US5804392A - Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor - Google Patents

Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor Download PDF

Info

Publication number
US5804392A
US5804392A US08/884,203 US88420397A US5804392A US 5804392 A US5804392 A US 5804392A US 88420397 A US88420397 A US 88420397A US 5804392 A US5804392 A US 5804392A
Authority
US
United States
Prior art keywords
epcr
protein
soluble
receptor
plasma
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/884,203
Inventor
Charles T. Esmon
Deborah J. Stearns-Kurosawa
Shinichiro Kurosawa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oklahoma Medical Research Foundation
Original Assignee
Oklahoma Medical Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oklahoma Medical Research Foundation filed Critical Oklahoma Medical Research Foundation
Priority to US08/884,203 priority Critical patent/US5804392A/en
Assigned to NATIONAL INSTITUTE OF HEALTH, THE reassignment NATIONAL INSTITUTE OF HEALTH, THE CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: OKLAHOMA MEDICAL RESEARCH FOUNDATION
Assigned to HOWARD HUGHES MEDICAL INSTITUTE reassignment HOWARD HUGHES MEDICAL INSTITUTE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ESMON, CHARLES T.
Assigned to OKLAHOMA MEDICAL RESEARCH FOUNDATION reassignment OKLAHOMA MEDICAL RESEARCH FOUNDATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ESMON, CHARLES T., HOWARD HUGHES MEDICAL INSTITUTE
Priority to US09/082,021 priority patent/US6037450A/en
Priority to JP50581099A priority patent/JP3553616B2/en
Priority to DE69814634T priority patent/DE69814634T2/en
Priority to AU82694/98A priority patent/AU748199B2/en
Priority to PT98932912T priority patent/PT991946E/en
Priority to DK98932912T priority patent/DK0991946T3/en
Priority to AT98932912T priority patent/ATE240523T1/en
Priority to EP98932912A priority patent/EP0991946B1/en
Priority to CA002294647A priority patent/CA2294647C/en
Priority to ES98932912T priority patent/ES2198727T3/en
Priority to CA002427749A priority patent/CA2427749A1/en
Priority to PCT/US1998/013385 priority patent/WO1999000673A1/en
Publication of US5804392A publication Critical patent/US5804392A/en
Application granted granted Critical
Priority to JP2001365405A priority patent/JP4308900B2/en
Priority to JP2003017832A priority patent/JP2003301000A/en
Priority to JP2006200128A priority patent/JP2006321811A/en
Priority to JP2008066863A priority patent/JP2008164635A/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: OKLAHOMA MEDICAL RESEARCH FOUNDATION
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70539MHC-molecules, e.g. HLA-molecules
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/564Immunoassay; Biospecific binding assay; Materials therefor for pre-existing immune complex or autoimmune disease, i.e. systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, rheumatoid factors or complement components C1-C9
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/86Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving blood coagulating time or factors, or their receptors
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90Enzymes; Proenzymes
    • G01N2333/914Hydrolases (3)
    • G01N2333/948Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/95Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
    • G01N2333/964Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
    • G01N2333/96425Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
    • G01N2333/96427Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
    • G01N2333/9643Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
    • G01N2333/96433Serine endopeptidases (3.4.21)
    • G01N2333/96441Serine endopeptidases (3.4.21) with definite EC number
    • G01N2333/96461Protein C (3.4.21.69)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S435/00Chemistry: molecular biology and microbiology
    • Y10S435/975Kit
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S530/00Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof
    • Y10S530/827Proteins from mammals or birds
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S530/00Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof
    • Y10S530/827Proteins from mammals or birds
    • Y10S530/829Blood
    • Y10S530/83Plasma; serum

Definitions

  • the present invention is generally in the area of assays involving detection and/or measurement of endothelial cell protein C/activated protein C receptor or soluble forms thereof derived either by proteolysis or by alternative splicing.
  • Protein C and APC have also been implicated in the regulation of the host response to inflammation.
