US6331393B1 - Process for high-throughput DNA methylation analysis - Google Patents

Process for high-throughput DNA methylation analysis Download PDF

Info

Publication number
US6331393B1
US6331393B1 US09/311,912 US31191299A US6331393B1 US 6331393 B1 US6331393 B1 US 6331393B1 US 31191299 A US31191299 A US 31191299A US 6331393 B1 US6331393 B1 US 6331393B1
Authority
US
United States
Prior art keywords
nucleic acid
cpg
methylated
dna
amplification
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US09/311,912
Inventor
Peter W. Laird
Cindy A. Eads
Kathleen D. Danenberg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Southern California USC
Original Assignee
University of Southern California USC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=23209034&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US6331393(B1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by University of Southern California USC filed Critical University of Southern California USC
Priority to US09/311,912 priority Critical patent/US6331393B1/en
Assigned to SOUTHERN CALIFORNIA, UNIVERSITY OF reassignment SOUTHERN CALIFORNIA, UNIVERSITY OF ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DANENBERG, KATHLEEN D., EADS, CINDY A., LAIRD, PETER W.
Priority to JP2000618495A priority patent/JP4044290B2/en
Priority to PCT/US2000/013029 priority patent/WO2000070090A1/en
Priority to AT00928969T priority patent/ATE332980T2/en
Priority to EP00928969.5A priority patent/EP1185695B2/en
Priority to ES00928969.5T priority patent/ES2267535T5/en
Priority to AU47122/00A priority patent/AU775798B2/en
Priority to CA002372665A priority patent/CA2372665C/en
Priority to DK06011777.7T priority patent/DK1710321T3/en
Priority to DK00928969.5T priority patent/DK1185695T4/en
Priority to DE60029323.8T priority patent/DE60029323T3/en
Priority to EP06011777.7A priority patent/EP1710321B1/en
Priority to ES06011777.7T priority patent/ES2564048T3/en
Priority to US10/016,505 priority patent/US7112404B2/en
Publication of US6331393B1 publication Critical patent/US6331393B1/en
Application granted granted Critical
Priority to AU2004229115A priority patent/AU2004229115B2/en
Priority to US11/518,353 priority patent/US7553627B2/en
Priority to JP2006290479A priority patent/JP2007068539A/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: UNIVERSITY OF SOUTHERN CALIFORNIA
Priority to US12/476,981 priority patent/US8323890B2/en
Priority to CY20161100185T priority patent/CY1118000T1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification

