ES2348219T3 - RECOMBINANT VIRUS POX VACCINE AGAINST SWINE CIRCOVIRUS. - Google Patents

Abstract

Immunogenic composition comprising (i) a recombinant pox virus comprising an isolated DNA molecule, where the pox virus is: ALVAC, or an attenuated canary pox where said canary pox virus is attenuated through more than 200 serial passes on chick embryo fibroblasts, of which the original seed was subjected to four successive plate purifications under agar, where a plate clone was amplified through five additional passes, and where the isolated DNA molecule comprises porcine circovirus ORF2 Type 2 (PCV2); and (ii) a carrier.

Description

Description FIELD OF THE INVENTION [0001] The present invention relates to the use of recombinant pox viruses, for example, modified pox viruses. In some embodiments, the present invention relates to the use of avian pox viruses, such as pox virus. Canary, for example, ALVAC. The present invention further relates to immunological compositions or vaccines comprising pox viruses expressing porcine circovirus 2 ORF2 (PCV2). The present invention further relates to the use of pox viruses that induce an immune response directed to or against ORF2 of PCV2 and / or PCV2; and, advantageously, to said compositions which are immunological, immunogenic or vaccine compositions and / or confer protective immunity against PCV2 infection. The present invention further relates to the uses and methods using said vectors and compositions, as well as intermediates thereof, and to said intermediates.

BACKGROUND OF THE INVENTION [0002] Post-weaning multisystemic wasting syndrome (PMWS) is a recently recognized disease of young pigs. PMWS is clinically characterized by progressive weight loss and other symptoms, such as tachypnea, sipnea and jaundice. Pathologically, lymphocytic and granulomatous infiltrates, lymphadenopathy and, more rarely, lymphocytic and granulomatous hepatitis and nephritis have been observed (Clark, 1997; Harding. 1997). [0003] This disease has been described in different European countries, as well as in North America. The treatment and prevention of this disease are not currently available. [0004] Several lines of evidence point to the porcine circovirus as the etiologic agent of PMWS (Ellis et al., 1998). Circovirus has been recovered from creeds with PMWS, and antibodies to porcine circovirus have been shown in pigs with the disease. [0005] Circoviruses are single-stranded circular DNA viruses found in a range of animal and plant species. The porcine circovirus was originally isolated as a contaminant from a continuous line of pig kidney. The cell culture isolate has been designated as PK-15 (Meehan et al., 1997). More recently, porcine circovirus obtained from pigs with PMWS has been compared with PK-15. Such viruses differ substantially from PK-15 at the level of nucleotide and protein sequences and have been designated as PCV2 (Meehan et al., 1998; Hamel et al., 1998). [0006] Up to thirteen open reading frames (ORF) have been identified in the PCV2 genome (COL1 to COL13 in French patent application 98 03707). Four of these ORFs share substantial homology with analog ORFs in the PK-15 genome. ORFI (Meehan et al., 1998; corresponding to COL4 in French patent application 98 03707), which comprises nucleotides 398-1342 (GenBank accession number AF055392), has the potential to encode a protein with an expected molecular weight of 37.7 kD ORF2 (Meehan et al., 1998; corresponding to COL13 in French patent application 98 03707) comprising nucleotides 13811768 attached to 1-314 (GenBank accession number AF055392), can encode a protein with an expected molecular weight of 27 , 8 kD. ORF3 (Meehan et al., 1998; corresponding to COL7 in French patent application 98 03707), which comprises nucleotides 1018-704 (GenBank accession number AF055392), can encode a protein with an expected molecular weight of 11.9 kD. ORF4 (Meehan et al., 1998; corresponding to COL10 in French patent application 98 03707), which comprises nucleotides 912-733 (GenBank accession number AF055392), can encode a protein with a predicted molecular weight of 6.5 kD. [0007] PCV2 ORF1 is highly homologous (86% identity) with the ORF1 of the PK-15 isolate (Meehan et al., 1998). The PK-15 ORF1 protein has been partially characterized (Meehan et al., 1997; Mankertz et al., 1998a). It is known to be essential for virus replication and is probably involved in viral DNA replication. [0008] The protein sequence identity among the respective ORF2 was lower (66% identity) than that of the ORF1, but each of the ORF2 shared a highly conserved basic N-terminal region, similar to that observed in the N-terminal region of the main structural protein of chick anemia virus (CAV) of avian circovirus (Meehan et al., 1998). Recently, Mankertz et al. (1998b) has suggested that the ORF2 of the PK-15 isolate (designated ORF1 in Mankertz et al., 1998b) encodes a capsid protein. [0009] Greater differences were observed between the respective ORF3 and ORF4 of the PK-15 isolate and PCV2-In each case, there was a deletion of the C-terminal region of ORF4 and ORF3 of PCV2 compared to the corresponding ORF present in the PK-15 isolate genome. The highest homology in the protein sequence was observed in the N-terminal regions of both ORF3 and ORF4 (Meehan et al., 1998).

[0010] The PCV2 genome transcript analysis has not been published yet. Recent data obtained with the PK-15 isolate indicated that the ORF2 transcript is spliced and spliced (Mankertz et al., 1998b). [0011] Vaccinia viruses have been successfully used to immunize against smallpox, culminating in the worldwide eradication of smallpox in 1980. With the eradication of smallpox, the new role of pox viruses has become important, the genetically engineered vector for the expression of exogenous genes (Panicali and Paoletti, 1982; Paoletti et al., 1984). The genes encoding heterologous antigens have been expressed in vaccinia, often resulting in protective immunity against stimulation by the corresponding pathogen (reviewed in Tartaglia et al., 1990). A highly attenuated vaccine strain, designated MVA, has also been used as a vector for pox virus-based vaccines. The use of MVA is described in US Patent No. 5,185,146. [0012] Two additional vaccine vector systems involve the use of pox viruses limited to natural hosts, avian pox viruses (avipox). Both avian smallpox virus (FPV; Taylor et al. 1988a, b) and canary pox virus (CPV; Taylor et al., 1991 & 1992) have been designed to express exogenous gene products. Avian smallpox virus (FPV) is the prototype virus of the Avipox genus of the Pox family. The virus causes an economically important poultry disease that has been well controlled since the 1920s through the use of live attenuated vaccines. Avipox virus replication is limited to avian species (Matthews, 1982) and there are no reports in the literature of avipox viruses that cause a productive infection in any non-avian species, including man. This host limitation provides an inherent safety barrier for the transmission of viruses to another species and makes the use of vaccine vectors based on avipox viruses in veterinary and human applications an attractive proposition. [0013] FPV has been used advantageously as a vector expressing poultry pathogen antigens. The hemagglutinin protein of a virulent avian influenza virus was expressed in a recombinant FPV (Taylor et al., 1988c). After inoculation of the recombinant in chicks and turkeys, an immune response was induced that was protective against stimulation with the homologous or heterologous influenza virus (Taylor et al., 1988c). FPV recombinants expressing the surface glycoproteins of Newcastle Disease Virus have also been developed (Taylor et al., 1990; Edbauer et al., 1990). [0014] Other attenuated pox viruses have been prepared by genetic modifications of wild-type virus strains. The NYVAC vector, derived by deletion of specific virulence genes and from various hosts of the Copenhagen strain of vaccinia (Tartaglia et al., 1992), has proven useful as a recombinant vector in obtaining a protective immune response against an exogenous antigen expressed. [0015] Another vector of pox virus designed in ALVAC, derived from the canary pox virus. ALVAC does not replicate productively in non-avian guests, a feature that is believed to improve the safety profile (Taylor et al., 1991 & 1992). Both ALVAC and NYVAC are BSL-1 vectors. [0016] A strategy for the development of a PCV2 subunit vaccine is the use of live viral vectors to express relevant PCV2 ORFs. Recombinant pox viruses can be constructed in two steps known in the art and analogous to methods for creating synthetic recombinants of pox viruses, such as vaccinia virus and avipox virus described in US Patent Nos. 4,769,330; 4,722,848; 4,603,112; 5,110,587; 5,174,993; 5,494,807; and 5,505,941. It should therefore be understood that the arrangement of a PCV2 recombinant pox virus, and of compositions and products thereof, particularly recombinant of PCV2 based on ALVAC and compositions and products thereof, especially recombinants containing ORF 1 and / or 2 of PCV2 and compositions and products thereof, would be a highly desirable advance on the state of current technology.

