US5834287A - DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparation and uses - Google Patents
DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparation and uses Download PDFInfo
- Publication number
- US5834287A US5834287A US08/605,501 US60550196A US5834287A US 5834287 A US5834287 A US 5834287A US 60550196 A US60550196 A US 60550196A US 5834287 A US5834287 A US 5834287A
- Authority
- US
- United States
- Prior art keywords
- recombinant enzyme
- seq
- amino acid
- enzyme
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01141—4-Alpha-D-{(1->4)-alpha-D-glucano} trehalose trehalohydrolase (3.2.1.141)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to a novel DNA encoding an enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, recombinant DNA containing the same, and a transformant, and further relates to a recombinant enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, as well as to preparations and uses thereof.
- Trehalose is a disaccharide which consists of 2 glucose molecules which are linked together with their reducing groups, and, naturally, it is present in bacteria, fungi, algae, insects, etc., in an extremely small quantity. Having no reducing residue within the molecule, trehalose does not cause an unsatisfactory browning reaction even when heated in the presence of amino acids or the like, and because of this it can sweeten food products without fear of causing unsatisfactory coloration and deterioration. Trehalose, however, is far from being readily prepared in a desired amount by conventional methods, and, actually, it has not scarcely been used for sweetening food products.
- the former as disclosed in Japanese Patent Laid-Open No.154,485/75, is a method which comprises allowing to grow microorganisms such as bacteria and yeasts in a nutrient culture medium, and collecting trehalose from the proliferated cells in the resultant culture.
- the latter as disclosed in Japanese Patent Laid-Open No.216,695/83, is a method which comprises providing maltose as a substrate, allowing a multi-enzymatic system using maltose- and trehalose-phosphorylases to act on maltose, and isolating the formed trehalose from the reaction system.
- the former facilitates the growth of microorganisms with a relative easiness, it requires a sequentially-complicated step for collecting trehalose from the microorganisms which contain at most 15 w/w %trehalose, on a dry solid basis (d.s.b.).
- the present inventors energetically screened enzymes which form saccharides having a trehalose structure from amylaceous saccharides, and found that microorganisms such as those of the species Rhizobium sp. M-11 and Arthrobacter sp. Q36 produce an absolutely novel enzyme which forms non-reducing saccharides having a trehalose structure as an end unit from reducing amylaceous saccharides having a degree of glucose polymerization of 3 or higher. Before or after this finding, it was revealed that such non-reducing saccharides are almost quantitatively hydrolyzed into trehalose and glucose and/or maltooligosaccharides by other enzymes produced from the same microorganisms of the species Rhizobium sp.
- the first object of the present invention is attained by a DNA which encodes an enzyme that releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
- the second object of the present invention is attained by a replicable recombinant DNA which contains the aforesaid DNA and a self-replicable vector.
- the third object of the present invention is attained by a transformant prepared by introducing the aforesaid self-replicable vector into an appropriate host.
- the fourth object of the present invention is attained by a recombinant enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
- the fifth object of the present invention is attained by a process to produce the recombinant enzyme comprising culturing a transformant capable of forming the enzyme in a nutrient culture medium, and recovering the formed enzyme from the resultant culture.
- the sixth object of the present invention is attained by a method for converting non-reducing saccharides containing a step of allowing the recombinant enzyme to act on non-reducing saccharides, having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, to release trehalose from the saccharides.
- FIG. 1 shows the optimum temperature of an enzyme derived from Rhizobium sp. M-11.
- FIG. 2 shows the optimum temperature of an enzyme derived from Arthrobacter sp. Q36.
- FIG. 3 shows the optimum pH of an enzyme derived from Rhizobium sp. M-11.
- FIG. 4 shows the optimum pH of an enzyme derived from Arthrobacter sp. Q36.
- FIG. 5 shows the thermal stability of an enzyme derived from Rhizobium sp. M-11.
- FIG. 6 shows the thermal stability of an enzyme derived from Arthrobacter sp. Q36.
- FIG. 7 shows the pH stability of an enzyme derived from Rhizobium sp. M-11.
- FIG. 8 shows the pH stability of an enzyme derived from Arthrobacter sp. Q36.
- FIG. 9 shows the restriction map of the recombinant DNA pBMU27 according to the present invention.
- the bold-lined part is a DNA encoding an enzyme derived from Rhizobium sp. M-11.
- FIG. 10 shows the restriction map of the recombinant DNA pBRT32 according to the present invention.
- the bold-lined part is a DNA encoding an enzyme derived from Arthrobacter sp. Q36.
- the DNA according to the present invention exerts the production of the enzyme encoded by the DNA in a manner that the DNA is inserted into an appropriate self-replicable vector to form a replicable recombinant DNA, followed by introducing the recombinant DNA into a host, incapable of producing the enzyme per se but readily replicable, to form a transformant.
- the production of the enzyme encoded by the DNA is attained by introducing the recombinant DNA into a host, incapable of producing the enzyme but replicable with a relative easiness, to form a transformant, and culturing the transformant to produce the enzyme.
- the transformant according to the present invention produces the enzyme when cultured.
- the recombinant enzyme according to the present invention releases trehalose when acts on non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
- the recombinant enzyme is readily obtained in a desired amount by culturing the transformant according to the invention.
- Non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher are converted into trehalose and glucose and/or maltooligosaccharides.
- the present invention is based on the finding of a novel enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
- a novel enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
- Such an enzyme can be obtained from cultures of microorganisms of the species Rhizobium sp. M-11 and Arthrobacter sp. Q36, and the present inventors isolated the enzyme by the combination use of conventional purification methods using column chromatography mainly, examined the properties and features, and revealed the reality, i.e. it is a polypeptide having the following physicochemical properties:
- pH Stability Stable up to a pH of around 5.5-10.0 when incubated at 25° C. for 16 hours.
- M-11 was inoculated into each liquid culture medium in each flask, followed by the incubation at 27° C. for 24 hours under rotary-shaking conditions. Twenty L of a fresh preparation of the same liquid culture medium was put in a 30-L jar fermentor and sterilized, followed by inoculating one v/v % of the culture obtained in the above into the sterilized liquid culture medium in the jar fermentor, and incubating it at a pH of 6-8 and 30° C. for 24 hours under aeration-agitation conditions.
- the solution thus obtained was dialyzed against 10 mM phosphate buffer (pH 7.0) for 24 hours, and centrifuged to remove insoluble substances.
- the resultant supernatant was fed to a column packed with "DEAE-TOYOPEARL®", a product for ion-exchange chromatography commercialized by Tosoh Corporation, Tokyo, Japan, which had been previously equilibrated with 10 mM phosphate buffer (pH 7.0), followed by feeding to the column a linear gradient buffer of sodium chloride ranging from 0 M to 0.5 M in 10 mM phosphate buffer (pH 7.0).
- Fractions containing the objective enzyme were collected from the eluate, pooled, dialyzed for 10 hours against 50 mM phosphate buffer (pH 7.0) containing 2 M ammonium sulfate, and centrifuged to remove insoluble substances.
- Fractions containing the objective enzyme were collected from the eluate, pooled, fed to a column packed with "TOYOPEARL® HW-55", a product for gel filtration column chromatography commercialized by Tosoh Corporation, Tokyo, Japan, which had been previously equilibrated with 50 mM phosphate buffer (pH 7.0), followed by feeding to the column 50 mM phosphate buffer (pH 7.0) and collecting fractions containing the objective enzyme.
- the enzyme thus obtained had a specific activity of about 240 units/mg protein, and the yield was about 650 units per L of the culture.
- the enzyme activity is expressed by the value measured on the following assay: Place 4 ml of 50 mM phosphate buffer (pH 7.0) containing 1.25 w/v % maltotriosyltrehalose in a test tube, add one ml of an enzyme solution to the tube, and incubate the resultant solution at 40° C. for 30 min to effect enzymatic reaction. Thereafter, one ml of the reaction mixture is mixed with 2 ml of copper reagent to suspend the enzymatic reaction, followed by assaying the reducing activity by the Somogyi-Nelson's method. As a control, an enzyme, which has been previously inactivated by heating at 100° C. for 10 min, is similarly treated as above.
- One unit activity of the enzyme is defined as the amount of enzyme which increases the reducing power corresponding to one ⁇ mol glucose per min under the above conditions.
- a non-reducing saccharide containing 98 W/W % or higher, d.s.b., ⁇ -glucosyltrehalose, ⁇ -maltosyltrehalose, ⁇ -maltotriosyltrehalose, ⁇ -maltotetraosyltrehalose or ⁇ -maltopentaosyltrehalose a non-reducing saccharide containing 98 W/W % or higher, d.s.b., ⁇ -glucosyltrehalose, ⁇ -maltosyltrehalose, ⁇ -maltotriosyltrehalose, ⁇ -maltotetraosyltrehalose or ⁇ -maltopentaosyltrehalose.
- the reaction mixture was desalted in usual manner, fed to "WB-T-330", a column for high-performance liquid chromatography (HPLC) commercialized by Wako Pure Chemical Industries, Ltd., Tokyo, Japan, followed by feeding to the column distilled water at a flow rate of 0.5 ml/min at ambient temperature to isolate saccharides contained in the reaction mixture while monitoring the saccharide concentration of the eluate with "MODEL RI-8012", a differential refractometer commercialized by Tosoh Corporation, Tokyo, Japan.
- HPLC high-performance liquid chromatography
- enzymes M-11 and Q36 almost quantitatively released trehalose, glucose and maltooligosaccharides from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher. These enzymes did not act on maltooligosaccharides, as a substrate, having a degree of glucose polymerization of 3 or higher. These facts indicate that these enzymes selectively act on non-reducing saccharides having a trehalose structure as an end unit and having a degree of polymerization degree of 3 or higher, and specifically hydrolyze the glycosidic bond between trehalose- and glycosyl-residues. Such an enzyme has never been reported and is estimated to have a novel enzymatic reaction mechanism.
- the purified enzymes M-11 and Q36 in Experiment 1 were respectively electrophoresed on sodium dodecyl sulfate polyacrylamide gel electrophoresis to show a single protein band at a position corresponding to about 57,000-68,000 daltons.
- the optimum temperature of the purified enzymes M-11 and Q36 obtained in Experiment 1 was about 35°-45° C. as shown in FIGS. 1 and 2 when incubated in usual manner in 50 mM phosphate buffer (pH 7.0) for 30 min.
- the optimum pH of the purified enzymes M-11 and Q36 obtained in Experiment 1 was about 6.0-7.5 as shown in FIGS. 3 and 4 when experimented in usual manner by incubating them at 40° C. for 30 min in 50 mM acetate buffer, phosphate buffer or sodium carbonate-sodium hydrogen carbonate buffer having different pHs.
- the purified enzymes M-11 and Q36 obtained in Experiment 1 were stable up to a temperature of about 30°-45° C. as shown in FIGS. 5 and 6 when experimented in usual manner by incubating them in 50 mM phosphate buffer (pH 7.0) for 60 min.
- the purified enzymes M-11 and Q36 obtained in Experiment 1 were stable up to a pH of about 5.5-10.0 as shown in FIGS. 7 and 8 when experimented in usual manner by incubating them at 25° C. for 16 hours in 50 mM acetate buffer, phosphate buffer or sodium carbonate-sodium hydrogen carbonate buffer having different pHs.
- the amino acid sequence containing the N-terminal of the purified enzyme M-11 obtained in Experiment 1 was analyzed on "MODEL 470A", a gas-phase protein sequencer commercialized by Applied Biosystems, Inc., Foster City, USA, to reveal that it has the amino acid sequence as shown in SEQ ID NO:5.
- the amino acid sequence containing the N-terminal of the purified enzyme Q36 was analyzed similarly as above to reveal that it has the amino acid sequence as shown in SEQ ID NO:6.
- enzyme Q36 obtained in Experiment 1-2 was partially hydrolyzed, and the resultant was fed to " ⁇ BONDAPAK C18", a column for reverse-phase high-performance liquid chromatography commercialized by Japan Millipore Ltd., Tokyo, Japan, which had been previously equilibrated with 0.1 v/v % trifluoroacetate containing 24 v/v % aqueous acetonitrile, followed by feeding to the column 0.1 v/v % trifluoroacetate containing 24 v/v % aqueous acetonitrile while increasing the concentration of aqueous acetonitrile from 24 v/v % to 44 v/v % at a flow rate of 0.9 ml/ml.
- Rhizobium sp. M-11 it is a microorganism which was isolated from a soil of Okayama-city, Okayama, Japan, deposited on Dec. 24, 1992, in National Institute of Bioscience and Human-Technology Agency of Industrial Science and Technology, Tsukuba, Ibaraki, Japan, and accepted under the accession number of FERM BP-4130, and it has been maintained by the institute.
- Arthrobacter sp. Q36 is a microorganism which was isolated from a soil of Soja-city, Okayama, Japan, deposited on Jun. 3, 1993, in the same institute, and accepted under the accession number of FERM BP-4316, and it has been maintained by the institute.
- Japanese Patent Application No.340,343/93 discloses the properties and features of the non-reducing saccharide-forming enzyme as well as the detailed bacteriological properties of these microorganisms.
- the present inventors energetically screened the chromosomal DNA of Rhizobium sp. M-11 by using an oligonucleotide as a probe which had been chemically synthesized based on the partial amino acid sequence of enzyme M-11 as revealed in Experiment 2-8 or 2-9, and obtained a DNA fragment which consists of 1,767 base pairs having the base sequence as shown in the following SEQ ID NO:1 that initiates from the 5'-terminus.
- the decoding of the base sequence of the enzyme has revealed that it has an amino acid sequence consisting of 589 amino acids as shown in SEQ ID NO:2.
- enzyme Q36 chromosomal DNA of enzyme Q36 was screened by using an oligonucleotide as a probe which had been chemically synthesized based on a partial amino acid sequence of enzyme Q36, and this yielded a DNA fragment having a base sequence consisting of 1,791 base pairs as shown in SEQ ID NO:3.
- the base sequence was decoded to reveal that enzyme Q36 has an amino acid sequence consisting of 597 amino acids as shown in SEQ ID NO:4.
- the enzyme was isolated from a culture of a donor microorganism and highly purified.
- the purified enzyme was partially hydrolyzed with protease, and the resultant 2 different types of peptide fragments were isolated and determined their amino acid sequences;
- a chromosomal DNA was isolated from a donor microorganism's cell, purified and partially digested by a restriction enzyme to obtain a DNA fragment consisting of about 2,000-6,000 base pairs.
- the DNA fragment was ligated by DNA ligase to a plasmid vector, which had been previously cut with a restriction enzyme, to obtain a recombinant DNA;
- the recombinant DNA was obtained from the selected transformant and annealed with a primer, followed by allowing a DNA polymerase to act on the resultant to extend the primer, and determining the base sequence of the resultant complementary chain DNA by the dideoxy chain termination method.
- the recombinant enzyme as referred to in the specification mean the whole recombinant enzymes which are preparable by the recombinant DNA technology and capable of releasing trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
- the recombinant enzyme according to the present invention has a revealed amino acid sequence, and, as an example, the amino acid sequence as shown in SEQ ID NO:2 or 4 which initiates from the N-terminal, as well as homologous ones to it, can be mentioned.
- Variants having amino acid sequences homologous to the one as shown in SEQ ID NO:2 or 4 can be obtained by replacing one or more amino acids in SEQ ID NO:2 or 4 with other amino acids without substantially altering the inherent activity of the enzyme.
- modified enzymes which have amino acid sequences similar to that of SEQ ID NO:2 or 4, as well as having the enzymatic activity inherent to the enzyme encoded by the DNA but defective one or more amino acids located near to the N-terminal of the amino acid sequence of SEQ ID NO:2 or 4 and/or having one or more amino acids newly added to the N-terminal by the modification of intracellular enzymes of hosts after the DNA expression.
- the enzyme as referred to in the present invention includes those which have the amino acid sequence corresponding to that of SEQ ID NO:2 or 4, and those which substantially have the amino acid sequence as shown in SEQ ID NO: 2 or 4 except that one or more amino acids in the amino acid sequence are defected, newly added to or replaced with other amino acids, as long as they release trehalose form non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
- DNAs which contain the base sequence of SEQ ID NO:1 or 3 and other DNAs, wherein one or more bases are replaced with other bases by degeneracy of genetic code, as long as they encode enzymes having the amino acid sequence as shown in SEQ ID NO: 2 or 4 and homologous variants thereof.
- the determination of base sequences from the 5'-termini of DNAs define their complementary base sequences. Therefore, the DNA according to the present invention also includes complementary base sequences corresponding to any one of the aforesaid base sequences. Needless to say, one or more bases in the base sequence, which encodes the enzyme or their variants, can be readily replaced with other bases to allow the DNA to actually express the enzyme production in hosts.
- the DNA according to the present invention is as described above, and any DNA derived from natural resources and those artificially synthesized can be used in the present invention as long as they have the aforementioned base sequences.
- the natural resources of the DNA according to the present invention are, for example, microorganisms of the genera Rhizobium, Arthrobacter, Brevibacterium and Micrococcus, i.e. Rhizobium sp. M-11 (FERM BP-4130), Arthrobacter sp. Q36 (FERM BP-4316), Brevibacterium helovolum (ATCC 11822) and Micrococcus roseus (ATCC 186) from which genes containing the present DNA can be obtained.
- microorganisms can be inoculated in nutrient culture media and cultured for about 1-3 days under aerobic conditions, and the resultant cells were collected from the cultures and subjected to ultrasonication or treated with a cell-wall lysis enzyme such as lysozyme or ⁇ -glucanase to extract genes containing the present DNA.
- a proteolytic enzyme such as protease can be used along with the cell-wall lysis enzyme, and, in the case of treating the cells with ultrasonication, they may be treated in the presence of a surfactant such as sodium dodecyl sulfate (SDS) or treated with freezing- and thawing-methods.
- SDS sodium dodecyl sulfate
- the objective DNA is obtainable by treating the resultant with phenol extraction, alcohol sedimentation, centrifugation, protease treatment and/or ribonuclease treatment used in general in the art.
- the DNA can be chemically synthesized by using the base sequence as shown in SEQ ID NO:1 or 3, or can be obtained in plasmid form by inserting a DNA, which encodes the amino acid sequence as shown in SEQ ID NO:2 or 4, into an appropriate self- replicable vector to obtain a recombinant DNA, introducing the recombinant DNA into an appropriate host to obtain a transformant, culturing the transformant, separating the proliferated cells from the resultant culture, and collecting plasmids containing the DNA from the cells.
- the present invention further relates to replicable recombinant DNAs which express the production of the enzyme according to the invention when introduced into microorganisms as well as plant- and animal-cells which do not produce the enzyme inherently but are readily proliferative.
- a recombinant DNA which generally contains the aforesaid DNA and a self-replicable vector, can be prepared by conventional method with a relative easiness when the material DNA is in hand.
- plasmid vectors such as pBR322, pUC18, Bluescript II SK(+), pUB110, pTZ4, pC194, pHV14, TRp7, TEp7, pBS7, etc.
- phage vectors such as ⁇ gt ⁇ C, ⁇ gt ⁇ B, ⁇ 11, ⁇ 1, ⁇ 105, etc.
- plasmid- and phage-vectors pBR322, pUC18, Bluescript II SK(+), ⁇ gt ⁇ C and ⁇ gt ⁇ B are satisfactorily used in case that the present DNA should be expressed in Escherichia coli, while pUB110, pTZ4, pC194, ⁇ 11, ⁇ 1 and ⁇ 105 are satisfactorily used to express the DNA in microorganisms of the genus Bacillus.
- the plasmid vectors pHV14, TRp7, TEp7 and pBS7 are suitably used when the recombinant DNA is allowed to grow in 2 or more hosts.
- the methods used to insert the present DNA into such vectors in the present invention may be conventional ones generally used in this field.
- a gene containing the present DNA and a self-replicable vector are first digested by a restriction enzyme and/or ultrasonic disintegrator, then the resultant DNA fragments and vector fragments are ligated.
- restriction enzymes which specifically act on nucleotides, particularly, type II restriction enzymes, more particularly, Sau 3AI, Eco RI, Hind III, Bam HI, Sal I, Xba I, Sac I, Pst I, etc., facilitate the ligation of the DNA fragments and vector fragments.
- the ligation of the DNA fragments and vector fragments is effected by annealing them first if necessary, then subjected to the action of a DNA ligase in vivo or in vitro.
- the recombinant DNA thus obtained is replicable without substantial limitation by introducing it into appropriate hosts, and culturing the resultant transformants.
- the recombinant DNA according to the present invention can be introduced into appropriate host microorganisms including Escherichia coli and those of the genus Bacillus as well as actinomyces and yeasts.
- Escherichia coli as a host, it can be cultured in the presence of the recombinant DNA and calcium ion, while in the case of using the microorganisms of the genus Bacillus the competent cell method and the colony hybridization method can be employed.
- Desired transformants can be cloned by the colony hybridization method or by culturing a variety of transformants in nutrient culture media containing non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, and selecting the objective transformants which release trehalose form the non-reducing saccharides.
- the transformants thus obtained extracellularly produce the objective enzyme when cultured in nutrient culture media.
- liquid media in general supplemented with carbon sources, nitrogen sources and minerals, and, if necessary, further supplemented with a small amount of amino acids and vitamins can be used as the nutrient culture media.
- carbon sources are saccharides such as starch, starch hydrolysate, glucose, fructose and sucrose.
- nitrogen sources are organic- and inorganic-substances containing nitrogen such as ammonia, ammonium salts, urea, nitrate, peptone, yeast extract, defatted soy been, corn steep liquor and beef extract.
- Cultures containing the objective enzyme can be prepared by inoculating the transformants into nutrient culture media, and incubating them at a temperature of 25°-65° C. and a pH of 2-8 for about 1-6 days under aerobic aeration-agitation conditions.
- Such a culture can be used intact as an enzyme preparation, and, usually, it may be disrupted with ultrasonic disintegrator and/or cell-wall lysis enzymes prior to use, followed by separating the enzyme from the intact cells and cell debris by filtration and/or centrifugation, and purifying the enzyme.
- the methods used for purifying the enzyme in the invention include conventional ones in general.
- the enzyme exerts a distinct activity of forming trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, and such an activity has not yet been found in any conventional enzymes. Therefore, the use of the enzyme facilitates the preparation of trehalose in a relatively-high yield and efficiency from non-reducing saccharides such as ⁇ -glucosyltrehalose, ⁇ -maltosyltrehalose, ⁇ -maltotriosyltrehalose, ⁇ -maltotetraosyltrehalose and ⁇ -maltopentaosyltrehalose in a considerably-high yield.