Definitions

  • the present invention provides an improved high-throughput and quantitative process for determining methylation patterns in genomic DNA samples. Specifically, the inventive process provides for treating genomic DNA samples with sodium bisulfite to create methylation-dependent sequence differences, followed by detection with fluorescence-based quantitative PCR techniques.
  • DNA is methylated only at cytosines located 5′ to guanosine in the CpG dinucleotide. This modification has important regulatory effects on gene expression predominantly when it involves CpG rich areas (CpG islands) located in the promoter region of a gene sequence. Extensive methylation of CpG islands has been associated with transcriptional inactivation of selected imprinted genes and genes on the inactive X chromosome of females. Aberrant methylation of normally unmethylated CpG islands has been described as a frequent event in immortalized and transformed cells and has been frequently associated with transcriptional inactivation of tumor suppressor genes in human cancers.
  • DNA methylases transfer methyl groups from a universal methyl donor, such as S-adenosyl methionine, to specific sites on the DNA.
  • a universal methyl donor such as S-adenosyl methionine
  • One biological function of DNA methylation in bacteria is protection of the DNA from digestion by cognate restriction enzymes.
  • Mammalian cells possess methylases that methylate cytosine residues on DNA that are 5′ neighbors of guanine (CpG). This methylation may play a role in gene inactivation, cell differentiation, tumorigenesis, X-chromosome inactivation, and genomic imprinting. CpG islands remain unmethylated in normal cells, except during X-chromosome inactivation and parental specific imprinting where methylation of 5′ regulatory regions can lead to transcriptional repression.
  • CpG guanine
  • DNA methylation is also a mechanism for changing the base sequence of DNA without altering its coding function.
  • DNA methylation is a heritable, reversible and epigenetic change. Yet, DNA methylation has the potential to alter gene expression, which has profound developmental and genetic consequences.
  • the methylation reaction involves flipping a target cytosine out of an intact double helix to allow the transfer of a methyl group from S-adenosylmethionine in a cleft of the enzyme DNA (cystosine-5)-methyltransferase (Klimasauskas et al., Cell 76:357-369, 1994) to form 5-methylcytosine (5-mCyt).
  • This enzymatic conversion is the only epigenetic modification of DNA known to exist in vertebrates and is essential for normal embryonic development (Bird, Cell 70:5-8, 1992; Laird and Jaenisch, Human Mol. Genet.
  • CpG island regions comprise about 1% of vertebrate genomes and also account for about 15% of the total number of CpG dinucleotides (Bird, Nature 321:209-213, 1986).
  • CpG islands are typically between 0.2 to about 1 kb in length and are located upstream of many housekeeping and tissue-specific genes, but may also extend into gene coding regions. Therefore, it is the methylation of cytosine residues within CpG islands in somatic tissues, which is believed to affect gene function by altering transcription (Cedar, Cell 53:3-4, 1988).
  • Methylation of cytosine residues contained within CpG islands of certain genes has been inversely correlated with gene activity. This could lead to decreased gene expression by a variety of mechanisms including, for example, disruption of local chromatin structure, inhibition of transcription factor-DNA binding, or by recruitment of proteins which interact specifically with methylated sequences indirectly preventing transcription factor binding. In other words, there are several theories as to how methylation affects mRNA transcription and gene expression, but the exact mechanism of action is not well understood. Some studies have demonstrated an inverse correlation between methylation of CpG islands and gene expression, however, most CpG islands on autosomal genes remain unmethylated in the germline and methylation of these islands is usually independent of gene expression.
  • Tissue-specific genes are usually unmethylated in the receptive target organs but are methylated in the germline and in non-expressing adult tissues.
  • CpG islands of constitutively-expressed housekeeping genes are normally unmethylated in the germline and in somatic tissues.
  • Abnormal methylation of CpG islands associated with tumor suppressor genes may also cause decreased gene expression. Increased methylation of such regions may lead to progressive reduction of normal gene expression resulting in the selection of a population of cells having a selective growth advantage (i.e., a malignancy).
  • the digestion-Southern method is a straightforward method but it has inherent disadvantages in that it requires a large amount of high molecular weight DNA (at least or greater than 5 ⁇ g) and has a limited scope for analysis of CpG sites (as determined by the presence of recognition sites for methylation-sensitive restriction enzymes).
  • Another method for analyzing changes in methylation patterns involves a PCR-based process that involves digestion of genomic DNA with methylation-sensitive restriction enzymes prior to PCR amplification (Singer-Sam et al., Nucl. Acids Res. 18:687, 1990). However, this method has not been shown effective because of a high degree of false positive signals (methylation present) due to inefficient enzyme digestion or overamplification in a subsequent PCR reaction.
  • Genomic sequencing has been simplified for analysis of DNA methylation patterns and 5-methylcytosine distribution by using bisulfite treatment (Frommer et al., Proc. Natl. Acad Sci. USA 89:1827-1831, 1992).
  • Bisulfite treatment of DNA distinguishes methylated from unmethylated cytosines, but original bisulfite genomic sequencing requires large-scale sequencing of multiple plasmid clones to determine overall methylation patterns, which prevents this technique from being commercially useful for determining methylation patterns in any type of a routine diagnostic assay.
  • MSP methylation-specific PCR
  • PCR techniques have been developed for detection of gene mutations (Kuppuswamy et al., Proc. Natl. Acad. Sci. USA 88:1143-1147, 1991) and quantitation of allelic-specific expression (Szabo and Mann, Genes Dev. 9:3097-3108, 1995; and Singer-Sam et al., PCR Methods Appl. 1 : 160 - 163 , 1992 ).
  • Such techniques use internal primers, which anneal to a PCR-generated template and terminate immediately 5′ of the single nucleotide to be assayed.
  • an allelic-specific expression technique has not been tried within the context of assaying for DNA methylation patterns.
  • the indirect methods for DNA methylation pattern determinations at specific loci that have been developed rely on techniques that alter the genomic DNA in a methylation-dependent manner before the amplification event.
  • the first is digestion by a restriction enzyme that is affected in its activity by 5-methylcytosine in a CpG sequence context. The cleavage, or lack of it, can subsequently be revealed by Southern blotting or by PCR.
  • the other technique that has received recent widespread use is the treatment of genomic DNA with sodium bisulfite. Sodium bisulfite treatment converts all unmethylated cytosines in the DNA to uracil by deamination, but leaves the methylated cytosine residues intact.
  • Subsequent PCR amplification replaces the uracil residues with thymines and the 5-methylcytosine residues with cytosines.
  • the resulting sequence difference has been detected using standard DNA sequence detection techniques, primarily PCR
  • DNA methylation detection techniques utilize bisulfite treatment.
  • All bisulfite treatment-based methods are followed by a PCR reaction to analyze specific loci within the genome.
  • the first is to design PCR primers that uniquely anneal with either methylated or unmethylated converted DNA. This technique is referred to as “methylation specific PCR” or “MSP”.
  • MSP methylation specific PCR
  • the method used by all other bisulfite-based techniques is to amplify the bisulfite-converted DNA using primers that anneal at locations that lack CpG dinucleotides in the original genomic sequence.
  • the PCR primers can amplify the sequence in between the two primers, regardless of the DNA methylation status of that sequence in the original genomic DNA. This results in a pool of different PCR products, all with the same length and differing in their sequence only at the sites of potential DNA methylation at CpGs located in between the two primers.
  • the difference between these methods of processing the bisulfite-converted sequence is that in MSP, the methylation information is derived from the occurrence or lack of occurrence of a PCR product, whereas in the other techniques a mix of products is always generated and the mixture is subsequently analyzed to yield quantitative information on the relative occurrence of the different methylation states.
  • the present invention provides a method for detecting a methylated CpG island within a genomic sample of DNA comprising:
  • the amplifying step is a polymerase chain reaction (PCR) and the modifying agent is bisulfite.
  • the converted nucleic acid contains uracil in place of unmethylated cytosine residues present in the unmodified genomic sample of DNA.
  • the probe further comprises a fluorescence label moiety and the amplification and detection step comprises fluorescence-based quantitative PCR.
  • the invention provides a method for detecting a methylated CpG-containing nucleic acid comprising:
  • the amplifying step comprises a polymerase chain reaction (PCR) and the modifying agent comprises bisulfite.
  • the converted nucleic acid contains uracil in place of unmethylated cytosine residues present in the unmodified nucleic acid-containing sample.
  • the detection method is by means of a measurement of a fluorescence signal based on amplification-mediated displacement of the CpG-specific probe and the amplification and detection method comprises fluorescence-based quantitative PCR.
  • the methylation amounts in the nucleic acid sample are quantitatively determined based on reference to a control reaction for amount of input nucleic acid.
  • the present invention further provides a method for detecting a methylated CpG-containing nucleic acid comprising:
  • the amplifying step is a polymerase chain reaction (PCR) and the modifying agent is bisulfite.
  • the converted nucleic acid contains uracil in place of unmethylated cytosine residues present in the unmodified nucleic acid-containing sample.
  • the detection method comprises measurement of a fluorescence signal based on amplification-mediated displacement of the CpG-specific probe and the amplification and detection method comprises fluorescence-based quantitative PCR.
  • the present invention further provides a methylation detection kit useful for the detection of a methylated CpG-containing nucleic acid comprising a carrier means being compartmentalized to receive in close confinement therein one or more containers comprising:
  • the modifying agent comprises bisulfite.
  • the modifying agent converts cytosine residues to uracil residues.
  • the specific oligonucleotide probe is a CpG-specific oligonucleotide probe, wherein the probe, but not the primers for amplification of the converted nucleic acid, distinguishes between modified unmethylated and methylated nucleic acid.
  • the specific oligonucleotide probe is a CpG-specific oligonucleotide probe, wherein both the probe and the primers for amplification of the converted nucleic acid, distinguish between modified unmethylated and methylated nucleic acid.
  • the probe further comprises a fluorescent moiety linked to an oligonucleotide base directly or through a linker moiety and the probe is a specific, dual-labeled TaqMan probe.
  • FIG. 1 shows an outline of the MSP technology (prior art) using PCR primers that initially discriminate between methylated and unmethylated (bisulfite-converted) DNA.
  • the top part shows the result of the MSP process when unmethylated single-stranded genomic DNA is initially subjected to sodium bisulfite conversion (deamination of unmethylated cytosine residues to uracil) followed by PCR reactions with the converted template, such that a PCR product appears only with primers specifically annealing to converted (and hence unmethylated) DNA.
  • the bottom portion shows the contrasting result when a methylated single-stranded genomic DNA sample is used.
  • the process first provides for bisulfite treatment followed by PCR reactions such that a PCR product appears only with primers specifically annealing to unconverted (and hence initially methylated) DNA.
  • FIG. 2 shows an alternate process for evaluating DNA methylation with sodium bisulfite-treated genomic DNA using nondiscriminating (with respect to methylation status) forward and reverse PCR primers to amplify a specific locus.
  • denatured (i.e., single-stranded) genomic DNA is provided that has mixed methylation status, as would typically be found in a sample for analysis.
  • the sample is converted in a standard sodium bisulfite reaction and the mixed products are amplified by a PCR reaction using primers that do not overlap any CpG dinucleotides. This produces an unbiased (with respect to methylation status) heterogeneous pool of PCR products.
  • the mixed or heterogeneous pool can then be analyzed by a technique capable of detecting sequence differences, including direct DNA sequencing, subcloning of PCR fragments followed by sequencing of representative clones, single-nucleotide primer extension reaction (MS-SNuPE), or restriction enzyme digestion (COBRA).
  • a technique capable of detecting sequence differences including direct DNA sequencing, subcloning of PCR fragments followed by sequencing of representative clones, single-nucleotide primer extension reaction (MS-SNuPE), or restriction enzyme digestion (COBRA).
  • FIGS. 3A-3D shows a flow diagram of the inventive process in several, but not all, alternative embodiments for PCR product analysis. Variations in detection methodology, such as the use of dual probe technology (Lightcycler®) or fluorescent primers (Sunrise® technology) are not shown in this Figure.
  • the inventive process begins with a mixed sample of genomic DNA that is converted in a sodium bisulfite reaction to a mixed pool of methylation-dependent sequence differences according to standard procedures (the bisulfite process converts unmethylated cytosine residues to uracil). Fluorescence-based PCR is then performed either in an “unbiased” PCR reaction with primers that do not overlap known CpG methylation sites (left arm of FIG.
  • Sequence discrimination can occur either at the level of the amplification process (C and D) or at the level of the fluorescence detection process (B), or both (D).
  • a quantitative test for methylation patterns in the genomic DNA sample is shown on the left arm (B), wherein sequence discrimination occurs at the level of probe hybridization.
  • the PCR reaction provides for unbiased amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site.
  • An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe overlie any CpG dinucleotides (A).
  • a qualitative test for genomic methylation is achieved by probing of the biased PCR pool with either control oligonucleotides that do not “cover” known methylation sites (C; a fluorescence-based version of the MSP technique), or with oligonucleotides covering potential methylation sites (D).
  • C control oligonucleotides that do not “cover” known methylation sites
  • D oligonucleotides covering potential methylation sites
  • FIG. 4 shows a flow chart overview of the inventive process employing a “TaqMan®” probe in the amplification process.
  • double-stranded genomic DNA is treated with sodium bisulfite and subjected to one of two sets of PCR reactions using TaqMan® probes; namely with either biased primers and TaqMan® probe (left column), or unbiased primers and TaqMan® probe (right column).
  • the TaqMan® probe is dual-labeled with a fluorescent “reporter” (labeled “R” in FIG. 4) and “qencher” (labeled “O”) molecules, and is designed to be specific for a relatively high GC content region so that it melts out at about 10° C.
  • the Taq polymerase enzymatically synthesizes a new strand during PCR, it will eventually reach the annealed TaqMan® probe.
  • the Taq polymerase 5′ to 3′ endonuclease activity will then displace the TaqMan® probe by digesting it to release the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescent system as described herein.
  • FIG. 5A-5B shows a comparison of the inventive assay to a conventional COBRA assay.
  • Panel A shows a COBRA gel used to determine the level of DNA methylation at the ESR1 locus in DNAs of known methylation status (sperm, unmethylated) and HCT116 (methylated). The relative amounts of the cleaved products are indicated below the gel.
  • a 56-bp fragment represents DNA molecules in which the TaqI site proximal to the hybridization probe is methylated in the original genomic DNA.
  • the 86-bp fragment represents DNA molecules in which the proximal TaqI site is unmethylated and the distal site is methylated.
  • Panel B summarizes the COBRA results and compares them to results obtained with the methylated and unmethylated version of the inventive assay process. The results are expressed as ratios between the methylation-specific reactions and a control reaction.
  • the control reaction was a MYOD1 assay as described in Example 1.
  • the ACTB primers described for the RT-PCR reactions were used as a control to verify the input of unconverted DNA samples. (The ACTB primers do not span an intron). “No PCR” indicates that no PCR product was obtained on unconverted genomic DNA with COBRA primers designed to amplify bisulfite-converted DNA sequences.
  • FIG. 6A-6C illustrates a determination of the specificity of the oligonucleotides.
  • Eight different combinations of forward primer, probe and reverse primer were tested on DNA samples with known methylation or lack of methylation at the ESR1 locus.
  • Panel A shows the nomenclature used for the combinations of the ESR1 oligos. “U” refers to the oligo sequence that anneals with bisulfite-converted unmethylated DNA, while “M” refers to the methylated version.
  • Position 1 indicates the forward PCR primer, position 2 the probe, and position 3 the reverse primer.
  • the combinations used for the eight reactions are shown below each pair of bars, representing duplicate experiments. The results are expressed as ratios between the ESR1 values and the MYOD1 control values.
  • Panel B represents an analysis of human sperm DNA.
  • Panel C represents an analysis of DNA obtained from the human colorectal cancer cell line HCT116.
  • FIG. 7 shows a test of the reproducibility of the reactions. Assays were performed in eight independent reactions to determine the reproducibility on samples of complex origin. A primary human colorectal adenocarcinoma and matched normal mucosa was used for this purpose (samples 10N and 10T shown in FIG. 8 ). The results shown in this figure represent the raw values obtained in the assay. The values have been plate-normalized, but not corrected for input DNA. The bars indicate the mean values obtained for the eight separate reactions. The error bars represent the standard error of the mean.
  • FIG. 8 illustrates a comparison of MLH1 expression, microsatellite instability and MLH1 promoter methylation of 25 matched-paired human colorectal samples.
  • the upper chart shows the MLH1 expression levels measured by quantitative, real time RT-PCR (TaqMan®) in matched normal (hatched bars) and tumor (solid black bars) colorectal samples. The expression levels are displayed as a ratio between MLH1 and ACTB measurements.
  • Microsatellite instability status (MSI) is indicated by the circles located between the two charts. A black circle denotes MSI positivity, while an open circle indicates that the sample is MSI negative, as determined by analysis of the BAT25 and BAT26 loci.
  • the lower chart shows the methylation status of the MLH1 locus as determined by an inventive process. The methylation levels are represented as the ratio between the MLH1 methylated reaction and the MYOD1 reaction.
  • the present invention provides a rapid, sensitive, reproducible high-throughput method for detecting methylation patterns in samples of nucleic acid.
  • the invention provides for methylation-dependent modification of the nucleic acid, and then uses processes of nucleic acid amplification, detection, or both to distinguish between methylated and unmethylated residues present in the original sample of nucleic acid.
  • the invention provides for determining the methylation status of CpG islands within samples of genomic DNA.
  • amplification and detection occur simultaneously as measured by fluorescence-based real-time quantitative PCR (“RT-PCR”) using specific, dual-labeled TaqMan® oligonucleotide probes.
  • RT-PCR fluorescence-based real-time quantitative PCR
  • the displaceable probes can be specifically designed to distinguish between methylated and unmethylated CpG sites present in the original, unmodified nucleic acid sample.
  • the present invention provides for significant advantages over previous PCR-based and other methods (e.g., Southern analyses) used for determining methylation patterns.
  • the present invention is substantially more sensitive than Southern analysis, and facilitates the detection of a low number (percentage) of methylated alleles in very small nucleic acid samples, as well as paraffin-embedded samples.
  • genomic DNA analysis is not limited to DNA sequences recognized by methylation-sensitive restriction endonucleases, thus allowing for fine mapping of methylation patterns across broader CpG-rich regions.
  • the present invention also eliminates the any false-positive results, due to incomplete digestion by methylation-sensitive restriction enzymes, inherent in previous PCR-based methylation methods.
  • the present invention also offers significant advantages over MSP technology. It can be applied as a quantitative process for measuring methylation amounts, and is substantially more rapid.
  • MSP technology One important advance over MSP technology is that the gel electrophoresis is not only a time-consuming manual task that limits high throughput capabilities, but the manipulation and opening of the PCR reaction tubes increases the chance of sample mis-identification and it greatly increases the chance of contaminating future PCR reactions with trace PCR products.
  • the standard method of avoiding PCR contamination by uracil incorporation and the use of Uracil DNA Glycosylase (AmpErase) is incompatible with bisulfite technology, due to the presence of uracil in bisulfite-treated DNA.
  • the present invention does not require any post-PCR manipulation or processing. This not only greatly reduces the amount of labor involved in the analysis of bisulfite-treated DNA, but it also provides a means to avoid handling of PCR products that could contaminate future reactions.
  • MSP methylation information is derived from the comparison of two separate PCR reactions (the methylated and the unmethylated versions).
  • MSP amplification is provided for by means of particular CpG-specific oligonucleotides; that is, by biased primers.
  • the DNA sequence covered by such primers contains more than one CpG dinucleotide with the consequence that the sequence amplified will represent only one of multiple potential sequence variants present, depending on the DNA methylation pattern in the original genomic DNA.
  • the forward primer is a 24-mer oligonucleotide that covers 3 CpGs
  • 2 3 8 different theoretical sequence permutations could arise in the genomic DNA following bisufite conversion within this 24-nucleotide sequence. If only a fully methylated and a fully unmethylated reaction is run, then only 2 out of the 8 possible methylation states are analyzed.
  • the MSP patent explicitly describes a non-quantitative technique based on the occurrence or non-occurrence of a PCR product in the fully methylated, versus fully unmethylated reaction, rather than a comparison of the kinetics of the two reactions.
  • one embodiment of the present invention provides for the unbiased amplification of all possible methylation states using primers that do not cover any CpG sequences in the original, unmodified DNA sequence.
  • quantitative information about DNA methylation patterns can then be distilled from the resulting PCR pool by any technique capable of detecting sequence differences (e.g., by fluorescence-based PCR).
  • MSP relies on the occurrence or non-occurrence of a PCR product in the methylated, versus unmethylated reaction to determine the methylation status of a CpG sequence covered by a primer.
  • this requires performing agarose or polyacrylamide gel electrophoretic analysis (see U.S. Pat. No. 5,786,146, FIGS. 2A-2E, and 3A-3E).
  • determining the methylation status of any CpG sites within a given MSP amplified region would require additional analyses such as: (a) restriction endonuclease analysis either before, or after (e.g., COBRA analysis; Xiong and Laird, Nucleic Acids Res.
  • nucleic acid modification and amplification provided that either the unmodified sequence region of interest contains methylation-sensitive sites, or that modification (e.g., bisulfite) results in creating or destroying restriction sites; (b) single nucleotide primer extension reactions (Ms-SNuPE; Gonzalo and Jones, Nucleic Acids Res 25: 2529-2531, 1997); or (c) DNA sequencing of the amplification products.
  • modification e.g., bisulfite
  • Single nucleotide primer extension reactions Ms-SNuPE; Gonzalo and Jones, Nucleic Acids Res 25: 2529-2531, 1997
  • DNA sequencing of the amplification products are not only subject to error (incomplete restriction enzyme digestion), but also add substantial time and expense to the process of determining the CpG methylation status of, for example, samples of genomic DNA.
  • amplification and detection occur simultaneously as measured by fluorescence-based real-time quantitative PCR using specific, dual-labeled oligonucleotide probes.
  • the methylation status at any probe-specific sequence within an amplified region can be determined contemporaneously with amplification, with no requirement for subsequent manipulation or analysis.
  • genomic sequencing As disclosed by MSP inventors, “[t]he only technique that can provide more direct analysis than MSP for most CpG sites within a defined region is genomic sequencing.” (U.S. Pat. No. 5,786,146 at 5, line 15-17).
  • the present invention provides, in fact, a method for the partial direct sequencing of modified CpG sites within a known (previously sequenced) region of genomic DNA.
  • a series of CpG-specific TaqMan® probes each corresponding to a particular methylation site in a given amplified DNA region, are constructed.
  • This series of probes are then utilized in parallel amplification reactions, using aliquots of a single, modified DNA sample, to simultaneously determine the complete methylation pattern present in the original unmodified sample of genomic DNA. This is accomplished in a fraction of the time and expense required for direct sequencing of the sample of genomic DNA, and are substantially more sensitive.
  • one embodiment of the present invention provides for a quantitative assessment of such a methylation pattern.
  • the present invention has identified four process techniques and associated diagnostic kits, utilizing a methylation-dependent nucleic acid modifying agent (e.g., bisulfite), to both qualitatively and quantitatively determine CpG methylation status in nucleic acid samples (e.g., genomic DNA samples).
  • a methylation-dependent nucleic acid modifying agent e.g., bisulfite
  • the four processes are outlined in FIG. 3 and labeled at the bottom with the letters A through D.
  • methylated-CpG sequence discrimination is designed to occur at the level of amplification, probe hybridization or at both levels.
  • applications C and D utilize “biased” primers that distinguish between modified unmethylated and methylated nucleic acid and provide methylated-CpG sequence discrimination at the PCR amplification level.
  • Process B uses “unbiased” primers (that do not cover CpG methylation sites), to provide for unbiased amplification of modified nucleic acid, but rather utilize probes that distinguish between modified unmethylated and methylated nucleic acid to provide for quantitative methylated-CpG sequence discrimination at the detection level (e.g., at the fluorescent (or luminescent) probe hybridization level only).
  • Process A does not, in itself, provide for methylated-CpG sequence discrimination at either the amplification or detection levels, but supports and validates the other three applications by providing control reactions for input DNA.
  • the invention provides a method for qualitatively detecting a methylated CpG-containing nucleic acid, the method including: contacting a nucleic acid-containing sample with a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid; amplifying the converted nucleic acid by means of two oligonucleotide primers in the presence of a specific oligonucleotide hybridization probe, wherein both the primers and probe distinguish between modified unmethylated and methylated nucleic acid; and detecting the “methylated” nucleic acid based on amplification-mediated probe displacement.
  • modifies means the conversion of an unmethylated cytosine to another nucleotide by the modifying agent, said conversion distinguishing unmethylated from methylated cytosine in the original nucleic acid sample.
  • the agent modifies unmethylated cytosine to uracil.
  • the agent used for modifying unmethylated cytosine is sodium bisulfite, however, other equivalent modifying agents that selectively modify unmethylated cytosine, but not methylated cytosine, can be substituted in the method of the invention.
  • Sodium-bisulfite readily reacts with the 5, 6-double bond of cytosine, but not with methylated cytosine, to produce a sulfonated cytosine intermediate that undergoes deamination under alkaline conditions to produce uracil (Example 1). Because Taq polymerase recognizes uracil as thymine and 5-methylcytidine (m5C) as cytidine, the sequential combination of sodium bisulfite treatment and PCR amplification results in the ultimate conversion of unmethylated cytosine residues to thymine (C ⁇ U ⁇ T) and methylated cytosine residues (“mC”) to cytosine (mC ⁇ mC ⁇ C).
  • sodium-bisulfite treatment of genomic DNA creates methylation-dependent sequence differences by converting unmethylated cyotsines to uracil, and upon PCR the resultant product contains cytosine only at positions where methylated cytosine occurs in the unmodified nucleic acid.
  • Oligonucleotide “primers,” as used herein, means linear, single-stranded, oligomeric deoxyribonucleic or ribonucleic acid molecules capable of sequence-specific hybridization (annealing) with complementary strands of modified or unmodified nucleic acid.
  • the specific primers are preferably DNA.
  • the primers of the invention embrace oligonucleotides of appropriate sequence and sufficient length so as to provide for specific and efficient initiation of polymerization (primer extension) during the amplification process.
  • oligonucleotide primers typically contain 12-30 nucleotides or more, although may contain fewer nucleotides. Preferably, the primers contain from 18-30 nucleotides.
  • primers are single-stranded although double-stranded primers may be used if the strands are first separated.
  • Primers may be prepared using any suitable method, such as conventional phosphotriester and phosphodiester methods or automated embodiments which are commonly known in the art.
  • the specific primers are preferably designed to be substantially complementary to each strand of the genomic locus of interest.
  • one primer is complementary to the negative ( ⁇ ) strand of the locus (the “lower” strand of a horizontally situated double-stranded DNA molecule) and the other is complementary to the positve (+) strand (“upper” strand).
  • the primers are preferably designed to overlap potential sites of DNA methylation (CpG nucleotides) and specifically distinguish modified unmethylated from methylated DNA. Preferably, this sequence discrimination is based upon the differential annealing temperatures of perfectly matched, versus mismatched oligonucleotides.
  • primers are typically designed to overlap from one to several CpG sequences. Preferably, they are designed to overlap from 1 to 5 CpG sequences, and most preferably from 1 to 4 CpG sequences. By contrast, in a quantitative embodiment of the invention, the primers do not overlap any CpG sequences.
  • the anti-sense primers contain adenosine residues (“As”) in place of guanosine residues (“Gs”) in the corresponding ( ⁇ ) strand sequence.
  • As adenosine residues
  • Gs guanosine residues
  • Us and Ts uracil and thymidine residues
  • the sense primers are preferably designed to be complementary to anti-sense primer extension products, and contain Ts in place of unmethylated Cs in the corresponding (+) strand sequence. These substituted Ts in the sense primer will be complementary to the As, incorporated in the anti-sense primer extension products at positions complementary to modified Cs (Us) in the original (+) strand.
  • the anti-sense primers will not contain As in place of Gs in the corresponding ( ⁇ ) strand sequence that are complementary to methylated Cs (i.e., mCpG sequences) in the original (+) strand.
  • the sense primers in this case will not contain Ts in place of methylated Cs in the corresponding (+) strand mCpG sequences.
  • Cs that are not in CpG sequences in regions covered by the fully-methylated primers, and are not methylated will be represented in the fully-methylated primer set as described above for unmethylated primers.
  • the amplification process provides for amplifying bisulfite converted nucleic acid by means of two oligonucleotide primers in the presence of a specific oligonucleotide hybridization probe. Both the primers and probe distinguish between modified unmethylated and methylated nucleic acid. Moreover, detecting the “methylated” nucleic acid is based upon amplification-mediated probe fluorescence. In one embodiment, the fluorescence is generated by probe degradation by 5′ to 3′ exonuclease activity of the polymerase enzyme. In another embodiment, the fluorescence is generated by fluorescence energy transfer effects between two adjacent hybridizing probes (Lightcycler® technology) or between a hybridizing probe and a primer.
  • the fluorescence is generated by the primer itself (Sunrise® technology).
  • the amplification process is an enzymatic chain reaction that uses the oligonucleotide primers to produce exponential quantities of amplification product, from a target locus, relative to the number of reaction steps involved.
  • one member of a primer set is complementary to the ( ⁇ ) strand, while the other is complementary to the (+) strand.
  • the primers are chosen to bracket the area of interest to be amplified; that is, the “amplicon.”
  • the DNA polymerase is Taq polymerase, as commonly used in the art.
  • the new amplicon sequences are also templates for the primers and polymerase, repeated cycles of denaturing, primer annealing, and extension results in exponential production of the amplicon.
  • the product of the chain reaction is a discrete nucleic acid duplex, corresponding to the amplicon sequence, with termini defined by the ends of the specific primers employed.
  • the amplification method used is that of PCR (Mullis et al., Cold Spring Harb. Symp. Quant. Biol 51:263-273; Gibbs, Anal. Chem. 62:1202-1214, 1990), or more preferably, automated embodiments thereof which are commonly known in the art.
  • methylation-dependent sequence differences are detected by methods based on fluorescence-based quantitative PCR (real-time quantitative PCR, Heid et al., Genome Res. 6:986-994, 1996; Gibson et al., Genome Res. 6:995-1001, 1996) (e.g., “TaqMan®,” “Lightcycler®,” and “Sunrise®)” technologies).
  • fluorescence-based quantitative PCR real-time quantitative PCR, Heid et al., Genome Res. 6:986-994, 1996; Gibson et al., Genome Res. 6:995-1001, 1996)
  • the sequence discrimination can occur at either or both of two steps: (1) the amplification step, or (2) the fluorescence detection step.
  • the amplification and fluorescent steps are the same.
  • the amplification process is that of fluorescence-based Real Time Quantitative PCR (Heid et al., Genome Res. 6:986-994, 1996) employing a dual-labeled fluorescent oligonucleotide probe (TaqMan® PCR, using an ABI Prism 7700 Sequence Detection System, Perkin Elmer Applied Biosystems, Foster City, Calif.).
  • the “TaqMan®” PCR reaction uses a pair of amplification primers along with a nonextendible interrogating oligonucleotide, called a TaqMan® probe, that is designed to hybridize to a GC-rich sequence located between the forward and reverse (i.e., sense and anti-sense) primers.
  • the TaqMan® probe further comprises a fluorescent “reporter moiety” and a “quencher moiety” covalently bound to linker moieties (e.g., phosphoramidites) attached to nucleotides of the TaqMan® oligonucleotide.
  • reporter and quencher molecules examples include: the 5′ fluorescent reporter dyes 6FAM (“FAM”; 2,7 dimethoxy-4,5-dichloro-6-carboxy-fluorescein), and TET (6-carboxy-4,7,2′,7′-tetrachlorofluorescein); and the 3′ quencher dye TAMRA (6-carboxytetramethylrhodamine) (Livak et al., PCR Methods Appl. 4:357-362, 1995; Gibson et al., Genome Res. 6:995-1001; and 1996; Heid et al., Genome Res. 6:986-994, 1996).
  • 6FAM fluorescent reporter dye
  • TET 6-carboxy-4,7,2′,7′-tetrachlorofluorescein
  • TAMRA 6-carboxytetramethylrhodamine
  • One process for designing appropriate TaqMan® probes involves utilizing a software facilitating tool, such as “Primer Express” that can determine the variables of CpG island location within GC-rich sequences to provide for at least a 10° C. melting temperature difference (relative to the primer melting temperatures) due to either specific sequence (tighter bonding of GC, relative to AT base pairs), or to primer length.
  • a software facilitating tool such as “Primer Express” that can determine the variables of CpG island location within GC-rich sequences to provide for at least a 10° C. melting temperature difference (relative to the primer melting temperatures) due to either specific sequence (tighter bonding of GC, relative to AT base pairs), or to primer length.
  • the TaqMan® probe may or may not cover known CpG methylation sites, depending on the particular inventive process used.
  • the TaqMan® probe is designed to distinguish between modified unmethylated and methylated nucleic acid by overlapping from 1 to 5 CpG sequences.
  • TaqMan® probes may be designed to be complementary to either unmodified nucleic acid, or, by appropriate base substitutions, to bisulfite-modified sequences that were either fully unmethylated or fully methylated in the original, unmodified nucleic acid sample.
  • the inventive process can be performed by designing reactions for the fully methylated and the fully unmethylated variants that represent the most extreme sequence variants in a hypothetical example (see FIG. 3, Application D). The ratio between these two reactions, or alternatively the ratio between the methylated reaction and a control reaction (FIG. 3, Application A), would provide a measure for the level of DNA methylation at this locus.
  • FIG. 4 A more detailed overview of the qualitative version is shown in FIG. 4 .
  • Detection of methylation in the embodiment of Application D is based on amplification-mediated displacement of the probe.
  • the process of probe displacement might be designed to leave the probe intact, or to result in probe digestion.
  • displacement of the probe occurs by digestion of the probe during amplification.
  • the fluorescent hybridization probe is cleaved by the 5′ to 3′ nucleolytic activity of the DNA polymerase. On cleavage of the probe, the reporter moiety emission is no longer transferred efficiently to the quenching moiety, resulting in an increase of the reporter moiety fluorescent-emission spectrum at 518 nm.
  • the fluorescent intensity of the quenching moiety (e.g., TAMRA), changes very little over the course of the PCR amplification.
  • TAMRA quenching moiety
  • the amplicon may range in size from 50 to 8,000 base pairs, or larger, but may be smaller. Typically, the amplicon is from 100 to 1000 base pairs, and preferably is from 100 to 500 base pairs.
  • the reactions are monitored in real time by performing PCR amplification using 96-well optical trays and caps, and using a sequence detector (ABI Prism) to allow measurement of the fluorescent spectra of all 96 wells of the thermal cycler continuously during the PCR amplification.
  • process D is run in combination with the process A (FIG. 3) to provide controls for the amount of input nucleic acid, and to normalize data from tray to tray.
  • the inventive process can be modified to avoid sequence discrimination at the PCR product detection level.
  • the primers are designed to cover CpG dinucleotides, and sequence discrimination occurs solely at the level of amplification.
  • the probe used in this embodiment is still a TaqMan® probe, but is designed so as not to overlap any CpG sequences present in the original, unmodified nucleic acid.
  • the embodiment of Application C represents a high-throughput, fluorescence-based real-time version of MSP technology, wherein a substantial improvement has been attained by reducing the time required for detection of methylated CpG sequences.
  • the reactions are monitored in real time by performing PCR amplification using 96-well optical trays and caps, and using a sequence detector (ABI Prism) to allow measurement of the fluorescent spectra of all 96 wells of the thermal cylcer continuously during the PCR amplification.
  • process C is run in combination with process A to provide controls for the amount of input nucleic acid, and to normalize data from tray to tray.
  • the inventive process can be also be modified to avoid sequence discrimination at the PCR amplification level (FIG. 3, A and B).
  • a quantitative process embodiment (FIG. 3, Application B)
  • just the probe is designed to cover CpG dinucleotides, and sequence discrimination occurs solely at the level of probe hybridization.
  • TaqMan® probes are used.
  • sequence variants resulting from the bisulfite conversion step are amplified with equal efficiency; as long as there is no inherent amplification bias (Warnecke et al., Nucleic Acids Res. 25:4422-4426, 1997).
  • Design of separate probes for each of the different sequence variants associated with a particular methylation pattern would allow a quantitative determination of the relative prevalence of each sequence permutation in the mixed pool of PCR products.
  • the reactions are monitored in real time by performing PCR amplification using 96-well optical trays and caps, and using a sequence detector (ABI Prism) to allow measurement of the fluorescent spectra of all 96 wells of the thermal cylcer continuously during the PCR amplification.
  • process B is run in combination with process A to provide controls for the amount of input nucleic acid, and to normalize data from tray to tray.
  • Application A. Process A does not, in itself, provide for methylated-CpG sequence discrimination at either the amplification or detection levels, but supports and validates the other three applications by providing control reactions for the amount of input DNA, and to normalize data from tray to tray. Thus, if neither the primers, nor the probe overlie any CpG dinucleotides, then the reaction represents unbiased amplification and measurement of amplification using fluorescent-based quantitative real-time PCR serves as a control for the amount of input DNA (FIG. 3, Application A).
  • process A not only lacks CpG dinucleotides in the primers and probe(s), but also does not contain any CpGs within the amplicon at all to avoid any differential effects of the bisulfite treatment on the amplification process.
  • the amplicon for process A is a region of DNA that is not frequently subject to copy number alterations, such as gene amplification or deletion.
  • Results obtained with the qualitative version of the technology are described in the examples below. Dozens of human tumor samples have been analyzed using this technology with excellent results. High-throughput using a TaqMan® machine allowed performance of 1100 analyses in three days with one TaqMan® machine.
  • genomic DNA was isolated from human sperm or HCT116 cells by the standard method of proteinase K digestion and phenol-chloroform extraction (Wolf et al., Am. J Hum. Genet. 51:478-485, 1992).
  • the DNA was then treated with sodium bisulfite by initially denaturing in 0.2 M NaOH, followed by addition of sodium bisulfite and hydroquinone (to final concentrations of 3.1 M, and 0.5M, respectively), incubation for 16 h. at 55° C., desalting (DNA Clean-Up System; Promega), desulfonation by 0.3M NaOH, and final ethanol precipitation.
  • ESR1 and APC genes were analyzed using COBRA (Combined Bisulfite Restriction Analysis).
  • COBRA analysis methylation-dependent sequence differences were introduced into the genomic DNA by standard bisulfite treatment according to the procedure described by Frommer et al ( Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992) (1 ug of salmon sperm DNA was added as a carrier before the genomic DNA was treated with sodium bisulfite).
  • PCR amplification of the bisulfite converted DNA was performed using primers specific for the interested CpG islands, followed by restriction endonuclease digestion, gel electrophoresis, and detection using specific, labeled hybridization probes.
  • the forward and reverse primer sets used for the ESR1 and APC genes are: TCCTAAAACTACACTTACTCC [SEQ ID NO. 35], GGTTATTTGGAAAAAGAGTATAG [SEQ ID NO. 36] (ESR1 promoter); and AGAGAGAAGTAGTTGTGTTAAT [SEQ ID NO. 37], ACTACACCAATACAACCACAT [SEQ ID NO. 38] (APC promoter), respectively.
  • PCR products of ESR1 were digested by restriction endonuleases TaqI and BstUI, while the products from APC were digested by Taq I and SfaN I, to measure methylation of 3 CpG sies for APC and 4 CpG sites for ESR1.
  • the digested PCR products were electrophoresed on denaturing polyacrylamide gel and transferred to nylon membrane (Zetabind; American Bioanalytical) by electroblotting.
  • the membranes were hybridized by a 5′-end labeled oligonucleotide to visualize both digested and undigested DNA fragments of interest.
  • the probes used are as follows: ESR1, AAACCAAAACTC [SEQ ID NO. 39]; and APC, CCCACACCCAACCAAT [SEQ ID NO. 40]. Quantitation was performed with the Phosphoimager 445SI (Molecular Dynamics). Calculations were performed in Microsoft Excel. The level of DNA methylation at the investigated CpG sites was determined by calculating the percentage of the digested PCR fragments (Xiong and Laird, supra).
  • MLH1 and CDKN2A were analyzed using MsSNuPE (Methylation-sensitive Single Nucleotide Primer Extension Assay), performed as decribed by Gonzalgo and Jones ( Nucleic Acids Res. 25:2529-2531).
  • PCR amplification of the bisulfite converted DNA was performed using primers specific for the interested CpG islands, and detection was performed using additional specific primers (extension probes).
  • the forward and reverse primer sets used for the MLH1 and CDKN2A genes are: GGAGGTTATAAGAGTAGGGTTAA [SEQ ID NO. 41], CCAACCAATAAAAACAAAAATACC [SEQ ID NO.
  • MsSNuPE extension probes are located immediately 5′ of the CpG to be analyzed, and the sequences are: TTTAGTAGAGGTATATAAGTT [SEQ ID NO. 47], TAAGGGGAGAGGAGGAGTTTGAGAAG [SEQ ID NO.
  • Inventive methylation analysis Bisulfite-converted genomic DNA was amplified using locus-specific PCR primers flanking an oligonucleotide probe with a 5′ fluorescent reporter dye (6FAM) and a 3′ quencher dye (TAMRA) (Livak et al., PCR Methods Appl. 4:357-362, 1995) (primers and probes used for the methylation analyses are listed under “Genes, MethyLight Primers and Probe Sequences” herein, infra).
  • 6FAM 5′ fluorescent reporter dye
  • TAMRA 3′ quencher dye
  • the forward and reverse primers and the corresponding fluorogenic probes were designed to discriminate between either fully methylated or fully unmethylated molecules of bisulfite-converted DNA (see discussion of primer design under “Detailed Description of the Invention, Process D” herein).
  • Primers and a probe were also designed for a stretch of the MYOD1 gene (Myogenic Differentiation Gene), completely devoid of CpG dinucleotides as a control reaction for the amount of input DNA.
  • Parallel reactions were performed using the inventive process with the methylated and unmethylated (D), or control oligos (A) on the bisulfite-treated sperm and HCT116 DNA samples. The values obtained for the methylated and unmethylated reactions were normalized to the values for the MYOD1 control reactions to give the ratios shown in Table 1 (below).
  • the 5′ to 3′ nuclease activity of Taq DNA polymerase cleaved the probe and released the reporter, whose fluorescence was detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, Calif.). After crossing a fluorescence detection threshold, the PCR amplification resulted in a fluorescent signal 25′ proportional to the amount of PCR product generated.
  • Initial template quantity can be derived from the cycle number at which the fluorescent signal crosses a threshold in the exponential phase of the PCR reaction.
  • Several reference samples were included on each assay plate to verify plate-to-plate consistency. Plates were normalized to each other using these reference samples.
  • the PCR amplification was performed using a 96-well optical tray and caps with a final reaction mixture of 25 ⁇ l consisting of 600 nM each primer, 200 nM probe, 200 ⁇ M each dATP, dCTP, dGTP, 400 ⁇ M dUTP, 5.5 mM MgCl 2 , 1 ⁇ TaqMan® Buffer A containing a reference dye, and bisulfite-converted DNA or unconverted DNA at the following conditions: 50° C. for 2 min, 95° C. for 10 min, followed by 40 cycles at 95° C. for 15 s and 60° C. for 1 min.
  • APC adenomatous polyposis coli
  • ESR1 estrogen receptor
  • CDKN2A p16
  • hMLH1 mismatch repair
  • the human ESR gene contains a CpG island at its 5′ end, which becomes increasingly methylated in colorectal mucosa with age and is heavily methylated in all human colorectal tumors analyzed (Issa et al., supra).
  • Hypermethylation of promoter-associated CpG islands of the CDKN2A (pl6) gene has been found in 60% of colorectal cancers showing microsatellite instability (MI) due to defects in one of several base mismatch repair genes (Ahuja et al., supra).
  • the mismatch repair gene MLH1 plays a pivotal role in the development of sporadic cases of mismatch repair-deficient colorectal tumors (Thibodeau et al., Science 260:816-819, 1993). It has been reported that MLH1 can become transcriptionally silenced by DNA hypermethylation of its promoter region, leading to microsatellite instability (MSI) (Kane et al., Cancer Res. 57:808-811, 1997; Ahuja et al., supra; Cunningham et al., Cancer Res. 58:3455-3460, 1998; Herman et al., supra; Veigl et al., supra).
  • MSI microsatellite instability
  • PCR primers and probes designed specifically for bisulfite converted DNA sequences, were used: (1) a set representing fully methylated and fully unmethylated DNA for the ESR1 gene; (2) a fully methylated set for the MLH1 gene; (3) a fully methylated and fully unmethylated set for the APC gene; and (4) a fully methylated and fully unmethylated set for the CDKN2A (p16) gene; and (5) an internal reference set for the MYOD1 gene to control for input DNA.
  • the methylated and unmethylated primers and corresponding probes were designed to overlap 1 to 5 potential CpG dinucleotides sites.
  • the MYOD1 internal reference primers and probe were designed to cover a region of the MYOD1 gene completely devoid of any CpG dinucleotides to allow for unbiased PCR amplification of the genomic DNA, regardless of methylation status.
  • parallel TaqMan® PCR reactions were performed with primers specific for the bisulfite-converted methylated and/or unmethylated gene sequences and with the MYOD1 reference primers.
  • the primer and probe sequences are listed below. In all cases, the first primer listed is the forward PCR primer, the second is the TaqMan® probe, and the third is the reverse PCR primer.
  • ESR1 methylated GGCGTTCGTTTTGGGATTG [SEQ ID NO.
  • CDKN2A methylated AACAACGTCCGCACCTCCT [SEQ ID NO. 16], 6FAM 5′-ACCCGACCCCGAACCGCG-3′ TAMRA [SEQ ID NO. 17], TGGAATTTTCGGTTGATTGGTT [SEQ ID NO. 18]
  • CDKN2A unmethylated CAACCAATCAACCAAAAATTCCAT [SEQ ID NO. 19], 6FAM 5′-CCACCACCCACTATCTACTCTCCCCCTC-3′ TAMRA [SEQ ID NO. 20], GGTGGATTGTGTGTGTTTGGTG [SEQ ID NO. 21]
  • MYOD1 MYOD1, (CCAACTCCAAATCCCCTCTCTAT [SEQ ID NO.
  • Tables 1 and 2 shows the results of the analysis of human sperm and HCT116 DNAs for methylation status of the CpG islands within the four genes; APC, ESR1, CDKN2A (pl6), and hMLH1. The results are expressed as ratios between the methylated and unmethylated reactions and a control reaction (MYOD1).
  • Table 1 shows that sperm DNA yielded a positive ratio only with the “unmethylated” primers and probe; consistent with the known unmethylated status of sperm DNA, and consistent with the percent methylation values determined by COBRA analysis. That is, priming on the bisulfite-treated DNA occurred from regions that contained unmethylated cytosine in CpG sequences in the corresponding genomic DNA, and hence were deaminated converted to uracil) by bisulfite treatment.
  • Table 2 shows the results of an analysis of HCT116 DNA for methylation status of the CpG islands within the four genes; APC, ESR1, CDKN2A (p16), and hMLH1. The results are expressed as ratios between the methylation-specific reactions and a control reaction (MYOD1).
  • ESR ESR gene
  • CDKN2A CDKN2A gene
  • HCT116 DNA yielded positive ratios with both the “methylated” and “unmethylated” primers and probe; consistent with the known methylated status of HCT116 DNA, and with the COBRA analysis that indicates only partial methylation of this region of the gene.
  • the APC gene gave positive results only with the unmethylated reaction.
  • this is entirely consistent with the COBRA analysis, and indicates that this APC gene region is unmethylated in HCT116 DNA. This may indicate that the methylation state of this particular APC gene regulatory region in the DNA from the HCT116 cell line is more like that of normal colonic mucosa or premalignant adenomas rather than that of colon carcinomas (known to be distinctly more methylated).
  • This example is a comparison of the inventive process (A and D in FIG. 3) with an independent COBRA method (See “Methods,” above) to determine the methylation status of a CpG island associated with the estrogen receptor (ESR1) gene in the human colorectal cell line HCT116 and in human sperm DNA.
  • This CpG island has been reported to be highly methylated in HCT116 and unmethylated in human sperm DNA (Xiong and Laird, supra; Issa et al., supra).
  • the COBRA analysis is described above. Two TaqI sites within this CpG island confirmed this, showing a lack of methylation in the sperm DNA and nearly complete methylation in HCT116 DNA (FIG. 5 A). Additionally, results using bisulfite-treated and untreated DNA were compared.
  • FIG. 6 shows a test of all possible combinations of primers and probes to further examine the specificity of the methylated and unmethylated oligonucleotides on DNAs of known methylation status.
  • Eight different combinations of the ESR1 “methylated” and “unmethylated” forward and reverse primers and probe (as described above in “Example 1”) were tested in different combinations in inventive assays on sperm and HCT 116 DNA in duplicate. The assays were performed as described above in Example 1.
  • Panel A (FIG. 6) shows the nomenclature used for the combinations of the ESR1 oligos.
  • “U” refers to the oligo sequence that anneals with bisulfite-converted unmethylated DNA, while “M” refers to the methylated version.
  • Position 1 indicates the forward PCR primer, position 2 the probe, and position 3 the reverse primer. The combinations used for the eight reactions are shown below each pair of bars, representing duplicate experiments. The results are expressed as ratios between the ESR1 values and the MYOD1 control values.
  • Panel B represents an analysis of human sperm DNA.
  • Panel C represents an analysis of DNA obtained from the human colorectal cancer cell line HCT116.
  • reaction 1 Only the fully unmethylated (reaction 1) or fully methylated combinations (reaction 8) resulted in a positive reaction for the sperm and HCT116, respectively.
  • the other combinations were negative, indicating that the PCR conditions do not allow for weak annealing of the mismatched oligonucleotides.
  • This selectivity indicates that the inventive process can discriminate between fully methylated or unmethylated alleles with a high degree of specificity.
  • FIG. 7 illustrates an analysis of the methylation status of the ESR1 locus in DNA samples derived from a primary colorectal adenocarcinoma and matched normal mucosa derived from the same patient (samples 10N and 10T in FIG. 8) in order to study a heterogeneous population of methylated and unmethylated alleles.
  • the colorectal tissue samples were collected as described in Example 5, below.
  • the reproducibility of the inventive process was tested by performing eight independent reactions for each assay.
  • the results for the ESR1 reactions and for the MYOD1 control reaction represent raw absolute values obtained for these reactions, rather than ratios, so that the standard errors of the individual reactions can be evaluated.
  • the values have been plate-normalized, but not corrected for input DNA.
  • the bars indicate the mean values obtained for the eight separate reactions.
  • the error bars represent the standard error of the mean.
  • FIG. 7 shows that the mean value for the methylated reaction was higher in the tumor compared to the normal tissue whereas the unmethylated reaction showed the opposite result.
  • the standard errors observed for the eight independent measurements were relatively modest and were comparable to those reported for other studies utilizing TaqMan® technology (Fink et al., Nature Med. 4:1329-1333, 1998).
  • Some of the variability of the inventive process may have been a result of stochastic PCR amplification (PCR bias), which can occur at low template concentrations. (Warnecke et al., Nucleic Acids Res. 25:4422-4426,1997). In summary, these results indicate that the inventive process can yield reproducible results for complex, heterogeneous DNA samples.
  • This example shows a comparison of MLH1 Expression, microsatellite instability and MLH1 promoter methylation in 25 matched-paired human colorectal samples.
  • the main benefit of the inventive process is the ability to rapidly screen human tumors for the methylation state of a particular locus.
  • the analysis of DNA methylation as a surrogate marker for gene expression is a novel way to obtain clinically useful information about tumors.
  • We tested the utility of the inventive process by interrogating the methylation status of the MLH1 promoter.
  • the mismatch repair gene MLH1 plays a pivotal role in the development of sporadic cases of mismatch repair-deficient colorectal tumors (Thibodeau et al., Science 260:816-819, 1993).
  • MSI microsatellite instability
  • Example 1 Application D 50 samples consisting of 25 matched pairs of human colorectal adenocarcinomas and normal mucosa were analyzed for the methylation status of the MLH1 CpG island. Quantitative RT-PCR (TaqMan®) analyses of the expression levels of MLH1 normalized to ACTB ( ⁇ -actin) was investigated. Furthermore, the microsatellite instability (MSI) status of each sample was analyzed by PCR of the BAT25 and BAT26 loci (Parsons et al., Cancer Res. 55:5548-5550, 1995).
  • TaqMan® Quantitative RT-PCR
  • MSI microsatellite instability
  • the twenty-five paired tumor and normal mucosal tissue samples were obtained from 25 patients with primary colorectal adenocarcinoma.
  • the patients comprised 16 males and 9 females, ranging in age from 39-88 years, with a mean age of 68.8.
  • the mucosal distance from tumor to normal specimens was between 10 and 20 cm.
  • Approximately 2 grams of the surgically removed tissue was immediately frozen in liquid nitrogen and stored at ⁇ 80° C. until RNA and DNA isolation.
  • Quantitative RT-PCR and Microsatellite Instability Analysis The quantitation of mRNA levels was carried out using real-time fluorescence detection. The TaqMan® reactions were performed as described above for the assay, but with the addition of 1U AmpErase uracil N-glycosylase). After RNA isolation, cDNA was prepared from each sample as previously described (Bender et al., Cancer Res 58:95-101, 1998).
  • quanidine isothiocyanate (4M) quanidine isothiocyanate
  • N-lauryl sarcosine 0.5%)
  • sodium citrate 25mM
  • 2-mercaptoethanol 0.1M
  • ACTB TGAGCGCGGCTACAGCTT [SEQ ID NO. 25], 6FAM5′-ACCACCACGGCCGAGCGG-3′TAMRA [SEQ ID NO. 26], CCTTAATGTCACACACGATT [SEQ ID NO. 27]); and MLH1 (GTTCTCCGGGAGATGTTGCATA [SEQ ID NO. 28], 6FAM5′-CCTCAGTGGGCCTTGGCACAGC-3′TAMRA [SEQ ID NO. 29], TGGTGGTGTTGAGAAGGTATAACTTG [SEQ ID NO. 30]).
  • Microsatellite instability was determined by PCR and sequence analysis of the BAT25 (25-base pair pA tract from an intron of the c-kit oncogene) and BAT26 (26-base pair pA tract from an intron of the mismatch repair gene hMSH2) loci as previously described (Parsons et al., Cancer Res 55:5548-5550, 1995).
  • BAT25 and BAT26 loci were amplified for 30 cycles using one 32 P-labeled primer and one unlabeled primer for each locus. Reactions were resolved on urea-formamide gels and exposed to film.
  • the forward and reverse primers that were used for the amplification of BAT25 and BAT26 were: BAT25 (TCGCCTCCAAGAATGTAAGT [SEQ ID NO. 31], TCTGCATTTTAACTATGGCTC [SEQ ID NO. 32]); and BAT26 (TGACTACTTTTGACTTCAGCC [SEQ ID NO. 33], AACCATTCAACATTTTTAACCC [SEQ ID NO. 34]).
  • FIG. 8 shows the correlation between MLH1 gene expression, MSI status and promoter methylation of MLH1, as determined by the inventive process.
  • the upper chart shows the MLH1 expression levels measured by quantitative, real time RT-PCR (TaqMan®) in matched normal (hatched bars) and tumor (solid black bars) colorectal samples. The expression levels are displayed as a ratio between MLH1 and ACTB measurements. Microsatellite instability status (MSI) is indicated by the circles located between the two charts. A black circle denotes MSI positivity, while an open circle indicates that the sample is MSI negative, as determined by analysis of the BAT25 and BAT26 loci.
  • the lower chart shows the methylation status of the MLH1 locus as determined by inventive process. The methylation levels are represented as the ratio between the MLH1 methylated reaction and the MYOD1 reaction.
  • Tumor 17 was the only sample that was both MSI positive (black circle) and showed transcriptional silencing of MLH1.
  • the remaining methylated tumors expressed MLH1 at modest levels and were MSI negative (white circle).
  • MLH1 was biallelically methylated in tumor 17, resulting in epigenetic silencing and consequent microsatellite instability, whereas the other tumors showed lesser degrees of MLH1 promoter hypermethylation and could have just one methylated allele, allowing expression from the unaltered allele.
  • the inventive process was capable of rapidly generating significant biological information, such as promoter CpG island hypermethylation in human tumors, which is associated with the transcriptional silencing of genes relevant to the cancer process.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)

Abstract

There is disclosed an improved high-throughput and quantitative process for determining methylation patterns in genomic DNA samples based on amplifying modified nucleic acid, and detecting methylated nucleic acid based on amplification-dependent displacement of specifically annealed hybridization probes. Specifically, the inventive process provides for treating genomic DNA samples with sodium bisulfite to create methylation-dependent sequence differences, followed by detection with fluorescence-based quantitative PCR techniques. The process is particularly well suited for the rapid analysis of a large number of nucleic acid samples, such as those from collections of tumor tissues.

