US5863769A - DNA encoding interleukin-1 receptor antagonist (IL-1raβ) - Google Patents

DNA encoding interleukin-1 receptor antagonist (IL-1raβ) Download PDF

Info

Publication number
US5863769A
US5863769A US08/790,032 US79003297A US5863769A US 5863769 A US5863769 A US 5863769A US 79003297 A US79003297 A US 79003297A US 5863769 A US5863769 A US 5863769A
Authority
US
United States
Prior art keywords
seq
polypeptide
polynucleotide
beta
identity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US08/790,032
Inventor
Peter Ronald Young
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SmithKline Beecham Corp
Original Assignee
SmithKline Beecham Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SmithKline Beecham Corp filed Critical SmithKline Beecham Corp
Assigned to SMITHKLINE BEECHAM CORPORATION reassignment SMITHKLINE BEECHAM CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: YOUNG, PETER RONALD
Priority to US08/790,032 priority Critical patent/US5863769A/en
Priority to DE69800895T priority patent/DE69800895D1/en
Priority to EP98300572A priority patent/EP0855404B1/en
Priority to JP10052620A priority patent/JPH10304888A/en
Priority to CA002232812A priority patent/CA2232812A1/en
Priority to US09/069,619 priority patent/US6054559A/en
Publication of US5863769A publication Critical patent/US5863769A/en
Application granted granted Critical
Priority to JP11134172A priority patent/JP2000032990A/en
Priority to US09/494,018 priority patent/US6399573B1/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by them and to the use of such polynucleotides and polypeptides, and to their production. More particularly, the polynucleotides and polypeptides of the present invention relate to Interleukin-1 family, hereinafter referred to as IL-1ra beta. The invention also relates to inhibiting or activating the action of such polynucleotides and polypeptides.
  • Interleukin 1 refers to two proteins (IL1 ⁇ and IL1 ⁇ ) which play a key role early in the inflammatory response for a review see C. A. Dinarello, Blood, 87:2095-2147 (1996) and references therein!. Both proteins are made as 31 kDal intracellular precursor proteins which are cleaved upon secretion to yield mature carboxy-terminal 17 kDal fragments which are biologically active. In the case of IL-1 ⁇ is active, this cleavage involves an intracellular cysteine protease, known as ICE, which is required to release the active fragment from the inactive precursor. The precursor of IL-1 ⁇ is active.
  • ICE intracellular cysteine protease
  • fibroblasts T cells
  • apoptosis eg A375 melanoma cells
  • cytokine induction eg of TNF, IL1, IL8
  • receptor activation eg E-selectin
  • eicosanoid production eg PGE2
  • degradative enzymes eg collagenase
  • IL-1 activates transcription factors such as NF- ⁇ B and AP-1
  • transcription factors such as NF- ⁇ B and AP-1
  • kinase cascades that have also been associated with cellular stresses, such as the stress activated MAP kinases JNK/SAPK and p38.
  • IL-1ra for IL-1 receptor antagonist
  • IRAP for IL-1 receptor antagonist protein
  • IL-1 ⁇ All three proteins, IL-1 ⁇ , IL-1 ⁇ and IL-1ra share approximately 25-30% amino acid identity and a similar three-dimensional structure consisting of twelve ⁇ -strands folded into a ⁇ -barrel, with an internal thrice repeated structural motif.
  • the active receptor complex consists of the type I receptor and IL1RAcP (for IL-1 accessory protein).
  • the type I receptor is responsible for binding of the three ligands, and is able to do so in the absence of the IL1RAcP.
  • signal transduction requires interaction of IL-1 ⁇ or ⁇ with the IL1RAcP.
  • IL-1ra does not interact with the IL-1 RAcP and hence cannot signal.
  • a third receptor subunit, the type II receptor binds IL-1 ⁇ and IL-1 ⁇ but cannot signal due to its lack of an intracellular domain. Rather it act as a decoy either in its membrane form or an antagonist in a cleaved secreted form, and hence inhibits IL-1 activity. It only weakly binds IL-1ra.
  • IL-1ra soluble IL-1 R
  • IL-1 ⁇ or ⁇ transgenic knockouts of these genes
  • IL-1ra has been shown to be effective in animal models of septic shock, rheumatoid arthritis, graft versus host disease, stroke, cardiac ischemia, and is currently in clinical trials for some of these indications.
  • IL-1 ⁇ and ⁇ have shown some potential as hematopoietic stem cell stimulators with potential as radio and chemoprotectants.
  • Interferon gamma inducing factor H. Okamura et al., Nature 378:88-91 (1995)!, was subsequently shown to fold in a similar structure to the IL-1s and share weak amino acid identity Bazan et al., Nature 379:59! (1996).
  • the name IL-1 ⁇ was proposed.
  • IGIF appears to play a direct role in the liver damage which occurs during toxic shock and is therefore like the other IL-1s in playing an early role in inflammatory and stressful conditions.
  • Interleukin-1s have an established, proven history as therapeutic targets.
  • septicenmia shock, arthritis
  • inflammatory bowel disease graft vs. host disease
  • autoimmunity stroke
  • cardiac ischemia acute respiratory disease syndrome
  • psoriasis psoriasis
  • restenosis traumatic brain injury
  • AIDS cachexia
  • the invention relates to IL-1ra beta polypeptides and recombinant materials and methods for their production.
  • Another aspect of the invention relates to methods for using such IL-1ra beta polypeptides and polynucleotides. Such uses include the treatment of chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, shock, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia, among others.
  • the invention relates to methods to identify agonists and antagonists using the materials provided by the invention, and treating conditions associated with IL-1ra beta imbalance with the identified compounds.
  • Yet another aspect of the invention relates to diagnostic assays for detecting diseases associated with inappropriate IL-1ra beta activity or levels.
  • FIG. 1 shows the nucleotide and deduced amino acid sequence of human IL-1ra beta. SEQ ID NOS: 1 and 2.
  • IL-1ra beta refers generally to a polypeptide having the amino acid sequence set forth in SEQ ID NO: 2 or an allelic variant thereof.
  • IL-1ra beta activity or IL-1ra beta polypeptide activity or “biological activity of the IL-1ra beta or IL-1ra beta polypeptide” refers to the metabolic or physiologic function of said IL-1ra beta including similar activities or improved activities or these activities with decreased undesirable side-effects. Also included are antigenic and immunogenic activities of said IL-1ra beta.
  • IL-1ra beta polypeptides refers to polypeptides with amino acid sequences sufficiently similar to IL-1ra beta sequences, preferably exhibiting at least one biological activity of the IL-1ra beta.
  • IL-1ra beta gene refers to a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 1 or allelic variants thereof and/or their complements.
  • IL-1ra beta polynucleotides refers to polynucleotides containing a nucleotide sequence which encodes a IL-1ra beta polypeptide or fragment thereof, or a nucleotide sequence which has at least 80% identity to a nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or the corresponding fragment thereof, or a nucleotide sequence which has sufficient 80% identity to a nucleotide sequence contained in SEQ ID NO:1 to hybridize under conditions useable for amplification or for use as a probe or marker.
  • Antibodies as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as Fab fragments, including the products of an Pab or other immunoglobulin expression library.
  • Isolated means altered “by the hand of man” from the natural state. If an "isolated” composition or substance occurs in nature, it has been changed or removed from its original environment, or both.
  • a polynucleotide or a polypeptide naturally present in a living animal is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.
  • Polynucleotide generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • Polynucleotides include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • polynucleotide embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells.
  • Polynucleotide also embraces relatively short polynucleotides, often referred to as oligonucleotides.
  • Polypeptide refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres.
  • Polypeptide refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids.
  • Polypeptides include amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.
  • Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.
  • Variant is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties.
  • a typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below.
  • a typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical.
  • a variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination.
  • a substituted or inserted amino acid residue may or may not be one encoded by the genetic code.
  • a variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.
  • Identity is a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. "Identity” per se has an art-recognized meaning and can be calculated using published techniques. See, e.g.: (COMPUTATIONAL MOLECULAR BIOLOGY; Lesk, A. M., ed., Oxford University Press, N.Y., 1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, D. W., ed., Academic Press, N.Y., 1993; COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, A. M., and Griffin, H.
  • Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., et al., Nucleic Acids Research (1984) 12 (1):387), BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J Molec Biol (1990) 215:403).
  • the IL-1ra beta polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as IL-1ra beta polypeptides and which have at least 80% identity to the polypeptide of SEQ ID NO:2 or the relevant portion and more preferably at least 85% identity, and still more preferably at least 90% identity, and even still more preferably at least 95% identity to SEQ ID NO:2.
  • the IL-1ra beta polypeptides may be in the form of the "mature" protein or may be a part of a larger protein such as a fusion protein. It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification such as multiple histidine residues, or an additional sequence for stability during recombinant production.
  • a fragment is a polypeptide having an amino acid sequence that entirely is the same as part, but not all, of the amino acid sequence of the aforementioned IL-1ra beta polypeptides.
  • fragments may be "free-standing," or comprised within a larger polypeptide of which they form a part or region, most preferably as a single continuous region.
  • Representative examples of polypeptide fragments of the invention include, for example, fragments from about amino acid number 1-20, 21-40,41-60, 61-80, 81-100, and 101 to the end of IL-1ra beta polypeptide.
  • “about” includes the particularly recited ranges larger or smaller by several, 5, 4, 3, 2 or 1 amino acid at either extreme or at both extremes.
  • Preferred fragments include, for example, truncation polypeptides having the amino acid sequence of IL-1ra beta polypeptides, except for deletion of a continuous series of residues that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terminus.
  • fragments characterized by structural or functional attributes such as fragments that comprise alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-forming regions, turn and turn-forming regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions.
  • Biologically active fragments are those that mediate IL-1ra beta activity, including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also included are those that are antigenic or immunogenic in an animal, especially in a human.
