US5866553A - Polynucleotide vaccine for papillomavirus - Google Patents

Polynucleotide vaccine for papillomavirus Download PDF

Info

Publication number
US5866553A
US5866553A US08/750,810 US75081096A US5866553A US 5866553 A US5866553 A US 5866553A US 75081096 A US75081096 A US 75081096A US 5866553 A US5866553 A US 5866553A
Authority
US
United States
Prior art keywords
hpv
dna
gene
vector
crpv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US08/750,810
Inventor
John J. Donnelly
Margaret A. Liu
Douglas Martinez
Donna L. Montgomery
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Merck Sharp and Dohme LLC
Original Assignee
Merck and Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck and Co Inc filed Critical Merck and Co Inc
Priority to US08/750,810 priority Critical patent/US5866553A/en
Assigned to MERCK & CO., INC. reassignment MERCK & CO., INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DONNELLY, JOHN J., LIU, MARGARET A., MARTINEZ, DOUGLAS, MONTGOMERY, DONNA L.
Application granted granted Critical
Publication of US5866553A publication Critical patent/US5866553A/en
Assigned to MERCK SHARP & DOHME CORP. reassignment MERCK SHARP & DOHME CORP. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: MERCK & CO., INC.
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/20011Papillomaviridae
    • C12N2710/20022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • This invention relates to the production and use of a novel pharmaceutical product: a nucleic acid which, when directly introduced into living vertebrate tissue, induces an immune response which specifically recognizes papilloma virus.
  • Papilloma virus (PV) infections occur in a variety of animals, including humans, sheep, dogs, cats, rabbits, monkeys, snakes and cattle.
  • Papilloma viruses infect epithelial cells, generally inducing benign epithelial or fibroepithelial tumors at the site of infection.
  • Papilloma viruses are species specific infective agents; e.g., a human papillomavirus generally does not infect a nonhuman animal.
  • Papilloma viruses may be classified into distinct groups based on the host that they infect.
  • Human papilloma viruses HPV
  • HPV Human papilloma viruses
  • Papilloma virus infections appear to induce type-specific immunogenic responses in that a neutralizing immunity to infection to one type of papilloma virus may not confer immunity against another type of papilloma virus.
  • HPV types 1,2, 3, 4, 7, 10 and 26-29 cause benign warts in both normal and immunocompromised individuals.
  • HPV types 5, 9, 9, 12, 14, 15, 17, 19-25, 36 and 46-50 cause flat lesions in immunocompromised individuals.
  • HPV types 6, 11, 34, 39, 41-44 and 51-55 cause nonmalignant condylomata of the genital tract.
  • HPV types 16 and 18 cause epithelial dysplasia of the genital tract and are associated with the majority of in situ and invasive carcinomas of the cervix, vagina, vulva and anal canal.
  • Neutralization of papilloma virus by antibodies appears to be type-specific and dependent upon conformational epitopes on the surface of the virus.
  • Papilloma viruses are small (50-60 nm), nonenveloped, icosahedral DNA viruses that encode for early and late genes.
  • the open reading frames (ORFs) of the virus genomes are designated E1 to E7 and L1 and L2, where "E” denotes early and “L” denotes late.
  • L1 and L2 encode virus capsid proteins.
  • E1 to E3 and E5 to E7 are associated with functions such as viral replication and transformation.
  • the L1 protein is the major capsid protein and has a molecular weight of 55-60K.
  • L2 protein is a minor capsid protein which has a predicted molecular weight of approximately 55K and an apparent molecular weight of 75-100K as determined by polyacrylamide gel electrophoresis. Electron microscopic and immunologic data suggest that most of the L2 protein is internal to the L1 protein.
  • the L2 proteins are highly conserved among different papilloma viruses, especially the 10 basic amino acids at the C-terminus.
  • the L1 ORF is highly conserved among different papilloma viruses.
  • the L1 and L2 genes have been used to generate recombinant proteins for potential use in the prevention and treatment of papilloma virus infections.
  • Zhou et al. cloned HPV type 16 L1 and L2 genes into a vaccinia virus vector and infected CV-1 mammalian cells with the recombinant vector to produce virus-like particles (VLP).
  • VLP virus-like particles
  • Bacterially-derived recombinant bovine papilloma virus L1 and L2 have been generated. Neutralizing sera to the recombinant bacterial proteins cross-reacted with native virus at low levels, presumably due to differences in the conformations of the native and bacterially-derived proteins.
  • Recombinant baculoviruses expressing HPV16 L1 or HPV16 L2 ORF have been used to infect insect SF9 cells and produce recombinant L1 and L2 proteins.
  • Western blot analyses showed that the baculovirus-derived L1 and L2 proteins reacted with antibody to HPV16.
  • the production of HPV 16 L1 and HPV16 L2 proteins by recombinant strains of Saccharomyces cerevisiae has also been demonstrated.
  • CTLs cytotoxic T-lymphocytes
  • CD8 + CTLs kill virally-infected cells when their T cell receptors recognize viral peptides associated with MHC class I molecules. These peptides are derived from endogenously synthesized viral proteins, regardless of the protein's location or function within the virus. Thus, by recognition of epitopes from conserved viral proteins, CTLs may provide cross-strain protection. Peptides capable of associating with MHC class I for CTL recognition originate from proteins that are present in or pass through the cytoplasm or endoplasmic reticulum. Therefore, in general, exogenous proteins, which enter the endosomal processing pathway (as in the case of antigens presented by MHC class II molecules), are not effective at generating CD8 + CTL responses.
  • Retroviral vectors have restrictions on the size and structure of polypeptides that can be expressed as fusion proteins while maintaining the ability of the recombinant virus to replicate, and the effectiveness of vectors such as vaccinia for subsequent immunizations may be compromised by immune responses against the vectors themselves. Also, viral vectors and modified pathogens have inherent risks that may hinder their use in humans. Furthermore, the selection of peptide epitopes to be presented is dependent upon the structure of an individual's MHC antigens and, therefore, peptide vaccines may have limited effectiveness due to the diversity of MHC haplotypes in outbred populations.
  • Intramuscular inoculation of polynucleotide constructs i.e., DNA plasmids encoding proteins
  • DNA plasmids encoding proteins have been shown to result in the in situ generation of the protein in muscle cells.
  • cDNA plasmids that encode viral proteins
  • antibody responses that provide homologous protection against subsequent challenge can be generated.
  • the use of polynucleotide vaccines (PNVs) to generate antibodies may result in an increased duration of the antibody responses as well as the provision of an antigen that may have the proper post-translational modifications and conformation of the native protein (vs. a recombinant protein).
  • the viral proteins produced in vivo after PNV immunization may assume their native conformation, thereby eliciting the production of virus neutralizing antibody.
  • the generation of CTL responses by this means offers the benefits of cross-strain protection without the use of a live potentially pathogenic vector or attenuated virus.
  • the method is not limited to intramuscular injection.
  • BGH bovine growth hormone
  • a jet injector has been used to transfect skin, muscle, fat, and mammary tissues of living animals.
  • Various methods for introducing nucleic acids were reviewed by Donnelly, Ulmer and Liu (The Immunologist, 2:20, 1994).
  • This invention contemplates a variety of methods for introducing nucleic acids into living tissue to induce expression of proteins.
  • This invention provides methods for introducing viral proteins into the antigen processing pathway to generate virus-specific CTLs and antibodies.
  • this invention provides DNA constructs encoding viral proteins of the human papilloma virus which encode induce specific CTLs and antibodies.
  • the protective efficacy of DNA vaccination against subsequent viral challenge is demonstrated by immunization with non-replicating plasmid DNA encoding one or more of the above mentioned viral proteins. This is advantageous since no infectious agent is involved, no assembly of virus particles is required, and determinant selection is permitted. Furthermore, because the sequence of some of the gene products is conserved among various types of papilloma viruses, protection against subsequent challenge by a different type of papilloma virus that is homologous to or heterologous to the strain from which the cloned gene is obtained is enabled.
  • DNA constructs encoding papilloma virus gene products, capable of being expressed upon direct introduction into animal tissues are novel prophylactic and therapeutic pharmaceuticals which can provide immune protection against infection by papilloma virus.
  • FIG. 1 shows the virus neutralizing antibody response induced in rabbits injected with CRPV L1 DNA, or with a mixture of L1 and L2 DNA (y-axis), and the corresponding ELISA titers induced the same.
  • FIG. 2 Antibody responses of rabbits injected with L1 DNA. ELISA titers against L1 VLP of rabbits given a single immunization with an arbitrarily selected dosage of 1 mg of L1 DNA are shown. Rabbits injected with control DNA did not produce detectable antibodies against L1 VLP.
  • A Normal serum, and immune serum absorbed with native or denatured VLPs as in (15), were tested for virus neutralizing activity. The mean areas of condylomas on 3 challenge sites, measured 7 weeks after challenge, are shown.
  • B Immune serum from a rabbit that had been injected with L1 DNA was serially absorbed three times with native (circles) or denatured (squares) L1 VLP expressed in a recombinant yeast (Saccharomyces cerevisiae) strain.
  • ELISA titer of the absorbed material is plotted as a percentage of the original ELISA titer of unabsorbed serum.
  • FIGS. 4(A-B) ELISA responses in assays for anti-CRPV E2 (A) and CRPV E7 (b) antibodies.
  • the net reaction rate (rate for post dose 4 minus rate for preimmune at the same dilution) in mOD/min is shown for each individual rabbit.
  • FIG. 5 Protective responses obtained in rabbits vaccinated with L1 DNA after challenge with CRPV.
  • DNA constructs encoding papilloma virus gene products, capable of being expressed upon direct introduction into animal tissues are novel prophylactic and therapeutic pharmaceuticals which can provide immune protection against infection by papilloma virus.
  • This invention provides polynucleotides which, when directly introduced into a vertebrate animal such as cottontail rabbits and humans, induce expression of encoded peptides within the tissues of the animal.
  • the peptide is one that does not occur in that animal except during infections, such as proteins associated with papilloma virus (PV)
  • the immune system of the animal is activated to launch a protective response.
  • these exogenous proteins are produced by cells of the host animal, they are processed and presented by the major histocompatibility complex (MHC). This recognition is analogous to that which occurs upon actual infection with the related organism.
  • MHC major histocompatibility complex
  • a polynucleotide is a nucleic acid that contains essential regulatory elements such that upon introduction into a living vertebrate cell, is able to direct cellular machinery to produce translation products encoded by the genes comprising the polynucleotide.
  • essential regulatory elements such that upon introduction into a living vertebrate cell, is able to direct cellular machinery to produce translation products encoded by the genes comprising the polynucleotide.
  • transcriptional promoters, terminators, carrier vectors or specific gene sequences may be used.
  • This invention provides nucleic acids which when introduced into animal tissues in vivo induces the expression of the papilloma virus gene product.
  • injection of DNA constructs of this invention into the muscle of rabbit induces expression of the encoded gene products and elicits virus neutralizing antibodies.
  • CRPV cottontail rabbit papilloma virus
  • animals injected with the polynucleotide vaccine exhibit much reduced lesions.
  • this invention discloses a vaccine useful in humans to prevent papilloma virus infections.
  • DNA constructs encoding papilloma viral proteins elicit protective immune responses in animals.
  • immune responses in animals have included virus neutralizing antibody and protection from viral challenge in rabbits with homologous types of papilloma virus.
  • the vaccine product will consist of separate DNA plasmids encoding, for example, the L1, L2, E2, E4 proteins of papilloma virus, either alone or in combination.
  • Anticipated advantages over other vaccines include but are not limited to increased breadth of protection due to CTL responses, increased breadth of antibody, and increased duration of protection.
  • the L1 or L2 or L1+L2 from HPV type 6a, 6b, 11, 16 or 18 protein sequence, obtained from clinical isolates is cloned into an expression vector.
  • the vector contains a promoter for RNA polymerase transcription, and a transcriptional terminator at the end of the HPV coding sequence. Examples of promoters include but are not limited to CMV. Examples of transcriptional terminators include but are not limited to BGH.
  • an antibiotic resistance marker expressed in E. coli is also preferably included in the expression vector. Neomycin resistance genes or any other pharmaceutically acceptable antibiotic resistance marker may be used.
  • the vector to contain an origin of replication and be of high copy number.
  • a variety of commercially available prokaryotic cloning vectors provide these benefits. It is desirable to remove non-essential DNA sequences.
  • this invention provides expression vectors encoding a PV protein as an immunogen.
  • the invention offers a means to induce cross-type protective immunity without the need for self-replicating agents.
  • immunization with DNA offers a number of other advantages.
  • this approach to vaccination should be applicable to tumors as well as infectious agents, since the CD8+CTL response is important for immunological intervention in both pathophysiological processes. Therefore, eliciting an immune response against a protein crucial to the transformation process may be an effective means of cancer protection or immunotherapy.
  • the generation of antibodies against expressed proteins after injection of DNA encoding a viral protein suggests that this technology provides a facile and effective means of making antibody-inducing vaccines.
  • DNA constructs compares favorably with that of traditional protein purification, which facilitates the generation of combination vaccines.
  • multiple constructs for example constructs encoding L1 and L2 proteins of one or more types of HPV, may be prepared, mixed and co-administered.
  • protein expression may be maintained for a period of time following DNA injection, the persistence of B- and T-cell memory may be enhanced, thereby engendering long-lived humoral and cell-mediated immunity.
  • HPV vaccines emphasize the need for development of more effective means for prevention of infection and amelioration of disease.
  • Generation of an improved CTL response against a conserved protein may provide significant long-term, cross-reactive immunity.
  • a range of doses is compared for immunogenicity in order to optimize concentrations for use. It is predictable that dosages of 10, 50, 100, and 200 ⁇ g of DNA are efficacious in man.
  • Human efficacy is shown in volunteers who receive HPV DNA vaccine.
  • the composition, dosage and administration regimens for the vaccine are based on the foregoing studies.
  • Clinical efficacy is shown by infection rate, illness scores, and duration of illness. These clinical findings are compared with laboratory evaluation of host immune response and viral detection in order to determine surrogate markers which correlate with protection.
  • the amount of expressible DNA to be introduced to a vaccine recipient will depend on the strength of the transcriptional and translational promoters used in the DNA construct, and on the immunogenicity of the expressed gene product.
  • an immunologically or prophylactically effective dose of about 1 ⁇ g to 1 mg. and preferably about 10 ⁇ g to 300 ⁇ g is administered directly into muscle tissue.
  • Subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, or inhalation delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided.
  • the polynucleotide may be naked, that is, unassociated with any proteins, adjuvants or other agents which affect the recipient's immune system. In this case, it is desirable for the polynucleotide to be in a physiologically acceptable solution, such as, but not limited to, sterile saline or sterile buffered saline.
  • the polynucleotide may be associated with liposomes, such as lecithin liposomes or other liposomes known in the art, as a DNA-liposome mixture, or the DNA may be associated with an adjuvant known in the art to boost immune responses, such as a protein or other carrier.
  • Agents which assist in the cellular uptake of DNA such as, but not limited to, calcium ions, viral proteins and other transfection facilitating agents may also be used to advantage. These agents are generally referred to as transfection facilitating agents and as pharmaceutically acceptable carriers.