Description

TECHNICAL FIELD OF THE INVENTION
The present invention provides an improved high-throughput and quantitative process for determining methylation patterns in genomic DNA samples. Specifically, the inventive process provides for treating genomic DNA samples with sodium bisulfite to create methylation-dependent sequence differences, followed by detection with fluorescence-based quantitative PCR techniques.
BACKGROUND OF THE INVENTION
In higher order eukaryotic organisms, DNA is methylated only at cytosines located 5′ to guanosine in the CpG dinucleotide. This modification has important regulatory effects on gene expression predominantly when it involves CpG rich areas (CpG islands) located in the promoter region of a gene sequence. Extensive methylation of CpG islands has been associated with transcriptional inactivation of selected imprinted genes and genes on the inactive X chromosome of females. Aberrant methylation of normally unmethylated CpG islands has been described as a frequent event in immortalized and transformed cells and has been frequently associated with transcriptional inactivation of tumor suppressor genes in human cancers.
DNA methylases transfer methyl groups from a universal methyl donor, such as S-adenosyl methionine, to specific sites on the DNA. One biological function of DNA methylation in bacteria is protection of the DNA from digestion by cognate restriction enzymes. Mammalian cells possess methylases that methylate cytosine residues on DNA that are 5′ neighbors of guanine (CpG). This methylation may play a role in gene inactivation, cell differentiation, tumorigenesis, X-chromosome inactivation, and genomic imprinting. CpG islands remain unmethylated in normal cells, except during X-chromosome inactivation and parental specific imprinting where methylation of 5′ regulatory regions can lead to transcriptional repression. DNA methylation is also a mechanism for changing the base sequence of DNA without altering its coding function. DNA methylation is a heritable, reversible and epigenetic change. Yet, DNA methylation has the potential to alter gene expression, which has profound developmental and genetic consequences.
The methylation reaction involves flipping a target cytosine out of an intact double helix to allow the transfer of a methyl group from S-adenosylmethionine in a cleft of the enzyme DNA (cystosine-5)-methyltransferase (Klimasauskas et al., Cell 76:357-369, 1994) to form 5-methylcytosine (5-mCyt). This enzymatic conversion is the only epigenetic modification of DNA known to exist in vertebrates and is essential for normal embryonic development (Bird, Cell 70:5-8, 1992; Laird and Jaenisch, Human Mol. Genet. 3:1487-1495, 1994; and Li et al., Cell 69:915-926, 1992). The presence of 5-mCyt at CpG dinucleotides has resulted in a 5-fold depletion of this sequence in the genome during vertebrate evolution, presumably due to spontaneous deamination of 5-mCyt to T (Schoreret et al., Proc. Natl. Acad Sci. USA 89:957-961, 1992). Those areas of the genome that do not show such suppression are referred to as “CpG islands” (Bird, Nature 321:209-213, 1986; and Gardiner-Garden et al., J. Mol. Biol. 196:261-282, 1987). These CpG island regions comprise about 1% of vertebrate genomes and also account for about 15% of the total number of CpG dinucleotides (Bird, Nature 321:209-213, 1986). CpG islands are typically between 0.2 to about 1 kb in length and are located upstream of many housekeeping and tissue-specific genes, but may also extend into gene coding regions. Therefore, it is the methylation of cytosine residues within CpG islands in somatic tissues, which is believed to affect gene function by altering transcription (Cedar, Cell 53:3-4, 1988).
Methylation of cytosine residues contained within CpG islands of certain genes has been inversely correlated with gene activity. This could lead to decreased gene expression by a variety of mechanisms including, for example, disruption of local chromatin structure, inhibition of transcription factor-DNA binding, or by recruitment of proteins which interact specifically with methylated sequences indirectly preventing transcription factor binding. In other words, there are several theories as to how methylation affects mRNA transcription and gene expression, but the exact mechanism of action is not well understood. Some studies have demonstrated an inverse correlation between methylation of CpG islands and gene expression, however, most CpG islands on autosomal genes remain unmethylated in the germline and methylation of these islands is usually independent of gene expression. Tissue-specific genes are usually unmethylated in the receptive target organs but are methylated in the germline and in non-expressing adult tissues. CpG islands of constitutively-expressed housekeeping genes are normally unmethylated in the germline and in somatic tissues.
Abnormal methylation of CpG islands associated with tumor suppressor genes may also cause decreased gene expression. Increased methylation of such regions may lead to progressive reduction of normal gene expression resulting in the selection of a population of cells having a selective growth advantage (i.e., a malignancy).
It is considered that an altered DNA methylation pattern, particularly methylation of cytosine residues, causes genome instability and is mutagenic. This, presumably, has led to an 80% suppression of a CpG methyl acceptor site in eukaryotic organisms, which methylate their genomes. Cytosine methylation further contributes to generation of polymorphism and germ-line mutations and to transition mutations that inactivate tumor-suppressor genes (Jones, Cancer Res. 56:2463-2467, 1996). Methylation is also required for embryonic development of mammals (Li et al., Cell 69:915-926, 1992). It appears that the methylation of CpG-rich promoter regions may be blocking transcriptional activity. Ushijima et al. (Proc. Natl. Acad Sci. USA 94:2284-2289, 1997) characterized and cloned DNA fragments that show methylation changes during murine hepatocarcinogenesis. Data from a group of studies of altered methylation sites in cancer cells show that it is not simply the overall levels of DNA methylation that are altered in cancer, but changes in the distribution of methyl groups.
These studies suggest that methylation at CpG-rich sequences, known as CpG islands, provide an alternative pathway for the inactivation of tumor suppressors. Methylation of CpG oligonucleotides in the promoters of tumor suppressor genes can lead to their inactivation. Other studies provide data that alterations in the normal methylation process are associated with genomic instability (Lengauer et al. Proc. Natl. Acad. Sci. USA 94:2545-2550, 1997). Such abnormal epigenetic changes may be found in many types of cancer and can serve as potential markers for oncogenic transformation, provided that there is a reliable means for rapidly determining such epigenetic changes. Therefore, there is a need in the art for a reliable and rapid (high-throughput) method for determining methylation as the preferred epigenetic alteration.
METHODS TO DETERMINE DNA METHYLATION
There are a variety of genome scanning methods that have been used to identify altered methylation sites in cancer cells. For example, one method involves restriction landmark genomic scanning (Kawai et al., Mol. Cell. Biol. 14:7421-7427, 1994), and another example involves methylation-sensitive arbitrarily primed PCR (Gonzalgo et al., Cancer Res. 57:594-599, 1997). Changes in methylation patterns at specific CpG sites have been monitored by digestion of genomic DNA with methylation-sensitive restriction enzymes followed by Southern analysis of the regions of interest (digestion-Southern method). The digestion-Southern method is a straightforward method but it has inherent disadvantages in that it requires a large amount of high molecular weight DNA (at least or greater than 5 μg) and has a limited scope for analysis of CpG sites (as determined by the presence of recognition sites for methylation-sensitive restriction enzymes). Another method for analyzing changes in methylation patterns involves a PCR-based process that involves digestion of genomic DNA with methylation-sensitive restriction enzymes prior to PCR amplification (Singer-Sam et al., Nucl. Acids Res. 18:687, 1990). However, this method has not been shown effective because of a high degree of false positive signals (methylation present) due to inefficient enzyme digestion or overamplification in a subsequent PCR reaction.
Genomic sequencing has been simplified for analysis of DNA methylation patterns and 5-methylcytosine distribution by using bisulfite treatment (Frommer et al., Proc. Natl. Acad Sci. USA 89:1827-1831, 1992). Bisulfite treatment of DNA distinguishes methylated from unmethylated cytosines, but original bisulfite genomic sequencing requires large-scale sequencing of multiple plasmid clones to determine overall methylation patterns, which prevents this technique from being commercially useful for determining methylation patterns in any type of a routine diagnostic assay.
In addition, other techniques have been reported which utilize bisulfite treatment of DNA as a starting point for methylation analysis. These include methylation-specific PCR (MSP) (Herman et al. Proc. Natl. Acad Sci. USA 93:9821-9826, 1992); and restriction enzyme digestion of PCR products amplified from bisulfite-converted DNA (Sadri and Hornsby, Nucl. Acids Res. 24:5058-5059, 1996; and Xiong and Laird, Nucl. Acids Res. 25:2532-2534, 1997).
PCR techniques have been developed for detection of gene mutations (Kuppuswamy et al., Proc. Natl. Acad. Sci. USA 88:1143-1147, 1991) and quantitation of allelic-specific expression (Szabo and Mann, Genes Dev. 9:3097-3108, 1995; and Singer-Sam et al., PCR Methods Appl. 1:160-163, 1992 ). Such techniques use internal primers, which anneal to a PCR-generated template and terminate immediately 5′ of the single nucleotide to be assayed. However an allelic-specific expression technique has not been tried within the context of assaying for DNA methylation patterns.
Most molecular biological techniques used to analyze specific loci, such as CpG islands in complex genomic DNA, involve some form of sequence-specific amplification, whether it is biological amplification by cloning in E. coli, direct amplification by PCR or signal amplification by hybridization with a probe that can be visualized. Since DNA methylation is added post-replicatively by a dedicated maintenance DNA methyltransferase that is not present in either E. coli or in the PCR reaction, such methylation information is lost during molecular cloning or PCR amplification. Moreover, molecular hybridization does not discriminate between methylated and unmethylated DNA, since the methyl group on the cytosine does not participate in base pairing. The lack of a facile way to amplify the methylation information in complex genomic DNA has probably been a most important impediment to DNA methylation research. Therefore, there is a need in the art to improve upon methylation detection techniques, especially in a quantitative manner.
The indirect methods for DNA methylation pattern determinations at specific loci that have been developed rely on techniques that alter the genomic DNA in a methylation-dependent manner before the amplification event. There are two primary methods that have been utilized to achieve this methylation-dependent DNA alteration. The first is digestion by a restriction enzyme that is affected in its activity by 5-methylcytosine in a CpG sequence context. The cleavage, or lack of it, can subsequently be revealed by Southern blotting or by PCR. The other technique that has received recent widespread use is the treatment of genomic DNA with sodium bisulfite. Sodium bisulfite treatment converts all unmethylated cytosines in the DNA to uracil by deamination, but leaves the methylated cytosine residues intact. Subsequent PCR amplification replaces the uracil residues with thymines and the 5-methylcytosine residues with cytosines. The resulting sequence difference has been detected using standard DNA sequence detection techniques, primarily PCR.
Many DNA methylation detection techniques utilize bisulfite treatment. Currently, all bisulfite treatment-based methods are followed by a PCR reaction to analyze specific loci within the genome. There are two principally different ways in which the sequence difference generated by the sodium bisulfite treatment can be revealed. The first is to design PCR primers that uniquely anneal with either methylated or unmethylated converted DNA. This technique is referred to as “methylation specific PCR” or “MSP”. The method used by all other bisulfite-based techniques (such as bisulfite genomic sequencing, COBRA and Ms-SNuPE) is to amplify the bisulfite-converted DNA using primers that anneal at locations that lack CpG dinucleotides in the original genomic sequence. In this way, the PCR primers can amplify the sequence in between the two primers, regardless of the DNA methylation status of that sequence in the original genomic DNA. This results in a pool of different PCR products, all with the same length and differing in their sequence only at the sites of potential DNA methylation at CpGs located in between the two primers. The difference between these methods of processing the bisulfite-converted sequence is that in MSP, the methylation information is derived from the occurrence or lack of occurrence of a PCR product, whereas in the other techniques a mix of products is always generated and the mixture is subsequently analyzed to yield quantitative information on the relative occurrence of the different methylation states.
MSP is a qualitative technique. There are two reasons that it is not quantitative. The first is that methylation information is derived from the comparison of two separate PCR reactions (the methylated and the unmethylated version). There are inherent difficulties in making kinetic comparisons of two different PCR reactions. The other problem with MSP is that often the primers cover more than one CpG dinucleotide. The consequence is that multiple sequence variants can be generated, depending on the DNA methylation pattern in the original genomic DNA. For instance, if the forward primer is a 24-mer oligonucleotide that covers 3 CpGs, then 23=8 different theoretical sequence permutations could arise in the genomic DNA following bisulfite conversion within this 24-nucleotide sequence. If only a fully methylated and a fully unmethylated reaction is run, then you are really only investigating 2 out of the 8 possible methylation states. The situation is further complicated if the intermediate methylation states lead to amplification, but with reduced efficiency. Therefore, the MSP technique is non-quantitative. Therefore, there is a need in the art to improve the MSP technique and change it to be more quantitative and facilitate its process to greater throughput. The present invention addresses this need for a more rapid and quantitative methylation assay.
SUMMARY OF THE INVENTION
The present invention provides a method for detecting a methylated CpG island within a genomic sample of DNA comprising:
(a) contacting a genomic sample of DNA from a patient with a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid;
(b) amplifying the converted nucleic acid by means of two oligonucleotide primers in the presence or absence of one or a plurality of specific oligonucleotide probes, wherein one or more of the oligonucleotide primers and/or probes are capable of distinguishing between unmethylated and methylated nucleic acid; and
(c) detecting the methylated nucleic acid based on amplification-mediated displacement of the probe. Preferably, the amplifying step is a polymerase chain reaction (PCR) and the modifying agent is bisulfite. Preferably, the converted nucleic acid contains uracil in place of unmethylated cytosine residues present in the unmodified genomic sample of DNA. Preferably, the probe further comprises a fluorescence label moiety and the amplification and detection step comprises fluorescence-based quantitative PCR.
The invention provides a method for detecting a methylated CpG-containing nucleic acid comprising:
(a) contacting a nucleic acid-containing sample with a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid;
(b) amplifying the converted nucleic acid in the sample by means of oligonucleotide primers in the presence of a CpG-specific oligonucleotide probe, wherein the CpG-specific probe, but not the primers, distinguish between modified unmethylated and methylated nucleic acid; and
(c) detecting the methylated nucleic acid based upon an amplification-mediated displacement of the CpG-specific probe. Preferably, the amplifying step comprises a polymerase chain reaction (PCR) and the modifying agent comprises bisulfite. Preferably, the converted nucleic acid contains uracil in place of unmethylated cytosine residues present in the unmodified nucleic acid-containing sample. Preferably, the detection method is by means of a measurement of a fluorescence signal based on amplification-mediated displacement of the CpG-specific probe and the amplification and detection method comprises fluorescence-based quantitative PCR. The methylation amounts in the nucleic acid sample are quantitatively determined based on reference to a control reaction for amount of input nucleic acid.
The present invention further provides a method for detecting a methylated CpG-containing nucleic acid comprising:
(a) contacting a nucleic acid-containing sample with a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid;
(b) amplifying the converted nucleic acid in the sample by means of oligonucleotide primers and in the presence of a CpG-specific oligonucleotide probe, wherein both the primers and the CpG-specific probe distinguish between modified unmethylated and methylated nucleic acid; and
(c) detecting the methylated nucleic acid based on amplification-mediated displacement of the CpG-specific probe. Preferably, the amplifying step is a polymerase chain reaction (PCR) and the modifying agent is bisulfite. Preferably, the converted nucleic acid contains uracil in place of unmethylated cytosine residues present in the unmodified nucleic acid-containing sample. Preferably, the detection method comprises measurement of a fluorescence signal based on amplification-mediated displacement of the CpG-specific probe and the amplification and detection method comprises fluorescence-based quantitative PCR.
The present invention further provides a methylation detection kit useful for the detection of a methylated CpG-containing nucleic acid comprising a carrier means being compartmentalized to receive in close confinement therein one or more containers comprising:
(i) a first container containing a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid;
(ii) a second container containing primers for amplification of the converted nucleic acid;
(iii) a third container containing primers for the amplification of control unmodified nucleic acid; and
(iv) a fourth container containing a specific oligonucleotide probe the detection of which is based on amplification-mediated displacement, wherein the primers and probe each may or may not distinguish between unmethylated and methylated nucleic acid. Preferably, the modifying agent comprises bisulfite. Preferably, the modifying agent converts cytosine residues to uracil residues. Preferably, the specific oligonucleotide probe is a CpG-specific oligonucleotide probe, wherein the probe, but not the primers for amplification of the converted nucleic acid, distinguishes between modified unmethylated and methylated nucleic acid. Alternatively, the specific oligonucleotide probe is a CpG-specific oligonucleotide probe, wherein both the probe and the primers for amplification of the converted nucleic acid, distinguish between modified unmethylated and methylated nucleic acid. Preferably, the probe further comprises a fluorescent moiety linked to an oligonucleotide base directly or through a linker moiety and the probe is a specific, dual-labeled TaqMan probe.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows an outline of the MSP technology (prior art) using PCR primers that initially discriminate between methylated and unmethylated (bisulfite-converted) DNA. The top part shows the result of the MSP process when unmethylated single-stranded genomic DNA is initially subjected to sodium bisulfite conversion (deamination of unmethylated cytosine residues to uracil) followed by PCR reactions with the converted template, such that a PCR product appears only with primers specifically annealing to converted (and hence unmethylated) DNA. The bottom portion shows the contrasting result when a methylated single-stranded genomic DNA sample is used. Again, the process first provides for bisulfite treatment followed by PCR reactions such that a PCR product appears only with primers specifically annealing to unconverted (and hence initially methylated) DNA.
FIG. 2 shows an alternate process for evaluating DNA methylation with sodium bisulfite-treated genomic DNA using nondiscriminating (with respect to methylation status) forward and reverse PCR primers to amplify a specific locus. In this illustration, denatured (i.e., single-stranded) genomic DNA is provided that has mixed methylation status, as would typically be found in a sample for analysis. The sample is converted in a standard sodium bisulfite reaction and the mixed products are amplified by a PCR reaction using primers that do not overlap any CpG dinucleotides. This produces an unbiased (with respect to methylation status) heterogeneous pool of PCR products. The mixed or heterogeneous pool can then be analyzed by a technique capable of detecting sequence differences, including direct DNA sequencing, subcloning of PCR fragments followed by sequencing of representative clones, single-nucleotide primer extension reaction (MS-SNuPE), or restriction enzyme digestion (COBRA).
FIGS. 3A-3D shows a flow diagram of the inventive process in several, but not all, alternative embodiments for PCR product analysis. Variations in detection methodology, such as the use of dual probe technology (Lightcycler®) or fluorescent primers (Sunrise® technology) are not shown in this Figure. Specifically, the inventive process begins with a mixed sample of genomic DNA that is converted in a sodium bisulfite reaction to a mixed pool of methylation-dependent sequence differences according to standard procedures (the bisulfite process converts unmethylated cytosine residues to uracil). Fluorescence-based PCR is then performed either in an “unbiased” PCR reaction with primers that do not overlap known CpG methylation sites (left arm of FIG. 3), or in a “biased” reaction with PCR primers that overlap known CpG dinucleotides (right arm of FIG. 3). Sequence discrimination can occur either at the level of the amplification process (C and D) or at the level of the fluorescence detection process (B), or both (D). A quantitative test for methylation patterns in the genomic DNA sample is shown on the left arm (B), wherein sequence discrimination occurs at the level of probe hybridization. In this version, the PCR reaction provides for unbiased amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site. An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe overlie any CpG dinucleotides (A). Alternatively, as shown in the right arm of FIG. 3, a qualitative test for genomic methylation is achieved by probing of the biased PCR pool with either control oligonucleotides that do not “cover” known methylation sites (C; a fluorescence-based version of the MSP technique), or with oligonucleotides covering potential methylation sites (D).
FIG. 4 shows a flow chart overview of the inventive process employing a “TaqMan®” probe in the amplification process. Briefly, double-stranded genomic DNA is treated with sodium bisulfite and subjected to one of two sets of PCR reactions using TaqMan® probes; namely with either biased primers and TaqMan® probe (left column), or unbiased primers and TaqMan® probe (right column). The TaqMan® probe is dual-labeled with a fluorescent “reporter” (labeled “R” in FIG. 4) and “qencher” (labeled “O”) molecules, and is designed to be specific for a relatively high GC content region so that it melts out at about 10° C. higher temperature in the PCR cycle than the forward or reverse primers. This allows it to remain fully hybridized during the PCR annealing/extension step. As the Taq polymerase enzymatically synthesizes a new strand during PCR, it will eventually reach the annealed TaqMan® probe. The Taq polymerase 5′ to 3′ endonuclease activity will then displace the TaqMan® probe by digesting it to release the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescent system as described herein.
FIG. 5A-5B shows a comparison of the inventive assay to a conventional COBRA assay. Panel A shows a COBRA gel used to determine the level of DNA methylation at the ESR1 locus in DNAs of known methylation status (sperm, unmethylated) and HCT116 (methylated). The relative amounts of the cleaved products are indicated below the gel. A 56-bp fragment represents DNA molecules in which the TaqI site proximal to the hybridization probe is methylated in the original genomic DNA. The 86-bp fragment represents DNA molecules in which the proximal TaqI site is unmethylated and the distal site is methylated. Panel B summarizes the COBRA results and compares them to results obtained with the methylated and unmethylated version of the inventive assay process. The results are expressed as ratios between the methylation-specific reactions and a control reaction. For the bisulfite-treated samples, the control reaction was a MYOD1 assay as described in Example 1. For the untreated samples, the ACTB primers described for the RT-PCR reactions were used as a control to verify the input of unconverted DNA samples. (The ACTB primers do not span an intron). “No PCR” indicates that no PCR product was obtained on unconverted genomic DNA with COBRA primers designed to amplify bisulfite-converted DNA sequences.
FIG. 6A-6C illustrates a determination of the specificity of the oligonucleotides. Eight different combinations of forward primer, probe and reverse primer were tested on DNA samples with known methylation or lack of methylation at the ESR1 locus. Panel A shows the nomenclature used for the combinations of the ESR1 oligos. “U” refers to the oligo sequence that anneals with bisulfite-converted unmethylated DNA, while “M” refers to the methylated version. Position 1 indicates the forward PCR primer, position 2 the probe, and position 3 the reverse primer. The combinations used for the eight reactions are shown below each pair of bars, representing duplicate experiments. The results are expressed as ratios between the ESR1 values and the MYOD1 control values. Panel B represents an analysis of human sperm DNA. Panel C represents an analysis of DNA obtained from the human colorectal cancer cell line HCT116.
FIG. 7 shows a test of the reproducibility of the reactions. Assays were performed in eight independent reactions to determine the reproducibility on samples of complex origin. A primary human colorectal adenocarcinoma and matched normal mucosa was used for this purpose (samples 10N and 10T shown in FIG. 8). The results shown in this figure represent the raw values obtained in the assay. The values have been plate-normalized, but not corrected for input DNA. The bars indicate the mean values obtained for the eight separate reactions. The error bars represent the standard error of the mean.
FIG. 8 illustrates a comparison of MLH1 expression, microsatellite instability and MLH1 promoter methylation of 25 matched-paired human colorectal samples. The upper chart shows the MLH1 expression levels measured by quantitative, real time RT-PCR (TaqMan®) in matched normal (hatched bars) and tumor (solid black bars) colorectal samples. The expression levels are displayed as a ratio between MLH1 and ACTB measurements. Microsatellite instability status (MSI) is indicated by the circles located between the two charts. A black circle denotes MSI positivity, while an open circle indicates that the sample is MSI negative, as determined by analysis of the BAT25 and BAT26 loci. The lower chart shows the methylation status of the MLH1 locus as determined by an inventive process. The methylation levels are represented as the ratio between the MLH1 methylated reaction and the MYOD1 reaction.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a rapid, sensitive, reproducible high-throughput method for detecting methylation patterns in samples of nucleic acid. The invention provides for methylation-dependent modification of the nucleic acid, and then uses processes of nucleic acid amplification, detection, or both to distinguish between methylated and unmethylated residues present in the original sample of nucleic acid. In a preferred embodiment, the invention provides for determining the methylation status of CpG islands within samples of genomic DNA.
In contrast to previous methods for determining methylation patterns, detection of the methylated nucleic acid is relatively rapid and is based on amplification-mediated displacement of specific oligonucleotide probes. In a preferred embodiment, amplification and detection, in fact, occur simultaneously as measured by fluorescence-based real-time quantitative PCR (“RT-PCR”) using specific, dual-labeled TaqMan® oligonucleotide probes. The displaceable probes can be specifically designed to distinguish between methylated and unmethylated CpG sites present in the original, unmodified nucleic acid sample.
Like the technique of methylation-specific PCR (“MSP”; U.S. Pat. No. 5,786,146), the present invention provides for significant advantages over previous PCR-based and other methods (e.g., Southern analyses) used for determining methylation patterns. The present invention is substantially more sensitive than Southern analysis, and facilitates the detection of a low number (percentage) of methylated alleles in very small nucleic acid samples, as well as paraffin-embedded samples. Moreover, in the case of genomic DNA, analysis is not limited to DNA sequences recognized by methylation-sensitive restriction endonucleases, thus allowing for fine mapping of methylation patterns across broader CpG-rich regions. The present invention also eliminates the any false-positive results, due to incomplete digestion by methylation-sensitive restriction enzymes, inherent in previous PCR-based methylation methods.
The present invention also offers significant advantages over MSP technology. It can be applied as a quantitative process for measuring methylation amounts, and is substantially more rapid. One important advance over MSP technology is that the gel electrophoresis is not only a time-consuming manual task that limits high throughput capabilities, but the manipulation and opening of the PCR reaction tubes increases the chance of sample mis-identification and it greatly increases the chance of contaminating future PCR reactions with trace PCR products. The standard method of avoiding PCR contamination by uracil incorporation and the use of Uracil DNA Glycosylase (AmpErase) is incompatible with bisulfite technology, due to the presence of uracil in bisulfite-treated DNA. Therefore, the avoidance of PCR product contamination in a high-throughput application with bisulfite-treated DNA is a greater technical challenge than for the amplification of unmodified DNA. The present invention does not require any post-PCR manipulation or processing. This not only greatly reduces the amount of labor involved in the analysis of bisulfite-treated DNA, but it also provides a means to avoid handling of PCR products that could contaminate future reactions.
Two factors limit MSP to, at best, semi-quantitative applications. First, MSP methylation information is derived from the comparison of two separate PCR reactions (the methylated and the unmethylated versions). There are inherent difficulties in making kinetic comparisons of two different PCR reactions without a highly quantitative method of following the amplification reaction, such as Real-Time Quantitative PCR. The other problem relates to the fact that MSP amplification is provided for by means of particular CpG-specific oligonucleotides; that is, by biased primers. Often, the DNA sequence covered by such primers contains more than one CpG dinucleotide with the consequence that the sequence amplified will represent only one of multiple potential sequence variants present, depending on the DNA methylation pattern in the original genomic DNA. For instance, if the forward primer is a 24-mer oligonucleotide that covers 3 CpGs, then 23=8 different theoretical sequence permutations could arise in the genomic DNA following bisufite conversion within this 24-nucleotide sequence. If only a fully methylated and a fully unmethylated reaction is run, then only 2 out of the 8 possible methylation states are analyzed.
The situation is further complicated if the intermediate methylation states are non-specifically amplified by the fully methylated or fully unmethylated primers. Accordingly, the MSP patent explicitly describes a non-quantitative technique based on the occurrence or non-occurrence of a PCR product in the fully methylated, versus fully unmethylated reaction, rather than a comparison of the kinetics of the two reactions.
By contrast, one embodiment of the present invention provides for the unbiased amplification of all possible methylation states using primers that do not cover any CpG sequences in the original, unmodified DNA sequence. To the extent that all methylation patterns are amplified equally, quantitative information about DNA methylation patterns can then be distilled from the resulting PCR pool by any technique capable of detecting sequence differences (e.g., by fluorescence-based PCR).
Furthermore, the present invention is substantially faster than MSP. As indicated above, MSP relies on the occurrence or non-occurrence of a PCR product in the methylated, versus unmethylated reaction to determine the methylation status of a CpG sequence covered by a primer. Minimally, this requires performing agarose or polyacrylamide gel electrophoretic analysis (see U.S. Pat. No. 5,786,146, FIGS. 2A-2E, and 3A-3E). Moreover, determining the methylation status of any CpG sites within a given MSP amplified region would require additional analyses such as: (a) restriction endonuclease analysis either before, or after (e.g., COBRA analysis; Xiong and Laird, Nucleic Acids Res. 25:2532-2534, 1997) nucleic acid modification and amplification, provided that either the unmodified sequence region of interest contains methylation-sensitive sites, or that modification (e.g., bisulfite) results in creating or destroying restriction sites; (b) single nucleotide primer extension reactions (Ms-SNuPE; Gonzalo and Jones, Nucleic Acids Res 25: 2529-2531, 1997); or (c) DNA sequencing of the amplification products. Such additional analyses are not only subject to error (incomplete restriction enzyme digestion), but also add substantial time and expense to the process of determining the CpG methylation status of, for example, samples of genomic DNA.
By contrast, in a preferred embodiment of the present invention, amplification and detection occur simultaneously as measured by fluorescence-based real-time quantitative PCR using specific, dual-labeled oligonucleotide probes. In principle, the methylation status at any probe-specific sequence within an amplified region can be determined contemporaneously with amplification, with no requirement for subsequent manipulation or analysis.
As disclosed by MSP inventors, “[t]he only technique that can provide more direct analysis than MSP for most CpG sites within a defined region is genomic sequencing.” (U.S. Pat. No. 5,786,146 at 5, line 15-17). The present invention provides, in fact, a method for the partial direct sequencing of modified CpG sites within a known (previously sequenced) region of genomic DNA. Thus, a series of CpG-specific TaqMan® probes, each corresponding to a particular methylation site in a given amplified DNA region, are constructed. This series of probes are then utilized in parallel amplification reactions, using aliquots of a single, modified DNA sample, to simultaneously determine the complete methylation pattern present in the original unmodified sample of genomic DNA. This is accomplished in a fraction of the time and expense required for direct sequencing of the sample of genomic DNA, and are substantially more sensitive. Moreover, one embodiment of the present invention provides for a quantitative assessment of such a methylation pattern.
The present invention has identified four process techniques and associated diagnostic kits, utilizing a methylation-dependent nucleic acid modifying agent (e.g., bisulfite), to both qualitatively and quantitatively determine CpG methylation status in nucleic acid samples (e.g., genomic DNA samples). The four processes are outlined in FIG. 3 and labeled at the bottom with the letters A through D. Overall, methylated-CpG sequence discrimination is designed to occur at the level of amplification, probe hybridization or at both levels. For example, applications C and D utilize “biased” primers that distinguish between modified unmethylated and methylated nucleic acid and provide methylated-CpG sequence discrimination at the PCR amplification level. Process B uses “unbiased” primers (that do not cover CpG methylation sites), to provide for unbiased amplification of modified nucleic acid, but rather utilize probes that distinguish between modified unmethylated and methylated nucleic acid to provide for quantitative methylated-CpG sequence discrimination at the detection level (e.g., at the fluorescent (or luminescent) probe hybridization level only). Process A does not, in itself, provide for methylated-CpG sequence discrimination at either the amplification or detection levels, but supports and validates the other three applications by providing control reactions for input DNA.
Process D. In a first embodiment (FIG. 3, Application D), the invention provides a method for qualitatively detecting a methylated CpG-containing nucleic acid, the method including: contacting a nucleic acid-containing sample with a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid; amplifying the converted nucleic acid by means of two oligonucleotide primers in the presence of a specific oligonucleotide hybridization probe, wherein both the primers and probe distinguish between modified unmethylated and methylated nucleic acid; and detecting the “methylated” nucleic acid based on amplification-mediated probe displacement.
The term “modifies” as used herein means the conversion of an unmethylated cytosine to another nucleotide by the modifying agent, said conversion distinguishing unmethylated from methylated cytosine in the original nucleic acid sample. Preferably, the agent modifies unmethylated cytosine to uracil. Preferably, the agent used for modifying unmethylated cytosine is sodium bisulfite, however, other equivalent modifying agents that selectively modify unmethylated cytosine, but not methylated cytosine, can be substituted in the method of the invention. Sodium-bisulfite readily reacts with the 5, 6-double bond of cytosine, but not with methylated cytosine, to produce a sulfonated cytosine intermediate that undergoes deamination under alkaline conditions to produce uracil (Example 1). Because Taq polymerase recognizes uracil as thymine and 5-methylcytidine (m5C) as cytidine, the sequential combination of sodium bisulfite treatment and PCR amplification results in the ultimate conversion of unmethylated cytosine residues to thymine (C→U→T) and methylated cytosine residues (“mC”) to cytosine (mC→mC→C). Thus, sodium-bisulfite treatment of genomic DNA creates methylation-dependent sequence differences by converting unmethylated cyotsines to uracil, and upon PCR the resultant product contains cytosine only at positions where methylated cytosine occurs in the unmodified nucleic acid.
Oligonucleotide “primers,” as used herein, means linear, single-stranded, oligomeric deoxyribonucleic or ribonucleic acid molecules capable of sequence-specific hybridization (annealing) with complementary strands of modified or unmodified nucleic acid. As used herein, the specific primers are preferably DNA. The primers of the invention embrace oligonucleotides of appropriate sequence and sufficient length so as to provide for specific and efficient initiation of polymerization (primer extension) during the amplification process. As used in the inventive processes, oligonucleotide primers typically contain 12-30 nucleotides or more, although may contain fewer nucleotides. Preferably, the primers contain from 18-30 nucleotides. The exact length will depend on multiple factors including temperature (during amplification), buffer, and nucleotide composition. Preferably, primers are single-stranded although double-stranded primers may be used if the strands are first separated. Primers may be prepared using any suitable method, such as conventional phosphotriester and phosphodiester methods or automated embodiments which are commonly known in the art.
As used in the inventive embodiments herein, the specific primers are preferably designed to be substantially complementary to each strand of the genomic locus of interest. Typically, one primer is complementary to the negative (−) strand of the locus (the “lower” strand of a horizontally situated double-stranded DNA molecule) and the other is complementary to the positve (+) strand (“upper” strand). As used in the embodiment of Application D, the primers are preferably designed to overlap potential sites of DNA methylation (CpG nucleotides) and specifically distinguish modified unmethylated from methylated DNA. Preferably, this sequence discrimination is based upon the differential annealing temperatures of perfectly matched, versus mismatched oligonucleotides. In the embodiment of Application D, primers are typically designed to overlap from one to several CpG sequences. Preferably, they are designed to overlap from 1 to 5 CpG sequences, and most preferably from 1 to 4 CpG sequences. By contrast, in a quantitative embodiment of the invention, the primers do not overlap any CpG sequences.
In the case of fully “unmethylated” (complementary to modified unmethylated nucleic acid strands) primer sets, the anti-sense primers contain adenosine residues (“As”) in place of guanosine residues (“Gs”) in the corresponding (−) strand sequence. These substituted As in the anti-sense primer will be complementary to the uracil and thymidine residues (“Us” and “Ts”) in the corresponding (+) strand region resulting from bisulfite modification of unmethylated C residues (“Cs”) and subsequent amplification. The sense primers, in this case, are preferably designed to be complementary to anti-sense primer extension products, and contain Ts in place of unmethylated Cs in the corresponding (+) strand sequence. These substituted Ts in the sense primer will be complementary to the As, incorporated in the anti-sense primer extension products at positions complementary to modified Cs (Us) in the original (+) strand.
In the case of fully-methylated primers (complementary to methylated CpG-containing nucleic acid strands), the anti-sense primers will not contain As in place of Gs in the corresponding (−) strand sequence that are complementary to methylated Cs (i.e., mCpG sequences) in the original (+) strand. Similarly, the sense primers in this case will not contain Ts in place of methylated Cs in the corresponding (+) strand mCpG sequences. However, Cs that are not in CpG sequences in regions covered by the fully-methylated primers, and are not methylated, will be represented in the fully-methylated primer set as described above for unmethylated primers.
Preferably, as employed in the embodiment of Application D, the amplification process provides for amplifying bisulfite converted nucleic acid by means of two oligonucleotide primers in the presence of a specific oligonucleotide hybridization probe. Both the primers and probe distinguish between modified unmethylated and methylated nucleic acid. Moreover, detecting the “methylated” nucleic acid is based upon amplification-mediated probe fluorescence. In one embodiment, the fluorescence is generated by probe degradation by 5′ to 3′ exonuclease activity of the polymerase enzyme. In another embodiment, the fluorescence is generated by fluorescence energy transfer effects between two adjacent hybridizing probes (Lightcycler® technology) or between a hybridizing probe and a primer. In another embodiment, the fluorescence is generated by the primer itself (Sunrise® technology). Preferably, the amplification process is an enzymatic chain reaction that uses the oligonucleotide primers to produce exponential quantities of amplification product, from a target locus, relative to the number of reaction steps involved.