  • polypeptides of the invention include polypeptides having an amino acid sequence at least identical to that of SEQ ID NO:2 or fragments thereof with at least 80% identity to the corresponding fragment of SEQ ID NO:2.
  • all of these polypeptides retain the biological activity of the IL-1ra beta, including antigenic activity.
  • variants of the defined sequence and fragments include those that vary from the referents by conservative amino acid substitutions - i.e., those that substitute a residue with another of like characteristics.
  • Typical such substitutions are among Ala, Val, Leu and Ile; among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gln; and among the basic residues Lys and Arg; or aromatic residues Phe and Tyr.
  • Particularly preferred are variants in which several, 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination.
  • the IL-1ra beta polypeptides of the invention can be prepared in any suitable manner.
  • Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.
  • Another aspect of the invention relates to isolated polynucleotides which encode the IL-1ra beta polypeptides and polynucleotides closely related thereto.
  • IL-1ra beta of the invention is structurally related to other proteins of the Interleukin- I family, as shown by the results of sequencing the cDNA encoding human IL-1ra beta.
  • the cDNA sequence contains an open reading frame encoding a protein of 169 amino acids with a deduced molecular weight of 18.7 kDa.
  • IL-1ra beta of FIG. 1 (SEQ ID NO:2) has about 29.9% identity (using BESTFIT (part of GCG suite of programs)) in amino acid residues with human IL-1 receptor antagonist (IL-1ra ) (S.P. Eisenberg et al., Nature 343:341-346, 1990) over 162 residues.
  • IL-1ra beta (SEQ ID NO:2) is 21.3% identical to human Interleukin-1 beta (IL-1 beta) over 160 residues (P. E. Auron et al., Proc Natl. Acad. Sci. USA 81:7907-7911, 1984; C. J. March et al., Nature 315:641-647 (1985)).
  • IL-1ra beta gene of FIG. 1 (SEQ ID NO:1) has about 59.0% identity (using BESTFED (part of the GCG suite of programs)) in 230 nucleotide residues with human IL-1ra .
  • One polynucleotide of the present invention encoding IL-1ra beta may be obtained using standard cloning and screening, from a cDNA library derived from mRNA in cells of human keratinocytes and TNF ⁇ plus IFN ⁇ (Interferon ⁇ ) induced epithelial cells using the expressed sequence tag (EST) analysis (Adams, M. D., et al. Science (1991) 252:1651 -1656; Adams, M. D. et al., Nature, (1992) 355:632-634; Adams, M. D., et al., Nature(1995) 377 Supp:3-174).
  • Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques.
  • the nucleotide sequence encoding IL-1ra beta polypeptides may be identical over its entire length to the coding sequence in FIG. 1 (SEQ ID NO:1), or may be a degenerate form of this nucleotide sequence encoding the polypeptide of SEQ ID NO:2, or may be highly identical to a nucleotide sequence that encodes the polypeptide of SEQ ID NO:2.
  • the polynucleotides of the invention contain a nucleotide sequence that is highly identical, at least identical, with a nucleotide sequence encoding a IL-1ra beta polypeptide, or at least 80% identical with the encoding nucleotide sequence set forth in FIG. 1 (SEQ ID NO:1), or at least 80% identical to a nucleotide sequence encoding the polypeptide of SEQ ID NO:2.
  • the polynucleotide may include the coding sequence for the mature polypeptide or a fragment thereof, by itself; the coding sequence for the mature polypeptide or fragment in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions.
  • a marker sequence which facilitates purification of the fused polypeptide can be encoded.
  • the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz et al., Proc Natl Acad Sci USA (1989) 86:821-824, or is an HA tag.
  • the polynucleotide may also contain non-coding 5' and 3' sequences, such as transcribed, non-translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.
  • EL-1ra beta polypeptides having the amino acid sequence of set out in FIG. 1 (SEQ ID NO:2) and variants thereof.
  • IL-1ra beta variants that have the amino acid sequence of the IL-1ra beta polypeptide of FIG. 1 (SEQ ID NO:2) in which several, 5-10, 1-5, 1-3, 1-2 or 1 amino acid residues are substituted, deleted or added, in any combination.
  • polynucleotides that are at least 80% identical over their entire length to a polynucleotide encoding the IL-1ra beta polypeptide having the amino acid sequence set out in FIG. 1 (SEQ ID NO:2), and polynucleotides which are complementary to such polynucleotides.
  • polynucleotides at least 80% identical over their entire length to the same are particularly preferred, and those with at least 90% are especially preferred.
  • those with at least 97% are highly preferred and those with at least 98-99% are most highly preferred, with at least 99% being the most preferred.
  • the present invention further relates to polynucleotides that hybridize to the herein above-described sequences.
  • the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • Polynucleotides of the invention which are sufficiently identical to a nucleotide sequence contained in SEQ ID NO:1, may be used as hybridization probes for cDNA and genomic DNA, to isolate full-length cDNAs and genomic clones encoding IL-1ra beta polypeptide and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the IL-1ra beta gene.
  • hybridization techniques are known to those of skill in the art.
  • these nucleotide sequences are 70% identical, preferably 80% identical, more preferably 90% identical to that of the referent.
  • the probes generally will comprise at least 15 nucleotides.
  • such probes will have at least 30 nucleotides and may have at least 50 nucleotides. Particularly preferred probes will range between 30 and 50 nucleotides.
  • polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to animal and human disease.
  • the present invention also relates to vectors which comprise a polynucleotide or polynucleotides of the present invention, and host cells which are genetically engineered with vectors of the invention and to the production of polypeptides of the invention by recombinant techniques.
  • Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
  • host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention.
  • Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al., BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection.
  • bacterial cells such as streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Aspergillus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells
  • plant cells include bacterial cells, such as streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Aspergillus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells
  • plant cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanom
  • Such systems include, among others, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
  • viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses
  • vectors derived from combinations thereof such as those derived from plasmid and bacteriophage genetic elements, such as cosmid
  • the expression systems may contain control regions that regulate as well as engender expression.
  • any system or vector suitable to maintain, propagate or express polynucleotides to produce a polypeptide in a host may be used.
  • the appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL (supra).
  • secretion signals may be incorporated into the desired polypeptide. These signals may be endogenous to the polypeptide or they may be heterologous signals.
  • the polypeptide may be produced at the surface of the cell. In this event, the cells may be harvested prior to use in the screening assay. If IL-1ra beta polypeptide is secreted into the medium, the medium can be recovered in order to recover and purify the polypeptide; if produced intracellularly, the cells must first be lysed before the polypeptide is recovered.
  • IL-1ra beta polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography is employed for purification. Well known techniques for refolding proteins may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification.
  • This invention also relates to the use of IL-1ra beta polynucleotides for use as diagnostic reagents. Detection of a mutated form of IL-1ra beta gene associated with a dysfunction will provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from under-expression, over-expression or altered expression of IL-1ra beta. Individuals carrying mutations in the IL-1ra beta gene may be detected at the DNA level by a variety of techniques.
  • Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR or other amplification techniques prior to analysis.
  • RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to labeled IL-1ra beta nucleotide sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures.
  • DNA sequence differences may also be detected by alterations in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing. See, e.g., Myers et al., Science (1985) 230:1242. Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method. See Cotton et al., Proc Natl Acad Sci USA (1985) 85:4397-4401.
  • an array of oligonucleotides probes comprising fragments from IL-1ra beta nucleotide sequences can be constructed to conduct efficient screening of e.g., genetic mutations.
  • the diagnostic assays offer a process for diagnosing or determining a susceptibility to chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia. through detection of mutation in the IL-1ra beta gene by the methods described.
  • septicemia septicemia
  • arthritis inflammatory bowel disease
  • graft vs. host disease autoimmunity
  • stroke cardiac ischemia
  • acute respiratory disease syndrome ARDS
  • psoriasis restenosis
  • traumatic brain injury AIDS
  • cachexia cachexia
  • methods comprising determining from a sample derived from a subject an abnormally decreased or increased level of IL-1ra beta polypeptide or IL-1ra beta mRNA. Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods.
  • Assay techniques that can be used to determine levels of a protein, such as an IL-1ra beta polypeptide, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.
  • the nucleotide sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • the mapping of relevant sequences to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
  • the IL-1ra beta gene was mapped to chromosome 2, in a region close to IL-1 ⁇ , ⁇ and IL-1ra by comparing with public databases containing sequences obtained from mapped fragments of genomic DNA obtained by PCR using synthetic oligonucleotide primer pairs.
  • the differences in the cDNA or genomic sequence between affected and unaffected individuals can also be determined. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
  • polypeptides of the invention or their fragments or analogs thereof, or cells expressing them can also be used as immunogens to produce antibodies immunospecific for the IL-1ra beta polypeptides.
  • immunospecific means that the antibodies have substantiall greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art.
  • Antibodies generated against the IL-1ra beta polypeptides can be obtained by administering the polypeptides or epitope-bearing fragments, analogs or cells to an animal, preferably a nonhuman, using routine protocols.
  • an animal preferably a nonhuman
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G.
  • the above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography.