  • Another advantage of polynucleotide immunization is the potential for the immunogen to enter the MHC class I pathway and evoke a cytotoxic T cell response. Since polynucleotide immunization may elicit both humoral and cell-mediated responses, another advantage may be that it provides a relatively simple method to survey a large number of viral genes and viral types for the vaccine potential. Immunization by injection of polynucleotides also allows the assembly of multicomponent vaccines by mixing individual components.
  • the term gene refers to a segment of nucleic acid which encodes a discrete polypeptide.
  • pharmaceutical, and vaccine are used interchangeably to indicate compositions useful for inducing immune responses.
  • construct, and plasmid are used interchangeably.
  • vector is used to indicate a DNA into which genes may be cloned for use according to the method of this invention.
  • one embodiment of this invention is a method for using PV genes to induce immune responses in vivo, in a vertebrate such as a mammal, including a human, which comprises:
  • Another embodiment of this invention may be a method for protecting against heterologous types of PV. This is accomplished by administering an immunologically effective amount of a nucleic acid which encodes a conserved PV epitope.
  • the polynucleotide vaccine encodes another PV protein, such as L1 or L2 or E1 through E7 or combinations thereof.
  • the DNA construct encodes proteins of HPV types 6a, 6b, 11, 16, or 18, wherein the DNA construct is capable of being expressed upon introduction into animal tissues in vivo and inducing an immune response against the expressed product of the encoded HPV gene. Combinations comprising such constructs with polynucleotides encoding other antigens, unrelated to HPV, are contemplated by the instant invention.
  • HPV gene encoding DNA constructs examples include:
  • the DNA construct encodes CRPV L1 protein, wherein the DNA construct is capable of being expressed upon introduction into animal tissues in vivo and inducing an immune response against the expressed product of the encoded CRPV gene. Combinations comprising such constructs with polynucleotides encoding other antigens, unrelated to CRPV, are contemplated by the instant invention.
  • CRPV gene encoding DNA constructs include:
  • compositions comprising the DNA may be formulated according to known methods such as by the admixture of a pharmaceutically acceptable carrier. Examples of such carriers and methods of formulation may be found in Remington's Pharmaceutical Sciences. To form a pharmaceutically acceptable composition suitable for effective administration, such compositions will contain an effective amount of the HPV DNA.
  • compositions of the invention are administered to an individual in amounts sufficient to treat or diagnose PV infections.
  • the effective amount may vary according to a variety of factors such as the individual's condition, weight, sex and age. Other factors include the mode of administration.
  • the compositions will be administered in dosages ranging from about 1 microgram to about 1 milligram.
  • compositions may be provided to the individual by a variety of routes such as subcutaneous, topical, oral and intramuscular.
  • the vaccines of the invention comprise HPV DNA that encode recombinant proteins of HPV that contain the antigenic determinants that induce the formation of neutralizing antibodies in the human host.
  • Such vaccines are also safe enough to be administered without danger of clinical infection; do not have toxic side effects; can be administered by an effective route; are stable; and are compatible with vaccine carriers.
  • the vaccines may be administered by a variety of routes, such as orally, parenterally, subcutaneously or intramuscularly.
  • the dosage administered may vary with the condition, sex, weight, and age of the individual; the route of administration; and the type PV of the vaccine.
  • the vaccine may be used in dosage forms such as capsules, suspensions, elixirs, or liquid solutions.
  • the vaccine may be formulated with an immunologically acceptable carrier.
  • the vaccines are administered in prophylactically or therapeutically effective amounts, that is, in amounts sufficient to generate a immunologically protective response.
  • the effective amount may vary according to the type of PV.
  • the vaccine may be administered in single or multiple doses.
  • the methods of the present invention make possible the formulation of monovalent and multivalent vaccines for preventing PV infection.
  • either monovalent or multivalent PV vaccines may be made.
  • a monovalent HPV type 16 vaccine may be made by formulating DNA encoding HPV 16 L1 protein or L2 protein or L1+L2 proteins.
  • a multivalent HPV vaccine may be formulated by mixing DNA encoding HPV L1 or L2 or L1+L2 proteins from different HPV types.
  • the DNA may be used to generate antibodies.
  • antibody as used herein includes both polyclonal and monoclonal antibodies, as well as fragments thereof, such as, Fv, Fab and F(ab)2 fragments that are capable of binding antigen or hapten.
  • the PV DNA and antibodies of the present invention may be used to serotype HPV or CRPV infection and for HPV screening.
  • the HPV and CRPV DNA and antibodies lend themselves to the formulation of kits suitable for the detection and serotyping of HPV or CRPV.
  • a kit would comprise a compartmentalized carrier suitable to hold in close confinement at least one container.
  • the carrier would further comprise reagents such as HPV DNA or anti-HPV antibodies suitable for detecting a variety of HPV types.
  • the carrier may also contain means for detection such as labeled antigen or enzyme substrates or the like.
  • V1 The expression vector V1 was constructed from pCMVIE-AKI-DHFR Y. Whang et al., J. Virol. 61, 1796 (1987)!. The AKI and DHFR genes were removed by cutting the vector with EcoR I and self-ligating. This vector does not contain intron A in the CMV promoter, so it was added as a PCR fragment that had a deleted internal Sac I site at 1855 as numbered in B. S. Chapman et al., Nuc. Acids Res. 19, 3979 (1991)!. The template used for the PCR reactions was pCMVintA-Lux, made by ligating the Hind III and Nhe I fragment from pCMV6a120 see B. S.
  • the primers that spanned intron A are: ##STR1##
  • the primers used to remove the Sac I site are: ##STR2##
  • the PCR fragment was cut with Sac I and Bgl II and inserted into the vector which had been cut with the same enzymes.
  • V1J Our purpose in creating V1J was to remove the promoter and transcription termination elements from our vector, V1, in order to place them within a more defined context, create a more compact vector, and to improve plasmid purification yields.
  • V1J is derived from vectors V1 and pUC19, a commercially available plasmid.
  • V1 was digested with SspI and EcoRI restriction enzymes producing two fragments of DNA. The smaller of these fragments, containing the CMVintA promoter and Bovine Growth Hormone (BGH) transcription termination elements which control the expression of heterologous genes was purified from an agarose electrophoresis gel. The ends of this DNA fragment were then "blunted” using the T4 DNA polymerase enzyme in order to facilitate its ligation to another "blunt-ended" DNA fragment.
  • BGH Bovine Growth Hormone
  • pUC19 was chosen to provide the "backbone" of the expression vector. It is known to produce high yields of plasmid, is well-characterized by sequence and function, and is of minimum size. We removed the entire lac operon from this vector, which was unnecessary for our purposes and may be detrimental to plasmid yields and heterologous gene expression, by partial digestion with the HaeII restriction enzyme. The remaining plasmid was purified from an agarose electrophoresis gel, blunt-ended with the T4 DNA polymerase, treated with calf intestinal alkaline phosphatase, and ligated to the CMVintA/BGH element described above. Plasmids exhibiting either of two possible orientations of the promoter elements within the pUC backbone were obtained. One of these plasmids gave much higher yields of DNA in E. coli and was designated V 1J. This vector's structure was verified by sequence analysis of the junction regions and was subsequently demonstrated to give comparable or higher expression of heterologous genes compared with V1.
  • the amp r gene from the pUC backbone of V1J was removed by digestion with SspI and Eam1105I restriction enzymes.
  • the remaining plasmid was purified by agarose gel electrophoresis, blunt-ended with T4 DNA polymerase, and then treated with calf intestinal alkaline phosphatase.
  • the commercially available kan r gene derived from transposon 903 and contained within the pUC4K plasmid, was excised using the PstI restriction enzyme, purified by agarose gel electrophoresis, and blunt-ended with T4 DNA polymerase. This fragment was ligated with the V1J backbone and plasmids with the kan r gene in either orientation were derived which were designated as V1Jneo #'s 1 and 3. Each of these plasmids was confirmed by restriction enzyme digestion analysis, DNA sequencing of the junction regions, and was shown to produce similar quantities of plasmid as V1J. Expression of heterologous gene products was also comparable to V1J for these V1Jneo vectors. We arbitrarily selected V1Jneo#3, referred to as V1Jneo hereafter, which contains the kan r gene in the same orientation as the amp r gene in V1J as the expression construct.
  • V1Jneo An Sfi I site was added to V1Jneo to facilitate integration studies.
  • a commercially available 13 base pair Sfi I linker (New England BioLabs) was added at the Kpn I site within the BGH sequence of the vector.
  • V1Jneo was linearized with Kpn I, gel purified, blunted by T4 DNA polymerase, and ligated to the blunt Sfi I linker. Clonal isolates were chosen by restriction mapping and verified by sequencing through the linker.
  • the new vector was designated V1Jns. Expression of heterologous genes in V1Jns (with Sfi I) was comparable to expression of the same genes in V1Jneo (with Kpn I).
  • CRPV-pLAII The source of the CRPV DNA for all cloned genes is CRPV-pLAII. This is the entire CRPV genome cloned into pBR322 at the Sal I site (Nasseri, M., Meyers, C. and Wettstein, F. O. (1989) Genetic analysis of CRPV pathogenesis: The L1 open reading frame is dispensable for cellular transformation but is required for papilloma formation, Virology 170, 321-325).
  • V1Jns-L1 The L1 coding sequence was generated by PCR, using the CRPV-pLAII DNA as template.
  • the PCR primers were designed to contain Bam HI sites for cleavage after the PCR fragment was gel purified.
  • the primers used to generate the L1 coding region were: ##STR3##
  • the PCR fragment was gel purified, cut with Bam HI and ligated to V1Jns cut with Bgl II.
  • V1Jns-L2 The L2 coding region was generated by PCR.
  • the vector CRPV-pLAII has the L2 gene disrupted by the Sal I site used in inserting CRPV into pBR322. Therefore, a template for PCR was generated by cutting CRPV-pLAII with SalI and ligating the CRPV DNA into circular form at the SAl I site. This ligated CRPV DNA was used as the template for PCR.
  • the PCR primers were designed to contain Bam HI sites for cleavage after the PCR fragment was gel purified.
  • the primers used to generate the L2 coding region were: ##STR4##
  • V1Jns-E2 The E2 coding region is generated by PCR, using the CRPV-pLAII DNA as template.
  • the PCR primers are designed to contain Bgl II sites for cleavage after the PCR fragment is gel purified.
  • the primers used to generate the E2 coding region are: ##STR5##
  • V1Jns-E4 The E4 coding region is generated by PCR, using the CRPV-pLAII DNA as template.
  • the PCR primers are designed to contain Bgl II sites for cleavage after the PCR fragment is gel purified.
  • the primers used to generate the E4 coding region are: ##STR6##
  • V1Jns-E7 The E7 coding region was generated by PCR, using the CRPV-pLAII as template in one case and purified DNA from Kreider's CRPV strain in another case. The same PCR primers were used for both templates. The PCR primers are designed to contain Bgl II sites for cleavage after the PCR fragment was gel purified.
  • the primers used to generate the E7 coding region were: ##STR7##
  • pGEX-2T-E2 The E2 coding region was generated by PCR as described for V1Jns-E2. The fragment was cloned into pGEX-2T into the Bam HI site to generate an in-frame fusion to glutathione S-transferase (GST). This construct is used to generate protein in E. coli.
  • pGEX-2T-E4 The E4 coding region was generated by PCR as described for V1Jns-E4. The fragment was cloned into pGEX-2T into the Barn HI site to generate an in-frame fusion to glutathione S-transferase (GST). This construct is used to generate protein in E. coli.
  • pGEX-2T-E7 The E7 coding region was generated by PCR as described for V1Jns-E7. The fragment was cloned into pGEX-2T into the Bam HI site to generate an in-frame fusion to glutathione S-transferase (GST). This construct is used to generate protein in E. coli.
  • V1J constructs were grown overnight to saturation.
  • Cells were harvested and lysed by a modification of an alkaline SDS procedure (Sambrook, J., Fritsch, E. F., And Maniatis, T., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y., ed.2 (1989).
  • the modification consisted of increasing the volumes three-fold for cell lysis and DNA extraction.
  • DNA was purified by double banding on CsCl-EtBr gradients. The ethidium bromide was removed by 1-butanol extraction. The resulting DNA was extracted with phenol/chloroform and precipitated with ethanol.
  • DNA was resuspended in TE (10 mM Tris, 1 mM EDTA), pH 8 for transfections and in 0.9% NaCl for injection into mice. Concentration and purity of each DNA preparation was determined by OD 260/280 readings. The 260/280 ratios were ⁇ 1.8.
  • the inoculum was divided equally among six intramuscular sites on both hind legs, both forelegs, and the lower back.
  • the rabbits were bled and given a second injection of the same DNA in the same manner.
  • the animals were bled again.
  • Sera were tested for virus neutralizing antibody by mixing tenfold serial dilutions of immune serum with a 1:3 dilution of CRPV stock virus (Kreider strain). Dilutions were prepared in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 1% bovine serum albumin (BSA). CRPV stock virus (purchased from Dr. J. Kreider, Hershey, Pa.) was prepared from skin fragments obtained from wild cottontail rabbits, which were infected with CRPV and implanted under the renal capsules of athymic mice. The resulting condylomas were homogenized and clarified by centrifugation to yield a stock virus preparation.
  • DMEM Dulbecco's Modified Eagle's Medium
  • BSA bovine serum albumin
  • the sera from rabbits that had been injected with L1 DNA also were tested for antibody by ELISA.
  • Polystyrene ELISA plates were coated overnight at 4° C. with 1 ⁇ g/well of semipurified, recombinant yeast-derived CRPV L1 protein.
  • the recombinant L1 was prepared in S. cerevisiae and purified as described by Kirnbauer et al. (Proc. Nat. Acad. Sci. U.S.A. 89:12180-4, 1992) with minor modifications. Diluted sera were added and incubated for 1 hour at room temperature (with shaking on an orbital shaker).
  • FIG. 1 shows that 12/13 sera that were positive for neutralizing activity (log titer ⁇ 1, i.e., positive with undiluted serum) also were positive for ELISA antibody (ELISA titer ⁇ 100).
  • ELISA titer ⁇ 100 Four of the 4 sera that were negative for neutralizing antibody had ELISA titers ⁇ 350. All of the sera from rabbits that received either L2 DNA alone or the V1J control vector had ELISA titers of less than 100.
  • the rabbits received a second injection of the same DNA.
  • the rabbits were challenged with CRPV.
  • the CRPV challenge was performed by applying 50 ⁇ l of two dilutions of virus stock (diluted 1:2 or 1:12 with DMEM plus 1% BSA) to triplicate 1 cm 2 sites of shaved, scarified skin on the back of each rabbit.
  • Sera taken at the time of challenge from animals injected with L1 DNA or L1+L2 DNA contained antibody to L1 by ELISA and virus neutralizing antibody as described above. The animals were observed for formation of warts at 3, 6 and 10 weeks following challenge. Of the rabbits that did not receive L1 DNA, 51 of 54 sites challenged with CRPV developed warts, while on animals that received L1 DNA, 2 of 60 sites developed warts. One of the two warts that was observed on a rabbit immunized with L1 DNA regressed within 3 weeks after its appearance. Table 1 shows the distribution of warts on rabbits after CRPV challenge. Prophylactic immunization with L1 DNA protected rabbits from the development of warts upon infection with virulent CRPV.
  • Groups of 4 NZW rabbits were injected intramuscularly with 1 mg of V1J-E2 or V1J-E7 DNA per immunization. Four immunizations were given at 0, 4, 9 and 20 weeks and were bled at 22 weeks. Antibodies were used as surrogate markers for expression of the encoded proteins. Serum antibodies were assayed using ELISA plates (NUNC Maxisorp) coated with 1 ⁇ g per well of GST-E2 or GST-E7 fusion protein purified from E. coli that had been transformed with a pGEX expression vector encoding CRPV E2 or E7 and induced with IPTG. The ELISA assay was performed as described in Example 3.
  • the net reaction rated (post dose 4 minus preimmune) in mOD/min are shown in FIG. 4. Net rates>10 mOD/min are considered positive; specimens with high antibody titers may have low net reaction rates at the lowest dilution due to oversaturation of the detection system. Thus the encoded E2 and E7 proteins were expressed and recognized by the recipient immune system.