As describe above, one member of a primer set is complementary to the (−) strand, while the other is complementary to the (+) strand. The primers are chosen to bracket the area of interest to be amplified; that is, the “amplicon.” Hybridization of the primers to denatured target nucleic acid followed by primer extension with a DNA polymerase and nucleotides, results in synthesis of new nucleic acid strands corresponding to the amplicon. Preferably, the DNA polymerase is Taq polymerase, as commonly used in the art. Although equivalent polymerases with a 5′ to 3′ nuclease activity can be substituted. Because the new amplicon sequences are also templates for the primers and polymerase, repeated cycles of denaturing, primer annealing, and extension results in exponential production of the amplicon. The product of the chain reaction is a discrete nucleic acid duplex, corresponding to the amplicon sequence, with termini defined by the ends of the specific primers employed. Preferably the amplification method used is that of PCR (Mullis et al., Cold Spring Harb. Symp. Quant. Biol 51:263-273; Gibbs, Anal. Chem. 62:1202-1214, 1990), or more preferably, automated embodiments thereof which are commonly known in the art.
Preferably, methylation-dependent sequence differences are detected by methods based on fluorescence-based quantitative PCR (real-time quantitative PCR, Heid et al., Genome Res. 6:986-994, 1996; Gibson et al., Genome Res. 6:995-1001, 1996) (e.g., “TaqMan®,” “Lightcycler®,” and “Sunrise®)” technologies). For the TaqMan® and Lightcycler® technologies, the sequence discrimination can occur at either or both of two steps: (1) the amplification step, or (2) the fluorescence detection step. In the case of the “Sunrise®” technology, the amplification and fluorescent steps are the same. In the case of the FRET hybridization, probes format on the Lightcycler®, either or both of the FRET oligonucleotides can be used to distinguish the sequence difference. Most preferably the amplification process, as employed in all inventive embodiments herein, is that of fluorescence-based Real Time Quantitative PCR (Heid et al., Genome Res. 6:986-994, 1996) employing a dual-labeled fluorescent oligonucleotide probe (TaqMan® PCR, using an ABI Prism 7700 Sequence Detection System, Perkin Elmer Applied Biosystems, Foster City, Calif.).
The “TaqMan®” PCR reaction uses a pair of amplification primers along with a nonextendible interrogating oligonucleotide, called a TaqMan® probe, that is designed to hybridize to a GC-rich sequence located between the forward and reverse (i.e., sense and anti-sense) primers. The TaqMan® probe further comprises a fluorescent “reporter moiety” and a “quencher moiety” covalently bound to linker moieties (e.g., phosphoramidites) attached to nucleotides of the TaqMan® oligonucleotide. Examples of suitable reporter and quencher molecules are: the 5′ fluorescent reporter dyes 6FAM (“FAM”; 2,7 dimethoxy-4,5-dichloro-6-carboxy-fluorescein), and TET (6-carboxy-4,7,2′,7′-tetrachlorofluorescein); and the 3′ quencher dye TAMRA (6-carboxytetramethylrhodamine) (Livak et al., PCR Methods Appl. 4:357-362, 1995; Gibson et al., Genome Res. 6:995-1001; and 1996; Heid et al., Genome Res. 6:986-994, 1996).
One process for designing appropriate TaqMan® probes involves utilizing a software facilitating tool, such as “Primer Express” that can determine the variables of CpG island location within GC-rich sequences to provide for at least a 10° C. melting temperature difference (relative to the primer melting temperatures) due to either specific sequence (tighter bonding of GC, relative to AT base pairs), or to primer length.
The TaqMan® probe may or may not cover known CpG methylation sites, depending on the particular inventive process used. Preferably, in the embodiment of Application D, the TaqMan® probe is designed to distinguish between modified unmethylated and methylated nucleic acid by overlapping from 1 to 5 CpG sequences. As described above for the fully unmethylated and fully methylated primer sets, TaqMan® probes may be designed to be complementary to either unmodified nucleic acid, or, by appropriate base substitutions, to bisulfite-modified sequences that were either fully unmethylated or fully methylated in the original, unmodified nucleic acid sample.
Each oligonucleotide primer or probe in the TaqMan® PCR reaction can span anywhere from zero to many different CpG dinucleotides that each can result in two different sequence variations following bisulfite treatment (mCpG, or UpG). For instance, if an oligonucleotide spans 3 CpG dinucleotides, then the number of possible sequence variants arising in the genomic DNA is 23=8 different sequences. If the forward and reverse primer each span 3 CpGs and the probe oligonucleotide (or both oligonucleotides together in the case of the FRET format) spans another 3, then the total number of sequence permutations becomes 8×8×8=512. In theory, one could design separate PCR reactions to quantitatively analyze the relative amounts of each of these 512 sequence variants. In practice, a substantial amount of qualitative methylation information can be derived from the analysis of a much smaller number of sequence variants. Thus, in its most simple form, the inventive process can be performed by designing reactions for the fully methylated and the fully unmethylated variants that represent the most extreme sequence variants in a hypothetical example (see FIG. 3, Application D). The ratio between these two reactions, or alternatively the ratio between the methylated reaction and a control reaction (FIG. 3, Application A), would provide a measure for the level of DNA methylation at this locus. A more detailed overview of the qualitative version is shown in FIG. 4.
Detection of methylation in the embodiment of Application D, as in other embodiments herein, is based on amplification-mediated displacement of the probe. In theory, the process of probe displacement might be designed to leave the probe intact, or to result in probe digestion. Preferably, as used herein, displacement of the probe occurs by digestion of the probe during amplification. During the extension phase of the PCR cycle, the fluorescent hybridization probe is cleaved by the 5′ to 3′ nucleolytic activity of the DNA polymerase. On cleavage of the probe, the reporter moiety emission is no longer transferred efficiently to the quenching moiety, resulting in an increase of the reporter moiety fluorescent-emission spectrum at 518 nm. The fluorescent intensity of the quenching moiety (e.g., TAMRA), changes very little over the course of the PCR amplification. Several factors my influence the efficiency of TaqMan® PCR reactions including: magnesium and salt concentrations; reaction conditions (time and temperature); primer sequences; and PCR target size (i.e., amplicon size) and composition. Optimization of these factors to produce the optimum fluorescence intensity for a given genomic locus is obvious to one skilled in the art of PCR, and preferred conditions are further illustrated in the “Examples” herein. The amplicon may range in size from 50 to 8,000 base pairs, or larger, but may be smaller. Typically, the amplicon is from 100 to 1000 base pairs, and preferably is from 100 to 500 base pairs. Preferably, the reactions are monitored in real time by performing PCR amplification using 96-well optical trays and caps, and using a sequence detector (ABI Prism) to allow measurement of the fluorescent spectra of all 96 wells of the thermal cycler continuously during the PCR amplification. Preferably, process D is run in combination with the process A (FIG. 3) to provide controls for the amount of input nucleic acid, and to normalize data from tray to tray.
Application C. The inventive process can be modified to avoid sequence discrimination at the PCR product detection level. Thus, in an additional qualitative process embodiment (FIG. 3, Application C), just the primers are designed to cover CpG dinucleotides, and sequence discrimination occurs solely at the level of amplification. Preferably, the probe used in this embodiment is still a TaqMan® probe, but is designed so as not to overlap any CpG sequences present in the original, unmodified nucleic acid. The embodiment of Application C represents a high-throughput, fluorescence-based real-time version of MSP technology, wherein a substantial improvement has been attained by reducing the time required for detection of methylated CpG sequences. Preferably, the reactions are monitored in real time by performing PCR amplification using 96-well optical trays and caps, and using a sequence detector (ABI Prism) to allow measurement of the fluorescent spectra of all 96 wells of the thermal cylcer continuously during the PCR amplification. Preferably, process C is run in combination with process A to provide controls for the amount of input nucleic acid, and to normalize data from tray to tray.
Application B. The inventive process can be also be modified to avoid sequence discrimination at the PCR amplification level (FIG. 3, A and B). In a quantitative process embodiment (FIG. 3, Application B), just the probe is designed to cover CpG dinucleotides, and sequence discrimination occurs solely at the level of probe hybridization. Preferably, TaqMan® probes are used. In this version, sequence variants resulting from the bisulfite conversion step are amplified with equal efficiency; as long as there is no inherent amplification bias (Warnecke et al., Nucleic Acids Res. 25:4422-4426, 1997). Design of separate probes for each of the different sequence variants associated with a particular methylation pattern (e.g., 23=8 probes in the case of 3 CpGs) would allow a quantitative determination of the relative prevalence of each sequence permutation in the mixed pool of PCR products. Preferably, the reactions are monitored in real time by performing PCR amplification using 96-well optical trays and caps, and using a sequence detector (ABI Prism) to allow measurement of the fluorescent spectra of all 96 wells of the thermal cylcer continuously during the PCR amplification. Preferably, process B is run in combination with process A to provide controls for the amount of input nucleic acid, and to normalize data from tray to tray.
Application A. Process A (FIG. 3) does not, in itself, provide for methylated-CpG sequence discrimination at either the amplification or detection levels, but supports and validates the other three applications by providing control reactions for the amount of input DNA, and to normalize data from tray to tray. Thus, if neither the primers, nor the probe overlie any CpG dinucleotides, then the reaction represents unbiased amplification and measurement of amplification using fluorescent-based quantitative real-time PCR serves as a control for the amount of input DNA (FIG. 3, Application A). Preferably, process A not only lacks CpG dinucleotides in the primers and probe(s), but also does not contain any CpGs within the amplicon at all to avoid any differential effects of the bisulfite treatment on the amplification process. Preferably, the amplicon for process A is a region of DNA that is not frequently subject to copy number alterations, such as gene amplification or deletion.
Results obtained with the qualitative version of the technology are described in the examples below. Dozens of human tumor samples have been analyzed using this technology with excellent results. High-throughput using a TaqMan® machine allowed performance of 1100 analyses in three days with one TaqMan® machine.
EXAMPLE 1
An initial experiment was performed to validate the inventive strategy for assessment of the methylation status of CpG islands in genomic DNA. This example shows a comparison between human sperm DNA (known to be highly unmethylated) and HCT116 DNA (from a human colorectal cell line, known to be highly methylated at many CpG sites) with respect to the methylation status of specific, hypermethylatable CpG islands in four different genes. COBRA (combined bisulfite restriction analysis; Xiong and Laird, Nucleic Acids Res. 25:2532-2534, 1997) was used as an independent measure of methylation status.
DNA Isolation and Bisulfite Treatment. Briefly, genomic DNA was isolated from human sperm or HCT116 cells by the standard method of proteinase K digestion and phenol-chloroform extraction (Wolf et al., Am. J Hum. Genet. 51:478-485, 1992). The DNA was then treated with sodium bisulfite by initially denaturing in 0.2 M NaOH, followed by addition of sodium bisulfite and hydroquinone (to final concentrations of 3.1 M, and 0.5M, respectively), incubation for 16 h. at 55° C., desalting (DNA Clean-Up System; Promega), desulfonation by 0.3M NaOH, and final ethanol precipitation. (Xiong and Laird, supra, citing Sadri and Hornsby, Nucleic Acids Res. 24:5058-5059, 1996; see also Frommer et al, Proc. Natl Acad. Sci. USA 89:1827-1831, 1992). After bisulfite treatment, the DNA was subjected either to COBRA analysis as previously described (Xiong and Laird, supra), or to the inventive amplification process using fluorescence-based, real-time quantitative PCR (Heid et al., Genome Res. 6:986-994, 1996; Gibson et al., Genome Res. 6:995-1001, 1996).
COBRA and MsSNuPE reactions. ESR1 and APC genes were analyzed using COBRA (Combined Bisulfite Restriction Analysis). For COBRA analysis, methylation-dependent sequence differences were introduced into the genomic DNA by standard bisulfite treatment according to the procedure described by Frommer et al (Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992) (1 ug of salmon sperm DNA was added as a carrier before the genomic DNA was treated with sodium bisulfite). PCR amplification of the bisulfite converted DNA was performed using primers specific for the interested CpG islands, followed by restriction endonuclease digestion, gel electrophoresis, and detection using specific, labeled hybridization probes. The forward and reverse primer sets used for the ESR1 and APC genes are: TCCTAAAACTACACTTACTCC [SEQ ID NO. 35], GGTTATTTGGAAAAAGAGTATAG [SEQ ID NO. 36] (ESR1 promoter); and AGAGAGAAGTAGTTGTGTTAAT [SEQ ID NO. 37], ACTACACCAATACAACCACAT [SEQ ID NO. 38] (APC promoter), respectively. PCR products of ESR1 were digested by restriction endonuleases TaqI and BstUI, while the products from APC were digested by Taq I and SfaN I, to measure methylation of 3 CpG sies for APC and 4 CpG sites for ESR1. The digested PCR products were electrophoresed on denaturing polyacrylamide gel and transferred to nylon membrane (Zetabind; American Bioanalytical) by electroblotting. The membranes were hybridized by a 5′-end labeled oligonucleotide to visualize both digested and undigested DNA fragments of interest. The probes used are as follows: ESR1, AAACCAAAACTC [SEQ ID NO. 39]; and APC, CCCACACCCAACCAAT [SEQ ID NO. 40]. Quantitation was performed with the Phosphoimager 445SI (Molecular Dynamics). Calculations were performed in Microsoft Excel. The level of DNA methylation at the investigated CpG sites was determined by calculating the percentage of the digested PCR fragments (Xiong and Laird, supra).
MLH1 and CDKN2A were analyzed using MsSNuPE (Methylation-sensitive Single Nucleotide Primer Extension Assay), performed as decribed by Gonzalgo and Jones (Nucleic Acids Res. 25:2529-2531). PCR amplification of the bisulfite converted DNA was performed using primers specific for the interested CpG islands, and detection was performed using additional specific primers (extension probes). The forward and reverse primer sets used for the MLH1 and CDKN2A genes are: GGAGGTTATAAGAGTAGGGTTAA [SEQ ID NO. 41], CCAACCAATAAAAACAAAAATACC [SEQ ID NO. 42] (MLH1 promoter); GTAGGTGGGGAGGAGTTTAGTT [SEQ ID NO.43], TCTAATAACCAACCAACCCCTCC [SEQ ID NO. 44] (CDKN2A promoter); and TTGTATTATTTTGTTTTTTTTGGTAGG [SEQ ID NO.45], CAACTTCTCAAATCATCAATCCTCAC [SEQ ID NO. 46] (CDKN2A Exon 2), respectively. The MsSNuPE extension probes are located immediately 5′ of the CpG to be analyzed, and the sequences are: TTTAGTAGAGGTATATAAGTT [SEQ ID NO. 47], TAAGGGGAGAGGAGGAGTTTGAGAAG [SEQ ID NO. 48] ( MLH1 promoter sites 1 and 2, respectively); TTTGAGGGATAGGGT [SEQ ID NO. 49], TTTTAGGGGTGTTATATT [SEQ ID NO. 50], TTTTTTTGTTTGGAAAGATAT [SEQ ID NO. 51] ( promoter sites 1, 2, and 3, respectively); and GTTGGTGGTGTTGTAT [SEQ ID NO. 52], AGGTTATGATGATGGGTAG [SEQ ID NO. 53], TATTAGAGGTAGTAATTATGTT [SEQ ID NO. 54] ( Exon2 sites 1, 2, and 3, respectively). A pair of reactions was set up for each sample using either 32p-dCTP or 32p-dTTP for single nucleotide extension. The extended MsSNuPE primers (probes) were separated by denaturing polyacrylamide gel. Quantitation was performed using the Phosphoimager.
Inventive methylation analysis. Bisulfite-converted genomic DNA was amplified using locus-specific PCR primers flanking an oligonucleotide probe with a 5′ fluorescent reporter dye (6FAM) and a 3′ quencher dye (TAMRA) (Livak et al., PCR Methods Appl. 4:357-362, 1995) (primers and probes used for the methylation analyses are listed under “Genes, MethyLight Primers and Probe Sequences” herein, infra). In this example, the forward and reverse primers and the corresponding fluorogenic probes were designed to discriminate between either fully methylated or fully unmethylated molecules of bisulfite-converted DNA (see discussion of primer design under “Detailed Description of the Invention, Process D” herein). Primers and a probe were also designed for a stretch of the MYOD1 gene (Myogenic Differentiation Gene), completely devoid of CpG dinucleotides as a control reaction for the amount of input DNA. Parallel reactions were performed using the inventive process with the methylated and unmethylated (D), or control oligos (A) on the bisulfite-treated sperm and HCT116 DNA samples. The values obtained for the methylated and unmethylated reactions were normalized to the values for the MYOD1 control reactions to give the ratios shown in Table 1 (below).
In a TaqMan® protocol, the 5′ to 3′ nuclease activity of Taq DNA polymerase cleaved the probe and released the reporter, whose fluorescence was detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, Calif.). After crossing a fluorescence detection threshold, the PCR amplification resulted in a fluorescent signal 25′ proportional to the amount of PCR product generated. Initial template quantity can be derived from the cycle number at which the fluorescent signal crosses a threshold in the exponential phase of the PCR reaction. Several reference samples were included on each assay plate to verify plate-to-plate consistency. Plates were normalized to each other using these reference samples. The PCR amplification was performed using a 96-well optical tray and caps with a final reaction mixture of 25 μl consisting of 600 nM each primer, 200 nM probe, 200 μM each dATP, dCTP, dGTP, 400 μM dUTP, 5.5 mM MgCl2, 1×TaqMan® Buffer A containing a reference dye, and bisulfite-converted DNA or unconverted DNA at the following conditions: 50° C. for 2 min, 95° C. for 10 min, followed by 40 cycles at 95° C. for 15 s and 60° C. for 1 min.
Genes, MethyLight Primers and Probe Sequences. Four human genes were chosen for analysis: (1) APC (adenomatous polyposis coli) (Hiltunen et al., Int. J Cancer 70:644-648, 1997); (2) ESR1 (estrogen receptor) (Issa et al., Nature Genet. 7:53640, 1994); (3) CDKN2A (p16) (Ahuja, Cancer Res. 57:3370-3374, 1997); and (4) hMLH1 (mismatch repair) (Herman et al., Proc. Natl. Acad. Sci. USA. 95:6870-6875, 1998; Veigl et al., Proc. Natl. Acad. Sci. USA. 95:8698-8702, 1998). These genes were chosen because they contain hypermethylatable CpG islands that are known to undergo de novo methylation in human colorectal tissue in all normal and tumor samples. The human APC gene, for example, has been linked to the development of colorectal cancer, and CpG sites in the regulatory sequences of the gene are known to be distinctly more methylated in colon carcinomas, but not in premalignant adenomas; relative to normal colonic mucosa (Hiltunen et al., supra). The human ESR gene contains a CpG island at its 5′ end, which becomes increasingly methylated in colorectal mucosa with age and is heavily methylated in all human colorectal tumors analyzed (Issa et al., supra). Hypermethylation of promoter-associated CpG islands of the CDKN2A (pl6) gene has been found in 60% of colorectal cancers showing microsatellite instability (MI) due to defects in one of several base mismatch repair genes (Ahuja et al., supra). The mismatch repair gene MLH1 plays a pivotal role in the development of sporadic cases of mismatch repair-deficient colorectal tumors (Thibodeau et al., Science 260:816-819, 1993). It has been reported that MLH1 can become transcriptionally silenced by DNA hypermethylation of its promoter region, leading to microsatellite instability (MSI) (Kane et al., Cancer Res. 57:808-811, 1997; Ahuja et al., supra; Cunningham et al., Cancer Res. 58:3455-3460, 1998; Herman et al., supra; Veigl et al., supra).
Five sets of PCR primers and probes, designed specifically for bisulfite converted DNA sequences, were used: (1) a set representing fully methylated and fully unmethylated DNA for the ESR1 gene; (2) a fully methylated set for the MLH1 gene; (3) a fully methylated and fully unmethylated set for the APC gene; and (4) a fully methylated and fully unmethylated set for the CDKN2A (p16) gene; and (5) an internal reference set for the MYOD1 gene to control for input DNA. The methylated and unmethylated primers and corresponding probes were designed to overlap 1 to 5 potential CpG dinucleotides sites. The MYOD1 internal reference primers and probe were designed to cover a region of the MYOD1 gene completely devoid of any CpG dinucleotides to allow for unbiased PCR amplification of the genomic DNA, regardless of methylation status. As indicated above, parallel TaqMan® PCR reactions were performed with primers specific for the bisulfite-converted methylated and/or unmethylated gene sequences and with the MYOD1 reference primers. The primer and probe sequences are listed below. In all cases, the first primer listed is the forward PCR primer, the second is the TaqMan® probe, and the third is the reverse PCR primer. ESR1 methylated (GGCGTTCGTTTTGGGATTG [SEQ ID NO. 1], 6FAM 5′-CGATAAAACCGAACGACCCGACGA-3′ TAMRA [SEQ ID NO. 2], GCCGACACGCGAACTCTAA [SEQ ID NO. 3]); ESR1 unmethylated (ACACATATCCCACCAACACACAA [SEQ ID NO. 4], 6FAM 5′-CAACCCTACCCCAAAAACCTACAAATCCAA-3′TAMRA [SEQ ID NO. 5], AGGAGTTGGTGGAGGGTGTTT [SEQ ID NO. 6]); MLH1 methylated (CTATCGCCGCCTCATCGT [SEQ ID NO. 7], 6FAM 5′-CGCGACGTCAAACGCCACTACG-3′ TAMRA [SEQ ID NO. 8], CGTTATATATCGTTCGTAGTATTCGTGTTT [SEQ ID NO. 9]); APC methylated (TTATATGTCGGTTACGTGCGTTTATAT [SEQ ID NO. 10], 6FAM 5′-CCCGTCGAAAACCCGCCGATTA-3′ TAMRA [SEQ ID NO. 11], GAACCAAAACGCTCCCCAT [SEQ ID NO. 12]); APC unmethylated (GGGTTGTGAGGGTATATTTTTGAGG [SEQ ID NO. 13], 6FAM 5′-CCCACCCAACCACACAACCTACCTAACC-3′ TAMRA [SEQ ID NO. 14], CCAACCCACACTCCACAATAAA [SEQ ID NO. 15]); CDKN2A methylated (AACAACGTCCGCACCTCCT [SEQ ID NO. 16], 6FAM 5′-ACCCGACCCCGAACCGCG-3′ TAMRA [SEQ ID NO. 17], TGGAATTTTCGGTTGATTGGTT [SEQ ID NO. 18]); CDKN2A unmethylated (CAACCAATCAACCAAAAATTCCAT [SEQ ID NO. 19], 6FAM 5′-CCACCACCCACTATCTACTCTCCCCCTC-3′ TAMRA [SEQ ID NO. 20], GGTGGATTGTGTGTGTTTGGTG [SEQ ID NO. 21]); and MYOD1, (CCAACTCCAAATCCCCTCTCTAT [SEQ ID NO. 22], 6FAM 5′-TCCCTTCCTATTCCTAAATCCAACCTAAATACCTCC-3′ TAMRA [SEQ ID NO. 23], TGATTAATTTAGATTGGGTTTAGAGAAGGA [SEQ ID NO. 24]).
Tables 1 and 2 shows the results of the analysis of human sperm and HCT116 DNAs for methylation status of the CpG islands within the four genes; APC, ESR1, CDKN2A (pl6), and hMLH1. The results are expressed as ratios between the methylated and unmethylated reactions and a control reaction (MYOD1). Table 1 shows that sperm DNA yielded a positive ratio only with the “unmethylated” primers and probe; consistent with the known unmethylated status of sperm DNA, and consistent with the percent methylation values determined by COBRA analysis. That is, priming on the bisulfite-treated DNA occurred from regions that contained unmethylated cytosine in CpG sequences in the corresponding genomic DNA, and hence were deaminated converted to uracil) by bisulfite treatment.
TABLE 1
COBRA or Methylated Unmethylated
Technique Ms-SNuPE Reaction* Reaction*
GENE
APC
0% 0 49
ESR1 0% 0 62
CDKN2A 0%** 0 52
hMLH1 ND 0 ND
*The values do not represent percentages, but values in an arbitrary unit that can be compared quantitatively between different DNA samples for the same reaction, after normalization with a control gene.
**Based on Ms-SNuPE.
Table 2 shows the results of an analysis of HCT116 DNA for methylation status of the CpG islands within the four genes; APC, ESR1, CDKN2A (p16), and hMLH1. The results are expressed as ratios between the methylation-specific reactions and a control reaction (MYOD1). For the ESR gene, a positive ratio was obtained only with the “methylated” primers and probe; consistent with the known methylated status of HCT116 DNA, and the COBRA analysis. For the CDKN2A gene, HCT116 DNA yielded positive ratios with both the “methylated” and “unmethylated” primers and probe; consistent with the known methylated status of HCT116 DNA, and with the COBRA analysis that indicates only partial methylation of this region of the gene. By contrast, the APC gene gave positive results only with the unmethylated reaction. However, this is entirely consistent with the COBRA analysis, and indicates that this APC gene region is unmethylated in HCT116 DNA. This may indicate that the methylation state of this particular APC gene regulatory region in the DNA from the HCT116 cell line is more like that of normal colonic mucosa or premalignant adenomas rather than that of colon carcinomas (known to be distinctly more methylated).
TABLE 2
COBRA and/or Methylated Unmethylated
Technique Ms-SNuPE Reaction* Reaction*
GENE
APC
 2% 0 81
ESR1 99% 36 0
CDKN2A 38%** 222 26
hMLH1 ND 0 ND
*The values do not represent percentages, but values in an arbitrary unit that can be compared quantitatively between different DNA samples for the same reaction, after normalization with a control gene.
** Based on Ms-SNuPE.
EXAMPLE 2
This example is a comparison of the inventive process (A and D in FIG. 3) with an independent COBRA method (See “Methods,” above) to determine the methylation status of a CpG island associated with the estrogen receptor (ESR1) gene in the human colorectal cell line HCT116 and in human sperm DNA. This CpG island has been reported to be highly methylated in HCT116 and unmethylated in human sperm DNA (Xiong and Laird, supra; Issa et al., supra). The COBRA analysis, is described above. Two TaqI sites within this CpG island confirmed this, showing a lack of methylation in the sperm DNA and nearly complete methylation in HCT116 DNA (FIG. 5A). Additionally, results using bisulfite-treated and untreated DNA were compared.
For an analysis, fully “methylated” and fully “unmethylated” ESR1, and control MYOD1 primers and probes were designed as described above under “Example 1.” Three separate reactions using either the “methylated,” “unmethylated” or control oligos on both sperm and HCT116 DNA were performed. As in Example 1, above, the values obtained for the methylated and unmethylated reactions were normalized to the values for the MYOD1 control reactions to give the ratios shown in FIG. 5B. Sperm DNA yielded a positive ratio only with the unmethylated primers and probe, consistent with its unmethylated status. In contrast, HCT116 DNA, with predominantly methylated ESR1 alleles, generated a positive ratio only in the methylated reaction (FIG. 5B). Both the sperm and HCT116 DNA yielded positive values in the MYOD1 reactions, indicating that there was sufficient input DNA for each sample. As expected, the non-bisulfite converted DNA with either the methylated or unmethylated oligonucleotides (FIG. 5B) was not amplified. These results are consistent with the COBRA findings (FIG. 5A), suggesting that the inventive assay can discriminate between the methylated and unmethylated alleles of the ESR1 gene. In addition, the reactions are specific to bisulfite-converted DNA, which precludes the generation of false positive results due to incomplete bisulfite conversion.
EXAMPLE 3
This example determined specificity of the inventive primers and probes. FIG. 6 shows a test of all possible combinations of primers and probes to further examine the specificity of the methylated and unmethylated oligonucleotides on DNAs of known methylation status. Eight different combinations of the ESR1 “methylated” and “unmethylated” forward and reverse primers and probe (as described above in “Example 1”) were tested in different combinations in inventive assays on sperm and HCT 116 DNA in duplicate. The assays were performed as described above in Example 1. Panel A (FIG. 6) shows the nomenclature used for the combinations of the ESR1 oligos. “U” refers to the oligo sequence that anneals with bisulfite-converted unmethylated DNA, while “M” refers to the methylated version. Position 1 indicates the forward PCR primer, position 2 the probe, and position 3 the reverse primer. The combinations used for the eight reactions are shown below each pair of bars, representing duplicate experiments. The results are expressed as ratios between the ESR1 values and the MYOD1 control values. Panel B represents an analysis of human sperm DNA. Panel C represents an analysis of DNA obtained from the human colorectal cancer cell line HCT116.
Only the fully unmethylated (reaction 1) or fully methylated combinations (reaction 8) resulted in a positive reaction for the sperm and HCT116, respectively. The other combinations were negative, indicating that the PCR conditions do not allow for weak annealing of the mismatched oligonucleotides. This selectivity indicates that the inventive process can discriminate between fully methylated or unmethylated alleles with a high degree of specificity.
EXAMPLE 4
This example shows that the inventive process is reproducible. FIG. 7 illustrates an analysis of the methylation status of the ESR1 locus in DNA samples derived from a primary colorectal adenocarcinoma and matched normal mucosa derived from the same patient (samples 10N and 10T in FIG. 8) in order to study a heterogeneous population of methylated and unmethylated alleles. The colorectal tissue samples were collected as described in Example 5, below. In addition, the reproducibility of the inventive process was tested by performing eight independent reactions for each assay. The results for the ESR1 reactions and for the MYOD1 control reaction represent raw absolute values obtained for these reactions, rather than ratios, so that the standard errors of the individual reactions can be evaluated. The values have been plate-normalized, but not corrected for input DNA. The bars indicate the mean values obtained for the eight separate reactions. The error bars represent the standard error of the mean.
FIG. 7 shows that the mean value for the methylated reaction was higher in the tumor compared to the normal tissue whereas the unmethylated reaction showed the opposite result. The standard errors observed for the eight independent measurements were relatively modest and were comparable to those reported for other studies utilizing TaqMan® technology (Fink et al., Nature Med. 4:1329-1333, 1998). Some of the variability of the inventive process may have been a result of stochastic PCR amplification (PCR bias), which can occur at low template concentrations. (Warnecke et al., Nucleic Acids Res. 25:4422-4426,1997). In summary, these results indicate that the inventive process can yield reproducible results for complex, heterogeneous DNA samples.
EXAMPLE 5
This example shows a comparison of MLH1 Expression, microsatellite instability and MLH1 promoter methylation in 25 matched-paired human colorectal samples. The main benefit of the inventive process is the ability to rapidly screen human tumors for the methylation state of a particular locus. In addition, the analysis of DNA methylation as a surrogate marker for gene expression is a novel way to obtain clinically useful information about tumors. We tested the utility of the inventive process by interrogating the methylation status of the MLH1 promoter. The mismatch repair gene MLH1 plays a pivotal role in the development of sporadic cases of mismatch repair-deficient colorectal tumors (Thibodeau et al., Science 260:816-819, 1993). It has been reported that MLH1 can become transcriptionally silenced by DNA hypermethylation of its promoter region, leading to microsatellite instability (MSI) (Kane et al., Cancer Res 57:808-811, 1997; Ahuja et al., Cancer Res 57:3370-3374, 1997; Cunningham et al., Cancer Res. 58:3455-3460, 1998; Herman, J. G. et al., Proc. Natl. Acad. Sci. USA 95:6870-6875, 1998; Veigl et al., Proc. Natl. Acad. Sci. USA 95:8698-8702, 1998).
Using the high-throughput inventive process, as described in Example 1 Application D, 50 samples consisting of 25 matched pairs of human colorectal adenocarcinomas and normal mucosa were analyzed for the methylation status of the MLH1 CpG island. Quantitative RT-PCR (TaqMan®) analyses of the expression levels of MLH1 normalized to ACTB (β-actin) was investigated. Furthermore, the microsatellite instability (MSI) status of each sample was analyzed by PCR of the BAT25 and BAT26 loci (Parsons et al., Cancer Res. 55:5548-5550, 1995). The twenty-five paired tumor and normal mucosal tissue samples were obtained from 25 patients with primary colorectal adenocarcinoma. The patients comprised 16 males and 9 females, ranging in age from 39-88 years, with a mean age of 68.8. The mucosal distance from tumor to normal specimens was between 10 and 20 cm. Approximately 2 grams of the surgically removed tissue was immediately frozen in liquid nitrogen and stored at −80° C. until RNA and DNA isolation.
Quantitative RT-PCR and Microsatellite Instability Analysis. The quantitation of mRNA levels was carried out using real-time fluorescence detection. The TaqMan® reactions were performed as described above for the assay, but with the addition of 1U AmpErase uracil N-glycosylase). After RNA isolation, cDNA was prepared from each sample as previously described (Bender et al., Cancer Res 58:95-101, 1998). Briefly, RNA was isolated by lysing tissue in buffer containing quanidine isothiocyanate (4M), N-lauryl sarcosine (0.5%), sodium citrate (25mM), and 2-mercaptoethanol (0.1M), followed by standard phenol-chloroform extraction, and precipitation in 50% isopropanol/50% lysis buffer. To prepare cDNA, RNA samples were reverse-transcribed using random hexamers, deoxynucleotide triphosphates, and Superscript II® reverse transcriptase (Life Technologies, Inc., Palo Alto, Calif.). The resulting cDNA was then amplified with primers specific for MLH1 and ACTB. Contamination of the RNA samples by genomic DNA was excluded by analysis of all RNA samples without prior cDNA conversion. Relative gene expression was determined based on the threshold cycles (number of PCR cycles required for detection with a specific probe) of the MLH1 gene and of the internal reference gene ACTB. The forward primer, probe and reverse primer sequences of the ACTB and MLH1 genes are: ACTB (TGAGCGCGGCTACAGCTT [SEQ ID NO. 25], 6FAM5′-ACCACCACGGCCGAGCGG-3′TAMRA [SEQ ID NO. 26], CCTTAATGTCACACACGATT [SEQ ID NO. 27]); and MLH1 (GTTCTCCGGGAGATGTTGCATA [SEQ ID NO. 28], 6FAM5′-CCTCAGTGGGCCTTGGCACAGC-3′TAMRA [SEQ ID NO. 29], TGGTGGTGTTGAGAAGGTATAACTTG [SEQ ID NO. 30]).
Alterations of numerous polyadenine (“pA”) sequences, distributed widely throughout the genome, is a useful characteristic to define tumors with microsatellite instability (Ionov et al., Nature 363:558-561, 1993). Microsatellite instability (MSI) was determined by PCR and sequence analysis of the BAT25 (25-base pair pA tract from an intron of the c-kit oncogene) and BAT26 (26-base pair pA tract from an intron of the mismatch repair gene hMSH2) loci as previously described (Parsons et al., Cancer Res 55:5548-5550, 1995). Briefly, segments the BAT25 and BAT26 loci were amplified for 30 cycles using one 32P-labeled primer and one unlabeled primer for each locus. Reactions were resolved on urea-formamide gels and exposed to film. The forward and reverse primers that were used for the amplification of BAT25 and BAT26 were: BAT25 (TCGCCTCCAAGAATGTAAGT [SEQ ID NO. 31], TCTGCATTTTAACTATGGCTC [SEQ ID NO. 32]); and BAT26 (TGACTACTTTTGACTTCAGCC [SEQ ID NO. 33], AACCATTCAACATTTTTAACCC [SEQ ID NO. 34]).
FIG. 8 shows the correlation between MLH1 gene expression, MSI status and promoter methylation of MLH1, as determined by the inventive process. The upper chart shows the MLH1 expression levels measured by quantitative, real time RT-PCR (TaqMan®) in matched normal (hatched bars) and tumor (solid black bars) colorectal samples. The expression levels are displayed as a ratio between MLH1 and ACTB measurements. Microsatellite instability status (MSI) is indicated by the circles located between the two charts. A black circle denotes MSI positivity, while an open circle indicates that the sample is MSI negative, as determined by analysis of the BAT25 and BAT26 loci. The lower chart shows the methylation status of the MLH1 locus as determined by inventive process. The methylation levels are represented as the ratio between the MLH1 methylated reaction and the MYOD1 reaction.
Four colorectal tumors had significantly elevated methylation levels compared to the corresponding normal tissue. One of these (tumor 17) exhibited a particularly high degree of MLH1 methylation, as scored by the inventive process. Tumor 17 was the only sample that was both MSI positive (black circle) and showed transcriptional silencing of MLH1. The remaining methylated tumors expressed MLH1 at modest levels and were MSI negative (white circle). These results show that MLH1 was biallelically methylated in tumor 17, resulting in epigenetic silencing and consequent microsatellite instability, whereas the other tumors showed lesser degrees of MLH1 promoter hypermethylation and could have just one methylated allele, allowing expression from the unaltered allele. Accordingly, the inventive process was capable of rapidly generating significant biological information, such as promoter CpG island hypermethylation in human tumors, which is associated with the transcriptional silencing of genes relevant to the cancer process.
54 19 base pairs nucleic acid single linear DNA No not provided 1 GGCGTTCGTT TTGGGATTG 19 24 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 2 CGATAAAACC GAACGACCCG ACGA 24 19 base pairs nucleic acid single linear DNA No not provided 3 GCCGACACGC GAACTCTAA 19 23 base pairs nucleic acid single linear DNA No not provided 4 ACACATATCC CACCAACACA CAA 23 30 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 5 CAACCCTACC CCAAAAACCT ACAAATCCAA 30 21 base pairs nucleic acid single linear DNA No not provided 6 AGGAGTTGGT GGAGGGTGTT T 21 18 base pairs nucleic acid single linear DNA No not provided 7 CTATCGCCGC CTCATCGT 18 22 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 8 CGCGACGTCA AACGCCACTA CG 22 30 base pairs nucleic acid single linear DNA No not provided 9 CGTTATATAT CGTTCGTAGT ATTCGTGTTT 30 27 base pairs nucleic acid single linear DNA No not provided 10 TTATATGTCG GTTACGTGCG TTTATAT 27 22 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 11 CCCGTCGAAA ACCCGCCGAT TA 22 19 base pairs nucleic acid single linear DNA No not provided 12 GAACCAAAAC GCTCCCCAT 19 25 base pairs nucleic acid single linear DNA No not provided 13 GGGTTGTGAG GGTATATTTT TGAGG 25 28 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 14 CCCACCCAAC CACACAACCT ACCTAACC 28 22 base pairs nucleic acid single linear DNA No not provided 15 CCAACCCACA CTCCACAATA AA 22 19 base pairs nucleic acid single linear DNA No not provided 16 AACAACGTCC GCACCTCCT 19 18 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 17 ACCCGACCCC GAACCGCG 18 22 base pairs nucleic acid single linear DNA No not provided 18 TGGAATTTTC GGTTGATTGG TT 22 24 base pairs nucleic acid single linear DNA No not provided 19 CAACCAATCA ACCAAAAATT CCAT 24 28 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 20 CCACCACCCA CTATCTACTC TCCCCCTC 28 22 base pairs nucleic acid single linear DNA No not provided 21 GGTGGATTGT GTGTGTTTGG TG 22 23 base pairs nucleic acid single linear DNA No not provided 22 CCAACTCCAA ATCCCCTCTC TAT 23 36 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 23 TCCCTTCCTA TTCCTAAATC CAACCTAAAT ACCTCC 36 30 base pairs nucleic acid single linear DNA No not provided 24 TGATTAATTT AGATTGGGTT TAGAGAAGGA 30 18 base pairs nucleic acid single linear DNA No not provided 25 TGAGCGCGGC TACAGCTT 18 18 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 26 ACCACCACGG CCGAGCGG 18 20 base pairs nucleic acid single linear DNA No not provided 27 CCTTAATGTC ACACACGATT 20 22 base pairs nucleic acid single linear DNA No not provided 28 GTTCTCCGGG AGATGTTGCA TA 22 22 base pairs nucleic acid single linear DNA No not provided 5′ substitution with fluorescent reporter dye 6FAM (2,7-dimethoxy-4,5-dichloro-6-carboxy- fluorescein-phosporamidite-cytosine); 3′substitution with quencher dye TAMRA (6-carboxytetramethylrhodamine). 29 CCTCAGTGGG CCTTGGCACA GC 22 26 base pairs nucleic acid single linear DNA No not provided 30 TGGTGGTGTT GAGAAGGTAT AACTTG 26 20 base pairs nucleic acid single linear DNA No not provided et alParsons Microsatellite Instability and Mutations of the Transforming Growth Factor B Type II Receptor Gene in Colorectal Cancer Cancer Res. 55 5548-5550 01-DEC-1995 31 TCGCCTCCAA GAATGTAAGT 20 21 base pairs nucleic acid single linear DNA No not provided et alParsons Microsatellite Instability and Mutations of the Transforming Growth Factor B Type II Receptor Gene in Colorectal Cancer Cancer Res. 55 5548-5550 01-DEC-1995 32 TCTGCATTTT AACTATGGCT C 21 21 base pairs nucleic acid single linear DNA No not provided et alParsons Microsatellite Instability and Mutations of the Transforming Growth Factor B Type II Receptor Gene in Colorectal Cancer Cancer Res. 55 5548-5550 01-DEC-1995 33 TGACTACTTT TGACTTCAGC C 21 22 base pairs nucleic acid single linear DNA No not provided et alParsons Microsatellite Instability and Mutations of the Transforming Growth Factor B Type II Receptor Gene in Colorectal Cancer Cancer Res. 55 5548-5550 01-DEC-1995 34 AACCATTCAA CATTTTTAAC CC 22 21 base pairs nucleic acid single linear DNA No not provided 35 TCCTAAAACT ACACTTACTC C 21 23 base pairs nucleic acid single linear DNA No not provided 36 GGTTATTTGG AAAAAGAGTA TAG 23 22 base pairs nucleic acid single linear DNA No not provided 37 AGAGAGAAGT AGTTGTGTTA AT 22 21 base pairs nucleic acid single linear DNA No not provided 38 ACTACACCAA TACAACCACA T 21 12 base pairs nucleic acid single linear DNA No not provided 39 AAACCAAAAC TC 12 16 base pairs nucleic acid single linear DNA No not provided 40 CCCACACCCA ACCAAT 16 23 base pairs nucleic acid single linear DNA No not provided 41 GGAGGTTATA AGAGTAGGGT TAA 23 24 base pairs nucleic acid single linear DNA No not provided 42 CCAACCAATA AAAACAAAAA TACC 24 22 base pairs nucleic acid single linear DNA No not provided 43 GTAGGTGGGG AGGAGTTTAG TT 22 23 base pairs nucleic acid single linear DNA No not provided 44 TCTAATAACC AACCAACCCC TCC 23 27 base pairs nucleic acid single linear DNA No not provided 45 TTGTATTATT TTGTTTTTTT TGGTAGG 27 26 base pairs nucleic acid single linear DNA No not provided 46 CAACTTCTCA AATCATCAAT CCTCAC 26 21 base pairs nucleic acid single linear DNA No not provided 47 TTTAGTAGAG GTATATAAGT T 21 26 base pairs nucleic acid single linear DNA No not provided 48 TAAGGGGAGA GGAGGAGTTT GAGAAG 26 15 base pairs nucleic acid single linear DNA No not provided 49 TTTGAGGGAT AGGGT 15 18 base pairs nucleic acid single linear DNA No not provided 50 TTTTAGGGGT GTTATATT 18 21 base pairs nucleic acid single linear DNA No not provided 51 TTTTTTTGTT TGGAAAGATA T 21 16 base pairs nucleic acid single linear DNA No not provided 52 GTTGGTGGTG TTGTAT 16 19 base pairs nucleic acid single linear DNA No not provided 53 AGGTTATGAT GATGGGTAG 19 22 base pairs nucleic acid single linear DNA No not provided 54 TATTAGAGGT AGTAATTATG TT 22