- non-reducing saccharides such as ⁇ -glucosyltrehalose, ⁇ -maltosyltrehalose, ⁇ -maltotriosyltrehalose, ⁇ -maltotetraosyltrehalose and ⁇ -maltopentaosyltrehalose in a considerably-high yield.
- non-reducing saccharides can be obtained in a satisfactorily-high yield from starch hydrolysates, which are obtained by treating amylaceous substances such as starch, amylose and amylopectin prepared with acids and/or amylases, by using non-reducing saccharide-forming enzyme as disclosed in Japanese Patent Application No.349,216/93.
- trehalose whose industrial preparation has been difficult, can be prepared from starch and amylaceous substances as a material with a relative easiness and in a desired amount when the present enzyme and the non-reducing saccharide-forming enzyme, as disclosed in Japanese Patent Application No.349,216/93, are used in combination.
- ⁇ -amylase, maltotetraose-forming amylase, maltopentaose-forming amylase and maltohexaose-forming amylase are especially useful to prepare the reducing amylaceous saccharides used in the invention, and, the use of any one of these amylases readily yields amylaceous saccharide mixtures rich in reducing amylaceous saccharides having a degree of glucose polymerization of 3 or higher in a considerably-high yield.
- the combination use of such an amylase and a starch debranching enzyme such as pullulanase or isoamylase can increase the yield of the reducing amylaceous saccharides usable as a substrate for the non-reducing saccharide-forming enzyme, i.e. the non-reducing saccharides can be obtained by coexisting the non-reducing saccharide-forming enzyme in an aqueous solution containing as a substrate one or more of the reducing amylaceous saccharides in an amount up to a concentration of 50 w/v %, and subjecting the solution to an enzymatic reaction at a temperature of about 40-55° C. and a pH of about 6-8 until a desired amount of the objective non-reducing saccharides are formed.
- a starch debranching enzyme such as pullulanase or isoamylase
- the recombinant enzyme according to the present invention is allowed to coexist in the aforesaid aqueous solution containing one or more of the non-reducing amylaceous saccharides, and to enzymatically react with the saccharides while keeping at a prescribed temperature and pH until a desired amount of trehalose is released.
- the temperature and pH used in the enzymatic reaction are set within the ranges of which do not inactivate the recombinant enzyme and allow the recombinant enzyme to effectively act on substrates, i.e. a temperature up to about 55° C., preferably, a temperature in the range of about 40°-55° C., and a pH of 5-10, preferably, a pH in the range of about 6-8.
- the amount and reaction time of the present recombinant enzyme are chosen dependently on the enzymatic reaction conditions.
- the enzymatic reaction effectively converts non-reducing saccharides into saccharide compositions containing trehalose and glucose and/or maltooligosaccharides, and, in the case of using ⁇ -maltotriosyltrehalose as a substrate, the conversion rate reaches to approximately 100%.
- non-reducing saccharides are formed from the hydrolysates while hydrolyzed into glucose and/or maltooligosaccharides, and because of this saccharide compositions with a relatively-high trehalose content can be effectively obtained in a relatively-high yield.
- reaction products obtained by the present conversion reaction can be used intact, and, usually, they are purified prior to use: Insoluble substances are eliminated from the reaction products by filtration and centrifugation, and the resultant solutions are decolored with activated charcoal, desalted and purified on ion exchangers, and concentrated into syrupy products. Dependently on their use, the syrupy products are dried in vacuo and spray-dried into solid products.
- the above mentioned syrupy products are subjected to one or more methods such as chromatography using an ion exchanger, activated charcoal and silica gel to separate saccharides, separately sedimentation using alcohol and/or acetone, membrane filtration, fermentation by yeasts, and removal and decomposition of reducing saccharides by alkalis.
- the methods to treat a large amount of reaction mixture are, for example, fixed bed- or pseudomoving bed-ion exchange column chromatography as disclosed in Japanese Patent Laid-Open Nos.23,799/83 and 72,598/83, and such a method enables an effective industrial-scale production of products with a relatively-high trehalose content.
- trehalose and compositions containing the same have a wide applicability to a variety of products which are apt to be readily damaged by the reducibility of saccharide sweeteners: For example, they can be satisfactorily used as a sweetener, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant in food products in general, cosmetics and pharmaceuticals.
- Rhizobium sp. M-11 was inoculated into bacto nutrient broth medium (pH 7.0), and cultured at 27° C. for 24 hours with a rotary shaker. The cells were separated from the resultant culture by centrifugation, suspended in TES buffer (pH 8.0), admixed with 0.05 w/v % lysozyme, and incubated at 37° C. for 30 min. The resultant was freezed at -80° C.
- Example 1-1 About one ml of the purified chromosomal DNA obtained in Example 1-1 was placed in a container, admixed with about 35 units of Sau 3AI, a restriction enzyme, and enzymatically reacted at 37° C. for about 20 min to partially digest the chromosomal DNA, followed by recovering a DNA fragment consisting of about 2,000-6,000 base pairs by means of sucrose density-gradient ultracentrifugation.
- the resultant transformant was inoculated into agar plate (pH 7.0) containing 50 ⁇ g/ml of 5-bromo-4-chloro-3-indolyl- ⁇ -galactoside, and cultured at 37° C. for 18 hours, followed by placing a nylon film on the agar plate to fix thereon about 6,000 colonies formed on the agar plate.
- agar plate pH 7.0
- SEQ ID NO:7 Based on the amino acid sequence located at positions from 8 to 13 as shown in SEQ ID NO:7, i.e.
- probe 1 represented by 5'-TTYGAYATHTGGGCNCC-3'(SEQ ID NO:15) was chemically synthesized, labelled with 32 P, and hybridized with the colonies of transformants fixed on the nylon film, followed by selecting 14 transformants which exhibited a strong hybridization.
- the objective recombinant DNA was selected in usual manner from the 14 transformants, and, in accordance with the method described by E. M. Southern in Journal of Molecular Biology, Vol.98, pp.503-517 (1975), the recombinant DNA was hybridized with probe 2 having the base sequence as shown in SEQ ID NO:8, which had been chemically synthesized based on the amino acid sequence located at positions from 2 to 6, i.e. Asp-Trp-Ala-Glu-Ala, in SEQ ID NO:8, followed by selecting a recombinant DNA strongly hybridized with the probe 2.
- the recombinant DNA and transformant thus selected were respectively named "pBMU27"and "BMU27".
- the transformant BMU27 was inoculated into L-broth (pH 7.0) containing 100 ⁇ g/ml ampicillin, and cultured at 37° C. for 24 hours by a rotary shaker. After completion of the culture, the resultant cells were collected from the culture by centrifugation, and treated with the alkaline method in general to extracellularly extract a recombinant DNA.
- the extract was in usual manner purified and analyzed to reveal that the recombinant DNA pBMU27 consists of about 5,700 base pairs and has the structure expressed by the restriction map as shown in FIG. 9. It was found that, as shown in FIG. 9, the DNA which consists of 1,767 base pairs for encoding the enzyme M-11 is positioned in the downstream near to the digested site of Eco RV, a restriction enzyme.
- a liquid nutrient culture medium consisting of 2.0 w/v % "PINE-DEX #4", a starch hydrolysate commercialized by Matsutani Chemical Ind., Co., Ltd., Tokyo, Japan, 0.5 w/v % peptone, 0.1 w/v % yeast extract, 0.1 w/v % disodium hydrogen phosphate and 0.1 w/v % potassium dihydrogen phosphate was adjusted to pH 7.0, admixed with 50 ⁇ g/ml ampicillin, autoclaved at 120° C. for 20 min, cooled and inoculated with a seed culture of transformant BMU27 obtained in Example 1-2, followed by culturing the transformant at 37° C.
- the resultant culture was treated with ultrasonic disintegrator to disrupt cells, and the resultant suspension was centrifuged to remove insoluble substances. The supernatant thus obtained was assayed for the enzyme activity to find that one L of the culture yielded about 4,000 units of the enzyme.
- a seed culture of Escherichia coli XLI-Blue or Rhizobium sp. M-11 was inoculated in the same fresh preparation of the same liquid nutrient culture medium but free of ampicillin, and, in the case of culturing Rhizobium sp. M-11, it was cultured and treated similarly as above except that the cultivation temperature was set to 30° C. Assaying the resultant activity, one L culture of Rhizobium sp. M-11 yielded about 2,000 units of the enzyme, and the yield was significantly lower than that of transformant BMU27. Escherichia coli XLI-Blue used as a host did not form the enzyme.
- the enzyme produced by the transformant MBU27 was purified similarly as in Experiment 1-1, and examined on the properties and characters. As a result, it was revealed that it has substantially the same physicochemical properties as enzyme M-11, i.e. it has a molecular weight of about 57,000-68,000 daltons on SDS-PAGE and an isoelectric point of about 3.3-4.6 on isoelectrophoresis. The results indicate that the present enzyme can be prepared by the recombinant DNA technology, and the yield can be significantly increased thereby.
- Example 2 Two ⁇ g of the recombinant DNA pBMU27 obtained in Example 1-2 was provided, admixed with 2 M aqueous sodium hydroxide solution to effect degeneration, and admixed with an adequate amount of cold ethanol, followed by collecting the formed sediment containing a template DNA and drying the sediment in vacuo.
- a chemically synthesized primer 1 represented by 5'-GTAAAACGACGGCCAGT-3'(SEQ ID NO:16
- the reaction product containing the complementary chain DNA was divided into quarters, to each of which 2.5 ⁇ l of 50 mM aqueous sodium chloride solution containing 80 ⁇ M dNTP and 8 ⁇ M ddATP, ddCTP, ddGTP or ddTTP was added, and the resultant mixture was incubated at 37° C. for 5 min, followed by suspending the reaction by the addition of 4 ⁇ l of 98 v/v % aqueous formamide solution containing 20 mM EDTA, 0.05 w/v % bromophenol blue, and 0.05 w/v % xylene cyanol.
- the reaction mixture was heated with a boiling-water bath for 3 min, and a portion of which was placed on a gel containing 6 w/v % polyacrylamide, and electrophoresed by energizing the gel with a constant voltage of about 2,000 volts to separate DNA fragments, followed by fixing the gel in usual manner, drying the gel and subjecting the resultant gel to autoradiography.
- amino acid sequence containing the N-terminal of SEQ ID NO:5 corresponds to the amino acid sequence located at positions from 8 to 27 in SEQ ID NO:12
- partial amino acid sequence of SEQ ID NO:7 or 8 corresponds to the amino acid sequence located at positions from 10 to 30 or at positions from 493 to 509 in SEQ ID NO:11.
- Example 1-1 a chromosomal DNA was isolated from Arthrobacter sp. Q36, purified and dissolved in SSC buffer (pH 7.1) to give a concentration of about one mg/ml, and the resultant solution was freezed at -80° C. for storage.
- Example 3-1 The purified chromosomal DNA obtained in Example 3-1 was partially digested similarly as in Example 1-2, followed by recovering a DNA fragment consisting of about 2,000-6,000 base pairs by sucrose density gradient ultracentrifugation. The DNA fragment was ligated to a lysate of Bluescript II SK(+) which had been treated with Bam HI, and the resultant recombinant DNA was introduced into Escherichia coli XLI-Blue.
- the transformants thus obtained were cultured similarly as in Example 1-2 on agar plates containing 5-bromo-4-chloro-3-indolyl- ⁇ -galactoside, and the formed about 5,000 colonies were fixed on a nylon film, while the probe 3 represented by 5'-ATGGGNTGGGAYCCNGC-3'was chemically synthesized based on the amino acid sequence of Met-Gly-Trp-Asp-Pro-Ala located at positions from 5 to 10 in SEQ ID NO:9, labelled with 32 P, and hybridized with transformant colonies which had been fixed on the nylon film, followed by selecting 10 transformants which strongly hybridized with the probe 3.
- the objective recombinant DNA was selected from 10 transformants, and hybridized with probe 4 represented by 5'-TAYGAYGTNTGGGC-3'(SEQ ID NO:18) which had been chemically synthesized based on the amino acid sequence of Tyr-Asp-Val-Trp-Ala located at positions from 8 to 12 in SEQ ID NO:10, followed by selecting a recombinant DNA which strongly hybridized with probe 4.
- the recombinant DNA and transformant thus selected were respectively named "pBRT32"and "BRT32".
- the transformant BRT32 was inoculated into L-broth containing ampicillin, and cultured similarly as in Example 1-2, and the proliferated cells were collected from the resultant culture, and from which a recombinant DNA was extracted, purified and analyzed to reveal that the recombinant DNA pBRT32 consists of about 6,200 base pairs and has the structure of the restriction map as shown in FIG. 10. As shown in FIG. 10, it was revealed that the DNA, which consists of 1,791 base pairs for encoding the DNA of enzyme Q36, is located in the downstream near to the cleavage site of Kpn I.
- a liquid nutrient culture medium consisting of 2.0 w/v % "PINE-DEX #4", a starch hydrolysate commercialized by Matsutani Chemical Ind., Co., Ltd., Tokyo, 0.5 w/v % peptone, 0.1 w/v % yeast extract, 0.1 w/v % disodium hydrogen phosphate and 0.1 w/v % potassium dihydrogen phosphate was adjusted to pH 7.0, admixed with 50 ⁇ g/ml ampicillin, autoclaved at 120° C. for 20 min, cooled and inoculated with a seed culture of the transformant BRT32 obtained in Example 3-2, followed by culturing the transformant at 37° C.
- the resultant culture was treated with an ultrasonic disintegrator to disrupt cells, and the resultant suspension was centrifuged to remove insoluble substances. The supernatant thus obtained was assayed for the present enzyme activity to find that one L of the culture yielded about 3,900 units of the enzyme.
- a seed culture of Escherichia coli XLI-Blue or Arthrobacter sp. Q36 was inoculated into a fresh preparation of the same liquid nutrient culture medium but free of ampicillin, and, in the case of culturing Arthrobacter sp. Q36, it was cultured and treated similarly as above except that the cultivation temperature was set to 30° C. Assaying the enzyme activity, one L of the culture of Arthrobacter sp. Q36 yielded about 1,800 units of the enzyme, and the yield was significantly lower than that of the transformant BRT32. The Escherichia coli XLI-Blue used as a host did not form the enzyme.
- the enzyme produced by the transformant BRT32 was purified similarly as in Experiment 1-1, and examined on the properties and characters to reveal that it has substantially the same physicochemical properties as that of enzyme Q36, i.e. it has a molecular weight of about 57,000-68,000 daltons on SDS-PAGE and an isoelectric point of about 3.3-4.6 on isoelectrophoresis. These results indicate that the enzyme can be prepared by the recombinant DNA technology, and the yield can be significantly increased thereby.
- the recombinant DNA pBRT32 obtained in Example 3-2 was similarly treated as in Example 2 to form a template DNA which was then annealed together with the primer 1, followed by allowing T7 DNA polymerase to act on the resultant to extend the primer 1 from the 5'-terminus to the 3'-terminus to obtain a complementary chain DNA.
- the complementary chain DNA was subjected to the dideoxy chain terminator method to analyze DNA fragments which had been isolated on a radiogram. The result revealed that the complementary chain DNA contained a base sequence consisting of 2,056 base pairs as shown in SEQ ID NO:12.
- amino acid sequence estimable from the base sequence was as shown in SEQ ID NO:14, and compared with the amino acid sequence containing the N-terminal or the partial amino acid sequence of SEQ ID NO:6, 9 or 10. As a result, it was found that the amino acid sequence of SEQ ID NO:6 corresponds to that located at positions from 2 to 21 in SEQ ID NO:12, and that the partial amino acid sequence in SEQ ID NO:9 or 10 corresponds to that located at positions from 470 to 489 or at positions from 12 to 31 in SEQ ID NO:14. These results indicate that enzyme Q36 has the amino acid sequence of SEQ ID NO:4, and it is encoded by the DNA having the base sequence as shown in SEQ ID NO:3.
- the flasks were cooled and inoculated with a seed culture of the transformant BMU27 obtained in Example 1-2, followed by culturing the transformant at 27° C. for 24 hours by a rotary shaker.
- 18 L of a fresh preparation of the same liquid culture medium was placed in a 30-L jar fermentor, admixed with 50 ⁇ g/ml ampicillin, sterilized at 120° C. for 20 min, cooled and inoculated with one v/v % of the seed culture obtained in the above, followed by the culture at 37° C. for 24 hours while keeping the pH at 6-8 under aeration-agitation conditions.
- the resultant culture was treated with an ultrasonic disintegrator to disrupt cells, and the resultant suspension was centrifuged to remove insoluble substances.
- the supernatant thus obtained was assayed for the enzyme activity to reveal that one L of the culture yielded about 3,900 units of the enzyme.
- the supernatant was purified by the method in Experiment 1-1 to obtain an about 67 ml aqueous solution containing an about 165 units/ml of a recombinant enzyme having a specific activity of about 290 units/mg protein.
- Recombinant BRT32 obtained by the method in Experiment 3-2 was cultured similarly as in Example 5, and the resultant culture was treated with an ultrasonic integrator to disrupt cells.
- the resultant suspension was centrifuged to remove insoluble substances, and the resultant supernatant was assayed for the enzyme activity to have an activity of about 4,000 units per L.
- the supernatant was purified by the method in Experiment 1-1 to obtain an about 55 ml aqueous solution containing about 200 units/ml of a recombinant enzyme with a specific activity of about 420 units/mg protein.
- the activity of a non-reducing saccharide-forming enzyme is expressed by the value measured on the following assay: Place 4 ml of 50 mM phosphate buffer (pH 7.0) containing 1.25 w/v % maltopentaose in a test tube, add one ml of an enzyme solution to the test tube, and incubate the solution at 40° C. for 60 min to effect enzymatic reaction. Thereafter, the reaction mixture is heated at 100° C. for 10 min to suspend the enzymatic reaction, followed by diluting it with distilled water by 10 times and assaying the reducing activity by the Somogyi-Nelson's method.
- One unit activity of the non-reducing saccharide-forming enzyme is defined as the amount of enzyme which decreases the reducing power corresponding to one ⁇ mol maltopentaose per min under the above conditions.
- a potato starch was suspended in water to give a 15 w/w % suspension which was then mixed with 0.1 w/w % calcium carbonate.
- the mixture was adjusted its pH to 6.0, mixed with 0.2 w/w %, d.s.b., of "TERMAMYL 60L", an ⁇ -amylase specimen commercialized by Novo Nordisk Bioindustri A/S, Copenhagen, Denmark, and enzymatically reacted at 95° C. for 15 min to effect gelatinization and liquefaction.
- the liquefied solution was autoclaved at 120° C.
- the product having a mild and moderate sweetness as well as an adequate viscosity and moisture-retaining ability, can be satisfactorily used in food products in general, cosmetics and pharmaceuticals as a sweetener, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
- Example 7-1(b) To 4 jacketed-stainless steel columns, having a diameter of 5.4 cm and a length of 5 m each was packed homogeneity with "XT-1016 (Na + -form)", a strong-acid cation exchange resin commercialized by Tokyo Organic Chemical Industries, Ltd., Tokyo, Japan, and the columns were cascaded in series to give a total column length of 20 m.
- the syrupy product obtained in Example 7-1(b) was fed to the columns at a rate of about 5 v/v % against the resin at an inner column temperature of 55° C., and the columns were fed with 55° C. hot water at an SV (space velocity ) 0.3 to fractionate saccharides in the syrupy product.
- fractions rich in trehalose were collected, pooled, concentrated, dried in vacuo and pulverized to obtain a solid product containing about 97 w/w % trehalose in a yield of about 56% against the starting material, d.s.b.
- the product having a mild sweetness and substantially free of reducibility, can be satisfactorily used in food products in general, cosmetics and pharmaceuticals as a sweetener, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
- Example 7-1(c) A portion of the trehalose rich fraction obtained in Example 7-1(c) was concentrated into an about 75 w/w % solution which was then transferred to a crystallizer, admixed with about 2 w/w %, d.s.b., hydrous crystalline trehalose as a seed crystal, and crystallized under gentle stirring conditions to obtain a massecuite with a crystallinity of about 45 w/w %.
- the massecuite was sprayed downward from a nozzle, equipped at the upper part of a spraying tower at a pressure of about 150 kg/cm 2 while about 85° C.
- the product having a substantial non-hygroscopicity and a mild and high-quality sweetness, can be satisfactorily used in food products in general, cosmetics, pharmaceuticals and feeds as a sweetener, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
- Potato starch was suspended in water to give a concentration of 6 w/w %, d.s.b., and the suspension was admixed with 500 units/g starch of isoamylase commercialized by Hayashibara Biochemical Laboratories,. Inc., Okayama, Japan, and enzymatically reacted for 20 hours.
- the reaction mixture was adjusted to a pH of 6.5, autoclaved at 120° C.
- the syrupy product was concentrated into an about 84 w/w % syrup which was then transferred to a crystallizer, admixed with an about 2 w/w % hydrous crystalline trehalose, d.s.b., and crystallized under gentle stirring conditions to obtain a massecuite having a crystallinity of about 45 w/w %.
- the massecuite was distributed to plastic plain vessels which were then allowed to stand at ambient temperature for 3 days to effect solidification and aging, followed by detaching the resultant blocks from the vessels and pulverizing the blocks with a cutter to obtain a solid product containing hydrous crystalline trehalose in a yield of about 90 w/w % against the material starch, d.s.b.
- the product which is substantially free of hygroscopicity and readily handleable, can be arbitrarily used in food products in general, cosmetics, pharmaceuticals as a sweetening agent, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
- Potato starch was suspended in water to give a concentration of 6 w/w %, d.s.b., and the suspension was admixed with 0.01 w/w % "NEO-SPITASE", a-amylase commercialized by Nagase Biochemicals, Ltd., Kyoto, Japan, adjusted to pH 6.2, and enzymatically reacted at 85°-90° C. for 20 min to gelatinize and liquefy the starch. The liquefied starch was heated at 120° C.
- Example 7-1(c) The syrupy product was fractionated similarly as in Example 7-1(c) except for using "CG6000(Na + )", a strong-acid cation exchange resin commercialized by Japan Organo, Co., Ltd., Tokyo, Japan, to obtain a fraction containing abut 95 w/w % trehalose, d.s.b.
- the fraction was concentrated to give a concentration of about 75 w/w %, d.s.b., and, similarly as in Example 8, crystallized, and the resultant massecuite in the form of block was pulverized to obtain a powdery product containing hydrous crystalline trehalose in a yield of about 70 w/w % against the material starch, d.s.b.