Abstract

DNA constructs encoding papilloma virus gene products, capable of being expressed upon direct introduction into animal tissues, are novel prophylactic pharmaceuticals which can provide immune protection against infection by papilloma virus.

Description

CROSS-RELATED TO OTHER APPLICATION
This is a continuation-in-part of U.S. Ser. No. 08/268,424 filed Jun. 30, 1994, now abandoned.
FIELD OF THE INVENTION
This invention relates to the production and use of a novel pharmaceutical product: a nucleic acid which, when directly introduced into living vertebrate tissue, induces an immune response which specifically recognizes papilloma virus.
BACKGROUND OF THE INVENTION
Papilloma virus (PV) infections occur in a variety of animals, including humans, sheep, dogs, cats, rabbits, monkeys, snakes and cattle. Papilloma viruses infect epithelial cells, generally inducing benign epithelial or fibroepithelial tumors at the site of infection. Papilloma viruses are species specific infective agents; e.g., a human papillomavirus generally does not infect a nonhuman animal.
Papilloma viruses may be classified into distinct groups based on the host that they infect. Human papilloma viruses (HPV) are further classified into more than 60 types based on DNA sequence homology (for a review, see Papilloma Viruses and Human Cancer, H. Pfister (ed.), CRC Press, Inc., 1990). Papilloma virus infections appear to induce type-specific immunogenic responses in that a neutralizing immunity to infection to one type of papilloma virus may not confer immunity against another type of papilloma virus.
In humans, different HPV types cause distinct diseases. HPV types 1,2, 3, 4, 7, 10 and 26-29 cause benign warts in both normal and immunocompromised individuals. HPV types 5, 9, 9, 12, 14, 15, 17, 19-25, 36 and 46-50 cause flat lesions in immunocompromised individuals. HPV types 6, 11, 34, 39, 41-44 and 51-55 cause nonmalignant condylomata of the genital tract. HPV types 16 and 18 cause epithelial dysplasia of the genital tract and are associated with the majority of in situ and invasive carcinomas of the cervix, vagina, vulva and anal canal.
Immunological studies in animal systems have shown that the production of neutralizing antibodies to papilloma virus antigens prevents infection with the homologous virus. The development of effective human papilloma virus vaccines has been slowed by the inability to cultivate papilloma viruses in vitro. The development of an effective HPV vaccine has been particularly slowed by the absence of a suitable animal host for the direct study of HPV.
Neutralization of papilloma virus by antibodies appears to be type-specific and dependent upon conformational epitopes on the surface of the virus.
Papilloma viruses are small (50-60 nm), nonenveloped, icosahedral DNA viruses that encode for early and late genes. The open reading frames (ORFs) of the virus genomes are designated E1 to E7 and L1 and L2, where "E" denotes early and "L" denotes late. L1 and L2 encode virus capsid proteins. E1 to E3 and E5 to E7 are associated with functions such as viral replication and transformation.
The L1 protein is the major capsid protein and has a molecular weight of 55-60K. L2 protein is a minor capsid protein which has a predicted molecular weight of approximately 55K and an apparent molecular weight of 75-100K as determined by polyacrylamide gel electrophoresis. Electron microscopic and immunologic data suggest that most of the L2 protein is internal to the L1 protein. The L2 proteins are highly conserved among different papilloma viruses, especially the 10 basic amino acids at the C-terminus. The L1 ORF is highly conserved among different papilloma viruses.
The L1 and L2 genes have been used to generate recombinant proteins for potential use in the prevention and treatment of papilloma virus infections. Zhou et al. cloned HPV type 16 L1 and L2 genes into a vaccinia virus vector and infected CV-1 mammalian cells with the recombinant vector to produce virus-like particles (VLP). These studies were interpreted as establishing that the expression of both HPV type 16 L1 and L2 proteins in epithelial cells is necessary and sufficient to allow assembly of VLP. The expression of L1 protein alone or L2 protein alone or double infection of cells with single recombinant vaccinia virus vectors containing L1 and L2 genes did not produce particles.
Bacterially-derived recombinant bovine papilloma virus L1 and L2 have been generated. Neutralizing sera to the recombinant bacterial proteins cross-reacted with native virus at low levels, presumably due to differences in the conformations of the native and bacterially-derived proteins.
Recombinant baculoviruses expressing HPV16 L1 or HPV16 L2 ORF have been used to infect insect SF9 cells and produce recombinant L1 and L2 proteins. Western blot analyses showed that the baculovirus-derived L1 and L2 proteins reacted with antibody to HPV16. The production of HPV 16 L1 and HPV16 L2 proteins by recombinant strains of Saccharomyces cerevisiae has also been demonstrated.
Since cytotoxic T-lymphocytes (CTLs) in both mice and humans are capable of recognizing epitopes derived from conserved internal viral proteins and are thought to be important in the immune response against viruses, efforts have been directed towards the development of CTL vaccines capable of providing heterologous protection against different viral strains.
It is known that CD8+ CTLs kill virally-infected cells when their T cell receptors recognize viral peptides associated with MHC class I molecules. These peptides are derived from endogenously synthesized viral proteins, regardless of the protein's location or function within the virus. Thus, by recognition of epitopes from conserved viral proteins, CTLs may provide cross-strain protection. Peptides capable of associating with MHC class I for CTL recognition originate from proteins that are present in or pass through the cytoplasm or endoplasmic reticulum. Therefore, in general, exogenous proteins, which enter the endosomal processing pathway (as in the case of antigens presented by MHC class II molecules), are not effective at generating CD8+ CTL responses.
Efforts to generate CTL responses have included the use of replicating vectors to produce the protein antigen within the cell or have focused upon the introduction of peptides into the cytosol. Both of these approaches have limitations that may reduce their utility as vaccines. Retroviral vectors have restrictions on the size and structure of polypeptides that can be expressed as fusion proteins while maintaining the ability of the recombinant virus to replicate, and the effectiveness of vectors such as vaccinia for subsequent immunizations may be compromised by immune responses against the vectors themselves. Also, viral vectors and modified pathogens have inherent risks that may hinder their use in humans. Furthermore, the selection of peptide epitopes to be presented is dependent upon the structure of an individual's MHC antigens and, therefore, peptide vaccines may have limited effectiveness due to the diversity of MHC haplotypes in outbred populations.
Intramuscular inoculation of polynucleotide constructs. i.e., DNA plasmids encoding proteins, have been shown to result in the in situ generation of the protein in muscle cells. By using cDNA plasmids that encode viral proteins, antibody responses that provide homologous protection against subsequent challenge can be generated. The use of polynucleotide vaccines (PNVs) to generate antibodies may result in an increased duration of the antibody responses as well as the provision of an antigen that may have the proper post-translational modifications and conformation of the native protein (vs. a recombinant protein). The viral proteins produced in vivo after PNV immunization may assume their native conformation, thereby eliciting the production of virus neutralizing antibody. The generation of CTL responses by this means offers the benefits of cross-strain protection without the use of a live potentially pathogenic vector or attenuated virus.
Benvenisty et al. reported that CaCl2 precipitated DNA introduced into mice intraperitoneally, intravenously or intramuscularly could be expressed. More recently, intramuscular (i.m.) injection of DNA expression vectors in mice was reported to result in the uptake of DNA by the muscle cells and expression of the protein encoded by the DNA (J. A. Wolff et al., 1990; G. Ascadi et al., 1991). The injected plasmids were shown to be maintained extrachromosomally and did not replicate. Subsequently, persistent expression after i.m. injection in skeletal muscle of rats, fish and primates, and cardiac muscle of rats has been reported. The technique of using nucleic acids as immunogenic agents was reported in WO90/11092 (4 Oct. 1990), in which naked polynucleotides were used to vaccinate vertebrates.
The method is not limited to intramuscular injection. For example, the introduction of gold microprojectiles coated with DNA encoding bovine growth hormone (BGH) into the skin of mice resulted in production of anti-BGH antibodies in the mice. A jet injector has been used to transfect skin, muscle, fat, and mammary tissues of living animals. Various methods for introducing nucleic acids were reviewed by Donnelly, Ulmer and Liu (The Immunologist, 2:20, 1994).
This invention contemplates a variety of methods for introducing nucleic acids into living tissue to induce expression of proteins. This invention provides methods for introducing viral proteins into the antigen processing pathway to generate virus-specific CTLs and antibodies. Thus, the need for specific therapeutic agents capable of eliciting desired prophylactic immune responses against viral pathogens is met for papilloma virus by this invention. Therefore, this invention provides DNA constructs encoding viral proteins of the human papilloma virus which encode induce specific CTLs and antibodies.
The protective efficacy of DNA vaccination against subsequent viral challenge is demonstrated by immunization with non-replicating plasmid DNA encoding one or more of the above mentioned viral proteins. This is advantageous since no infectious agent is involved, no assembly of virus particles is required, and determinant selection is permitted. Furthermore, because the sequence of some of the gene products is conserved among various types of papilloma viruses, protection against subsequent challenge by a different type of papilloma virus that is homologous to or heterologous to the strain from which the cloned gene is obtained is enabled.
SUMMARY OF THE INVENTION
DNA constructs encoding papilloma virus gene products, capable of being expressed upon direct introduction into animal tissues are novel prophylactic and therapeutic pharmaceuticals which can provide immune protection against infection by papilloma virus.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the virus neutralizing antibody response induced in rabbits injected with CRPV L1 DNA, or with a mixture of L1 and L2 DNA (y-axis), and the corresponding ELISA titers induced the same.
FIG. 2. Antibody responses of rabbits injected with L1 DNA. ELISA titers against L1 VLP of rabbits given a single immunization with an arbitrarily selected dosage of 1 mg of L1 DNA are shown. Rabbits injected with control DNA did not produce detectable antibodies against L1 VLP.
FIGS. 3(A-B). Effect of absorption with L1 VLP on antiserum obtained by immunization with L1 DNA. A, Normal serum, and immune serum absorbed with native or denatured VLPs as in (15), were tested for virus neutralizing activity. The mean areas of condylomas on 3 challenge sites, measured 7 weeks after challenge, are shown. B, Immune serum from a rabbit that had been injected with L1 DNA was serially absorbed three times with native (circles) or denatured (squares) L1 VLP expressed in a recombinant yeast (Saccharomyces cerevisiae) strain. After each serial absorption, aliquots of serum then were assayed for antibody activity against baculovirus-derived L1 VLP by ELISA. The ELISA titer of the absorbed material is plotted as a percentage of the original ELISA titer of unabsorbed serum.
FIGS. 4(A-B). ELISA responses in assays for anti-CRPV E2 (A) and CRPV E7 (b) antibodies. The net reaction rate (rate for post dose 4 minus rate for preimmune at the same dilution) in mOD/min is shown for each individual rabbit.
FIG. 5. Protective responses obtained in rabbits vaccinated with L1 DNA after challenge with CRPV.
DETAILED DESCRIPTION OF THE INVENTION
DNA constructs encoding papilloma virus gene products, capable of being expressed upon direct introduction into animal tissues are novel prophylactic and therapeutic pharmaceuticals which can provide immune protection against infection by papilloma virus.
This invention provides polynucleotides which, when directly introduced into a vertebrate animal such as cottontail rabbits and humans, induce expression of encoded peptides within the tissues of the animal. Where the peptide is one that does not occur in that animal except during infections, such as proteins associated with papilloma virus (PV), the immune system of the animal is activated to launch a protective response. Because these exogenous proteins are produced by cells of the host animal, they are processed and presented by the major histocompatibility complex (MHC). This recognition is analogous to that which occurs upon actual infection with the related organism. The result, as shown herein, is induction of immune responses which may protect against virulent infection.
As used herein, a polynucleotide is a nucleic acid that contains essential regulatory elements such that upon introduction into a living vertebrate cell, is able to direct cellular machinery to produce translation products encoded by the genes comprising the polynucleotide. There are many embodiments of the instant invention which those skilled in the art can appreciate from the specification. For example, different transcriptional promoters, terminators, carrier vectors or specific gene sequences may be used.
This invention provides nucleic acids which when introduced into animal tissues in vivo induces the expression of the papilloma virus gene product. Thus, for example, injection of DNA constructs of this invention into the muscle of rabbit induces expression of the encoded gene products and elicits virus neutralizing antibodies. Upon subsequent challenge with cottontail rabbit papilloma virus (CRPV), using doses which cause lesions on all control rabbits, animals injected with the polynucleotide vaccine exhibit much reduced lesions. Thus, this invention discloses a vaccine useful in humans to prevent papilloma virus infections.
DNA constructs encoding papilloma viral proteins elicit protective immune responses in animals. As will be described in more detail below, immune responses in animals have included virus neutralizing antibody and protection from viral challenge in rabbits with homologous types of papilloma virus.
In one embodiment, the vaccine product will consist of separate DNA plasmids encoding, for example, the L1, L2, E2, E4 proteins of papilloma virus, either alone or in combination.