OBJECTIVES AND SUMMARY DESCRIPTION OF THE INVENTION [0017] Therefore, an objective of the present invention is to provide compositions and methods for the treatment and prophylaxis of infection with PCV2. It is also an objective to provide a means to treat or prevent PMWS. [0018] In one aspect, the present invention provides an immunogenic composition comprising (i) a recombinant pox virus comprising an isolated DNA molecule, wherein the pox virus is: ALVAC, or an attenuated canary pox where said pox virus of Canary is attenuated through more than 200 serial passes on chick embryo fibroblasts, of which the original seed was subjected to four successive plate purifications under agar, from which a plate clone was amplified through five additional passes, and where the isolated DNA molecule comprises porcine circovirus type 2 ORF2 (PCV2); and (ii) a carrier. [0019] In a further aspect, the present invention provides the use of a recombinant pox virus comprising an isolated DNA molecule, where the pox virus is: ALVAC, or an attenuated canary pox where said canary pox virus is attenuated to through more than 200 serial passes on chick embryo fibroblasts, of which the original seed was subjected to four successive plate purifications under agar, from which a plate clone was amplified through five additional passes, and where the molecule Isolated DNA comprises ORF2 of PCV2; for the preparation of an immunogenic composition to induce an immune response against PCV2 in an adult pig, a young pig or a pregnant sow. [0020] In another aspect, the present invention provides a vaccine comprising (i) a recombinant pox virus comprising an isolated DNA molecule, where the pox virus is: ALVAC, or an attenuated canary pox where said canary pox virus is attenuates through more than 200 serial passes on chick embryo fibroblasts, of which the original seed was subjected to four successive plate purifications under agar, from which a plate clone was amplified through five additional passes, and where the isolated DNA molecule comprises porcine circovirus type 2 ORF2 (PCV2); and (ii) a carrier. [0021] In one aspect, the description refers to an antigenic, immunological, immunogenic or vaccine composition or a therapeutic composition for inducing an antigenic, immunogenic or immunological response in a host animal inoculated with the composition. The composition advantageously includes a carrier or diluent and a recombinant virus, such as a recombinant pox virus. The recombinant pox virus or virus contains and expresses an exogenous nucleic acid molecule that encodes an ORF, antigen, immunogen or epitope of interest to PCV2, or a protein that produces an immune response against PCV2 or conditions caused by PCV2, such as PMWS. For example, the recombinant virus may be modified recombinant pox virus or virus; for example, said virus or pox virus that has inactivated in the same genetic functions encoded by the virus, for example, genetic functions encoded by the non-essential virus, so that the recombinant virus has an attenuated virulence and increased security. The description also provides the viruses used in the composition, as well as methods for the manufacture and uses of the composition and viruses. [0022] The virus used in the composition according to the description is advantageously a pox virus, particularly a vaccinia virus or an avipox virus, such as avian smallpox virus or canary pox virus and more advantageously, ALVAC. The modified recombinant virus may include, for example, a non-essential region of the virus genome, a heterologous DNA sequence encoding an antigenic protein, for example, derived from PCV2 ORFs, for example, PCV2 ORF 1 and / or 2 . [0023] In another aspect, the description refers to an immunogenic composition containing a modified recombinant virus that has genetic functions encoded by the inactivated non-essential virus, so that the recombinant virus has an attenuated virulence and increased safety. The modified recombinant virus includes, for example, in a non-essential region of the virus genome, a heterologous DNA sequence encoding an antigenic protein (for example, derived from PCV2 ORFs, especially ORF 1 and / or 2), where the Composition, when administered to a host, is capable of inducing a specific immune response for the antigen. [0024] In a further aspect, the description refers to a modified recombinant virus that has genetic functions encoded by the non-essential virus inactivated therein, so that the virus has an attenuated virulence, and where the modified recombinant virus also contains DNA from a heterologous origin, for example, in a non-essential region of the virus genome. The DNA can encode PCV2 genes, such as some or all of ORF1, ORF2, ORF3, or ORV4 of PCV2 (Meehan et al., 1998), or epitope or epitopes of interest thereof. Genetic functions can be inactivated by deleting an open reading frame that encodes a virulence factor or by using viruses limited to natural hosts. The virus used according to the description is advantageously a pox virus, for example, a vaccinia virus or an avipox virus, such as avian smallpox virus or canary pox virus. [0025] Advantageously, the open reading frame that is removed from the pox virus genome or virus is selected from the group consisting of J2R, B 13R + B14R, A26L, A56R, C7L-K1L, and I4L (according to terminology indicated in Goebel et al.,

1990); and the combination thereof. In this aspect, the open reading frame comprises a thymidine kinase gene, a hemorrhagic region, a type A inclusion body region, a hemagglutinin gene, a host variety gene region or a large subunit, ribonucleotide reductase ; or, the combination thereof. [0026] A suitable modified Copenhagen strain of vaccinia virus is identified as NYVAC (Tartaglia et al., 1992), or a vaccinia virus from which J2R, B13R + B14R has been removed. A26L, A56R, C7L-K11 and I4L or a thymidine kinase gene, a hemorrhagic region, an inclusion body region of type A, a hemagglutinin gene, a region of the host variety gene and a large subunit, ribonucleotide reductase (See also US Patent No. 5,364,773, 5,494,807, and 5,762,938, with respect to NYVAC and vectors that have additional deletions or inactivations of those of NYVAC that are also useful in the practice of this description). [0027] Preferably, the pox virus vector is an ALVAC or a canary pox virus that was attenuated, for example, through more than 200 serial passes on chick embryo fibroblasts (Rentschler vaccine strain), of which The original seed was subjected to four successive plate purifications under agar, from which a plate clone was amplified through five additional passes. (See also US Patent Nos. 5,756,103 and 5,766,599 with respect to AT VAC and TROVAC (an attenuated avian smallpox virus useful in the practice of this description); and United States Patents Nos. 6,004,777, 5,990,091, 5,770,212, 6,033,904, 5,869,312, 5,382,425, and WO 95/30018, with respect to vectors that can also be used in the practice of this description, such as vectors that have a higher expression, vectors that have functions removed therefrom and useful vectors with respect to to porcine hosts (for example, useful vectors with porcine hosts may include, a pox virus, including a vaccinia virus, an avipox virus, a canary pox virus and a pig pox virus), as well as with respect to the terms used and teachings of the present invention, such as "immunogenic composition", "immunological composition", "vaccine", and "epitope of interest", and dosage, routes of administration, formulation ones, adjuvants and suso for recombinant viruses and expression products thereof). [0028] The description in a further aspect refers to the expression product of the recombinant pox virus and the uses thereof, such as to form antigenic, immunological or vaccine compositions for treatment,

prevention, diagnosis or analysis; and to recombinant pox virus DNA that is useful in the construction of DNA probes and PCR primers. [0029] These and other embodiments are described or obvious from the following Detailed description and are comprised by it.

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] A better understanding of the description will be achieved by referring to the accompanying drawings, incorporated in the present invention by reference, in which:

•

Figure 1 (SEQ ID NO: 1) shows the nucleotide sequence of a 3.7-kilogram pair of ALVAC DNA fragments containing the open reading frame C6.

•

Figure 2 shows the map of the donor plasmid pJP102.

•

Figure 3 (SEQ ID NO: 8) shows the nucleotide sequence of the 2.5-kilogram pair fragment of the donor plasmid pJP102 from the KpnI restriction sites (position 653) to SacI (position 3166).

•

Figure 4 shows the map of the donor plasmid pJP105.

•

Figure 4 shows the map of the donor plasmid pJP107.

•

Figure 6 (SEQ ID NO: 11) shows the nucleotide sequence of the 3.6 kilogram pair fragment of the donor plasmid pJP107 from the KpnI restriction sites (position 653) to SacI (position 4255).

DETAILED DESCRIPTION [0031] In one aspect, the description refers to a recombinant virus, such as a recombinant pox virus, which contains a PCV2 DNA sequence therein, for example, in a non-essential region of the pox virus genome. . The pox virus is advantageously an avipox virus, such as avian smallpox virus, especially an attenuated avian smallpox virus, or a canary pox virus, such as ALVAC. [0032] According to the description, the recombinant pox virus expresses gene products of the exogenous PCV2 gene. Specific PCV2 ORFs are inserted into the pox virus vector and the resulting recombinant pox virus is used to infect an animal. The expression in the animal of PCV2 gene products results in an immune response in the animal to PCV2. Thus, the recombinant pox virus of the description can be used in an immunological composition or vaccine to provide a means to induce an immune response that may be, but not necessarily, protective. [0033] The method of administration for the recombinant PCV2 pox virus or the expression product thereof, compositions of the description, such as immunological, antigenic or vaccine compositions or therapeutic compositions, can be through a parenteral route (intradermal, intramuscular or subcutaneous). Such administration allows a systemic immune response or humoral responses.

or cell mediated. [0034] More generally, recombinant PCV2 pox viruses, antigenic, immunological or vaccine pox PCV2 virus compositions or therapeutic compositions can be prepared according to standard techniques known to those skilled in the pharmaceutical or veterinary field. Said compositions can be administered in doses and by techniques known to experts in the pharmaceutical or veterinary field taking into consideration factors such as the age, sex, weight, species and condition of the particular patient and the route of administration. The compositions can be administered alone or can be co-administered or sequentially administered with compositions, for example, with "other" immunological, antigenic or vaccine or therapeutic compositions, thus providing multivalent or "cocktail" or combination compositions and methods that use them. Again, the ingredients and method of administration (sequential or co-administration), as well as dosage dosages, can be determined taking into account factors, such as the age, sex, weight, species and condition of the particular patient and, the route of administration . In this regard, reference is made to US Patent No. 5,843,456, directed to anti-rabies compositions and combination compositions and uses thereof. [0035] Examples of mentioned compositions in which liquid orifice preparations are included, for example, oral, nasal, anal, vaginal, peroral, intragastric administration, etc., such as suspensions, syrups or elixirs; and preparations for parenteral, subcutaneous, intradermal, intramuscular administration

or intravenously (eg, injectable administration), such as sterile suspensions or emulsions. In such compositions, the recombinant pox virus or antigens may be in an intimate mixture with a carrier, diluent or excipient, such as sterile water, physiological saline, glucose or the like. The compositions can also be lyophilized. The compositions may contain auxiliary substances, such as wetting or emulsifying agents, pH buffering agents, adjuvants, gelling or viscosity enhancing additives, preservatives, flavoring agents, colorants, and the like, depending on the route of administration and the desired preparation. Standard texts, such as "REMINGTONS PHARMACEUTICAL SCIENCE", 17th edition, 1985, can be consulted for

Prepare suitable preparations, without much experimentation. Suitable doses can also be based on the following Examples. [0036] The compositions may contain at least one adjuvant compound selected from the acrylic or methacrylic acid polymers and the copolymers of

5 maleic anhydride and alkenyl derivatives. [0037] Preferred adjuvant compounds are crosslinked acrylic or methacrylic acid polymers, especially with polyalkenyl ethers of sugars or polyalcohols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Those skilled in the art can also

10 refer to US Patent No. 2,909,462 which describes said crosslinked acrylic polymers with a polyhydroxy compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms being at least three radical substituted hydroxyls unsaturated aliphatics having at least 2 carbon atoms. Preferred radicals are those containing

15 2 to 4 carbon atoms, for example, vinyl, allyls and other ethylenically unsaturated groups. Unsaturated radicals may themselves contain other substituents, such as methyl. Products marketed under the name Carbopol® (BF Goodrich, Ohio, USA) are particularly appropriate. They are crosslinked with allyl sucrose or with allyl pentaerythritol. Among them, we can mention Carbopol® 974P,

20 934P and 971P. [0038] Among the copolymers of maleic anhydride and alkenyl derivative, EMA® (Monsanto) copolymers which are linear or crosslinked maleic and ethylene anhydride copolymers are preferred, for example, crosslinked with divine ether. Reference is made to J. Fields et al., Nature, 186: 778-780, June 4, 1960.

