 5 under conditions which allow expression of the isolated DNA molecule by the recombinant poxvirus.
10. A method for inducing an immunological response against porcine circovirus in a host capable of an immunological response against porcine circovirus comprising administering to the host the recombinant poxvirus of any one of claims 1 to 3, 4 or 5.
11. The method of claim 10 wherein the recombinant poxvirus is administered with an adjuvant.
12. The method of claim 11 wherein the adjuvant is a carbomer.
13. An immunological composition comprising a recombinant avipox virus comprising an isolated DNA molecule selected from the group consisting of ORFs 1 to 13 of porcine circovirus type II, and a carbomer adjuvant.
14. The immunological composition of claim 13 wherein the isolated DNA molecule encodes PCV2 ORF1, PCV2 ORF2, or PCV2 ORF1 and PCV2 ORF2.
15. The immunological composition of any one of claim 13 or 14 wherein the avipox virus is a canarypox virus.
16. A recombinant avipox virus comprising an isolated DNA molecule comprising porcine circovirus type II (PCV2) open reading frames 1 and 2 (ORFs 1 and 2).
17. The recombinant avipox virus of claim 16 which is a recombinant canarypox virus.
18. An immunological composition comprising the recombinant avipox virus of any one of claim 16 or 17 and a carrier.
19. A method of expressing a gene product in a cell cultured in vitro comprising introducing into the cell the recombinant avipox virus as claimed in any one of claim 16 or 17 under conditions which allow expression of the isolated DNA molecule by the recombinant avipox virus.
20. A method for inducing an immunological response against porcine circovirus in a host capable of an immunological response against porcine circovirus comprising administering to the host the recombinant avipox virus of any of claim 16 or 17.
21. A method for inducing an immunological response against porcine circovirus in a host capable of an immunological response against porcine circovirus comprising administering to the host the composition of any one of claim 13 or 14.
22. A method for inducing an immunological response against porcine circovirus in a host capable of an immunological response against porcine circovirus comprising administering to the host the composition of claim 15.
23. The method of claim 10 wherein the host is a porcine.
24. The method of claim 20 wherein the host is a porcine.
25. The method of claim 21 wherein the host is a porcine.
26. The method of claim 22 wherein the host is a porcine.
US09/583,545 1999-06-10 2000-06-01 Porcine circovirus recombinant poxvirus vaccine Expired - Lifetime US6497883B1 (en)

Priority Applications (22)

Application Number Priority Date Filing Date Title
US09/583,545 US6497883B1 (en) 1999-06-10 2000-06-01 Porcine circovirus recombinant poxvirus vaccine
CNB00810560XA CN1195854C (en) 1999-06-10 2000-06-09 Porcine circovirus recombinant poxvirus vaccine
PCT/IB2000/000882 WO2000077216A2 (en) 1999-06-10 2000-06-09 Porcine circovirus vaccine in recombinant poxvirus
DK08005549.4T DK1975235T3 (en) 1999-06-10 2000-06-09 Porcine circovirus vaccine in recombinant poxvirus
PT00938971T PT1185660E (en) 1999-06-10 2000-06-09 Porcine circovirus vaccine in recombinant poxvirus
DE60044778T DE60044778D1 (en) 1999-06-10 2000-06-09 PIG CIRCOVIRUS VACCINE IN RECOMBINANT POX VIRUS
BR0011737-4A BR0011737A (en) 1999-06-10 2000-06-09 Porcine circovirus recombinant poxviruses vaccine
CA2376600A CA2376600C (en) 1999-06-10 2000-06-09 Porcine circovirus recombinant poxvirus vaccine
BRPI0011737-4A BRPI0011737B1 (en) 1999-06-10 2000-06-09 RECOMBINANT POXVIRUS VACCINE OF PORCINE CIRCUVIRUS
EP00938971A EP1185660B1 (en) 1999-06-10 2000-06-09 Porcine circovirus vaccine in recombinant poxvirus
JP2001503659A JP4859316B2 (en) 1999-06-10 2000-06-09 Porcine circovirus recombinant poxvirus vaccine
KR1020017015883A KR100837724B1 (en) 1999-06-10 2000-06-09 Recombinant poxvirus vaccine of porcine circovirus
PT80055494T PT1975235E (en) 1999-06-10 2000-06-09 Porcine circovirus vaccine in recombinant poxvirus
EP08005549.4A EP1975235B1 (en) 1999-06-10 2000-06-09 Porcine circovirus vaccine in recombinant poxvirus
DK00938971.9T DK1185660T3 (en) 1999-06-10 2000-06-09 Pig circovirus vaccine in recombinant pox virus
ES08005549.4T ES2560513T3 (en) 1999-06-10 2000-06-09 Recombinant poxvirus vaccine against porcine circovirus
PL352201A PL205032B1 (en) 1999-06-10 2000-06-09 Porcine circovirus vaccine in recombinant poxvirus
AT00938971T ATE476510T1 (en) 1999-06-10 2000-06-09 SWINE CIRCOVIRUS VACCINE IN RECOMBINANT SMALLVIRUS
HU0201689A HU229051B1 (en) 1999-06-10 2000-06-09 Porcine circovirus vaccine in reconbinant poxvirus
AU54189/00A AU778520B2 (en) 1999-06-10 2000-06-09 Porcine circovirus recombinant poxvirus vaccine
MXPA01012723A MXPA01012723A (en) 1999-06-10 2000-06-09 Porcine circovirus recombinant poxvirus vaccine.
CY20101100958T CY1116483T1 (en) 1999-06-10 2010-10-25 CIRCULAR SWINE VACCINE IN RECOVERY EVOLOGY

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US13847899P 1999-06-10 1999-06-10
US09/583,545 US6497883B1 (en) 1999-06-10 2000-06-01 Porcine circovirus recombinant poxvirus vaccine

Publications (1)

Publication Number Publication Date
US6497883B1 true US6497883B1 (en) 2002-12-24

Family

ID=26836231

Family Applications (1)

Application Number Title Priority Date Filing Date
US09/583,545 Expired - Lifetime US6497883B1 (en) 1999-06-10 2000-06-01 Porcine circovirus recombinant poxvirus vaccine

Country Status (17)

Country Link
US (1) US6497883B1 (en)
EP (2) EP1975235B1 (en)
JP (1) JP4859316B2 (en)
KR (1) KR100837724B1 (en)
CN (1) CN1195854C (en)
AT (1) ATE476510T1 (en)
AU (1) AU778520B2 (en)
BR (2) BRPI0011737B1 (en)
CA (1) CA2376600C (en)
DE (1) DE60044778D1 (en)
DK (2) DK1975235T3 (en)
ES (1) ES2560513T3 (en)
HU (1) HU229051B1 (en)
MX (1) MXPA01012723A (en)
PL (1) PL205032B1 (en)
PT (2) PT1975235E (en)
WO (1) WO2000077216A2 (en)