- the product which is substantially free of hygroscopicity and readily handleable, can be arbitrarily used in food products in general, cosmetics, pharmaceuticals as a sweetening agent, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
- the present invention is based on the finding that a novel enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
- the present invention is to explore a way to produce the enzyme in a relatively-large scale and in a considerably-high yield.
- the enzyme produced by the transformant according to the present invention is the one characterized by its revealed total amino acid sequence, and because of this it can be used for the preparations of trehalose which is premised on being used in food products without fear of causing side effects.
- the present invention is an useful invention which exerts the aforesaid significant action and effect as well as giving a great contribution to this field.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Disclosed are a DNA encoding an enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, recombinant DNA and enzyme, transformant, and their preparations and uses. These facilitate the industrial-scale production of trehalose with a relative easiness and low cost, and trehalose thus obtained can be satisfactorily used in a variety of food products, cosmetics and pharmaceuticals.
Description
This present application is a division of U.S. application Ser. No. 08/399,646, filed Mar. 7, 1995, now U.S. Pat. No. 5,556,781.
1. Field of the Invention
The present invention relates to a novel DNA encoding an enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, recombinant DNA containing the same, and a transformant, and further relates to a recombinant enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, as well as to preparations and uses thereof.
2. Description of the Prior Art
Trehalose is a disaccharide which consists of 2 glucose molecules which are linked together with their reducing groups, and, naturally, it is present in bacteria, fungi, algae, insects, etc., in an extremely small quantity. Having no reducing residue within the molecule, trehalose does not cause an unsatisfactory browning reaction even when heated in the presence of amino acids or the like, and because of this it can sweeten food products without fear of causing unsatisfactory coloration and deterioration. Trehalose, however, is far from being readily prepared in a desired amount by conventional methods, and, actually, it has not scarcely been used for sweetening food products.
Conventional methods are roughly, classified into 2 groups, i.e. the one using cells of microorganisms and the other employing a multi-enzymatic system wherein enzymes are allowed to act on saccharides. The former, as disclosed in Japanese Patent Laid-Open No.154,485/75, is a method which comprises allowing to grow microorganisms such as bacteria and yeasts in a nutrient culture medium, and collecting trehalose from the proliferated cells in the resultant culture. The latter, as disclosed in Japanese Patent Laid-Open No.216,695/83, is a method which comprises providing maltose as a substrate, allowing a multi-enzymatic system using maltose- and trehalose-phosphorylases to act on maltose, and isolating the formed trehalose from the reaction system. Although the former facilitates the growth of microorganisms with a relative easiness, it requires a sequentially-complicated step for collecting trehalose from the microorganisms which contain at most 15 w/w %trehalose, on a dry solid basis (d.s.b.). While the latter enables the separation of trehalose itself with a relative easiness, but it is theoretically difficult to increase the trehalose yield by allowing enzymes to act on substrates at a considerably-high concentration because the enzymatic reaction per se is an equilibrium reaction of 2 different types of enzymes and the equilibrium point constantly inclines to the side of forming glucose phosphate.
In view of the foregoing, the present inventors energetically screened enzymes which form saccharides having a trehalose structure from amylaceous saccharides, and found that microorganisms such as those of the species Rhizobium sp. M-11 and Arthrobacter sp. Q36 produce an absolutely novel enzyme which forms non-reducing saccharides having a trehalose structure as an end unit from reducing amylaceous saccharides having a degree of glucose polymerization of 3 or higher. Before or after this finding, it was revealed that such non-reducing saccharides are almost quantitatively hydrolyzed into trehalose and glucose and/or maltooligosaccharides by other enzymes produced from the same microorganisms of the species Rhizobium sp. M-11 and Arthrobacter sp. Q36. Since the combination use of such enzymes enables to form a-desired amount of trehalose with a relative easiness, the aforementioned objects relating to trehalose would be completely overcome. Insufficient producibility of such enzymes by the microorganisms results in a drawback that a relatively-large scale culture of the microorganisms is inevitable to industrially produce trehalose and/or non-reducing saccharides having a trehalose structure as an end unit.
Recombinant DNA technology has made a remarkable progress in recent years. At present, even an enzyme, whose total amino acid sequence has not yet been revealed, can be readily prepared in a desired amount, if a gene encoding the enzyme was once isolated and the base sequence was decoded, by preparing a recombinant DNA containing a DNA which encodes the enzyme, introducing the recombinant DNA into microorganisms or cells of plants or animals, and culturing the resultant transformants. Under these circumstances, urgently required are the finding of genes which encode these enzymes and the elucidation of their base sequences.
It is an object of the present invention to provide a DNA which encodes an enzyme that releases trehalose from non-reducing saccharides having a trehalose structure as an end unit.
It is a further object of the present invention to provide a replicable recombinant DNA containing the aforesaid DNA.
It is yet another object of the present invention to provide a transformant which is prepared by introducing the recombinant DNA into an appropriate host.
It is a further object of the present invention to prepare the aforesaid enzyme by the application of the recombinant DNA technology.
It is a further object of the present invention to provide a preparation of the enzyme.
It is a further object of the present invention to provide a method for converting non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
The first object of the present invention is attained by a DNA which encodes an enzyme that releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
The second object of the present invention is attained by a replicable recombinant DNA which contains the aforesaid DNA and a self-replicable vector.
The third object of the present invention is attained by a transformant prepared by introducing the aforesaid self-replicable vector into an appropriate host.
The fourth object of the present invention is attained by a recombinant enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
The fifth object of the present invention is attained by a process to produce the recombinant enzyme comprising culturing a transformant capable of forming the enzyme in a nutrient culture medium, and recovering the formed enzyme from the resultant culture.
The sixth object of the present invention is attained by a method for converting non-reducing saccharides containing a step of allowing the recombinant enzyme to act on non-reducing saccharides, having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, to release trehalose from the saccharides.
FIG. 1 shows the optimum temperature of an enzyme derived from Rhizobium sp. M-11.
FIG. 2 shows the optimum temperature of an enzyme derived from Arthrobacter sp. Q36.
FIG. 3 shows the optimum pH of an enzyme derived from Rhizobium sp. M-11.
FIG. 4 shows the optimum pH of an enzyme derived from Arthrobacter sp. Q36.
FIG. 5 shows the thermal stability of an enzyme derived from Rhizobium sp. M-11.
FIG. 6 shows the thermal stability of an enzyme derived from Arthrobacter sp. Q36.
FIG. 7 shows the pH stability of an enzyme derived from Rhizobium sp. M-11.
FIG. 8 shows the pH stability of an enzyme derived from Arthrobacter sp. Q36.
FIG. 9 shows the restriction map of the recombinant DNA pBMU27 according to the present invention. In the figure, the bold-lined part is a DNA encoding an enzyme derived from Rhizobium sp. M-11.
FIG. 10 shows the restriction map of the recombinant DNA pBRT32 according to the present invention. In the figure, the bold-lined part is a DNA encoding an enzyme derived from Arthrobacter sp. Q36.
The DNA according to the present invention exerts the production of the enzyme encoded by the DNA in a manner that the DNA is inserted into an appropriate self-replicable vector to form a replicable recombinant DNA, followed by introducing the recombinant DNA into a host, incapable of producing the enzyme per se but readily replicable, to form a transformant.
Although the recombinant DNA per se does not produce the enzyme, the production of the enzyme encoded by the DNA is attained by introducing the recombinant DNA into a host, incapable of producing the enzyme but replicable with a relative easiness, to form a transformant, and culturing the transformant to produce the enzyme.
The transformant according to the present invention produces the enzyme when cultured.
The recombinant enzyme according to the present invention releases trehalose when acts on non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
The recombinant enzyme is readily obtained in a desired amount by culturing the transformant according to the invention.
Non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher are converted into trehalose and glucose and/or maltooligosaccharides.
The present invention is based on the finding of a novel enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher. Such an enzyme can be obtained from cultures of microorganisms of the species Rhizobium sp. M-11 and Arthrobacter sp. Q36, and the present inventors isolated the enzyme by the combination use of conventional purification methods using column chromatography mainly, examined the properties and features, and revealed the reality, i.e. it is a polypeptide having the following physicochemical properties:
(1) Action Releasing trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher;
(2) Molecular weight About 57,000-68,000 daltons on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE);
(3) Isoelectric point About 3.3-4.6 on isoelectrophoresis;
(4) Optimum temperature Exhibiting an optimum temperature of around 35°-45° C. when incubated at pH 7.0 for 30 min;
(5) Optimum pH Exhibiting an optimum pH of around 6.0-7.5 when incubated at 40° C. for 30 min;
(6) Thermal stability Stable up to a temperature of around 30°-45° C. when incubated at pH 7.0 for 60 min; and
(7) pH Stability Stable up to a pH of around 5.5-10.0 when incubated at 25° C. for 16 hours.
Experiments, which were conducted to reveal the physicochemical properties of the enzymes produced by microorganisms of the species Rhizobium sp. M-11 and Arthrobacter sp. Q36 (the enzymes from Rhizobium sp. M-11 and Arthrobacter sp. Q36 are respectively designated as "enzyme M-11" and "enzyme Q36" hereinafter), are explained in the below:
In 500-ml Erlenmeyer flasks were placed 100 ml aliquots of a liquid culture medium (pH 7.0) containing 2.0 w/v % "PINE-DEX # 4", a starch hydrolysate commercialized by Matsutani Chemical Ind., Co., Ltd., Tokyo, Japan, 0.5 w/v % peptone, 0.1 w/v % yeast extract, 0.1 w/v % disodium hydrogen phosphate, and 0.1 w/v % potassium dihydrogen phosphate, and the flasks were autoclaved at 120° C. for 20 min to effect sterilization. After cooling the flasks a seed culture of Rhizobium sp. M-11 was inoculated into each liquid culture medium in each flask, followed by the incubation at 27° C. for 24 hours under rotary-shaking conditions. Twenty L of a fresh preparation of the same liquid culture medium was put in a 30-L jar fermentor and sterilized, followed by inoculating one v/v % of the culture obtained in the above into the sterilized liquid culture medium in the jar fermentor, and incubating it at a pH of 6-8 and 30° C. for 24 hours under aeration-agitation conditions.
Thereafter, about 18 L of the resultant culture was subjected to an ultra-high pressure cell disrupting apparatus to disrupt cells. The resultant suspension was centrifuged to obtain a supernatant, and to about 16 L of which was added ammonium sulfate to give a 20 w/v % saturation, followed by the standing at 4° C. for one hour and the centrifugation to remove sediment. To the resultant supernatant was added ammonium sulfate to give a 60 w/v % saturation, and the solution was allowed to stand at 4° C. for 24 hours and centrifuged to collect sediment which was then dissolved in a minimum amount of 10 mM phosphate buffer (pH 7.0). The solution thus obtained was dialyzed against 10 mM phosphate buffer (pH 7.0) for 24 hours, and centrifuged to remove insoluble substances. The resultant supernatant was fed to a column packed with "DEAE-TOYOPEARL®", a product for ion-exchange chromatography commercialized by Tosoh Corporation, Tokyo, Japan, which had been previously equilibrated with 10 mM phosphate buffer (pH 7.0), followed by feeding to the column a linear gradient buffer of sodium chloride ranging from 0 M to 0.5 M in 10 mM phosphate buffer (pH 7.0). Fractions containing the objective enzyme were collected from the eluate, pooled, dialyzed for 10 hours against 50 mM phosphate buffer (pH 7.0) containing 2 M ammonium sulfate, and centrifuged to remove insoluble substances. Thereafter, the resultant supernatant was fed to a column, which had been packed with "BUTYL TOYOPEARL®", a gel for hydrophobic column chromatography commercialized by Tosoh Corporation, Tokyo, Japan, and equilibrated with 50 mM phosphate buffer (pH 7.0) containing 2 M ammonium sulfate, followed by feeding to the column a linear gradient buffer of ammonium sulfate ranging from 2 M to 0 M in 50 mM phosphate buffer (pH 7.0). Fractions containing the objective enzyme were collected from the eluate, pooled, fed to a column packed with "TOYOPEARL® HW-55", a product for gel filtration column chromatography commercialized by Tosoh Corporation, Tokyo, Japan, which had been previously equilibrated with 50 mM phosphate buffer (pH 7.0), followed by feeding to the column 50 mM phosphate buffer (pH 7.0) and collecting fractions containing the objective enzyme. The enzyme thus obtained had a specific activity of about 240 units/mg protein, and the yield was about 650 units per L of the culture.
Throughout the specification the enzyme activity is expressed by the value measured on the following assay: Place 4 ml of 50 mM phosphate buffer (pH 7.0) containing 1.25 w/v % maltotriosyltrehalose in a test tube, add one ml of an enzyme solution to the tube, and incubate the resultant solution at 40° C. for 30 min to effect enzymatic reaction. Thereafter, one ml of the reaction mixture is mixed with 2 ml of copper reagent to suspend the enzymatic reaction, followed by assaying the reducing activity by the Somogyi-Nelson's method. As a control, an enzyme, which has been previously inactivated by heating at 100° C. for 10 min, is similarly treated as above. One unit activity of the enzyme is defined as the amount of enzyme which increases the reducing power corresponding to one μmol glucose per min under the above conditions.
Similarly as in Experiment 1-1, a seed culture of Arthrobacter sp. Q36 was cultured, and the resultant culture was treated to obtain a purified enzyme Q36 having a specific activity of about 450 units/mg protein in a yield of about 650 units per L of the culture.
According to the method disclosed in Japanese Patent Application No.349,216/93, a non-reducing saccharide containing 98 W/W % or higher, d.s.b., α-glucosyltrehalose, α-maltosyltrehalose, α-maltotriosyltrehalose, α-maltotetraosyltrehalose or α-maltopentaosyltrehalose. Either of the non-reducing saccharides as a substrate was dissolved in 50 mM phosphate buffer (pH 7.0) into a 20 w/v % solution which was then mixed with 2 units/g substrate of the purified enzyme M-11 or Q36 in Experiment 1 and subjected to an enzymatic reaction at 40° C. for 48 hours. The reaction mixture was desalted in usual manner, fed to "WB-T-330", a column for high-performance liquid chromatography (HPLC) commercialized by Wako Pure Chemical Industries, Ltd., Tokyo, Japan, followed by feeding to the column distilled water at a flow rate of 0.5 ml/min at ambient temperature to isolate saccharides contained in the reaction mixture while monitoring the saccharide concentration of the eluate with "MODEL RI-8012", a differential refractometer commercialized by Tosoh Corporation, Tokyo, Japan. As a control, an aqueous solution which contains either maltotriose, maltotetraose, maltopentaose, maltohexaose or maltoheptaose was similarly treated as above, and the resultant mixture was analyzed. The saccharide compositions of the reaction mixtures were tabulated in Tables 1 and 2.
TABLE 1 ______________________________________ Saccharide Saccharide in composition Substrate reaction mixture (%) ______________________________________ Trehalose 17.5 α-Glucosyltrehalose Glucose 6.5 α-Glucosyltrehalose 76.0 Trehalose 44.3 α-Maltosyltrehalose Maltose 44.4 α-Maltosyltrehalose 11.3 Trehalose 39.5 α-Maltotriosyltrehalose Maltotriose 60.0 α-Maltotriosyltrehalose 0.5 Trehalose 34.2 α-Maltotetraosyltrehalose Maltotetraose 65.5 α-Maltotetraosyltrehalose 0.3 Trehalose 29.1 α-Maltopentaosyltrehalose Maltopentaose 70.6 α-Maltopentaosyltrehalose 0.3 Maltotriose Maltotriose 100.0 Maltotetraose Maltotetraose 100.0 Maltopentaose Maltopentaose 100.0 Maltohexaose Maltohexaose 100.0 Maltoheptaose Maltoheptaose 100.0 ______________________________________
TABLE 2 ______________________________________ Saccharide Saccharide in Composition Substrate reaction mixture (%) ______________________________________ Trehalose 19.3 α-Glucosyltrehalose Glucose 10.2 α-Glucosyltrehalose 70.5 α-Maltosyltrehalose Trehalose 44.5 Maltose 44.4 α-Maltosyltrehalose 11.1 Trehalose 38.8 α-Maltotriosyltrehalose Maltotriose 60.7 α-Maltotriosyltrehalose 0.5 Trehalose 34.1 α-Maltotetraosyltrehalose Maltotetraose 65.7 α-Maltotetraosyltrehalose 0.2 Trehalose 29.3 α-Maltopentaosyltrehalose Maltopentaose 70.4 α-Maltopentaosyltrehalose 0.3 Maltotriose Maltotriose 100.0 Maltotetraose Maltotetraose 100.0 Maltopentaose Maltopentaose 100.0 Maltohexaose Maltohexaose 100.0 Maltoheptaose Maltoheptaose 100.0 ______________________________________
As shown in Tables 1 and 2, enzymes M-11 and Q36 almost quantitatively released trehalose, glucose and maltooligosaccharides from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher. These enzymes did not act on maltooligosaccharides, as a substrate, having a degree of glucose polymerization of 3 or higher. These facts indicate that these enzymes selectively act on non-reducing saccharides having a trehalose structure as an end unit and having a degree of polymerization degree of 3 or higher, and specifically hydrolyze the glycosidic bond between trehalose- and glycosyl-residues. Such an enzyme has never been reported and is estimated to have a novel enzymatic reaction mechanism.
In accordance with the method reported by U. K. Laemmli in Nature, Vol.227, pp.680-685 (1970), the purified enzymes M-11 and Q36 in Experiment 1 were respectively electrophoresed on sodium dodecyl sulfate polyacrylamide gel electrophoresis to show a single protein band at a position corresponding to about 57,000-68,000 daltons. The marker proteins used in this experiment were myosin (MW=200,000 daltons), β-galactosidase (MW=116,250 daltons), phosphorylase B (MW=97,400 daltons), serum albumin (MW=66,200 daltons) and ovalbumin (MW=45,000 daltons).
The purified enzymes M-11 and Q36 obtained in Experiment 1 gave an isoelectric point of about 3.3-4.6 on isoelectrophoresis.
The optimum temperature of the purified enzymes M-11 and Q36 obtained in Experiment 1 was about 35°-45° C. as shown in FIGS. 1 and 2 when incubated in usual manner in 50 mM phosphate buffer (pH 7.0) for 30 min.
The optimum pH of the purified enzymes M-11 and Q36 obtained in Experiment 1 was about 6.0-7.5 as shown in FIGS. 3 and 4 when experimented in usual manner by incubating them at 40° C. for 30 min in 50 mM acetate buffer, phosphate buffer or sodium carbonate-sodium hydrogen carbonate buffer having different pHs.
The purified enzymes M-11 and Q36 obtained in Experiment 1 were stable up to a temperature of about 30°-45° C. as shown in FIGS. 5 and 6 when experimented in usual manner by incubating them in 50 mM phosphate buffer (pH 7.0) for 60 min.
The purified enzymes M-11 and Q36 obtained in Experiment 1 were stable up to a pH of about 5.5-10.0 as shown in FIGS. 7 and 8 when experimented in usual manner by incubating them at 25° C. for 16 hours in 50 mM acetate buffer, phosphate buffer or sodium carbonate-sodium hydrogen carbonate buffer having different pHs.
The amino acid sequence containing the N-terminal of the purified enzyme M-11 obtained in Experiment 1 was analyzed on "MODEL 470A", a gas-phase protein sequencer commercialized by Applied Biosystems, Inc., Foster City, USA, to reveal that it has the amino acid sequence as shown in SEQ ID NO:5.
The amino acid sequence containing the N-terminal of the purified enzyme Q36 was analyzed similarly as above to reveal that it has the amino acid sequence as shown in SEQ ID NO:6.
An adequate amount of the purified enzyme M-11 obtained in Experiment 1-1 was weighed, dialyzed against 10 mM Tris-HCl buffer (pH 9.0) at 4° C. for 18 hours, and admixed with 10 mM Tris-HCl buffer (pH 9.0) to give a concentration of about one mg/ml of the enzyme. About one ml of the resultant solution was placed in a container, admixed with 10 μg lysyl endopeptidase, and incubated at 30° C. for 22 hours to partially hydrolyze the enzyme. The resultant hydrolysate was applied to "CAPCELL-PAK C18", a column for reverse-phase high-performance liquid chromatography commercialized by Shiseido Co., Ltd., Tokyo, Japan, which had been previously equilibrated with 0.1 v/v % trifluoroacetate containing 16 v/v % aqueous acetonitrile, followed by feeding to the column 0.1 v/v % trifluoroacetate at a flow rate of 0.9 ml/min while increasing the concentration of acetonitrile from 16 v/v % to 64 v/v % to separately collect fractions containing a peptide fragment eluted about 43 min or about 57 min after the initiation of feeding (the peptide fragments were respectively named "peptide fragment A" and "peptide fragment B"). Fractions containing the peptide fragment A or B were separately pooled, dried in vacuo, and dissolved in 0.1 v/v % trifluoroacetate containing 50 v/v % aqueous acetonitrile. Similarly as in Experiment 2-8, the peptide fragments A and B were analyzed to reveal that they have the amino acid sequences as shown in SEQ ID NOs:7 and 8, respectively.
Similarly as in enzyme M-11, enzyme Q36 obtained in Experiment 1-2 was partially hydrolyzed, and the resultant was fed to "μBONDAPAK C18", a column for reverse-phase high-performance liquid chromatography commercialized by Japan Millipore Ltd., Tokyo, Japan, which had been previously equilibrated with 0.1 v/v % trifluoroacetate containing 24 v/v % aqueous acetonitrile, followed by feeding to the column 0.1 v/v % trifluoroacetate containing 24 v/v % aqueous acetonitrile while increasing the concentration of aqueous acetonitrile from 24 v/v % to 44 v/v % at a flow rate of 0.9 ml/ml. Fractions containing a peptide fragment eluted about 4 min or about 24 min after the initiation of feeding (the fractions were respectively called "peptide fragment C" and "peptide fragment D" hereinafter) were respectively collected, pooled, dried in vacuo, and dissolved in 0.1 v/v % trifluoroacetate containing 50 v/v % aqueous acetonitrile. Analyses of the peptide fragments C and D conducted similarly as above have revealed that they have amino acid sequences as shown in SEQ ID NOs:9 10 respectively.