[0039] From the point of view of their structure, acrylic or methacrylic acid polymers and EMA® copolymers are preferably formed from basic units of the following formula: in which: -R1 and R2, which are identical or different , represent H or CH3 -x = 0 or 1, preferably x = 1 -y = 1 or 2, with x + y = 2 [0040] For EMA® copolymers, x = 0 and y = 2. For carbomers, x = y = 1. [0041] The dissolution of these polymers in water leads to an acid solution that will be neutralized, preferably to physiological pH, in order to provide the adjuvant solution in which the vaccine itself will be incorporated. The carboxyl groups of the polymer are then partially in the form of COO-. [0042] Preferably, a solution of adjuvant, especially carbomer, in distilled water, preferably in the presence of sodium chloride, is prepared, the solution being obtained at an acidic pH. This stock solution is diluted by adding it to the desired amount (to obtain the desired final concentration) or a substantial part thereof, of water loaded with NaCl, preferably physiological saline solution (NaCl 9 g / l), quickly in several parts with a concomitant or subsequent neutralization (pH 7.3 to 7.4), preferably with NaOH. This solution at physiological pH will be used as is to mix with the vaccine, which can be stored especially in lyophilized, liquid or frozen form. [0043] The concentration of the polymer in the final vaccine composition will be 0.01 to 2% w / v, more particularly 0.06 to 1% w / v, preferably 0.1 to 0.6% w / v. [0044] Immunological compositions according to the description can be associated with at least one live, inactivated, subunit or recombinant vaccine attenuated vaccine (eg, pox virus as vector or plasmid DNA) expressing at least one immunogen of another pathogen of pork [0045] The description comprises vectors that encode and express equivalent nucleotide sequences, that is, sequences that do not change either the functionality or the specificity of strain (type 1 strain and type 2 strain) of the gene under consideration or those of polypeptides encoded by this gene. Naturally, sequences that differ by code degeneration are included. [0046] The sequences of PCV-2 used in the examples are derived from Meehan et al. (Strain Imp. 1010 nucleotides of ORF1 398-1342; nucleotides of ORF2 1381-314; and correspond respectively to ORF4 and ORF13 in the United States application for Serial No. 09 / 161,092 of September 25, 1998 and to COL4 and COL13 in WO -A9918214). Other strains of PCV-2 and their sequences have been published in WO-A-9918214 and are called Imp1008, Imp999, Imp1011-48285 and Imp1011-48121, as well as in

image 1

TO THE.

Hamel et al. J. Virol. June 1998, vol 72, 6: 5262-5267 (GenBank AF027217) and in

I.

Morozov et al. J. Clinical Microb. Sept. 1998 vol. 36, 9: 2535-2541, as well as GenBank AF086834, AF086835 and AF086836, and give access to equivalent ORF sequences. These sequences, or ORFs thereof, or regions thereof encoding an antigen or epitope of interest can also be used in the practice of this description.

[0047] The description also comprises the sequences equivalent to those used in the present invention in the documents cited herein; for example, sequences that are capable of hybridizing to the nucleotide sequence under conditions of high astringency (see, for example, Sambrook et al. (1989). Among the equivalent sequences, gene fragments that retain the immunogenicity of the complete sequence, for example, an epitope of interest. [0048] The homology of the entire genome between types 1 and 2 of PCV is approximately 75%. For ORF1, it is approximately 86%, and for ORF2, approximately 66% On the contrary, homologies between genomes and between ORF in type 2 are generally above 95%.

[0049] In addition, the equivalent sequences useful in the practice of this description, for ORF1, are those sequences that have a homology equal to or greater than 88%, advantageously 90%, or greater, preferably 925 or 95% or higher with ORF1 of strain Imp1010, and for ORF2, are those sequences that have a homology equal to or greater than 80%, advantageously 85% or higher, preferably 90% or 95% or higher with ORF2 of the strain Imp1010. [0050] ORF1 and ORF2 according to Meehan 1998 has the potential to encode proteins with predicted molecular weights of 37.7 kD and 27.8 kD respectively. ORF3 and ORF4 (according to Meehan et al. 1998, correspond to ORF7 and ORF 10 respectively in WOA-9918214) have the potential to encode proteins with predicted molecular weights of 11.9 and 6.5 kD, respectively. The sequences of these ORFs are also available in Genbank AF 055392. They can also be incorporated into plasmids and can be used according to the description alone or in combination, for example, with ORF1 and / or ORF2. [0051] The other ORF 1-3 and 5, 6, 8-9, 11-12 described in U.S. application. of Serial No. 09 / 161,092 of September 25, 1998 (COLs 1-3 and 5, 6, 8-9, 11-12 in WO-A9918214), or the region or regions thereof encoding an antigen or epitope of of interest, they may be used in the practice of this description, for example, alone or in combination or, in any case, with each other or with ORFs 1 and 2 or the region or regions thereof encoding the antigen or antigens or epitope or epitopes [0052] This description also includes the use of equivalent sequences; for example, from ORFs of several PCV-2 strains cited here. For homology, it can be determined that there are equivalent sequences that come from a strain of PCV that has an ORF2 and / or an ORF1 that have a homology as defined above with the corresponding ORF of strain 1010. [0053] ORF3 according to Meehan, an equivalent sequence has a homology with it which is advantageously, for example, equal to or greater than 80%, for example 85% or higher, preferably 90% or 95% or higher with ORF3 of strain Imp1010 . For ORF4 according to Meehan 1998, an equivalent sequence advantageously has a homology that is equal to or greater than 86%, advantageously 90% or more, preferably 95% or more with ORF4 of the Imp 1010 strain. [ 0054] From the genomic nucleotide sequence, for example, those described in WO-A-99 18214, it is routine to determine ORFs using standard software, such as MacVector®. In addition, the alignment of genomes with those of strain 1010 and comparison with the ORF of strain 1010 allows a person skilled in the art to easily determine the ORF of the genome of another strain (eg, other strains described in WO-A- 99 18214 or in other documents cited here). [0055] The use of software or sequence alignment does not involve much experimentation and provides direct access to ORF or equivalent nucleic acid molecules. [0056] Nucleotide sequence homology can be determined using the Myers and Miller "Align" program, ("Optimal Alignments in Linear Space", CABIOS 4, 11-17, 1988) and available at NCBI. Alternatively or additionally , the term "homology" or "identity", for example, with respect to a nucleotide or amino acid sequence, may indicate a quantitative measure of homology between two sequences.The percentage in sequence homology can be calculated as (Nref-Ndif ) * 100 / Nref, where Ndif is the total number of non-identical residues in the two sequences when aligned and where Nref is the number of residues in one of the sequences, therefore, the AGTCAGTC DNA sequence will have a sequence similarity 75% with the sequence AATCAATC (Nref = 8; Ndif = 2). [0057] Alternatively or additionally, "homology" or "identity" with respect to the sequences may refer to the number of positions with identical nucleotides or amino acids div idido by the number of nucleotides or amino acids in the shortest of the two sequences, where the alignment of the two sequences can be determined according to the algorithm of Wilbur and Lipman (Wilbur and Lipman, 1983 PNAS USA 80: 726), for example, using a window size of 20 nucleotides, a word length of 4 nucleotides, a space penalty of 4, and a computer-assisted analysis and sequence interpretation including alignment using commercially available programs can be conveniently performed ( for example, Intelligenetics ™ Suite, Intelligenetics Inc. CA). When it is said that RNA sequences are similar, or have a degree of identity or homology of the sequence with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. . [0058] RNA sequences within the scope of the description can be derived from DNA sequences, considering thymidine (T) in the DNA sequence equal to uracil (U) in RNA sequences. [0059] Additionally or alternatively, the similarity or identity or homology of the amino acid sequence can be determined using the BlastP program (Altschul et al., Nucl. Acids Res. 25, 3389-3402) and available at NCBI. The following references provide algorithms for comparing the identity or relative homology of amino acid residues of two proteins and additionally or alternatively, with respect to the above, the teachings in these references can be used to determine the percentage of homology or identity: Needleman SB and Wunsch CD, "A general method applicable to the search for similarities in the amino acid sequences of two proteins," J. Mol. Biol. 48: 444-453 (1970); Smith TF and Waterman MS, "Comparison of Bio-sequences" Advances in Applied Mathematics 2: 482-489 (1981); Smith TF, Waterman MS and Sadler JR, "Statistical characterization of nucleic acid sequence functional domains," Nucleic Acids Res, 11: 2205-2220 (1983); Feng DF and Dolittle RF, "Progressive sequence alignment as a prerequisite to correct phylogenetic trees," J. of Molec. Evol., 25: 351-360, (1987); Higgins DG and Sharp PM, "Fast and sensitive multiple sequence alignment on a microcomputer," CABIOS 5: 151-153 (1989); Thompson JD, Higgins DG and Gibson TJ, "ClusterW: improving the sensitivity of progressive multiple sequence alignment through sequence weighing, positionsspecific gap penalties and weight matrix choice, Nucleic Acid Res., 22: 4673-480 (1994); and, Devereux J , Haeberlie P and Smithies O, "A comprehensive set of sequence analysis program for the VAX," Nucl. Acids Res., 12: 387-395 (1984). [0060] This description not only allows administration in adult pigs, but also in young people and in pregnant females; in the latter case, this makes it possible, in particular, to confer passive immunity to newborns (maternal antibodies). Preferably, the sows are inoculated before reproduction; and / or before mating and / or during pregnancy Advantageously, at least one inoculation is performed before mating and preferably it is followed by an inoculation to be carried out during pregnancy, for example, about halfway through pregnancy (approximately te 6-8 weeks of gestation) and / or at the end of gestation (approximately 11-13 weeks of gestation). Thus, an advantageous pattern is an inoculation before breeding and / or mating and a reinforcement inoculation during pregnancy. Next, there may be a realm before each mating and / or during gestation at approximately half of gestation and / or at the end of gestation. Preferably, the kingdoms are during pregnancy. Pigs can also be inoculated, for example, before mating. [0061] Piglets, such as piglets of vaccinated females (for example, inoculated as described herein), are inoculated in the first weeks of life, for example, inoculation in week one and / or two and / or three and / or four and / or five of life. Preferably, the piglets are first inoculated in the first week of life