Anticipated advantages over other vaccines include but are not limited to increased breadth of protection due to CTL responses, increased breadth of antibody, and increased duration of protection.
In one embodiment of the invention, the L1 or L2 or L1+L2 from HPV type 6a, 6b, 11, 16 or 18 protein sequence, obtained from clinical isolates, is cloned into an expression vector. The vector contains a promoter for RNA polymerase transcription, and a transcriptional terminator at the end of the HPV coding sequence. Examples of promoters include but are not limited to CMV. Examples of transcriptional terminators include but are not limited to BGH. In addition, to assist in preparation of the pharmaceutical, an antibiotic resistance marker expressed in E. coli is also preferably included in the expression vector. Neomycin resistance genes or any other pharmaceutically acceptable antibiotic resistance marker may be used. Further, to aid in the high level production of the pharmaceutical by fermentation in prokaryotic organisms, it is advantageous for the vector to contain an origin of replication and be of high copy number. A variety of commercially available prokaryotic cloning vectors provide these benefits. It is desirable to remove non-essential DNA sequences.
Therefore, this invention provides expression vectors encoding a PV protein as an immunogen. The invention offers a means to induce cross-type protective immunity without the need for self-replicating agents. In addition, immunization with DNA offers a number of other advantages. First, this approach to vaccination should be applicable to tumors as well as infectious agents, since the CD8+CTL response is important for immunological intervention in both pathophysiological processes. Therefore, eliciting an immune response against a protein crucial to the transformation process may be an effective means of cancer protection or immunotherapy. Second, the generation of antibodies against expressed proteins after injection of DNA encoding a viral protein suggests that this technology provides a facile and effective means of making antibody-inducing vaccines.
The ease of producing and purifying DNA constructs compares favorably with that of traditional protein purification, which facilitates the generation of combination vaccines. Thus, multiple constructs, for example constructs encoding L1 and L2 proteins of one or more types of HPV, may be prepared, mixed and co-administered. Finally, because protein expression may be maintained for a period of time following DNA injection, the persistence of B- and T-cell memory may be enhanced, thereby engendering long-lived humoral and cell-mediated immunity.
The limitations of proposed HPV vaccines emphasize the need for development of more effective means for prevention of infection and amelioration of disease. Generation of an improved CTL response against a conserved protein may provide significant long-term, cross-reactive immunity.
We have demonstrated protein expression from PNV constructs in rabbits by detection of host immune response directed against CRPV antigens. The results of these animal experiments indicate that direct DNA injection may provide a method for protection of humans against HPV infection and disease.
A range of doses is compared for immunogenicity in order to optimize concentrations for use. It is predictable that dosages of 10, 50, 100, and 200 μg of DNA are efficacious in man.
Human efficacy is shown in volunteers who receive HPV DNA vaccine. The composition, dosage and administration regimens for the vaccine are based on the foregoing studies. Clinical efficacy is shown by infection rate, illness scores, and duration of illness. These clinical findings are compared with laboratory evaluation of host immune response and viral detection in order to determine surrogate markers which correlate with protection.
Molecular biology for preparing and purifying DNA constructs enable the preparation of the DNA pharmaceuticals of this invention. While standard techniques of molecular biology are sufficient for the production of the products of this invention, the specific constructs disclosed herein provide novel therapeutics which may produce cross-strain protection.
The amount of expressible DNA to be introduced to a vaccine recipient will depend on the strength of the transcriptional and translational promoters used in the DNA construct, and on the immunogenicity of the expressed gene product. In general, an immunologically or prophylactically effective dose of about 1 μg to 1 mg. and preferably about 10 μg to 300 μg is administered directly into muscle tissue. Subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, or inhalation delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided.
The polynucleotide may be naked, that is, unassociated with any proteins, adjuvants or other agents which affect the recipient's immune system. In this case, it is desirable for the polynucleotide to be in a physiologically acceptable solution, such as, but not limited to, sterile saline or sterile buffered saline. Alternatively, the polynucleotide may be associated with liposomes, such as lecithin liposomes or other liposomes known in the art, as a DNA-liposome mixture, or the DNA may be associated with an adjuvant known in the art to boost immune responses, such as a protein or other carrier. Agents which assist in the cellular uptake of DNA, such as, but not limited to, calcium ions, viral proteins and other transfection facilitating agents may also be used to advantage. These agents are generally referred to as transfection facilitating agents and as pharmaceutically acceptable carriers.
There are several advantages of immunization with a gene rather than its gene product. One advantage is the relative simplicity with which native or nearly native antigen may be presented to the immune system. Another advantage of polynucleotide immunization is the potential for the immunogen to enter the MHC class I pathway and evoke a cytotoxic T cell response. Since polynucleotide immunization may elicit both humoral and cell-mediated responses, another advantage may be that it provides a relatively simple method to survey a large number of viral genes and viral types for the vaccine potential. Immunization by injection of polynucleotides also allows the assembly of multicomponent vaccines by mixing individual components.
As used herein, the term gene refers to a segment of nucleic acid which encodes a discrete polypeptide. The term pharmaceutical, and vaccine are used interchangeably to indicate compositions useful for inducing immune responses. The terms construct, and plasmid are used interchangeably. The term vector is used to indicate a DNA into which genes may be cloned for use according to the method of this invention.
Accordingly, one embodiment of this invention is a method for using PV genes to induce immune responses in vivo, in a vertebrate such as a mammal, including a human, which comprises:
a) isolating at least one PV gene,
b) linking the gene to regulatory sequences such that the gene is operatively linked to control sequences which, when introduced into a living tissue direct the transcription initiation and subsequent translation of the gene,
c) introducing the gene into a living tissue, and
d) optionally, boosting with additional PV gene.
Another embodiment of this invention may be a method for protecting against heterologous types of PV. This is accomplished by administering an immunologically effective amount of a nucleic acid which encodes a conserved PV epitope.
In another embodiment of this invention, the polynucleotide vaccine encodes another PV protein, such as L1 or L2 or E1 through E7 or combinations thereof.
In another embodiment of this invention, the DNA construct encodes proteins of HPV types 6a, 6b, 11, 16, or 18, wherein the DNA construct is capable of being expressed upon introduction into animal tissues in vivo and inducing an immune response against the expressed product of the encoded HPV gene. Combinations comprising such constructs with polynucleotides encoding other antigens, unrelated to HPV, are contemplated by the instant invention.
Examples of HPV gene encoding DNA constructs include:
V1J-L1, V1J-L2, V1J-E1, V1J-E2, V1J-E3, V1J-E4, V1J-E5, V1J-E6, V1J-E7, V1J-E1i E4, V1J-E1 E4-L1, V1J-E2-C
In specific embodiments of this invention, the DNA construct encodes CRPV L1 protein, wherein the DNA construct is capable of being expressed upon introduction into animal tissues in vivo and inducing an immune response against the expressed product of the encoded CRPV gene. Combinations comprising such constructs with polynucleotides encoding other antigens, unrelated to CRPV, are contemplated by the instant invention.
Examples of CRPV gene encoding DNA constructs include:
V1J-L1, V1J-L2, V1J-E1, V1J-E2, V1J-E3, V1J-E4, V1J-E5, V1J-E6, V1J-E7, V1J-E1i E4, V1J-E1 E4-L1, V1J-E2-C.
Pharmaceutically useful compositions comprising the DNA may be formulated according to known methods such as by the admixture of a pharmaceutically acceptable carrier. Examples of such carriers and methods of formulation may be found in Remington's Pharmaceutical Sciences. To form a pharmaceutically acceptable composition suitable for effective administration, such compositions will contain an effective amount of the HPV DNA.
Therapeutic or diagnostic compositions of the invention are administered to an individual in amounts sufficient to treat or diagnose PV infections. The effective amount may vary according to a variety of factors such as the individual's condition, weight, sex and age. Other factors include the mode of administration. Generally, the compositions will be administered in dosages ranging from about 1 microgram to about 1 milligram.
The pharmaceutical compositions may be provided to the individual by a variety of routes such as subcutaneous, topical, oral and intramuscular.
The vaccines of the invention comprise HPV DNA that encode recombinant proteins of HPV that contain the antigenic determinants that induce the formation of neutralizing antibodies in the human host. Such vaccines are also safe enough to be administered without danger of clinical infection; do not have toxic side effects; can be administered by an effective route; are stable; and are compatible with vaccine carriers.
The vaccines may be administered by a variety of routes, such as orally, parenterally, subcutaneously or intramuscularly. The dosage administered may vary with the condition, sex, weight, and age of the individual; the route of administration; and the type PV of the vaccine. The vaccine may be used in dosage forms such as capsules, suspensions, elixirs, or liquid solutions. The vaccine may be formulated with an immunologically acceptable carrier.
The vaccines are administered in prophylactically or therapeutically effective amounts, that is, in amounts sufficient to generate a immunologically protective response. The effective amount may vary according to the type of PV. The vaccine may be administered in single or multiple doses.
The methods of the present invention make possible the formulation of monovalent and multivalent vaccines for preventing PV infection. Using the methods, either monovalent or multivalent PV vaccines may be made. For example, a monovalent HPV type 16 vaccine may be made by formulating DNA encoding HPV 16 L1 protein or L2 protein or L1+L2 proteins. Alternatively, a multivalent HPV vaccine may be formulated by mixing DNA encoding HPV L1 or L2 or L1+L2 proteins from different HPV types.
The DNA may be used to generate antibodies. The term "antibody" as used herein includes both polyclonal and monoclonal antibodies, as well as fragments thereof, such as, Fv, Fab and F(ab)2 fragments that are capable of binding antigen or hapten.
The PV DNA and antibodies of the present invention may be used to serotype HPV or CRPV infection and for HPV screening. The HPV and CRPV DNA and antibodies lend themselves to the formulation of kits suitable for the detection and serotyping of HPV or CRPV. Such a kit would comprise a compartmentalized carrier suitable to hold in close confinement at least one container. The carrier would further comprise reagents such as HPV DNA or anti-HPV antibodies suitable for detecting a variety of HPV types. The carrier may also contain means for detection such as labeled antigen or enzyme substrates or the like.
The following examples are provided to further define the invention without, however, limiting the invention to the particulars of these examples.
EXAMPLE 1
VECTORS FOR VACCINE PRODUCTION
A) V1: The expression vector V1 was constructed from pCMVIE-AKI-DHFR Y. Whang et al., J. Virol. 61, 1796 (1987)!. The AKI and DHFR genes were removed by cutting the vector with EcoR I and self-ligating. This vector does not contain intron A in the CMV promoter, so it was added as a PCR fragment that had a deleted internal Sac I site at 1855 as numbered in B. S. Chapman et al., Nuc. Acids Res. 19, 3979 (1991)!. The template used for the PCR reactions was pCMVintA-Lux, made by ligating the Hind III and Nhe I fragment from pCMV6a120 see B. S. Chapman et al., ibid.,! which includes hCMV-IE1 enhancer/promoter and intron A, into the Hind III and Xba I sites of pBL3 to generate pCMVIntBL. The 1881 base pair luciferase gene fragment (Hind III-Sma I Klenow filled-in) from RSV-Lux J. R. de Wet et al., Mol. Cell Biol. 7, 725, 1987! was cloned into the Sal I site of pCMVIntBL, which was Klenow filled-in and phosphatase treated.
The primers that spanned intron A are: ##STR1## The primers used to remove the Sac I site are: ##STR2##
The PCR fragment was cut with Sac I and Bgl II and inserted into the vector which had been cut with the same enzymes.
B) V1J EXPRESSION VECTOR
Our purpose in creating V1J was to remove the promoter and transcription termination elements from our vector, V1, in order to place them within a more defined context, create a more compact vector, and to improve plasmid purification yields.
V1J is derived from vectors V1 and pUC19, a commercially available plasmid. V1 was digested with SspI and EcoRI restriction enzymes producing two fragments of DNA. The smaller of these fragments, containing the CMVintA promoter and Bovine Growth Hormone (BGH) transcription termination elements which control the expression of heterologous genes was purified from an agarose electrophoresis gel. The ends of this DNA fragment were then "blunted" using the T4 DNA polymerase enzyme in order to facilitate its ligation to another "blunt-ended" DNA fragment.
pUC19 was chosen to provide the "backbone" of the expression vector. It is known to produce high yields of plasmid, is well-characterized by sequence and function, and is of minimum size. We removed the entire lac operon from this vector, which was unnecessary for our purposes and may be detrimental to plasmid yields and heterologous gene expression, by partial digestion with the HaeII restriction enzyme. The remaining plasmid was purified from an agarose electrophoresis gel, blunt-ended with the T4 DNA polymerase, treated with calf intestinal alkaline phosphatase, and ligated to the CMVintA/BGH element described above. Plasmids exhibiting either of two possible orientations of the promoter elements within the pUC backbone were obtained. One of these plasmids gave much higher yields of DNA in E. coli and was designated V 1J. This vector's structure was verified by sequence analysis of the junction regions and was subsequently demonstrated to give comparable or higher expression of heterologous genes compared with V1.