No enzyme having these physicochemical properties has been known, and this concluded that it is a novel substance. Referring to Rhizobium sp. M-11, it is a microorganism which was isolated from a soil of Okayama-city, Okayama, Japan, deposited on Dec. 24, 1992, in National Institute of Bioscience and Human-Technology Agency of Industrial Science and Technology, Tsukuba, Ibaraki, Japan, and accepted under the accession number of FERM BP-4130, and it has been maintained by the institute. Arthrobacter sp. Q36 is a microorganism which was isolated from a soil of Soja-city, Okayama, Japan, deposited on Jun. 3, 1993, in the same institute, and accepted under the accession number of FERM BP-4316, and it has been maintained by the institute.
Japanese Patent Application No.340,343/93, applied by the same applicant, discloses the properties and features of the non-reducing saccharide-forming enzyme as well as the detailed bacteriological properties of these microorganisms.
The present inventors energetically screened the chromosomal DNA of Rhizobium sp. M-11 by using an oligonucleotide as a probe which had been chemically synthesized based on the partial amino acid sequence of enzyme M-11 as revealed in Experiment 2-8 or 2-9, and obtained a DNA fragment which consists of 1,767 base pairs having the base sequence as shown in the following SEQ ID NO:1 that initiates from the 5'-terminus. The decoding of the base sequence of the enzyme has revealed that it has an amino acid sequence consisting of 589 amino acids as shown in SEQ ID NO:2.
Similarly as in enzyme M-11, the chromosomal DNA of enzyme Q36 was screened by using an oligonucleotide as a probe which had been chemically synthesized based on a partial amino acid sequence of enzyme Q36, and this yielded a DNA fragment having a base sequence consisting of 1,791 base pairs as shown in SEQ ID NO:3. The base sequence was decoded to reveal that enzyme Q36 has an amino acid sequence consisting of 597 amino acids as shown in SEQ ID NO:4.
The sequential experimental steps used for revealing the base sequence and amino acid sequence as shown in SEQ ID NOs:1 to 4 are summarized as below:
(1) The enzyme was isolated from a culture of a donor microorganism and highly purified. The purified enzyme was partially hydrolyzed with protease, and the resultant 2 different types of peptide fragments were isolated and determined their amino acid sequences;
(2) Separately, a chromosomal DNA was isolated from a donor microorganism's cell, purified and partially digested by a restriction enzyme to obtain a DNA fragment consisting of about 2,000-6,000 base pairs. The DNA fragment was ligated by DNA ligase to a plasmid vector, which had been previously cut with a restriction enzyme, to obtain a recombinant DNA;
(3) The recombinant DNA was introduced into Escherichia coli to obtain transformants, and from which an objective transformant containing a DNA encoding the enzyme was selected by the colony hybridization method using an oligonucleotide, as a probe, which had been chemically synthesized based on the aforesaid partial amino acid sequence; and
(4) The recombinant DNA was obtained from the selected transformant and annealed with a primer, followed by allowing a DNA polymerase to act on the resultant to extend the primer, and determining the base sequence of the resultant complementary chain DNA by the dideoxy chain termination method. The comparison of an amino acid sequence, estimable from the determined base sequence with the aforesaid amino acid sequence, confirmed that the base sequence encodes the enzyme.
The recombinant enzyme as referred to in the specification mean the whole recombinant enzymes which are preparable by the recombinant DNA technology and capable of releasing trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher. Generally, the recombinant enzyme according to the present invention has a revealed amino acid sequence, and, as an example, the amino acid sequence as shown in SEQ ID NO:2 or 4 which initiates from the N-terminal, as well as homologous ones to it, can be mentioned. Variants having amino acid sequences homologous to the one as shown in SEQ ID NO:2 or 4 can be obtained by replacing one or more amino acids in SEQ ID NO:2 or 4 with other amino acids without substantially altering the inherent activity of the enzyme. Although even when used the same DNA and it also depends on hosts into which the DNA is introduced, as well as on ingredients and components of nutrient culture media used for culturing transformants, and their cultivation temperature and pH, there may be produced modified enzymes which have amino acid sequences similar to that of SEQ ID NO:2 or 4, as well as having the enzymatic activity inherent to the enzyme encoded by the DNA but defective one or more amino acids located near to the N-terminal of the amino acid sequence of SEQ ID NO:2 or 4 and/or having one or more amino acids newly added to the N-terminal by the modification of intracellular enzymes of hosts after the DNA expression. In view of the technical background in the art, the enzyme as referred to in the present invention includes those which have the amino acid sequence corresponding to that of SEQ ID NO:2 or 4, and those which substantially have the amino acid sequence as shown in SEQ ID NO: 2 or 4 except that one or more amino acids in the amino acid sequence are defected, newly added to or replaced with other amino acids, as long as they release trehalose form non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher.
In this field, it is known that one or more bases in DNAs can be replaced with other bases by the degeneracy of genetic code without altering the amino acid sequences encoded by the DNAs. Based on this the DNA according to the present invention includes DNAs which contain the base sequence of SEQ ID NO:1 or 3 and other DNAs, wherein one or more bases are replaced with other bases by degeneracy of genetic code, as long as they encode enzymes having the amino acid sequence as shown in SEQ ID NO: 2 or 4 and homologous variants thereof.
According to the today's recombinant DNA technology, the determination of base sequences from the 5'-termini of DNAs define their complementary base sequences. Therefore, the DNA according to the present invention also includes complementary base sequences corresponding to any one of the aforesaid base sequences. Needless to say, one or more bases in the base sequence, which encodes the enzyme or their variants, can be readily replaced with other bases to allow the DNA to actually express the enzyme production in hosts.
The DNA according to the present invention is as described above, and any DNA derived from natural resources and those artificially synthesized can be used in the present invention as long as they have the aforementioned base sequences. The natural resources of the DNA according to the present invention are, for example, microorganisms of the genera Rhizobium, Arthrobacter, Brevibacterium and Micrococcus, i.e. Rhizobium sp. M-11 (FERM BP-4130), Arthrobacter sp. Q36 (FERM BP-4316), Brevibacterium helovolum (ATCC 11822) and Micrococcus roseus (ATCC 186) from which genes containing the present DNA can be obtained. These microorganisms can be inoculated in nutrient culture media and cultured for about 1-3 days under aerobic conditions, and the resultant cells were collected from the cultures and subjected to ultrasonication or treated with a cell-wall lysis enzyme such as lysozyme or β-glucanase to extract genes containing the present DNA. In this case, a proteolytic enzyme such as protease can be used along with the cell-wall lysis enzyme, and, in the case of treating the cells with ultrasonication, they may be treated in the presence of a surfactant such as sodium dodecyl sulfate (SDS) or treated with freezing- and thawing-methods. The objective DNA is obtainable by treating the resultant with phenol extraction, alcohol sedimentation, centrifugation, protease treatment and/or ribonuclease treatment used in general in the art.
To artificially synthesize the DNA according to the present invention, it can be chemically synthesized by using the base sequence as shown in SEQ ID NO:1 or 3, or can be obtained in plasmid form by inserting a DNA, which encodes the amino acid sequence as shown in SEQ ID NO:2 or 4, into an appropriate self- replicable vector to obtain a recombinant DNA, introducing the recombinant DNA into an appropriate host to obtain a transformant, culturing the transformant, separating the proliferated cells from the resultant culture, and collecting plasmids containing the DNA from the cells.
The present invention further relates to replicable recombinant DNAs which express the production of the enzyme according to the invention when introduced into microorganisms as well as plant- and animal-cells which do not produce the enzyme inherently but are readily proliferative. Such a recombinant DNA, which generally contains the aforesaid DNA and a self-replicable vector, can be prepared by conventional method with a relative easiness when the material DNA is in hand. Examples of such a vector are plasmid vectors such as pBR322, pUC18, Bluescript II SK(+), pUB110, pTZ4, pC194, pHV14, TRp7, TEp7, pBS7, etc.; and phage vectors such as λgt·λC, λgt·λB, ρ11, φ1, φ105, etc. Among these plasmid- and phage-vectors, pBR322, pUC18, Bluescript II SK(+), λgt·λC and λgt·λB are satisfactorily used in case that the present DNA should be expressed in Escherichia coli, while pUB110, pTZ4, pC194, ρ11, φ1 and φ105 are satisfactorily used to express the DNA in microorganisms of the genus Bacillus. The plasmid vectors pHV14, TRp7, TEp7 and pBS7 are suitably used when the recombinant DNA is allowed to grow in 2 or more hosts.
The methods used to insert the present DNA into such vectors in the present invention may be conventional ones generally used in this field. A gene containing the present DNA and a self-replicable vector are first digested by a restriction enzyme and/or ultrasonic disintegrator, then the resultant DNA fragments and vector fragments are ligated. To digest DNAs and vectors, restriction enzymes which specifically act on nucleotides, particularly, type II restriction enzymes, more particularly, Sau 3AI, Eco RI, Hind III, Bam HI, Sal I, Xba I, Sac I, Pst I, etc., facilitate the ligation of the DNA fragments and vector fragments. The ligation of the DNA fragments and vector fragments is effected by annealing them first if necessary, then subjected to the action of a DNA ligase in vivo or in vitro. The recombinant DNA thus obtained is replicable without substantial limitation by introducing it into appropriate hosts, and culturing the resultant transformants.
The recombinant DNA according to the present invention can be introduced into appropriate host microorganisms including Escherichia coli and those of the genus Bacillus as well as actinomyces and yeasts. In the case of using Escherichia coli as a host, it can be cultured in the presence of the recombinant DNA and calcium ion, while in the case of using the microorganisms of the genus Bacillus the competent cell method and the colony hybridization method can be employed. Desired transformants can be cloned by the colony hybridization method or by culturing a variety of transformants in nutrient culture media containing non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, and selecting the objective transformants which release trehalose form the non-reducing saccharides.
The transformants thus obtained extracellularly produce the objective enzyme when cultured in nutrient culture media. Generally, liquid media in general supplemented with carbon sources, nitrogen sources and minerals, and, if necessary, further supplemented with a small amount of amino acids and vitamins can be used as the nutrient culture media. Examples of the carbon sources are saccharides such as starch, starch hydrolysate, glucose, fructose and sucrose. Examples of the nitrogen sources are organic- and inorganic-substances containing nitrogen such as ammonia, ammonium salts, urea, nitrate, peptone, yeast extract, defatted soy been, corn steep liquor and beef extract. Cultures containing the objective enzyme can be prepared by inoculating the transformants into nutrient culture media, and incubating them at a temperature of 25°-65° C. and a pH of 2-8 for about 1-6 days under aerobic aeration-agitation conditions. Such a culture can be used intact as an enzyme preparation, and, usually, it may be disrupted with ultrasonic disintegrator and/or cell-wall lysis enzymes prior to use, followed by separating the enzyme from the intact cells and cell debris by filtration and/or centrifugation, and purifying the enzyme. The methods used for purifying the enzyme in the invention include conventional ones in general. From cultures the intact cells and cell debris are eliminated and subjected to one or more methods such as concentration, salting out, dialysis, separately sedimentation, gel filtration chromatography, ion exchange chromatography, hydrophobic chromatography, affinity chromatography, gel electrophoresis and isoelectric point electrophoresis.
As is described above, the enzyme exerts a distinct activity of forming trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, and such an activity has not yet been found in any conventional enzymes. Therefore, the use of the enzyme facilitates the preparation of trehalose in a relatively-high yield and efficiency from non-reducing saccharides such as α-glucosyltrehalose, α-maltosyltrehalose, α-maltotriosyltrehalose, α-maltotetraosyltrehalose and α-maltopentaosyltrehalose in a considerably-high yield. These non-reducing saccharides can be obtained in a satisfactorily-high yield from starch hydrolysates, which are obtained by treating amylaceous substances such as starch, amylose and amylopectin prepared with acids and/or amylases, by using non-reducing saccharide-forming enzyme as disclosed in Japanese Patent Application No.349,216/93. Thus, trehalose, whose industrial preparation has been difficult, can be prepared from starch and amylaceous substances as a material with a relative easiness and in a desired amount when the present enzyme and the non-reducing saccharide-forming enzyme, as disclosed in Japanese Patent Application No.349,216/93, are used in combination.
As described in "Handbook of Amylases and Related Enzymes", 1st edition, edited by The Amylase Research Society of Japan, published by Pergamon Press plc, Oxford, England (1988), α-amylase, maltotetraose-forming amylase, maltopentaose-forming amylase and maltohexaose-forming amylase are especially useful to prepare the reducing amylaceous saccharides used in the invention, and, the use of any one of these amylases readily yields amylaceous saccharide mixtures rich in reducing amylaceous saccharides having a degree of glucose polymerization of 3 or higher in a considerably-high yield. If necessary, the combination use of such an amylase and a starch debranching enzyme such as pullulanase or isoamylase can increase the yield of the reducing amylaceous saccharides usable as a substrate for the non-reducing saccharide-forming enzyme, i.e. the non-reducing saccharides can be obtained by coexisting the non-reducing saccharide-forming enzyme in an aqueous solution containing as a substrate one or more of the reducing amylaceous saccharides in an amount up to a concentration of 50 w/v %, and subjecting the solution to an enzymatic reaction at a temperature of about 40-55° C. and a pH of about 6-8 until a desired amount of the objective non-reducing saccharides are formed.
Usually, in the present conversion method, the recombinant enzyme according to the present invention is allowed to coexist in the aforesaid aqueous solution containing one or more of the non-reducing amylaceous saccharides, and to enzymatically react with the saccharides while keeping at a prescribed temperature and pH until a desired amount of trehalose is released.
Although the enzymatic reaction proceeds even below a concentration of 0.1 w/v % of a substrate, a higher concentration of 2 w/v %, preferably, 5-50 w/v % of a substrate can be satisfactorily used to apply the present conversion method to an industrial-scale production. The temperature and pH used in the enzymatic reaction are set within the ranges of which do not inactivate the recombinant enzyme and allow the recombinant enzyme to effectively act on substrates, i.e. a temperature up to about 55° C., preferably, a temperature in the range of about 40°-55° C., and a pH of 5-10, preferably, a pH in the range of about 6-8. The amount and reaction time of the present recombinant enzyme are chosen dependently on the enzymatic reaction conditions. The enzymatic reaction effectively converts non-reducing saccharides into saccharide compositions containing trehalose and glucose and/or maltooligosaccharides, and, in the case of using α-maltotriosyltrehalose as a substrate, the conversion rate reaches to approximately 100%. In the case of simultaneously subjecting starch hydrolysates to the action of either of the above amylases together with the non-reducing saccharide-forming enzyme and the present recombinant enzyme, non-reducing saccharides are formed from the hydrolysates while hydrolyzed into glucose and/or maltooligosaccharides, and because of this saccharide compositions with a relatively-high trehalose content can be effectively obtained in a relatively-high yield.
The reaction products obtained by the present conversion reaction can be used intact, and, usually, they are purified prior to use: Insoluble substances are eliminated from the reaction products by filtration and centrifugation, and the resultant solutions are decolored with activated charcoal, desalted and purified on ion exchangers, and concentrated into syrupy products. Dependently on their use, the syrupy products are dried in vacuo and spray-dried into solid products. In order to obtain products which substantially consist of non-reducing saccharides, the above mentioned syrupy products are subjected to one or more methods such as chromatography using an ion exchanger, activated charcoal and silica gel to separate saccharides, separately sedimentation using alcohol and/or acetone, membrane filtration, fermentation by yeasts, and removal and decomposition of reducing saccharides by alkalis. The methods to treat a large amount of reaction mixture are, for example, fixed bed- or pseudomoving bed-ion exchange column chromatography as disclosed in Japanese Patent Laid-Open Nos.23,799/83 and 72,598/83, and such a method enables an effective industrial-scale production of products with a relatively-high trehalose content.
These trehalose and compositions containing the same have a wide applicability to a variety of products which are apt to be readily damaged by the reducibility of saccharide sweeteners: For example, they can be satisfactorily used as a sweetener, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant in food products in general, cosmetics and pharmaceuticals.
The following examples explain the present invention in more detail, and the techniques themselves used in the examples are conventional ones in this field, for example, those described by J. Sumbruck et al. in "Molecular Cloning A Laboratory Manual", 2nd edition, published by Cold Spring Harbor Laboratory Press (1989).
A seed culture of Rhizobium sp. M-11 was inoculated into bacto nutrient broth medium (pH 7.0), and cultured at 27° C. for 24 hours with a rotary shaker. The cells were separated from the resultant culture by centrifugation, suspended in TES buffer (pH 8.0), admixed with 0.05 w/v % lysozyme, and incubated at 37° C. for 30 min. The resultant was freezed at -80° C. for one hour, admixed with TSS buffer (pH 9.0), heated to 60° C., and further admixed with a mixture solution of TES buffer and phenol, and the resultant solution was chilled with ice, followed by centrifugally collecting the precipitated crude chromosomal DNA. To the supernatant was added 2 fold volumes of cold ethanol, and the reprecipitated crude chromosomal DNA was collected, suspended in SSC buffer (pH 7.1), admixed with 7.5 μg ribonuclease and 125 μg protease, and incubated at 37° C. for one hour. Thereafter, a mixture solution of chloroform and isoamyl alcohol was added to the reaction mixture to extract the objective chromosomal DNA, and admixed with cold ethanol, followed by collecting the formed sediment containing the chromosomal DNA. The purified chromosomal DNA thus obtained was dissolved in SSC buffer (pH 7.1) to give a concentration of about one mg/ml, and the resultant solution was freezed at -80° C.
About one ml of the purified chromosomal DNA obtained in Example 1-1 was placed in a container, admixed with about 35 units of Sau 3AI, a restriction enzyme, and enzymatically reacted at 37° C. for about 20 min to partially digest the chromosomal DNA, followed by recovering a DNA fragment consisting of about 2,000-6,000 base pairs by means of sucrose density-gradient ultracentrifugation. One μg of Bluescript II SK(+), a plasmid vector, was provided, subjected to the action of Bam HI, a restriction enzyme, to completely digest the plasmid vector, admixed with 10 μg of the DNA fragment and 2 units of T4 DNA ligase, and allowed to stand at 4° C. overnight to ligate the DNA fragment to the vector fragment. To the resultant recombinant DNA was added 30 μl of "Epicurian Coli® XLI-Blue", competent cell commercialized by Toyobo Co., Ltd., Tokyo, Japan, allowed to stand under ice-chilling conditions for 30 min, heated to 42° C., admixed with SOC broth, and incubated at 37° C. for one hour to introduce the recombinant DNA into Escherichia coli.
The resultant transformant was inoculated into agar plate (pH 7.0) containing 50 μg/ml of 5-bromo-4-chloro-3-indolyl-β-galactoside, and cultured at 37° C. for 18 hours, followed by placing a nylon film on the agar plate to fix thereon about 6,000 colonies formed on the agar plate. Based on the amino acid sequence located at positions from 8 to 13 as shown in SEQ ID NO:7, i.e. Phe-Asp-Ile-Trp-Ala-Pro, the base sequence of probe 1 represented by 5'-TTYGAYATHTGGGCNCC-3'(SEQ ID NO:15) was chemically synthesized, labelled with 32 P, and hybridized with the colonies of transformants fixed on the nylon film, followed by selecting 14 transformants which exhibited a strong hybridization.
The objective recombinant DNA was selected in usual manner from the 14 transformants, and, in accordance with the method described by E. M. Southern in Journal of Molecular Biology, Vol.98, pp.503-517 (1975), the recombinant DNA was hybridized with probe 2 having the base sequence as shown in SEQ ID NO:8, which had been chemically synthesized based on the amino acid sequence located at positions from 2 to 6, i.e. Asp-Trp-Ala-Glu-Ala, in SEQ ID NO:8, followed by selecting a recombinant DNA strongly hybridized with the probe 2. The recombinant DNA and transformant thus selected were respectively named "pBMU27"and "BMU27".
The transformant BMU27 was inoculated into L-broth (pH 7.0) containing 100 μg/ml ampicillin, and cultured at 37° C. for 24 hours by a rotary shaker. After completion of the culture, the resultant cells were collected from the culture by centrifugation, and treated with the alkaline method in general to extracellularly extract a recombinant DNA. The extract was in usual manner purified and analyzed to reveal that the recombinant DNA pBMU27 consists of about 5,700 base pairs and has the structure expressed by the restriction map as shown in FIG. 9. It was found that, as shown in FIG. 9, the DNA which consists of 1,767 base pairs for encoding the enzyme M-11 is positioned in the downstream near to the digested site of Eco RV, a restriction enzyme.
A liquid nutrient culture medium consisting of 2.0 w/v % "PINE-DEX # 4", a starch hydrolysate commercialized by Matsutani Chemical Ind., Co., Ltd., Tokyo, Japan, 0.5 w/v % peptone, 0.1 w/v % yeast extract, 0.1 w/v % disodium hydrogen phosphate and 0.1 w/v % potassium dihydrogen phosphate was adjusted to pH 7.0, admixed with 50 μg/ml ampicillin, autoclaved at 120° C. for 20 min, cooled and inoculated with a seed culture of transformant BMU27 obtained in Example 1-2, followed by culturing the transformant at 37° C. for 24 hours by a rotary shaker. The resultant culture was treated with ultrasonic disintegrator to disrupt cells, and the resultant suspension was centrifuged to remove insoluble substances. The supernatant thus obtained was assayed for the enzyme activity to find that one L of the culture yielded about 4,000 units of the enzyme.
As a control, a seed culture of Escherichia coli XLI-Blue or Rhizobium sp. M-11 was inoculated in the same fresh preparation of the same liquid nutrient culture medium but free of ampicillin, and, in the case of culturing Rhizobium sp. M-11, it was cultured and treated similarly as above except that the cultivation temperature was set to 30° C. Assaying the resultant activity, one L culture of Rhizobium sp. M-11 yielded about 2,000 units of the enzyme, and the yield was significantly lower than that of transformant BMU27. Escherichia coli XLI-Blue used as a host did not form the enzyme.
Thereafter, the enzyme produced by the transformant MBU27 was purified similarly as in Experiment 1-1, and examined on the properties and characters. As a result, it was revealed that it has substantially the same physicochemical properties as enzyme M-11, i.e. it has a molecular weight of about 57,000-68,000 daltons on SDS-PAGE and an isoelectric point of about 3.3-4.6 on isoelectrophoresis. The results indicate that the present enzyme can be prepared by the recombinant DNA technology, and the yield can be significantly increased thereby.