or in the third week of life (for example, at the time of weaning). Advantageously, said piglets are then reinforced two to four weeks later. [0062] The present description is further described by the following non-limiting illustrative examples.

EXAMPLES [0063] The description in a preferred embodiment refers to recombinant pox viruses containing a PCV2 DNA sequence therein in a non-essential region of the pox virus genome. Gene products that express the recombinant pox viruses of the exogenous PCV2 gene. In particular, the ORF2 and ORF1 genes encoding PCV2 proteins were isolated, characterized and inserted into ALVAC recombinants (canary pox vector). The molecular biology techniques used are those described by Sambrook et al. (1989). Cell Lines and Virus Strains. The strain of PCV2 designated as Imp: 1010-Stoon has been previously described (Meehan et al., 1998). It was isolated from mesenteric lymph node tissues of a diseased pig originating in Canada. Cloning of the PCV2 genome was described by Meehan et al. (1998). Plasmid pGem7ZImp1010-Stoon-EcoRI No. 14 contains the PCV2 genome as an EcoRI fragment inserted into the EcoRI site of plasmid pGem-7Z (Promega, Madison, WI). The complete nucleotide sequence of the strain of PCV-2 Imp.1010-Stoon PCV2 was determined by Meehan et al. (1998) and is capable under the GenBank accession number AF055392. [0064] The parental canary pox virus (Rentschler strain) is a vaccine strain for canaries. The vaccine strain was obtained from a wild-type isolate and was attenuated through more than 200 serial passes on chick embryo fibroblasts. An original viral seed was subjected to four successive plate purifications under agar and a plaque clone was amplified through five additional passes, after which the original virus was used as a parental virus in in vitro recombination tests. The purified canary pox isolate on plate was designated as ALVAC. ALVAC was deposited on November 14, 1996 under the terms of the Budapest Treaty in the American Type Culture Collection, ATCC accession number VR-2547. [0065] The generation of pox virus recombinants involves different stages: (a) construction of an insertion plasmid containing sequences ("arms") that flank the insertion locus in the pox virus genome, and a multiple cloning site (MCS) located between the two flanking arms (for example, see Example 1); (2) construction of donor plasmids consisting of an insertion plasmid in the MCS in which an exogenous gene expression cassette has been inserted (eg, see examples 2 to 5); (3) in vitro recombination in cell culture between the arms of the donor plasmid and the parental pox virus genome that allows the insertion of the exogenous gene expression cassette into the appropriate locus of the pox virus genome, and plaque purification of the virus recombinant (for example, see example 6).

[0066] PCV2 recombinant immunogens can be used in association with PCV1 immunogens for immunization of animals against PMWS. In a less preferred strategy, PCV1 immunogens without PCV2 immunogens can be used. Example 1 - CONSTRUCTION OF CANARY POX INSERTION PLASID IN LOCUS C6 [0067] Figure 1 (SEQ Id No. 1) is the sequence of a 3.7 kb segment of the canary pox DNA. Sequence analysis revealed an ORF designated as C6L that starts at position 377 and ends at position 2254. Next, a C6 insertion plasmid constructed by removing the C6 ORF and replacing it with a site is described. Multiple cloning (MCS) flanked by transcriptional and translational termination signals. A 380 bp PCR fragment was amplified from canary pox genomic DNA using oligonucleotide primers C6A1 (SEQ ID NO: 2) and C6B1 (SEQ ID NO: 3). A 1155 bp PCR fragment was amplified from canary pox genomic DNA using oligonucleotide primers C6C1 (SEQ ID NO: 4) and C6D1 (SEQ ID NO: 5). The 380 bp and 1155 bp fragments were fused by addition as template and amplification of a 1613 bp PCR fragment using oligonucleotide primers C6A1 (SEQ ID NO: 2) and C6D1 (SEQ ID NO: 5). This fragment was digested with SacIy KpnI, and bound in pBluescript SK + (Stratagene, La Jolla, CA, USA) digested with SacI / KpnI. The resulting plasmid, pC6L was confirmed by DNA sequence analysis. It consists of 370 bp of canary pox DNA in the 5 'direction of C6 ("left arm of C6"), the early termination of vaccinia signal, the translation stop codons in six reading frames, an MCS containing the SmaI, PstI, XhoI and EcoRI sites, early termination of vaccinia signal, translation stop codons in six reading frames and the 1156 bp sequence in the 3 'direction of the canary pox ("right arm of C6"). [0068] Plasmid pJP099 from pC6L was derived by binding a cassette containing the H6 vaccinia promoter (described in Taylor et al. (1988c), Guo et al. (1989), and Perkus et al. (1989) ) coupled to an exogenous gene at the SmaI / EcoRI sites of pC6L. This plasmid pJP099 contains a unique EcoRV site and a unique NruI site located at the 3 ’end of the H6 promoter and a unique SalI site located between the STOP codon of the exogenous gene and the left arm of C6. The EcoRV / SalIo NruI / SalI fragment of ~ 4.5 kb of pJP099 therefore contains the plasmid sequence (pBluescript SK +; Stratagene, La Jolla, CA, USA), the two C6 arms and the 5 'end of the H6 promoter to the EcoRV or NruI site. Sequences of the primers:

[0069]

Primer C6A1 (SEQ ID NO: 2) ATCATCGAGCTCGCGGCCGCCTATCA.AAAGTCTTAATGAGTT Primer C6B1 (SEQ ID NO: 3)

image2

Primer C6C1 (SEQ ID NO: 4) Primer C6D1 (SEQ ID NO: 5) GATGATGGTACCTTCATAAATACAAGTTTGATTAAACTTAAGTTG

image2

Example 2 - CONSTRUCTION OF ALVAC GIVER PLASMID FOR PCV2 ORF2 [0070] Plasmid pGem7Z-Imp1010-Stoon-EcoRF No. 14, containing the PCV2 genome as an EcoRI fragment in plasmid pGem-7Z was digested with EcoRI , and a 1768 bp fragment was isolated and bound. [0071] In order to insert the PCV2 ORF2 into an appropriate ALVAC insertion vector; Primers JP760 (SEQ ID NO: 6) and JP773 (SEQ ID NO: 7) were used to amplify PCV2 ORF2 from the attached Eco68 fragment of 1768 bp (see above) which results in PCR J1304. Primer JP760 (SEQ ID NO: 6) contains the 3 ′ end of the EcoRV H6 promoter and the 5 ′ end of PCV2 ORF2. Primer JP773 (SEQ ID NO: 7) contains the 3 ′ end of PCV2 ORF2 followed by the SalI site. The J1304 PCR product was then digested with EcoRV / SalI and cloned as a ~ 750 bp fragment into a ~ 4.5 kb EcoRV / SalI fragment of pJP099 (see above in Example 1). The resulting plasmid was confirmed by sequence analysis and designated as pJP102 (see map of pJP102 in Figure 2 and the sequence (SEQ ID NO: 8) in Figure 3). The sequence of ORF2 matches the sequence available in GenBank, Accession number AF055392. The donor plasmid pJP102 (linearized with NotI) is used in an in vitro recombination test (IVR) to generate the ALVAC recombinant vCP1614 (see example 6). Sequence of the primers:

[0072]