Claims (26)

We claim:
1. A method for detecting cytosine methylation and methylated CpG islands within a genomic sample of DNA comprising:
(a) contacting a genomic sample of DNA with a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid;
(b) amplifying the converted nucleic acid by means of oligonucleotide primers in the presence of one or a plurality of specific oligonucleotide probes, wherein one or a plurality of the oligonucleotide primers or the specific probe(s) are capable of distinguishing between unmethylated and methylated nucleic acid, with the proviso that at least one oligonucleotide probe is a CpG-specific probe capable of distinguishing between unmethylated and methylated nucleic acid; and
(c) detecting the methylated nucleic acid based on amplification-mediated displacement of the CpG-specific probe.
2. The method of claim 1 wherein the amplifying step is a polymerase chain reaction (PCR).
3. The method of claim 1 wherein the modifying agent is bisulfite.
4. The method of claim 1 wherein the converted nucleic acid contains uracil in place of unmethylated cytosine residues present in the unmodified nucleic acid-containing sample.
5. The method of claim 1 wherein the probe further comprises one or a plurality of fluorescence label moieties.
6. The method of claim 5 wherein the amplification and detection step comprises fluorescence-based quantitative PCR.
7. A method for detecting a methylated CpG-containing nucleic acid comprising:
(a) contacting a nucleic acid-containing sample with a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid;
(b) amplifying the converted nucleic acid in the sample by means of oligonucleotide primers in the presence of a CpG-specific oligonucleotide probe, wherein the CpG-specific probe, but not the primers, distinguishes between modified unmethylated and methylated nucleic acid; and
(c) detecting the methylated nucleic acid based upon an amplification-mediated displacement of the CpG-specific probe.
8. The method of claim 7 wherein the amplifying step comprises a polymerase chain reaction (PCR).
9. The method of claim 7 wherein the modifying agent comprises bisulfite.
10. The method of claim 7 wherein the converted nucleic acid contains uracil in place of unmethylated cytosine residues present in the unmodified nucleic acid-containing sample.
11. The method of claim 7 wherein the detection method is by means of a measurement of a fluorescence signal based on amplification-mediated displacement of the CpG-specific probe.
12. The method of claim 7 wherein the amplification and detection method comprises fluorescence-based quantitative PCR.
13. The method of claim 7 wherein methylation amounts in the nucleic acid sample are quantitatively determined based on reference to a control reaction for amount of input nucleic acid.
14. A method for detecting a methylated CpG-containing nucleic acid comprising:
(a) contacting a nucleic acid-containing sample with a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid;
(b) amplifying the converted nucleic acid in the sample by means of oligonucleotide primers in the presence of a CpG-specific oligonucleotide probe, wherein both the primers and the CpG-specific probe distinguish between modified unmethylated and methylated nucleic acid; and
(c) detecting the methylated nucleic acid based on amplification-mediated displacement of the CpG-specific probe.
15. The method of claim 14 wherein the amplifying step comprises a polymerase chain reaction (PCR).
16. The method of claim 14 wherein the modifying agent is bisulfite.
17. The method of claim 14 wherein the converted nucleic acid contains uracil in place of unmethylated cytosine residues present in the unmodified nucleic acid-containing sample.
18. The method of claim 14 wherein the detection method comprises measuring a fluorescence signal based on amplification-mediated displacement of the CpG-specific probe.
19. The method of claim 14 wherein the amplification and detection method is fluorescence-based quantitative PCR.
20. A methylation detection kit useful for the detection of a methylated CpG-containing nucleic acid comprising a carrier means being compartmentalized to receive in close confinement therein one or more containers comprising:
(i) a first container containing a modifying agent that modifies unmethylated cytosine to produce a converted nucleic acid;
(ii) a second container containing primers for amplification of the converted nucleic acid;
(iii) a third container containing primers for the amplification of control unmodified nucleic acid; and
(iv) a fourth container containing a specific oligonucleotide probe the detection of which is based on amplification-mediated displacement, wherein the specific oligonucleotide probe is a CpG-specific oligonucleotide probe that distinguishes between modified unmethylated and methylated nucleic acid, and wherein the primers may or may not distinguish between unmethylated and methylated nucleic acid.
21. The kit of claim 20, wherein the modifying agent is bisulfite.
22. The kit of claim 20 wherein the modifying agent converts cytosine residues to uracil residues.
23. The kit of claim 20, wherein the CpG-specific oligonucleotide probe, but not the primers for amplification of the converted nucleic acid, distinguishes between modified unmethylated and methylated nucleic acid.
24. The kit of claim 20, wherein both the CpG-specific oligonucleotide probe and the primers for amplification of the converted nucleic acid, distinguish between modified unmethylated and methylated nucleic acid.
25. The kit of claim 20, wherein the CpG-specific probe further comprises a fluorescent moiety linked to an oligonucleotide base directly or through a linker moiety.
26. The kit of claim 20, wherein the CpG-specific probe is a specific, dual-labeled TaqMan® probe.
US09/311,912 1999-05-14 1999-05-14 Process for high-throughput DNA methylation analysis Expired - Lifetime US6331393B1 (en)

Priority Applications (19)

Application Number Priority Date Filing Date Title
US09/311,912 US6331393B1 (en) 1999-05-14 1999-05-14 Process for high-throughput DNA methylation analysis
PCT/US2000/013029 WO2000070090A1 (en) 1999-05-14 2000-05-12 Process for high throughput dna methylation analysis
DK00928969.5T DK1185695T4 (en) 1999-05-14 2000-05-12 High Capacity Method for Analysis of Methylation of DNA
ES06011777.7T ES2564048T3 (en) 1999-05-14 2000-05-12 High performance DNA methylation analysis procedure
AT00928969T ATE332980T2 (en) 1999-05-14 2000-05-12 METHOD FOR ANALYZING DNA METHYLATION WITH HIGH THROUGHPUT
EP00928969.5A EP1185695B2 (en) 1999-05-14 2000-05-12 Process for high throughput dna methylation analysis
ES00928969.5T ES2267535T5 (en) 1999-05-14 2000-05-12 High performance DNA methylation analysis procedure
AU47122/00A AU775798B2 (en) 1999-05-14 2000-05-12 Process for high throughput DNA methylation analysis
CA002372665A CA2372665C (en) 1999-05-14 2000-05-12 Process for high throughput dna methylation analysis
DK06011777.7T DK1710321T3 (en) 1999-05-14 2000-05-12 METHOD OF HIGH CAPACITY FOR ANALYSIS OF DNA METHYLING
JP2000618495A JP4044290B2 (en) 1999-05-14 2000-05-12 Method for high-throughput DNA methylation analysis
DE60029323.8T DE60029323T3 (en) 1999-05-14 2000-05-12 METHOD FOR ANALYZING DNA METHYLATION AT HIGH RATE OF PURCHASE
EP06011777.7A EP1710321B1 (en) 1999-05-14 2000-05-12 Process for high throughput DNA methylation analysis
US10/016,505 US7112404B2 (en) 1999-05-14 2001-12-10 Process for high throughput DNA methylation analysis
AU2004229115A AU2004229115B2 (en) 1999-05-14 2004-11-17 Process for high throughput DNA methylation analysis
US11/518,353 US7553627B2 (en) 1999-05-14 2006-09-08 Process for high throughput DNA methylation analysis
JP2006290479A JP2007068539A (en) 1999-05-14 2006-10-25 Method for high-throughput DNA methylation analysis
US12/476,981 US8323890B2 (en) 1999-05-14 2009-06-02 Process for high-throughput DNA methylation analysis
CY20161100185T CY1118000T1 (en) 1999-05-14 2016-03-03 HIGH PROCEDURE FOR DNA Methylation Analysis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US09/311,912 US6331393B1 (en) 1999-05-14 1999-05-14 Process for high-throughput DNA methylation analysis

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/016,505 Continuation US7112404B2 (en) 1999-05-14 2001-12-10 Process for high throughput DNA methylation analysis

Publications (1)

Publication Number Publication Date
US6331393B1 true US6331393B1 (en) 2001-12-18

Family

ID=23209034

Family Applications (4)

Application Number Title Priority Date Filing Date
US09/311,912 Expired - Lifetime US6331393B1 (en) 1999-05-14 1999-05-14 Process for high-throughput DNA methylation analysis
US10/016,505 Expired - Lifetime US7112404B2 (en) 1999-05-14 2001-12-10 Process for high throughput DNA methylation analysis
US11/518,353 Expired - Fee Related US7553627B2 (en) 1999-05-14 2006-09-08 Process for high throughput DNA methylation analysis
US12/476,981 Expired - Fee Related US8323890B2 (en) 1999-05-14 2009-06-02 Process for high-throughput DNA methylation analysis

Family Applications After (3)

Application Number Title Priority Date Filing Date
US10/016,505 Expired - Lifetime US7112404B2 (en) 1999-05-14 2001-12-10 Process for high throughput DNA methylation analysis
US11/518,353 Expired - Fee Related US7553627B2 (en) 1999-05-14 2006-09-08 Process for high throughput DNA methylation analysis
US12/476,981 Expired - Fee Related US8323890B2 (en) 1999-05-14 2009-06-02 Process for high-throughput DNA methylation analysis

Country Status (11)

Country Link
US (4) US6331393B1 (en)
EP (2) EP1710321B1 (en)
JP (2) JP4044290B2 (en)
AT (1) ATE332980T2 (en)
AU (2) AU775798B2 (en)
CA (1) CA2372665C (en)
CY (1) CY1118000T1 (en)
DE (1) DE60029323T3 (en)
DK (2) DK1185695T4 (en)
ES (2) ES2267535T5 (en)
WO (1) WO2000070090A1 (en)