C) V1Jneo EXPRESSION VECTOR
It was necessary to remove the ampr gene used for antibiotic selection of bacteria harboring V1J because ampicillin may not be used in large-scale fermenters for the production of human clinical products. The ampr gene from the pUC backbone of V1J was removed by digestion with SspI and Eam1105I restriction enzymes. The remaining plasmid was purified by agarose gel electrophoresis, blunt-ended with T4 DNA polymerase, and then treated with calf intestinal alkaline phosphatase. The commercially available kanr gene, derived from transposon 903 and contained within the pUC4K plasmid, was excised using the PstI restriction enzyme, purified by agarose gel electrophoresis, and blunt-ended with T4 DNA polymerase. This fragment was ligated with the V1J backbone and plasmids with the kanr gene in either orientation were derived which were designated as V1Jneo #'s 1 and 3. Each of these plasmids was confirmed by restriction enzyme digestion analysis, DNA sequencing of the junction regions, and was shown to produce similar quantities of plasmid as V1J. Expression of heterologous gene products was also comparable to V1J for these V1Jneo vectors. We arbitrarily selected V1Jneo#3, referred to as V1Jneo hereafter, which contains the kanr gene in the same orientation as the ampr gene in V1J as the expression construct.
D) V1Jns EXPRESSION VECTOR:
An Sfi I site was added to V1Jneo to facilitate integration studies. A commercially available 13 base pair Sfi I linker (New England BioLabs) was added at the Kpn I site within the BGH sequence of the vector. V1Jneo was linearized with Kpn I, gel purified, blunted by T4 DNA polymerase, and ligated to the blunt Sfi I linker. Clonal isolates were chosen by restriction mapping and verified by sequencing through the linker. The new vector was designated V1Jns. Expression of heterologous genes in V1Jns (with Sfi I) was comparable to expression of the same genes in V1Jneo (with Kpn I).
EXAMPLE 2
Preparation Of DNA Constructs Encoding Cottontail Rabbit Papilloma Virus Proteins
The source of the CRPV DNA for all cloned genes is CRPV-pLAII. This is the entire CRPV genome cloned into pBR322 at the Sal I site (Nasseri, M., Meyers, C. and Wettstein, F. O. (1989) Genetic analysis of CRPV pathogenesis: The L1 open reading frame is dispensable for cellular transformation but is required for papilloma formation, Virology 170, 321-325).
1. V1Jns-L1: The L1 coding sequence was generated by PCR, using the CRPV-pLAII DNA as template. The PCR primers were designed to contain Bam HI sites for cleavage after the PCR fragment was gel purified.
The primers used to generate the L1 coding region were: ##STR3##
The PCR fragment was gel purified, cut with Bam HI and ligated to V1Jns cut with Bgl II.
2. V1Jns-L2: The L2 coding region was generated by PCR. The vector CRPV-pLAII has the L2 gene disrupted by the Sal I site used in inserting CRPV into pBR322. Therefore, a template for PCR was generated by cutting CRPV-pLAII with SalI and ligating the CRPV DNA into circular form at the SAl I site. This ligated CRPV DNA was used as the template for PCR. The PCR primers were designed to contain Bam HI sites for cleavage after the PCR fragment was gel purified.
The primers used to generate the L2 coding region were: ##STR4##
3. V1Jns-E2: The E2 coding region is generated by PCR, using the CRPV-pLAII DNA as template. The PCR primers are designed to contain Bgl II sites for cleavage after the PCR fragment is gel purified.
The primers used to generate the E2 coding region are: ##STR5##
4. V1Jns-E4: The E4 coding region is generated by PCR, using the CRPV-pLAII DNA as template. The PCR primers are designed to contain Bgl II sites for cleavage after the PCR fragment is gel purified.
The primers used to generate the E4 coding region are: ##STR6##
5. V1Jns-E7: The E7 coding region was generated by PCR, using the CRPV-pLAII as template in one case and purified DNA from Kreider's CRPV strain in another case. The same PCR primers were used for both templates. The PCR primers are designed to contain Bgl II sites for cleavage after the PCR fragment was gel purified.
The primers used to generate the E7 coding region were: ##STR7##
6. pGEX-2T-E2: The E2 coding region was generated by PCR as described for V1Jns-E2. The fragment was cloned into pGEX-2T into the Bam HI site to generate an in-frame fusion to glutathione S-transferase (GST). This construct is used to generate protein in E. coli.
7. pGEX-2T-E4: The E4 coding region was generated by PCR as described for V1Jns-E4. The fragment was cloned into pGEX-2T into the Barn HI site to generate an in-frame fusion to glutathione S-transferase (GST). This construct is used to generate protein in E. coli.
8. pGEX-2T-E7: The E7 coding region was generated by PCR as described for V1Jns-E7. The fragment was cloned into pGEX-2T into the Bam HI site to generate an in-frame fusion to glutathione S-transferase (GST). This construct is used to generate protein in E. coli.
EXAMPLE 3
Plasmid Purification from E. coli
V1J constructs were grown overnight to saturation. Cells were harvested and lysed by a modification of an alkaline SDS procedure (Sambrook, J., Fritsch, E. F., And Maniatis, T., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y., ed.2 (1989). The modification consisted of increasing the volumes three-fold for cell lysis and DNA extraction. DNA was purified by double banding on CsCl-EtBr gradients. The ethidium bromide was removed by 1-butanol extraction. The resulting DNA was extracted with phenol/chloroform and precipitated with ethanol. DNA was resuspended in TE (10 mM Tris, 1 mM EDTA), pH 8 for transfections and in 0.9% NaCl for injection into mice. Concentration and purity of each DNA preparation was determined by OD260/280 readings. The 260/280 ratios were ≧1.8.
EXAMPLE 4
Production of CRPV Specific Antibodies In Vivo
Five rabbits per group were bled and then injected with 1.2 ml of saline containing 1 mg of V1Jns-L1, V1Jns-L2, V1Jns-L1 mixed with V1Jns-L2 (2 mg total), or with V1Jns (control vector with no protein encoded) alone. The inoculum was divided equally among six intramuscular sites on both hind legs, both forelegs, and the lower back. Three weeks after the initial DNA injection, the rabbits were bled and given a second injection of the same DNA in the same manner. Four weeks after the second injection, the animals were bled again.
Sera were tested for virus neutralizing antibody by mixing tenfold serial dilutions of immune serum with a 1:3 dilution of CRPV stock virus (Kreider strain). Dilutions were prepared in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 1% bovine serum albumin (BSA). CRPV stock virus (purchased from Dr. J. Kreider, Hershey, Pa.) was prepared from skin fragments obtained from wild cottontail rabbits, which were infected with CRPV and implanted under the renal capsules of athymic mice. The resulting condylomas were homogenized and clarified by centrifugation to yield a stock virus preparation. The mixtures of immune serum and virus stock were incubated on ice for at least 60 minutes, and then 50 μl of each mixture was applied to a 1 cm2 area of shaved, scarified skin on the backs of 3 New Zealand White rabbits. The animals were observed 7 weeks later for the presence of warts and the anteroposterior and lateral dimensions (in mm) of the ellipsoidal warts were measured. Endpoint titers were determined from the frequency of warts at the various dilutions by Reed-Muench interpolation. Neutralizing antibody titers of rabbits injected with L1 DNA or both L1 and L2 DNA are plotted on the y-axis of FIG. 1.
The sera from rabbits that had been injected with L1 DNA also were tested for antibody by ELISA. Polystyrene ELISA plates were coated overnight at 4° C. with 1 μg/well of semipurified, recombinant yeast-derived CRPV L1 protein. The recombinant L1 was prepared in S. cerevisiae and purified as described by Kirnbauer et al. (Proc. Nat. Acad. Sci. U.S.A. 89:12180-4, 1992) with minor modifications. Diluted sera were added and incubated for 1 hour at room temperature (with shaking on an orbital shaker). The plates were then washed and horseradish peroxidase-labeled goat anti-rabbit IgG (Fc specific) was added. After one hour of incubation with shaking the plates were washed and substrate was added. Plates were read at 450 nm using a kinetic ELISA reader (Molecular Devices Corp.), and the values obtained were corrected for background by subtraction of the reaction rate of the preimmune serum from that of the postimmnunization serum at the same dilution. Titers were determined by interpolation of the resulting curve of corrected reaction rate versus dilution to a rate value of 10 mOD/min. ELISA titers of rabbits injected with L1 DNA or L1 plus L2 DNA are plotted on the x-axis of FIG. 1. FIG. 1 shows that 12/13 sera that were positive for neutralizing activity (log titer≧1, i.e., positive with undiluted serum) also were positive for ELISA antibody (ELISA titer≧100). Four of the 4 sera that were negative for neutralizing antibody had ELISA titers≦350. All of the sera from rabbits that received either L2 DNA alone or the V1J control vector had ELISA titers of less than 100. Taken together, these data show that antibodies specific for CRPV and capable of neutralizing it were obtained after injection of L1 DNA. ELISA titers in rabbits persisted undiminished for at least 32 weeks following immunization (FIG. 2).
EXAMPLE 5
Protection of Rabbits upon Challenge with Virulent CRPV
Five rabbits per group were injected intramuscularly with 1 mg, of V1Jns-L1, V1Jns-L2, V1Jns-L1 mixed with V1Jns-L2 (2 mg total), or with V1Jns (control vector with no protein encoded) alone, as described above. Three weeks after the initial DNA injection, the rabbits received a second injection of the same DNA. Four weeks after the second injection, the rabbits were challenged with CRPV. The CRPV challenge was performed by applying 50 μl of two dilutions of virus stock (diluted 1:2 or 1:12 with DMEM plus 1% BSA) to triplicate 1 cm2 sites of shaved, scarified skin on the back of each rabbit. Sera taken at the time of challenge from animals injected with L1 DNA or L1+L2 DNA contained antibody to L1 by ELISA and virus neutralizing antibody as described above. The animals were observed for formation of warts at 3, 6 and 10 weeks following challenge. Of the rabbits that did not receive L1 DNA, 51 of 54 sites challenged with CRPV developed warts, while on animals that received L1 DNA, 2 of 60 sites developed warts. One of the two warts that was observed on a rabbit immunized with L1 DNA regressed within 3 weeks after its appearance. Table 1 shows the distribution of warts on rabbits after CRPV challenge. Prophylactic immunization with L1 DNA protected rabbits from the development of warts upon infection with virulent CRPV.
EXAMPLE 6
Conformational specificify of antibodies induced with L1 DNA
To demonstrate that protective neutralizing antibodies recognize conformational epitopes on VLPs, absorption experiments were performed. Absorption of immune serum with L1 VLP (15) removed all of the neutralizing antibody and ELISA activity (FIG. 3A, B). The application to scarified skin of CRPV mixed with preimmune rabbit serum resulted in condylomas on all sites challenged, while when CRPV was mixed with immune serum and similarly applied, no condylomas were seen due to the neutralizing antibody activity. When CRPV was mixed with immune serum that had been absorbed with L1 VLPs, from which the neutralizing antibodies should have been removed, all (3/3) sites were positive for condylomas. In contrast, when immune serum was absorbed with denatured nonparticulate L1 protein (denatured by reduction and alkylation in 8M urea), the serum was still able to neutralize CRPV (FIG. 3A), and retained its activity in the ELISA (FIG. 3B). Thus the virus-neutralizing antibodies induced by L1 DNA immunization could be removed only by L1 VLPs in a native conformation and not by denatured L1. The ELISA assay appears to detect primarily conformationally-specific antibodies reacting with intact L1 VLP, as the depletion of ELISA activity by absorption corresponded to the removal of neutralizing antibodies (FIG. 3B).
EXAMPLE 7
Antibody responses induced with E2 and E7 DNA
Groups of 4 NZW rabbits were injected intramuscularly with 1 mg of V1J-E2 or V1J-E7 DNA per immunization. Four immunizations were given at 0, 4, 9 and 20 weeks and were bled at 22 weeks. Antibodies were used as surrogate markers for expression of the encoded proteins. Serum antibodies were assayed using ELISA plates (NUNC Maxisorp) coated with 1 μg per well of GST-E2 or GST-E7 fusion protein purified from E. coli that had been transformed with a pGEX expression vector encoding CRPV E2 or E7 and induced with IPTG. The ELISA assay was performed as described in Example 3. The net reaction rated (post dose 4 minus preimmune) in mOD/min are shown in FIG. 4. Net rates>10 mOD/min are considered positive; specimens with high antibody titers may have low net reaction rates at the lowest dilution due to oversaturation of the detection system. Thus the encoded E2 and E7 proteins were expressed and recognized by the recipient immune system.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 14
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
CTATATAAGCAGAGCTCGTTTAG23
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
GTAGCAAAGATCTAAGGACGGTGACTGCAG30
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
GTATGTGTCTGAAAATGAGCGTGGAGATTGGGCTCGCAC39
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
GTGCGAGCCCAATCTCCACGCTCATTTTCAGACACATAC39
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GGTACAGGATCCACCATGGCAGTGTGGCTGTCTACGCAG39
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
CCACATGGATCCTTAAGTACGTCTCTTGCGTTTAGATG38
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
GGTACAGGATCCACCATGGTTGCACGGTCACGAAAACGC39
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
CCACATGGATCCTTATTCTGCGTAGACAGCCACACT36
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
GGTACAAGATCTACCATGGAGGCTCTCAGCCAGCGCTTA39
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 42 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CCACATAGATCTCTAAAGCCCATAAAAATTCCCTAAAAACAC42
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
GGTACAAGATCTACCATGAGCCATGGACATTGCAGGATAC40
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
CCACATAGATCTTTATAAGCTCGCGAAGCCGTCTATTCC39
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: NO
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GGTACAAGATCTACCATGATAGGCAGAACTCCTAAGCTTAG41
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 36 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
CCACATAGATCTTCAGTTACAACACTCCGGGCACAC36
__________________________________________________________________________