  • Antibodies against IL-1ra beta polypeptides may also be employed to treat chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia., among others.
  • Another aspect of the invention relates to a method for inducing an immunological response in a mammal which comprises inoculating the mammal with IL-1ra beta polypeptide, or a fragment thereof, adequate to produce antibody and/or T cell immune response to protect said animal from chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia., among others.
  • IL-1ra beta polypeptide or a fragment thereof
  • Yet another aspect of the invention relates to a method of inducing immunological response in a mammal which comprises, delivering IL-1ra beta gene via a vector directing expression of IL-1ra beta polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal from diseases.
  • composition which, when introduced into a mammalian host, induces an immunological response in that mammal to a IL-1ra beta polypeptide wherein the composition comprises a IL-1ra beta polypeptide or IL-1ra beta gene.
  • the vaccine formulation may further comprise a suitable carrier. Since IL-1ra beta polypeptide may be broken down in the stomach, it is preferably administered parenterally (including subcutaneous, intramuscular, intravenous, intradermal etc. injection).
  • Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation instonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use.
  • the vaccine formulation may also include adjuvant systems for enhancing the immunogenicity of the formulation, such as oil-in water systems and other systems known in the art. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.
  • the IL-1ra beta polypeptide of the present invention may be employed in a screening process for compounds which stimulate (agonists) or inhibit (antagonists, or otherwise called inhibitors) the synthesis or action of the IL-1ra beta polypeptide of the present invention.
  • the IL-1ra beta polypeptide of the present invention may also be employed in a screening process for compounds which mimic the agonist or antagonist properties of the IL-1ra beta polypeptide of the present invention.
  • polypeptides of the invention may also be used to assess and identify agonist or antagonists from, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures.
  • agonists or antagonists may be natural substrates, ligands, receptors, etc., as the case may be, of the polypeptide of the present invention; or may be structural or functional mimetics of the polypeptide of the present invention. See Coligan et al., Current Protocols in Immunology 1(2):Chapter 5 (1991).
  • IL-1ra beta proteins are ubiquitous in the mammalian host and are responsible for many biological functions, including many pathologies. Accordingly, it is desirous to find compounds and drugs which stimulate IL-1ra beta polypeptide on the one hand and which can inhibit the function of IL-1ra beta polypeptide on the other hand.
  • agonists are employed for therapeutic and prophylactic purposes for such conditions as chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia.
  • Antagonists may be employed for a variety of therapeutic and prophylactic purposes for such conditions as chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, shock, atherschlerosis, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia.
  • septicemia arthritis
  • inflammatory bowel disease graft vs. host disease
  • autoimmunity stroke
  • shock atherschlerosis
  • cardiac ischemia cardiac ischemia
  • ARDS acute respiratory disease syndrome
  • psoriasis restenosis
  • traumatic brain injury AIDS
  • cachexia cachexia
  • such screening procedures may involve identifying, generating and using appropriate cells which express the receptor of the IL-1ra beta polypeptide of the present invention on the surface thereof.
  • Such cells include cells from mammals, yeast, Drosophila or E. coli.
  • Such cells may be identified, for example, by direct binding methods using radiolabeled or fluorescently tagged IL-1ra beta polypeptide.
  • Cells expressing the IL-1ra beta polypeptide receptor (or cell membrane containing the expressed polypeptide) are then contacted with a test compound to observe binding, or stimulation or inhibition of a functional response.
  • the cDNA for the IL-1ra beta polypeptide receptor may be cloned by the above direct binding methods using expression cloning or purification methods known in the art, and its intracellular domain expressed as a secreted or membrane protein.
  • the soluble or membrane bound receptor can then be used to identify agonists or antagonists via direct binding methods.
  • the assays may simply test binding of a candidate compound wherein adherence to the cells bearing the IL-1ra beta polypeptide receptor is detected by means of a label directly or indirectly associated with the candidate compound or in an assay involving competition with a labeled IL-1ra beta polypeptide. Further, these assays may test whether the candidate compound results in a signal similar to that generated by binding of the IL-1ra beta polypeptide, using detection systems appropriate to the cells bearing the IL-1ra beta polypeptide receptor at their surfaces. Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist by the presence of the candidate compound is observed. Standard methods for conducting such screening assays are well understood in the art.
  • IL-1ra beta polypeptide antagonists include antibodies or, in some cases, oligonucleotides or proteins which are closely related to the ligands, substrates, receptors, etc., as the case may be, of the IL-1ra beta polypeptide, e.g., a fragment of the ligands, substrates, receptors, or small molecules which bind to the target receptor of the present invention but do not elicit a response, so that the activity of the polypeptide is prevented.
  • This invention provides methods of treating an abnormal conditions related to both an excess of and insufficient amounts of IL-1ra beta polypeptide activity.
  • One approach comprises administering to a subject an inhibitor compound (antagonist) as herein above described along with a pharmaceutically acceptable carrier in an amount effective to inhibit activation by blocking binding of the IL-1ra beta polypeptide to its target receptor, or by inhibiting a second signal, and thereby alleviating the abnormal condition.
  • soluble forms of EL-1ra beta polypeptides capable of binding its receptor in competition with endogenous IL-1ra beta polypeptide may be administered.
  • Typical embodiments of such competitors comprise fragments of the IL-1ra beta polypeptide.
  • expression of the gene encoding endogenous IL-1ra beta polypeptide can be inhibited using expression blocking techniques.
  • Known such techniques involve the use of antisense sequences, either internally generated or separately administered. See, for example, O'Connor, J Neurochem (1991) 56:560 in Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988).
  • oligonucleotides which form triple helices with the gene can be supplied. See, for example, Lee et al., Nucleic Acids Res (1979) 3:173; Cooney et al, Science (1988) 241:456; Dervan et al, Science (1991) 251:1360. These oligomers can be administered per se or the relevant oligomers can be expressed in vivo.
  • IL-1ra beta For treating abnormal conditions related to an under-expression of IL-1ra beta and its activity, several approaches are also available.
  • One approach comprises administering to a subject a therapeutically effective amount of the IL-1ra beta polypeptide or a compound, i.e., an agonist or mimetic as described above, in combination with a pharmaceutically acceptable carrier, to thereby alleviate the abnormal condition.
  • gene therapy may be employed to effect the endogenous production of IL-1ra beta by the relevant cells in the subject.
  • a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as discussed above.
  • the retroviral expression construct may then be isolated and introduced into a packaging cell transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest.
  • These producer cells may be administered to a subject for engineering cells in vivo and expression of the polypeptide in vivo.
  • gene therapy see Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) in Human Molecular Genetics, T Strachan and A P Read, BIOS Scientific Publishers Ltd (1996).
  • Peptides such as the soluble form of IL-1ra beta polypeptides, and agonists and antagonist peptides or small molecules, may be formulated in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier include but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. Formulation should suit the mode of administration, and is well within the skill of the art.
  • the invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.
  • Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
  • systemic administration of the pharmaceutical compositions include injection, typically by intravenous injection.
  • Other injection routes such as subcutaneous, intramuscular, or intraperitoneal, can be used.
  • Alternative means for systemic administration include transmucosal and transdermal administration using penetrants such as bile salts or fusidic acids or other detergents.
  • penetrants such as bile salts or fusidic acids or other detergents.
  • oral administration may also be possible.
  • Administration of these compounds may also be topical and/or localized, in the form of salves, pastes, gels and the like.
  • the dosage range required depends on the choice of peptide, the route of administration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending practitioner. Suitable dosages, however, are in the range of 0.1-100 ⁇ g/kg of subject. Wide variations in the needed dosage, however, are to be expected in view of the variety of compounds available and the differing efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art.
  • Polypeptides used in treatment can also be generated endogenously in the subject, in treatment modalities often referred to as "gene therapy" as described above.
  • cells from a subject may be engineered with a polynucleotide, such as a DNA or RNA, to encode a polypeptide ex vivo, and for example, by the use of a retroviral plasmid vector. The cells are then introduced into the subject.
  • a polynucleotide such as a DNA or RNA
  • HGS EST #1506331 Project ID HAICQ62
  • Human Genome Sciences EST database vide supra for EST analysis
  • This partial sequence showed significant seqeunce identity (35% over 77 aa) to murine IL-1ra.
  • This cDNA was completely sequenced on both strands using an automated sequencer.
  • a total of 1183 bp were sequenced, and this includes an open reading frame enconding a peptide of 169 aa.
  • the cDNA and protein sequences are SEQ ID NOS: 1 and 2, respectively, and are named IL-1 ra ⁇ .
  • the protein does not appear to have a signal sequence at its amino terminus and is likely to be expressed as an intracellular, cytosolic protein like other members of the family. It is possible that alternative splice forms exist which include a signal sequence, as has been found for IL-1ra.
  • the IL-1ra beta gene was mapped to chromosome 2, in a region close to IL-1 ⁇ , and ⁇ and IL-1ra by comparing with public databases containing sequences obtained from mapped fragments of genomic DNA obtained by PCR using synthetic oligonucleotide primer pairs. Using the algorithm BLAST, a match was found with human STS CHLC.GAAT11C03.P3330 clone GAAT11lC03 (Accession number G942011) which can be mapped to chromosome 2 approximately 142 cM from the top of the chromosome.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