Cited By (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030170270A1 (en) * 2001-12-12 2003-09-11 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
WO2003102021A2 (en) 2002-03-20 2003-12-11 Merial Limited Cotton rat lung cells for virus culture
US6676958B2 (en) * 2001-06-19 2004-01-13 Advanced Bioadjuvants, Llc Adjuvant composition for mucosal and injection delivered vaccines
US20040062775A1 (en) * 1997-12-05 2004-04-01 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US20040076635A1 (en) * 1997-12-05 2004-04-22 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US20040253270A1 (en) * 2001-12-12 2004-12-16 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US20050058653A1 (en) * 1997-03-10 2005-03-17 John Ellis Prevention of myocarditis, abortion and intrauterine infection associated with porcine circovirus-2
WO2005049794A2 (en) 2003-11-13 2005-06-02 University Of Georgia Research Foundation, Inc. Methods of characterizing infectious bursal disease virus
WO2005085448A2 (en) 2003-05-01 2005-09-15 Merial Limited Canine ghrh gene, polypeptides and methdos of use
US20050214324A1 (en) * 2002-05-09 2005-09-29 Bavarian Nordic A/S Method for the cultivation of primary cells and for the amplification of viruses under serum free conditions
WO2005112544A2 (en) 2004-02-19 2005-12-01 The Governors Of The University Of Alberta Leptin promoter polymorphisms and uses thereof
WO2006072065A3 (en) * 2004-12-30 2006-12-07 Boehringer Ingelheim Vetmed Pcv2 immunogenic compositions and methods of producing such compositions
CN1328373C (en) * 2005-04-07 2007-07-25 南京农业大学 Porcine circus-virus 2 type recombinant adenovirus and vaccine
US20080226669A1 (en) * 2005-12-29 2008-09-18 Boehringer Ingelheim Vetmedica, Inc. Multivalent pcv2 immunogenic compositions and methods of producing such compositions
US20080260779A1 (en) * 2005-12-29 2008-10-23 Boehringer Ingelheim Vetmedica, Inc Use of a pcv2 immunogenic composition for lessening clinical symptoms in pigs
US20080292663A1 (en) * 2007-05-22 2008-11-27 Gerber Jay D Adjuvant compositions and methods for delivering vaccines
US7459270B2 (en) 2000-11-23 2008-12-02 Bavarian Nordic A/S Modified Vaccinia Ankara virus variant
US20080305128A1 (en) * 2007-01-03 2008-12-11 Boehringer Ingelheim Vetmedica, Inc. Treatment of prdc in pigs
US20090098158A1 (en) * 2007-09-04 2009-04-16 Boehringer Ingelheim Vetmedica, Inc. Reduction of concomitant infections in pigs by the use of pcv2 antigen
CN100489092C (en) * 2006-06-16 2009-05-20 中国农业科学院哈尔滨兽医研究所 Type II genetic marker strain of porcine circovirus and its application
US20090202588A1 (en) * 2005-12-01 2009-08-13 Luis Enjuanes Sanches Nucleic acids encoding TGEV and PRRSV sequences for improved expression of PRRSV sequences
US20090317423A1 (en) * 2008-01-23 2009-12-24 Boehringer Ingelheim Vetmedica, Inc. Pcv2 mycoplasma hyopneumoniae immunogenic compositions and methods of producing such compositions
US7700285B1 (en) 2005-12-29 2010-04-20 Boehringer Ingelheim Vetmedica, Inc. PCV2 immunogenic compositions and methods of producing such compositions
EP2186823A1 (en) 2005-11-14 2010-05-19 Merial Limited Gene therapy for renal failure
US20100129397A1 (en) * 2006-12-11 2010-05-27 Boehringer Ingelheim Vetmedica, Inc. Effective method of treatment of porcine circovirus and lawsonia intracellularis infections
EP2198881A1 (en) 2005-04-25 2010-06-23 Merial Limited Nipah virus vaccines
US20100167352A1 (en) * 1999-12-03 2010-07-01 Luis Enjuanes Sanchez Infectious clones
EP2228071A1 (en) 2006-11-14 2010-09-15 Merial Limited Intra-vascular kidney gene therapy with plasmid encoding BMP-7
WO2010115133A2 (en) 2009-04-03 2010-10-07 Merial Limited Newcastle disease virus vectored avian vaccines
US20110020394A1 (en) * 2007-12-31 2011-01-27 Boehringer Ingelheim Vetmedica, Inc. Pcv2 orf2 virus like particle with foreign amino acid insertion
US20110059126A1 (en) * 2009-09-02 2011-03-10 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing virucidal activity in pcv-2 compositions and pcv-2 compositions with an improved immunogenicity
US20110091499A1 (en) * 2006-12-15 2011-04-21 Boehringer Ingelheim Vetmedica, Inc. Treatment of pigs with pcv2 antigent
US7943298B2 (en) 2007-02-13 2011-05-17 Boehringer Ingelheim Vetmedica, Inc. Prevention and treatment of sub-clinical PCVD
EP2390352A1 (en) 2003-03-18 2011-11-30 Quantum Genetics Ireland Limited Systems and methods for improving protein and milk production of dairy herds
WO2012030720A1 (en) 2010-08-31 2012-03-08 Merial Limited Newcastle disease virus vectored herpesvirus vaccines
WO2012090073A2 (en) 2010-12-30 2012-07-05 The Netherlands Cancer Institute Methods and compositions for predicting chemotherapy sensitivity
WO2012138789A2 (en) 2011-04-04 2012-10-11 Netherlands Cancer Institute Methods and compositions for predicting resistance to anticancer treatment
WO2012138783A2 (en) 2011-04-04 2012-10-11 Netherlands Cancer Institute Methods and compositions for predicting resistance to anticancer treatment
WO2012145577A1 (en) 2011-04-20 2012-10-26 Merial Limited Adjuvanted rabies vaccine with improved viscosity profile
WO2012149038A1 (en) 2011-04-25 2012-11-01 Advanced Bioscience Laboratories, Inc. Truncated hiv envelope proteins (env), methods and compositions related thereto
WO2012166493A1 (en) 2011-06-01 2012-12-06 Merial Limited Needle-free administration of prrsv vaccines
WO2013025274A1 (en) 2011-08-12 2013-02-21 Merial Limited Vacuum -assisted preservation of biological products, in particular of vaccines
WO2013093629A2 (en) 2011-12-20 2013-06-27 Netherlands Cancer Institute Modular vaccines, methods and compositions related thereto
WO2013123242A1 (en) 2012-02-14 2013-08-22 Merial Limited Recombinant poxviral vectors expressing both rabies and ox40 proteins, and vaccines made therefrom
WO2013138776A1 (en) 2012-03-16 2013-09-19 Merial Limited Novel methods for providing long-term protective immunity against rabies in animals, based upon administration of replication-deficient flavivirus expressing rabies g
WO2014164697A1 (en) 2013-03-12 2014-10-09 Merial Limited Reverse genetics schmallenberg virus vaccine compositions, and methods of use thereof
EP2816057A1 (en) 2006-06-01 2014-12-24 Merial Limited Recombinant vaccine against bluetongue virus
US9101571B2 (en) 2010-12-22 2015-08-11 Sbc Virbac Limited. Porcine circovirus type 2 (PCV2), immunogenic composition containing the same, test kit, and application thereof
RU2575615C2 (en) * 2004-12-30 2016-02-20 Берингер Ингельгейм Ветмедика, Инк. Pcv2 immunogenic compositions and methods for producing these compositions
WO2016073410A1 (en) 2014-11-03 2016-05-12 Merial, Inc. Methods of using microneedle vaccine formulations to elicit in animals protective immunity against rabies virus
WO2016183423A1 (en) 2015-05-14 2016-11-17 Merial Inc. Method for porcine circovirus production and pcv2 vaccines
US9505808B2 (en) 2013-10-02 2016-11-29 Boehringer Ingelheim Vetmedica, Inc. PCV2 ORF2 protein variant and virus like particles composed thereof
WO2016210094A1 (en) 2015-06-23 2016-12-29 Merial, Inc. Prrsv minor protein-containing recombinant viral vectors and methods of making and use thereof
US9649370B2 (en) 2013-05-08 2017-05-16 Protatek International, Inc. Vaccine for PCV2 and mycoplasma
RU2620968C2 (en) * 2004-12-30 2017-05-30 Берингер Ингельгейм Ветмедика, Инк. Pcv2 immunogenic compositions and methods of such compositions production
EP3260137A1 (en) 2008-01-28 2017-12-27 Merial, Inc. Canine influenza vaccines
US9919041B2 (en) 2004-12-30 2018-03-20 Boehringer Ingelheim Vetmedica, Inc. PCV2 immunogenic compositions and methods of producing such compositions
US9987348B2 (en) 2013-09-25 2018-06-05 Zoetis Services Llc PCV2B divergent vaccine composition and methods of use