Claims (4)

What is claimed is:
1. A papillomavirus (PV) vaccine for use in a human comprising a vector comprising:
(a) a polynucleotide encoding at least one human papillomavirus (HPV) gene from an HPV selected from the group consisting of: HPV 6a, HPV 6b, HPV 11, HPV 16 and HPV 18, and expressing a protein selected from the group consisting of: L1 and L1+L2,
(b) a CMV promoter for RNA polymerase transcription;
(c) a transcriptional terminator from a bovine growth hormone gene; and
(d) a neomycin resistance marker gene;
wherein the vector is present in a physiologically acceptable solution.
2. A vaccine according to claim 1 wherein the vector is V1Jneo or V1Jns.
3. A method for inducing an immune response to HPV in vivo comprising introducing into a living tissue of a human an HPV vaccine wherein said vaccine comprises a vector comprising:
(a) a polynucleotide encoding at least one HPV L1 gene from an HPV virus selected from the group consisting of HPV 6a, HPV 6b, HPV 11, HPV 16, and HPV 18;
(b) a CMV promoter for RNA polymerase transcription;
(c) a bovine growth hormone transcriptional terminator; and
(d) a neomycin resistance marker gene;
wherein the vector is present in a physiologically acceptable solution and wherein said L1 gene is expressed and an immune response is induced.
4. A method according to claim 3 wherein the vector is V1Jneo or V1Jns.
US08/750,810 1994-06-30 1995-06-01 Polynucleotide vaccine for papillomavirus Expired - Fee Related US5866553A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/750,810 US5866553A (en) 1994-06-30 1995-06-01 Polynucleotide vaccine for papillomavirus

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US26842494A 1994-06-30 1994-06-30
US08/750,810 US5866553A (en) 1994-06-30 1995-06-01 Polynucleotide vaccine for papillomavirus
PCT/US1995/006915 WO1996000583A1 (en) 1994-06-30 1995-06-01 Polynucleotide vaccine for papillomavirus

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US26842494A Continuation-In-Part 1994-06-30 1994-06-30

Publications (1)

Publication Number Publication Date
US5866553A true US5866553A (en) 1999-02-02

Family

ID=23022939

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/750,810 Expired - Fee Related US5866553A (en) 1994-06-30 1995-06-01 Polynucleotide vaccine for papillomavirus

Country Status (20)

Country Link
US (1) US5866553A (en)
EP (1) EP0768893B1 (en)
JP (1) JPH10501987A (en)
CN (1) CN1156966A (en)
AT (1) ATE233101T1 (en)
AU (1) AU701973B2 (en)
CA (1) CA2193365C (en)
CZ (1) CZ375296A3 (en)
DE (1) DE69529748T2 (en)
ES (1) ES2191052T3 (en)
FI (1) FI965224A (en)
HU (1) HU220747B1 (en)
IL (1) IL113817A (en)
MX (1) MX9700229A (en)
NO (1) NO965590L (en)
NZ (1) NZ288045A (en)
PL (1) PL180639B1 (en)
SK (1) SK164196A3 (en)
WO (1) WO1996000583A1 (en)
ZA (1) ZA954641B (en)

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999052463A1 (en) * 1998-04-14 1999-10-21 Merck & Co., Inc. Needleless administration of polynucleotide formulations
WO2001061022A1 (en) * 2000-02-15 2001-08-23 Genomine Inc. Recombinant human papillomavirus vaccine expressed in transgenic plants
US20010048925A1 (en) * 1999-02-03 2001-12-06 Bell Steve J.D. Therapeutic calcium phosphate particles and methods of manufacture and use
US20020044948A1 (en) * 2000-03-15 2002-04-18 Samir Khleif Methods and compositions for co-stimulation of immunological responses to peptide antigens
US6384018B1 (en) * 1994-11-14 2002-05-07 Merck & Co., Inc. Polynucleotide tuberculosis vaccine
US20020054914A1 (en) * 1999-02-03 2002-05-09 Tulin Morcol Compositions and methods for therapuetic agents complexed with calcium phosphate and encased by casein
US20030185892A1 (en) * 2001-08-17 2003-10-02 Bell Steve J. D. Intraocular delivery compositions and methods
US20030191082A1 (en) * 1999-03-26 2003-10-09 Wheeler Carl J. Adjuvant compositions and methods for enhancing immune responses to polynucleotide-based vaccines
US20030228327A1 (en) * 2001-11-05 2003-12-11 Lasher Alfred W. DNA-based plasmid formulations and vaccines and prophylactics containing the same
US20040146534A1 (en) * 2001-02-13 2004-07-29 Glenn Gregory M. Vaccine for transcutaneous immunization
US6797276B1 (en) 1996-11-14 2004-09-28 The United States Of America As Represented By The Secretary Of The Army Use of penetration enhancers and barrier disruption agents to enhance the transcutaneous immune response
US20040208848A1 (en) * 2002-12-13 2004-10-21 Smith Jonathan F. Multi-antigenic alphavirus replicon particles and methods
US20040241181A1 (en) * 2001-06-22 2004-12-02 Ertl Hildeghund C. J. Methods of inducing a cytotoxic immune response and recormbinant simian adenovirus compositions useful therein
US20040258703A1 (en) * 1997-11-14 2004-12-23 The Government Of The Us, As Represented By The Secretary Of The Army Skin-active adjuvants for transcutaneous immunization
US20040258763A1 (en) * 1999-02-03 2004-12-23 Bell Steve J.D. Methods of manufacture and use of calcium phosphate particles containing allergens
US20050026257A1 (en) * 2001-07-30 2005-02-03 Lutz Gissmann Production and applications for polyvalent vaccines against diseases caused by papilloma viruses
US20050234114A1 (en) * 2004-02-13 2005-10-20 Lee William W Therapeutic calcium phosphate particles and methods of making and using same
US20050287157A1 (en) * 1999-04-08 2005-12-29 Iomai Corporation Dry formulation for transcutaneous immunization
US20060002959A1 (en) * 1996-11-14 2006-01-05 Government Of The United States Skin-sctive adjuvants for transcutaneous immuization
US6995008B1 (en) * 1994-03-07 2006-02-07 Merck & Co., Inc. Coordinate in vivo gene expression
US20060269593A1 (en) * 1996-11-14 2006-11-30 The Government Of The United States Adjuvant for transcutaneous immunization
US20090041812A1 (en) * 2004-11-01 2009-02-12 Bell Steve J D Therapeutic Calcium Phosphate Particles in Use for Aesthetic of Cosmetic Medicine, and Methods of Manufacture and Use
US20090047301A1 (en) * 2005-02-01 2009-02-19 The Johns Hopkins University Papillomavirus L2 N-Terminal Peptides for the Induction of Broadly Cross-Neutralizing Antibodies
US20090081244A1 (en) * 1996-11-14 2009-03-26 Army, Gov. Of The Us, As Represented By The Dry Formulation for Transcutaneous Immunization
US20100255031A1 (en) * 2007-04-29 2010-10-07 Ying Gu truncated l1 protein of human papillomavirus type 16
US20100255021A1 (en) * 2007-05-29 2010-10-07 Xiamen University Truncated l1 protein of human papillomavirus type 6
US9364529B2 (en) 2007-04-29 2016-06-14 Beijing Wantai Biological Pharmacy Enterprise Co., Ltd. Truncated L1 protein of human papillomavirus type 18