JP760 (SEQ ID NO: 6)

image2

JP773 (SEQ ID NO: 7) TAC-TAC-TAC-GTC-GAC-TTA-GGG-TTT-AAG-TGG-GGG-GTC

Example 3 - CONSTRUCTION OF AN ALVAC GIVING PLASMY FOR ORF1 AND ORF2 OF PCV2 [0073] PCV2 ORF1 was amplified by PCR using primers JP774 (SEQ ID NO: 9) and JP775 (SEQ ID NO: 10) in the plasmid pGem7Z-Imp1010-Stoon-EcoRI No. 14 which results in J1311 PCR. Primer JP774 (SEQ ID NO: 9) contains the 3 ′ end of the NruI H6 promoter and the 5 ′ end of PCV2 ORF1. Primer JP775 (SEQ ID NO: 10) contains the 3 ′ end of PCV2 ORF1 followed by a SalI site. The J1311 PCR product (~ 1Kb) was cloned into pCR2.1 (Invitrogen, Carlsbad, CA). The resulting plasmid was confirmed by sequence analysis and designated as pJP104. The sequence of ORF1 matches the sequence available in the GenBank, Access Number AF055392. A ~ 970 bp NruI / SalI fragment from pJP 104 was isolated and cloned into a ~ 4.5 kb NruI / SalI fragment from pJP099 (see Example 1), which gives rise to a plasmid that was confirmed by restriction analysis and was designated as pJP105 (see Figure 4). The donor plasmid pJP105 could be used in an in vitro recombination test (described in example 6) to generate ALVAC recombinant expressing PCV2 ORF1. [0074] Blunt ends of a BamHI / SalI fragment of pJP102 (see Example 2) were created using the Klenow fragment of DNA polymerase, and cloned into the EcoRI site with blunt ends created by Klenow of pJP105. Clone insertion orientation was checked by restriction analysis and head-to-head orientation was chosen. This plasmid was confirmed by sequence analysis and designated as pJP107 (see map of pJP107 in Figure 5 and the sequence (SEQ ID NO: 11) in Figure 6). The donor plasmid pJP107 (linearized with NotI) was not used in an in vitro recombination test 5 (IVR) to generate the ALVAC recombinant vCP1615 (see Example 6). Sequence of the primers:

[0075]

JP774 (SEQ ID NO: 9)

image2

JP775 (SEQ ID NO: 10) TAC-TAC-TAC-GTC-GAC-TCA-GTA-ATT-TAT-TTC-ATA-TGG

Example 4 - CONSTRUCTION OF ALVAC GIVER PLASMID FOR PCV1 ORF2 [0076] Plasmid pPCV1 was used (B. Meehan et al. J. Gen. Virol. 1997. 78. 221227), which contained the PCV1 genome as a Pst1en fragment the plasmid pGem-7Z, as a template to amplify the ORF2 of PCV1. [0077] In order to insert the PCV2 ORF2 into an appropriate ALVAC insertion vector: Primers JP787 (SEQ ID NO: 12) and JP788 (SEQ ID NO: 13) were used to amplify the PCV1 ORF2 of the plasmid pPCV1 (see above) that results in J1315 PCR. Primer JP787 (SEQ ID NO: 12) contains the 3 ′ end of the H6 promoter of EcoRV and ORF 2 followed by the SalI site. The J1315 PCR product was then digested with EcoRV / SalI and cloned as a ~ 750 bp fragment into a ~ 4.5 kb EcoRV / SalI fragment of pJP099 (see above in Example 1). The resulting plasmid was confirmed by sequence analysis and designated as pJP113. The sequence of ORF2 matches the sequence available in GenBank, Access Number U49186. The donor plasmid pJP1113 (linearized with NotI) was used in an in vitro recombination test (IVR) to generate the ALVAC recombinant vCP1621 (see Example 7). Sequence of the primers:

[0078]

JP787 (SEQ ID NO: 12)

image2

JP788 (SEQ ID NO: 13) TAC-TAC-TAC-GTC-GAC-TTA-TTT-ATT-TAG-AGG-GTC-TTT-TAG-G

Example 5 - CONSTRUCTION OF A PLASMID FOR ORF2 AND ORF1 OF PCV1 [0079] Plasmid pPCV1 was digested with PstI (see Example 4 above), which contained the PCV1 genome as a PstI fragment in plasmid pGem-7Z, and was isolated and ligated a fragment of 1759 bp. [0080] Primers JP789 (SEQ ID NO: 1) and JP790 (SEQ ID NO: 15) were used to amplify the PCV1 ORF1 of the 1759 bp bound PstI fragment (see above), which results in PCR J1316. Primer JP789 (SEQ ID NO: 14) contains the 3 ′ end of the NruI H6 promoter and the 5 ′ end of PCV1 ORF1. Primer JP790 (SEQ ID NO: 15) contains the 3 ′ end of PCV1 ORF1 followed by a SalI site. The J1316 PCR product (~ 1 Kb) was cloned into pCR2.1 (Invitrogen, Carlsbad, CA). The resulting plasmid was confirmed by sequence analysis and designated as pJP114. The sequence of ORF1 matches the sequence available in GenBank, Access Number U49186. A ~ 970 bp NruI / SalI fragment of pJP114 was isolated and cloned into a ~ 4.5 kb NruI / SalI fragment of pJP099 (see Example 1), which gives rise to a plasmid that was confirmed by restriction analysis and was designated as pJP115. The donor plasmid pJP115 could be used in an in vitro recombination test (described in example 7) to generate an ALVAC recombinant expressing PCV1 ORF1. [0081] Blunt ends of a BamHI / SalI fragment of pJP113 (see Example 4) were created using the Klenow fragment of DNA polymerase, and cloned into the EcoRI site with blunt ends created by Klenow of pJP115. Clone insertion orientation was checked by restriction analysis and head-to-head orientation was chosen. This plasmid was confirmed by sequence analysis and designated as pJP117. The donor plasmid pJP117 (linearized with NotI) was not used in an in vitro recombination test (IVR) to generate the ALVAC recombinant vCP1622 (see Example 7). Sequence of the primers:

[0082]

JP789 (SEQ ID NO: 1)

image2

JP790 (SEQ ID NO: 15) TAC-TAC-TAC-GTC-GAC-TCA-GTA-ATT-TAT-TTT-ATA-TGG

Example 6 - GENERATION OF ALVAC-PCV2 RECOMBINANTS [0083] Plasmids pJP102 (see Example 2 and Figure 2) and pJP107 (see Example 3 and Figure 5) were linearized with NotI and transfected into infected primary CEF cells with ALVAC using the calcium phosphate precipitation method described above (Panicali and Paoletti, 1982; Piccini et al., 1987). Positive plaques were selected based on hybridization to radiolabelled probes of specific PCV2 and subjected to four sequential rounds of plate purification until a pure population was achieved. Next, a representative plate of each IVR was amplified and the resulting ALVAC recombinants were designated as vCP1614 and vCP1615. The vCP1614 virus is the result of cases of recombination between ALVAC and the donor plasmid pJP102 and contains the PCV2 ORF2 inserted into the C6 locus of ALVAC. The vCP1615 virus is the result of recombination cases between ALVAC and the donor plasmid pJP107, and contains the PCV2 ORF2 and ORF1 inserted in the ALVAC C6 locus in the head-to-head orientation. [0084] Similarly, a recombinant ALVAC expressing only PCV2 ORF1 can be generated using the donor plasmid pJP105 described in example 3. [0085] Immunofluorescence. In order to determine if PCV2 proteins were expressed in Vero cells infected with the ALVAC recombinant, an immunofluorescence (IF) analysis was performed. The infected Vero cells were washed with PBS 24 hours after infection (m.o.i. of about 10) and fixed with 95% cold acetone for 3 minutes at room temperature. Five monoclonal antibody (MAb) (hybridoma supernatant) preparations specific for PCV2 ORF1 (PCV2 199 1D3GA & PCV2 210 7G5GD) or PCV2 ORF2 (PCV2 190 4C7CF, PCV2 190 2B1BC & PCV2 190 3A8BC) were used as the first antibody. These monoclonal antibodies were obtained from Merial-Lyon. Monoclonal antibodies can also be obtained following the teachings of the documents cited in the present invention, for example WO-A-99 18214, 1998, French applications Nos. 97/12382, 98/00873, 98/03707, requested on 3 October 1997, January 22, 1998, and March 20, 1998, and WO99 / 29717. The IF reaction was performed as described by Taylor et al. (1990). [0086] Specific immunofluorescence of PCV2 with the three specific ORF2 antibodies could be detected in cells infected with vCP1614 and cells infected with vCP1615. Specific immunofluorescence of PCV2 with the two specific ORF1 antibodies could be detected in cells infected with vCP1615 only. These results indicated that, as expected, vCP1614 expresses only ORF2, while vCP1615 expresses both ORF1 and ORF2. No fluorescence was detected in Vero cells infected with ALVAC, or in non-infected Vero cells.

Example 7 - GENERATION OF ALVAC-PCV1 RECOMBINANTS [0087] Plasmids pJP113 (see Example 4) and pJP117 (see Example 5) were linearized with NotI and transfected into primary CEF cells infected with ALVAC using the phosphate precipitation method of calcium described previously (Panicali and Paoletti, 1982; Piccini et al., 1987). Positive plaques were selected based on hybridization to radiolabelled probes of specific PCV1 and subjected to four sequential rounds of plate purification until a pure population was achieved. Next, a representative plate of each IVR was amplified and the resulting ALVAC recombinants were designated as vCP1621 and vCP1622. The vCP1621 virus is the result of cases of recombination between ALVAC and the donor plasmid pJP113 and contains the PCV1 ORF2 inserted into the C6 locus of ALVAC. The vCP1622 virus is the result of recombination cases between ALVAC and the donor plasmid pJP117, and contains the PCV1 ORF2 and ORF1 inserted in the ALVAC C6 locus in the head-to-head orientation. [0088] Similarly, a recombinant ALVAC expressing only PCV1 ORF1 can be generated using the donor plasmid pJP115 described in example 5. [0089] Immunofluorescence. In order to determine if PCV1 proteins were expressed in Vero cells infected with the ALVAC recombinant, an immunofluorescence (IF) analysis was performed. The infected Vero cells were washed with PBS 24 hours after infection (m.o.i. of about 10) and fixed with 95% cold acetone for 3 minutes at room temperature. A specific anti-PCV1 polyclonal pig serum (Allan G. et al. Microbiol. 1999, 66: 115123) was used as the first antibody. The IF reaction was performed as described by Taylor et al. (1990). [0090] Specific immunofluorescence of PCV1 could be detected in cells infected with vCP1621 and cells infected with vCP1622. These results indicated that, as expected, vCP1621 and vCP1622 express specific products of PCV1. No fluorescence was detected with PCV2 specific polyclonal pig serum in cells infected with vCP1621 and in cells infected with vCP1622. No fluorescence was detected in Vero cells infected with parental ALVAC, or in non-infected Vero cells.