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6517843B1 (en) * 1999-08-31 2003-02-11 Merial Reduction of porcine circovirus-2 viral load with inactivated PCV-2
US7192594B2 (en) 1997-10-03 2007-03-20 Merial Limited Postweaning multisystemic wasting syndrome and porcine circovirus from pigs
ID28224A (en) 1997-12-11 2001-05-10 Univ Saskatchewan VIRUS SYNDROME OF POST-DECISION MULTISISTEMIC DAMAGE FROM PIG
US6943152B1 (en) 1999-06-10 2005-09-13 Merial DNA vaccine-PCV
MXPA03008810A (en) 2001-03-27 2004-02-17 Univ Saskatchewan Methods to culture circovirus.
TW200643171A (en) * 2005-06-07 2006-12-16 Temasek Life Sciences Lab Ltd Porcine circovirus type 2 vaccines
CN101773667A (en) * 2010-01-28 2010-07-14 洛阳普莱柯生物工程有限公司 Preparation method for vaccine of porcine circovirus II
CN102198268B (en) * 2011-03-29 2013-08-14 范红结 Recombinant Swine pox virus (SPV) vector vaccine for the expression of Streptococcus equi subsp zooepidemicus (SEZ) M-like protein (SzP)
CN102861327B (en) * 2012-09-27 2015-01-21 郑州后羿制药有限公司 Cell inactivated vaccine, egg yoke antibody and injection and freeze-dried powder containing same
WO2014187822A1 (en) * 2013-05-22 2014-11-27 Boehringer Ingelheim Espana, S.A. Method for the reduction of pcv-2 in a herd of swine
RU2771533C2 (en) * 2015-10-16 2022-05-05 Канзас Стейт Юниверсити Рисерч Фаундейшн Immunogenic compositions for immunising pigs against type 3 circovirus and methods for production and application thereof
WO2018023473A1 (en) * 2016-08-03 2018-02-08 台湾生物制剂股份有限公司 Fully expressing cell used as an antigen vector and uses thereof to prepare a vaccine or diagnostic reagent, or for monoclonal antibody screening
CN111087452A (en) * 2019-12-18 2020-05-01 中国农业科学院兰州兽医研究所 Prokaryotic soluble expression method of porcine circovirus 2b subtype Cap protein

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5382425A (en) 1992-01-13 1995-01-17 Syntro Corporation Recombinant swinepox virus
US5587164A (en) * 1993-02-08 1996-12-24 Bayer Corporation Porcine reproductive and respiratory syndrome virus antigen and processes for the preparation and use of said antigen in vaccines and diagnostics
US5756103A (en) * 1991-03-07 1998-05-26 Virogenetics Corporation Alvac canarypox virus recombinants comprising heterlogous inserts
US5770212A (en) 1994-04-29 1998-06-23 Immuno Aktiengesellschaft Recombinant poxviruses with foreign DNA in essential regions
US5820869A (en) 1995-06-07 1998-10-13 American Home Products Corporation Recombinant raccoon pox viruses and their use as an effective vaccine against feline immunodeficiency virus infection
US5833975A (en) 1989-03-08 1998-11-10 Virogenetics Corporation Canarypox virus expressing cytokine and/or tumor-associated antigen DNA sequence
FR2769322A1 (en) * 1997-10-03 1999-04-09 Merial Sas New type II porcine circovirus, used for, e.g. passive immunization of pregnant sows
WO1999018214A1 (en) * 1997-10-03 1999-04-15 Merial Porcine circoviruses, vaccines and diagnostic reagents
US5990091A (en) 1997-03-12 1999-11-23 Virogenetics Corporation Vectors having enhanced expression, and methods of making and uses thereof
US6004777A (en) 1997-03-12 1999-12-21 Virogenetics Corporation Vectors having enhanced expression, and methods of making and uses thereof
US6033904A (en) 1992-01-13 2000-03-07 Syntro Corporation Recombinant swinepox virus