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2751879B1 (en) * 1996-07-30 1998-10-30 Transgene Sa PHARMACEUTICAL COMPOSITION AGAINST TUMORS AND PAPILLOMAVIRUS INFECTIONS
US7118754B1 (en) 1996-07-30 2006-10-10 Transgene S.A. Pharmaceutical composition for treating papillomavirus tumors and infection
DE19631357A1 (en) * 1996-08-02 1998-02-05 Deutsches Krebsforsch Vector for activating the immune system against cells associated with papilloma viruses or sequences thereof
ES2232934T3 (en) * 1997-02-14 2005-06-01 MERCK & CO., INC. FORMULATIONS OF VACCINES BASED ON POLINUCLEOTIDES.
US6013258A (en) * 1997-10-09 2000-01-11 Zycos Inc. Immunogenic peptides from the HPV E7 protein
US6183746B1 (en) 1997-10-09 2001-02-06 Zycos Inc. Immunogenic peptides from the HPV E7 protein
US20020039584A1 (en) 1998-02-20 2002-04-04 Medigene Ag Papilloma virus capsomere vaccine formulations and methods of use
CA2229955C (en) 1998-02-20 2003-12-09 Medigene Gmbh Papilloma virus capsomere vaccine formulations and methods of use
US7182947B2 (en) 1998-02-20 2007-02-27 Medigene Ag Papillomavirus truncated L1 protein and fusion protein constructs
US7494658B2 (en) 1998-02-20 2009-02-24 Medigene Ag Papilloma virus truncated L1 protein and fusion protein constructs
US6926897B1 (en) 1998-03-24 2005-08-09 Medigene Aktiengesellschaft Medicament for the avoidance or treatment of papillomavirus-specific tumour
WO2000014244A2 (en) * 1998-09-04 2000-03-16 Connaught Laboratories Limited Treatment of cervical cancer
DE60016765T2 (en) * 1999-08-25 2005-11-24 Merck & Co., Inc. SYNTHETIC PAPILLOMA GENES WHICH ARE OPTIMIZED FOR EXPRESSION IN HUMAN CELLS
US7001995B1 (en) 1999-08-25 2006-02-21 Merck & Co., Inc. Synthetic human papillomavirus genes
SE0002498D0 (en) * 2000-07-03 2000-07-03 Stefan Schwartz Papillomavirus vaccine
KR20020005332A (en) * 2000-07-10 2002-01-17 정상훈 Kit for treatment of alopecia
CN105209063A (en) * 2013-03-15 2015-12-30 宾夕法尼亚大学理事会 Vaccines having an antigen and interleukin-23 as an adjuvant

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4497796A (en) * 1980-03-26 1985-02-05 The Regents Of The University Of California Gene transfer in intact mammals
WO1986005816A1 (en) * 1985-04-04 1986-10-09 Georgetown University Type-specific papillomavirus dna sequences and peptides
WO1990011092A1 (en) * 1989-03-21 1990-10-04 Vical, Inc. Expression of exogenous polynucleotide sequences in a vertebrate
WO1993002184A1 (en) * 1991-07-19 1993-02-04 The University Of Queensland Papilloma virus vaccine
EP0586076A2 (en) * 1992-08-07 1994-03-09 American Home Products Corporation Recombinant adenovirus vaccines
WO1994005792A1 (en) * 1992-09-03 1994-03-17 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Self-assembling recombinant papillomavirus capsid proteins
US5415995A (en) * 1986-07-10 1995-05-16 The Board Of Trustees Of The Leland Stanford Junior University Diagnostic peptides of human papilloma virus
US5576206A (en) * 1992-04-27 1996-11-19 Georgetown University Human papilloma virus genes and their use in gene therapy
US5593972A (en) * 1993-01-26 1997-01-14 The Wistar Institute Genetic immunization

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4497796A (en) * 1980-03-26 1985-02-05 The Regents Of The University Of California Gene transfer in intact mammals
WO1986005816A1 (en) * 1985-04-04 1986-10-09 Georgetown University Type-specific papillomavirus dna sequences and peptides
US5415995A (en) * 1986-07-10 1995-05-16 The Board Of Trustees Of The Leland Stanford Junior University Diagnostic peptides of human papilloma virus
WO1990011092A1 (en) * 1989-03-21 1990-10-04 Vical, Inc. Expression of exogenous polynucleotide sequences in a vertebrate
WO1993002184A1 (en) * 1991-07-19 1993-02-04 The University Of Queensland Papilloma virus vaccine
US5576206A (en) * 1992-04-27 1996-11-19 Georgetown University Human papilloma virus genes and their use in gene therapy
EP0586076A2 (en) * 1992-08-07 1994-03-09 American Home Products Corporation Recombinant adenovirus vaccines
WO1994005792A1 (en) * 1992-09-03 1994-03-17 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Self-assembling recombinant papillomavirus capsid proteins
US5593972A (en) * 1993-01-26 1997-01-14 The Wistar Institute Genetic immunization

Non-Patent Citations (43)

* Cited by examiner, † Cited by third party
Title
Browne, et al., "Analysis of the L1 Gene Product of Human Papillomavirus Type 16 by Expression . . . ", J. Gen. Virol., (1988), vol. 69, pp. 1263-1273.
Browne, et al., Analysis of the L1 Gene Product of Human Papillomavirus Type 16 by Expression . . . , J. Gen. Virol., (1988), vol. 69, pp. 1263 1273. *
Cason, J. Papilloma virus vaccines current status. Clinical Immunotherapeutics, vol. 1, No. 4, pp. 293 306, Apr. 1994. *
Cason, J. Papilloma virus vaccines- current status. Clinical Immunotherapeutics, vol. 1, No. 4, pp. 293-306, Apr. 1994.
Doorbar, et al., "Identification of Proteins Encoded by the L1 and L2 Open Reading Frames ofHuman Papillomavirus 1a", J. of Virol., Sep. 1987, vol. 67, No. 9, pp. 2793-2799.
Doorbar, et al., Identification of Proteins Encoded by the L1 and L2 Open Reading Frames ofHuman Papillomavirus 1a , J. of Virol., Sep. 1987, vol. 67, No. 9, pp. 2793 2799. *
Hagenese, et al., "Self-Assembly of Human Papillomavirus Type 1 Capsids by Expression of the L1 Protein Alone or by Coexpression . . . ", J. of Virol., Jan. 1993, vol. 67, No. 1, pp. 315-322.
Hagenese, et al., Self Assembly of Human Papillomavirus Type 1 Capsids by Expression of the L1 Protein Alone or by Coexpression . . . , J. of Virol., Jan. 1993, vol. 67, No. 1, pp. 315 322. *
Kirnbauer, "Papillomavirus L1 major capsid protein self-assembles into virus-like particles that are highly immunogenic", Proc. Natl. Acad. Sci., Vo. 89, pp. 12180-12184, Dec. 1992.
Kirnbauer, Papillomavirus L1 major capsid protein self assembles into virus like particles that are highly immunogenic , Proc. Natl. Acad. Sci., Vo. 89, pp. 12180 12184, Dec. 1992. *
LeCann, et al., "Self-assembly of human papillomavirus type 16 capsids by expression of the L1 protein in insect cells", FEMS Microbiology Letters, 117, (1994), pp. 269-274.
LeCann, et al., Self assembly of human papillomavirus type 16 capsids by expression of the L1 protein in insect cells , FEMS Microbiology Letters, 117, (1994), pp. 269 274. *
Lin et al. Cottontail Rabbit Papillomavirus L1 Protein Based Vaccines: Protection is Achieved Only with a Full Length, Nondenatured Product. Journal of Virology, vol. 67, No. 7, pp. 4154 4162, Jul. 1993. *
Lin et al. Cottontail Rabbit Papillomavirus L1 Protein-Based Vaccines: Protection is Achieved Only with a Full-Length, Nondenatured Product. Journal of Virology, vol. 67, No. 7, pp. 4154-4162, Jul. 1993.
Lin et al. Progression from Papilloma to Carcinoma is Accompanied by Changes in Antibody Response to Papillomavirus Proteins. Journal of Virology, vol. 67, No. 1, pp. 382 389, Jan. 1993. *
Lin et al. Progression from Papilloma to Carcinoma is Accompanied by Changes in Antibody Response to Papillomavirus Proteins. Journal of Virology, vol. 67, No. 1, pp. 382-389, Jan. 1993.
Lin, et al., "Effective Vaccination against Papillomavirus Development by immunization with L1 or L2 Structural Protein of Cottontail Rabbit Papillomavirus", Virology, vol. 187, (1992), pp. 612-619.
Lin, et al., Effective Vaccination against Papillomavirus Development by immunization with L1 or L2 Structural Protein of Cottontail Rabbit Papillomavirus , Virology, vol. 187, (1992), pp. 612 619. *
Meyers et al. Identification of Three Transforming Proteins Encoded by Cottontail Rabbit Papillomavirus. Journal of Virology, vol. 66, No. 3, pp. 1655 1664, Mar. 1992. *
Meyers et al. Identification of Three Transforming Proteins Encoded by Cottontail Rabbit Papillomavirus. Journal of Virology, vol. 66, No. 3, pp. 1655-1664, Mar. 1992.
Orkin et al. Report and recommendations of the panel to assess the NIH investment in research on gene therapy, Issued by the National Institutes of Health, Dec. 7, 1995. *
Rose, et al., "Expression of Human Papillomavirus Type 11 L1 Protein in Insect Cells: In Vivo and In Vitro Assembly of Viruslike Particles", J. of Virol., Apr. 1993, pp. 1936-1944.
Rose, et al., Expression of Human Papillomavirus Type 11 L1 Protein in Insect Cells: In Vivo and In Vitro Assembly of Viruslike Particles , J. of Virol., Apr. 1993, pp. 1936 1944. *
Steele, et al., "Humoral Assays of Human Sera to Disrupted and Nondisrupted Epitopes of Human Papillomavirus Type 1", Virology., vol. 174, (1990) pp. 388-398.
Steele, et al., Humoral Assays of Human Sera to Disrupted and Nondisrupted Epitopes of Human Papillomavirus Type 1 , Virology., vol. 174, (1990) pp. 388 398. *
Strayer, D. S. The viruses don t always read the books engineered vaccines and gene therapy using viral vectors. Laboratory Investigation, vol. 71, No. 3, pp. 319 323, Sep. 1994. *
Strayer, D. S. The viruses don't always read the books-engineered vaccines and gene-therapy using viral vectors. Laboratory Investigation, vol. 71, No. 3, pp. 319-323, Sep. 1994.
Strike, et al., "Expression in Escherichia coli of Seven DNA Fragments Comprising the Complete L1 and L2 Open . . . ", J. Gen. Virol. (1989) vol. 70, pp. 543-555.
Strike, et al., Expression in Escherichia coli of Seven DNA Fragments Comprising the Complete L1 and L2 Open . . . , J. Gen. Virol. (1989) vol. 70, pp. 543 555. *
Ulmer , et al., "The Generation of Protective Humoral and Cell-Mediated Immunity of Polynucleotide Vaccines", FASED Journal, No. 4, 5 p. A748 (1994).
Ulmer , et al., The Generation of Protective Humoral and Cell Mediated Immunity of Polynucleotide Vaccines , FASED Journal, No. 4, 5 p. A748 (1994). *
Ulmer, et al., "Heterologous Protection Against Influenza by Injection of DNA Encoding a Viral Protein", Science, vol. 259, pp. 1745-1749 (1993).
Ulmer, et al., Heterologous Protection Against Influenza by Injection of DNA Encoding a Viral Protein , Science, vol. 259, pp. 1745 1749 (1993). *
Wolfe, et al., "An Early History of Gene Transfer and Therapy", Human Gene Therapy, vol. 5, pp. 467-480 (1994).
Wolfe, et al., An Early History of Gene Transfer and Therapy , Human Gene Therapy, vol. 5, pp. 467 480 (1994). *
Wolff, et al., "Direct Gene Transfer into Mouse Muscle in Vivo", Science, vol. 247, pp. 1464-1468 (1990).
Wolff, et al., Direct Gene Transfer into Mouse Muscle in Vivo , Science, vol. 247, pp. 1464 1468 (1990). *
Zhou, et al., "Expression of Vaccinia Recombinant HPV 16 L1 and L2 ORF Proteins in Epithelial Cells is Sufficient for Assembly of HPV Virion-like Particles", Virology, vol. 185, (1991), pp. 251-257.
Zhou, et al., "Increased antibody responses to human papillomavirus type 16 L1 protein expressed by recombinant", J. Gen. Virol., (1990) vol. 71, pp. 2185-2190.
Zhou, et al., "Synthesis and assembly of infectious bovine papillomavirus particles in vitro", J. Gen. Virol., (1993), vol. 74, pp. 763-768.
Zhou, et al., Expression of Vaccinia Recombinant HPV 16 L1 and L2 ORF Proteins in Epithelial Cells is Sufficient for Assembly of HPV Virion like Particles , Virology, vol. 185, (1991), pp. 251 257. *
Zhou, et al., Increased antibody responses to human papillomavirus type 16 L1 protein expressed by recombinant , J. Gen. Virol., (1990) vol. 71, pp. 2185 2190. *
Zhou, et al., Synthesis and assembly of infectious bovine papillomavirus particles in vitro , J. Gen. Virol., (1993), vol. 74, pp. 763 768. *