Cited By (199)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020197639A1 (en) * 2001-06-08 2002-12-26 Shia Michael A. Methods and products for analyzing nucleic acids based on methylation status
WO2003014388A2 (en) 2001-08-09 2003-02-20 Epigenomics Ag Method and nucleic acids for the analysis of colon cancer
US20030082600A1 (en) * 2001-03-09 2003-05-01 Alexander Olek Highly sensitive method for the detection of cytosine methylation patters
US20030148327A1 (en) * 2000-04-06 2003-08-07 Alexander Olek Diagnosis of diseases associated with metastasis
EP1342794A1 (en) * 2002-03-05 2003-09-10 Epigenomics AG Method and device for determination of tissue specificity of free floating DNA in bodily fluids
US20030180758A1 (en) * 2000-09-15 2003-09-25 Promega Corporation Detection of microsatellite instability and its use in diagnosis of tumors
US20030215842A1 (en) * 2002-01-30 2003-11-20 Epigenomics Ag Method for the analysis of cytosine methylation patterns
US20040029117A1 (en) * 2001-03-01 2004-02-12 Alexander Olek Methods, systems and computer program products for determining the biological effect and/or activity of drugs, chemical substances and/or pharmaceutical compositions based on their effect on the methylation status of the DNA
US20040038245A1 (en) * 2000-08-25 2004-02-26 Belinsky Steven A Nested methylation-specific polymerase chain reaction cancer detection method
US20040048279A1 (en) * 2000-11-14 2004-03-11 Alexander Olek Method for detecting methylation states for a toxicological diagnostic
US20040101843A1 (en) * 2002-11-22 2004-05-27 Gerald Zon Detection of methylated DNA sites
US20040121371A1 (en) * 2002-09-19 2004-06-24 Applera Corporation Methods and compositions for detecting targets
US20040132048A1 (en) * 2002-06-26 2004-07-08 Robert Martienssen Methods and compositions for determining methylation profiles
WO2004013284A3 (en) * 2002-08-02 2004-07-15 Univ Tufts A method to assess genomic dna methylation using high-performance liquid chromatography-electospray ionization mass spectrometry
US20040219539A1 (en) * 2003-05-02 2004-11-04 Millar Douglas Spencer Treatment of methylated nucleic acid
US20040241704A1 (en) * 2002-08-29 2004-12-02 Roche Molecular Systems, Inc Method for bisulfite treatment
US20040265845A1 (en) * 2002-11-14 2004-12-30 Hoon Dave S.B. Detection of micro metastasis of melanoma and breast cancer in paraffin-embedded tumor draining lymph nodes by multimarker quantitative RT-PCR
US20050003463A1 (en) * 2002-02-27 2005-01-06 Peter Adorjan Method and nucleic acids for the analysis of colorectal cell proliferative disorders
US20050009059A1 (en) * 2003-05-07 2005-01-13 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
WO2004051224A3 (en) * 2002-12-03 2005-01-27 Illumina Inc Multiplexed methylation detection methods
US20050026183A1 (en) * 2003-05-15 2005-02-03 Jian-Bing Fan Methods and compositions for diagnosing conditions associated with specific DNA methylation patterns
KR100470221B1 (en) * 2002-02-20 2005-02-05 굿젠 주식회사 Minisequencing type oligonucleotide chip for detecting methylation of promoter CpG islands of multiple genes, method for preparing thereof and method for detecting cancer using the same
US20050048498A1 (en) * 2003-08-29 2005-03-03 Applera Corporation Compositions, methods, and kits for assembling probes
US20050069895A1 (en) * 2003-08-29 2005-03-31 Applera Corporation Compositions, methods, and kits for fabricating coded molecular tags
US20050069879A1 (en) * 2001-06-22 2005-03-31 Kurt Berlin Method for high sensitivity detection of cytosine-methylation
US20050074774A1 (en) * 2003-08-29 2005-04-07 Applera Corporation Multiplex detection compositions, methods, and kits
US20050079527A1 (en) * 2003-08-29 2005-04-14 Applera Corporation Bisulfite method
US20050089898A1 (en) * 2003-08-29 2005-04-28 Applera Corporation Method and materials for quaternary amine catalyzed bisulfite conversion of cytosine to uracil
WO2005024056A3 (en) * 2003-08-15 2005-06-02 Epigenomics Ag Method for the detection of cytosine methylations in dna with the aid of scorpion primers
US20050123944A1 (en) * 2003-08-01 2005-06-09 U.S. Genomics, Inc. Methods and compositions related to the use of sequence-specific endonucleases for analyzing nucleic acids under non-cleaving conditions
US20050153316A1 (en) * 2003-10-21 2005-07-14 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
US20050164246A1 (en) * 2003-05-15 2005-07-28 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
WO2004087957A3 (en) * 2003-04-03 2005-07-28 Oncomethylome Sciences S A Hypermethylated genes and cervical cancer
EP1561821A2 (en) 2003-12-11 2005-08-10 Epigenomics AG Prognostic markers for prediction of treatment response and/or survival of breast cell proliferative disorder patients
US20050202473A1 (en) * 2000-09-15 2005-09-15 Promega Corporation Detection of microsatellite instability and its use in diagnosis of tumors
US20050222880A1 (en) * 2002-06-21 2005-10-06 Yoshinori Shiraishi Device for removing raindrops on umrella and system for promoting installation of the device
US20050227265A1 (en) * 2004-02-10 2005-10-13 Francis Barany Method for detection of promoter methylation status
US20050233340A1 (en) * 2004-04-20 2005-10-20 Barrett Michael T Methods and compositions for assessing CpG methylation
US6960436B2 (en) * 2002-02-06 2005-11-01 Epigenomics Ag Quantitative methylation detection in DNA samples
US20050260640A1 (en) * 2004-03-24 2005-11-24 Applera Corportion Encoding and decoding reactions for determining target molecules
US20050266458A1 (en) * 2004-04-30 2005-12-01 Applera Corporation Methods and kits for methylation detection
US20050272065A1 (en) * 2004-03-02 2005-12-08 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
EP1609873A1 (en) * 2004-06-23 2005-12-28 Epigenomics AG Method for quantification of methylated DNA
US20060003351A1 (en) * 2004-04-30 2006-01-05 Applera Corporation Methods and kits for identifying target nucleotides in mixed populations
WO2005098035A3 (en) * 2004-04-06 2006-02-02 Epigenomics Ag Method for the quantification of methylated dna
US20060058518A1 (en) * 2003-01-29 2006-03-16 Frank Bergmann Method for bisulfite treatment
US20060068430A1 (en) * 2004-09-20 2006-03-30 Sigma-Aldrich Co. Purification of biomolecules from contaminating intact nucleic acids
EP1655377A1 (en) * 2004-04-06 2006-05-10 Epigenomics AG Method of quantifying methylated DNA
US20060099581A1 (en) * 2002-04-09 2006-05-11 Kurt Berlin Method for analysis of methylated nucleic acids
US20060115832A1 (en) * 2002-11-14 2006-06-01 Jon Wayne Cancer Institute Detection of cancer cells in body fluids
US20060121467A1 (en) * 2002-10-01 2006-06-08 John Foekens Method and nucleic acids for the improved treatment of breast cell proliferative disorders
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
WO2005035725A3 (en) * 2003-10-08 2006-06-29 Univ Boston Methods for prenatal diagnosis of chromosomal abnormalities
US20060148853A1 (en) * 2004-11-08 2006-07-06 Applera Corporation Bisulfite conversion reagent
US20060188910A1 (en) * 2005-02-18 2006-08-24 Applera Corporation Compositions, methods, and kits for analyzing DNA methylation
US7112404B2 (en) * 1999-05-14 2006-09-26 Epigenomics Ag Process for high throughput DNA methylation analysis
US20060234252A1 (en) * 2004-07-02 2006-10-19 Applera Corporation Methods and kits for methylation detection
EP1721992A2 (en) 2005-04-15 2006-11-15 Epigenomics AG Methods and nucleic acids for analyses of cellular proliferative disorders
WO2006121295A1 (en) * 2005-05-11 2006-11-16 Korea Research Institute Of Standards And Science Method for quantitative analysis of methyl cytosine in dna and uses thereof
US20060258856A1 (en) * 2002-02-13 2006-11-16 Medimolecular Pty. Ltd. Method of isolating nucleic acids from stool samples
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
EP1746169A1 (en) 2005-07-21 2007-01-24 Epigenomics AG Method for quantification of methylated DNA
US20070037184A1 (en) * 2005-06-16 2007-02-15 Applera Corporation Methods and kits for evaluating dna methylation
US20070042365A1 (en) * 2003-01-24 2007-02-22 Millar Douglas S Assay for detecting methylation changes in nucleic acids using an intercalating nucleic acid
WO2007039128A1 (en) 2005-09-21 2007-04-12 Epigenomics Ag Markers for the prediction of outcome of anthracycline treatment
US20070087358A1 (en) * 2005-10-19 2007-04-19 Melanie Ehrlich Methods for diagnosing cancer based on DNA methylation status in NBL2
US20070087360A1 (en) * 2005-06-20 2007-04-19 Boyd Victoria L Methods and compositions for detecting nucleotides
US20070178453A1 (en) * 2002-08-02 2007-08-02 Tamas Rujan Method for amplification of nucleic acids of low complexity
US20070178457A1 (en) * 2003-06-17 2007-08-02 Human Genetic Signatures Pty. Ltd. Methods for genome amplification
US20070178459A1 (en) * 2003-09-04 2007-08-02 Human Genetic Signatures Pty. Ltd. Nucleic acid detection assay
US20070184438A1 (en) * 2003-06-23 2007-08-09 Cathy Lofton-Day Methods and nucleic acids for the analysis of colorectal cell proliferative disorders
EP1840224A1 (en) 2006-03-29 2007-10-03 Pangaea Biotech, S.A. Method of predicting survival of a non-small-cell lung cancer patient to a chemotherapeutic treatment
KR100761031B1 (en) 2006-05-27 2007-10-04 김연수 Cancer diagnostic kit using DNA methylation
US20070238117A1 (en) * 2006-03-22 2007-10-11 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Method for retaining methylation pattern in globally amplified dna
US20070259364A1 (en) * 2001-01-31 2007-11-08 The Ohio State University Research Foundation DETECTION OF METHYLATED CpG RICH SEQUENCES DIAGNOSTIC FOR MALIGNANT CELLS
US20080003609A1 (en) * 2006-05-10 2008-01-03 The Cleveland Clinic Foundation Method of detecting bladder urothelial carcinoma
RU2315312C2 (en) * 2002-08-01 2008-01-20 Мтм Лабораториес Аг Diagnosis method for using a solution
US20080050738A1 (en) * 2006-05-31 2008-02-28 Human Genetic Signatures Pty Ltd. Detection of target nucleic acid
US20080064029A1 (en) * 2003-06-23 2008-03-13 Epigenomics Ag Methods and Nucleic Acids for Analyses of Colorectal Cell Proliferative Disorders
WO2008047234A1 (en) 2006-10-18 2008-04-24 Epigenomics Ag A molecule for providing a standard for the quantitative analysis of the methylation status of a nucleic acid
US7368239B2 (en) 2003-08-29 2008-05-06 Applera Corporation Method and materials for polyamine catalyzed bisulfite conversion of cytosine to uracil
US20080108073A1 (en) * 2001-11-19 2008-05-08 Affymetrix, Inc. Methods of Analysis of Methylation
US7371526B2 (en) 2003-08-29 2008-05-13 Applera Corporation Method and materials for bisulfite conversion of cytosine to uracil
US20080171318A1 (en) * 2004-09-30 2008-07-17 Epigenomics Ag Epigenetic Methods and Nucleic Acids for the Detection of Lung Cell Proliferative Disorders
WO2008087040A2 (en) 2007-01-19 2008-07-24 Epigenomics Ag Methods and nucleic acids for analyses of cell proliferative disorders
EP1961827A2 (en) 2004-07-18 2008-08-27 Epigenomics AG Epigenetic methods and nucleic acids for the detection of breast cell proliferative disorders
US20080207460A1 (en) * 2002-12-02 2008-08-28 Solexa Limited Determination of methylation of nucleic acid sequences
US20080213870A1 (en) * 2007-03-01 2008-09-04 Sean Wuxiong Cao Methods for obtaining modified DNA from a biological specimen
US20080223695A1 (en) * 2005-10-12 2008-09-18 Scanvaegt International A/S Device for Transfer of Items
US20080254470A1 (en) * 2005-10-03 2008-10-16 Epigenomics Ag Methods and Nucleic Acids For the Analysis of Gene Expression Associated With the Prognosis of Cell Proliferative Disorders
US20080254447A1 (en) * 2003-12-11 2008-10-16 Epigenomics Ag Method and Nucleic Acids for the Improved Treatment of Breast Cell Proliferative Disorders
US20080254474A1 (en) * 2007-04-12 2008-10-16 University Of Southern California Dna methylation analysis by digital bisulfite genomic sequencing and digital methylight
US20080281087A1 (en) * 2005-12-14 2008-11-13 Roche Molecular Systems, Inc. Patent Department Method For Bisulfite Treatment
US20080286761A1 (en) * 2003-12-01 2008-11-20 Epigenomics Ag Methods and Nucleic Acids for the Analysis of Gene Expression Associated with the Development of Prostate Cell Proliferative Disorders
WO2008140724A1 (en) 2007-05-08 2008-11-20 Schering Corporation Methods of treatment using intravenous formulations comprising temozolomide
US20090005268A1 (en) * 2005-07-18 2009-01-01 Epigenomics Ag Compositions and Methods for Cancer Diagnostics Comprising Pan-Cancer Markers
US20090029346A1 (en) * 2004-12-23 2009-01-29 Human Genetic Signatures Pty., Ltd. Detection of human papilloma virus
US20090042732A1 (en) * 2004-12-03 2009-02-12 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US20090042290A1 (en) * 2007-08-06 2009-02-12 Christopher Steele Method of modifying a macromolecule without prior extraction from a sample
US20090047666A1 (en) * 2003-06-23 2009-02-19 Epigenomics Ag Methods and nucleic acids for the analysis of colon proliferative disorders
US20090053706A1 (en) * 2005-05-02 2009-02-26 University Of Southern California Dna methylation markers associated with the cpg island methylator phenotype (cimp) in human colorectal cancer
US7501240B2 (en) 2003-12-02 2009-03-10 Roche Molecular Systems, Inc. Method for bisulfite treatment
US20090130657A1 (en) * 2004-09-10 2009-05-21 Human Genetic Signatures Pty Ltd. Amplification blocker comprising intercalating nucleic acids (ina) containing intercalating pseudonucleotides (ipn)
US20090148842A1 (en) * 2007-02-07 2009-06-11 Niall Gormley Preparation of templates for methylation analysis
US20090181400A1 (en) * 2001-11-16 2009-07-16 The Johns Hopkins University School Of Medicine Method of Detection of Prostate Cancer
US20090197250A1 (en) * 2004-12-02 2009-08-06 Epigenomics Ag Methods and nucleic acids for the analysis of gene expression associated with the prognosis of prostate cell proliferative disorders
EP2088210A2 (en) 2003-10-09 2009-08-12 Epigenomics AG Improved bisulfite conversion of DNA
US20090203011A1 (en) * 2007-01-19 2009-08-13 Epigenomics Ag Methods and nucleic acids for analyses of cell proliferative disorders
US20090208930A1 (en) * 2004-09-03 2009-08-20 Frank Bergmann Dna decontamination method
US20090305294A1 (en) * 2003-02-13 2009-12-10 Medimolecular Pty Ltd Method of isolating nucleic acids from stool samples
WO2009153667A2 (en) 2008-06-17 2009-12-23 Occure Gmbh Method for the detection of ovarian cancer
US20090317810A1 (en) * 2006-04-17 2009-12-24 Epigenomics Ag Methods and nucleic acids for the detection of colorectal cell proliferative disorders
US20100035242A1 (en) * 2004-06-23 2010-02-11 Epigenomics Ag Methods and nucleic acids for the detection of metastasis of colon cell proliferative disorders
US20100041013A1 (en) * 2005-09-14 2010-02-18 Human Genetic Signatures Pty Ltd. Assay for a health state
US20100092972A1 (en) * 2007-03-16 2010-04-15 Human Genetic Signatures Pty Ltd. Assay for gene expression
US20100105063A1 (en) * 2007-07-02 2010-04-29 Euclid Diagnostics Llc Methods for evaluating the methylation status of a polynucleotide
WO2010048337A2 (en) 2008-10-22 2010-04-29 Illumina, Inc. Preservation of information related to genomic dna methylation
EP2186912A2 (en) 2005-11-08 2010-05-19 Euclid Diagnostics LLC Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
US20100136559A1 (en) * 2008-12-02 2010-06-03 Bio-Rad Laboratories, Inc. Chromatin structure detection
US20100143929A1 (en) * 2008-12-04 2010-06-10 Rush University Medical Center Dna methylation based test for monitoring efficacy of treatment
US20100143902A1 (en) * 2006-07-21 2010-06-10 Epigenomics Ag Methods and nucleic acids for analyses of cellular proliferative disorders
US20100221785A1 (en) * 2005-05-26 2010-09-02 Human Genetic Signatures Pty Ltd Isothermal Strand Displacement Amplification Using Primers Containing a Non-Regular Base
US20100304386A1 (en) * 2007-11-27 2010-12-02 Human Genetic Signatures Pty Ltd. Enzymes for amplification and copying bisulphite modified nucleic acids
WO2010149782A1 (en) 2009-06-26 2010-12-29 Epigenomics Ag Methods and nucleic acids for analysis of bladder cell proliferative disorders
US20110003700A1 (en) * 2007-12-20 2011-01-06 Human Genetic Signatures Pty Ltd. Elimination of contaminants associated with nucleic acid amplification
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
EP2298932A1 (en) 2005-09-29 2011-03-23 Epigenomics AG Methods and nucleic acids for the analysis of gene expression, in particular methylation of KAAG1, associated with tissue classification
EP2302069A1 (en) 2007-12-11 2011-03-30 Epigenomics AG Methods and nucleic acids for analyses of cell proliferative disorders
EP2309005A1 (en) 2009-08-03 2011-04-13 Eplgenomics AG Methods for preservation of genomic DNA sequence complexity
WO2011051414A1 (en) 2009-10-28 2011-05-05 Signature Diagnostics Ag Method for the prognosis of ovarian carcinoma
EP2319943A1 (en) 2009-11-05 2011-05-11 Epigenomics AG Methods of predicting therapeutic efficacy of cancer therapy
US20110171637A1 (en) * 2006-07-21 2011-07-14 Reimo Tetzner Methods and nucleic acids for analyses of cellular proliferative disorders
EP2354250A1 (en) 2003-06-23 2011-08-10 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
US8003354B2 (en) 2000-02-07 2011-08-23 Illumina, Inc. Multiplex nucleic acid reactions
EP2385136A1 (en) 2005-04-01 2011-11-09 Epigenomics AG Improved bisulfite conversion of DNA
WO2011139721A1 (en) 2010-04-27 2011-11-10 The Regents Of The University Of California Cancer biomarkers and methods of use thereof
US20110287416A1 (en) * 2007-09-17 2011-11-24 Oncomethylome Sciences Sa Methylation detection
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US8150627B2 (en) 2003-05-15 2012-04-03 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
EP2442108A1 (en) 2006-07-14 2012-04-18 The Regents of the University of California Cancer biomarkers and methods of use thereof
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
EP2479283A1 (en) 2006-04-17 2012-07-25 Epigenomics AG Methods and nucleic acids for the detection of colorectal cell proliferative disorders
US8263742B2 (en) 2008-07-24 2012-09-11 Brookhaven Science Associates, Llc Methods for detection of methyl-CpG dinucleotides
US8288103B2 (en) 2000-02-07 2012-10-16 Illumina, Inc. Multiplex nucleic acid reactions
WO2013007702A1 (en) 2011-07-08 2013-01-17 Epigenomics Ag Methods and nucleic acids for determining the prognosis of a cancer subject
WO2013096661A1 (en) 2011-12-22 2013-06-27 Illumina, Inc. Methylation biomarkers for ovarian cancer
WO2013165748A1 (en) 2012-04-30 2013-11-07 Raindance Technologies, Inc Digital analyte analysis
WO2013174432A1 (en) 2012-05-24 2013-11-28 Fundació Institut D'investigació Biomèdica De Bellvitge (Idibell) Method for the identification of the origin of a cancer of unknown primary origin by methylation analysis
WO2014071281A1 (en) 2012-11-02 2014-05-08 The Johns Hopkins University Dna methylation biomarkers of post-partum depression risk
US8728987B2 (en) 2011-08-03 2014-05-20 Bio-Rad Laboratories, Inc. Filtering small nucleic acids using permeabilized cells
US20140141998A1 (en) * 2005-02-14 2014-05-22 The Johns Hopkins University Neoplasia screening compositions and methods of use
WO2014172288A2 (en) 2013-04-19 2014-10-23 Raindance Technologies, Inc. Digital analyte analysis
WO2015006645A1 (en) 2013-07-11 2015-01-15 The Johns Hopkins University A dna methylation and genotype specific biomarker of suicide attempt and/or suicide ideation
US9127312B2 (en) 2011-02-09 2015-09-08 Bio-Rad Laboratories, Inc. Analysis of nucleic acids
US9273347B2 (en) 2010-09-10 2016-03-01 Bio-Rad Laboratories, Inc. Detection of RNA-interacting regions in DNA
US9354224B2 (en) 2000-11-03 2016-05-31 Dana-Farber Cancer Institute, Inc. Methods and compositions for the diagnosis of cancer susceptibilities and defective DNA repair mechanisms and treatment thereof
WO2016115530A1 (en) 2015-01-18 2016-07-21 The Regents Of The University Of California Method and system for determining cancer status
US9427737B2 (en) 2012-12-14 2016-08-30 Bio-Rad Laboratories, Inc. Methods and compositions for using oils for analysis and detection of molecules
EP3095878A1 (en) 2005-11-17 2016-11-23 Epigenomics AG Method for the determination of the dna methylation level of a cpg position in identical cells within a tissue sample
EP3168309A1 (en) 2015-11-10 2017-05-17 Lifecodexx AG Detection of foetal chromosomal aneuploidies using dna regions that are differentially methylated between the foetus and the pregnant female
EP3184649A1 (en) 2006-11-24 2017-06-28 Epigenomics AG Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
US9732375B2 (en) 2011-09-07 2017-08-15 Human Genetic Signatures Pty. Ltd. Molecular detection assay using direct treatment with a bisulphite reagent
US9822412B2 (en) 2014-05-09 2017-11-21 Lifecodexx Ag Detection of DNA that originates from a specific cell-type
US9822413B2 (en) 2014-05-09 2017-11-21 Lifecodexx Ag Multiplex detection of DNA that originates from a specific cell-type
WO2018109217A1 (en) 2016-12-16 2018-06-21 Gatc Biotech Ag Epigenetic markers and related methods and means for the detection and management of certain cancers
US10093986B2 (en) 2016-07-06 2018-10-09 Youhealth Biotech, Limited Leukemia methylation markers and uses thereof
US10144958B2 (en) * 2014-02-14 2018-12-04 Base4 Innovation Ltd. Methylation detection method
US10202650B2 (en) 2016-05-31 2019-02-12 Youhealth Biotech, Limited Methods for monitoring ELOVL2, KLF14 and PENK gene expression following treatment with vitamin C
WO2019071161A1 (en) 2017-10-06 2019-04-11 Youhealth Biotech, Limited Methylation markers for diagnosing cancer
WO2019143845A1 (en) 2018-01-17 2019-07-25 The Regents Of The University Of California Phenotypic age and dna methylation based biomarkers for life expectancy and morbidity
EP3521454A1 (en) 2014-05-09 2019-08-07 LifeCodexx AG Detection of dna that originates from a specific cell-type and related methods
US10435743B2 (en) 2011-05-20 2019-10-08 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample
US10513739B2 (en) 2017-03-02 2019-12-24 Youhealth Oncotech, Limited Methylation markers for diagnosing hepatocellular carcinoma and lung cancer
US10544467B2 (en) 2016-07-06 2020-01-28 Youhealth Oncotech, Limited Solid tumor methylation markers and uses thereof
WO2020076983A1 (en) 2018-10-10 2020-04-16 The Regents Of The University Of California Dna methylation based biomarkers for life expectancy and morbidity
US10683551B2 (en) 2011-02-15 2020-06-16 Bio-Rad Laboratories, Inc. Detecting methylation in a subpopulation of genomic DNA
WO2020150705A1 (en) 2019-01-18 2020-07-23 The Regents Of The University Of California Dna methylation measurement for mammals based on conserved loci
EP3798321A1 (en) 2015-12-17 2021-03-31 Illumina, Inc. Distinguishing methylation levels in complex biological samples
US11072828B2 (en) 2014-10-06 2021-07-27 The Johns Hopkins University DNA methylation and genotype specific biomarker for predicting post-traumatic stress disorder
US11332795B2 (en) 2008-05-14 2022-05-17 Dermtech, Inc. Diagnosis of melanoma and solar lentigo by nucleic acid analysis
US11396678B2 (en) 2016-07-06 2022-07-26 The Regent Of The University Of California Breast and ovarian cancer methylation markers and uses thereof
US11433075B2 (en) 2017-06-22 2022-09-06 Triact Therapeutics, Inc. Methods of treating glioblastoma
US11543411B2 (en) 2014-12-05 2023-01-03 Prelude Corporation DCIS recurrence and invasive breast cancer
US11578373B2 (en) 2019-03-26 2023-02-14 Dermtech, Inc. Gene classifiers and uses thereof in skin cancers
US20230049979A1 (en) * 2020-02-06 2023-02-16 OncoHost Ltd. Machine learning prediction of therapy response
WO2023052640A1 (en) 2021-09-30 2023-04-06 Tivenix Sa A method for diagnosing and predicting progression of neurodegenerative diseases or disorders
US11628144B2 (en) 2017-09-29 2023-04-18 Triact Therapeutics, Inc. Iniparib formulations and uses thereof
EP4170661A1 (en) 2021-10-19 2023-04-26 Institut National de la Santé et de la Recherche Médicale (INSERM) Methylation profile analysis using smoothing method
WO2023066972A1 (en) 2021-10-19 2023-04-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Dna methylation signature for diagnosing hepatocellular carcinoma
WO2023175019A1 (en) 2022-03-15 2023-09-21 Genknowme S.A. Method determining the difference between the biological age and the chronological age of a subject
US11821900B2 (en) 2018-09-14 2023-11-21 Prelude Corporation Method of selection for treatment of subjects at risk of invasive breast cancer
WO2024044578A1 (en) 2022-08-22 2024-02-29 University Of Virginia Dna methylation biomarkers of premenstrual dysphoric disorder and perimenopausal depression
WO2024059649A1 (en) 2022-09-13 2024-03-21 The Saban Research Institute; Children's Hospital Los Angeles Dna methylation signature of retinoblastoma
US11976332B2 (en) 2018-02-14 2024-05-07 Dermtech, Inc. Gene classifiers and uses thereof in non-melanoma skin cancers
WO2024256726A1 (en) 2023-06-15 2024-12-19 Genknowme S.A. Computer implemented method determining a value of allostatic load of a human being
CN119491038A (en) * 2024-11-27 2025-02-21 上海市第十人民医院 A one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy
US12351876B2 (en) 2016-07-06 2025-07-08 Helio Health, Inc. Colon cancer methylation markers and uses thereof
US12359257B2 (en) 2016-07-06 2025-07-15 Helio Health Inc. Liver cancer methylation markers and uses thereof
US12404540B2 (en) 2018-10-17 2025-09-02 The University Of Queensland Epigenetic biomarker and uses therefor

Families Citing this family (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040033490A1 (en) * 2000-03-31 2004-02-19 Laird Peter W. Epigenetic sequences for esophageal adenocarcinoma
ATE445023T1 (en) * 2000-10-23 2009-10-15 Cancer Rec Tech Ltd NUCLEIC ACID AMPLIFICATION-BASED METHOD FOR DETERMINING METHYLATION PROFILE AND REAGENTS THEREFOR
GB0025913D0 (en) 2000-10-23 2000-12-06 Guldberg Per Materials and methods relating to nucleic acid amplification and profiling
DE10104937B4 (en) * 2001-01-29 2005-03-17 Epigenomics Ag Fluorescence polarization 2
ATE429511T1 (en) * 2001-03-01 2009-05-15 Epigenomics Ag METHOD FOR DEVELOPING GENE SETS FOR DIAGNOSTIC AND THERAPEUTIC PURPOSES BASED ON THE EXPRESSION AND METHYLATION STATUS OF THE GENES
DE10128508A1 (en) 2001-06-14 2003-02-06 Epigenomics Ag Methods and nucleic acids for the differentiation of prostate tumors
DE10128509A1 (en) * 2001-06-14 2003-01-02 Epigenomics Ag Methods and nucleic acids for the differentiation of prostate and kidney carcinomas
DE10132211A1 (en) * 2001-06-27 2003-01-16 Epigenomics Ag Detection of specific dinucleotides in DNA samples by fluorescence resonance energy transfer (FRET)
WO2003012051A2 (en) 2001-07-31 2003-02-13 The State Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of The University Of Oregon Inhibitor of dna methylation
US6927028B2 (en) * 2001-08-31 2005-08-09 Chinese University Of Hong Kong Non-invasive methods for detecting non-host DNA in a host using epigenetic differences between the host and non-host DNA
DE10154317B4 (en) 2001-10-26 2005-06-09 Epigenomics Ag Method for the detection of cytosine methylations in immobilized DNA samples
CA2467814A1 (en) * 2001-12-03 2003-06-12 Illumina, Inc. Multiplexed methylation detection methods
US7238518B2 (en) 2002-10-04 2007-07-03 Nisshinbo Industries, Inc. Oligonucleotide-immobilized substrate for detecting methylation
DE10304219B3 (en) * 2003-01-30 2004-08-19 Epigenomics Ag Method for the detection of cytosine methylation patterns with high sensitivity
US20060024676A1 (en) * 2003-04-14 2006-02-02 Karen Uhlmann Method of detecting epigenetic biomarkers by quantitative methyISNP analysis
EP1649050A2 (en) * 2003-06-24 2006-04-26 Epigenomics AG Improved heavymethyl assay for the methylation analysis of the gstpi gene
GB0318110D0 (en) * 2003-08-01 2003-09-03 Isaeo Ltd Methods and kits for detecting an enzyme capable of modifying a nucleic acid
JPWO2005116254A1 (en) * 2004-05-25 2008-04-03 財団法人ヒューマンサイエンス振興財団 Method for quantitatively evaluating DNA methylation
EP1985715A3 (en) * 2004-07-16 2008-12-31 Oncomethylome Sciences, S.A. ESR1 and cervical cancer
EP1815026A2 (en) * 2004-11-10 2007-08-08 University Of Southern California High throughput methods comprising analysis of repetitive element dna methylation
CA2592993C (en) 2004-12-13 2013-06-18 National University Corporation Okayama University Method for detecting methylation in genes and method for examining neoplasm through detecting methylation in genes
WO2006131391A1 (en) * 2005-06-10 2006-12-14 Epigenomics Ag Prognostic assay for prediction of treatment response and/or survival of breast cell proliferative disorder patients
US20090042195A1 (en) * 2005-10-07 2009-02-12 Bradford Coffee Methods and systems for screening for and diagnosing dna methylation associated abnormalities and sex chromosome aneuploidies
WO2007070888A1 (en) * 2005-12-16 2007-06-21 University Of Maryland, Baltimore Methylation of gene promoters as a predictor of effectiveness of therapy
DE102006001161A1 (en) 2006-01-06 2007-07-12 Qiagen Gmbh Method for the detection of cytosine methylations
WO2007088744A1 (en) * 2006-02-03 2007-08-09 The University Of Tokyo Method for cell identification based on methylation state of genomic dna
US20090111120A1 (en) * 2006-03-30 2009-04-30 University Of Maryland, Baltimore Methylation of genes as a predictor of polyp formation and recurrence
CA2660218A1 (en) * 2006-08-08 2008-02-14 Epigenomics Ag A method for methylation analysis of nucleic acid
US20080124735A1 (en) * 2006-10-16 2008-05-29 Matthias Schuster Method for detection of one or more CpG positions
JP2008136404A (en) * 2006-11-30 2008-06-19 Sysmex Corp Method for confirming amount of dna after conversion treatment of non-methylated cytosine in dna methylation detection
US8206927B2 (en) 2007-01-23 2012-06-26 Sequenom, Inc. Method for accurate assessment of DNA quality after bisulfite treatment
US20090246771A1 (en) * 2007-11-02 2009-10-01 University Of Southern California Compositions and methods comprising biomarkers of sperm quality, semen quality and fertility
DE102008008313A1 (en) 2008-02-07 2009-08-13 Qiagen Gmbh Amplification of bisulfited nucleic acids
EP2143807A1 (en) * 2008-06-27 2010-01-13 Epigenomics AG Method for methylation-selective amplification
WO2010003153A2 (en) * 2008-07-03 2010-01-07 Life Technologies Corporation Methylation analysis of mate pairs
US8346485B2 (en) 2008-11-25 2013-01-01 Quest Diagnostics Investments Incorporated Methods and apparatuses for estimating initial target nucleic acid concentration in a sample by modeling background signal and cycle-dependent amplification efficiency of a polymerase chain reaction
WO2010083046A2 (en) * 2009-01-15 2010-07-22 The Salk Institute For Biological Studies Methods for using next generation sequencing to identify 5-methyl cytosines in the genome
EP2287335A1 (en) * 2009-08-05 2011-02-23 DiaSorin S.p.A. Highly sensitive rapid isothermal method for the detection of methylation patterns
US20110046009A1 (en) * 2009-08-24 2011-02-24 Perkinelmer Health Sciences, Inc. Methods for detecting dna methylation using encoded particles
US8568984B2 (en) * 2010-02-19 2013-10-29 Philadelphia Health & Education Corporation Methods of diagnosing non-urinary tract diseases by detecting aberrant methylation
ES2581594T3 (en) * 2010-05-25 2016-09-06 The Johns Hopkins University Compositions and methods to detect a neoplasm
CN105886657B (en) 2010-09-13 2019-11-01 临床基因组学股份有限公司 The outer genetic marker of colorectal cancer and the diagnostic method for using them
US10428390B2 (en) * 2010-12-16 2019-10-01 Genomictree, Inc. Method for detecting methylation of colorectal cancer specific methylation marker gene for colorectal cancer diagnosis
NZ621638A (en) 2011-08-25 2016-03-31 Clinical Genomics Pty Ltd Dna methylation in colorectal and breast cancer diagnostic methods
EP2751285B2 (en) 2011-08-31 2020-04-01 Genentech, Inc. Method for sensitivity testing of a tumour for a egfr kinase inhibitor
EP2761025A1 (en) 2011-09-30 2014-08-06 Genentech, Inc. Diagnostic methylation markers of epithelial or mesenchymal phenotype and response to egfr kinase inhibitor in tumours or tumour cells
US10131953B2 (en) 2011-11-03 2018-11-20 Wisconsin Alumni Research Foundation Unbiased DNA methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer
WO2013084075A2 (en) 2011-12-06 2013-06-13 Mdxhealth Sa Methods of detecting mutations and epigenetic changes
EP4001436B1 (en) 2012-05-11 2024-03-13 Clinical Genomics Pty. Ltd. Diagnostic gene marker panel
WO2013170191A1 (en) 2012-05-11 2013-11-14 Genentech, Inc. Methods of using antagonists of nad biosynthesis from nicotinamide
DK2850212T3 (en) 2012-05-18 2020-03-23 Clinical Genomics Pty Ltd Method of screening for colorectal cancer
CA2882185A1 (en) * 2012-08-28 2014-03-06 Istat Biomedical Co., Ltd. Test composition for screening cancers
WO2014134548A2 (en) * 2013-02-28 2014-09-04 Lu Jim Z Assay, methods and compositions for diagnosing cancer
EP2971171A4 (en) * 2013-03-14 2016-11-02 Abbott Molecular Inc Multiplex methylation-specific amplification systems and methods
US20140274757A1 (en) 2013-03-14 2014-09-18 Marie K. Kirby Differential Methylation Level of CpG Loci That Are Determinative of a Biochemical Reoccurrence of Prostate Cancer
US9758835B2 (en) 2013-03-15 2017-09-12 Baylor Research Institute Ulcerative colitis (UC)-associated colorectal neoplasia markers
EP2978861B1 (en) 2013-03-28 2020-07-15 Wisconsin Alumni Research Foundation Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer
CN104250663B (en) * 2013-06-27 2017-09-15 北京大学 The high-flux sequence detection method on methylated CpG island
CN106471008B (en) 2014-05-02 2021-04-09 马来西亚棕榈油协会 Palm Mantle phenotype assay
WO2015181804A2 (en) * 2014-05-30 2015-12-03 Pontificia Universidad Católica De Chile Method and assay for the non-invasive detection of early gastric cancer by the combined use of methylated reprimo cell-free dna and pepsinogen i/ii
JP6810612B2 (en) 2014-06-05 2021-01-06 クリニカル ジェノミクス ピーティーワイ リミテッド Methods for methylation analysis
CN107148476B (en) 2014-10-17 2021-06-08 科罗拉多大学董事会法人团体 Head and neck cancer biomarkers and methods of use
AU2016361451B2 (en) 2015-11-27 2024-01-25 Cartherics Pty. Ltd. Genetically modified cells and uses thereof
US10913986B2 (en) 2016-02-01 2021-02-09 The Board Of Regents Of The University Of Nebraska Method of identifying important methylome features and use thereof
US11130998B2 (en) 2016-11-14 2021-09-28 Wisconsin Alumni Research Foundation Unbiased DNA methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer
US11542548B2 (en) 2019-06-11 2023-01-03 Wisconsin Alumni Research Foundation; Blood DNA methylation biomarker diagnostic test for anxiety and depressive disorders
BR112022001229A2 (en) 2019-07-22 2022-06-14 Octavio Franco Polypeptides having antisenescent effects and uses thereof
CN112662761A (en) * 2020-03-05 2021-04-16 博尔诚(北京)科技有限公司 Probe composition for detecting 3 parenchymal organ tumors
US20230203585A1 (en) 2020-05-22 2023-06-29 Wisconsin Alumni Research Foundation Epigenetic modification of select genes as markers of hypersomnolence
WO2026022118A1 (en) * 2024-07-23 2026-01-29 Qiagen Gmbh Method of detecting methylated nucleic acids