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2909462A (en) 1955-12-08 1959-10-20 Bristol Myers Co Acrylic acid polymer laxative compositions
US4603112A (en) 1981-12-24 1986-07-29 Health Research, Incorporated Modified vaccinia virus
US5505941A (en) 1981-12-24 1996-04-09 Health Research, Inc. Recombinant avipox virus and method to induce an immune response
US4769330A (en) 1981-12-24 1988-09-06 Health Research, Incorporated Modified vaccinia virus and methods for making and using the same
US4722848A (en) 1982-12-08 1988-02-02 Health Research, Incorporated Method for immunizing animals with synthetically modified vaccinia virus
US5110587A (en) 1981-12-24 1992-05-05 Health Research, Incorporated Immunogenic composition comprising synthetically modified vaccinia virus
US5364773A (en) 1991-03-07 1994-11-15 Virogenetics Corporation Genetically engineered vaccine strain
US5174993A (en) 1981-12-24 1992-12-29 Health Research Inc. Recombinant avipox virus and immunological use thereof
CA1341245C (en) 1988-01-12 2001-06-05 F. Hoffmann-La Roche Ag Recombinant vaccinia virus mva
US5843456A (en) 1991-03-07 1998-12-01 Virogenetics Corporation Alvac poxvirus-rabies compositions and combination compositions and uses
US5869312A (en) 1992-01-13 1999-02-09 Syntro Corporation Recombinant swinepox virus
US6517843B1 (en) * 1999-08-31 2003-02-11 Merial Reduction of porcine circovirus-2 viral load with inactivated PCV-2
US6391314B1 (en) 1997-10-03 2002-05-21 Merial Porcine circoviruses vaccines diagnostic reagents

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5833975A (en) 1989-03-08 1998-11-10 Virogenetics Corporation Canarypox virus expressing cytokine and/or tumor-associated antigen DNA sequence
US5756103A (en) * 1991-03-07 1998-05-26 Virogenetics Corporation Alvac canarypox virus recombinants comprising heterlogous inserts
US5382425A (en) 1992-01-13 1995-01-17 Syntro Corporation Recombinant swinepox virus
US6033904A (en) 1992-01-13 2000-03-07 Syntro Corporation Recombinant swinepox virus
US5587164A (en) * 1993-02-08 1996-12-24 Bayer Corporation Porcine reproductive and respiratory syndrome virus antigen and processes for the preparation and use of said antigen in vaccines and diagnostics
US5770212A (en) 1994-04-29 1998-06-23 Immuno Aktiengesellschaft Recombinant poxviruses with foreign DNA in essential regions
US5820869A (en) 1995-06-07 1998-10-13 American Home Products Corporation Recombinant raccoon pox viruses and their use as an effective vaccine against feline immunodeficiency virus infection
US5990091A (en) 1997-03-12 1999-11-23 Virogenetics Corporation Vectors having enhanced expression, and methods of making and uses thereof
US6004777A (en) 1997-03-12 1999-12-21 Virogenetics Corporation Vectors having enhanced expression, and methods of making and uses thereof
FR2769322A1 (en) * 1997-10-03 1999-04-09 Merial Sas New type II porcine circovirus, used for, e.g. passive immunization of pregnant sows
WO1999018214A1 (en) * 1997-10-03 1999-04-15 Merial Porcine circoviruses, vaccines and diagnostic reagents
US6368601B1 (en) 1997-10-03 2002-04-09 Merial Porcine circovirus vaccine and diagnostics reagents