  • Activated protein C can prevent the lethal effects of E. coli in baboon models of gram negative sepsis (Taylor et al., 1987. J. Clin. Invest. 79; U.S. Pat. No. 5,009,889 to Taylor and Esmon) and preliminary clinical results suggest that protein C is effective in treating certain forms of human septic shock (Gerson et al., 1993. Pediatrics 91, 418-422). Inhibition of protein S, an important component of the protein C pathway, exacerbates the response of primates to sublethal levels of E. coli and augments the appearance of TNF in the circulation (Taylor et al., 1991. Blood 78, 357-363). These results suggest that protein C may both control coagulation and influence inflammation.
  • thrombomodulin an endothelial cell surface protein
  • TNF tumor necrosis factor
  • C4bBP a regulatory protein of the complement system, binds protein S to form a complex that is functionally inactive in supporting APC anticoagulant activity in vitro (Dahlback, 1986. J. Biol. Chem. 261, 12022-12027) and in vivo (Taylor,et al., 1991).
  • C4bBP behaves as an acute phase reactant (Dahlback, 1991. Thromb. Haemostas. 66, 49-61).
  • proteins of this pathway not only appear to regulate inflammation, but they also interact with components that regulate inflammation, and they themselves are subject to down regulation by inflammatory mediators.
  • Endothelial cells play a critical role in the protein C pathway in that they express two of the known receptors responsible for efficient protein C activation, thrombomodulin and the endothelial protein C/APC receptor (EPCR) (Fukudome and Esmon. 1994. J. Biol. Chem. 269:26486-26491; Stearns-Kurosawa, et al. 1996. Proc. Natl. Acad. Sci. (USA) 93:10212-10216).
  • Thrombomodulin (CD141) is a transmembrane cofactor that binds circulating thrombin with high affinity and the resultant enzyme-cofactor complex is required for physiologically relevant protein C activation rates (Esmon and Owen. 1981. Proc. Natl. Acad. Sci. (USA) 78:2249-2252; Dittman, W. A. 1991. Trends Cardiovasc. Med. 1:331-336).
  • EPCR is a recently identified receptor with significant homology to the CD1/MHC class 1 family (Fukudome and Esmon, 1994; Fukudome, et al. 1996. J. Biol. Chem. 271:17491-17498; Regan, et al. 1996. J. Biol. Chem. 271:17499-17503).
  • the cloning and biological role of the endothelial cell receptor for protein C was described in PCT/US95/09636 by Oklahoma Medical Research Foundation, entitled "Cloning and Regulation of an Endothelial Cell Protein C/Activated Protein C Receptor".
  • the protein was predicted to consist of 238 amino acids, which includes a 15 amino acid signal sequence at the N-terminus, and a 23 amino acid transmembrane region which characterizes the receptor as a type 1 transmembrane protein.
  • EPCR binds both protein C and APC with similar affinity (Kd app ⁇ 30 nM) (Fukudome, et al., 1996) in the presence of calcium and facilitates protein C activation by presenting the protein C substrate to the thrombin-thrombomodulin activation complex on cell surfaces (Stearns-Kurosawa, et al., 1996).
  • Both endothelial cell receptors are type 1 transmembrane proteins in which the ligand binds to an extracellular domain and both have a short intracellular cytoplasmic tail (Fukudome, et al. 1996; Jackman, et al. 1987. Proc. Natl. Acad. Sci.
  • Soluble thrombomodulin also accelerates inactivation of thrombin by a variety of inhibitors (Bourin and Lindahl. 1993. Biochem. J. 289:313-330; Rezaie, 1995. J. Biol. Chem. 270:25336-25339). Both plasma and urine contain detectable thrombomodulin (Takano, et al. 1990. Blood. 76:2024-2029; Ishii and Majerus. 1985. J. Clin. Invest. 76:2178-2181) and because the thrombomodulin gene does not contain introns (Jackman, et al., 1987), these soluble forms are due to proteolysis of the extracellular domain at the cell surface.