IL-1ra beta polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing IL-1ra beta polypeptides and polynucleotides in the design of protocols for the treatment of chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia., among others, and diagnostic assays for such conditions.

Description

FIELD OF INVENTION
This invention relates to newly identified polynucleotides, polypeptides encoded by them and to the use of such polynucleotides and polypeptides, and to their production. More particularly, the polynucleotides and polypeptides of the present invention relate to Interleukin-1 family, hereinafter referred to as IL-1ra beta. The invention also relates to inhibiting or activating the action of such polynucleotides and polypeptides.
BACKGROUND OF THE INVENTION
Interleukin 1 refers to two proteins (IL1α and IL1β) which play a key role early in the inflammatory response for a review see C. A. Dinarello, Blood, 87:2095-2147 (1996) and references therein!. Both proteins are made as 31 kDal intracellular precursor proteins which are cleaved upon secretion to yield mature carboxy-terminal 17 kDal fragments which are biologically active. In the case of IL-1β is active, this cleavage involves an intracellular cysteine protease, known as ICE, which is required to release the active fragment from the inactive precursor. The precursor of IL-1α is active.
These two proteins act by binding to cell surface receptors found on almost all cell types and triggering a range of responses either alone or in concert with other secreted factors. These range from effects on proliferation (eg of fibroblasts, T cells), apoptosis (eg A375 melanoma cells), cytokine induction (eg of TNF, IL1, IL8), receptor activation (eg E-selectin), eicosanoid production (eg PGE2) and the secretion of degradative enzymes (eg collagenase). To achieve this, IL-1 activates transcription factors such as NF-κB and AP-1, Several of the activities of IL-1 action on target cells are believed to be mediated through activation of kinase cascades that have also been associated with cellular stresses, such as the stress activated MAP kinases JNK/SAPK and p38.
A third member of the IL-1 family was subsequently discovered which acts as a natural antagonist of IL-1α and IL-1β by binding to the IL-1 receptor but not transducing an intracellular signal or a biological response. The protein was called IL-1ra (for IL-1 receptor antagonist) or IRAP (for IL-1 receptor antagonist protein). At least three alternatively splice forms of IL-1ra exist: one encodes a secreted protein, and the other two encode intracellular proteins. The relative role of the three forms and reason for their different localization is not known. All three proteins, IL-1α, IL-1β and IL-1ra share approximately 25-30% amino acid identity and a similar three-dimensional structure consisting of twelve β-strands folded into a β-barrel, with an internal thrice repeated structural motif.
There are three known IL-1 receptor subunits. The active receptor complex consists of the type I receptor and IL1RAcP (for IL-1 accessory protein). The type I receptor is responsible for binding of the three ligands, and is able to do so in the absence of the IL1RAcP. However signal transduction requires interaction of IL-1α or β with the IL1RAcP. IL-1ra does not interact with the IL-1 RAcP and hence cannot signal. A third receptor subunit, the type II receptor, binds IL-1α and IL-1β but cannot signal due to its lack of an intracellular domain. Rather it act as a decoy either in its membrane form or an antagonist in a cleaved secreted form, and hence inhibits IL-1 activity. It only weakly binds IL-1ra.
Many studies using IL-1ra, soluble IL-1 R, derived from the intracellular domain of the type I IL-1R, antibodies to IL-1α or β, and transgenic knockouts of these genes have shown conclusively that the IL-1 s play a key role in a number of pathophysiologies (see C. A. Dinarello, Blood 87:2095-2147 (1996) for a review). For example, IL-1ra has been shown to be effective in animal models of septic shock, rheumatoid arthritis, graft versus host disease, stroke, cardiac ischemia, and is currently in clinical trials for some of these indications. Moreover, IL-1α and β have shown some potential as hematopoietic stem cell stimulators with potential as radio and chemoprotectants.
More recently, a more distant member of the IL-1 family was identified. This protein, originally isolated through its ability to induce Interferon gamma in T cells and hence called Interferon gamma inducing factor (IGIF) H. Okamura et al., Nature 378:88-91 (1995)!, was subsequently shown to fold in a similar structure to the IL-1s and share weak amino acid identity Bazan et al., Nature 379:59! (1996). The name IL-1γ was proposed. IGIF appears to play a direct role in the liver damage which occurs during toxic shock and is therefore like the other IL-1s in playing an early role in inflammatory and stressful conditions.
This indicates that these Interleukin-1s have an established, proven history as therapeutic targets. Clearly there is a need for identification and characterization of further members of Interleukin-1 family which can play a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, chronic and acute inflanmmation, septicenmia, shock, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, and cachexia.
SUMMARY OF THE INVENTION
In one aspect, the invention relates to IL-1ra beta polypeptides and recombinant materials and methods for their production. Another aspect of the invention relates to methods for using such IL-1ra beta polypeptides and polynucleotides. Such uses include the treatment of chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, shock, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia, among others. In still another aspect, the invention relates to methods to identify agonists and antagonists using the materials provided by the invention, and treating conditions associated with IL-1ra beta imbalance with the identified compounds. Yet another aspect of the invention relates to diagnostic assays for detecting diseases associated with inappropriate IL-1ra beta activity or levels.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the nucleotide and deduced amino acid sequence of human IL-1ra beta. SEQ ID NOS: 1 and 2.
DESCRIPTION OF THE INVENTION Definitions
The following definitions are provided to facilitate understanding of certain terms used frequently herein.
"IL-1ra beta" refers generally to a polypeptide having the amino acid sequence set forth in SEQ ID NO: 2 or an allelic variant thereof.
"IL-1ra beta activity or IL-1ra beta polypeptide activity" or "biological activity of the IL-1ra beta or IL-1ra beta polypeptide" refers to the metabolic or physiologic function of said IL-1ra beta including similar activities or improved activities or these activities with decreased undesirable side-effects. Also included are antigenic and immunogenic activities of said IL-1ra beta.
"IL-1ra beta polypeptides" refers to polypeptides with amino acid sequences sufficiently similar to IL-1ra beta sequences, preferably exhibiting at least one biological activity of the IL-1ra beta.
"IL-1ra beta gene" refers to a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 1 or allelic variants thereof and/or their complements.
"IL-1ra beta polynucleotides" refers to polynucleotides containing a nucleotide sequence which encodes a IL-1ra beta polypeptide or fragment thereof, or a nucleotide sequence which has at least 80% identity to a nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or the corresponding fragment thereof, or a nucleotide sequence which has sufficient 80% identity to a nucleotide sequence contained in SEQ ID NO:1 to hybridize under conditions useable for amplification or for use as a probe or marker.
"Antibodies" as used herein includes polyclonal and monoclonal antibodies, chimeric, single chain, and humanized antibodies, as well as Fab fragments, including the products of an Pab or other immunoglobulin expression library.
"Isolated" means altered "by the hand of man" from the natural state. If an "isolated" composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.
"Polynucleotide" generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotides" include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications has been made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.
"Polypeptide" refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. "Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. "Polypeptides" include amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, PROTEINS--STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, N.Y., 1993 and Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, N.Y., 1983; Seifter et al., "Analysis for protein modifications and nonprotein cofactors", Meth Enzymol (1990) 182:626-646 and Rattan et al., "Protein Synthesis: Posttranslational Modifications and Aging", Ann NY Acad Sci (1992) 663:48-62.
"Variant" as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.
"Identity" is a measure of the identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. "Identity" per se has an art-recognized meaning and can be calculated using published techniques. See, e.g.: (COMPUTATIONAL MOLECULAR BIOLOGY; Lesk, A. M., ed., Oxford University Press, N.Y., 1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, D. W., ed., Academic Press, N.Y., 1993; COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, N.J., 1994; SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heinje, G., Academic Press, 1987; and SEQUENCE ANALYSIS PRIMER, Gribskov, M. and Devereux, J., eds., M Stockton Press, N.Y., 1991). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity" is well known to skilled artisans (Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., et al., Nucleic Acids Research (1984) 12 (1):387), BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J Molec Biol (1990) 215:403).
Polypeptides of the Invention
The IL-1ra beta polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as IL-1ra beta polypeptides and which have at least 80% identity to the polypeptide of SEQ ID NO:2 or the relevant portion and more preferably at least 85% identity, and still more preferably at least 90% identity, and even still more preferably at least 95% identity to SEQ ID NO:2.
The IL-1ra beta polypeptides may be in the form of the "mature" protein or may be a part of a larger protein such as a fusion protein. It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification such as multiple histidine residues, or an additional sequence for stability during recombinant production.
Biologically active fragments of the IL-1ra beta polypeptides are also included in the invention. A fragment is a polypeptide having an amino acid sequence that entirely is the same as part, but not all, of the amino acid sequence of the aforementioned IL-1ra beta polypeptides. As with IL-1ra beta polypeptides, fragments may be "free-standing," or comprised within a larger polypeptide of which they form a part or region, most preferably as a single continuous region. Representative examples of polypeptide fragments of the invention, include, for example, fragments from about amino acid number 1-20, 21-40,41-60, 61-80, 81-100, and 101 to the end of IL-1ra beta polypeptide. In this context "about" includes the particularly recited ranges larger or smaller by several, 5, 4, 3, 2 or 1 amino acid at either extreme or at both extremes.
Preferred fragments include, for example, truncation polypeptides having the amino acid sequence of IL-1ra beta polypeptides, except for deletion of a continuous series of residues that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terminus. Also preferred are fragments characterized by structural or functional attributes such as fragments that comprise alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-forming regions, turn and turn-forming regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions. Biologically active fragments are those that mediate IL-1ra beta activity, including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also included are those that are antigenic or immunogenic in an animal, especially in a human.
Thus, the polypeptides of the invention include polypeptides having an amino acid sequence at least identical to that of SEQ ID NO:2 or fragments thereof with at least 80% identity to the corresponding fragment of SEQ ID NO:2. Preferably, all of these polypeptides retain the biological activity of the IL-1ra beta, including antigenic activity. Included in this group are variants of the defined sequence and fragments. Preferred variants are those that vary from the referents by conservative amino acid substitutions - i.e., those that substitute a residue with another of like characteristics. Typical such substitutions are among Ala, Val, Leu and Ile; among Ser and Thr; among the acidic residues Asp and Glu; among Asn and Gln; and among the basic residues Lys and Arg; or aromatic residues Phe and Tyr. Particularly preferred are variants in which several, 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination.