Cited By (195)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050058653A1 (en) * 1997-03-10 2005-03-17 John Ellis Prevention of myocarditis, abortion and intrauterine infection associated with porcine circovirus-2
US7211379B2 (en) 1997-10-03 2007-05-01 Merial Sas Prevention of myocarditis, abortion and intrauterine infection associated with porcine circovirus-2
US7740866B2 (en) 1997-12-05 2010-06-22 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7179472B2 (en) 1997-12-05 2007-02-20 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20040161410A1 (en) * 1997-12-05 2004-08-19 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US20040265848A1 (en) * 1997-12-05 2004-12-30 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US7951907B2 (en) 1997-12-05 2011-05-31 Wyeth Llc Circovirus sequences associated with piglet weight loss disease (PWD)
US8124723B2 (en) 1997-12-05 2012-02-28 Wyeth Llc Circovirus sequences associated with piglet weight loss disease (PWD)
US20050084497A1 (en) * 1997-12-05 2005-04-21 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US8415525B2 (en) 1997-12-05 2013-04-09 Zoetis W Llc Circovirus sequences associated with piglet weight loss disease (PWD)
US8715690B2 (en) 1997-12-05 2014-05-06 Zoetis W Llc Circovirus sequences associated with piglet weight loss disease (PWD)
US20040062775A1 (en) * 1997-12-05 2004-04-01 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US8916353B2 (en) 1997-12-05 2014-12-23 Zoetis W Llc Circovirus sequences associated with piglet weight loss disease (PWD)
US20100209453A1 (en) * 1997-12-05 2010-08-19 Wyeth Circovirus sequence associated with piglet weight loss disease (pwd)
US20100189733A1 (en) * 1997-12-05 2010-07-29 Wyeth Circovirus sequences associated with piglet weight loss disease (pwd)
US20050238662A1 (en) * 1997-12-05 2005-10-27 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US20100189735A1 (en) * 1997-12-05 2010-07-29 Wyeth Circovirus sequences associated with piglet weight loss disease (pwd)
US20060083756A1 (en) * 1997-12-05 2006-04-20 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US20060222663A1 (en) * 1997-12-05 2006-10-05 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US20060222659A1 (en) * 1997-12-05 2006-10-05 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US7758865B2 (en) 1997-12-05 2010-07-20 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7148015B2 (en) 1997-12-05 2006-12-12 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7740865B2 (en) 1997-12-05 2010-06-22 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20070041990A1 (en) * 1997-12-05 2007-02-22 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20070041989A1 (en) * 1997-12-05 2007-02-22 Weyth Circovirus sequences associated with piglet weight loss disease (PWD)
US20070048780A1 (en) * 1997-12-05 2007-03-01 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20070059325A1 (en) * 1997-12-05 2007-03-15 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20070059324A1 (en) * 1997-12-05 2007-03-15 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20070065457A1 (en) * 1997-12-05 2007-03-22 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20070065925A1 (en) * 1997-12-05 2007-03-22 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20040076635A1 (en) * 1997-12-05 2004-04-22 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US20070110767A1 (en) * 1997-12-05 2007-05-17 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7223407B2 (en) 1997-12-05 2007-05-29 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US10052375B2 (en) 1997-12-05 2018-08-21 Zoetics Services LLC Circovirus sequences associated with piglet weight loss disease (PWD)
US7244433B2 (en) 1997-12-05 2007-07-17 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7741026B2 (en) 1997-12-05 2010-06-22 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7258865B2 (en) 1997-12-05 2007-08-21 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7261898B2 (en) 1997-12-05 2007-08-28 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7722883B2 (en) 1997-12-05 2010-05-25 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7604808B2 (en) 1997-12-05 2009-10-20 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20070253971A1 (en) * 1997-12-05 2007-11-01 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7297537B2 (en) 1997-12-05 2007-11-20 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7314628B2 (en) 1997-12-05 2008-01-01 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7323330B2 (en) 1997-12-05 2008-01-29 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20090162918A1 (en) * 1997-12-05 2009-06-25 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7390494B2 (en) 1997-12-05 2008-06-24 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US9700613B2 (en) 1997-12-05 2017-07-11 Zoetis Services Llc Circovirus sequences associated with piglet weight loss disease (PWD)
US7405075B2 (en) 1997-12-05 2008-07-29 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7407803B2 (en) 1997-12-05 2008-08-05 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US7425444B2 (en) 1997-12-05 2008-09-16 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20090123490A1 (en) * 1997-12-05 2009-05-14 Andre Jestin Circovirus sequences associated with piglet weight loss disease (PWD)
US20080233147A1 (en) * 1997-12-05 2008-09-25 Andre Jestin Circovirus sequences associated with piglet weight loss disease (PWD)
US9717784B2 (en) 1997-12-05 2017-08-01 Zoetis Services Llc Circovirus sequences associated with piglet weight loss disease (PWD)
US20040091502A1 (en) * 1997-12-05 2004-05-13 Agence Francaise De Securite Sanitaire Des Aliments Circovirus sequences associated with piglet weight loss disease (PWD)
US7223594B2 (en) 1997-12-05 2007-05-29 Wyeth Circovirus sequences associated with piglet weight loss disease (PWD)
US20100167352A1 (en) * 1999-12-03 2010-07-01 Luis Enjuanes Sanchez Infectious clones
US7459270B2 (en) 2000-11-23 2008-12-02 Bavarian Nordic A/S Modified Vaccinia Ankara virus variant
US20040170640A1 (en) * 2001-06-19 2004-09-02 Gerber Jay D. Methods for preparing and delivering adjuvant compositions
US7879333B2 (en) 2001-06-19 2011-02-01 Advanced Bioadjuvants, Llc Methods for preparing and delivering adjuvant compositions
US20080050395A1 (en) * 2001-06-19 2008-02-28 Gerber Jay D Methods for preparing and delivering adjuvant compositions
US8501221B2 (en) 2001-06-19 2013-08-06 Advanced Bioadjuvants Llc Methods for preparing and delivering adjuvant compositions
US6676958B2 (en) * 2001-06-19 2004-01-13 Advanced Bioadjuvants, Llc Adjuvant composition for mucosal and injection delivered vaccines
US7279166B2 (en) 2001-12-12 2007-10-09 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US7276353B2 (en) 2001-12-12 2007-10-02 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US10507238B2 (en) 2001-12-12 2019-12-17 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US20040253270A1 (en) * 2001-12-12 2004-12-16 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US9889187B2 (en) 2001-12-12 2018-02-13 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US9211324B2 (en) 2001-12-12 2015-12-15 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US20100055122A1 (en) * 2001-12-12 2010-03-04 Xiang-Jin Meng Chimeric infectious dna clones, chimeric porcine circoviruses and uses thereof
US8058048B2 (en) 2001-12-12 2011-11-15 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US20030170270A1 (en) * 2001-12-12 2003-09-11 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US7575752B2 (en) 2001-12-12 2009-08-18 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
WO2003102021A2 (en) 2002-03-20 2003-12-11 Merial Limited Cotton rat lung cells for virus culture
US20050214324A1 (en) * 2002-05-09 2005-09-29 Bavarian Nordic A/S Method for the cultivation of primary cells and for the amplification of viruses under serum free conditions
US7695939B2 (en) 2002-09-05 2010-04-13 Bavarian Nordic A/S Method for the cultivation of primary cells and for the amplification of viruses under serum free conditions
EP2390352A1 (en) 2003-03-18 2011-11-30 Quantum Genetics Ireland Limited Systems and methods for improving protein and milk production of dairy herds
WO2005085448A2 (en) 2003-05-01 2005-09-15 Merial Limited Canine ghrh gene, polypeptides and methdos of use