  • Soluble degradation products of thrombomodulin in plasma are a known marker of endothelial cell damage in a variety of disease states (Takano, et al., 1990; Tanaka, et al. 1991. Clin. Chem. 37:269-272; Takahashi, et al. 1991. Am. J. Hematol. 38:174-177; Asakura, et al. 1991. Am. J. Hematol. 38:281-287; Wada, et al. 1992. Am. J. Hematol. 39:20-24; Takahashi, et al. 1992. Am. J. Hematol. 41:32-39; Ohdama, et al. 1994. Chest 106:666-671) and are comprised of a mixture of thrombin-binding fragments with varying reduced affinities, as well as non-binding fragments (Takano, et al., 1990).
  • rsEPCR recombinant soluble EPCR
  • rsEPCR recombinant soluble EPCR
  • APC anticoagulant activity is inhibited effectively when bound to rsEPCR (Regan, et al., 1996), presumably because both rsEPCR and factor Va share binding determinants in a groove reminiscent of the anion binding exosite I in thrombin occupied by thrombomodulin (Mather, et al. 1996. EMBO J. 15:6822-6831).
  • rsEPCR does not appear to influence proteolysis of small synthetic substrates by APC, nor inactivation of APC by ⁇ 1-antitrypsin or protein C inhibitor (Regan, et al., 1996). Unlike membrane-bound EPCR which enhances protein C activation (Stearns-Kurosaw, at al., 1996), rsEPCR has little effect on protein C activation by the soluble thrombin-thrombomodulin complex (Regan, et al., 1996), suggesting that any soluble forms of EPCR might inhibit protein C activation by competing with membrane-associated EPCR for protein C.
  • Immunohistochemistry indicates that EPCR is present primarily on the surface of endothelial cells from large vessels and is absent or present at low levels on most capillary endothelial cells.
  • plasma EPCR inhibited both protein C activation on an endothelial cell line and APC anticoagulant activity in a one-stage factor Xa clotting assay. Soluble EPCR has also been detected in human urine. Cloning of the gene encoding EPCR demonstrates that at least human EPCR can be alternatively spliced, yielding a truncated soluble EPCR including an insert unique to the alternatively spliced form (sEPCR). These results indicate that plasma EPCR can be derived either by proteolysis at the cell surface or by alternative splicing.
  • the data indicates that the truncated soluble plasma EPCR could attenuate the membrane-bound EPCR augmentation of protein C activation and the anticoagulant function of activated protein C.
  • levels of soluble EPCR appear to be correlated with inflammation and disease states associated with abnormal coagulation.
  • Assays are described based on measurement of soluble EPCR which are indicative of disease conditions involving coagulation, inflammation, and large vessel disease. Assay reagents are described, including isolated purified soluble EPCR, recombinant truncated soluble EPCR, and antibodies to the soluble EPCRs.
  • FIG. 1 is a schematic of the two known mechanisms for producing a soluble receptor as applied to EPCR, by proteolysis of the membrane-bound receptor to release an extracellular domain and leave the membrane anchor behind, and by alternative splicing of the mRNA, showing the sequences unique to membrane bound EPCR (mEPCR) and to proteolyzed plasma EPCR (pEPCR), and the sequence unique to soluble EPCR (sEPCR).
  • mEPCR membrane bound EPCR
  • pEPCR proteolyzed plasma EPCR
  • sEPCR sequence unique to soluble EPCR
  • FIG. 2 is a schematic comparing mEPCR and sEPCR, showing the nucleotide insert and encoded amino acid sequence unique to sEPCR.
  • FIG. 3 shows the sequence inserted into human, bovine, murine, and baboon EPCR by alternative splicing.
  • FIG. 4a is a graph showing that soluble plasma EPCR binds to human protein C and APC.
  • EA.hy926 cells were incubated with 60 nM fl-APC in the presence of 0-500 nM rsEPCR ( ⁇ ) or plasma EPCR ( ⁇ ) for 30 minutes on ice. The cells were washed and cell-bound fluorescence was determined by flow cytometry as described. The intrinsic cell fluorescence in the absence of added fl-APC is indicated by the arrow. The mean cell fluorescence (MCF) plotted represents the average of duplicate MCF determinations.