Example 8 - FORMULATION OF CANARY VIRUS POX RECOMBINANTS WITH CARBOPOL ™ 974P [0091] For vaccine preparation, recombinant canary pox viruses vCP1614 and vCP1615 (Example 6) can be mixed with carbomer solutions. In the same way, the recombinant canary pox viruses vCP1621 and vCP1622 (Example 7) can be mixed with carbomer solutions. The carbomer component used for the vaccination of pigs is Carbopol ™ 974P manufactured by the company BF Goodrich (molecular weight of # 3,000,000). First, a 1.5% Carbopol ™ 974P stock solution in distilled water containing 1 g / l of sodium chloride is prepared. This stock solution is then used to make a 4 mg / ml Carbopol ™ 974P solution in physiological water. The stock solution is mixed with the required volume of physiological water, either in one stage or in several successive stages, adjusting the pH value in each stage with a 1 N sodium hydroxide solution (or more concentrated) to obtain a pH final 7.3-7.4. This final Carbopol ™ 974P solution is a ready-to-use solution to reconstitute a lyophilized recombinant virus or to dilute a concentrated recombinant virus stock solution. For example, to obtain a final viral suspension containing 10e8 pfu per 2 ml dose, 0.1 ml of a 10e9 pfu / ml stock solution can be diluted in 1.9 ml of the Carbopol ready-to-use solution. ™ 974P 4 mg / ml. In the same way, ready-to-use solutions Carbopol ™ 974P 2 mg / ml can also be prepared.

Example 9 - PIG IMMUNIZATION AND STIMULATION AFTER

9.1. IMMUNIZATION OF 1 DAYS OF LIFE MILKS [0092] Groups of piglets, expelled by caesarean section on the day were placed in insulators

0. The piglets are vaccinated by intramuscular route on day 2 with several vaccine solutions. Viral vaccine suspensions are prepared by diluting recombinant virus stock solutions in sterile physiological water (0.9% NaCl). Suitable ranges for viral suspensions can be determined empirically, but will generally vary from 106 to 1010, and preferably about 1010, pfu / dose. Vaccine solutions can also be prepared by mixing the recombinant virus suspension with a solution of Carbopol ™ 974P, as described in Example 8. [0093] Piglets are vaccinated with: Recombinant virus vCP1614 (Example 2); Recombinant virus vCP1615 (Example 3); Recombinant virus vCP1614 mixed with Carbopol (4 mg / ml solution); or recombinant virus vCP1615 mixed with Carbopol (4 mg / ml solution). [0094] Viral suspensions contain 108 plaque forming units (pfu) per dose. Each viral suspension is injected intramuscularly under a volume of 1 ml. Intramuscular injection is given in the neck muscles. [0095] Two injections of viral suspensions are administered on Day 2 and Day 14 of the experiment. Stimulation is performed on Day 21 by oronasal administration of a viral suspension prepared from a culture of a virulent strain of PCV-2. After stimulation, piglets are monitored for 3 weeks for the specific clinical signs of post-weaning multisystem depletion syndrome. The following signs are assessed: Rectal temperature: daily monitoring for 2 weeks after stimulation, then 2 rectal temperature measurements during the third week. Weight: piglets are weighed just before stimulation and then weekly during the first 3 weeks after stimulation. [0096] Samples are taken on Day 2, Day 14, Day 21, Day 28, Day 35, and Day 42 of the experiment in order to monitor the levels of viremia and specific anti-PCV2 antibody titers. Necropsies: on Day 42, all surviving piglets undergo euthanasia in a human manner and undergo autopsy to look for specific macroscopic lesions of PMWS. Tissue samples are prepared from liver, lymph nodes, spleen, kidneys and thymus in order to look for specific histological lesions.

9.2. IMMUNIZATION OF MILK FOR 5-7 WEEKS OF LIFE [0097] Piglets of 5-7 weeks of age are vaccinated, free of specific maternal anti-PCV2 antibodies, by intramuscular route with several vaccine solutions. Viral vaccine suspensions are prepared by diluting recombinant virus stock solutions in sterile physiological water (0.9% NaCl). Vaccine solutions can also be prepared by mixing the suspension of recombinant viruses with a solution of Carbopol ™ 974P, as described in Example 8. [0098] Piglets are vaccinated with: Recombinant virus vCP1614 (Example 2); Recombinant virus vCP1615 (Example 3); Recombinant virus vCP1614 mixed with Carbopol (4 mg / ml solution); or recombinant virus vCP1615 mixed with Carbopol (4 mg / ml solution). [0099] Viral suspensions contain 108 plaque forming units (pfu) per dose. Each viral suspension is injected intramuscularly under a volume of 2 ml. Intramuscular injection is given in the neck muscles. [0100] Two injections of viral suspensions are administered on Day 0 and Day 21 of the experiment. Stimulation is performed on Day 35 by oronasal administration of a viral suspension prepared from a culture of a virulent strain of PCV-2. After stimulation, piglets are monitored for 8 weeks for the specific clinical signs of post-weaning multisystem depletion syndrome. The clinical monitoring is identical to that described in Example 9.1, except that the total duration of the monitoring is 8 weeks instead of 3 weeks. [0101] Necropsies are performed through the experiment for piglets that die from the stimulus and at the end of the experiment (Day 97) for all surviving piglets. The tissue samples are the same as described in Example 9.1.

9.3. IMMUNIZATION OF NEW BORN MILKS [0102] Groups of 3 or 4 piglets expelled by caesarean section are placed in insulators on day 0. On day 2 the piglets are vaccinated with 108 pfu of vCP 1614, vCP 1615 or parental ALVAC vector in 1 ml of PBS intramuscularly in the neck.

A second vaccine or placebo injection is given on day 14. Vaccination with ALVAC recombinant is well tolerated by piglets and no evidence of adverse reaction to vaccination is observed. Piglets are stimulated on day 21 by oronasal administration of a viral suspension of PCV-2, 1 ml in each duct

5 nasal Necropsies are performed on day 45 and tissue samples are collected for virus isolation. [0103] Results of necropsy:

• PMWS is generally characterized by lymphadenopathy and more rarely by hepatitis

or nephritis Thus, general observations in lymph nodes are assessed.

10 for each piglet as follows: 0 = no visible increase in lymph nodes is observed; 1 = slight increase in lymph nodes, limited to bronchial lymph nodes; 2 = moderate increase in lymph nodes, limited to bronchial lymph nodes; 3 = severe increase in lymph nodes, extended to bronchial lymph nodes, prescapular and inguinal submandibular. Groups Assessment [0104] Bronchial lymphadenopathy for PCV-2 is a prominent general observation. A significant reduction in lymph node lesion is observed in relation to the control group after immunization with vCP 1614 and vCP 1615 (p ≤ 0.05).

vCP1614

0.5

0.0

0.0

1.0

average

0.38

standard deviation

0.48

vCP1615

0.0

0.5

0.5

1.0

average

0.5

standard deviation

0.41

Controls

2.0

2.5

2.5

2.5

average

2.38

standard deviation

0.25

REFERENCES [0105]

one.

Clark, E.G. Proc. Amer Assoc. Swine Pract., Pp. 499-501 (1997).

2.

Edbauer, C., R. Weinberg, J. Taylor, A. Rey-Senelonge, J.F. Bouquet, P. Desmettre and E. Paoletti, Virology 179, 901-904 (1990).

3.

Ellis, J., L. Hassard, E. Clark, J. Harding, G. Allan, P. Willson, J. Strakappe, K. Martin, F. McNeilly, B. Meehan, D. Todd, D. Haines, Can . Vet. J. 39, 44-51 (1998).

Four.

Goebel, S.J., G.P. Johnson, M.E. Perkus, S.W. Davis, J.P. Winslow, E. Paoletti, Virology 179, 247-266, 517-563 (1990).

5.

Guo, P., S. Goebel, S. Davis, M.E. Perkus, B. Languet, P. Desmettre, G. Allen, and

E. Paoletti, J. Virol. 63, 4189-4198 (1989).

6.

Hamel, A.L., L.L. Lin and G. P.S. Nayar, J. Virol. 72, 5262-5267 (1998).

7.

Harding J.C., Proc. Am. Assoc. Swine Pract. 28, 503 (1997).

8.

Mankertz, A., J. Mankertz, K. Wolf, H.-J. Buhk, Gen. Virol. 79, 381-384 (1998a).

9.

Mankertz, J., H.-J. Buhk, G. Blaess, A. Mankertz, Virus Gene 16,267-276 (1998b).

10.

Matthews, R.E.F., Intervirology 17, 42-44 (1982).

eleven.

Meehan, B.M., J.L. Creelan, M.S. McNulty, D. Todd, J. Gen. Virol. 78, 221-227 (1997).

12.

Meehan, B.M., F. McNeilly, D. Todd, S. Kennedy, V.A. Jewhurst, J.A. Ellis, L.E. Hassard, E.G. Clark, D.M. Haines, G.M. Allan, J. Gen. Virol. 79.2171-2179 (1998).