Two μg of the recombinant DNA pBMU27 obtained in Example 1-2 was provided, admixed with 2 M aqueous sodium hydroxide solution to effect degeneration, and admixed with an adequate amount of cold ethanol, followed by collecting the formed sediment containing a template DNA and drying the sediment in vacuo. To the template DNA were added 50 pmole/ml of a chemically synthesized primer 1 represented by 5'-GTAAAACGACGGCCAGT-3'(SEQ ID NO:16), 10 μl of 40 mM Tris-HCl buffer (pH 7.5) containing 20 mM magnesium chloride and 20 mM sodium chloride, and the mixture was incubated at 65° C. for 2 min to effect annealing and admixed with 2 μl of an aqueous solution containing dATP, dGTP and dTTP in respective amounts of 7.5 μM, 0.5 μl of α-32 P!dCTP (2 mCi/ml), one μl of 0.1 M dithiothreitol, and 2 μl of 1. 5 units/ml T7 DNA polymerase, followed by incubating the resultant mixture at 25° C. for 5 min to extend the primer 1 from the 5'-terminus to the 3'-terminus. Thus, a complementary chain DNA was formed.
The reaction product containing the complementary chain DNA was divided into quarters, to each of which 2.5 μl of 50 mM aqueous sodium chloride solution containing 80 μM dNTP and 8 μM ddATP, ddCTP, ddGTP or ddTTP was added, and the resultant mixture was incubated at 37° C. for 5 min, followed by suspending the reaction by the addition of 4 μl of 98 v/v % aqueous formamide solution containing 20 mM EDTA, 0.05 w/v % bromophenol blue, and 0.05 w/v % xylene cyanol. The reaction mixture was heated with a boiling-water bath for 3 min, and a portion of which was placed on a gel containing 6 w/v % polyacrylamide, and electrophoresed by energizing the gel with a constant voltage of about 2,000 volts to separate DNA fragments, followed by fixing the gel in usual manner, drying the gel and subjecting the resultant gel to autoradiography.
Analyses of the DNA fragments separated on the radiogram revealed that the complementary chain DNA contains the base sequence consisting of about 2,161 base pairs as shown in SEQ ID NO:11. An amino acid sequence estimable from the base sequence was as shown in SEQ ID NO:12 and was compared with the amino acid sequence containing the N-terminal or the partial amino acid sequence of enzyme M-11 as shown in SEQ ID NO:5, 7 or 8. As a result, it was found that the amino acid sequence containing the N-terminal of SEQ ID NO:5 corresponds to the amino acid sequence located at positions from 8 to 27 in SEQ ID NO:12, and the partial amino acid sequence of SEQ ID NO:7 or 8 corresponds to the amino acid sequence located at positions from 10 to 30 or at positions from 493 to 509 in SEQ ID NO:11. These results indicate that enzyme M-11 has the amino acid sequence of SEQ ID NO:2, and it is encoded by the DNA having the base sequence as shown in SEQ ID NO:1.
Similarly as in Example 1-1, a chromosomal DNA was isolated from Arthrobacter sp. Q36, purified and dissolved in SSC buffer (pH 7.1) to give a concentration of about one mg/ml, and the resultant solution was freezed at -80° C. for storage.
The purified chromosomal DNA obtained in Example 3-1 was partially digested similarly as in Example 1-2, followed by recovering a DNA fragment consisting of about 2,000-6,000 base pairs by sucrose density gradient ultracentrifugation. The DNA fragment was ligated to a lysate of Bluescript II SK(+) which had been treated with Bam HI, and the resultant recombinant DNA was introduced into Escherichia coli XLI-Blue. The transformants thus obtained were cultured similarly as in Example 1-2 on agar plates containing 5-bromo-4-chloro-3-indolyl-β-galactoside, and the formed about 5,000 colonies were fixed on a nylon film, while the probe 3 represented by 5'-ATGGGNTGGGAYCCNGC-3'was chemically synthesized based on the amino acid sequence of Met-Gly-Trp-Asp-Pro-Ala located at positions from 5 to 10 in SEQ ID NO:9, labelled with 32 P, and hybridized with transformant colonies which had been fixed on the nylon film, followed by selecting 10 transformants which strongly hybridized with the probe 3.
Similarly as in Example 1-2, the objective recombinant DNA was selected from 10 transformants, and hybridized with probe 4 represented by 5'-TAYGAYGTNTGGGC-3'(SEQ ID NO:18) which had been chemically synthesized based on the amino acid sequence of Tyr-Asp-Val-Trp-Ala located at positions from 8 to 12 in SEQ ID NO:10, followed by selecting a recombinant DNA which strongly hybridized with probe 4. The recombinant DNA and transformant thus selected were respectively named "pBRT32"and "BRT32".
The transformant BRT32 was inoculated into L-broth containing ampicillin, and cultured similarly as in Example 1-2, and the proliferated cells were collected from the resultant culture, and from which a recombinant DNA was extracted, purified and analyzed to reveal that the recombinant DNA pBRT32 consists of about 6,200 base pairs and has the structure of the restriction map as shown in FIG. 10. As shown in FIG. 10, it was revealed that the DNA, which consists of 1,791 base pairs for encoding the DNA of enzyme Q36, is located in the downstream near to the cleavage site of Kpn I.
A liquid nutrient culture medium consisting of 2.0 w/v % "PINE-DEX # 4", a starch hydrolysate commercialized by Matsutani Chemical Ind., Co., Ltd., Tokyo, 0.5 w/v % peptone, 0.1 w/v % yeast extract, 0.1 w/v % disodium hydrogen phosphate and 0.1 w/v % potassium dihydrogen phosphate was adjusted to pH 7.0, admixed with 50 μg/ml ampicillin, autoclaved at 120° C. for 20 min, cooled and inoculated with a seed culture of the transformant BRT32 obtained in Example 3-2, followed by culturing the transformant at 37° C. for 24 hours by a rotary shaker. The resultant culture was treated with an ultrasonic disintegrator to disrupt cells, and the resultant suspension was centrifuged to remove insoluble substances. The supernatant thus obtained was assayed for the present enzyme activity to find that one L of the culture yielded about 3,900 units of the enzyme.
As a control, a seed culture of Escherichia coli XLI-Blue or Arthrobacter sp. Q36 was inoculated into a fresh preparation of the same liquid nutrient culture medium but free of ampicillin, and, in the case of culturing Arthrobacter sp. Q36, it was cultured and treated similarly as above except that the cultivation temperature was set to 30° C. Assaying the enzyme activity, one L of the culture of Arthrobacter sp. Q36 yielded about 1,800 units of the enzyme, and the yield was significantly lower than that of the transformant BRT32. The Escherichia coli XLI-Blue used as a host did not form the enzyme.
Thereafter, the enzyme produced by the transformant BRT32 was purified similarly as in Experiment 1-1, and examined on the properties and characters to reveal that it has substantially the same physicochemical properties as that of enzyme Q36, i.e. it has a molecular weight of about 57,000-68,000 daltons on SDS-PAGE and an isoelectric point of about 3.3-4.6 on isoelectrophoresis. These results indicate that the enzyme can be prepared by the recombinant DNA technology, and the yield can be significantly increased thereby.
The recombinant DNA pBRT32 obtained in Example 3-2 was similarly treated as in Example 2 to form a template DNA which was then annealed together with the primer 1, followed by allowing T7 DNA polymerase to act on the resultant to extend the primer 1 from the 5'-terminus to the 3'-terminus to obtain a complementary chain DNA. Similarly as in Example 2, the complementary chain DNA was subjected to the dideoxy chain terminator method to analyze DNA fragments which had been isolated on a radiogram. The result revealed that the complementary chain DNA contained a base sequence consisting of 2,056 base pairs as shown in SEQ ID NO:12. An amino acid sequence estimable from the base sequence was as shown in SEQ ID NO:14, and compared with the amino acid sequence containing the N-terminal or the partial amino acid sequence of SEQ ID NO:6, 9 or 10. As a result, it was found that the amino acid sequence of SEQ ID NO:6 corresponds to that located at positions from 2 to 21 in SEQ ID NO:12, and that the partial amino acid sequence in SEQ ID NO:9 or 10 corresponds to that located at positions from 470 to 489 or at positions from 12 to 31 in SEQ ID NO:14. These results indicate that enzyme Q36 has the amino acid sequence of SEQ ID NO:4, and it is encoded by the DNA having the base sequence as shown in SEQ ID NO:3.
In 500-ml Erlenmeyer flasks were placed 100 ml aliquots of a liquid nutrient culture medium (pH 7.0) consisting of 2.0 w/v % "PINE-DEX # 4", a starch hydrolysate commercialized by Matsutani Chemical Ind., Co., Ltd., Tokyo, Japan, 0.5 w/v % peptone, 0.1 w/v % yeast extract, 0.1 w/v % disodium hydrogen phosphate and 0.1 w/v % potassium dihydrogen phosphate, and to each flask was added 50 μg/ml ampicillin and autoclaved at 120° C. for 20 min. Thereafter, the flasks were cooled and inoculated with a seed culture of the transformant BMU27 obtained in Example 1-2, followed by culturing the transformant at 27° C. for 24 hours by a rotary shaker. Apart from this, 18 L of a fresh preparation of the same liquid culture medium was placed in a 30-L jar fermentor, admixed with 50 μg/ml ampicillin, sterilized at 120° C. for 20 min, cooled and inoculated with one v/v % of the seed culture obtained in the above, followed by the culture at 37° C. for 24 hours while keeping the pH at 6-8 under aeration-agitation conditions. The resultant culture was treated with an ultrasonic disintegrator to disrupt cells, and the resultant suspension was centrifuged to remove insoluble substances. The supernatant thus obtained was assayed for the enzyme activity to reveal that one L of the culture yielded about 3,900 units of the enzyme. The supernatant was purified by the method in Experiment 1-1 to obtain an about 67 ml aqueous solution containing an about 165 units/ml of a recombinant enzyme having a specific activity of about 290 units/mg protein.
Recombinant BRT32 obtained by the method in Experiment 3-2 was cultured similarly as in Example 5, and the resultant culture was treated with an ultrasonic integrator to disrupt cells. The resultant suspension was centrifuged to remove insoluble substances, and the resultant supernatant was assayed for the enzyme activity to have an activity of about 4,000 units per L. The supernatant was purified by the method in Experiment 1-1 to obtain an about 55 ml aqueous solution containing about 200 units/ml of a recombinant enzyme with a specific activity of about 420 units/mg protein.
To 500-ml Erlenmeyer flasks were placed 100 ml aliquots of a liquid nutrient culture medium (pH 7.0) consisting of 2.0 w/v % maltose, 0.5 w/v % peptone, 0.1 w/v % yeast extract, 0.1 w/v % disodium hydrogen phosphate and 0.1 w/v % potassium dihydrogen phosphate, and the flasks were autoclaved at 120° C. for 20 min. Thereafter, the flasks were cooled and inoculated with a seed culture of Rhizobium sp. M-11, followed by culturing it at 27° C. for 24 hours by a rotary shaker. Apart from this, 20 L of a fresh preparation of the same liquid culture medium was placed in a 30-L jar fermentor, and sterilized, inoculated with one v/v % of the seed culture obtained in the above, followed by the culture at 30° C. and at a pH of 7-8 for 24 hours under aeration-agitation conditions. Thereafter, the resultant culture was treated with an ultrasonic disintegrator to disrupt cells, and the resultant suspension was centrifuged to remove insoluble substances and purified according to the method in Experiment 1-1 to obtain a non-reducing saccharide-forming enzyme having a specific activity of about 195 units/mg protein in a yield of about 220 units per L of the culture.
Throughout the specification the activity of a non-reducing saccharide-forming enzyme is expressed by the value measured on the following assay: Place 4 ml of 50 mM phosphate buffer (pH 7.0) containing 1.25 w/v % maltopentaose in a test tube, add one ml of an enzyme solution to the test tube, and incubate the solution at 40° C. for 60 min to effect enzymatic reaction. Thereafter, the reaction mixture is heated at 100° C. for 10 min to suspend the enzymatic reaction, followed by diluting it with distilled water by 10 times and assaying the reducing activity by the Somogyi-Nelson's method. One unit activity of the non-reducing saccharide-forming enzyme is defined as the amount of enzyme which decreases the reducing power corresponding to one μmol maltopentaose per min under the above conditions.
A potato starch was suspended in water to give a 15 w/w % suspension which was then mixed with 0.1 w/w % calcium carbonate. The mixture was adjusted its pH to 6.0, mixed with 0.2 w/w %, d.s.b., of "TERMAMYL 60L", an α-amylase specimen commercialized by Novo Nordisk Bioindustri A/S, Copenhagen, Denmark, and enzymatically reacted at 95° C. for 15 min to effect gelatinization and liquefaction. The liquefied solution was autoclaved at 120° C. for 30 min to inactivate the remaining enzyme, rapidly cooled to 45° C., 1,000 units/g starch, d.s.b., of pullulanase commercialized by Hayashibara Biochemical Laboratories., Inc., Okayama, Japan, 3.4 units/g starch, d.s.b., of the non-reducing saccharide-forming enzyme obtained in Example 7-1(a), and 4.2 units/g starch, d.s.b., of the recombinant enzyme obtained by the method in Example 5, followed the enzymatic reaction for 48 hours. The reaction mixture was heated at 95° C. for 10 min to inactivate the remaining enzyme, cooled, filtered, and, in usual manner, decolored with an activated charcoal, desalted and purified with an ion-exchange resin, and concentrated to obtain a syrupy product with a concentration of about 60 w/w % in a yield of about 92%, d.s.b.
Analysis of the syrup by the method of Experiment 2-1 revealed that it contained 70.2 w/w % trehalose, 2.4 w/w % α-glucosyltrehalose, 3.3 w/w % α-maltosyltrehalose, 0.7 w/w % glucose, 10.1 w/w % maltose, 12.9 w/w % maltotriose, and 0.4 w/w % maltooligosaccharides having a degree of glucose polymerization of 4 or higher. The product, having a mild and moderate sweetness as well as an adequate viscosity and moisture-retaining ability, can be satisfactorily used in food products in general, cosmetics and pharmaceuticals as a sweetener, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
To 4 jacketed-stainless steel columns, having a diameter of 5.4 cm and a length of 5 m each was packed homogeneity with "XT-1016 (Na+ -form)", a strong-acid cation exchange resin commercialized by Tokyo Organic Chemical Industries, Ltd., Tokyo, Japan, and the columns were cascaded in series to give a total column length of 20 m. The syrupy product obtained in Example 7-1(b) was fed to the columns at a rate of about 5 v/v % against the resin at an inner column temperature of 55° C., and the columns were fed with 55° C. hot water at an SV (space velocity ) 0.3 to fractionate saccharides in the syrupy product. Based on the analysis of the saccharide composition of the eluate, fractions rich in trehalose were collected, pooled, concentrated, dried in vacuo and pulverized to obtain a solid product containing about 97 w/w % trehalose in a yield of about 56% against the starting material, d.s.b.
The product, having a mild sweetness and substantially free of reducibility, can be satisfactorily used in food products in general, cosmetics and pharmaceuticals as a sweetener, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
A portion of the trehalose rich fraction obtained in Example 7-1(c) was concentrated into an about 75 w/w % solution which was then transferred to a crystallizer, admixed with about 2 w/w %, d.s.b., hydrous crystalline trehalose as a seed crystal, and crystallized under gentle stirring conditions to obtain a massecuite with a crystallinity of about 45 w/w %. The massecuite was sprayed downward from a nozzle, equipped at the upper part of a spraying tower at a pressure of about 150 kg/cm2 while about 85° C. hot air was flowing downward from the upper part of the tower to accumulate a crystalline powder on a belt conveyer provided on the basement of the tower, followed by gradually transferring it out of the tower. Thereafter, the powder was transferred to an ageing tower and aged for 10 hours to complete the crystallization and drying while an about 40° C. hot air was blowing to the contents. Thus, a powdery product containing hydrous crystalline trehalose was obtained in a yield of about 90 w/w % against the starting material, d.s.b.
The product, having a substantial non-hygroscopicity and a mild and high-quality sweetness, can be satisfactorily used in food products in general, cosmetics, pharmaceuticals and feeds as a sweetener, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
Potato starch was suspended in water to give a concentration of 6 w/w %, d.s.b., and the suspension was admixed with 500 units/g starch of isoamylase commercialized by Hayashibara Biochemical Laboratories,. Inc., Okayama, Japan, and enzymatically reacted for 20 hours. The reaction mixture was adjusted to a pH of 6.5, autoclaved at 120° C. for 10 min to inactivate the remaining enzyme, rapidly cooled to 95° C., admixed with 0.1 w/w t per g starch, d.s.b., of "TERMAMYL 60L", an α-amylase specimen commercialized by Novo Nordisk Bioindustri A/S, Copenhagen, Denmark, and enzymatically reacted for 15 min. The reaction mixture was heated at 130° C. for 30 min to inactivate the remaining enzyme, rapidly cooled to 45° C., admixed with 4.1 units/g starch, d.s.b., of a non-reducing saccharide-forming enzyme obtained by the method in Example 7-1(a), and 4.9 units/g starch, d.s.b., of the present recombinant enzyme obtained by the method in Example 6, and enzymatically reacted for 64 hours. The reaction mixture was heated at 95° C. for 10 min to inactivate the remaining enzyme, rapidly cooled to 55° C., adjusted to pH 5.0, admixed with 10 units/g starch, d.s.b., of "GLUCOZYME", a glucoamylase specimen commercialized by Nagase Biochemicals, Ltd., Kyoto, Japan, and enzymatically reacted for 40 hours. The reaction mixture was heated at 95° C. for 10 min to inactivate the remaining enzyme, cooled, filtered, and, in usual manner, decolored with an activated charcoal, desalted and purified with an ion-exchange resin, and concentrated to obtain an about 60 w/w % syrupy product containing about 80.5 w/w % trehalose, d.s.b. The syrupy product was concentrated into an about 84 w/w % syrup which was then transferred to a crystallizer, admixed with an about 2 w/w % hydrous crystalline trehalose, d.s.b., and crystallized under gentle stirring conditions to obtain a massecuite having a crystallinity of about 45 w/w %. The massecuite was distributed to plastic plain vessels which were then allowed to stand at ambient temperature for 3 days to effect solidification and aging, followed by detaching the resultant blocks from the vessels and pulverizing the blocks with a cutter to obtain a solid product containing hydrous crystalline trehalose in a yield of about 90 w/w % against the material starch, d.s.b.
The product, which is substantially free of hygroscopicity and readily handleable, can be arbitrarily used in food products in general, cosmetics, pharmaceuticals as a sweetening agent, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
Potato starch was suspended in water to give a concentration of 6 w/w %, d.s.b., and the suspension was admixed with 0.01 w/w % "NEO-SPITASE", a-amylase commercialized by Nagase Biochemicals, Ltd., Kyoto, Japan, adjusted to pH 6.2, and enzymatically reacted at 85°-90° C. for 20 min to gelatinize and liquefy the starch. The liquefied starch was heated at 120° C. for 10 min to inactivate the remaining enzyme, rapidly cooled to 45° C., admixed with 500 units/g starch, d.s.b., of isoamylase commercialized by Hayashibara Biochemical Laboratories, Inc., Okayama, Japan, 3.2 units/g starch, d.s.b., of a non-reducing saccharide-forming enzyme obtained by the method in Example 7-1(a), and 5.0 units/g starch, d.s.b., of the present recombinant enzyme obtained by the method in Example 5, and enzymatically reacted for 48 hours. The reaction mixture was heated at 95° C. for 10 min to inactivate the remaining enzyme, rapidly cooled to 55° C., adjusted to pH 5.0, admixed with 10 units/g starch, d.s.b., of "GL-UCOZYME", glucoamylase commercialized by Nagase Biochemicals Ltd., Kyoto, Japan, and enzymatically reacted for 40 hours. The reaction mixture was heated at 95° C. for 10 min to inactivate the remaining enzyme, rapidly cooled, filtered, and, in usual manner, decolored with an activated charcoal, desalted and purified with an ion-exchange resin, and concentrated to give a concentration of about 60 w/w %, d.s.b., to obtain a syrupy product containing 78.3 w/w % trehalose, d.s.b. The syrupy product was fractionated similarly as in Example 7-1(c) except for using "CG6000(Na+)", a strong-acid cation exchange resin commercialized by Japan Organo, Co., Ltd., Tokyo, Japan, to obtain a fraction containing abut 95 w/w % trehalose, d.s.b. The fraction was concentrated to give a concentration of about 75 w/w %, d.s.b., and, similarly as in Example 8, crystallized, and the resultant massecuite in the form of block was pulverized to obtain a powdery product containing hydrous crystalline trehalose in a yield of about 70 w/w % against the material starch, d.s.b.
The product, which is substantially free of hygroscopicity and readily handleable, can be arbitrarily used in food products in general, cosmetics, pharmaceuticals as a sweetening agent, taste-improving agent, quality-improving agent, stabilizer, filler, excipient and adjuvant.
As is described above, the present invention is based on the finding that a novel enzyme which releases trehalose from non-reducing saccharides having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher. The present invention is to explore a way to produce the enzyme in a relatively-large scale and in a considerably-high yield. The enzyme produced by the transformant according to the present invention is the one characterized by its revealed total amino acid sequence, and because of this it can be used for the preparations of trehalose which is premised on being used in food products without fear of causing side effects.
Therefore, the present invention is an useful invention which exerts the aforesaid significant action and effect as well as giving a great contribution to this field.