  • MCF mean cell fluorescence
  • FIGS. 4b and 4c are graphs showing soluble plasma EPCR and rsEPCR inhibit protein C activation on cell surfaces.
  • EA.hy926 cell monolayers were pre-incubated for 15 minutes at room temperature with 0.1 ⁇ M protein C alone ( ⁇ ) or with 1 ⁇ M rsEPCR ( ⁇ ), or 2 ⁇ g/ml 1494 mAb ( ⁇ ).
  • Protein C activation was initiated by the addition of thrombin (2 nM final) and the reactions were stopped at the indicated times.
  • Activated protein C was determined with an amidolytic assay and the activity rates in mOD/min are plotted for each time point. Control wells without added thrombin were included ( ⁇ ). Each data point represents the average of triplicate well determinations.
  • EA.hy926 cell monolayers were pre-incubated for 15 minutes at room temperature with 0.1 ⁇ M protein C and the indicated concentrations of plasma EPCR ( ⁇ ) or rsEPCR ( ⁇ ). Thrombin (final 2 nM) was added and the activation proceeded for 60 minutes at room temperature. The supernatants were added to a mixture of antithrombin and heparin and activated protein C activities (mOD/min) were determined with an amidolytic assay. Each data point represents the average of triplicate well determinations.
  • FIG. 4d is a graph showing soluble plasma EPCR inhibits APC anticoagulant activity
  • the anticoagulant activity of APC 25 nM was determined with a one-stage Xa clotting assay in the presence of 460 nM plasma EPCR or rsEPCR. The effect was reversed when either soluble EPCR was pre-incubated for 5 minutes with 42 ⁇ g/ml of 1496 mAb which blocks binding of APC to EPCR.
  • the data represent the average of 4-6 determinations ⁇ S.D.
  • FIG. 5 is a graph comparing levels of soluble plasma TM to soluble plasma PCR in lupus patients, demonstrating that there is no correlation between TM and EPCR values, but that the majority of lupus patients exhibit extremely elevated levels of soluble plasma EPCR.
  • Endothelial Protein C Receptor EPCR
  • Soluble in solution and not bound to a cell surface.
  • the examples demonstrate that a soluble form of EPCR circulates in plasma and is present in urine.
  • the plasma EPCR level was about 100 ng/ml and it appeared to be a single antigen species of approximately 43,000 daltons.
  • Subsequent purification of the soluble EPCR from plasma and functional studies determined that it was capable of binding both protein C and APC with an affinity similar to intact membrane-bound EPCR.
  • the in vitro studies using an endothelial cell line demonstrated that plasma EPCR inhibited protein C activation at near physiological concentrations of protein C and thrombin.
  • direct addition of purified plasma EPCR to plasma resulted in inhibition of APC anticoagulant activity that was reversed with monoclonal antibodies to rsEPCR.
  • the identification of the purified plasma protein as being EPCR was based on comparison with the properties of rsEPCR. These proteins both reacted with the same battery of monoclonal and polyclonal antibodies, had the same amino-terminal sequence, bound to immobilized protein C in a Ca 2+ -dependent fashion, and blocked protein C activation and APC anticoagulant activity with similar dose response curves. In addition, the affinities of both protein C and APC for rsEPCR and plasma EPCR are similar to the affinity of intact membrane-bound EPCR. These properties appear to be unique to EPCR.
  • EPCR expression is most intense on large vessels and decreases progressively with decreasing vessel size, with little or no expression in the most abundant endothelial cell type, the capillary endothelium.
  • EPCR expression may play a critical role in capturing the protein C substrate from the circulation and presenting it to the thrombin-thrombomodulin complex for activation. This is supported by in vitro observations that both the EA.hy926 endothelial cell line and human umbilical vein endothelial cells have at least six times more surface-expressed EPCR antigen than thrombomodulin. In the microcirculation where thrombomodulin concentration is high and EPCR is low, one would predict little influence on protein C activation. Finally, circulating soluble EPCR may reduce the generation of APC and the ability of APC to inactivate factor Va.