WO2005049794A2 (en) 2003-11-13 2005-06-02 University Of Georgia Research Foundation, Inc. Methods of characterizing infectious bursal disease virus
WO2005112544A2 (en) 2004-02-19 2005-12-01 The Governors Of The University Of Alberta Leptin promoter polymorphisms and uses thereof
JP2008526212A (en) * 2004-12-30 2008-07-24 ベーリンガー インゲルヘイム ヴェトメディカ アイエヌシー. PCV2 immunogenic compositions and methods of making such compositions
CN107602671B (en) * 2004-12-30 2021-11-16 勃林格殷格翰动物保健美国有限公司 PCV2 immunogenic compositions and methods of producing such compositions
US20110274710A1 (en) * 2004-12-30 2011-11-10 Boehringer Ingelheim Vetmedica, Inc. Pcv2 immunogenic compositions and methods of producing such compositions
US7910306B2 (en) * 2004-12-30 2011-03-22 Boehringer Ingelheim Vetmedica, Inc. PCV2 immunogenic compositions and methods of producing such compositions
US9919041B2 (en) 2004-12-30 2018-03-20 Boehringer Ingelheim Vetmedica, Inc. PCV2 immunogenic compositions and methods of producing such compositions
CN107602671A (en) * 2004-12-30 2018-01-19 勃林格殷格翰动物保健有限公司 PCV2 immunogenic compositions and the method for producing this composition
US20090016992A1 (en) * 2004-12-30 2009-01-15 Boehringer Ingelheim Vetmedica, Inc. Pcv2 immunogenic compositions and methods of producing such compositions
WO2006072065A3 (en) * 2004-12-30 2006-12-07 Boehringer Ingelheim Vetmed Pcv2 immunogenic compositions and methods of producing such compositions
TWI582231B (en) * 2004-12-30 2017-05-11 百靈佳殷格翰家畜藥品公司 Second porcine circovirus (PCV2) immunogen composition, and method of preparing the same
US20090022750A1 (en) * 2004-12-30 2009-01-22 Boehringer Ingelheim Vetmedica, Inc. Pcv2 immunogenic compositions and methods of producing such compositions
RU2620968C2 (en) * 2004-12-30 2017-05-30 Берингер Ингельгейм Ветмедика, Инк. Pcv2 immunogenic compositions and methods of such compositions production
RU2435854C2 (en) * 2004-12-30 2011-12-10 Берингер Ингельгейм Ветмедика, Инк. Immunogenic compositions pcv2 and methods for producing such compositions
US9011872B2 (en) 2004-12-30 2015-04-21 Boehringer Ingelheim Vetmedica, Inc. PCV2 immunogenic compositions and methods of producing such compositions
US7829101B2 (en) 2004-12-30 2010-11-09 Boehringer Ingelheim Vetmedica, Inc. PCV2 immunogenic compositions and methods of producing such compositions
TWI479021B (en) * 2004-12-30 2015-04-01 百靈佳殷格翰家畜藥品公司 Second porcine circovirus (PCV2) immunogen composition, and method of preparing the same
RU2575615C2 (en) * 2004-12-30 2016-02-20 Берингер Ингельгейм Ветмедика, Инк. Pcv2 immunogenic compositions and methods for producing these compositions
US7833707B2 (en) * 2004-12-30 2010-11-16 Boehringer Ingelheim Vetmedica, Inc. Methods of overexpression and recovery of porcine circovirus type 2 ORF2
US10576142B2 (en) 2004-12-30 2020-03-03 Boehringer Ingelheim Vetmedica, Inc. PCV2 immunogenic compositions and methods of producing such compositions
KR20140120944A (en) * 2004-12-30 2014-10-14 베링거잉겔하임베트메디카인코퍼레이티드 Pcv2 immunogenic compositions and methods of producing such compositions
RU2620968C9 (en) * 2004-12-30 2017-08-08 Берингер Ингельгейм Ветмедика, Инк. Pcv2 immunogenic compositions and methods of such compositions production
JP2012016357A (en) * 2004-12-30 2012-01-26 Boehringer Ingelheim Vetmedica Inc Pcv2 immunogenic composition and method for producing the composition
US20090042245A1 (en) * 2004-12-30 2009-02-12 Mark Eichmeyer Methods of overexpression and recovery of porcine circovirus type 2 ORF2
US20090022749A1 (en) * 2004-12-30 2009-01-22 Boehringer Ingelheim Vetmedica, Inc. Pcv2 immunogenic compositions and methods of producing such compositions
US8025888B2 (en) * 2004-12-30 2011-09-27 Boehringer Ingelheim Vetmedica, Inc. PCV2 immunogenic compositions and methods of producing such compositions
US20090022752A1 (en) * 2004-12-30 2009-01-22 Boehringer Ingelheim Vetmedica, Inc. Pcv2 immunogenic compositions and methods of producing such compositions
CN1328373C (en) * 2005-04-07 2007-07-25 南京农业大学 Porcine circus-virus 2 type recombinant adenovirus and vaccine
EP2198881A1 (en) 2005-04-25 2010-06-23 Merial Limited Nipah virus vaccines
EP3536704A1 (en) 2005-11-14 2019-09-11 Boehringer Ingelheim Animal Health USA Inc. Gene therapy for renal failure
EP3147296A1 (en) 2005-11-14 2017-03-29 Merial, Inc. Gene therapy for renal failure
EP2186823A1 (en) 2005-11-14 2010-05-19 Merial Limited Gene therapy for renal failure
US20090202588A1 (en) * 2005-12-01 2009-08-13 Luis Enjuanes Sanches Nucleic acids encoding TGEV and PRRSV sequences for improved expression of PRRSV sequences
US7838214B2 (en) 2005-12-29 2010-11-23 Boehringer Ingelheim Vetmedical, Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
US20080279875A1 (en) * 2005-12-29 2008-11-13 Boehringer Ingelheim Vetmedica, Inc Use of a pcv2 immunogenic composition for lessening clinical symptoms in pigs
US7700285B1 (en) 2005-12-29 2010-04-20 Boehringer Ingelheim Vetmedica, Inc. PCV2 immunogenic compositions and methods of producing such compositions
US7968285B2 (en) * 2005-12-29 2011-06-28 Boehringer Ingelheim Vetmedica, Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
US9610345B2 (en) 2005-12-29 2017-04-04 Boehringer Ingelheim Vetmedica, Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
US9101561B2 (en) * 2005-12-29 2015-08-11 Boehringer Ingelheim Vetmedica, Inc. Multivalent PCV2 immunogenic compositions and methods of producing such compositions
US8119143B2 (en) 2005-12-29 2012-02-21 Boehringer Ingelheim Vetmedica, Inc. Multivalent PCV2 immunogenic compositions and methods of producing such compositions
JP2009522310A (en) * 2005-12-29 2009-06-11 ベーリンガー インゲルハイム フェトメディカ インコーポレイテッド Use of PCV2 immunogenic composition for alleviation of clinical symptoms in pigs
US20080226669A1 (en) * 2005-12-29 2008-09-18 Boehringer Ingelheim Vetmedica, Inc. Multivalent pcv2 immunogenic compositions and methods of producing such compositions
US20120107348A1 (en) * 2005-12-29 2012-05-03 Boehringer Ingelheim Vetmedica, Inc. Multivalent pcv2 immunogenic compositions and methods of producing such compositions
US10624963B2 (en) 2005-12-29 2020-04-21 Boehringer Ingelheim Vetmedica, Inc. Multivalent PCV2 immunogenic compositions and methods of producing such compositions
US20080260779A1 (en) * 2005-12-29 2008-10-23 Boehringer Ingelheim Vetmedica, Inc Use of a pcv2 immunogenic composition for lessening clinical symptoms in pigs
US10568955B2 (en) 2005-12-29 2020-02-25 Boehringer Ingelheim Vetmedica, Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
US20080261887A1 (en) * 2005-12-29 2008-10-23 Boehringer Ingelheim Vetmedica, Inc Use of a pcv2 immunogenic composition for lessening clinical symptoms in pigs
WO2007094893A3 (en) * 2005-12-29 2008-11-06 Boehringer Ingelheim Vetmed Use of a pcv2 immunogenic composition for lessening clinical symptoms in pigs
US20080279876A1 (en) * 2005-12-29 2008-11-13 Boehringer Ingelheim Vetmedica, Inc Use of a pcv2 immunogenic composition for lessening clinical symptoms in pigs
US9987349B2 (en) 2005-12-29 2018-06-05 Boehringer Ingelheim Vetmedica, Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
US9011868B2 (en) 2005-12-29 2015-04-21 Boehringer Ingelheim Vetmedica, Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
JP2013067655A (en) * 2005-12-29 2013-04-18 Boehringer Ingelheim Vetmedica Inc Use of pcv2 immunogenic composition for alleviating clinical symptom in pig
US9925255B2 (en) 2005-12-29 2018-03-27 Boehringer Ingelheim Vetmedica, Inc. Multivalent PCV2 immunogenic compositions and methods of producing such compositions
US9925256B2 (en) 2005-12-29 2018-03-27 Boehringer Ingelheim Vetmedica, Inc. Multivalent PCV2 immunogenic compositions and methods of producing such compositions
US9669087B2 (en) 2005-12-29 2017-06-06 Boehringer Ingelheim Vetmedica, Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
US20110217327A1 (en) * 2005-12-29 2011-09-08 Boehringer Ingelheim Vetmedica, Inc Use of a pcv2 immunogenic composition for lessening clinical symptoms in pigs
US7829273B2 (en) 2005-12-29 2010-11-09 Boehringer Ingelheim Vetmedica, Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
AU2006338182B2 (en) * 2005-12-29 2013-08-22 Boehringer Ingelheim Animal Health USA Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