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 18 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1767 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1767 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GCCAAGCCGGTGCAGGGAGCGGGGCGCTTCGATATCTGGGCGCCCGAG48 AlaLysProValGlnGlyAlaGlyArgPheAspIleTrpAlaProGlu 151015 GCAGGCACCGTAACGCTGCTGGCCGGCGGGGAGCGCTACGAGATGGGC96 AlaGlyThrValThrLeuLeuAlaGlyGlyGluArgTyrGluMetGly 202530 CGCCGCCCCGGCAACGGGCCGGCGGACGAAGGCTGGTGGACGGCCGCG144 ArgArgProGlyAsnGlyProAlaAspGluGlyTrpTrpThrAlaAla 354045 GATGCACCGACAGGCGCGGACGTGGACTACGGATACCTGCTCGACGGC192 AspAlaProThrGlyAlaAspValAspTyrGlyTyrLeuLeuAspGly 505560 GACGAAATCCCGCTGCCGGACCCCCGGACCCGCCGCCAGCCCGAAGGC240 AspGluIleProLeuProAspProArgThrArgArgGlnProGluGly 65707580 GTCCATGCCCTGTCCCGGACCTTCGACCCCGGCGCCCACCGCTGGCAG288 ValHisAlaLeuSerArgThrPheAspProGlyAlaHisArgTrpGln 859095 GACGCCGGGTGGCAGGGCAGGGAACTCCAGGGCTCCGTGATTTACGAA336 AspAlaGlyTrpGlnGlyArgGluLeuGlnGlySerValIleTyrGlu 100105110 CTCCACATCGGAACGTTCACGCCGGAAGGGACGCTGGACGCCGCCGCG384 LeuHisIleGlyThrPheThrProGluGlyThrLeuAspAlaAlaAla 115120125 GGCAAGCTGGACTACCTCGCCGGCCTGGGCATCGACTTCATTGAGCTG432 GlyLysLeuAspTyrLeuAlaGlyLeuGlyIleAspPheIleGluLeu 130135140 CTGCCCGTGAATGCCTTCAACGGCACGCACAACTGGGGCTACGACGGC480 LeuProValAsnAlaPheAsnGlyThrHisAsnTrpGlyTyrAspGly 145150155160 GTCCAGTGGTTTGCCGTGCATGAAGGCTACGGCGGGCCTGCGGCGTAC528 ValGlnTrpPheAlaValHisGluGlyTyrGlyGlyProAlaAlaTyr 165170175 CAGCGGTTCGTGGATGCGGCCCACGCGGCCGGCCTCGGCGTCATCCAG576 GlnArgPheValAspAlaAlaHisAlaAlaGlyLeuGlyValIleGln 180185190 GACGTGGTCTACAACCACCTCGGGCCGAGCGGGAACTACCTCCCCAGG624 AspValValTyrAsnHisLeuGlyProSerGlyAsnTyrLeuProArg 195200205 TACGGCCCGTACCTCAAGCACGGCGAAGGCAACACCTGGGGCGATTCG672 TyrGlyProTyrLeuLysHisGlyGluGlyAsnThrTrpGlyAspSer 210215220 GTCAACCTGGACGGGCCGGGATCCGACCACGTCCGCCAGTACATCCTG720 ValAsnLeuAspGlyProGlySerAspHisValArgGlnTyrIleLeu 225230235240 GACAACGTGGCCATGTGGCTGCGCGACTACCGGGTGGACGGCCTCCGC768 AspAsnValAlaMetTrpLeuArgAspTyrArgValAspGlyLeuArg 245250255 CTGGACGCCGTCCACGCCCTGAAGGATGAGCGGGCCGTCCACATCCTG816 LeuAspAlaValHisAlaLeuLysAspGluArgAlaValHisIleLeu 260265270 GAGGAGTTCGGCGCGCTGGCGGACGCCCTGTCGTCCGAAGGCGGCCGC864 GluGluPheGlyAlaLeuAlaAspAlaLeuSerSerGluGlyGlyArg 275280285 CCGCTGACCCTCATCGCCGAGTCCGACCTCAACAATCCGCGGCTGCTG912 ProLeuThrLeuIleAlaGluSerAspLeuAsnAsnProArgLeuLeu 290295300 TACCCCCGGGATGTCAACGGCTACGGACTGGCCGGCCAGTGGAGCGAC960 TyrProArgAspValAsnGlyTyrGlyLeuAlaGlyGlnTrpSerAsp 305310315320 GACTTCCACCACGCCGTGCACGTCAACGTCAGCGGGGAAACCACCGGC1008 AspPheHisHisAlaValHisValAsnValSerGlyGluThrThrGly 325330335 TACTACAGCGACTTCGACTCGCTCGGAGCCCTCGCCAAGGTCCTGCGT1056 TyrTyrSerAspPheAspSerLeuGlyAlaLeuAlaLysValLeuArg 340345350 GACGGGTTCTTCCACGACGGCAGCTACTCCAGCTTCCGCGGCCGCTGC1104 AspGlyPhePheHisAspGlySerTyrSerSerPheArgGlyArgCys 355360365 CACGGCCGGCCGATCAACTTCAGCGCCGTGCATCCGGCCGCGCTGGTG1152 HisGlyArgProIleAsnPheSerAlaValHisProAlaAlaLeuVal 370375380 GTCTGCTCACAGAACCATGACCAGATCGGCAACCGGGCCACCGGGGAC1200 ValCysSerGlnAsnHisAspGlnIleGlyAsnArgAlaThrGlyAsp 385390395400 CGGCTGTCCCAGTCACTTCCGTACGGCAGCCTGGCCCTGGCCGCCGTG1248 ArgLeuSerGlnSerLeuProTyrGlySerLeuAlaLeuAlaAlaVal 405410415 CTGACCCTCACCGGTCCGTTCACGCCCATGCTGTTCATGGGAGAGGAA1296 LeuThrLeuThrGlyProPheThrProMetLeuPheMetGlyGluGlu 420425430 TACGGGGCCACCACCCCGTGGCAGTTCTTCACCTCGCACCCTGAACCC1344 TyrGlyAlaThrThrProTrpGlnPhePheThrSerHisProGluPro 435440445 GAGCTGGGCAAGGCCACGGCCGAGGGCAGGATCAGGGAGTTCGAGCGC1392 GluLeuGlyLysAlaThrAlaGluGlyArgIleArgGluPheGluArg 450455460 ATGGGGTGGGATCCCGCCGTCGTGCCCGATCCGCAGGATCCGGAGACC1440 MetGlyTrpAspProAlaValValProAspProGlnAspProGluThr 465470475480 TTCACCCGCTCCAAACTGGACTGGGCGGAAGCGTCCGCCGGCGATCAT1488 PheThrArgSerLysLeuAspTrpAlaGluAlaSerAlaGlyAspHis 485490495 GCCCGCCTCCTGGAGCTGTACCGCTCGCTTATCACGCTGCGGCGGTCA1536 AlaArgLeuLeuGluLeuTyrArgSerLeuIleThrLeuArgArgSer 500505510 ACTCCGGAGCTCGCGCGCCTGGGCTTTGCGGACACCGCCGTCGAGTTC1584 ThrProGluLeuAlaArgLeuGlyPheAlaAspThrAlaValGluPhe 515520525 GACGACGACGCCCGCTGGCTCCGTTATTGGCGCGGAGGCGTGCAGGTG1632 AspAspAspAlaArgTrpLeuArgTyrTrpArgGlyGlyValGlnVal 530535540 GTGCTGAACTTCGCGGACCGTCCCATCAGCCTGGACCGGCCGGGAACC1680 ValLeuAsnPheAlaAspArgProIleSerLeuAspArgProGlyThr 545550555560 GCGCTGCTGCTCGCCACCGACGACGCCGTCCGGATGGACGGAGTCCAG1728 AlaLeuLeuLeuAlaThrAspAspAlaValArgMetAspGlyValGln 565570575 GTGGAGCTGCCGCCGCTGAGCGCCGCGGTTCTGCGCGAC1767 ValGluLeuProProLeuSerAlaAlaValLeuArgAsp 580585 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 589 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: AlaLysProValGlnGlyAlaGlyArgPheAspIleTrpAlaProGlu 151015 AlaGlyThrValThrLeuLeuAlaGlyGlyGluArgTyrGluMetGly 202530 ArgArgProGlyAsnGlyProAlaAspGluGlyTrpTrpThrAlaAla 354045 AspAlaProThrGlyAlaAspValAspTyrGlyTyrLeuLeuAspGly 505560 AspGluIleProLeuProAspProArgThrArgArgGlnProGluGly 65707580 ValHisAlaLeuSerArgThrPheAspProGlyAlaHisArgTrpGln 859095 AspAlaGlyTrpGlnGlyArgGluLeuGlnGlySerValIleTyrGlu 100105110 LeuHisIleGlyThrPheThrProGluGlyThrLeuAspAlaAlaAla 115120125 GlyLysLeuAspTyrLeuAlaGlyLeuGlyIleAspPheIleGluLeu 130135140 LeuProValAsnAlaPheAsnGlyThrHisAsnTrpGlyTyrAspGly 145150155160 ValGlnTrpPheAlaValHisGluGlyTyrGlyGlyProAlaAlaTyr 165170175 GlnArgPheValAspAlaAlaHisAlaAlaGlyLeuGlyValIleGln 180185190 AspValValTyrAsnHisLeuGlyProSerGlyAsnTyrLeuProArg 195200205 TyrGlyProTyrLeuLysHisGlyGluGlyAsnThrTrpGlyAspSer 210215220 ValAsnLeuAspGlyProGlySerAspHisValArgGlnTyrIleLeu 225230235240 AspAsnValAlaMetTrpLeuArgAspTyrArgValAspGlyLeuArg 245250255 LeuAspAlaValHisAlaLeuLysAspGluArgAlaValHisIleLeu 260265270 GluGluPheGlyAlaLeuAlaAspAlaLeuSerSerGluGlyGlyArg 275280285 ProLeuThrLeuIleAlaGluSerAspLeuAsnAsnProArgLeuLeu 290295300 TyrProArgAspValAsnGlyTyrGlyLeuAlaGlyGlnTrpSerAsp 305310315320 AspPheHisHisAlaValHisValAsnValSerGlyGluThrThrGly 325330335 TyrTyrSerAspPheAspSerLeuGlyAlaLeuAlaLysValLeuArg 340345350 AspGlyPhePheHisAspGlySerTyrSerSerPheArgGlyArgCys 355360365 HisGlyArgProIleAsnPheSerAlaValHisProAlaAlaLeuVal 370375380 ValCysSerGlnAsnHisAspGlnIleGlyAsnArgAlaThrGlyAsp 385390395400 ArgLeuSerGlnSerLeuProTyrGlySerLeuAlaLeuAlaAlaVal 405410415 LeuThrLeuThrGlyProPheThrProMetLeuPheMetGlyGluGlu 420425430 TyrGlyAlaThrThrProTrpGlnPhePheThrSerHisProGluPro 435440445 GluLeuGlyLysAlaThrAlaGluGlyArgIleArgGluPheGluArg 450455460 MetGlyTrpAspProAlaValValProAspProGlnAspProGluThr 465470475480 PheThrArgSerLysLeuAspTrpAlaGluAlaSerAlaGlyAspHis 485490495 AlaArgLeuLeuGluLeuTyrArgSerLeuIleThrLeuArgArgSer 500505510 ThrProGluLeuAlaArgLeuGlyPheAlaAspThrAlaValGluPhe 515520525 AspAspAspAlaArgTrpLeuArgTyrTrpArgGlyGlyValGlnVal 530535540 ValLeuAsnPheAlaAspArgProIleSerLeuAspArgProGlyThr 545550555560 AlaLeuLeuLeuAlaThrAspAspAlaValArgMetAspGlyValGln 565570575 ValGluLeuProProLeuSerAlaAlaValLeuArgAsp 580585 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1791 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1791 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: ACGCACACCTACCCGCGGGAAGCCGCGAAACCCGTCCTGGGCCCCGCA48 ThrHisThrTyrProArgGluAlaAlaLysProValLeuGlyProAla 590595600605 CGCTACGACGTCTGGGCGCCCAACGCTGAATCCGTGACGCTGCTGGCC96 ArgTyrAspValTrpAlaProAsnAlaGluSerValThrLeuLeuAla 610615620 GGCGGGGAGCGCTACGCCATGCAGCGCCGGGCCGAGACCGGGCCGGAG144 GlyGlyGluArgTyrAlaMetGlnArgArgAlaGluThrGlyProGlu 625630635 GACGCCGGCTGGTGGACCGCCGCCGGCGCGCCTACGGATGGCAACGTG192 AspAlaGlyTrpTrpThrAlaAlaGlyAlaProThrAspGlyAsnVal 640645650 GACTACGGGTACCTTCTGGACGGCGACGAAACACCGCTTCCGGATCCA240 AspTyrGlyTyrLeuLeuAspGlyAspGluThrProLeuProAspPro 655660665 CGGACCCGCCGCCAGCCCGACGGCGTCCACGCCCTGTCCCGCACGTTC288 ArgThrArgArgGlnProAspGlyValHisAlaLeuSerArgThrPhe 670675680685 GACCCGTCCGCGTACAGCTGGCAGGACGACGCCTGGCAGGGCAGGGAA336 AspProSerAlaTyrSerTrpGlnAspAspAlaTrpGlnGlyArgGlu 690695700 CTGCAGGGCGCCGTCATCTACGAGCTCCACCTCGGAACATTCACGCCC384 LeuGlnGlyAlaValIleTyrGluLeuHisLeuGlyThrPheThrPro 705710715 GAAGGGACGCTGGAGGCGGCCGCCGGAAAGCTGGACTACCTCGCCGGC432 GluGlyThrLeuGluAlaAlaAlaGlyLysLeuAspTyrLeuAlaGly 720725730 TTGGGCGTCGACTTCATCGAGCTGCTGCCGGTGAACGCTTTCAACGGC480 LeuGlyValAspPheIleGluLeuLeuProValAsnAlaPheAsnGly 735740745 ACGCACAACTGGGGTTACGACGGTGTCCAGTGGTTCGCTGTGCACGAG528 ThrHisAsnTrpGlyTyrAspGlyValGlnTrpPheAlaValHisGlu 750755760765 GCATACGGCGGGCCGGAAGCGTACCAGCGGTTCGTCGACGCCGCCCAC576 AlaTyrGlyGlyProGluAlaTyrGlnArgPheValAspAlaAlaHis 770775780 GCCGCAGGCCTTGGCGTGATCCAGGACGTGGTCTACAACCACCTCGGC624 AlaAlaGlyLeuGlyValIleGlnAspValValTyrAsnHisLeuGly 785790795 CCCAGCGGGAACTACCTGCCGCGGTTCGGGCCGTACCTCAAGCAGGGC672 ProSerGlyAsnTyrLeuProArgPheGlyProTyrLeuLysGlnGly 800805810 GAGGGTAACACGTGGGGCGACTCGGTGAACCTGGACGGGCCCGGCTCC720 GluGlyAsnThrTrpGlyAspSerValAsnLeuAspGlyProGlySer 815820825 GACCATGTGCGCCGGTACATCCTGGACAACCTGGCCATGTGGCTGCGT768 AspHisValArgArgTyrIleLeuAspAsnLeuAlaMetTrpLeuArg 830835840845 GACTACCGGGTGGACGGCCTGCGGCTGGACGCCGTCCACGCCCTGAAG816 AspTyrArgValAspGlyLeuArgLeuAspAlaValHisAlaLeuLys 850855860 GATGAGCGGGCGGTGCACATCCTGGAGGACTTCGGGGCGCTGGCCGAT864 AspGluArgAlaValHisIleLeuGluAspPheGlyAlaLeuAlaAsp 865870875 CAGATCTCCGCCGAGGTGGGACGGCCGCTGACGCTCATCGCCGAGTCC912 GlnIleSerAlaGluValGlyArgProLeuThrLeuIleAlaGluSer 880885890 GACCTCAACAACCCGCGGCTGCTGTACCCGCGGGACGTCAACGGGTAC960 AspLeuAsnAsnProArgLeuLeuTyrProArgAspValAsnGlyTyr 895900905 GGGCTGGAAGGGCAGTGGAGCGACGACTTCCACCACGCCGTCCACGTC1008 GlyLeuGluGlyGlnTrpSerAspAspPheHisHisAlaValHisVal 910915920925 AACGTCACCGGCGAAACCACCGGCTACTACAGTGACTTCGACTCGCTG1056 AsnValThrGlyGluThrThrGlyTyrTyrSerAspPheAspSerLeu 930935940 GCCGCCCTCGCCAAGGTGCTCCGGGACGGCTTCTTCCACGACGGCAGC1104 AlaAlaLeuAlaLysValLeuArgAspGlyPhePheHisAspGlySer 945950955 TACTCCAGCTTCCGGGAACGCCACCACGGACGGCCGATTAATTTCAGC1152 TyrSerSerPheArgGluArgHisHisGlyArgProIleAsnPheSer 960965970 GCCGTACACCCAGCCGCCCTGGTGGTCTGTTCGCAGAACCACGACCAG1200 AlaValHisProAlaAlaLeuValValCysSerGlnAsnHisAspGln 975980985 ATCGGCAACCGTGCCACGGGGGACCGGCTCTCCCAGACCCTGCCGTAC1248 IleGlyAsnArgAlaThrGlyAspArgLeuSerGlnThrLeuProTyr 99099510001005 GGAAGCCTGGCCCTCGCTGCGGTGCTGACCCTGACGGGACCCTTCACG1296 GlySerLeuAlaLeuAlaAlaValLeuThrLeuThrGlyProPheThr 101010151020 CCCATGCTGCTCATGGGCGAGGAGTACGGCGCCAGCACGCCGTGGCAG1344 ProMetLeuLeuMetGlyGluGluTyrGlyAlaSerThrProTrpGln 102510301035 TTTTTCACCTCGCACCCGGAGCCGGAGCTCGGCAAGGCCACCGCGGAG1392 PhePheThrSerHisProGluProGluLeuGlyLysAlaThrAlaGlu 104010451050 GGCCGGATCAAGGAGTTCGAGCGCATGGGGTGGGATCCCGCCGTCGTG1440 GlyArgIleLysGluPheGluArgMetGlyTrpAspProAlaValVal 105510601065 CCCGATCCCCAGGATCCTGAGACGTTCCGCCGGTCCAAGCTGGACTGG1488 ProAspProGlnAspProGluThrPheArgArgSerLysLeuAspTrp 1070107510801085 GCGGAAGCCGCCGAAGGCGACCATGCCCGGCTGCTGGAGCTGTACCGT1536 AlaGluAlaAlaGluGlyAspHisAlaArgLeuLeuGluLeuTyrArg 109010951100 TCGCTCACCGCCCTGCGCCGCTCCACGCCGGACCTCACCAAGCTGGGC1584 SerLeuThrAlaLeuArgArgSerThrProAspLeuThrLysLeuGly 110511101115 TTCGAGGACACGCAGGTGGCGTTCGACGAGGACGCCCGCTGGCTGCGG1632 PheGluAspThrGlnValAlaPheAspGluAspAlaArgTrpLeuArg 112011251130 TTCCGCCGGGGTGGCGTGCAGGTGCTGCTCAACTTCTCGGAACAGCCC1680 PheArgArgGlyGlyValGlnValLeuLeuAsnPheSerGluGlnPro 113511401145 GTGAGCCTGGACGGGGCGGGCACGGCCCTGCTGCTGGCCACCGACGAC1728 ValSerLeuAspGlyAlaGlyThrAlaLeuLeuLeuAlaThrAspAsp 1150115511601165 GCCGTCCGGCTAGAAGGTGAGCGTGCGGAACTCGGTCCGCTGAGCGCC1776 AlaValArgLeuGluGlyGluArgAlaGluLeuGlyProLeuSerAla 117011751180 GCCGTCGTCAGCGAC1791 AlaValValSerAsp 1185 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 597 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: ThrHisThrTyrProArgGluAlaAlaLysProValLeuGlyProAla 151015 ArgTyrAspValTrpAlaProAsnAlaGluSerValThrLeuLeuAla 202530 GlyGlyGluArgTyrAlaMetGlnArgArgAlaGluThrGlyProGlu 354045 AspAlaGlyTrpTrpThrAlaAlaGlyAlaProThrAspGlyAsnVal 505560 AspTyrGlyTyrLeuLeuAspGlyAspGluThrProLeuProAspPro 65707580 ArgThrArgArgGlnProAspGlyValHisAlaLeuSerArgThrPhe 859095 AspProSerAlaTyrSerTrpGlnAspAspAlaTrpGlnGlyArgGlu 100105110 LeuGlnGlyAlaValIleTyrGluLeuHisLeuGlyThrPheThrPro 115120125 GluGlyThrLeuGluAlaAlaAlaGlyLysLeuAspTyrLeuAlaGly 130135140 LeuGlyValAspPheIleGluLeuLeuProValAsnAlaPheAsnGly 145150155160 ThrHisAsnTrpGlyTyrAspGlyValGlnTrpPheAlaValHisGlu 165170175 AlaTyrGlyGlyProGluAlaTyrGlnArgPheValAspAlaAlaHis 180185190 AlaAlaGlyLeuGlyValIleGlnAspValValTyrAsnHisLeuGly 195200205 ProSerGlyAsnTyrLeuProArgPheGlyProTyrLeuLysGlnGly 210215220 GluGlyAsnThrTrpGlyAspSerValAsnLeuAspGlyProGlySer 225230235240 AspHisValArgArgTyrIleLeuAspAsnLeuAlaMetTrpLeuArg 245250255 AspTyrArgValAspGlyLeuArgLeuAspAlaValHisAlaLeuLys 260265270 AspGluArgAlaValHisIleLeuGluAspPheGlyAlaLeuAlaAsp 275280285 GlnIleSerAlaGluValGlyArgProLeuThrLeuIleAlaGluSer 290295300 AspLeuAsnAsnProArgLeuLeuTyrProArgAspValAsnGlyTyr 305310315320 GlyLeuGluGlyGlnTrpSerAspAspPheHisHisAlaValHisVal 325330335 AsnValThrGlyGluThrThrGlyTyrTyrSerAspPheAspSerLeu 340345350 AlaAlaLeuAlaLysValLeuArgAspGlyPhePheHisAspGlySer 355360365 TyrSerSerPheArgGluArgHisHisGlyArgProIleAsnPheSer 370375380 AlaValHisProAlaAlaLeuValValCysSerGlnAsnHisAspGln 385390395400 IleGlyAsnArgAlaThrGlyAspArgLeuSerGlnThrLeuProTyr 405410415 GlySerLeuAlaLeuAlaAlaValLeuThrLeuThrGlyProPheThr 420425430 ProMetLeuLeuMetGlyGluGluTyrGlyAlaSerThrProTrpGln 435440445 PhePheThrSerHisProGluProGluLeuGlyLysAlaThrAlaGlu 450455460 GlyArgIleLysGluPheGluArgMetGlyTrpAspProAlaValVal 465470475480 ProAspProGlnAspProGluThrPheArgArgSerLysLeuAspTrp 485490495 AlaGluAlaAlaGluGlyAspHisAlaArgLeuLeuGluLeuTyrArg 500505510 SerLeuThrAlaLeuArgArgSerThrProAspLeuThrLysLeuGly 515520525 PheGluAspThrGlnValAlaPheAspGluAspAlaArgTrpLeuArg 530535540 PheArgArgGlyGlyValGlnValLeuLeuAsnPheSerGluGlnPro 545550555560 ValSerLeuAspGlyAlaGlyThrAlaLeuLeuLeuAlaThrAspAsp 565570575 AlaValArgLeuGluGlyGluArgAlaGluLeuGlyProLeuSerAla 580585590 AlaValValSerAsp 595 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: AlaLysProValGlnGlyAlaGlyArgPheAspIleTrpAlaProGlu 151015 AlaGlyThrVal 20 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: ThrHisThrTyrProArgGluAlaAlaLysProValLeuGlyProAla 151015 ArgTyrAspVal 20 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: ProValGlnGlyAlaGlyArgPheAspIleTrpAlaProGluAlaGly 151015 ThrValThrLeuLeu 20 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: LeuAspTrpAlaGluAlaSerAlaGlyAspHisAlaArgLeuLeuGlu 151015 Leu (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: GluPheGluArgMetGlyTrpAspProAlaValValProAspProGln 151015 AspProGluThr 20 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: ProValLeuGlyProAlaArgTyrAspValTrpAlaProAsnAlaGlu 151015 SerValThrLeu 20 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2161 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 207..1994 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: GGCGCCGGGGGAGTGCTGGCGCTTGCCACCCGGCTCCCCTACGGGCTGGAACAGTCGGGC60 GGCTGGCGGGACACCGCCGTCGAGCTTGAAGCCGCCATGACGGACGAACTGACCGGCTCC120 ACTTTCGGGCCGGGACCGGCGGCGCTGTCAGAAGTCTTCCGGGCCTACCCGGTGGCCTTG180 TTGGTCCCCGCGACAGGAGGCAAGTCATGACGCAGCCCAACGATGCGGCCAAG233 MetThrGlnProAsnAspAlaAlaLys 600605 CCGGTGCAGGGAGCGGGGCGCTTCGATATCTGGGCGCCCGAGGCAGGC281 ProValGlnGlyAlaGlyArgPheAspIleTrpAlaProGluAlaGly 610615620 ACCGTAACGCTGCTGGCCGGCGGGGAGCGCTACGAGATGGGCCGCCGC329 ThrValThrLeuLeuAlaGlyGlyGluArgTyrGluMetGlyArgArg 