The IL-1ra beta polypeptides of the invention can be prepared in any suitable manner. Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.
Polynucleotides of the Invention
Another aspect of the invention relates to isolated polynucleotides which encode the IL-1ra beta polypeptides and polynucleotides closely related thereto.
IL-1ra beta of the invention is structurally related to other proteins of the Interleukin- I family, as shown by the results of sequencing the cDNA encoding human IL-1ra beta. The cDNA sequence contains an open reading frame encoding a protein of 169 amino acids with a deduced molecular weight of 18.7 kDa. IL-1ra beta of FIG. 1 (SEQ ID NO:2) has about 29.9% identity (using BESTFIT (part of GCG suite of programs)) in amino acid residues with human IL-1 receptor antagonist (IL-1ra ) (S.P. Eisenberg et al., Nature 343:341-346, 1990) over 162 residues. Furthermore, IL-1ra beta (SEQ ID NO:2) is 21.3% identical to human Interleukin-1 beta (IL-1 beta) over 160 residues (P. E. Auron et al., Proc Natl. Acad. Sci. USA 81:7907-7911, 1984; C. J. March et al., Nature 315:641-647 (1985)). IL-1ra beta gene of FIG. 1 (SEQ ID NO:1) has about 59.0% identity (using BESTFED (part of the GCG suite of programs)) in 230 nucleotide residues with human IL-1ra .
One polynucleotide of the present invention encoding IL-1ra beta may be obtained using standard cloning and screening, from a cDNA library derived from mRNA in cells of human keratinocytes and TNFα plus IFN γ (Interferon γ) induced epithelial cells using the expressed sequence tag (EST) analysis (Adams, M. D., et al. Science (1991) 252:1651 -1656; Adams, M. D. et al., Nature, (1992) 355:632-634; Adams, M. D., et al., Nature(1995) 377 Supp:3-174). Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques.
Thus, the nucleotide sequence encoding IL-1ra beta polypeptides may be identical over its entire length to the coding sequence in FIG. 1 (SEQ ID NO:1), or may be a degenerate form of this nucleotide sequence encoding the polypeptide of SEQ ID NO:2, or may be highly identical to a nucleotide sequence that encodes the polypeptide of SEQ ID NO:2. Preferably, the polynucleotides of the invention contain a nucleotide sequence that is highly identical, at least identical, with a nucleotide sequence encoding a IL-1ra beta polypeptide, or at least 80% identical with the encoding nucleotide sequence set forth in FIG. 1 (SEQ ID NO:1), or at least 80% identical to a nucleotide sequence encoding the polypeptide of SEQ ID NO:2.
When the polynucleotides of the invention are used for the recombinant production of IL-1ra beta polypeptide, the polynucleotide may include the coding sequence for the mature polypeptide or a fragment thereof, by itself; the coding sequence for the mature polypeptide or fragment in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions. For example, a marker sequence which facilitates purification of the fused polypeptide can be encoded. In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz et al., Proc Natl Acad Sci USA (1989) 86:821-824, or is an HA tag. The polynucleotide may also contain non-coding 5' and 3' sequences, such as transcribed, non-translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.
Among particularly preferred embodiments of the invention are polynucleotides encoding EL-1ra beta polypeptides having the amino acid sequence of set out in FIG. 1 (SEQ ID NO:2) and variants thereof.
Further preferred embodiments are polynucleotides encoding IL-1ra beta variants that have the amino acid sequence of the IL-1ra beta polypeptide of FIG. 1 (SEQ ID NO:2) in which several, 5-10, 1-5, 1-3, 1-2 or 1 amino acid residues are substituted, deleted or added, in any combination.
Further preferred embodiments of the invention are polynucleotides that are at least 80% identical over their entire length to a polynucleotide encoding the IL-1ra beta polypeptide having the amino acid sequence set out in FIG. 1 (SEQ ID NO:2), and polynucleotides which are complementary to such polynucleotides. In this regard, polynucleotides at least 80% identical over their entire length to the same are particularly preferred, and those with at least 90% are especially preferred. Furthermore, those with at least 97% are highly preferred and those with at least 98-99% are most highly preferred, with at least 99% being the most preferred.
The present invention further relates to polynucleotides that hybridize to the herein above-described sequences. In this regard, the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
Polynucleotides of the invention, which are sufficiently identical to a nucleotide sequence contained in SEQ ID NO:1, may be used as hybridization probes for cDNA and genomic DNA, to isolate full-length cDNAs and genomic clones encoding IL-1ra beta polypeptide and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the IL-1ra beta gene. Such hybridization techniques are known to those of skill in the art. Typically these nucleotide sequences are 70% identical, preferably 80% identical, more preferably 90% identical to that of the referent. The probes generally will comprise at least 15 nucleotides. Preferably, such probes will have at least 30 nucleotides and may have at least 50 nucleotides. Particularly preferred probes will range between 30 and 50 nucleotides.
The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to animal and human disease.
Vectors, Host Cells, Expression
The present invention also relates to vectors which comprise a polynucleotide or polynucleotides of the present invention, and host cells which are genetically engineered with vectors of the invention and to the production of polypeptides of the invention by recombinant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
For recombinant production, host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention. Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al., BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection.
Representative examples of appropriate hosts include bacterial cells, such as streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells; and plant cells.
A great variety of expression systems can be used. Such systems include, among others, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. The expression systems may contain control regions that regulate as well as engender expression. Generally, any system or vector suitable to maintain, propagate or express polynucleotides to produce a polypeptide in a host may be used. The appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL (supra).
For secretion of the translated protein into the lumen of the endoplasmic reticulum, into the periplasmic space or into the intracellular environment, appropriate secretion signals may be incorporated into the desired polypeptide. These signals may be endogenous to the polypeptide or they may be heterologous signals.
If the IL-1ra beta polypeptide is to be expressed for use in screening assays, the polypeptide may be produced at the surface of the cell. In this event, the cells may be harvested prior to use in the screening assay. If IL-1ra beta polypeptide is secreted into the medium, the medium can be recovered in order to recover and purify the polypeptide; if produced intracellularly, the cells must first be lysed before the polypeptide is recovered. IL-1ra beta polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography is employed for purification. Well known techniques for refolding proteins may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification.
Diagnostic Assays
This invention also relates to the use of IL-1ra beta polynucleotides for use as diagnostic reagents. Detection of a mutated form of IL-1ra beta gene associated with a dysfunction will provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from under-expression, over-expression or altered expression of IL-1ra beta. Individuals carrying mutations in the IL-1ra beta gene may be detected at the DNA level by a variety of techniques.
Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR or other amplification techniques prior to analysis. RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to labeled IL-1ra beta nucleotide sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. DNA sequence differences may also be detected by alterations in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing. See, e.g., Myers et al., Science (1985) 230:1242. Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method. See Cotton et al., Proc Natl Acad Sci USA (1985) 85:4397-4401. In another embodiment, an array of oligonucleotides probes comprising fragments from IL-1ra beta nucleotide sequences can be constructed to conduct efficient screening of e.g., genetic mutations. Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability. (See for example: M.Chee et al., Science, Vol 274, pp 610-613 (1996)).
The diagnostic assays offer a process for diagnosing or determining a susceptibility to chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia. through detection of mutation in the IL-1ra beta gene by the methods described.
In addition, chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, and cachexia can be diagnosed by methods comprising determining from a sample derived from a subject an abnormally decreased or increased level of IL-1ra beta polypeptide or IL-1ra beta mRNA. Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods. Assay techniques that can be used to determine levels of a protein, such as an IL-1ra beta polypeptide, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.
Chromosome Assays
The nucleotide sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. The mapping of relevant sequences to chromosomes according to the present invention is an important first step in correlating those sequences with gene associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
The IL-1ra beta gene was mapped to chromosome 2, in a region close to IL-1α, β and IL-1ra by comparing with public databases containing sequences obtained from mapped fragments of genomic DNA obtained by PCR using synthetic oligonucleotide primer pairs.
The differences in the cDNA or genomic sequence between affected and unaffected individuals can also be determined. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
Antibodies
The polypeptides of the invention or their fragments or analogs thereof, or cells expressing them can also be used as immunogens to produce antibodies immunospecific for the IL-1ra beta polypeptides. The term"immunospecific" means that the antibodies have substantiall greater affinity for the polypeptides of the invention than their affinity for other related polypeptides in the prior art.
Antibodies generated against the IL-1ra beta polypeptides can be obtained by administering the polypeptides or epitope-bearing fragments, analogs or cells to an animal, preferably a nonhuman, using routine protocols. For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C., Nature (1975) 256:495497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., Immunology Today (1983) 4:72) and the EBV-hybridoma technique (Cole et al., MONOCLONAL ANTIBODIES AND CANCER THERAPY, pp. 77-96, Alan R. Liss, Inc., 1985).
Techniques for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can also be adapted to produce single chain antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms including other mammals, may be used to express humanized antibodies.
The above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography.
Antibodies against IL-1ra beta polypeptides may also be employed to treat chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia., among others.
Vaccines
Another aspect of the invention relates to a method for inducing an immunological response in a mammal which comprises inoculating the mammal with IL-1ra beta polypeptide, or a fragment thereof, adequate to produce antibody and/or T cell immune response to protect said animal from chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia., among others. Yet another aspect of the invention relates to a method of inducing immunological response in a mammal which comprises, delivering IL-1ra beta gene via a vector directing expression of IL-1ra beta polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal from diseases.
Further aspect of the invention relates to an immunological/vaccine formulation (composition) which, when introduced into a mammalian host, induces an immunological response in that mammal to a IL-1ra beta polypeptide wherein the composition comprises a IL-1ra beta polypeptide or IL-1ra beta gene. The vaccine formulation may further comprise a suitable carrier. Since IL-1ra beta polypeptide may be broken down in the stomach, it is preferably administered parenterally (including subcutaneous, intramuscular, intravenous, intradermal etc. injection). Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation instonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents or thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use. The vaccine formulation may also include adjuvant systems for enhancing the immunogenicity of the formulation, such as oil-in water systems and other systems known in the art. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.