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5786146A (en) * 1996-06-03 1998-07-28 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5210015A (en) * 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5538848A (en) * 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
US5788146A (en) * 1996-02-13 1998-08-04 Bradford Company Parent welding partition assembly
GB9609441D0 (en) * 1996-05-04 1996-07-10 Zeneca Ltd Process
US5736333A (en) * 1996-06-04 1998-04-07 The Perkin-Elmer Corporation Passive internal references for the detection of nucleic acid amplification products
JP4540754B2 (en) 1996-06-04 2010-09-08 ユニバーシティ オブ ユタ リサーチ ファウンデーション Monitoring of hybridization during PCR
US5866336A (en) * 1996-07-16 1999-02-02 Oncor, Inc. Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
US6117635A (en) 1996-07-16 2000-09-12 Intergen Company Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon
AUPP312998A0 (en) 1998-04-23 1998-05-14 Commonwealth Scientific And Industrial Research Organisation Diagnostic assay
US6140054A (en) * 1998-09-30 2000-10-31 University Of Utah Research Foundation Multiplex genotyping using fluorescent hybridization probes
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US6472156B1 (en) * 1999-08-30 2002-10-29 The University Of Utah Homogeneous multiplex hybridization analysis by color and Tm
CA2549852A1 (en) 2003-12-11 2005-06-30 Epigenomics Ag Method and nucleic acids for the improved treatment of breast cell proliferative disorders
AU2005231971A1 (en) 2004-04-06 2005-10-20 Epigenomics Ag Method for the quantification of methylated DNA
EP2311984A1 (en) 2004-12-02 2011-04-20 Epigenomics AG Methods and nucleic acids for the analysis of gene expression associated with the prognosis of prostate cell proliferative disorders

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5786146A (en) * 1996-06-03 1998-07-28 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Gonzalgo et al. Nucleic Acids Research 25(12): 2529-2531, 1997. *
Xiong et al. Nucleic Acids Research 25(12):2532-2534, 1997.*