Cited By (47)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6995008B1 (en) * 1994-03-07 2006-02-07 Merck & Co., Inc. Coordinate in vivo gene expression
US6384018B1 (en) * 1994-11-14 2002-05-07 Merck & Co., Inc. Polynucleotide tuberculosis vaccine
US6797276B1 (en) 1996-11-14 2004-09-28 The United States Of America As Represented By The Secretary Of The Army Use of penetration enhancers and barrier disruption agents to enhance the transcutaneous immune response
US8911742B2 (en) 1996-11-14 2014-12-16 The United States Of America As Represented By The Secretary Of The Army Transcutaneous immunization without heterologous adjuvant
US20090081244A1 (en) * 1996-11-14 2009-03-26 Army, Gov. Of The Us, As Represented By The Dry Formulation for Transcutaneous Immunization
US20080233142A1 (en) * 1996-11-14 2008-09-25 Government Of The United States, As Represented By Secretary Of The Army Use of penetration enhancers and barrier disruption methods to enhance the immune response of an antigen
US20060269593A1 (en) * 1996-11-14 2006-11-30 The Government Of The United States Adjuvant for transcutaneous immunization
US20060002959A1 (en) * 1996-11-14 2006-01-05 Government Of The United States Skin-sctive adjuvants for transcutaneous immuization
US20040258703A1 (en) * 1997-11-14 2004-12-23 The Government Of The Us, As Represented By The Secretary Of The Army Skin-active adjuvants for transcutaneous immunization
WO1999052463A1 (en) * 1998-04-14 1999-10-21 Merck & Co., Inc. Needleless administration of polynucleotide formulations
US20110236685A1 (en) * 1999-02-03 2011-09-29 Bell Steve J D Therapeutic calcium phosphate particles and methods of manufacture and use
US20020054914A1 (en) * 1999-02-03 2002-05-09 Tulin Morcol Compositions and methods for therapuetic agents complexed with calcium phosphate and encased by casein
US20010048925A1 (en) * 1999-02-03 2001-12-06 Bell Steve J.D. Therapeutic calcium phosphate particles and methods of manufacture and use
US6355271B1 (en) 1999-02-03 2002-03-12 Biosante Pharmaceuticals, Inc. Therapeutic calcium phosphate particles and methods of manufacture and use
US8431221B2 (en) 1999-02-03 2013-04-30 Captivate Pharmaceuticals, Llc Therapeutic calcium phosphate particles and methods of manufacture and use
US20040258763A1 (en) * 1999-02-03 2004-12-23 Bell Steve J.D. Methods of manufacture and use of calcium phosphate particles containing allergens
US20030191082A1 (en) * 1999-03-26 2003-10-09 Wheeler Carl J. Adjuvant compositions and methods for enhancing immune responses to polynucleotide-based vaccines
US8415317B2 (en) 1999-03-26 2013-04-09 Vical Incorporated Adjuvant compositions and methods for enhancing immune responses to polynucleotide-based vaccines
US7582613B2 (en) 1999-03-26 2009-09-01 Vical Incorporated Adjuvant compositions and methods for enhancing immune responses to polynucleotide-based vaccines
US20110165197A1 (en) * 1999-03-26 2011-07-07 Vical Incorporated Adjuvant compositions and methods for enhancing immune responses to polynucleotide-based vaccines
US20080145387A1 (en) * 1999-03-26 2008-06-19 Vical Incorporated Adjuvant compositions and methods for enhancing immune responses to polynucleotide-based vaccines
US20050287157A1 (en) * 1999-04-08 2005-12-29 Iomai Corporation Dry formulation for transcutaneous immunization
WO2001061022A1 (en) * 2000-02-15 2001-08-23 Genomine Inc. Recombinant human papillomavirus vaccine expressed in transgenic plants
US20020044948A1 (en) * 2000-03-15 2002-04-18 Samir Khleif Methods and compositions for co-stimulation of immunological responses to peptide antigens
US20040146534A1 (en) * 2001-02-13 2004-07-29 Glenn Gregory M. Vaccine for transcutaneous immunization
US20040241181A1 (en) * 2001-06-22 2004-12-02 Ertl Hildeghund C. J. Methods of inducing a cytotoxic immune response and recormbinant simian adenovirus compositions useful therein
US20050026257A1 (en) * 2001-07-30 2005-02-03 Lutz Gissmann Production and applications for polyvalent vaccines against diseases caused by papilloma viruses
US7354714B2 (en) 2001-07-30 2008-04-08 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Production and applications for polyvalent vaccines against diseases caused by papilloma viruses
US20030185892A1 (en) * 2001-08-17 2003-10-02 Bell Steve J. D. Intraocular delivery compositions and methods
US20030228327A1 (en) * 2001-11-05 2003-12-11 Lasher Alfred W. DNA-based plasmid formulations and vaccines and prophylactics containing the same
US8617533B2 (en) 2002-12-13 2013-12-31 Alphavax, Inc. Multi-antigenic alphavirus replicon particles and methods
US20040208848A1 (en) * 2002-12-13 2004-10-21 Smith Jonathan F. Multi-antigenic alphavirus replicon particles and methods
US7651694B2 (en) 2004-02-13 2010-01-26 Nod Pharmaceuticals, Inc. Therapeutic calcium phosphate particles and methods of making and using same
US20050234114A1 (en) * 2004-02-13 2005-10-20 Lee William W Therapeutic calcium phosphate particles and methods of making and using same
US20090041812A1 (en) * 2004-11-01 2009-02-12 Bell Steve J D Therapeutic Calcium Phosphate Particles in Use for Aesthetic of Cosmetic Medicine, and Methods of Manufacture and Use
US10610469B2 (en) 2004-11-01 2020-04-07 Dr. Leonard B. Miller Therapeutic calcium phosphate particles in use for aesthetic or cosmetic medicine, and methods of manufacture and use
US9388221B2 (en) * 2005-02-01 2016-07-12 The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services Papillomavirus L2 N-terminal peptides for the induction of broadly cross-neutralizing antibodies
US20130177585A1 (en) * 2005-02-01 2013-07-11 John T. Schiller Papillomavirus l2 n-terminal peptides for the induction of broadly cross-neutralizing antibodies
US20090047301A1 (en) * 2005-02-01 2009-02-19 The Johns Hopkins University Papillomavirus L2 N-Terminal Peptides for the Induction of Broadly Cross-Neutralizing Antibodies
US8404244B2 (en) 2005-02-01 2013-03-26 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Papillomavirus L2 N-terminal peptides for the induction of broadly cross-neutralizing antibodies
US9364529B2 (en) 2007-04-29 2016-06-14 Beijing Wantai Biological Pharmacy Enterprise Co., Ltd. Truncated L1 protein of human papillomavirus type 18
US9428555B2 (en) 2007-04-29 2016-08-30 Beijing Wantai Biological Pharmacy Enterprise Co., Ltd. Truncated L1 protein of Human Papillomavirus type 16
US20100255031A1 (en) * 2007-04-29 2010-10-07 Ying Gu truncated l1 protein of human papillomavirus type 16
US8748127B2 (en) * 2007-05-29 2014-06-10 Xiamen University Truncated L1 protein of human papillomavirus type 6
US20140288283A1 (en) * 2007-05-29 2014-09-25 Beijing Wantai Biological Pharmacy Enterprise Co., Ltd. Truncated l1 protein of human papillomavirus type 6
US20100255021A1 (en) * 2007-05-29 2010-10-07 Xiamen University Truncated l1 protein of human papillomavirus type 6
US9745351B2 (en) * 2007-05-29 2017-08-29 Xiamen University Truncated L1 protein of human papillomavirus type 6

Also Published As

Publication number Publication date
ATE233101T1 (en) 2003-03-15
AU701973B2 (en) 1999-02-11
DE69529748D1 (en) 2003-04-03
PL180639B1 (en) 2001-03-30
DE69529748T2 (en) 2003-10-16
MX9700229A (en) 1997-04-30
FI965224A0 (en) 1996-12-27
HU9603562D0 (en) 1997-02-28
HUT76446A (en) 1997-09-29
NZ288045A (en) 1998-08-26
PL317874A1 (en) 1997-04-28
ZA954641B (en) 1996-01-26
NO965590L (en) 1997-02-28
FI965224A (en) 1996-12-27
WO1996000583A1 (en) 1996-01-11
CA2193365C (en) 2007-04-03
NO965590D0 (en) 1996-12-27
EP0768893A1 (en) 1997-04-23
CA2193365A1 (en) 1996-01-11
IL113817A0 (en) 1995-08-31
JPH10501987A (en) 1998-02-24
IL113817A (en) 2001-03-19
AU2694595A (en) 1996-01-25
SK164196A3 (en) 1997-08-06
ES2191052T3 (en) 2003-09-01
EP0768893B1 (en) 2003-02-26
CZ375296A3 (en) 1997-08-13
HU220747B1 (en) 2002-05-28
CN1156966A (en) 1997-08-13

Similar Documents

Publication Publication Date Title
US5866553A (en) Polynucleotide vaccine for papillomavirus
RU2360001C2 (en) Optimised expression li hpv45 in yeast
EP0692028B1 (en) Pharmaceuticals based on papillomaviruses
WO1998023635A1 (en) Novel promiscuous t helper cell epitopes
EA012037B1 (en) Multivalent vaccines comprising recombinant viral vectors
Jagu et al. A multimeric L2 vaccine for prevention of animal papillomavirus infections
US6174532B1 (en) L2 immunogenic peptides of papillomavirus
WO1992010513A1 (en) Subunit papillomavirus vaccine and peptides for use therein
US6183745B1 (en) Subunit papilloma virus vaccine and peptides for use therein
AU708460B2 (en) A polynucleotide herpes virus vaccine
CN113278634B (en) Novel vaccine for preventing and treating merkel cell carcinoma
RU2173170C2 (en) Polynucleotide vaccine for papilloma virus
Yi et al. Recombinant bivalent vaccine against foot-and-mouth disease virus serotype O/A infection in guinea pig
MXPA05003558A (en) Dna vaccine encoding at least two nonstructural early proteins of papillomavirus.
Deng et al. The preparation of human papillomavirus type 58 vaccine and exploring its biological activity and immunogenicity in vitro
AU719837B2 (en) Pharmaceuticals based on papillomaviruses
AU660954B2 (en) Subunit papillomavirus vaccine and peptides for use therein
Kwak Development of prophylactic human papillomavirus vaccines
Embers Immunogenicity and Cellular Protein Associations of the Papillomavirus Minor Capsid Protein
AU5013099A (en) Papillomavirus vaccine
AU4889102A (en) Papillomavirus vaccine

Legal Events

Date Code Title Description
AS Assignment

Owner name: MERCK & CO., INC., NEW JERSEY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DONNELLY, JOHN J.;LIU, MARGARET A.;MARTINEZ, DOUGLAS;AND OTHERS;REEL/FRAME:009568/0224

Effective date: 19961211

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

AS Assignment

Owner name: MERCK SHARP & DOHME CORP., NEW JERSEY

Free format text: CHANGE OF NAME;ASSIGNOR:MERCK & CO., INC.;REEL/FRAME:023854/0563

Effective date: 20091102

Owner name: MERCK SHARP & DOHME CORP.,NEW JERSEY

Free format text: CHANGE OF NAME;ASSIGNOR:MERCK & CO., INC.;REEL/FRAME:023854/0563

Effective date: 20091102

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20110202