Screening Assays
The IL-1ra beta polypeptide of the present invention may be employed in a screening process for compounds which stimulate (agonists) or inhibit (antagonists, or otherwise called inhibitors) the synthesis or action of the IL-1ra beta polypeptide of the present invention. The IL-1ra beta polypeptide of the present invention may also be employed in a screening process for compounds which mimic the agonist or antagonist properties of the IL-1ra beta polypeptide of the present invention. Thus, polypeptides of the invention may also be used to assess and identify agonist or antagonists from, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures. These agonists or antagonists may be natural substrates, ligands, receptors, etc., as the case may be, of the polypeptide of the present invention; or may be structural or functional mimetics of the polypeptide of the present invention. See Coligan et al., Current Protocols in Immunology 1(2):Chapter 5 (1991).
IL-1ra beta proteins are ubiquitous in the mammalian host and are responsible for many biological functions, including many pathologies. Accordingly, it is desirous to find compounds and drugs which stimulate IL-1ra beta polypeptide on the one hand and which can inhibit the function of IL-1ra beta polypeptide on the other hand. In general, agonists are employed for therapeutic and prophylactic purposes for such conditions as chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia. Antagonists may be employed for a variety of therapeutic and prophylactic purposes for such conditions as chronic and acute inflammation, septicemia, arthritis, inflammatory bowel disease, graft vs. host disease, autoimmunity, stroke, shock, atherschlerosis, cardiac ischemia, acute respiratory disease syndrome (ARDS), psoriasis, restenosis, traumatic brain injury, AIDS, cachexia.
In general, such screening procedures may involve identifying, generating and using appropriate cells which express the receptor of the IL-1ra beta polypeptide of the present invention on the surface thereof. Such cells include cells from mammals, yeast, Drosophila or E. coli. Such cells may be identified, for example, by direct binding methods using radiolabeled or fluorescently tagged IL-1ra beta polypeptide. Cells expressing the IL-1ra beta polypeptide receptor (or cell membrane containing the expressed polypeptide) are then contacted with a test compound to observe binding, or stimulation or inhibition of a functional response. Alternatively, the cDNA for the IL-1ra beta polypeptide receptor may be cloned by the above direct binding methods using expression cloning or purification methods known in the art, and its intracellular domain expressed as a secreted or membrane protein. The soluble or membrane bound receptor can then be used to identify agonists or antagonists via direct binding methods.
The assays may simply test binding of a candidate compound wherein adherence to the cells bearing the IL-1ra beta polypeptide receptor is detected by means of a label directly or indirectly associated with the candidate compound or in an assay involving competition with a labeled IL-1ra beta polypeptide. Further, these assays may test whether the candidate compound results in a signal similar to that generated by binding of the IL-1ra beta polypeptide, using detection systems appropriate to the cells bearing the IL-1ra beta polypeptide receptor at their surfaces. Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist by the presence of the candidate compound is observed. Standard methods for conducting such screening assays are well understood in the art.
Examples of potential IL-1ra beta polypeptide antagonists include antibodies or, in some cases, oligonucleotides or proteins which are closely related to the ligands, substrates, receptors, etc., as the case may be, of the IL-1ra beta polypeptide, e.g., a fragment of the ligands, substrates, receptors, or small molecules which bind to the target receptor of the present invention but do not elicit a response, so that the activity of the polypeptide is prevented.
Prophylactic and Therapeutic Methods
This invention provides methods of treating an abnormal conditions related to both an excess of and insufficient amounts of IL-1ra beta polypeptide activity.
If the activity of IL-1ra beta polypeptide is in excess, several approaches are available. One approach comprises administering to a subject an inhibitor compound (antagonist) as herein above described along with a pharmaceutically acceptable carrier in an amount effective to inhibit activation by blocking binding of the IL-1ra beta polypeptide to its target receptor, or by inhibiting a second signal, and thereby alleviating the abnormal condition.
In another approach, soluble forms of EL-1ra beta polypeptides capable of binding its receptor in competition with endogenous IL-1ra beta polypeptide may be administered. Typical embodiments of such competitors comprise fragments of the IL-1ra beta polypeptide.
In still another approach, expression of the gene encoding endogenous IL-1ra beta polypeptide can be inhibited using expression blocking techniques. Known such techniques involve the use of antisense sequences, either internally generated or separately administered. See, for example, O'Connor, J Neurochem (1991) 56:560 in Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988). Alternatively, oligonucleotides which form triple helices with the gene can be supplied. See, for example, Lee et al., Nucleic Acids Res (1979) 6:3073; Cooney et al, Science (1988) 241:456; Dervan et al, Science (1991) 251:1360. These oligomers can be administered per se or the relevant oligomers can be expressed in vivo.
For treating abnormal conditions related to an under-expression of IL-1ra beta and its activity, several approaches are also available. One approach comprises administering to a subject a therapeutically effective amount of the IL-1ra beta polypeptide or a compound, i.e., an agonist or mimetic as described above, in combination with a pharmaceutically acceptable carrier, to thereby alleviate the abnormal condition. Alternatively, gene therapy may be employed to effect the endogenous production of IL-1ra beta by the relevant cells in the subject. For example, a polynucleotide of the invention may be engineered for expression in a replication defective retroviral vector, as discussed above. The retroviral expression construct may then be isolated and introduced into a packaging cell transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest. These producer cells may be administered to a subject for engineering cells in vivo and expression of the polypeptide in vivo. For overview of gene therapy, see Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) in Human Molecular Genetics, T Strachan and A P Read, BIOS Scientific Publishers Ltd (1996).
Formulation and Administration
Peptides, such as the soluble form of IL-1ra beta polypeptides, and agonists and antagonist peptides or small molecules, may be formulated in combination with a suitable pharmaceutical carrier. Such formulations comprise a therapeutically effective amount of the polypeptide or compound, and a pharmaceutically acceptable carrier or excipient. Such carriers include but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. Formulation should suit the mode of administration, and is well within the skill of the art. The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.
Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
Preferred forms of systemic administration of the pharmaceutical compositions include injection, typically by intravenous injection. Other injection routes, such as subcutaneous, intramuscular, or intraperitoneal, can be used. Alternative means for systemic administration include transmucosal and transdermal administration using penetrants such as bile salts or fusidic acids or other detergents. In addition, if properly formulated in enteric or encapsulated formulations, oral administration may also be possible. Administration of these compounds may also be topical and/or localized, in the form of salves, pastes, gels and the like.
The dosage range required depends on the choice of peptide, the route of administration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending practitioner. Suitable dosages, however, are in the range of 0.1-100 μg/kg of subject. Wide variations in the needed dosage, however, are to be expected in view of the variety of compounds available and the differing efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art.
Polypeptides used in treatment can also be generated endogenously in the subject, in treatment modalities often referred to as "gene therapy" as described above. Thus, for example, cells from a subject may be engineered with a polynucleotide, such as a DNA or RNA, to encode a polypeptide ex vivo, and for example, by the use of a retroviral plasmid vector. The cells are then introduced into the subject.
EXAMPLES
The examples below are carried out using standard techniques, which are well known and routine to those of skill in the art, except where otherwise described in detail. The examples illustrate, but do not limit the invention.
Example 1 Isolation and identification of IL-1RAβ
A potential full length clone (HGS EST #1506331; Project ID HAICQ62) was initially identified through a search of the Human Genome Sciences EST database (vide supra for EST analysis) for proteins with homology to members of the interleukin 1 family. This partial sequence showed significant seqeunce identity (35% over 77 aa) to murine IL-1ra. This cDNA was completely sequenced on both strands using an automated sequencer. A total of 1183 bp were sequenced, and this includes an open reading frame enconding a peptide of 169 aa. The cDNA and protein sequences are SEQ ID NOS: 1 and 2, respectively, and are named IL-1 raβ. The protein does not appear to have a signal sequence at its amino terminus and is likely to be expressed as an intracellular, cytosolic protein like other members of the family. It is possible that alternative splice forms exist which include a signal sequence, as has been found for IL-1ra.
The IL-1ra beta gene was mapped to chromosome 2, in a region close to IL-1α, and β and IL-1ra by comparing with public databases containing sequences obtained from mapped fragments of genomic DNA obtained by PCR using synthetic oligonucleotide primer pairs. Using the algorithm BLAST, a match was found with human STS CHLC.GAAT11C03.P3330 clone GAAT11lC03 (Accession number G942011) which can be mapped to chromosome 2 approximately 142 cM from the top of the chromosome.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 2
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1183 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
GGCACGAGCCACGATTCAGTCCCCTGGACTGTAGATAAAGACCCTTTCTTGCCAGGTGCT60
GAGACAACCACACTATGAGAGGCACTCCAGGAGACGCTGATGGTGGAGGAAGGGCCGTCT120
ATCAATCAATGTGTAAACCTATTACTGGGACTATTAATGATTTGAATCAGCAAGTGTGGA180
CCCTTCAGGGTCAGAACCTTGTGGCAGTTCCACGAAGTGACAGTGTGACCCCAGTCACTG240
TTGCTGTTATCACATGCAAGTATCCAGAGGCTCTTGAGCAAGGCAGAGGGGATCCCATTT300
ATTTGGGAATCCAGAATCCAGAAATGTGTTTGTATTGTGAGAAGGTTGGAGAACAGCCCA360
CATTGCAGCTAAAAGAGCAGAAGATCATGGATCTGTATGGCCAACCCGAGCCCGTGAAAC420
CCTTCCTTTTCTACCGTGCCAAGACTGGTAGGACCTCCACCCTTGAGTCTGTGGCCTTCC480
CGGACTGGTTCATTGCCTCCTCCAAGAGAGACCAGCCCATCATTCTGACTTCAGAACTTG540
GGAAGTCATACAACACTGCCTTTGAATTAAATATAAATGACTGAACTCAGCCTAGAGGTG600
GCAGCTTGGTCTTTGTCTTAAAGTTTCTGGTTCCCAATGTGTTTTCGTCTACATTTTCTT660
AGTGTCATTTTCACGCTGGTGCTGAGACAGGGGCAAGGCTGCTGTTATCATCTCATTTTA720
TAATGAAGAAGAAGCAATTACTTCATAGCAACTGAAGAACAGGATGTGGCCTCAGAAGCA780
GGAGAGCTGGGTGGTATAAGGCTGTCCTCTCAAGCTGGTGCTGTGTAGGCCACAAGGCAT840
CTGCATGAGTGACTTTAAGACTCAAAGACCAAACACTGAGCTTTCTTCTAGGGGTGGGTA900
TGAAGATGCTTCAGAGCTCATGCGCGTTACCCACGATGGCATGACTAGCACAGAGCTGAT960
CTCTGTTTCTGTTTTGCTTTATTCCCTCTTGGGATGATATCATCCAGTCTTTATATGTTG1020
CCAATATACCTCATTGTGTGTAATAGAACCTTCTTAGCATTAAGACCTTGTAAACAAAAA1080
TAATTCTTGTGTTAAGTTAAATCATTTTTGTCCTAATTGTAATGTGTAATCTTAAAGTTA1140
AATAAACTTTGTGTATTTATATAATAAAAAAAAAAAAAAAAAA1183
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 169 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
MetArgGlyThrProGlyAspAlaAspGlyGlyGlyArgAlaValTyr
151015
GlnSerMetCysLysProIleThrGlyThrIleAsnAspLeuAsnGln
202530
GlnValTrpThrLeuGlnGlyGlnAsnLeuValAlaValProArgSer
354045
AspSerValThrProValThrValAlaValIleThrCysLysTyrPro
505560
GluAlaLeuGluGlnGlyArgGlyAspProIleTyrLeuGlyIleGln
65707580
AsnProGluMetCysLeuTyrCysGluLysValGlyGluGlnProThr
859095
LeuGlnLeuLysGluGlnLysIleMetAspLeuTyrGlyGlnProGlu
100105110
ProValLysProPheLeuPheTyrArgAlaLysThrGlyArgThrSer
115120125
ThrLeuGluSerValAlaPheProAspTrpPheIleAlaSerSerLys
130135140
ArgAspGlnProIleIleLeuThrSerGluLeuGlyLysSerTyrAsn
145150155160
ThrAlaPheGluLeuAsnIleAsnAsp
165
__________________________________________________________________________