Cited By (379)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7112404B2 (en) * 1999-05-14 2006-09-26 Epigenomics Ag Process for high throughput DNA methylation analysis
US7553627B2 (en) 1999-05-14 2009-06-30 University of Southern California, USC Stevens Center for Innovation Process for high throughput DNA methylation analysis
US8323890B2 (en) * 1999-05-14 2012-12-04 The University Of Southern California Process for high-throughput DNA methylation analysis
US20100009365A1 (en) * 1999-05-14 2010-01-14 University Of Southern California Process for high-throughput dna methylation analysis
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7611869B2 (en) * 2000-02-07 2009-11-03 Illumina, Inc. Multiplexed methylation detection methods
US8906626B2 (en) 2000-02-07 2014-12-09 Illumina, Inc. Multiplex nucleic acid reactions
US10837059B2 (en) 2000-02-07 2020-11-17 Illumina, Inc. Multiplex nucleic acid reactions
US8288103B2 (en) 2000-02-07 2012-10-16 Illumina, Inc. Multiplex nucleic acid reactions
US8003354B2 (en) 2000-02-07 2011-08-23 Illumina, Inc. Multiplex nucleic acid reactions
US9850536B2 (en) 2000-02-07 2017-12-26 Illumina, Inc. Multiplex nucleic acid reactions
US20030148327A1 (en) * 2000-04-06 2003-08-07 Alexander Olek Diagnosis of diseases associated with metastasis
US20040067491A1 (en) * 2000-04-06 2004-04-08 Alexander Olek Diagnosis of diseases associated with metabolism
US20040076956A1 (en) * 2000-04-06 2004-04-22 Alexander Olek Diagnosis of diseases associated with dna repair
US7214485B2 (en) * 2000-08-25 2007-05-08 Lovelace Respiratory Research Institute Nested methylation-specific polymerase chain reaction cancer detection method
US20040038245A1 (en) * 2000-08-25 2004-02-26 Belinsky Steven A Nested methylation-specific polymerase chain reaction cancer detection method
US7749706B2 (en) 2000-09-15 2010-07-06 Promega Corporation Detection of microsatellite instability and its use in diagnosis of tumors
US20050202473A1 (en) * 2000-09-15 2005-09-15 Promega Corporation Detection of microsatellite instability and its use in diagnosis of tumors
US7902343B2 (en) 2000-09-15 2011-03-08 Promega Corporation Detection of microsatellite instability and its use in diagnosis of tumors
US20070117136A1 (en) * 2000-09-15 2007-05-24 Promega Corporation Detection of microsatellite instability and its use in diagnosis of tumors
US20030180758A1 (en) * 2000-09-15 2003-09-25 Promega Corporation Detection of microsatellite instability and its use in diagnosis of tumors
US7364853B2 (en) 2000-09-15 2008-04-29 Promega Corporation Detection of microsatellite instability and its use in diagnosis of tumors
US7202031B2 (en) * 2000-09-15 2007-04-10 Promega Corporation Detection of microsatellite instability and its use in diagnosis of tumors
US9354224B2 (en) 2000-11-03 2016-05-31 Dana-Farber Cancer Institute, Inc. Methods and compositions for the diagnosis of cancer susceptibilities and defective DNA repair mechanisms and treatment thereof
US20040048279A1 (en) * 2000-11-14 2004-03-11 Alexander Olek Method for detecting methylation states for a toxicological diagnostic
US20070259364A1 (en) * 2001-01-31 2007-11-08 The Ohio State University Research Foundation DETECTION OF METHYLATED CpG RICH SEQUENCES DIAGNOSTIC FOR MALIGNANT CELLS
US7756643B2 (en) * 2001-03-01 2010-07-13 Epigenomics Ag Method for determining the biological effect and/or activity of at least one drug, chemical substances and/or pharmaceutical composition based on their effect on the methylation status of DNA
US20040029117A1 (en) * 2001-03-01 2004-02-12 Alexander Olek Methods, systems and computer program products for determining the biological effect and/or activity of drugs, chemical substances and/or pharmaceutical compositions based on their effect on the methylation status of the DNA
US20100233722A1 (en) * 2001-03-01 2010-09-16 Epigenomics Ag Methods for determining the biological effect and/or activity of r pharmaceutical compositions based on their effect on the methylation status of the DNA
US7229759B2 (en) * 2001-03-09 2007-06-12 Epigenomics Ag Highly sensitive method for the detection of cytosine methylation patterns
US20030082600A1 (en) * 2001-03-09 2003-05-01 Alexander Olek Highly sensitive method for the detection of cytosine methylation patters
US20020197639A1 (en) * 2001-06-08 2002-12-26 Shia Michael A. Methods and products for analyzing nucleic acids based on methylation status
US20050069879A1 (en) * 2001-06-22 2005-03-31 Kurt Berlin Method for high sensitivity detection of cytosine-methylation
WO2003014388A2 (en) 2001-08-09 2003-02-20 Epigenomics Ag Method and nucleic acids for the analysis of colon cancer
US20050064410A1 (en) * 2001-08-09 2005-03-24 Jurgen Distler Method and nucleic acids for the analysis of colon cancer
US20090181400A1 (en) * 2001-11-16 2009-07-16 The Johns Hopkins University School Of Medicine Method of Detection of Prostate Cancer
US20110151438A9 (en) * 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
US20080108073A1 (en) * 2001-11-19 2008-05-08 Affymetrix, Inc. Methods of Analysis of Methylation
US10822642B2 (en) 2001-11-19 2020-11-03 Affymetrix, Inc. Methods of analysis of methylation
US10407717B2 (en) 2001-11-19 2019-09-10 Affymetrix, Inc. Methods of analysis of methylation
US20030215842A1 (en) * 2002-01-30 2003-11-20 Epigenomics Ag Method for the analysis of cytosine methylation patterns
US6960436B2 (en) * 2002-02-06 2005-11-01 Epigenomics Ag Quantitative methylation detection in DNA samples
US20060258856A1 (en) * 2002-02-13 2006-11-16 Medimolecular Pty. Ltd. Method of isolating nucleic acids from stool samples
KR100470221B1 (en) * 2002-02-20 2005-02-05 굿젠 주식회사 Minisequencing type oligonucleotide chip for detecting methylation of promoter CpG islands of multiple genes, method for preparing thereof and method for detecting cancer using the same
US9988683B2 (en) 2002-02-27 2018-06-05 Epigenomics Ag Method and nucleic acids for the analysis of colon cell proliferative disorders
US8691503B2 (en) * 2002-02-27 2014-04-08 Epigenomics Ag Method and nucleic acids for the analysis of colorectal cell proliferative disorders
US20110046005A1 (en) * 2002-02-27 2011-02-24 Epigenomics Ag Method and nucleic acids for the analysis of colon cell proliferative disorders
US20050003463A1 (en) * 2002-02-27 2005-01-06 Peter Adorjan Method and nucleic acids for the analysis of colorectal cell proliferative disorders
US20060234224A1 (en) * 2002-02-27 2006-10-19 Peter Adorjan Method and nucleic acids for the analysis of colon cell proliferative disorders
EP1342794A1 (en) * 2002-03-05 2003-09-10 Epigenomics AG Method and device for determination of tissue specificity of free floating DNA in bodily fluids
US20050221314A1 (en) * 2002-03-05 2005-10-06 Epigenomics Ag Method and device for determination of tissue specificity of free floating dna in bodily fluids
WO2003074730A1 (en) * 2002-03-05 2003-09-12 Epigenomics Ag Method and device for determination of tissue specificity of free floating dna in bodily fluids
US20060099581A1 (en) * 2002-04-09 2006-05-11 Kurt Berlin Method for analysis of methylated nucleic acids
US20050222880A1 (en) * 2002-06-21 2005-10-06 Yoshinori Shiraishi Device for removing raindrops on umrella and system for promoting installation of the device
US20040132048A1 (en) * 2002-06-26 2004-07-08 Robert Martienssen Methods and compositions for determining methylation profiles
US7186512B2 (en) 2002-06-26 2007-03-06 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
WO2004046313A3 (en) * 2002-06-26 2005-03-10 Cold Spring Harbor Lab Methods and compositions for determining methylation profiles
US20070178506A1 (en) * 2002-06-26 2007-08-02 Cold Spring Harbor Laboratory And Washington University Methods and compositions for determining methylation profiles
US8273528B2 (en) 2002-06-26 2012-09-25 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
RU2315312C2 (en) * 2002-08-01 2008-01-20 Мтм Лабораториес Аг Diagnosis method for using a solution
US20070178453A1 (en) * 2002-08-02 2007-08-02 Tamas Rujan Method for amplification of nucleic acids of low complexity
WO2004013284A3 (en) * 2002-08-02 2004-07-15 Univ Tufts A method to assess genomic dna methylation using high-performance liquid chromatography-electospray ionization mass spectrometry
US9394332B2 (en) 2002-08-29 2016-07-19 Epigenomics Ag Method for bisulfite treatment
US9868756B2 (en) 2002-08-29 2018-01-16 Epigenomics Ag Method for bisulfite treatment
US20040241704A1 (en) * 2002-08-29 2004-12-02 Roche Molecular Systems, Inc Method for bisulfite treatment
US7153658B2 (en) 2002-09-19 2006-12-26 Applera Corporation Methods and compositions for detecting targets
US20040121371A1 (en) * 2002-09-19 2004-06-24 Applera Corporation Methods and compositions for detecting targets
US20060121467A1 (en) * 2002-10-01 2006-06-08 John Foekens Method and nucleic acids for the improved treatment of breast cell proliferative disorders
EP2157191A2 (en) 2002-10-01 2010-02-24 Epigenomics AG Method and nucleic acids for the improved treatment of breast cell proliferative disorders
US8101359B2 (en) 2002-10-01 2012-01-24 Epigenomics Ag Method for determining risk of relapse of breast cancer following tamoxifen adjuvant therapy
US20040265845A1 (en) * 2002-11-14 2004-12-30 Hoon Dave S.B. Detection of micro metastasis of melanoma and breast cancer in paraffin-embedded tumor draining lymph nodes by multimarker quantitative RT-PCR
US8039218B2 (en) 2002-11-14 2011-10-18 John Wayne Cancer Institute Detection of cancer cells in body fluids
US20110207136A1 (en) * 2002-11-14 2011-08-25 John Wayne Cancer Institute Detection of Micro Metastasis of Melanoma and Breast Cancer in Paraffin-Embedded Tumor Draining Lymph Nodes by Multimarker Quantitative RT-PCR
US7910295B2 (en) 2002-11-14 2011-03-22 John Wayne Cancer Institute Detection of micro metastasis of melanoma and breast cancer in paraffin-embedded tumor draining lymph nodes by multimarker quantitative RT-PCR
US20060115832A1 (en) * 2002-11-14 2006-06-01 Jon Wayne Cancer Institute Detection of cancer cells in body fluids
US20040101843A1 (en) * 2002-11-22 2004-05-27 Gerald Zon Detection of methylated DNA sites
US20080207460A1 (en) * 2002-12-02 2008-08-28 Solexa Limited Determination of methylation of nucleic acid sequences
WO2004051224A3 (en) * 2002-12-03 2005-01-27 Illumina Inc Multiplexed methylation detection methods
US20070042365A1 (en) * 2003-01-24 2007-02-22 Millar Douglas S Assay for detecting methylation changes in nucleic acids using an intercalating nucleic acid
US7413855B2 (en) 2003-01-29 2008-08-19 Roche Molecular Systems, Inc. Method for bisulfite treatment
US20060058518A1 (en) * 2003-01-29 2006-03-16 Frank Bergmann Method for bisulfite treatment
US20090305294A1 (en) * 2003-02-13 2009-12-10 Medimolecular Pty Ltd Method of isolating nucleic acids from stool samples
WO2004087957A3 (en) * 2003-04-03 2005-07-28 Oncomethylome Sciences S A Hypermethylated genes and cervical cancer
US20040219539A1 (en) * 2003-05-02 2004-11-04 Millar Douglas Spencer Treatment of methylated nucleic acid
US7288373B2 (en) 2003-05-02 2007-10-30 Human Genetic Signatures Pty Ltd. Treatment of methylated nucleic acid
US20070020633A1 (en) * 2003-05-02 2007-01-25 Millar Douglas S Treatment of nucleic acid
US20050009059A1 (en) * 2003-05-07 2005-01-13 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US20050153347A1 (en) * 2003-05-07 2005-07-14 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
US8150627B2 (en) 2003-05-15 2012-04-03 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US20050026183A1 (en) * 2003-05-15 2005-02-03 Jian-Bing Fan Methods and compositions for diagnosing conditions associated with specific DNA methylation patterns
US20050164246A1 (en) * 2003-05-15 2005-07-28 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
US8150626B2 (en) 2003-05-15 2012-04-03 Illumina, Inc. Methods and compositions for diagnosing lung cancer with specific DNA methylation patterns
WO2004110246A3 (en) * 2003-05-15 2005-06-09 Illumina Inc Methods and compositions for diagnosing conditions associated with specific dna methylation patterns
US20070178457A1 (en) * 2003-06-17 2007-08-02 Human Genetic Signatures Pty. Ltd. Methods for genome amplification
US7799525B2 (en) 2003-06-17 2010-09-21 Human Genetic Signatures Pty Ltd. Methods for genome amplification
EP2354249A1 (en) 2003-06-23 2011-08-10 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
US20070184438A1 (en) * 2003-06-23 2007-08-09 Cathy Lofton-Day Methods and nucleic acids for the analysis of colorectal cell proliferative disorders
US8163488B2 (en) 2003-06-23 2012-04-24 Epigenomics Ag Methods and nucleic acids for analysis of colon proliferative disorders
US20090047666A1 (en) * 2003-06-23 2009-02-19 Epigenomics Ag Methods and nucleic acids for the analysis of colon proliferative disorders
EP2354248A1 (en) 2003-06-23 2011-08-10 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
EP2354250A1 (en) 2003-06-23 2011-08-10 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
EP2345745A1 (en) 2003-06-23 2011-07-20 Epigenomics AG Methods and nucleic acids for analyses of colorectal cell proliferative disorders
US20080064029A1 (en) * 2003-06-23 2008-03-13 Epigenomics Ag Methods and Nucleic Acids for Analyses of Colorectal Cell Proliferative Disorders
US20050123944A1 (en) * 2003-08-01 2005-06-09 U.S. Genomics, Inc. Methods and compositions related to the use of sequence-specific endonucleases for analyzing nucleic acids under non-cleaving conditions
US20060194208A1 (en) * 2003-08-15 2006-08-31 Reimo Tetzner Method for the detection of cytosine methylations in dna with the aid of scorpion
EP1835037A1 (en) * 2003-08-15 2007-09-19 Epigenomics AG Method for the detection of cytosine methylations in DNA involving scorpion-primers
US9863001B2 (en) 2003-08-15 2018-01-09 Epigenomics Ag Method for the detection of cytosine methylations in DNA
WO2005024056A3 (en) * 2003-08-15 2005-06-02 Epigenomics Ag Method for the detection of cytosine methylations in dna with the aid of scorpion primers
US7534873B2 (en) 2003-08-29 2009-05-19 Applied Biosystems, Llc Method and materials for quaternary amine catalyzed bisulfite conversion of cytosine to uracil
US20100105886A1 (en) * 2003-08-29 2010-04-29 Life Technologies Corporation Compositions, methods, and kits for fabricating coded molecular tags
US20050069895A1 (en) * 2003-08-29 2005-03-31 Applera Corporation Compositions, methods, and kits for fabricating coded molecular tags
US7368239B2 (en) 2003-08-29 2008-05-06 Applera Corporation Method and materials for polyamine catalyzed bisulfite conversion of cytosine to uracil
US20050074774A1 (en) * 2003-08-29 2005-04-07 Applera Corporation Multiplex detection compositions, methods, and kits
US7371526B2 (en) 2003-08-29 2008-05-13 Applera Corporation Method and materials for bisulfite conversion of cytosine to uracil
US20050079527A1 (en) * 2003-08-29 2005-04-14 Applera Corporation Bisulfite method
US20100112572A1 (en) * 2003-08-29 2010-05-06 Life Technologies Corporation Compositions, methods, and kits for fabricating coded molecular tags
US20050089898A1 (en) * 2003-08-29 2005-04-28 Applera Corporation Method and materials for quaternary amine catalyzed bisulfite conversion of cytosine to uracil
US20090280497A1 (en) * 2003-08-29 2009-11-12 Life Technologies Corporation Multiplex Detection Compositions, Methods, and Kits
US7198900B2 (en) 2003-08-29 2007-04-03 Applera Corporation Multiplex detection compositions, methods, and kits
US7262013B2 (en) 2003-08-29 2007-08-28 Applera Corporation Bisulfite method
US20110223596A1 (en) * 2003-08-29 2011-09-15 Life Technologies Corporation Multiplex Detection Compositions, Methods, and Kits
US20050048498A1 (en) * 2003-08-29 2005-03-03 Applera Corporation Compositions, methods, and kits for assembling probes
US7846693B2 (en) 2003-09-04 2010-12-07 Human Genetic Signatures Pty. Ltd. Nucleic acid detection assay
US20070178459A1 (en) * 2003-09-04 2007-08-02 Human Genetic Signatures Pty. Ltd. Nucleic acid detection assay
US20090325232A1 (en) * 2003-10-08 2009-12-31 Trustees Of Boston University Methods for prenatal diagnosis of chromosomal abnormalities
US7785798B2 (en) 2003-10-08 2010-08-31 Trustees Of Boston University Methods for prenatal diagnosis of chromosomal abnormalities
WO2005035725A3 (en) * 2003-10-08 2006-06-29 Univ Boston Methods for prenatal diagnosis of chromosomal abnormalities
US7655399B2 (en) 2003-10-08 2010-02-02 Trustees Of Boston University Methods for prenatal diagnosis of chromosomal abnormalities
US20070059707A1 (en) * 2003-10-08 2007-03-15 The Trustees Of Boston University Methods for prenatal diagnosis of chromosomal abnormalities
EP2088210A2 (en) 2003-10-09 2009-08-12 Epigenomics AG Improved bisulfite conversion of DNA
US8361719B2 (en) 2003-10-21 2013-01-29 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
US20050158739A1 (en) * 2003-10-21 2005-07-21 Orion Genomics Llc Differential enzymatic fragmentation
US8163485B2 (en) 2003-10-21 2012-04-24 Orion Genomics, Llc Differential enzymatic fragmentation
US7910296B2 (en) 2003-10-21 2011-03-22 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
US7901880B2 (en) 2003-10-21 2011-03-08 Orion Genomics Llc Differential enzymatic fragmentation
US20100240064A1 (en) * 2003-10-21 2010-09-23 Orion Genomics Llc Differential enzymatic fragmentation
US20050153316A1 (en) * 2003-10-21 2005-07-14 Orion Genomics Llc Methods for quantitative determination of methylation density in a DNA locus
US9181587B2 (en) 2003-12-01 2015-11-10 Epigenomics Ag Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
US20080286761A1 (en) * 2003-12-01 2008-11-20 Epigenomics Ag Methods and Nucleic Acids for the Analysis of Gene Expression Associated with the Development of Prostate Cell Proliferative Disorders
EP3269826A1 (en) 2003-12-01 2018-01-17 Epigenomics AG Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
US7501240B2 (en) 2003-12-02 2009-03-10 Roche Molecular Systems, Inc. Method for bisulfite treatment
US20080254447A1 (en) * 2003-12-11 2008-10-16 Epigenomics Ag Method and Nucleic Acids for the Improved Treatment of Breast Cell Proliferative Disorders
EP1561821A2 (en) 2003-12-11 2005-08-10 Epigenomics AG Prognostic markers for prediction of treatment response and/or survival of breast cell proliferative disorder patients
US9017944B2 (en) 2003-12-11 2015-04-28 Epigenomics Ag Methods for the prognosis of breast cancer
US20050227265A1 (en) * 2004-02-10 2005-10-13 Francis Barany Method for detection of promoter methylation status
US7358048B2 (en) 2004-02-10 2008-04-15 Cornell Research Foundation, Inc. Method for detection of promoter methylation status
US8088581B2 (en) 2004-03-02 2012-01-03 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US20050272065A1 (en) * 2004-03-02 2005-12-08 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US7459274B2 (en) 2004-03-02 2008-12-02 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US20110076726A1 (en) * 2004-03-02 2011-03-31 Orion Genomics Llc Differential enzymatic fragmentation by whole genome amplification
US20050260640A1 (en) * 2004-03-24 2005-11-24 Applera Corportion Encoding and decoding reactions for determining target molecules
US7601821B2 (en) 2004-03-24 2009-10-13 Applied Biosystems, Llc Encoding and decoding reactions for determining target molecules
WO2005098035A3 (en) * 2004-04-06 2006-02-02 Epigenomics Ag Method for the quantification of methylated dna
EP1655377A1 (en) * 2004-04-06 2006-05-10 Epigenomics AG Method of quantifying methylated DNA
US20050233340A1 (en) * 2004-04-20 2005-10-20 Barrett Michael T Methods and compositions for assessing CpG methylation
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
US20050266458A1 (en) * 2004-04-30 2005-12-01 Applera Corporation Methods and kits for methylation detection
US7364855B2 (en) 2004-04-30 2008-04-29 Applera Corporation Methods and kits for methylation detection
US7427479B2 (en) 2004-04-30 2008-09-23 Applera Corporation Methods and kits for identifying target nucleotides in mixed populations
US20060003351A1 (en) * 2004-04-30 2006-01-05 Applera Corporation Methods and kits for identifying target nucleotides in mixed populations
US20080311566A1 (en) * 2004-06-23 2008-12-18 Fabian Model Method for Quantification of Methylated Dna
US7972784B2 (en) * 2004-06-23 2011-07-05 Epigenomics Ag Method for quantification of methylated DNA
US20100035242A1 (en) * 2004-06-23 2010-02-11 Epigenomics Ag Methods and nucleic acids for the detection of metastasis of colon cell proliferative disorders
WO2006000447A1 (en) * 2004-06-23 2006-01-05 Epigenomics Ag Method for quantification of methylated dna
US7943308B2 (en) 2004-06-23 2011-05-17 Epigenomics Ag Methods and nucleic acids for the detection of metastasis of colon cell proliferative disorders
EP1609873A1 (en) * 2004-06-23 2005-12-28 Epigenomics AG Method for quantification of methylated DNA
US20110201005A1 (en) * 2004-06-23 2011-08-18 Epigenomics Ag Methods and Nucleic Acids for the Detection of Metastasis of Colon Cell Proliferative Disorders
US20060234252A1 (en) * 2004-07-02 2006-10-19 Applera Corporation Methods and kits for methylation detection
EP2281902A1 (en) 2004-07-18 2011-02-09 Epigenomics AG Epigenetic methods and nucleic acids for the detection of breast cell proliferative disorders
EP1961827A2 (en) 2004-07-18 2008-08-27 Epigenomics AG Epigenetic methods and nucleic acids for the detection of breast cell proliferative disorders
US7989169B2 (en) 2004-09-03 2011-08-02 Roche Molecular Systems, Inc. Selective amplification of methylated nucleic acids
US20090208930A1 (en) * 2004-09-03 2009-08-20 Frank Bergmann Dna decontamination method
EP2330214A1 (en) 2004-09-03 2011-06-08 F. Hoffmann-La Roche AG Method for DNA decontamination
US7803580B2 (en) 2004-09-10 2010-09-28 Human Genetic Signatures Pty. Ltd. Amplification blocker comprising intercalating nucleic acids (INA) containing intercalating pseudonucleotides (IPN)
US20090130657A1 (en) * 2004-09-10 2009-05-21 Human Genetic Signatures Pty Ltd. Amplification blocker comprising intercalating nucleic acids (ina) containing intercalating pseudonucleotides (ipn)
US20060068430A1 (en) * 2004-09-20 2006-03-30 Sigma-Aldrich Co. Purification of biomolecules from contaminating intact nucleic acids
US20080171318A1 (en) * 2004-09-30 2008-07-17 Epigenomics Ag Epigenetic Methods and Nucleic Acids for the Detection of Lung Cell Proliferative Disorders
US20060148853A1 (en) * 2004-11-08 2006-07-06 Applera Corporation Bisulfite conversion reagent
US7658288B2 (en) 2004-11-08 2010-02-09 Applied Biosystems, Llc Bisulfite conversion reagent
US20100112595A1 (en) * 2004-11-08 2010-05-06 Life Technologies Corporation Bisulfite Conversion Reagent
US20090197250A1 (en) * 2004-12-02 2009-08-06 Epigenomics Ag Methods and nucleic acids for the analysis of gene expression associated with the prognosis of prostate cell proliferative disorders
EP2284279A1 (en) 2004-12-02 2011-02-16 Epigenomics AG Methods and nucleic acids for the analysis of gene expression associated with the prognosis of prostate cell proliferative disorders
US20110136098A1 (en) * 2004-12-03 2011-06-09 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US20090042732A1 (en) * 2004-12-03 2009-02-12 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US7833942B2 (en) 2004-12-03 2010-11-16 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US8598088B2 (en) 2004-12-03 2013-12-03 Human Genetic Signatures Pty. Ltd. Methods for simplifying microbial nucleic acids by chemical modification of cytosines
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
US20090029346A1 (en) * 2004-12-23 2009-01-29 Human Genetic Signatures Pty., Ltd. Detection of human papilloma virus
US20140141998A1 (en) * 2005-02-14 2014-05-22 The Johns Hopkins University Neoplasia screening compositions and methods of use
US20060188910A1 (en) * 2005-02-18 2006-08-24 Applera Corporation Compositions, methods, and kits for analyzing DNA methylation
US20100028890A1 (en) * 2005-02-18 2010-02-04 Life Technologies Corporation Compositions, methods, and kits for analyzing dna methylation
US20110195405A1 (en) * 2005-02-18 2011-08-11 Life Technologies Corporation Compositions, methods, and kits for analyzing dna methylation
WO2006112939A3 (en) * 2005-02-18 2009-04-16 Applera Corp Compositions, methods, and kits for analyzing dna methylation
EP2803734A1 (en) 2005-04-01 2014-11-19 Epigenomics AG Improved bisulfite conversion of DNA
EP2385136A1 (en) 2005-04-01 2011-11-09 Epigenomics AG Improved bisulfite conversion of DNA
US9695478B2 (en) 2005-04-15 2017-07-04 Epigenomics Ag Methods and nucleic acids for the analyses of cellular proliferative disorders
US11186879B2 (en) 2005-04-15 2021-11-30 Epigenomics Ag Methods and nucleic acids for analyses of cellular proliferative disorders
EP1721992A2 (en) 2005-04-15 2006-11-15 Epigenomics AG Methods and nucleic acids for analyses of cellular proliferative disorders
US20110039719A1 (en) * 2005-04-15 2011-02-17 Epigenomics Ag Methods and nucleic acids for the analyses of cellular proliferative disorders
US20060286576A1 (en) * 2005-04-15 2006-12-21 Epigenomics Ag Methods and nucleic acids for the analyses of cellular proliferative disorders
US7749702B2 (en) 2005-04-15 2010-07-06 Epigenomics Ag Methods and nucleic acids for the analyses of cellular proliferative disorders
US10385402B2 (en) 2005-04-15 2019-08-20 Epigenomics Ag Methods and nucleic acids for analyses of cellular proliferative disorders
US7951563B2 (en) 2005-04-15 2011-05-31 Epigenomics Ag Methods and nucleic acids for analysis of cellular proliferative disorders
US8900829B2 (en) 2005-04-15 2014-12-02 Epigenomics Ag Methods and nucleic acids for analyses of cellular proliferative disorders
EP2045335A1 (en) 2005-04-15 2009-04-08 Epigenomics AG Methods and nucleic acids for analyses of cellular proliferative disorders
US20090075260A1 (en) * 2005-04-15 2009-03-19 Epigenomics Ag Methods and Nucleic Acids For Analysis of Cellular Proliferative Disorders
US8110361B2 (en) 2005-05-02 2012-02-07 University of Southern California USC Stevens Center for Innovation DNA methylation markers associated with the CpG island methylator phenotype (CIMP) in human colorectal cancer
US20090053706A1 (en) * 2005-05-02 2009-02-26 University Of Southern California Dna methylation markers associated with the cpg island methylator phenotype (cimp) in human colorectal cancer
EP2395101A1 (en) 2005-05-02 2011-12-14 University of Southern California DNA methylation markers associated with the CpG island methylator phenotype (cimp) in human colorectal cancer
EP2345743A1 (en) 2005-05-02 2011-07-20 University of Southern California DNA methylation markers associated with the CpG island methylator phenotyp (CIMP) in human colorectal cancer
EP2386654A1 (en) 2005-05-02 2011-11-16 University of Southern California DNA Methylation markers associated with the CpG island methylator phenotype (cimp) in human colorectal cancer
WO2006121295A1 (en) * 2005-05-11 2006-11-16 Korea Research Institute Of Standards And Science Method for quantitative analysis of methyl cytosine in dna and uses thereof
KR100673811B1 (en) 2005-05-11 2007-01-24 한국표준과학연구원 Quantitative Analysis of Methyl Cytosine in Genes and Their Uses
US20100221785A1 (en) * 2005-05-26 2010-09-02 Human Genetic Signatures Pty Ltd Isothermal Strand Displacement Amplification Using Primers Containing a Non-Regular Base
US8431347B2 (en) 2005-05-26 2013-04-30 Human Genetic Signatures Pty Ltd Isothermal strand displacement amplification using primers containing a non-regular base
US20070037184A1 (en) * 2005-06-16 2007-02-15 Applera Corporation Methods and kits for evaluating dna methylation
WO2008018855A3 (en) * 2005-06-16 2008-12-04 Applera Corp Methods and kits for evaluating dna methylation
US20070087360A1 (en) * 2005-06-20 2007-04-19 Boyd Victoria L Methods and compositions for detecting nucleotides
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20090005268A1 (en) * 2005-07-18 2009-01-01 Epigenomics Ag Compositions and Methods for Cancer Diagnostics Comprising Pan-Cancer Markers
WO2007009822A3 (en) * 2005-07-21 2007-05-10 Epigenomics Ag Method for the quantification of methylated dna
US8703414B2 (en) * 2005-07-21 2014-04-22 Epigenomics Ag Method for the quantification of methylated DNA
EP1746169A1 (en) 2005-07-21 2007-01-24 Epigenomics AG Method for quantification of methylated DNA
US20110104663A1 (en) * 2005-07-21 2011-05-05 Epigenomics Ag Method for the Quantification of Methylated DNA
US8343738B2 (en) 2005-09-14 2013-01-01 Human Genetic Signatures Pty. Ltd. Assay for screening for potential cervical cancer
US20100041013A1 (en) * 2005-09-14 2010-02-18 Human Genetic Signatures Pty Ltd. Assay for a health state
US20090111707A1 (en) * 2005-09-21 2009-04-30 Epigenomics Ag Markers for the prediction of outcome of anthracycline treatment
WO2007039128A1 (en) 2005-09-21 2007-04-12 Epigenomics Ag Markers for the prediction of outcome of anthracycline treatment
US10053735B2 (en) 2005-09-21 2018-08-21 Therawis Diagnostics Gmbh Markers for the prediction of outcome of anthracycline treatment
EP2298932A1 (en) 2005-09-29 2011-03-23 Epigenomics AG Methods and nucleic acids for the analysis of gene expression, in particular methylation of KAAG1, associated with tissue classification
US20080254470A1 (en) * 2005-10-03 2008-10-16 Epigenomics Ag Methods and Nucleic Acids For the Analysis of Gene Expression Associated With the Prognosis of Cell Proliferative Disorders
US20080223695A1 (en) * 2005-10-12 2008-09-18 Scanvaegt International A/S Device for Transfer of Items
US20070087358A1 (en) * 2005-10-19 2007-04-19 Melanie Ehrlich Methods for diagnosing cancer based on DNA methylation status in NBL2
EP2186912A2 (en) 2005-11-08 2010-05-19 Euclid Diagnostics LLC Materials and methods for assaying for methylation of CpG islands associated with genes in the evaluation of cancer
EP3095878A1 (en) 2005-11-17 2016-11-23 Epigenomics AG Method for the determination of the dna methylation level of a cpg position in identical cells within a tissue sample
US8137937B2 (en) 2005-12-14 2012-03-20 Roche Molecular Systems, Inc. Method for bisulfite treatment
US20080281087A1 (en) * 2005-12-14 2008-11-13 Roche Molecular Systems, Inc. Patent Department Method For Bisulfite Treatment
US7820385B2 (en) 2006-03-22 2010-10-26 The United States Of America As Represented By The Department Of Health And Human Services, Centers For Disease Control And Prevention Method for retaining methylation pattern in globally amplified DNA
US20070238117A1 (en) * 2006-03-22 2007-10-11 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Method for retaining methylation pattern in globally amplified dna
EP1840224A1 (en) 2006-03-29 2007-10-03 Pangaea Biotech, S.A. Method of predicting survival of a non-small-cell lung cancer patient to a chemotherapeutic treatment
US8709716B2 (en) 2006-03-31 2014-04-29 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20110166037A1 (en) * 2006-03-31 2011-07-07 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US7901882B2 (en) 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US10822659B2 (en) 2006-03-31 2020-11-03 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US9828640B2 (en) 2006-03-31 2017-11-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
US20090317810A1 (en) * 2006-04-17 2009-12-24 Epigenomics Ag Methods and nucleic acids for the detection of colorectal cell proliferative disorders
EP2479283A1 (en) 2006-04-17 2012-07-25 Epigenomics AG Methods and nucleic acids for the detection of colorectal cell proliferative disorders
EP2484778A2 (en) 2006-04-17 2012-08-08 Epigenomics AG Methods and nucleic acids for the detection of colorectal cell proliferative disorders
US20080003609A1 (en) * 2006-05-10 2008-01-03 The Cleveland Clinic Foundation Method of detecting bladder urothelial carcinoma
KR100761031B1 (en) 2006-05-27 2007-10-04 김연수 Cancer diagnostic kit using DNA methylation
US20080050738A1 (en) * 2006-05-31 2008-02-28 Human Genetic Signatures Pty Ltd. Detection of target nucleic acid
US12332245B2 (en) 2006-07-14 2025-06-17 The Regents Of The University Of California Cancer biomarkers and methods of use thereof
EP2442109A1 (en) 2006-07-14 2012-04-18 The Regents of the University of California Cancer biomarkers and methods of use thereof
EP2442108A1 (en) 2006-07-14 2012-04-18 The Regents of the University of California Cancer biomarkers and methods of use thereof
EP3796002A1 (en) 2006-07-14 2021-03-24 The Regents of The University of California Cancer biomarkers and methods of use thereof
EP2450710A2 (en) 2006-07-14 2012-05-09 The Regents of the University of California Cancer biomarkers and methods of use thereof
US20100143902A1 (en) * 2006-07-21 2010-06-10 Epigenomics Ag Methods and nucleic acids for analyses of cellular proliferative disorders
US20110171637A1 (en) * 2006-07-21 2011-07-14 Reimo Tetzner Methods and nucleic acids for analyses of cellular proliferative disorders
EP2634265A1 (en) 2006-07-21 2013-09-04 Epigenomics AG Methods and nucleic acids related to the gene GLI3 for analyses of cellular proliferative disorders
EP2634264A1 (en) 2006-07-21 2013-09-04 Epigenomics AG Methods and nucleic acids related to the gene PCDHGC3 for analyses of cellular proliferative disorders
WO2008047234A1 (en) 2006-10-18 2008-04-24 Epigenomics Ag A molecule for providing a standard for the quantitative analysis of the methylation status of a nucleic acid
US9850532B2 (en) 2006-11-24 2017-12-26 Epigenomics Ag Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
EP3184649A1 (en) 2006-11-24 2017-06-28 Epigenomics AG Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
EP2258871A1 (en) 2007-01-19 2010-12-08 Epigenomics AG Methods and nucleic acids for analyses of cell proliferative disorders
US20090203011A1 (en) * 2007-01-19 2009-08-13 Epigenomics Ag Methods and nucleic acids for analyses of cell proliferative disorders
WO2008087040A2 (en) 2007-01-19 2008-07-24 Epigenomics Ag Methods and nucleic acids for analyses of cell proliferative disorders
US11827927B2 (en) 2007-02-07 2023-11-28 Illumina Cambridge Limited Preparation of templates for methylation analysis
US12385085B2 (en) 2007-02-07 2025-08-12 Illumina Cambridge Limited Preparation of templates for methylation analysis
US20090148842A1 (en) * 2007-02-07 2009-06-11 Niall Gormley Preparation of templates for methylation analysis
US10954554B2 (en) 2007-02-07 2021-03-23 Illumina Cambridge Limited Preparation of templates for methylation analysis
US9868982B2 (en) 2007-02-07 2018-01-16 Illumina Cambridge Limited Preparation of templates for methylation analysis
US20080213870A1 (en) * 2007-03-01 2008-09-04 Sean Wuxiong Cao Methods for obtaining modified DNA from a biological specimen
US20100092972A1 (en) * 2007-03-16 2010-04-15 Human Genetic Signatures Pty Ltd. Assay for gene expression
US20080254474A1 (en) * 2007-04-12 2008-10-16 University Of Southern California Dna methylation analysis by digital bisulfite genomic sequencing and digital methylight
US9290803B2 (en) 2007-04-12 2016-03-22 University Of Southern California DNA methylation analysis by digital bisulfite genomic sequencing and digital methylight
WO2008140724A1 (en) 2007-05-08 2008-11-20 Schering Corporation Methods of treatment using intravenous formulations comprising temozolomide
EP2409700A1 (en) 2007-05-08 2012-01-25 Schering Corporation Methods of treatment using intravenous formulations comprising temozolomide
US20100105063A1 (en) * 2007-07-02 2010-04-29 Euclid Diagnostics Llc Methods for evaluating the methylation status of a polynucleotide
US8361724B2 (en) 2007-07-02 2013-01-29 Euclid Diagnostics Llc Methods for evaluating the methylation status of a polynucleotide
US8658369B2 (en) 2007-07-02 2014-02-25 Euclid Diagnostics Llc Methods for evaluating the methylation status of a polynucleotide
US20090042290A1 (en) * 2007-08-06 2009-02-12 Christopher Steele Method of modifying a macromolecule without prior extraction from a sample
US20110287416A1 (en) * 2007-09-17 2011-11-24 Oncomethylome Sciences Sa Methylation detection
US9050280B2 (en) * 2007-09-17 2015-06-09 Mdxhealth Sa Methylation detection of MGMT
US20100304386A1 (en) * 2007-11-27 2010-12-02 Human Genetic Signatures Pty Ltd. Enzymes for amplification and copying bisulphite modified nucleic acids
US8685675B2 (en) 2007-11-27 2014-04-01 Human Genetic Signatures Pty. Ltd. Enzymes for amplification and copying bisulphite modified nucleic acids
EP2302069A1 (en) 2007-12-11 2011-03-30 Epigenomics AG Methods and nucleic acids for analyses of cell proliferative disorders
US20110003700A1 (en) * 2007-12-20 2011-01-06 Human Genetic Signatures Pty Ltd. Elimination of contaminants associated with nucleic acid amplification
US11332795B2 (en) 2008-05-14 2022-05-17 Dermtech, Inc. Diagnosis of melanoma and solar lentigo by nucleic acid analysis
US11753687B2 (en) 2008-05-14 2023-09-12 Dermtech, Inc. Diagnosis of melanoma and solar lentigo by nucleic acid analysis
WO2009153667A2 (en) 2008-06-17 2009-12-23 Occure Gmbh Method for the detection of ovarian cancer
US8592185B2 (en) 2008-07-24 2013-11-26 Brookhaven Science Associates, Llc Methods for detection of methyl-CpG dinucleotides
US8361746B2 (en) 2008-07-24 2013-01-29 Brookhaven Science Associates, Llc Methods for detection of methyl-CpG dinucleotides
US8263742B2 (en) 2008-07-24 2012-09-11 Brookhaven Science Associates, Llc Methods for detection of methyl-CpG dinucleotides
US8895268B2 (en) 2008-10-22 2014-11-25 Illumina, Inc. Preservation of information related to genomic DNA methylation
US8541207B2 (en) 2008-10-22 2013-09-24 Illumina, Inc. Preservation of information related to genomic DNA methylation
US10174372B2 (en) 2008-10-22 2019-01-08 Illumina, Inc. Preservation of information related to genomic DNA methylation
US9605311B2 (en) 2008-10-22 2017-03-28 Illumina, Inc. Tandem sequencing top and bottom strands of double stranded nucleic acid using arrays configured for single molecule detection
WO2010048337A2 (en) 2008-10-22 2010-04-29 Illumina, Inc. Preservation of information related to genomic dna methylation
US20110201524A1 (en) * 2008-10-22 2011-08-18 Illumina, Inc. Preservation of information related to genomic dna methylation
US20100136559A1 (en) * 2008-12-02 2010-06-03 Bio-Rad Laboratories, Inc. Chromatin structure detection
US8497066B2 (en) * 2008-12-04 2013-07-30 Rush University Medical Center DNA methylation based test for monitoring efficacy of treatment
US20100143929A1 (en) * 2008-12-04 2010-06-10 Rush University Medical Center Dna methylation based test for monitoring efficacy of treatment
WO2010149782A1 (en) 2009-06-26 2010-12-29 Epigenomics Ag Methods and nucleic acids for analysis of bladder cell proliferative disorders
EP2966181A1 (en) 2009-06-26 2016-01-13 Epigenomics AG Methods and nucleic acids for analysis of bladder cell proliferative disorders
EP2309005A1 (en) 2009-08-03 2011-04-13 Eplgenomics AG Methods for preservation of genomic DNA sequence complexity
WO2011051414A1 (en) 2009-10-28 2011-05-05 Signature Diagnostics Ag Method for the prognosis of ovarian carcinoma
EP2319943A1 (en) 2009-11-05 2011-05-11 Epigenomics AG Methods of predicting therapeutic efficacy of cancer therapy
EP3508854A1 (en) 2010-04-27 2019-07-10 The Regents of The University of California Cancer biomarkers and methods of use thereof
WO2011139721A1 (en) 2010-04-27 2011-11-10 The Regents Of The University Of California Cancer biomarkers and methods of use thereof
US12571798B2 (en) 2010-04-27 2026-03-10 The Regents Of The University Of California Cancer biomarkers and methods of use thereof
US10760126B2 (en) 2010-09-10 2020-09-01 Bio-Rad Laboratories, Inc. Detection of RNA-interacting regions in DNA
US9273347B2 (en) 2010-09-10 2016-03-01 Bio-Rad Laboratories, Inc. Detection of RNA-interacting regions in DNA
US10167509B2 (en) 2011-02-09 2019-01-01 Bio-Rad Laboratories, Inc. Analysis of nucleic acids
US9127312B2 (en) 2011-02-09 2015-09-08 Bio-Rad Laboratories, Inc. Analysis of nucleic acids
US11499181B2 (en) 2011-02-09 2022-11-15 Bio-Rad Laboratories, Inc. Analysis of nucleic acids
US10683551B2 (en) 2011-02-15 2020-06-16 Bio-Rad Laboratories, Inc. Detecting methylation in a subpopulation of genomic DNA
US10435743B2 (en) 2011-05-20 2019-10-08 The Regents Of The University Of California Method to estimate age of individual based on epigenetic markers in biological sample
WO2013007702A1 (en) 2011-07-08 2013-01-17 Epigenomics Ag Methods and nucleic acids for determining the prognosis of a cancer subject
US8728987B2 (en) 2011-08-03 2014-05-20 Bio-Rad Laboratories, Inc. Filtering small nucleic acids using permeabilized cells
US9752177B2 (en) 2011-08-03 2017-09-05 Bio-Rad Laboratories, Inc. Filtering small nucleic acids using permeabilized cells
US9732375B2 (en) 2011-09-07 2017-08-15 Human Genetic Signatures Pty. Ltd. Molecular detection assay using direct treatment with a bisulphite reagent
WO2013096661A1 (en) 2011-12-22 2013-06-27 Illumina, Inc. Methylation biomarkers for ovarian cancer
EP3524693A1 (en) 2012-04-30 2019-08-14 Raindance Technologies, Inc. Digital analyte analysis
WO2013165748A1 (en) 2012-04-30 2013-11-07 Raindance Technologies, Inc Digital analyte analysis
WO2013174432A1 (en) 2012-05-24 2013-11-28 Fundació Institut D'investigació Biomèdica De Bellvitge (Idibell) Method for the identification of the origin of a cancer of unknown primary origin by methylation analysis
WO2014071281A1 (en) 2012-11-02 2014-05-08 The Johns Hopkins University Dna methylation biomarkers of post-partum depression risk
US9427737B2 (en) 2012-12-14 2016-08-30 Bio-Rad Laboratories, Inc. Methods and compositions for using oils for analysis and detection of molecules
WO2014172288A2 (en) 2013-04-19 2014-10-23 Raindance Technologies, Inc. Digital analyte analysis
WO2015006645A1 (en) 2013-07-11 2015-01-15 The Johns Hopkins University A dna methylation and genotype specific biomarker of suicide attempt and/or suicide ideation
US10144958B2 (en) * 2014-02-14 2018-12-04 Base4 Innovation Ltd. Methylation detection method
US9822412B2 (en) 2014-05-09 2017-11-21 Lifecodexx Ag Detection of DNA that originates from a specific cell-type
US9822413B2 (en) 2014-05-09 2017-11-21 Lifecodexx Ag Multiplex detection of DNA that originates from a specific cell-type
US10017818B2 (en) 2014-05-09 2018-07-10 Lifecodexx Ag Multiplex detection of DNA that originates from a specific cell-type
US11773443B2 (en) 2014-05-09 2023-10-03 Eurofins Lifecodexx Gmbh Multiplex detection of DNA that originates from a specific cell-type
EP3521454A1 (en) 2014-05-09 2019-08-07 LifeCodexx AG Detection of dna that originates from a specific cell-type and related methods
US10801067B2 (en) 2014-05-09 2020-10-13 Eurofins Lifecodexx Gmbh Detection of DNA that originates from a specific cell-type and related methods
US11965207B2 (en) 2014-05-09 2024-04-23 Eurofins Lifecodexx Gmbh Detection of DNA that originates from a specific cell-type and related methods
US11072828B2 (en) 2014-10-06 2021-07-27 The Johns Hopkins University DNA methylation and genotype specific biomarker for predicting post-traumatic stress disorder
US12291749B2 (en) 2014-10-06 2025-05-06 The Johns Hopkins University DNA methylation and genotype specific biomarker for predicting post-traumatic stress disorder
US12487242B2 (en) 2014-12-05 2025-12-02 Prelude Corporation DCIS recurrence and invasive breast cancer
US11543411B2 (en) 2014-12-05 2023-01-03 Prelude Corporation DCIS recurrence and invasive breast cancer
US9984201B2 (en) 2015-01-18 2018-05-29 Youhealth Biotech, Limited Method and system for determining cancer status
WO2016115530A1 (en) 2015-01-18 2016-07-21 The Regents Of The University Of California Method and system for determining cancer status
WO2017081047A1 (en) 2015-11-10 2017-05-18 Lifecodexx Ag Detection of foetal chromosomal aneuploidies using dna regions that are differentially methylated between the foetus and the pregnant female
EP3168309A1 (en) 2015-11-10 2017-05-17 Lifecodexx AG Detection of foetal chromosomal aneuploidies using dna regions that are differentially methylated between the foetus and the pregnant female
US11753684B2 (en) 2015-11-10 2023-09-12 Eurofins Lifecodexx Gmbh Detection of fetal chromosomal aneuploidies using DNA regions that are differentially methylated between the fetus and the pregnant female
EP4648053A2 (en) 2015-12-17 2025-11-12 Illumina, Inc. Distinguishing methylation levels in complex biological samples
EP3798321A1 (en) 2015-12-17 2021-03-31 Illumina, Inc. Distinguishing methylation levels in complex biological samples
US11319593B2 (en) 2015-12-17 2022-05-03 Illumina, Inc. Distinguishing methylation levels in complex biological samples
US10202650B2 (en) 2016-05-31 2019-02-12 Youhealth Biotech, Limited Methods for monitoring ELOVL2, KLF14 and PENK gene expression following treatment with vitamin C
US11279978B2 (en) 2016-05-31 2022-03-22 The Regents Of The University Of California Methods for evaluating, monitoring, and modulating aging process
US10093986B2 (en) 2016-07-06 2018-10-09 Youhealth Biotech, Limited Leukemia methylation markers and uses thereof
US11396678B2 (en) 2016-07-06 2022-07-26 The Regent Of The University Of California Breast and ovarian cancer methylation markers and uses thereof
US12359257B2 (en) 2016-07-06 2025-07-15 Helio Health Inc. Liver cancer methylation markers and uses thereof
US10544467B2 (en) 2016-07-06 2020-01-28 Youhealth Oncotech, Limited Solid tumor methylation markers and uses thereof
US12351876B2 (en) 2016-07-06 2025-07-08 Helio Health, Inc. Colon cancer methylation markers and uses thereof
US10829821B2 (en) 2016-07-06 2020-11-10 Youhealth Oncotech, Limited Leukemia methylation markers and uses thereof
WO2018109217A1 (en) 2016-12-16 2018-06-21 Gatc Biotech Ag Epigenetic markers and related methods and means for the detection and management of certain cancers
WO2018109212A1 (en) 2016-12-16 2018-06-21 Gatc Biotech Ag Epigenetic markers and related methods and means for the detection and management of ovarian cancer
US10513739B2 (en) 2017-03-02 2019-12-24 Youhealth Oncotech, Limited Methylation markers for diagnosing hepatocellular carcinoma and lung cancer
US11433075B2 (en) 2017-06-22 2022-09-06 Triact Therapeutics, Inc. Methods of treating glioblastoma
US11628144B2 (en) 2017-09-29 2023-04-18 Triact Therapeutics, Inc. Iniparib formulations and uses thereof
WO2019071161A1 (en) 2017-10-06 2019-04-11 Youhealth Biotech, Limited Methylation markers for diagnosing cancer
WO2019143845A1 (en) 2018-01-17 2019-07-25 The Regents Of The University Of California Phenotypic age and dna methylation based biomarkers for life expectancy and morbidity
US11976332B2 (en) 2018-02-14 2024-05-07 Dermtech, Inc. Gene classifiers and uses thereof in non-melanoma skin cancers
US11821900B2 (en) 2018-09-14 2023-11-21 Prelude Corporation Method of selection for treatment of subjects at risk of invasive breast cancer
WO2020076983A1 (en) 2018-10-10 2020-04-16 The Regents Of The University Of California Dna methylation based biomarkers for life expectancy and morbidity
US12404540B2 (en) 2018-10-17 2025-09-02 The University Of Queensland Epigenetic biomarker and uses therefor
WO2020150705A1 (en) 2019-01-18 2020-07-23 The Regents Of The University Of California Dna methylation measurement for mammals based on conserved loci
US11578373B2 (en) 2019-03-26 2023-02-14 Dermtech, Inc. Gene classifiers and uses thereof in skin cancers
US20230049979A1 (en) * 2020-02-06 2023-02-16 OncoHost Ltd. Machine learning prediction of therapy response
WO2023052640A1 (en) 2021-09-30 2023-04-06 Tivenix Sa A method for diagnosing and predicting progression of neurodegenerative diseases or disorders
WO2023066972A1 (en) 2021-10-19 2023-04-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Dna methylation signature for diagnosing hepatocellular carcinoma
EP4170661A1 (en) 2021-10-19 2023-04-26 Institut National de la Santé et de la Recherche Médicale (INSERM) Methylation profile analysis using smoothing method
WO2023175019A1 (en) 2022-03-15 2023-09-21 Genknowme S.A. Method determining the difference between the biological age and the chronological age of a subject
WO2024044578A1 (en) 2022-08-22 2024-02-29 University Of Virginia Dna methylation biomarkers of premenstrual dysphoric disorder and perimenopausal depression
WO2024059649A1 (en) 2022-09-13 2024-03-21 The Saban Research Institute; Children's Hospital Los Angeles Dna methylation signature of retinoblastoma
WO2024256726A1 (en) 2023-06-15 2024-12-19 Genknowme S.A. Computer implemented method determining a value of allostatic load of a human being
CN119491038A (en) * 2024-11-27 2025-02-21 上海市第十人民医院 A one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy

Also Published As

Publication number Publication date
EP1185695B2 (en) 2016-11-09
CA2372665A1 (en) 2000-11-23
EP1185695A4 (en) 2004-05-19
US8323890B2 (en) 2012-12-04
AU2004229115B2 (en) 2007-08-23
US20070212699A1 (en) 2007-09-13
EP1185695B1 (en) 2006-07-12
US20020086324A1 (en) 2002-07-04
US7112404B2 (en) 2006-09-26
DK1710321T3 (en) 2016-03-07
US20100009365A1 (en) 2010-01-14
WO2000070090A1 (en) 2000-11-23
CA2372665C (en) 2007-07-17
DE60029323T3 (en) 2017-03-30
EP1710321A3 (en) 2007-04-04
AU4712200A (en) 2000-12-05
DE60029323D1 (en) 2006-08-24
ES2267535T5 (en) 2017-05-30
AU2004229115A1 (en) 2004-12-09
EP1710321A2 (en) 2006-10-11
ES2267535T3 (en) 2007-03-16
JP2002543852A (en) 2002-12-24
EP1710321B1 (en) 2015-12-09
JP2007068539A (en) 2007-03-22
DK1185695T3 (en) 2006-11-06
US7553627B2 (en) 2009-06-30
AU775798B2 (en) 2004-08-19
DK1185695T4 (en) 2017-02-20
EP1185695A1 (en) 2002-03-13
JP4044290B2 (en) 2008-02-06
DE60029323T2 (en) 2007-07-05
CY1118000T1 (en) 2017-05-17
ATE332980T2 (en) 2006-08-15
ES2564048T3 (en) 2016-03-17

Similar Documents

Publication Publication Date Title
US6331393B1 (en) Process for high-throughput DNA methylation analysis
US8911937B2 (en) Method for detecting methylation status by using methylation-independent primers
US6251594B1 (en) Cancer diagnostic method based upon DNA methylation differences
US6200756B1 (en) Methods for identifying methylation patterns in a CpG-containing nucleic acid
US7144701B2 (en) High-throughput methods for detecting DNA methylation
WO2002081749A2 (en) Detection of aberrant dna methylation as marker for human cancer
Gao et al. DNA microarray: a high throughput approach for methylation detection
US20100143893A1 (en) Method for detection of cytosine methylation
Rand et al. Bisulphite differential denaturation PCR for analysis of DNA methylation
AU2001297759A1 (en) Detection of aberrant DNA methylation as marker for huiman cancer

Legal Events

Date Code Title Description
AS Assignment

Owner name: SOUTHERN CALIFORNIA, UNIVERSITY OF, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LAIRD, PETER W.;EADS, CINDY A.;DANENBERG, KATHLEEN D.;REEL/FRAME:010525/0631;SIGNING DATES FROM 19991209 TO 20000104

STCF Information on status: patent grant

Free format text: PATENTED CASE

CC Certificate of correction
FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF SOUTHERN CALIFORNIA;REEL/FRAME:021087/0032

Effective date: 20000612

FEPP Fee payment procedure

Free format text: PAT HOLDER NO LONGER CLAIMS SMALL ENTITY STATUS, ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: STOL); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

SULP Surcharge for late payment
FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12