625630635 CCCGGCAACGGGCCGGCGGACGAAGGCTGGTGGACGGCCGCGGATGCA377 ProGlyAsnGlyProAlaAspGluGlyTrpTrpThrAlaAlaAspAla 640645650 CCGACAGGCGCGGACGTGGACTACGGATACCTGCTCGACGGCGACGAA425 ProThrGlyAlaAspValAspTyrGlyTyrLeuLeuAspGlyAspGlu 655660665670 ATCCCGCTGCCGGACCCCCGGACCCGCCGCCAGCCCGAAGGCGTCCAT473 IleProLeuProAspProArgThrArgArgGlnProGluGlyValHis 675680685 GCCCTGTCCCGGACCTTCGACCCCGGCGCCCACCGCTGGCAGGACGCC521 AlaLeuSerArgThrPheAspProGlyAlaHisArgTrpGlnAspAla 690695700 GGGTGGCAGGGCAGGGAACTCCAGGGCTCCGTGATTTACGAACTCCAC569 GlyTrpGlnGlyArgGluLeuGlnGlySerValIleTyrGluLeuHis 705710715 ATCGGAACGTTCACGCCGGAAGGGACGCTGGACGCCGCCGCGGGCAAG617 IleGlyThrPheThrProGluGlyThrLeuAspAlaAlaAlaGlyLys 720725730 CTGGACTACCTCGCCGGCCTGGGCATCGACTTCATTGAGCTGCTGCCC665 LeuAspTyrLeuAlaGlyLeuGlyIleAspPheIleGluLeuLeuPro 735740745750 GTGAATGCCTTCAACGGCACGCACAACTGGGGCTACGACGGCGTCCAG713 ValAsnAlaPheAsnGlyThrHisAsnTrpGlyTyrAspGlyValGln 755760765 TGGTTTGCCGTGCATGAAGGCTACGGCGGGCCTGCGGCGTACCAGCGG761 TrpPheAlaValHisGluGlyTyrGlyGlyProAlaAlaTyrGlnArg 770775780 TTCGTGGATGCGGCCCACGCGGCCGGCCTCGGCGTCATCCAGGACGTG809 PheValAspAlaAlaHisAlaAlaGlyLeuGlyValIleGlnAspVal 785790795 GTCTACAACCACCTCGGGCCGAGCGGGAACTACCTCCCCAGGTACGGC857 ValTyrAsnHisLeuGlyProSerGlyAsnTyrLeuProArgTyrGly 800805810 CCGTACCTCAAGCACGGCGAAGGCAACACCTGGGGCGATTCGGTCAAC905 ProTyrLeuLysHisGlyGluGlyAsnThrTrpGlyAspSerValAsn 815820825830 CTGGACGGGCCGGGATCCGACCACGTCCGCCAGTACATCCTGGACAAC953 LeuAspGlyProGlySerAspHisValArgGlnTyrIleLeuAspAsn 835840845 GTGGCCATGTGGCTGCGCGACTACCGGGTGGACGGCCTCCGCCTGGAC1001 ValAlaMetTrpLeuArgAspTyrArgValAspGlyLeuArgLeuAsp 850855860 GCCGTCCACGCCCTGAAGGATGAGCGGGCCGTCCACATCCTGGAGGAG1049 AlaValHisAlaLeuLysAspGluArgAlaValHisIleLeuGluGlu 865870875 TTCGGCGCGCTGGCGGACGCCCTGTCGTCCGAAGGCGGCCGCCCGCTG1097 PheGlyAlaLeuAlaAspAlaLeuSerSerGluGlyGlyArgProLeu 880885890 ACCCTCATCGCCGAGTCCGACCTCAACAATCCGCGGCTGCTGTACCCC1145 ThrLeuIleAlaGluSerAspLeuAsnAsnProArgLeuLeuTyrPro 895900905910 CGGGATGTCAACGGCTACGGACTGGCCGGCCAGTGGAGCGACGACTTC1193 ArgAspValAsnGlyTyrGlyLeuAlaGlyGlnTrpSerAspAspPhe 915920925 CACCACGCCGTGCACGTCAACGTCAGCGGGGAAACCACCGGCTACTAC1241 HisHisAlaValHisValAsnValSerGlyGluThrThrGlyTyrTyr 930935940 AGCGACTTCGACTCGCTCGGAGCCCTCGCCAAGGTCCTGCGTGACGGG1289 SerAspPheAspSerLeuGlyAlaLeuAlaLysValLeuArgAspGly 945950955 TTCTTCCACGACGGCAGCTACTCCAGCTTCCGCGGCCGCTGCCACGGC1337 PhePheHisAspGlySerTyrSerSerPheArgGlyArgCysHisGly 960965970 CGGCCGATCAACTTCAGCGCCGTGCATCCGGCCGCGCTGGTGGTCTGC1385 ArgProIleAsnPheSerAlaValHisProAlaAlaLeuValValCys 975980985990 TCACAGAACCATGACCAGATCGGCAACCGGGCCACCGGGGACCGGCTG1433 SerGlnAsnHisAspGlnIleGlyAsnArgAlaThrGlyAspArgLeu 99510001005 TCCCAGTCACTTCCGTACGGCAGCCTGGCCCTGGCCGCCGTGCTGACC1481 SerGlnSerLeuProTyrGlySerLeuAlaLeuAlaAlaValLeuThr 101010151020 CTCACCGGTCCGTTCACGCCCATGCTGTTCATGGGAGAGGAATACGGG1529 LeuThrGlyProPheThrProMetLeuPheMetGlyGluGluTyrGly 102510301035 GCCACCACCCCGTGGCAGTTCTTCACCTCGCACCCTGAACCCGAGCTG1577 AlaThrThrProTrpGlnPhePheThrSerHisProGluProGluLeu 104010451050 GGCAAGGCCACGGCCGAGGGCAGGATCAGGGAGTTCGAGCGCATGGGG1625 GlyLysAlaThrAlaGluGlyArgIleArgGluPheGluArgMetGly 1055106010651070 TGGGATCCCGCCGTCGTGCCCGATCCGCAGGATCCGGAGACCTTCACC1673 TrpAspProAlaValValProAspProGlnAspProGluThrPheThr 107510801085 CGCTCCAAACTGGACTGGGCGGAAGCGTCCGCCGGCGATCATGCCCGC1721 ArgSerLysLeuAspTrpAlaGluAlaSerAlaGlyAspHisAlaArg 109010951100 CTCCTGGAGCTGTACCGCTCGCTTATCACGCTGCGGCGGTCAACTCCG1769 LeuLeuGluLeuTyrArgSerLeuIleThrLeuArgArgSerThrPro 110511101115 GAGCTCGCGCGCCTGGGCTTTGCGGACACCGCCGTCGAGTTCGACGAC1817 GluLeuAlaArgLeuGlyPheAlaAspThrAlaValGluPheAspAsp 112011251130 GACGCCCGCTGGCTCCGTTATTGGCGCGGAGGCGTGCAGGTGGTGCTG1865 AspAlaArgTrpLeuArgTyrTrpArgGlyGlyValGlnValValLeu 1135114011451150 AACTTCGCGGACCGTCCCATCAGCCTGGACCGGCCGGGAACCGCGCTG1913 AsnPheAlaAspArgProIleSerLeuAspArgProGlyThrAlaLeu 115511601165 CTGCTCGCCACCGACGACGCCGTCCGGATGGACGGAGTCCAGGTGGAG1961 LeuLeuAlaThrAspAspAlaValArgMetAspGlyValGlnValGlu 117011751180 CTGCCGCCGCTGAGCGCCGCGGTTCTGCGCGACTGAGCGTGCGCGCCTTCGGG2014 LeuProProLeuSerAlaAlaValLeuArgAsp 11851190 GCGGGCGTCCTTCCGGTGACCGGATGCTGGACGCCCGCCCCGCAGCTCCACAGGCGCTGG2074 CAGGATGGAACGTATGACTTTTCTGGCAGCGGACAACCGCTACGAAACCATGCCATACCG2134 CCGCGTCGGACGCAGCGGGCTGAAGCT2161 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 596 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: MetThrGlnProAsnAspAlaAlaLysProValGlnGlyAlaGlyArg 151015 PheAspIleTrpAlaProGluAlaGlyThrValThrLeuLeuAlaGly 202530 GlyGluArgTyrGluMetGlyArgArgProGlyAsnGlyProAlaAsp 354045 GluGlyTrpTrpThrAlaAlaAspAlaProThrGlyAlaAspValAsp 505560 TyrGlyTyrLeuLeuAspGlyAspGluIleProLeuProAspProArg 65707580 ThrArgArgGlnProGluGlyValHisAlaLeuSerArgThrPheAsp 859095 ProGlyAlaHisArgTrpGlnAspAlaGlyTrpGlnGlyArgGluLeu 100105110 GlnGlySerValIleTyrGluLeuHisIleGlyThrPheThrProGlu 115120125 GlyThrLeuAspAlaAlaAlaGlyLysLeuAspTyrLeuAlaGlyLeu 130135140 GlyIleAspPheIleGluLeuLeuProValAsnAlaPheAsnGlyThr 145150155160 HisAsnTrpGlyTyrAspGlyValGlnTrpPheAlaValHisGluGly 165170175 TyrGlyGlyProAlaAlaTyrGlnArgPheValAspAlaAlaHisAla 180185190 AlaGlyLeuGlyValIleGlnAspValValTyrAsnHisLeuGlyPro 195200205 SerGlyAsnTyrLeuProArgTyrGlyProTyrLeuLysHisGlyGlu 210215220 GlyAsnThrTrpGlyAspSerValAsnLeuAspGlyProGlySerAsp 225230235240 HisValArgGlnTyrIleLeuAspAsnValAlaMetTrpLeuArgAsp 245250255 TyrArgValAspGlyLeuArgLeuAspAlaValHisAlaLeuLysAsp 260265270 GluArgAlaValHisIleLeuGluGluPheGlyAlaLeuAlaAspAla 275280285 LeuSerSerGluGlyGlyArgProLeuThrLeuIleAlaGluSerAsp 290295300 LeuAsnAsnProArgLeuLeuTyrProArgAspValAsnGlyTyrGly 305310315320 LeuAlaGlyGlnTrpSerAspAspPheHisHisAlaValHisValAsn 325330335 ValSerGlyGluThrThrGlyTyrTyrSerAspPheAspSerLeuGly 340345350 AlaLeuAlaLysValLeuArgAspGlyPhePheHisAspGlySerTyr 355360365 SerSerPheArgGlyArgCysHisGlyArgProIleAsnPheSerAla 370375380 ValHisProAlaAlaLeuValValCysSerGlnAsnHisAspGlnIle 385390395400 GlyAsnArgAlaThrGlyAspArgLeuSerGlnSerLeuProTyrGly 405410415 SerLeuAlaLeuAlaAlaValLeuThrLeuThrGlyProPheThrPro 420425430 MetLeuPheMetGlyGluGluTyrGlyAlaThrThrProTrpGlnPhe 435440445 PheThrSerHisProGluProGluLeuGlyLysAlaThrAlaGluGly 450455460 ArgIleArgGluPheGluArgMetGlyTrpAspProAlaValValPro 465470475480 AspProGlnAspProGluThrPheThrArgSerLysLeuAspTrpAla 485490495 GluAlaSerAlaGlyAspHisAlaArgLeuLeuGluLeuTyrArgSer 500505510 LeuIleThrLeuArgArgSerThrProGluLeuAlaArgLeuGlyPhe 515520525 AlaAspThrAlaValGluPheAspAspAspAlaArgTrpLeuArgTyr 530535540 TrpArgGlyGlyValGlnValValLeuAsnPheAlaAspArgProIle 545550555560 SerLeuAspArgProGlyThrAlaLeuLeuLeuAlaThrAspAspAla 565570575 ValArgMetAspGlyValGlnValGluLeuProProLeuSerAlaAla 580585590 ValLeuArgAsp 595 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2056 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 90..1883 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: GCCGGCTTCGGACCGGGGGCAGTGAAGATCGCCGACATCTTCCGGTCGTTCCCCGTTGCG60 CTGCTGGTGCCGCAGACAGGAGGAGAGTCATGACGCACACCTACCCGCGGGAA113 MetThrHisThrTyrProArgGlu 600 GCCGCGAAACCCGTCCTGGGCCCCGCACGCTACGACGTCTGGGCGCCC161 AlaAlaLysProValLeuGlyProAlaArgTyrAspValTrpAlaPro 605610615620 AACGCTGAATCCGTGACGCTGCTGGCCGGCGGGGAGCGCTACGCCATG209 AsnAlaGluSerValThrLeuLeuAlaGlyGlyGluArgTyrAlaMet 625630635 CAGCGCCGGGCCGAGACCGGGCCGGAGGACGCCGGCTGGTGGACCGCC257 GlnArgArgAlaGluThrGlyProGluAspAlaGlyTrpTrpThrAla 640645650 GCCGGCGCGCCTACGGATGGCAACGTGGACTACGGGTACCTTCTGGAC305 AlaGlyAlaProThrAspGlyAsnValAspTyrGlyTyrLeuLeuAsp 655660665 GGCGACGAAACACCGCTTCCGGATCCACGGACCCGCCGCCAGCCCGAC353 GlyAspGluThrProLeuProAspProArgThrArgArgGlnProAsp 670675680 GGCGTCCACGCCCTGTCCCGCACGTTCGACCCGTCCGCGTACAGCTGG401 GlyValHisAlaLeuSerArgThrPheAspProSerAlaTyrSerTrp 685690695700 CAGGACGACGCCTGGCAGGGCAGGGAACTGCAGGGCGCCGTCATCTAC449 GlnAspAspAlaTrpGlnGlyArgGluLeuGlnGlyAlaValIleTyr 705710715 GAGCTCCACCTCGGAACATTCACGCCCGAAGGGACGCTGGAGGCGGCC497 GluLeuHisLeuGlyThrPheThrProGluGlyThrLeuGluAlaAla 720725730 GCCGGAAAGCTGGACTACCTCGCCGGCTTGGGCGTCGACTTCATCGAG545 AlaGlyLysLeuAspTyrLeuAlaGlyLeuGlyValAspPheIleGlu 735740745 CTGCTGCCGGTGAACGCTTTCAACGGCACGCACAACTGGGGTTACGAC593 LeuLeuProValAsnAlaPheAsnGlyThrHisAsnTrpGlyTyrAsp 750755760 GGTGTCCAGTGGTTCGCTGTGCACGAGGCATACGGCGGGCCGGAAGCG641 GlyValGlnTrpPheAlaValHisGluAlaTyrGlyGlyProGluAla 765770775780 TACCAGCGGTTCGTCGACGCCGCCCACGCCGCAGGCCTTGGCGTGATC689 TyrGlnArgPheValAspAlaAlaHisAlaAlaGlyLeuGlyValIle 785790795 CAGGACGTGGTCTACAACCACCTCGGCCCCAGCGGGAACTACCTGCCG737 GlnAspValValTyrAsnHisLeuGlyProSerGlyAsnTyrLeuPro 800805810 CGGTTCGGGCCGTACCTCAAGCAGGGCGAGGGTAACACGTGGGGCGAC785 ArgPheGlyProTyrLeuLysGlnGlyGluGlyAsnThrTrpGlyAsp 815820825 TCGGTGAACCTGGACGGGCCCGGCTCCGACCATGTGCGCCGGTACATC833 SerValAsnLeuAspGlyProGlySerAspHisValArgArgTyrIle 830835840 CTGGACAACCTGGCCATGTGGCTGCGTGACTACCGGGTGGACGGCCTG881 LeuAspAsnLeuAlaMetTrpLeuArgAspTyrArgValAspGlyLeu 845850855860 CGGCTGGACGCCGTCCACGCCCTGAAGGATGAGCGGGCGGTGCACATC929 ArgLeuAspAlaValHisAlaLeuLysAspGluArgAlaValHisIle 865870875 CTGGAGGACTTCGGGGCGCTGGCCGATCAGATCTCCGCCGAGGTGGGA977 LeuGluAspPheGlyAlaLeuAlaAspGlnIleSerAlaGluValGly 880885890 CGGCCGCTGACGCTCATCGCCGAGTCCGACCTCAACAACCCGCGGCTG1025 ArgProLeuThrLeuIleAlaGluSerAspLeuAsnAsnProArgLeu 895900905 CTGTACCCGCGGGACGTCAACGGGTACGGGCTGGAAGGGCAGTGGAGC1073 LeuTyrProArgAspValAsnGlyTyrGlyLeuGluGlyGlnTrpSer 910915920 GACGACTTCCACCACGCCGTCCACGTCAACGTCACCGGCGAAACCACC1121 AspAspPheHisHisAlaValHisValAsnValThrGlyGluThrThr 925930935940 GGCTACTACAGTGACTTCGACTCGCTGGCCGCCCTCGCCAAGGTGCTC1169 GlyTyrTyrSerAspPheAspSerLeuAlaAlaLeuAlaLysValLeu 945950955 CGGGACGGCTTCTTCCACGACGGCAGCTACTCCAGCTTCCGGGAACGC1217 ArgAspGlyPhePheHisAspGlySerTyrSerSerPheArgGluArg 960965970 CACCACGGACGGCCGATTAATTTCAGCGCCGTACACCCAGCCGCCCTG1265 HisHisGlyArgProIleAsnPheSerAlaValHisProAlaAlaLeu 975980985 GTGGTCTGTTCGCAGAACCACGACCAGATCGGCAACCGTGCCACGGGG1313 ValValCysSerGlnAsnHisAspGlnIleGlyAsnArgAlaThrGly 9909951000 GACCGGCTCTCCCAGACCCTGCCGTACGGAAGCCTGGCCCTCGCTGCG1361 AspArgLeuSerGlnThrLeuProTyrGlySerLeuAlaLeuAlaAla 1005101010151020 GTGCTGACCCTGACGGGACCCTTCACGCCCATGCTGCTCATGGGCGAG1409 ValLeuThrLeuThrGlyProPheThrProMetLeuLeuMetGlyGlu 102510301035 GAGTACGGCGCCAGCACGCCGTGGCAGTTTTTCACCTCGCACCCGGAG1457 GluTyrGlyAlaSerThrProTrpGlnPhePheThrSerHisProGlu 104010451050 CCGGAGCTCGGCAAGGCCACCGCGGAGGGCCGGATCAAGGAGTTCGAG1505 ProGluLeuGlyLysAlaThrAlaGluGlyArgIleLysGluPheGlu 105510601065 CGCATGGGGTGGGATCCCGCCGTCGTGCCCGATCCCCAGGATCCTGAG1553 ArgMetGlyTrpAspProAlaValValProAspProGlnAspProGlu 107010751080 ACGTTCCGCCGGTCCAAGCTGGACTGGGCGGAAGCCGCCGAAGGCGAC1601 ThrPheArgArgSerLysLeuAspTrpAlaGluAlaAlaGluGlyAsp 1085109010951100 CATGCCCGGCTGCTGGAGCTGTACCGTTCGCTCACCGCCCTGCGCCGC1649 HisAlaArgLeuLeuGluLeuTyrArgSerLeuThrAlaLeuArgArg 110511101115 TCCACGCCGGACCTCACCAAGCTGGGCTTCGAGGACACGCAGGTGGCG1697 SerThrProAspLeuThrLysLeuGlyPheGluAspThrGlnValAla 112011251130 TTCGACGAGGACGCCCGCTGGCTGCGGTTCCGCCGGGGTGGCGTGCAG1745 PheAspGluAspAlaArgTrpLeuArgPheArgArgGlyGlyValGln 113511401145 GTGCTGCTCAACTTCTCGGAACAGCCCGTGAGCCTGGACGGGGCGGGC1793 ValLeuLeuAsnPheSerGluGlnProValSerLeuAspGlyAlaGly 115011551160 ACGGCCCTGCTGCTGGCCACCGACGACGCCGTCCGGCTAGAAGGTGAG1841 ThrAlaLeuLeuLeuAlaThrAspAspAlaValArgLeuGluGlyGlu 1165117011751180 CGTGCGGAACTCGGTCCGCTGAGCGCCGCCGTCGTCAGCGAC1883 ArgAlaGluLeuGlyProLeuSerAlaAlaValValSerAsp 11851190 TGACGTTTTCTTGGGGGCGGCGTCCACCGCCGGTGACCGGATGGTGGACGTCCGCCCCGA1943 AGCCTCGGCGCGGCTGGCAGGATGGAACGCATGACTTATGTGGCCTCGGACACCCGCTAC2003 GACACCATGCCCTACCGCCGCGTCGGACGCAGCGGCCTCAAACTGCCGGCCAT2056 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 598 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: MetThrHisThrTyrProArgGluAlaAlaLysProValLeuGlyPro 151015 AlaArgTyrAspValTrpAlaProAsnAlaGluSerValThrLeuLeu 202530 AlaGlyGlyGluArgTyrAlaMetGlnArgArgAlaGluThrGlyPro 354045 GluAspAlaGlyTrpTrpThrAlaAlaGlyAlaProThrAspGlyAsn 505560 ValAspTyrGlyTyrLeuLeuAspGlyAspGluThrProLeuProAsp 65707580 ProArgThrArgArgGlnProAspGlyValHisAlaLeuSerArgThr 859095 PheAspProSerAlaTyrSerTrpGlnAspAspAlaTrpGlnGlyArg 100105110 GluLeuGlnGlyAlaValIleTyrGluLeuHisLeuGlyThrPheThr 115120125 ProGluGlyThrLeuGluAlaAlaAlaGlyLysLeuAspTyrLeuAla 130135140 GlyLeuGlyValAspPheIleGluLeuLeuProValAsnAlaPheAsn 145150155160 GlyThrHisAsnTrpGlyTyrAspGlyValGlnTrpPheAlaValHis 165170175 GluAlaTyrGlyGlyProGluAlaTyrGlnArgPheValAspAlaAla 180185190 HisAlaAlaGlyLeuGlyValIleGlnAspValValTyrAsnHisLeu 195200205 GlyProSerGlyAsnTyrLeuProArgPheGlyProTyrLeuLysGln 210215220 GlyGluGlyAsnThrTrpGlyAspSerValAsnLeuAspGlyProGly 225230235240 SerAspHisValArgArgTyrIleLeuAspAsnLeuAlaMetTrpLeu 245250255 ArgAspTyrArgValAspGlyLeuArgLeuAspAlaValHisAlaLeu 260265270 LysAspGluArgAlaValHisIleLeuGluAspPheGlyAlaLeuAla 275280285 AspGlnIleSerAlaGluValGlyArgProLeuThrLeuIleAlaGlu 290295300 SerAspLeuAsnAsnProArgLeuLeuTyrProArgAspValAsnGly 305310315320 TyrGlyLeuGluGlyGlnTrpSerAspAspPheHisHisAlaValHis 325330335 ValAsnValThrGlyGluThrThrGlyTyrTyrSerAspPheAspSer 340345350 LeuAlaAlaLeuAlaLysValLeuArgAspGlyPhePheHisAspGly 355360365 SerTyrSerSerPheArgGluArgHisHisGlyArgProIleAsnPhe 370375380 SerAlaValHisProAlaAlaLeuValValCysSerGlnAsnHisAsp 385390395400 GlnIleGlyAsnArgAlaThrGlyAspArgLeuSerGlnThrLeuPro 405410415 TyrGlySerLeuAlaLeuAlaAlaValLeuThrLeuThrGlyProPhe 420425430 ThrProMetLeuLeuMetGlyGluGluTyrGlyAlaSerThrProTrp 435440445 GlnPhePheThrSerHisProGluProGluLeuGlyLysAlaThrAla 450455460 GluGlyArgIleLysGluPheGluArgMetGlyTrpAspProAlaVal 465470475480 ValProAspProGlnAspProGluThrPheArgArgSerLysLeuAsp 485490495 TrpAlaGluAlaAlaGluGlyAspHisAlaArgLeuLeuGluLeuTyr 500505510 ArgSerLeuThrAlaLeuArgArgSerThrProAspLeuThrLysLeu 515520525 GlyPheGluAspThrGlnValAlaPheAspGluAspAlaArgTrpLeu 530535540 ArgPheArgArgGlyGlyValGlnValLeuLeuAsnPheSerGluGln 545550555560 ProValSerLeuAspGlyAlaGlyThrAlaLeuLeuLeuAlaThrAsp 565570575 AspAlaValArgLeuGluGlyGluArgAlaGluLeuGlyProLeuSer 580585590 AlaAlaValValSerAsp 595 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: TTYGAYATHTGGGCNCC17 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: GTAAAACGACGGCCAGT17 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: ATGGGNTGGGAYCCNGC17 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: TAYGAYGTNTGGGC14 __________________________________________________________________________
Claims (20)
1. A recombinant enzyme which releases trehalose from a non-reducing saccharide having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, said recombinant enzyme being obtained from a recombinant host microorganism by expressing said recombinant enzyme from a DNA sequence which encodes said recombinant enzyme and which is derived from a microorganism selected from the genera consisting of Rhizobium, Arthrobacter, Brevibacterium, and Micrococcus, and wherein said recombinant enzyme has an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, and a variant thereof where one or more amino acid residues in SEQ ID NO:2 or SEQ ID NO:4 are deleted, replaced with a different amino acid, or supplemented with one or more amino acids, which variant is a functional equivalent of the recombinant enzyme of SEO ID NO:2 or SEO ID NO:4 and has substantially the same activity.