Claims (19)

What is claimed is:
1. An isolated polynucleotide comprising a polyncleotide which encodes the IL-1ra beta polypeptide of SEQ ID NO:2.
2. An isolated polynucleotide comprising a polynucleotide which is at least 80% identical to that of SEQ ID NO:1 in which identity is calculated using FASTA, and parameters are set so that the highest order match is obtained.
3. An isolated polynucleotide comprising a polynucleotide contained in SEQ ID NO:1 which encodes the IL-1ra beta polypeptide of SEQ ID NO:2.
4. The polynucleotide of SEQ ID NO: 1.
5. An isolated polynucleotide of claim 3 comprising a polynucleotide that has at least 90% identy to that of SEQ ID NO:1, in which identity is calculated using FASTA, and parameters are set so that the highest order match is obtained.
6. An isolated polynucleotide of claim 2 comprising a polynucleotide that has at least 95% identity to that of SEQ ID NO:1, in which identity is calculated using FASTA, and parameters are set so that the highest order match is obtained.
7. An isolated polynucleotide comprising a polynucleotide that has at least 80% identity to the sequence contained in SEQ ID NO:1 encoding the polypeptide of SEQ ID NO:2, in which identity is calculated using FASTA, and parameters are set so that the highest order match is obtained.
8. An isolated polynucleotide of claim 7 comprising a polynucleotide that has at least 90% identity to the sequence contained in SEQ ID NO:1 encoding a polypeptide of SEQ ID NO:2, in which identity is calculated using FASTA, and parameters are set so that the highest order match is obtained.
9. An isolated polynucleotide comprising a polynucleotide that has at least 95% identity to the sequence contained in SEQ ID NO:1 encoding a polypeptide of SEQ ID NO:2, in which identity is calculated using FASTA, and parameters are set so that the highest order match is obtained.
10. An isolated polynucleotide which is complementary to a polynucleotide of any one of claims 1, 3, 7, 8, and 9.
11. The polynucleotide which is the RNA transcript of SEQ ID NO:1.
12. The isolated polynucleotide which is the RNA transcript of coding region nucleotide number 75 to 581 of SEQ ID NO:1.
13. A polynucleotide comprising a DNA sequence obtainable by screening an appropriate library under stringent hybridization conditions with a probe having the sequence of SEQ ID NO:1 ;and isolating said DNA sequence.
14. The polynucleotide of claim 1 which is DNA or RNA.
15. A DNA or RNA molecule comprising an expression system, wherein said expression system is capable of production a IL-1ra beta polypeptide of SEQ ID NO:2 when said expression system is present in a compatible host cell.
16. A host cell comprising the expression system of claim 15.
17. A process for producing a IL-1ra beta polypeptide comprising culturing a host of claim 16 under conditions sufficient for the production of said polypeptide, and recovering the polypeptide from the culture.
18. A process for producing a cell which produces a IL-1ra beta polypeptide thereof comprising transforming or transfecting a host cell with the expression system of claim 15, such that the host cell, under appropriate culture conditions, produces a IL-1ra beta polypeptide.
19. Cells produced by the process of claim 18.
US08/790,032 1997-01-28 1997-01-28 DNA encoding interleukin-1 receptor antagonist (IL-1raβ) Expired - Fee Related US5863769A (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
US08/790,032 US5863769A (en) 1997-01-28 1997-01-28 DNA encoding interleukin-1 receptor antagonist (IL-1raβ)
DE69800895T DE69800895D1 (en) 1997-01-28 1998-01-27 Interleukin-1 receptor antagonist beta (il-1rabeta)
EP98300572A EP0855404B1 (en) 1997-01-28 1998-01-27 Interleukin-1 receptor antagonist beta (il-1rabeta)
JP10052620A JPH10304888A (en) 1997-01-28 1998-01-28 Interleukin-1 receptor antagonist beta(il-1rabeta)
CA002232812A CA2232812A1 (en) 1997-01-28 1998-03-20 Interleukin-1 receptor antagonist beta (il-1ra.beta.)
US09/069,619 US6054559A (en) 1997-01-28 1998-04-29 Interleukin-1 receptor antagonist beta (IL-1raβ)
JP11134172A JP2000032990A (en) 1997-01-28 1999-05-14 Interleukin-1 receptor antagonist, beta(1l-1raβ) polypeptide
US09/494,018 US6399573B1 (en) 1997-01-28 2000-01-28 Interleukin-1 receptor antagonist beta (IL-1rabeta)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/790,032 US5863769A (en) 1997-01-28 1997-01-28 DNA encoding interleukin-1 receptor antagonist (IL-1raβ)
CA002232812A CA2232812A1 (en) 1997-01-28 1998-03-20 Interleukin-1 receptor antagonist beta (il-1ra.beta.)

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US746498A Continuation-In-Part 1997-01-28 1998-01-14

Publications (1)

Publication Number Publication Date
US5863769A true US5863769A (en) 1999-01-26

Family

ID=31979142

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/790,032 Expired - Fee Related US5863769A (en) 1997-01-28 1997-01-28 DNA encoding interleukin-1 receptor antagonist (IL-1raβ)

Country Status (5)

Country Link
US (1) US5863769A (en)
EP (1) EP0855404B1 (en)
JP (2) JPH10304888A (en)
CA (1) CA2232812A1 (en)
DE (1) DE69800895D1 (en)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999036541A1 (en) * 1998-01-14 1999-07-22 Smithkline Beecham Corporation INTERLEUKIN-1 RECEPTOR ANTAGONIST BETA (IL-1RAβ)
US6197551B1 (en) 1998-01-27 2001-03-06 Millennium Pharmaceuticals, Inc. Spoil-1 protein and nucleic acid molecules and uses therefor
US6423321B2 (en) 1999-02-24 2002-07-23 Edward L. Tobinick Cytokine antagonists for the treatment of sensorineural hearing loss
US20020131954A1 (en) * 2000-05-02 2002-09-19 Tobinick Edward L. Interleukin antagonists for the treatment of neurological, retinal and muscular disorders
US6471961B1 (en) * 1999-02-24 2002-10-29 Edward L. Tobinick Interleukin antagonists for the treatment of neurological, retinal and muscular disorders
US20030004106A1 (en) * 1999-12-10 2003-01-02 Amgen, Inc., A Corporation Of The State Of Delaware Interleukin-1 receptor antagonist-related molecules and uses thereof
US20030007972A1 (en) * 1999-02-24 2003-01-09 Edward Tobinick Cytokine antagonists and other biologics for the treatment of bone metastases
US6521422B1 (en) 1999-08-04 2003-02-18 Amgen Inc. Fhm, a novel member of the TNF ligand supergene family
US20030082688A1 (en) * 1998-01-27 2003-05-01 Millennium Pharmaceuticals, Inc. Spoil protein and nucleic acid molecules and uses therefor
US20030092684A1 (en) * 1999-04-27 2003-05-15 Fredeking Terry M. Compositions and methods for treating hemorrhagic virus infections and other disorders
US20030096355A1 (en) * 1999-07-09 2003-05-22 Ke Zhang Isolation, identification and characterization of ymkz5, a novel member of the TNF-receptor supergene family
US6599716B1 (en) 1999-08-04 2003-07-29 Amgen Inc. Nucleic acids encoding NTR3, a member of the TNF-receptor supergene family
US6627199B1 (en) 1999-07-09 2003-09-30 Amgen Inc Isolation, identification and characterization of tmst2, a novel member of the TNF-receptor supergene family
US6843987B2 (en) * 2000-02-02 2005-01-18 Schering Corporation Mammalian cytokines; receptors; related reagents and methods
US6982089B2 (en) 1999-02-24 2006-01-03 Tact Ip, Llc Cytokine antagonists for neurological and neuropsychiatric disorders
US20060009450A1 (en) * 2004-07-06 2006-01-12 Edward Lewis Tobinick Use and methods of use of etanercept and other TNF binding biologics to improve human cognitive function
US20090060940A1 (en) * 2007-08-30 2009-03-05 Tseng-Rong Tu Compositions and methods for treating psoriasis by ganoderma lucidum (Reishi) polysaccharides
US8323635B2 (en) 2007-11-14 2012-12-04 General Regeneratives, Ltd. Methods of using interleukin-1 receptor antagonist as a myeloprotective agent
US20150232855A1 (en) * 2006-08-10 2015-08-20 Roy C. Levitt Localized Therapy of Lower Airways Inflammatory Disorders With Proinflammatory Cytokine Inhibitors
WO2015191783A2 (en) 2014-06-10 2015-12-17 Abbvie Inc. Biomarkers for inflammatory disease and methods of using same
US9339528B2 (en) 2009-10-26 2016-05-17 General Regeneratives, Ltd. Methods for treating epithelium trauma of the intestinal mucosa using interleukin-1 receptor antagonist
CN112979781A (en) * 2021-03-18 2021-06-18 中国海洋大学 Sebastes schlegeli IL-1 beta recombinant protein and preparation method and application thereof
US11884719B2 (en) 2018-12-21 2024-01-30 23Andme, Inc. Anti-IL-36 antibodies and methods of use thereof

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6294170B1 (en) 1997-08-08 2001-09-25 Amgen Inc. Composition and method for treating inflammatory diseases
US6541623B1 (en) * 1998-04-03 2003-04-01 Hyseq, Inc. Interleukin—1 receptor antagonist and uses thereof
DE69932247T2 (en) * 1998-08-21 2007-05-31 Immunex Corp., Thousand Oaks HUMAN IL-1 EPSILON DNA AND POLYPEPTIDE
US6838290B2 (en) 1998-08-21 2005-01-04 Immunex Corporation Methods for screening compounds that affect IL-1 epsilon activity
US6949359B1 (en) 1998-08-21 2005-09-27 Immunex Corporation Human IL-1 epsilon DNA and polypeptides
US6680380B1 (en) 1998-09-18 2004-01-20 Schering Corporation Nucleic acids encoding mammalian interleukin-1ζ, related reagents and methods
IL126562A0 (en) * 1998-10-14 1999-08-17 Interpharm Lab Ltd Expression and secretion of icil-1 receptor antagonist type ii
EP2319929A1 (en) 1998-12-23 2011-05-11 Genentech, Inc. IL-1 related polypeptides
JP2003516132A (en) * 1999-12-10 2003-05-13 アムジェン インコーポレイテッド Interleukin-1 receptor antagonist-like molecules and uses thereof
US7087224B2 (en) * 2000-10-31 2006-08-08 Amgen Inc. Method of treating anemia by administering IL-1ra
EP2500438A3 (en) * 2002-09-25 2012-11-28 Genentech, Inc. Novel compositions and methods for the treatment of psoriasis
WO2004060911A2 (en) * 2002-12-30 2004-07-22 Amgen Inc. Combination therapy with co-stimulatory factors
GB0607189D0 (en) * 2006-04-10 2006-05-17 Polybiomed Ltd interleukin IL 1ra composition

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT1269989B (en) * 1994-09-21 1997-04-16 Dompe Spa IL-1 RECEPTOR ANTAGONISTS WITH INCREASED INHIBITORY ACTIVITY

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
Auron, et al., "Nucleotide sequence of human monocyte interleukin 1 precursor cDNA", Proc. Natl. Acad. Sci. USA, 81, pp. 7907-7911 (1984).
Auron, et al., Nucleotide sequence of human monocyte interleukin 1 precursor cDNA , Proc. Natl. Acad. Sci. USA, 81, pp. 7907 7911 (1984). *
Bazan, et al., "A newly defined inteleukin-1?", Nature, 379, p. 591 (1996).
Bazan, et al., A newly defined inteleukin 1 , Nature, 379, p. 591 (1996). *
Carter, et al., "Purification cloning, expression and biological characterization of an interleukin-1 receptor antagonist protein", Nature, 344, pp. 633-638 (1990).
Carter, et al., Purification cloning, expression and biological characterization of an interleukin 1 receptor antagonist protein , Nature, 344, pp. 633 638 (1990). *
Eisenberg, et al., "Primary structure and functional expression from complementary DNA of a human interleukin-1 receptor antagonist", Nature, 343, pp. 341-346 (1990).
Eisenberg, et al., Primary structure and functional expression from complementary DNA of a human interleukin 1 receptor antagonist , Nature, 343, pp. 341 346 (1990). *
Gu, et al., "Activation of Interferon-γ Inducting Factor Mediated by Interleukin-1β Convertng Enzyme", Science, 275, pp. 206-209 (1997).
Gu, et al., Activation of Interferon Inducting Factor Mediated by Interleukin 1 Convertng Enzyme , Science, 275, pp. 206 209 (1997). *
Hannum, et al. "Interleukin-1 receptor antagonist activity of a human interleukin-1 inhibitor", Nature, 343, pp. 336-340 (1990).
Hannum, et al. Interleukin 1 receptor antagonist activity of a human interleukin 1 inhibitor , Nature, 343, pp. 336 340 (1990). *
Haskill, et al., "cDNA cloning of an intracellular form of the human interleukin 1 receptor antagonist associated with epithelium", Proc. Natl. Acad. Sci., 88, pp. 3681-3685 (1991).
Haskill, et al., cDNA cloning of an intracellular form of the human interleukin 1 receptor antagonist associated with epithelium , Proc. Natl. Acad. Sci., 88, pp. 3681 3685 (1991). *
Helen et al, EST, Acc. No. N59092, 1995. *
KO, MS., EST, Acc No. T25675, 1994. *
March, et al., "Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs", Nature, 315, pp. 614-647 (1985).
March, et al., Cloning, sequence and expression of two distinct human interleukin 1 complementary DNAs , Nature, 315, pp. 614 647 (1985). *
Murray et al EST, Acc. No. G10162, 1995. *
Okamura, et al., "Cloning of a new cytokine that induces IFN-γ production by T cells", Nature, 378, pp. 88-91 (1995).
Okamura, et al., Cloning of a new cytokine that induces IFN production by T cells , Nature, 378, pp. 88 91 (1995). *