13.

Nayar, G.P.S., A. Hamel and L. Lin. Dog. Vet. J. 38, 385-386 (1997).

14.

Panicali, D. and E. Paoletti, Proc. Natl Acad. Sci. USA 79, 4927-4931 (1982).

fifteen.

Paoletti, E., B.R. Lipinskaks, C. Samsonoff, S. Mercer, and D. Panicali, Proc. Natl Acad. Sci. U.S.A. 81, 193-197 (1984).

16.

Perkus, M.E., K. Limbach, and E. Paoletti, J. Virol. 63, 3829-3836 (1989).

17.

Piccini, A., M.E. Perkus, and E. Paoletti, In Methods in Enzymology, Vol. 153, eds. Wu, R., and Grossman, L., (Academic Press) pp. 545-563 (1987).

18.

Sambrook, J., E.F. Fritsch, and T. Maniatis, In Molecular cloning: A laboratory manual, 2nd edition, (Cold Spring Harbor Press, NY) (1989).

19.

Tartaglia, J., J. Winslow, S. Goebel, G.P. Johnson, J. Taylor, and E. Paoletti, J.

Gen. Virol. 71, 1517-1524 (1990).

twenty.

Tartaglia, J., Perkus ME, Taylor J, Norton EK, Audonnet JC, Cox WI, Davis SW, van der Hoeven J, Meignier B, Riviere M, and E. Paoletti, Virology 188, 217-32 (1992).

twenty-one.

Taylor, J., R. Weinberg, B. Languet, Ph. Desmettre and E. Paoletti, Vaccine 6, 497-503 (1988a).

22

Taylor, J. and E. Paoletti, Vaccine 6, 466-468 (1988b).

2. 3.

Taylor, J., R. Weinberg, Y. Kawaoka, R. Webster and E. Paoletti, Vaccine 6, 504508 (1988c).

24.

Taylor, J., C. Edbauer, A. Rey-Senelonge, J.F. Bouquet, E. Norton, S. Goebel, P. Desmettre and E. Paoletti, J. Virol. 64, 1441-1450 (1990).

25.

Taylor, J., C. Trimarchi, R. Weinberg, B. Languet, F. Guillemin, P. Desmettre and

E. Paoletti, Vaccine 9, 190-193 (1991).

26.

Taylor J, Weinberg R, Tartaglia J, Richardson C, Alkhatib G, Briedis D, Appel M, Norton E, Paoletti E., Virology187, 321-328 (1992).

27.

Todd, D., F.D. Niagro, B.W. Ritchie, W. Curran, G.M. Allan, P.D. Lukert, K.S. Latimer, W.L. Steffens, M.S. McNulty, Arch. Virol. 117, 129-135 (1991). SEQUENCE LIST

[0106]

(one)

GENERAL INFORMATION:

(i)

APPLICANT: Bublot, Michel Perez, Jennifer M. Charreyre, Catherine E.

(ii)

TITLE OF THE INVENTION: Recombinant Pox Virus of Porcine Circovirus 2

(iii) NUMBER OF SEQUENCES: 13

(iv)

CORRESPONDENCE ADDRESS:

(TO)

RECIPIENT: Frommer Lawrence HaugLLP

(B)

STREET: 745 Fifth Avenue

(C)

CITY: NY

(D)

STATE: NY

(AND)

COUNTRY: USA

(F)

CP: 10151

(v)

LEGIBLE FORM BY COMPUTER:

(TO)

TYPE OF MEDIA: DISK

(B)

COMPUTER: IBM PC compatible

(C)

OPERATING SYSTEM: PC-DOS / MS-DOS

(D)

SOFTWARE: Patent In Release # 1.0, Version # 1.25

(saw)

DATA OF THIS APPLICATION:

(A) APPLICATION NUMBER: 5 (B) APPLICATION DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY / AGENT INFORMATION:

(TO)

NAME: Kowalski, Thomas J.

(B)

RECORD NUMBER: 32, 147

10 (C) REFERENCE NUMBER / RECORD: 4543132511.1

(ix) INFORMATION FOR TELECOMMUNICATIONS:

(A) PHONE: 212-588-0800

(B)

TELEFAX: 212-588-0500 15 (2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(TO)

LENGTH: 3701 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple 20 (D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

(2)

INFORMATION FOR SEQ ID NO: 2:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 42 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(xi)

SEQUENCE DESCRIPTION: SEQ ID NO: 2:

(2)

INFORMATION FOR SEQ ID NO: 3:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 73 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(xi)

SEQUENCE DESCRIPTION: SEQ ID NO: 3:

(2)

INFORMATION FOR SEQ ID NO: 4:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 72 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(xi)

SEQUENCE DESCRIPTION: SEQ ID NO: 4:

(2)

INFORMATION FOR SEQ ID NO: 5:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 45 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(xi)

SEQUENCE DESCRIPTION: SEQ ID NO: 5:

(2)

INFORMATION FOR SEQ ID NO: 6:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 53 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(xi)

SEQUENCE DESCRIPTION: SEQ ID NO: 6:

(2)

INFORMATION FOR SEQ ID NO: 7:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 36 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(xi)

SEQUENCE DESCRIPTION: SEQ ID NO: 7:

(2)

INFORMATION FOR SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 2520 base pairs

(B)

TYPE: 15 (C) CHAIN nucleic acid: simple

image2

image2

image2

image2

image2

image2

image2

image2

image2

image2

image2

10

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

image2

image2

image2

(2) INFORMATION FOR SEQ ID NO: 9:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 57 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(xi)

SEQUENCE DESCRIPTION: SEQ ID NO: 9:

image2

10 (2) INFORMATION FOR SEQ ID NO: 10:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 36 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(xi)

SEQUENCE DESCRIPTION: SEQ ID NO: 10:

image2

(2)

INFORMATION FOR SEQ ID NO: 11: 20 (i) SEQUENCE CHARACTERISTICS:

(TO)

LENGTH: 3609 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear 25 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

image2

image2

image2

image2

(2)

INFORMATION FOR SEQ ID NO: 12:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 53 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(ii)

TYPE OF MOLECULE: DNA (genomic)

(xi)

SEQUENCE DESCRIPTIONS SEQ ID NO: 12:

(2)

INFORMATION FOR SEQ ID NO: 13:

(i)

CHARACTERISTICS OF THE SEQUENCE:

(TO)

LENGTH: 40 base pairs

(B)

TYPE: nucleic acid

(C)

CHAIN: simple

(D)

TOPOLOGY: linear

(ii)

TYPE OF MOLECULE: DNA (genomic)

(xi)

SEQUENCE DESCRIPTION: SEQ ID NO: 13:

image2

image2

REFERENCES CITED IN THE DESCRIPTION

This list of references cited by the applicant is intended solely to assist the reader and is not part of the European patent document. Although the utmost care has been taken in its realization, errors or omissions cannot be excluded and the EPO declines any responsibility in this regard.

Patent documents cited in the description

•

FR 9803707 [0006] [0086]

•

US 5185146 A [0011]

•

US 4769330 A [0016]

•

US 4722848 A [0016]

•

US 4603112 A [0016]

•

US 5110587 A [0016]

•

US 5174993 A [0016]

•

US 5494807 A [0016] [0026]

•

US 5505941 A [0016]

•

US 5364773 A [0026]

•

US 5762938 A [0026]

•

US 5756103 A [0027]

•

US 5766599 A [0027]

•

US 6004777 A [0027]

•

US 5990091 A [0027]

•

US 5770212 A [0027]

•

US 6033904 A [0027]

•

US 5869312 A [0027]

•

US 5382425 A [0027]

•

WO 9530018 A [0027]

•

US 5843456 A [0034]

•

US 2909462 A [0037]

•

US 16109298 A [0047] [0052]

•

WO 9918214 A [0047] [0051] [0052] [0055] [0086]

•

JP 775 A [0074]

•

FR 9712382 [0086]

•

FR 9800873 [0086]

•

WO 9929717 A [0086]

Non-patent documents cited in the description

•

REMINGTONS PHARMACEUTICAL SCIENCE. 1995 [0035]

•

Phameuropa, June 1996, vol. 8 (2 [0037]

•

J. Fields et al. Nature, June 04, 1960, vol. 186, 778-780 [0038]

•

TO THE. Hamel et al. J. Virol., June 1998, vol. 72 (6), 5262-5267 [0047]

•

I. Morozov et al. J. Clinical Microb., September 1998, vol. 36 (9), 2535-2541 [0047]

•

Myers; Miller Optimal Alignments in Linear Space. CABIOS, 1988, vol. 4, 11-17 [0057]

•

Wilbur; Lipman PNAS USA, 1983, vol. 80, 726 [0058]

•

Altschul et al. Nucl. Acids Res., Vol. 25, 3389-3402 [0060]

•

Needleman SB; Wunsch CD. A general meted applicable to the search for similarities in the amino acid sequences of two proteins. J. Mol. Biol., 1970, vol. 48, 444-453 [0060]

•

Smith TF; Waterman MS. Comparison of Bio-sequences. Advances in Applied Mathematics, 1981, vol. 2, 482-489 [0060]

•

Smith TF; Waterman MS; Sadler JR. Statistical characterization of nucleic acid sequence functional domains. Nucleic Acids Res, 1983, vol. 11, 2205-2220 [0060]

•

Feng DF; Dolittle RF Progressive sequence alignment as a prerequisite to correct phylogenetic trees. J. of Molec. Evol., 1987, vol. 25, 351-360 [0060]

•

Higgins DG; Sharp PM Fast and sensitive multiple sequence alignment on a microcomputer. CABIOS, 1989, vol. 5, 151-153 [0060]