2. The recombinant enzyme as claimed in claim 1, which has the following physicochemical properties of:
(1) Molecular weight About 57,000-68,000 daltons on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE); and
(2) Isoelectric point (pI) About 3.3-4.6 on isoelectrophoresis.
3. The recombinant enzyme as claimed in claim 1, which is encoded by a DNA having a base sequence selected from the group consisting of SEQ ID NOs:1 and 3 that initiate from the 5'-terminus, and variants thereof where one or more bases in SEO ID NO:1 or 3 are replaced with different bases by means of the degeneracy of the genetic code without altering the corresponding amino acid sequences of SEQ ID NO:2 and SEQ ID NO:4, and complementary base sequences thereof.
4. The recombinant enzyme as claimed in claim 3, wherein said DNA has a base sequence of a variant where one or more bases in SEQ ID NOs:1 and 3 are replaced with different bases by means of the degeneracy of the genetic code without altering the corresponding amino acid sequences of SEQ ID NOs:2 and 4.
5. The recombinant enzyme as claimed in claim 1, which is encoded by a DNA having a base sequence selected from the group consisting of SEQ ID NOs:11 and 13.
6. The recombinant enzyme according to claim 1, wherein said recombinant enzyme has the amino acid sequence of a variant where one amino acid residue in SEQ ID NO:2 or SEQ ID NO:4 is deleted, replaced with a different amino acid or supplemented with a single amino acid without substantially altering the activity of said recombinant enzyme.
7. A recombinant enzyme which releases trehalose from a non-reducing saccharide having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, said recombinant enzyme being obtained from a recombinant host microorganism by expressing said recombinant enzyme from a DNA sequence which encodes said recombinant enzyme and which is derived from a microorganism selected from the genera consisting of Rhizobium, Arthrobacter, Brevibacterium, and Micrococcus, wherein said recombinant enzyme has an amino acid sequence selected from SEQ ID NO:4 and a variant thereof where one amino acid residue in SEQ ID NO:4 is deleted, replaced with a different amino acid or supplemented with a single amino acid without substantially altering the activity of said recombinant enzyme.
8. The recombinant enzyme according to claim 7, wherein said recombinant enzyme has the amino acid sequence of SEQ ID NO:4.
9. The recombinant enzyme according to claim 7, wherein said recombinant enzyme has the amino acid sequence of a variant where one amino acid residue in SEQ ID NO:4 is deleted, replaced with a different amino acid or supplemented with a single amino acid without substantially altering the activity of said recombinant enzyme.
10. The recombinant enzyme according to claim 7, which has the following physicochemical properties of:
(1) Molecular weight About 57,000-68,000 daltons on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE); and
(2) Isoelectric point (pI) About 3.3-4.6 on isoelectrophoresis.
11. The recombinant enzyme according to claim 7, which is encoded by a DNA sequence selected from the group consisting of SEQ ID NO:3, a variant thereof where one or more bases are replaced with different bases by means of the degeneracy of the genetic code without altering the corresponding amino acid sequence of SEQ ID NO:4, and a complementary base sequence thereof.
12. The recombinant enzyme according to claim 11, wherein said recombinant enzyme is encoded by a DNA sequence having the sequence of SEQ ID NO:3.
13. The recombinant enzyme according to claim 11, wherein said recombinant enzyme is encoded by a DNA sequence having the sequence of a variant where one or more bases in SEQ ID NO:3 are replaced with different bases by means of the degeneracy of the genetic code without altering the corresponding amino acid of SEQ ID NO:4.
14. A recombinant enzyme which releases trehalose from a non-reducing saccharide having a trehalose structure as an end unit and having a degree of glucose polymerization of 3 or higher, said recombinant enzyme being obtained from a recombinant host microorganism by expressing said recombinant enzyme from a DNA sequence which encodes said recombinant enzyme and which is derived from a microorganism selected from the genera consisting of Rhizobium, Arthrobacter, Brevibacterium, and Micrococcus, wherein said recombinant enzyme has an amino acid sequence selected from SEQ ID NO:2 and a variant thereof where one amino acid residue in SEQ ID NO:2 is deleted, replaced with a different amino acid or supplemented with a single amino acid without substantially altering the activity of said recombinant enzyme.
15. The recombinant enzyme according to claim 14, wherein said recombinant enzyme has the amino acid sequence of SEQ ID NO:2.
16. The recombinant enzyme according to claim 14, wherein said recombinant enzyme has the amino acid sequence of a variant where one amino acid residue in SEQ ID NO:2 is deleted, replaced with a different amino acid or supplemented with a single amino acid without substantially altering the activity of said recombinant enzyme.
17. The recombinant enzyme according to claim 14, which has the following physicochemical properties of:
(1) Molecular weight About 57,000-68,000 daltons on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE); and
(2) Isoelectric point (pI) About 3.3-4.6 on isoelectrophoresis.
18. The recombinant enzyme according to claim 14, which is encoded by a DNA sequence selected from the group consisting of SEQ ID NO:1, a variant thereof where one or more bases are replaced with different bases by means of the degeneracy of the genetic code without altering the corresponding amino acid sequence of SEQ ID NO:2, and a complementary base sequence thereof.
19. The recombinant enzyme according to claim 18, wherein said recombinant enzyme is encoded by a DNA sequence having the sequence of SEQ ID NO:1.
20. The recombinant enzyme according to claim 18, wherein said recombinant enzyme is encoded by a DNA sequence having the sequence of a variant where one or more bases in SEQ ID NO:1 are replaced with different bases by means of the degeneracy of the genetic code without altering the corresponding amino acid of SEQ ID NO:2.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/605,501 US5834287A (en) | 1994-03-07 | 1996-02-26 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparation and uses |
Applications Claiming Priority (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP6-59834 | 1994-03-07 | ||
JP6-59840 | 1994-03-07 | ||
JP5983494 | 1994-03-07 | ||
JP5984094 | 1994-03-07 | ||
US08/399,646 US5556781A (en) | 1994-03-07 | 1995-03-07 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
US08/605,501 US5834287A (en) | 1994-03-07 | 1996-02-26 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparation and uses |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/399,646 Division US5556781A (en) | 1994-03-07 | 1995-03-07 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
Publications (1)
Publication Number | Publication Date |
---|---|
US5834287A true US5834287A (en) | 1998-11-10 |
Family
ID=26400910
Family Applications (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/399,646 Expired - Lifetime US5556781A (en) | 1994-03-07 | 1995-03-07 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
US08/607,321 Expired - Lifetime US5716813A (en) | 1994-03-07 | 1996-02-26 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
US08/605,501 Expired - Lifetime US5834287A (en) | 1994-03-07 | 1996-02-26 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparation and uses |
US08/961,240 Expired - Fee Related US5830715A (en) | 1994-03-07 | 1997-10-30 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
Family Applications Before (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/399,646 Expired - Lifetime US5556781A (en) | 1994-03-07 | 1995-03-07 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
US08/607,321 Expired - Lifetime US5716813A (en) | 1994-03-07 | 1996-02-26 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/961,240 Expired - Fee Related US5830715A (en) | 1994-03-07 | 1997-10-30 | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
Country Status (5)
Country | Link |
---|---|
US (4) | US5556781A (en) |
EP (1) | EP0671470B9 (en) |
KR (1) | KR100374449B1 (en) |
DE (1) | DE69532485T2 (en) |
TW (2) | TW494136B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7259232B1 (en) * | 2000-10-27 | 2007-08-21 | Nymox Pharmaceutical Corporation | Preferred segments of neural thread protein |
Families Citing this family (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE69532485T2 (en) * | 1994-03-07 | 2004-11-04 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Trehalose-releasing enzyme, DNA coding for it, production and use |
EP1130101B1 (en) * | 1994-06-15 | 2008-10-15 | Kirin Beer Kabushiki Kaisha | Transferase and amylase, process for producing the enzymes, use thereof, and genes coding for the same |
JP3650632B2 (en) * | 1994-06-16 | 2005-05-25 | 株式会社林原生物化学研究所 | Recombinant enzyme that converts maltose to trehalose |
US5985593A (en) * | 1996-10-11 | 1999-11-16 | Integrated Research Technology, L.L.C. | Compositions and methods for enzymatic decontamination |
JP4153057B2 (en) * | 1997-03-10 | 2008-09-17 | 中国化薬株式会社 | Method for producing D-glucuronolactone |
JPH11116588A (en) | 1997-10-16 | 1999-04-27 | Hayashibara Biochem Lab Inc | Production of trehalose and sugar alcohol |
JP4295840B2 (en) * | 1997-12-09 | 2009-07-15 | 株式会社林原生物化学研究所 | Blood circulation improving agent |
JP4203159B2 (en) | 1997-12-09 | 2008-12-24 | 株式会社林原生物化学研究所 | Nerve function regulator |
JP3958884B2 (en) * | 1998-09-11 | 2007-08-15 | 株式会社林原生物化学研究所 | Non-reducing saccharide-forming enzyme, trehalose-releasing enzyme, and method for producing saccharide using the enzyme |
AU760216B2 (en) * | 1998-09-11 | 2003-05-08 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Non-reducing saccharide-forming enzyme, trehalose-releasing enzyme, and process for producing saccharides using the same enzymes |
JP4652540B2 (en) | 2000-03-02 | 2011-03-16 | 株式会社林原生物化学研究所 | Body odor inhibitors and their uses |
CA2355814C (en) | 2000-09-14 | 2010-06-29 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Pharmaceutical composition for ophthalmic use |
JP4754066B2 (en) | 2000-12-22 | 2011-08-24 | 株式会社林原生物化学研究所 | Anti-joint disorder |
CN1953755A (en) * | 2004-05-17 | 2007-04-25 | 株式会社林原生物化学研究所 | Method for enhancing life activity and /or expanding suitable region for life activity of living body contacting to water-based environment |
Citations (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPS5015448A (en) * | 1973-06-08 | 1975-02-18 | ||
JPS582379A (en) * | 1981-06-29 | 1983-01-07 | Natl House Ind Co Ltd | Heat-accumulating and insulating material |
JPS587259A (en) * | 1981-06-30 | 1983-01-17 | バツクスタ− トラヴエノル ラボラトリ−ズ インコ−ポレ−テッド | Precisely metering apparatus of liquid dispensed into vein |
JPS5821669A (en) * | 1981-07-30 | 1983-02-08 | Tetsuzo Kato | Preparation of 2-(1-acylaminoalkyl)-6-methyl-4(3h)- pyrimidinone |
GB2106912A (en) * | 1981-08-03 | 1983-04-20 | Hayashibara Seibutsu Kagaki Ke | Process for producing high-purity maltose |
US4521252A (en) * | 1981-10-26 | 1985-06-04 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Process for producing a high-purity isomaltose |
EP0555540A1 (en) * | 1991-12-11 | 1993-08-18 | Ajinomoto Co., Inc. | Method of producing trehalose |
EP0628630A2 (en) * | 1993-06-03 | 1994-12-14 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Trehalose-releasing enzyme, and its preparation and uses |
US5556781A (en) * | 1994-03-07 | 1996-09-17 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPS50154485A (en) * | 1974-05-31 | 1975-12-12 | ||
JPS58216695A (en) * | 1982-06-07 | 1983-12-16 | Otsuka Shokuhin Kogyo Kk | Preparation of trehalose |
EP0691344B1 (en) * | 1992-12-28 | 2003-03-19 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Purification of trehalose |
-
1995
- 1995-03-07 DE DE69532485T patent/DE69532485T2/en not_active Expired - Lifetime
- 1995-03-07 KR KR1019950004580A patent/KR100374449B1/en not_active IP Right Cessation
- 1995-03-07 US US08/399,646 patent/US5556781A/en not_active Expired - Lifetime
- 1995-03-07 EP EP95301474A patent/EP0671470B9/en not_active Expired - Lifetime
- 1995-04-11 TW TW084103502A patent/TW494136B/en not_active IP Right Cessation
- 1995-04-11 TW TW090120935A patent/TW591109B/en not_active IP Right Cessation
-
1996
- 1996-02-26 US US08/607,321 patent/US5716813A/en not_active Expired - Lifetime
- 1996-02-26 US US08/605,501 patent/US5834287A/en not_active Expired - Lifetime
-
1997
- 1997-10-30 US US08/961,240 patent/US5830715A/en not_active Expired - Fee Related
Patent Citations (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPS5015448A (en) * | 1973-06-08 | 1975-02-18 | ||
JPS582379A (en) * | 1981-06-29 | 1983-01-07 | Natl House Ind Co Ltd | Heat-accumulating and insulating material |
JPS587259A (en) * | 1981-06-30 | 1983-01-17 | バツクスタ− トラヴエノル ラボラトリ−ズ インコ−ポレ−テッド | Precisely metering apparatus of liquid dispensed into vein |
JPS5821669A (en) * | 1981-07-30 | 1983-02-08 | Tetsuzo Kato | Preparation of 2-(1-acylaminoalkyl)-6-methyl-4(3h)- pyrimidinone |
GB2106912A (en) * | 1981-08-03 | 1983-04-20 | Hayashibara Seibutsu Kagaki Ke | Process for producing high-purity maltose |
US4521252A (en) * | 1981-10-26 | 1985-06-04 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Process for producing a high-purity isomaltose |
EP0555540A1 (en) * | 1991-12-11 | 1993-08-18 | Ajinomoto Co., Inc. | Method of producing trehalose |
EP0628630A2 (en) * | 1993-06-03 | 1994-12-14 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Trehalose-releasing enzyme, and its preparation and uses |
US5472863A (en) * | 1993-06-03 | 1995-12-05 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | Trehalose-releasing enzyme |
US5556781A (en) * | 1994-03-07 | 1996-09-17 | Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparations and uses |
Non-Patent Citations (9)
Title |
---|
E. M. Southern, Detection of Specific Sequences Among DNA Fragments Separated by Gel Electrophoresis, J. Mol. Biol., vol. 98, pp. 503 517, 1975. * |
E. M. Southern, Detection of Specific Sequences Among DNA Fragments Separated by Gel Electrophoresis, J. Mol. Biol., vol. 98, pp. 503-517, 1975. |
Enzyme Kinetics of Amylases and Related Enzymes, Handbook of Amylases and Related Enzymes, pp. 1 9, 1988. * |
Enzyme Kinetics of Amylases and Related Enzymes, Handbook of Amylases and Related Enzymes, pp. 1-9, 1988. |
J. Sambrook et al, Molecular Cloning a Laboratory Manual, Second Edition, published by Cold Spring Harbor Laboratory Press, 1989. * |
Maruta et al., Biochimica Et Biophysica Acta, "Cloning and Sequencing of Trehalose Biosynthesis Genes from Arthrobacter sp. Q36", No. 1289, 1996, pp. 10-13. |
Maruta et al., Biochimica Et Biophysica Acta, Cloning and Sequencing of Trehalose Biosynthesis Genes from Arthrobacter sp. Q36 , No. 1289, 1996, pp. 10 13. * |
U. K. Laemmli, Cleavage of Structural Proteins During the Assembly of the Head of Bacteriophage T4, Nature, vol. 227, pp. 680 685, 15 Aug. 1970. * |
U. K. Laemmli, Cleavage of Structural Proteins During the Assembly of the Head of Bacteriophage T4, Nature, vol. 227, pp. 680-685, 15 Aug. 1970. |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7259232B1 (en) * | 2000-10-27 | 2007-08-21 | Nymox Pharmaceutical Corporation | Preferred segments of neural thread protein |
Also Published As
Publication number | Publication date |
---|---|
DE69532485T2 (en) | 2004-11-04 |
EP0671470A3 (en) | 1997-02-05 |
TW494136B (en) | 2002-07-11 |
DE69532485D1 (en) | 2004-03-04 |
TW591109B (en) | 2004-06-11 |
EP0671470B9 (en) | 2004-11-03 |
US5830715A (en) | 1998-11-03 |
US5716813A (en) | 1998-02-10 |
EP0671470B1 (en) | 2004-01-28 |
EP0671470A2 (en) | 1995-09-13 |
KR950032624A (en) | 1995-12-22 |
KR100374449B1 (en) | 2003-09-06 |
US5556781A (en) | 1996-09-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5856146A (en) | Recombinant thermostable enzyme which releases trehalose from non-reducing saccharide | |
US5834287A (en) | DNA encoding enzyme, recombinant DNA and enzyme, transformant, and their preparation and uses | |
EP0704531B1 (en) | Recombinant thermostable enzyme for converting maltose into trehalose | |
EP0709461B1 (en) | DNA encoding a recombinant thermostable enzyme which forms non-reducing saccharide from reducing amylaceous saccharide | |
US5871977A (en) | DNA encoding enzyme recombinant DNA and enzyme transformant, and their preparation and uses | |
JP3559609B2 (en) | Recombinant enzyme, its production method and use | |
EP0695804B1 (en) | DNA encoding for a recombinant enzyme for converting maltose into trehalose | |
JP3557272B2 (en) | Recombinant enzyme, its production method and use | |
US5763228A (en) | Recombinant enzyme for converting maltose into trehalose from pimelobacter sp. | |
CA2159551C (en) | Recombinant thermostable enzyme for converting maltose into trehalose | |
JP3557276B2 (en) | DNA encoding an enzyme, recombinant DNA containing the same, and transformant | |
JP3557271B2 (en) | DNA encoding an enzyme, recombinant DNA containing the same, and transformant | |
EP0812915A2 (en) | Polypeptide having beta-fructofuranosidase activity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
FPAY | Fee payment |
Year of fee payment: 4 |
|
FPAY | Fee payment |
Year of fee payment: 8 |
|
FPAY | Fee payment |
Year of fee payment: 12 |