US7838213B2 (en) * 2005-12-29 2010-11-23 Boehringer Ingelheim Vetmedica, Inc. Use of a PCV2 immunogenic composition for lessening clinical symptoms in pigs
US20090092636A1 (en) * 2005-12-29 2009-04-09 Boehringer Ingelheim Vetmedica, Inc Multivalent pcv2 immunogenic compositions and methods of producing such compositions
EP2816057A1 (en) 2006-06-01 2014-12-24 Merial Limited Recombinant vaccine against bluetongue virus
CN100489092C (en) * 2006-06-16 2009-05-20 中国农业科学院哈尔滨兽医研究所 Type II genetic marker strain of porcine circovirus and its application
EP2228071A1 (en) 2006-11-14 2010-09-15 Merial Limited Intra-vascular kidney gene therapy with plasmid encoding BMP-7
US20100129397A1 (en) * 2006-12-11 2010-05-27 Boehringer Ingelheim Vetmedica, Inc. Effective method of treatment of porcine circovirus and lawsonia intracellularis infections
US9636389B2 (en) 2006-12-11 2017-05-02 Boehringer Ingelheim Vetmedica, Inc. Effective method of treatment of porcine circovirus and Lawsonia intracellularis infections
US20110091499A1 (en) * 2006-12-15 2011-04-21 Boehringer Ingelheim Vetmedica, Inc. Treatment of pigs with pcv2 antigent
US9517260B2 (en) 2006-12-15 2016-12-13 Boehringer Ingelheim Vetmedica, Inc. Treatment of pigs with PCV2 antigen
US8865183B2 (en) 2006-12-15 2014-10-21 Boehringer Ingelheim Vetmedica, Inc. Treatment of pigs with PCV2 antigent
US20080305128A1 (en) * 2007-01-03 2008-12-11 Boehringer Ingelheim Vetmedica, Inc. Treatment of prdc in pigs
US7914992B2 (en) 2007-01-03 2011-03-29 Boehringer Ingelheim Vetmedica, Inc. Treatment of PRDC in pigs
US9522182B2 (en) 2007-01-03 2016-12-20 Boehringer Ingelheim Vetmedica, Inc. Prophylaxis and treatment of PRDC
US9132187B2 (en) 2007-02-13 2015-09-15 Boehringer Ingelheim Vetmedica, Inc. Prevention and treatment of sub-clinical PCVD
US9943587B2 (en) 2007-02-13 2018-04-17 Boehringer Ingelheim Vetmedica, Inc. Prevention and treatment of sub-clinical PCVD
US8496940B2 (en) 2007-02-13 2013-07-30 Boehringer Ingelheim Vetmedica, Inc. Prevention and treatment of sub-clinical PCVD
US7943298B2 (en) 2007-02-13 2011-05-17 Boehringer Ingelheim Vetmedica, Inc. Prevention and treatment of sub-clinical PCVD
US20110182935A1 (en) * 2007-02-13 2011-07-28 Boehringer Ingelheim Vetmedica, Inc. Prevention and treatment of sub-clinical pcvd
US9555092B2 (en) 2007-02-13 2017-01-31 Boehringer Ingelheim Vetmedica, Inc. Prevention and treatment of sub-clinical PCVD
US20080292663A1 (en) * 2007-05-22 2008-11-27 Gerber Jay D Adjuvant compositions and methods for delivering vaccines
US20110052629A1 (en) * 2007-09-04 2011-03-03 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing concomitant infections in pigs with a pcv2 antigen
US8475805B2 (en) 2007-09-04 2013-07-02 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing concomitant infections in pigs with a PCV2 antigen
US9132186B2 (en) 2007-09-04 2015-09-15 Boehringer Ingelheim Vetmedica, Inc. Reduction of concomitant infections in pigs by the use of PCV2 antigen
US20090098158A1 (en) * 2007-09-04 2009-04-16 Boehringer Ingelheim Vetmedica, Inc. Reduction of concomitant infections in pigs by the use of pcv2 antigen
US7829274B2 (en) * 2007-09-04 2010-11-09 Boehringer Ingelheim Vetmedica, Inc. Reduction of concomitant infections in pigs by the use of PCV2 antigen
US20110020394A1 (en) * 2007-12-31 2011-01-27 Boehringer Ingelheim Vetmedica, Inc. Pcv2 orf2 virus like particle with foreign amino acid insertion
US20090317423A1 (en) * 2008-01-23 2009-12-24 Boehringer Ingelheim Vetmedica, Inc. Pcv2 mycoplasma hyopneumoniae immunogenic compositions and methods of producing such compositions
US9669086B2 (en) 2008-01-23 2017-06-06 Boehringer Ingelheim Vetmedica, Inc. PCV2 Mycoplasma hyopneumoniae immunogenic compositions and methods of producing such compositions
EP3260137A1 (en) 2008-01-28 2017-12-27 Merial, Inc. Canine influenza vaccines
WO2010115133A2 (en) 2009-04-03 2010-10-07 Merial Limited Newcastle disease virus vectored avian vaccines
EP2998315A2 (en) 2009-04-03 2016-03-23 Merial Limited Newcastle disease virus vectored avian vaccines
US20110059126A1 (en) * 2009-09-02 2011-03-10 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing virucidal activity in pcv-2 compositions and pcv-2 compositions with an improved immunogenicity
US9561270B2 (en) 2009-09-02 2017-02-07 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing virucidal activity in PCV-2 compositions and PCV-2 compositions with an improved immunogenicity
EP3156070A2 (en) 2010-08-31 2017-04-19 Merial Inc. Newcastle disease virus vectored herpesvirus vaccines
EP4014989A1 (en) 2010-08-31 2022-06-22 Boehringer Ingelheim Animal Health USA Inc. Newcastle disease virus vectored herpesvirus vaccines
WO2012030720A1 (en) 2010-08-31 2012-03-08 Merial Limited Newcastle disease virus vectored herpesvirus vaccines
US9101571B2 (en) 2010-12-22 2015-08-11 Sbc Virbac Limited. Porcine circovirus type 2 (PCV2), immunogenic composition containing the same, test kit, and application thereof
WO2012090073A2 (en) 2010-12-30 2012-07-05 The Netherlands Cancer Institute Methods and compositions for predicting chemotherapy sensitivity
WO2012138789A2 (en) 2011-04-04 2012-10-11 Netherlands Cancer Institute Methods and compositions for predicting resistance to anticancer treatment
WO2012138783A2 (en) 2011-04-04 2012-10-11 Netherlands Cancer Institute Methods and compositions for predicting resistance to anticancer treatment
WO2012145577A1 (en) 2011-04-20 2012-10-26 Merial Limited Adjuvanted rabies vaccine with improved viscosity profile
WO2012149038A1 (en) 2011-04-25 2012-11-01 Advanced Bioscience Laboratories, Inc. Truncated hiv envelope proteins (env), methods and compositions related thereto
WO2012166493A1 (en) 2011-06-01 2012-12-06 Merial Limited Needle-free administration of prrsv vaccines
WO2013025274A1 (en) 2011-08-12 2013-02-21 Merial Limited Vacuum -assisted preservation of biological products, in particular of vaccines
WO2013093629A2 (en) 2011-12-20 2013-06-27 Netherlands Cancer Institute Modular vaccines, methods and compositions related thereto
WO2013123242A1 (en) 2012-02-14 2013-08-22 Merial Limited Recombinant poxviral vectors expressing both rabies and ox40 proteins, and vaccines made therefrom
EP3466443A1 (en) 2012-02-14 2019-04-10 Merial, Inc. Recombinant poxviral vectors expressing both rabies and ox40 proteins, and vaccines made therefrom
WO2013138776A1 (en) 2012-03-16 2013-09-19 Merial Limited Novel methods for providing long-term protective immunity against rabies in animals, based upon administration of replication-deficient flavivirus expressing rabies g
WO2014164697A1 (en) 2013-03-12 2014-10-09 Merial Limited Reverse genetics schmallenberg virus vaccine compositions, and methods of use thereof
US9956279B2 (en) 2013-05-08 2018-05-01 Protatek International, Inc. Vaccine for PCV2 and mycoplasma
US9649370B2 (en) 2013-05-08 2017-05-16 Protatek International, Inc. Vaccine for PCV2 and mycoplasma
US9987348B2 (en) 2013-09-25 2018-06-05 Zoetis Services Llc PCV2B divergent vaccine composition and methods of use
US9505808B2 (en) 2013-10-02 2016-11-29 Boehringer Ingelheim Vetmedica, Inc. PCV2 ORF2 protein variant and virus like particles composed thereof
US11858963B2 (en) 2013-10-02 2024-01-02 Boehringer Ingelheim Animal Health USA Inc. PCV2 ORF2 protein variant and virus like particles composed thereof
US12247051B2 (en) 2013-10-02 2025-03-11 Boehringer Ingelheim Animal Health USA Inc. PCV2 ORF2 protein variant and virus like particles composed thereof
WO2016073410A1 (en) 2014-11-03 2016-05-12 Merial, Inc. Methods of using microneedle vaccine formulations to elicit in animals protective immunity against rabies virus
WO2016183423A1 (en) 2015-05-14 2016-11-17 Merial Inc. Method for porcine circovirus production and pcv2 vaccines
EP3738975A1 (en) 2015-06-23 2020-11-18 Boehringer Ingelheim Animal Health USA Inc. Prrsv minor protein-containing recombinant viral vectors and methods of making and use thereof
EP3889166A1 (en) 2015-06-23 2021-10-06 Boehringer Ingelheim Animal Health USA Inc. Prrsv minor protein-containing recombinant viral vectors and methods of making and use thereof
WO2016210094A1 (en) 2015-06-23 2016-12-29 Merial, Inc. Prrsv minor protein-containing recombinant viral vectors and methods of making and use thereof