•

Thompson JD; Higgins DG; Gibson TJ. ClusterW: improving the sensitivity of progressive multiple sequence alignment through sequence weighing, positionsspecific gap penalties and weight matrix choice. Nucleic Acid Res., 1994, vol. 22, 4673-480 [0060]

•

Devereux J; Haeberlie P; Smithies O. A comprehensive set of sequence analysis program for the VAX. Nucl. Acids Res., 1984, vol. 12, 387-395 [0060]

•

Sambrook et al. Cell Lines and Virus Strains, 1989 [0064]

•

B. Meehan et al. J. Gen. Virol., 1997, vol. 78, 221-227 [0077]

•

Allan G. et al. Vet. Microbiol., 1999, vol. 66, 115-123 [0090]

•

Clark, E.G. Proc. Amer Assoc. Swine Pract., 1997, 499-501 [0106]

•

Edbauer, C.; R. Weinberg; J. Taylor; A. Rey-Senelonge; J.F. Bouquet; P. Desmettre; E. Paoletti. Virology, 1990, vol. 179, 901-904 [0106]

•

Ellis, J.; L. Hassard; E. Clark; J. Harding; G. Allan; P. Willson; J. Strakappe; K. Martin; F. McNeilly; B. Meehan. Dog. Vet. J., 1998, vol. 39, 44-51 [0106]

•

Goebel, S.J. ; G.P. Johnson; I. Perkus; S.W. Davis; J.P. Winslow; E. Paoletti. Virology, 1990, vol. 179, 247-266517-563 [0106]

•

Guo, P.; S. Goebel; S. Davis; I. Perkus; B. Languet; P. Desmettre; G. Allen;

AND.

Paoletti J. Virol., 1989, vol. 63, 4189-4198 [0106]

•

Hamel, A.L. ; L.L. Lin; G. P.S. Nayar J. Virol., 1998, vol. 72, 5262-5267 [0106]

•

Harding J.C. Proc. Am. Assoc. Swine Pract., 1997, vol. 28, 503 [0106]

•

Mankertz, A.; J. Mankertz; K. Wolf; H.-J. Buhk. Gen. Virol., 1998, vol. 79, 381384 [0106]

•

Mankertz, J.; H.-J. Buhk; G. Blaess; A. Mankertz. Virus Gene, 1998, vol. 16, 267276 [0106]

•

Matthews, R.E.F. Intervirology, 1982, vol. 17, 42-44 [0106]

•

Meehan, B.M. ; J.L. Creelan; M.S. McNulty; D. Todd J. Gen. Virol., 1997, vol. 78, 221-227 [0106]

•

Meehan, B.M. ; F. McNeilly; D. Todd; S. Kennedy; GOES. Jewhurst; J.A. Ellis;

YOU. Hassard; E.G. Clark; D.M. Haines; G.M. Allan. J. Gen. Virol., 1998, vol. 79, 2171-2179 [0106]

•

Nayar, G.P.S. ; A. Hamel; L. Lin. Dog. Vet. J., 1997, vol. 38, 385-386 [0106]

•

Panicali, D.; E. Paoletti. Proc. Natl Acad. Sci. USA, 1982, vol. 79, 4927-4931 [0106]

•

Paoletti, E.; B.R. Lipinskaks; C. Samsonoff; S. Mercer; D. Panicali. Proc. Natl Acad. Sci. U.S.A., 1984, vol. 81, 193-197 [0106]

•

Perkus, M.E. ; K. Limbach; E. Paoletti. J. Virol., 1989, vol. 63, 3829-3836 [0106]

•

Piccini, A.; I. Perkus; E. Paoletti. Methods in Enzymology. Academic Press, 1987, vol. 153, 545-563 [0106]

•

Sambrook, J.; E.F. Fritsch; T. Maniatis. Molecular cloning: A laboratory manual. Cold Spring Harbor Press, 1989 [0106]

•

Tartaglia, J.; J. Winslow; S. Goebel; G.P. Johnson; J. Taylor; E. Paoletti. J. Gen. Virol., 1990, vol. 71, 1517-1524 [0106]

•

Tartaglia, J.; Perkus ME; Taylor J; Norton EK; Audonnet JC; Cox WI; Davis SW; van der Hoeven J; Meignier B; Riviere M. Virology, 1992, vol. 188, 217-32 [0106]

•

Taylor, J.; R. Weinberg; B. Languet; Ph. Desmettre; E. Paoletti. Vaccine, 1988, vol. 6, 497-503 [0106]

•

Taylor, J.; E. Paoletti. Vaccine, 1988, vol. 6, 466-468 [0106]

•

Taylor, J.; R. Weinberg; Y. Kawaoka; R. Webster; E. Paoletti. Vaccine, 1988, vol. 6, 504-508 [0106]

•

Taylor, J.; C. Edbauer; A. Rey-Senelonge; J.F. Bouquet; E. Norton; S. Goebel; P. Desmettre; E. Paoletti. J. Virol., 1990, vol. 64, 1441-1450 [0106]

•

Taylor, J.; C. Trimarchi; R. Weinberg; B. Languet; F. Guillemin; P. Desmettre; E. Paoletti. Vaccine, 1991, vol. 9, 190-193 [0106]

•

Taylor J; Weinberg R; Tartaglia J; Richardson C; Alkhatib G; Briedis D; Appel M; Norton E; Paoletti E. Virology, 1992, vol. 187, 321-328 [0106]

•

Todd, D.; F.D. Niagro; B.W. Ritchie; W. Curran; G.M. Allan; P.S. Lukert; K.S. Latimer; W.L. Steffens; M.S. McNulty Arch. Virol., 1991, vol. 117, 129-135 [0106]

Claims (22)

1. Immunogenic composition comprising (i) a pox virus recombinant comprising an isolated DNA molecule, where the pox virus is: ALVAC, or an attenuated canary pox where said canary pox virus is attenuated through more than 200 serial passes on chick embryo fibroblasts, of which the original seed was subjected to four successive plate purifications under agar, from which a plate clone through five additional passages, and where the isolated DNA molecule comprises porcine circovirus type 2 ORF2 (PCV2); and (ii) a carrier.

2.

Immunogenic composition according to claim 1, wherein the recombinant pox virus is a recombinant ALVAC canary pox virus.

3.

Immunogenic composition according to claim 1 or 2, wherein the isolated DNA molecule comprises ORF1 of PCV2 and ORF2 and PCV2.

Four.

Immunogenic composition according to claim 3, wherein said ALVAC has the sequence shown in SEQ ID No. 1 and said C6 locus is in a position from 377 to 2254 of SEQ ID No. 1 and where the isolated DNA molecule is located in the C6 locus of the ALVAC canary pox virus genome.

5.

Immunogenic composition according to any one of claims 1 to 4, which contains an adjuvant.

6.

Immunogenic composition according to claim 5, wherein the adjuvant is a carbomer.

7. Use of a recombinant pox virus comprising an isolated DNA molecule, where the pox virus is: ALVAC, or an attenuated canary pox where said canary pox virus is attenuated through more than 200 serial passes on chick embryo fibroblasts, of which the original seed was subjected to four successive plate purifications under agar, from which a plate clone through five additional passages, and where the isolated DNA molecule comprises PCV2 ORF2; for the preparation of an immunogenic composition to induce an immune response against PCV2 in an adult pig, a young pig or a pregnant sow. 8. Use according to claim 7, wherein the immunogenic composition is administered to a sow before mating and again during pregnancy.

9.

Use according to claim 8, wherein the immunogenic composition is administered during pregnancy at approximately 6-8 weeks of gestation and / or approximately 11-13 weeks of gestation.

10.

Use according to any of claims 7 to 9 to confer passive immunity to a newborn piglet.

eleven.

Use according to any of claims 7 to 9, wherein the immunogenic composition is administered to a pregnant female and then to her piglet or piglets after birth.

12.

Use according to claim 7 or 11, wherein the immunogenic composition is administered to a piglet between birth and weaning.

13.

Use according to claim 12, wherein the immunogenic composition is administered to a piglet in the first week of life or in the third week of life, and is preferably administered again two to four weeks later.

14.

Use according to any of claims 7 to 13, wherein the immunogenic composition contains an adjuvant.

fifteen.

Use according to claim 14, wherein the adjuvant is a carbomer.

16.

Use according to any of claims 7 to 15, wherein the isolated DNA molecule comprises PCV2 ORF1 and PCV2 ORF2.

17. Vaccine comprising (i) a recombinant pox virus comprising an isolated DNA molecule, wherein the pox virus is: ALVAC, or an attenuated canary pox where said canary pox virus is attenuated through more than 200 serial passes on chick embryo fibroblasts, of which the original seed was subjected to four successive plate purifications under agar, from which a plate clone through five additional passes, and where the isolated DNA molecule comprises the porcine circovirus type 2 ORF2 (PCV2); and (ii) a carrier. 18. Vaccine according to claim 17, wherein the recombinant pox virus is a recombinant ALVAC canary pox virus. 19. Vaccine according to claim 17 or 18, wherein the isolated DNA molecule comprises PCV2 ORF1 and PCV2 ORF2. 20. Vaccine according to any of claims 17 to 19, wherein said ALVAC has the sequence shown in SEQ ID No. 1 and said C6 locus is in position 377 to 2254 of SEQ ID No. 1 and wherein the isolated DNA molecule be 5 found in the C6 locus of the ALVAC canary pox virus genome.

twenty-one.

Vaccine according to any of claims 17 to 20, which contains an adjuvant.

22

Vaccine according to claim 21, wherein the adjuvant is a carbomer.