  • the soluble EPCR levels are about 2.5 nM, a concentration well below both the Kd app (approximately 30 nM) and the 80 nM protein C concentration in the circulation. Both of the effects of soluble plasma EPCR (inhibition of APC anticoagulant activity and protein C activation) required considerably higher concentrations than that present in normal plasma, leaving the question of the physiological role of the plasma EPCR uncertain. Patients with soluble EPCR levels that exceed 40 nM have been identified, as described in Example 3 (lupus). Thus, if the local concentration near the endothelial cell surface exceeds the systemic concentration, the soluble EPCR concentration would reach levels that would attenuate both APC generation and activity, contributing to thrombotic risk.
  • a soluble form of a receptor can be produced by proteolytic cleavage of the membrane-bound receptor or by alternative splicing mechanisms. Proteolysis at the membrane surface releases soluble thrombomodulin, and receptors for TNF, IL-1, IL-2, M-CSF, PDGF, and NGF (Heaney, et al. 1996. Blood 87:847-857). Soluble receptors have a multitude of potential functions including acting as antagonists of the membrane receptor, stabilizing the ligand, initiating ligand-mediated signaling, downmodulation of the membrane form, and binding to receptor inhibitors to indirectly facilitate receptor-ligand activity.
  • the latter mechanism is used by the IL-1 receptor system in which the soluble isoforms of both IL-1 receptors are generated by proteolytic cleavage and tightly regulate the responsiveness to IL-1 ⁇ and IL-1 ⁇ (Arend, et al. 1994. J. Immunol. 153:4766-4774).
  • the EPCR genomic structure contains an alternative splicing site which would code for a soluble protein truncated just before the transmembrane domain (Fukudome and Esmon. 1995. J. Biol. Chem. 270:5571-5577), as discussed below. Soluble IL-6 receptors appear to be generated by both proteolytic and alternative splicing mechanisms (Mullberg, et al. 1994. J.
  • Plasma EPCR is located primarily on endothelium of large vessels and is barely detectable in capillaries.
  • Plasma EPCR derived from membrane-bound EPCR can therefore serve as a marker of large vessel disease processes.
  • Plasma EPCR may serve as a useful comparison with plasma thrombomodulin levels which have been shown to be modulated in a variety of disease states, but which would reflect both large and small vessel disease processes, but probably would be dominated by small vessel contributions since most endothelium is microvascular.
  • the cDNA for EPCR is predicted to code for a protein of 238 amino acids (Sequence ID No. 2), which includes a 15 amino acid signal sequence (von Heijne, (1986) Nucleic Acids Res. 14, 4683-4690) at the N-terminal. Therefore, the mature protein is predicted to contain 223 amino acids. Direct sequencing of the recombinant protein showed that the mature protein started at Ser18.
  • Sequence ID No. 2 is the predicted amino acid sequence of EPCR.
  • Amino acids 1-15 of Sequence ID No. 2 (MLTTLLPILLLSGWA) are the putative signal sequence determined by the method of von Heijne (von Heijne, 1986). Amino acids 211-236 of Sequence ID No.
  • LLLGVLVGGFIIAGVAVGIFLCTGGR are the putative transmembrane domain. Potential N-glycosylation sites are present at amino acids 47-49, 64-66, 136-138, and 172-174 of Sequence ID No. 2. Extracellular cysteine residues are present at amino acids 17 (removed in plasma EPCR), 114, 118, and 186 of Sequence ID No. 2. A potential transmembrane region (Engelman et al., (1986) Annu. Rev. Biophys. Chem. 15, 321-53) consisting of 23 amino acids was identified at the C-terminal end (beginning at amino acid 211 of Sequence ID No. 2).
  • the protein is a type 1 transmembrane protein.
  • the extracellular domain contains four potential N-glycosylation sites and three Cys residues. Glycosylation is not essential for activity, as shown by N-glycanase digestion.