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6054559A (en) * 1997-01-28 2000-04-25 Smithkline Beecham Corporation Interleukin-1 receptor antagonist beta (IL-1raβ)
US6399573B1 (en) 1997-01-28 2002-06-04 Smithkline Beecham Corporation Interleukin-1 receptor antagonist beta (IL-1rabeta)
WO1999036541A1 (en) * 1998-01-14 1999-07-22 Smithkline Beecham Corporation INTERLEUKIN-1 RECEPTOR ANTAGONIST BETA (IL-1RAβ)
US20030082688A1 (en) * 1998-01-27 2003-05-01 Millennium Pharmaceuticals, Inc. Spoil protein and nucleic acid molecules and uses therefor
US6197551B1 (en) 1998-01-27 2001-03-06 Millennium Pharmaceuticals, Inc. Spoil-1 protein and nucleic acid molecules and uses therefor
US6471961B1 (en) * 1999-02-24 2002-10-29 Edward L. Tobinick Interleukin antagonists for the treatment of neurological, retinal and muscular disorders
US20030007972A1 (en) * 1999-02-24 2003-01-09 Edward Tobinick Cytokine antagonists and other biologics for the treatment of bone metastases
US6982089B2 (en) 1999-02-24 2006-01-03 Tact Ip, Llc Cytokine antagonists for neurological and neuropsychiatric disorders
US6423321B2 (en) 1999-02-24 2002-07-23 Edward L. Tobinick Cytokine antagonists for the treatment of sensorineural hearing loss
US20030092684A1 (en) * 1999-04-27 2003-05-15 Fredeking Terry M. Compositions and methods for treating hemorrhagic virus infections and other disorders
US6627199B1 (en) 1999-07-09 2003-09-30 Amgen Inc Isolation, identification and characterization of tmst2, a novel member of the TNF-receptor supergene family
US7320796B2 (en) 1999-07-09 2008-01-22 Amgen Inc. Isolation, identification and characterization of tmst2, a novel member of the TNF-receptor supergene family
US20080241154A1 (en) * 1999-07-09 2008-10-02 Amgen Inc. Isolation, Identification and Characterization of tmst2, a Novel Member of the TNF-Receptor Supergene Family
US20030096355A1 (en) * 1999-07-09 2003-05-22 Ke Zhang Isolation, identification and characterization of ymkz5, a novel member of the TNF-receptor supergene family
US20040018544A1 (en) * 1999-07-09 2004-01-29 Chris Saris Isolation, identification and characterization of tmst2, a novel member of the TNF-receptor supergene family
US6852839B2 (en) 1999-08-04 2005-02-08 Amgen, Inc. Fhm, a novel member of the TNF ligand supergene family
US20040248324A1 (en) * 1999-08-04 2004-12-09 Hailing Hsu Fhm a novel member of the TNF ligand supergene family: materials and methods for interaction modulators
US20040265913A1 (en) * 1999-08-04 2004-12-30 Hailing Hsu Fhm a novel member of the TNF ligand supergene family: antibody materials and methods
US6599716B1 (en) 1999-08-04 2003-07-29 Amgen Inc. Nucleic acids encoding NTR3, a member of the TNF-receptor supergene family
US6521422B1 (en) 1999-08-04 2003-02-18 Amgen Inc. Fhm, a novel member of the TNF ligand supergene family
US7118863B2 (en) 1999-08-04 2006-10-10 Amgen, Inc. Methods for detecting NTR3 nucleic acids by hybridization
US7544519B2 (en) 1999-08-04 2009-06-09 Amgen Inc. Fhm a novel member of the TNF ligand supergene family: materials and methods for interaction modulators
US20030004106A1 (en) * 1999-12-10 2003-01-02 Amgen, Inc., A Corporation Of The State Of Delaware Interleukin-1 receptor antagonist-related molecules and uses thereof
US6843987B2 (en) * 2000-02-02 2005-01-18 Schering Corporation Mammalian cytokines; receptors; related reagents and methods
US20020131954A1 (en) * 2000-05-02 2002-09-19 Tobinick Edward L. Interleukin antagonists for the treatment of neurological, retinal and muscular disorders
US6623736B2 (en) * 2000-05-02 2003-09-23 Edward L. Tobinick Interleukin antagonists for the treatment of neurological, retinal and muscular disorders
US20060009450A1 (en) * 2004-07-06 2006-01-12 Edward Lewis Tobinick Use and methods of use of etanercept and other TNF binding biologics to improve human cognitive function
US7214658B2 (en) 2004-07-06 2007-05-08 Tact Ip, Llc Method of delivering a TNF antagonist to the brain of a human by perispinal administration without direct intrathecal injection
US10550389B2 (en) * 2006-08-10 2020-02-04 Roy C. Levitt Localized therapy of lower airways inflammatory disorders with proinflammatory cytokine inhibitors
US20150232855A1 (en) * 2006-08-10 2015-08-20 Roy C. Levitt Localized Therapy of Lower Airways Inflammatory Disorders With Proinflammatory Cytokine Inhibitors
US11718853B2 (en) 2006-08-10 2023-08-08 Onspira Therapeutics, Inc. Localized therapy of lower airways inflammatory disorders with proinflammatory cytokine inhibitors
US11091763B2 (en) 2006-08-10 2021-08-17 Altavant Sciences Gmbh Localized therapy of lower airways inflammatory disorders with proinflammatory cytokine inhibitors
US7947283B2 (en) * 2007-08-30 2011-05-24 Wyntek Corporation Compositions and methods for treating psoriasis by Ganoderma lucidum (Reishi) polysaccharides
US20090060940A1 (en) * 2007-08-30 2009-03-05 Tseng-Rong Tu Compositions and methods for treating psoriasis by ganoderma lucidum (Reishi) polysaccharides
US8323635B2 (en) 2007-11-14 2012-12-04 General Regeneratives, Ltd. Methods of using interleukin-1 receptor antagonist as a myeloprotective agent
US9339528B2 (en) 2009-10-26 2016-05-17 General Regeneratives, Ltd. Methods for treating epithelium trauma of the intestinal mucosa using interleukin-1 receptor antagonist
WO2015191783A2 (en) 2014-06-10 2015-12-17 Abbvie Inc. Biomarkers for inflammatory disease and methods of using same
US11884719B2 (en) 2018-12-21 2024-01-30 23Andme, Inc. Anti-IL-36 antibodies and methods of use thereof
CN112979781A (en) * 2021-03-18 2021-06-18 中国海洋大学 Sebastes schlegeli IL-1 beta recombinant protein and preparation method and application thereof
CN112979781B (en) * 2021-03-18 2022-05-17 中国海洋大学 A kind of Xu's flat scorpionfish IL-1β recombinant protein and its preparation method and application

Also Published As

Publication number Publication date
DE69800895D1 (en) 2001-07-19
EP0855404A1 (en) 1998-07-29
CA2232812A1 (en) 1999-09-20
JP2000032990A (en) 2000-02-02
JPH10304888A (en) 1998-11-17
EP0855404B1 (en) 2001-06-13

Similar Documents

Publication Publication Date Title
EP0855404B1 (en) Interleukin-1 receptor antagonist beta (il-1rabeta)
US6319688B1 (en) Polynucleotide encoding human sodium dependent phosphate transporter (IPT-1)
US6399573B1 (en) Interleukin-1 receptor antagonist beta (IL-1rabeta)
WO1999021991A1 (en) Bmzf12: a zinc finger gene cloned from bone marrow
EP0848062A2 (en) Aspartic protease ASP1
US5945310A (en) DNA encoding members of the IL-1 family, IL-1 delta
CA2240631A1 (en) Pigr-1, a member of immunoglobulin gene superfamily
EP0894855A2 (en) Human I kappa B-beta transcription factor
US5837508A (en) Membrane-type matrix metalloproteinase-5 gene
US6342371B1 (en) Interleukin-1 homologue, IL-1H4
US5932446A (en) Hmvab41
US6657047B2 (en) Human Pelota homolog
WO1999022006A1 (en) CBLAFC02: A SUBUNIT OF VACUOLAR H(+)-ATPase
WO1999021988A1 (en) THE HUMAN VESICLE TRAFFICKING PROTEIN SEC22b GENE OF CBFBBA01
US20020019520A1 (en) CBFBGA09: a human SL15 homolog
WO1999021885A1 (en) A human abc transporter-7 (habc7) gene
EP0879886A2 (en) Signal transduction protein HLDAT86, the human Wnt-4 homolog
EP0892050A2 (en) Human HFIZG53
WO1999021982A1 (en) Human m6b1 gene
US20020052473A1 (en) Interleukin-1 homologue, mat IL-1H4
WO1999036523A1 (en) A gene similar to rat golgi v-snare (gos-28) (cblalg01)
WO1999036522A1 (en) A gene having low similarity to tropomyosin (cbcadb07)
WO1999046291A1 (en) A human glia maturation factor (gmf) beta homolog gene (cbfboe11)
WO1999021990A1 (en) Cbmaad07: a voltage dependent anion channel protein
WO1999021985A1 (en) Cbfbtb01: a human tif4e-like translation initiation factor

Legal Events

Date Code Title Description
AS Assignment

Owner name: SMITHKLINE BEECHAM CORPORATION, PENNSYLVANIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:YOUNG, PETER RONALD;REEL/FRAME:008433/0272

Effective date: 19970128

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20110126