Also Published As

Publication number Publication date
KR100837724B1 (en) 2008-06-13
EP1975235A2 (en) 2008-10-01
HUP0201689A2 (en) 2002-09-28
ATE476510T1 (en) 2010-08-15
PT1975235E (en) 2016-01-27
DK1975235T3 (en) 2015-11-16
JP2003529323A (en) 2003-10-07
ES2560513T3 (en) 2016-02-19
HU229051B1 (en) 2013-07-29
CA2376600A1 (en) 2000-12-21
CA2376600C (en) 2011-05-03
EP1185660B1 (en) 2010-08-04
BRPI0011737B1 (en) 2017-10-24
PL205032B1 (en) 2010-03-31
PL352201A1 (en) 2003-08-11
WO2000077216A2 (en) 2000-12-21
KR20020028896A (en) 2002-04-17
CN1361824A (en) 2002-07-31
BR0011737A (en) 2002-03-05
EP1975235B1 (en) 2015-10-28
AU778520B2 (en) 2004-12-09
JP4859316B2 (en) 2012-01-25
DE60044778D1 (en) 2010-09-16
CN1195854C (en) 2005-04-06
AU5418900A (en) 2001-01-02
WO2000077216A3 (en) 2001-08-09
DK1185660T3 (en) 2010-10-04
PT1185660E (en) 2010-10-22
EP1975235A3 (en) 2008-12-10
MXPA01012723A (en) 2002-07-22
HUP0201689A3 (en) 2004-01-28
EP1185660A2 (en) 2002-03-13

Similar Documents

Publication Publication Date Title
EP1185660B1 (en) Porcine circovirus vaccine in recombinant poxvirus
CA2383367C (en) Prevention of myocarditis, abortion and intrauterine infection associated with porcine circovirus-2
JP2003529323A5 (en)
KR101347503B1 (en) Pcv-2 vaccine
AU5078600A (en) DNA vaccine - PVC
CN109803678B (en) Vaccine against porcine parvovirus
KR100805807B1 (en) Feline Calicivirus genes and vaccines, especially recombinant vaccines
EP0868522B1 (en) Recombinant poxvirus-feline infectious peritonitis virus, compositions thereof and methods for making and using them
US20130177582A1 (en) Parapoxvirus expressing the vp60 major capsid protein of the rabbit haemorrhagic disease virus
US6541458B1 (en) Feline calicivirus genes and vaccines in particular recombinant vaccines
ES2348219T3 (en) RECOMBINANT VIRUS POX VACCINE AGAINST SWINE CIRCOVIRUS.
AU769221B2 (en) Recombinant poxvirus-feline infectious peritonitis virus, compositions thereof and methods for making and using them

Legal Events

Date Code Title Description
AS Assignment

Owner name: MERIAL, FRANCE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BUBLOT, MICHEL;PEREZ, JENNIFER;CHARREYRE, CATHERINE E.;REEL/FRAME:011450/0052;SIGNING DATES FROM 20000809 TO 20000814

STCF Information on status: patent grant

Free format text: PATENTED CASE

CC Certificate of correction
FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: PAYER NUMBER DE-ASSIGNED (ORIGINAL EVENT CODE: RMPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12