  • the cytoplasmic region contains only three amino acids and terminates with a Cys, which is palmitoylated. If the terminal cysteine is not properly palmitoylated, the protein may be secreted. Altering the sequence of the EPCR to replace this cysteine with another amino acid thereby provides a means for making an essentially full length EPCR which is secreted instead of being membrane bound.
  • the nucleotide sequences encoding the receptor include the sequence shown in Sequence ID No. 1, and sequences having conservative substitutions, additions or deletions thereof which hybridize to Sequence ID No. 1 under stringent conditions.
  • the amino acids sequences constituting the receptor include the sequence shown in Sequence ID No. 2, and sequences having conservative substitutions, additions or deletions thereof which form a receptor having functionally equivalent biological activity. It is well known to those skilled in the art what constitutes conservative substitutions, additions or deletions, and which could be readily ascertained as encoding, or forming, a functionally equivalent receptor molecule using the functional assays described herein. This is further illustrated by reference to FIG. 3, discussed below.
  • Receptors are most often visualized as being proteins anchored in a cell membrane with the portion exposed to the outside of a cell responsible for binding a specific ligand to generate a physiological response.
  • a soluble form of the receptor exists that frequently is quite capable of binding its ligand, despite the fact that it is no longer restricted to a cell.
  • Ligand binding to the soluble receptor isoform can also generate a response which takes many forms, including up- or down-modulation of the membrane-bound receptor interactions, or propagating a response by transporting the ligand to a cell that normally is not responsive (Heaney, ML and DW Golde. Soluble cytokine receptors. Blood 87:847-857, 1996).
  • Human plasma contains about 100 ng/ml of soluble EPCR (Table 1). This was measured by an enzyme linked immunoassay (ELISA) using two monoclonal antibodies (1494 mAb and 1495 mAb) and standard techniques. Significantly elevated soluble EPCR levels were found in patients with systemic lupus erythematosus and sepsis. These levels seemed fairly high for a membrane-bound receptor that is present, with few exceptions, only on the surface of the large blood vessels.
  • ELISA enzyme linked immunoassay
  • thrombomodulin TM
  • TM thrombomodulin
  • TM genomic structure does not contain introns (Jackman, et al. Proc. Natl. Acad. Sci. (USA) 84:6425-6429, 1987), so the only way to create a soluble TM isoform is by proteolysis of the membrane-bound receptor.
  • Proteolysis of endothelial TM by neutrophil elastase and cathepsin G has been shown in vitro, suggesting that the elevated soluble TM levels found in a variety of disease states result from proteolysis mediated by products of activated inflammatory cells at the endothelial surface (Boehme, et al., Immunology 87:134-140, 1996 and Abe, et al. J. Lab. Clin. Med. 123:874-881, 1994).
  • the genomic structure of human EPCR contains four exons, separated by introns. Review of this sequence reveals an in-frame reading sequence after the exon III-intron III boundary (at the 5' GT) that includes a TAA stop codon at position 7527. Since this stop codon is upstream of exon IV that codes for the transmembrane domain, the predicted protein would contain a unique 48 residue carboxyl-terminal tail (coded for by the intron sequence) and would not contain a transmembrane anchor.
  • FIG. 1 is a diagram of two potential ways truncated EPCR can be derived: by proteolysis immediately before the transmembrane domain or by alternative splicing.
  • alternative splicing results in inclusion of a peptide sequence in the alternatively spliced truncated EPCR.
  • this sequence is highly conserved between species, although slight differences exist, resulting in a new carboxyl-terminal tail of 48 residues for human and bovine EPCR, 51 residues for murine EPCR, and 22 residues for baboon EPCR.
  • Patient samples can be screened for the presence of, and amount of, sEPCR or EPCR, using antibodies to either EPCR, the unique insert present in the alternatively spliced insert in EPCR, or antibodies which bind with greater affinity to either EPCR or sEPCR due to conformational differences. Samples can also be screened using other standard techniques to specifically quantitate proteins which are present.
  • Antibodies to EPCR and in particular, soluble EPCR ("sEPCR”), and recombinant soluble EPCR (“rsEPCR”) can be generated which are useful in detection, characterization or isolation of receptor proteins, as well as for modifying receptor protein activity, in most cases, through inhibition of ligand binding.
  • Antibodies are generated by standard techniques, using human or animal purified or recombinant receptor proteins or fragments thereof as the immunogen.
  • the antibodies referred to as 1494, 1495, and 1496 mAbs are IgGl K antibodies that bind to recombinant soluble EPCR and to cell surface-expressed EPCR.
  • the 1494 and 1496 mAbs block the binding of protein C and APC to EPCR, and inhibit the ability of cellular EPCR to facilitate protein C activation by the thrombin-thrombomodulin complex.
  • the 1495 mAb does not block ligand binding to EPCR, does not alter cell surface protein C activation, and has a binding epitope distinct from that for 1494 or 1486 mAb.
  • the antibodies can be labelled using standard techniques, such as radiolabelling, enzyme labelling, fluorescent labels such as fluorescein, gold particles, dyes, and other means for detection of the antibodies.
  • antibody can be biotinylated with biotinamidocaproate N-hydroxysuccinimide ester using standard procedures.
  • Antibody can be immobilized to a solid support for use in immunoassays, for example, AffiGel-10TM, nitrocellulose, or microtiter wells, or use in solution phase immunoassays.
  • EPCR is measured using microtiter plates (MaxisorpTM, NUNC NS, Roskilde, Denmark) coated with 50 microliters of 4 micrograms/ml 1495 mAb in 15 mM Na 2 CO 3 , 35 mM NaHCO 3 , pH 9.6, at 4° C. overnight. At room temperature, the plates are then washed three times with 20 mM Tris-HCl, 0.1M NaCl, 0.05% Tween 20, pH 7.5 (assay buffer), and blocked with assay buffer containing 0.1% (wt/vol) gelatin for at least one hour. The wells are then washed, 50 microliter samples added in triplicate wells, and the plates incubated for one hour.
  • the wells are aspirated, washed three times with assay buffer, and 50 microliters of 2 micrograms/ml biotin-1494 mAb added.
  • the plates are incubated for 1 hour, washed three times, and 50 microliters of 0.25 micrograms/ml streptavidin-alkaline phosphatase conjugate (GIBCO BRL) added and incubated for an additional hour.
  • the wells are washed five times, and the substrate and amplifier reagents from an ELISA amplification kit (GIBCO BRL) added sequentially at 15-min intervals according to the manufacturer's directions.
  • the color development is stopped with 0.3M H 2 SO 4 , and the endpoint absorbance read at 490 nm on a V max microplate reader.
  • Standards in triplicate wells are from 1.5 to 100 ng rsEPCR/ml in 20 mM Tris-HCl, 0.1M NaCl, and 1 mM EDTA, 0.1% gelatin, pH 7.5.
  • the standard curve is linear from 1.5 to 12.5 ng/ml, and samples are diluted with the same buffer to fall within the linear range. Studies show that between one and two percent plasma does not affect the linearity of the assay or the sensitivity of the standard curve. Plasma samples from healthy volunteers were diluted with assay buffer containing 1 mM EDTA to a final 2% plasma, and EPCR antigen levels are calculated from the average of triplicate wells by reference to standard curve determined on the same plate.
  • the assay for soluble EPCR is useful in detection and analysis of coagulation and inflammatory states and disorders as discussed herein, such as autoimmune diseases like lupus, in transplant monitoring, sepsis, shock, pre-eclampsia, diabetes, cardiopulmonary bypass, unstable angina, restenosis, angioplasty (i.e., vascular disease), kidney or liver disease.
  • autoimmune diseases like lupus
  • the EPCR is a marker for large blood vessels, and therefore for damage to large blood vessels.
  • An increase in the amount of soluble EPCR is indicative of large vessel injury, resulting either in proteolysis of EPCR or stimulation of sEPCR synthesis.
  • the ratio of EPCR to thrombomodulin can also be determined, based on either blood or urine samples, which is indicative of the relative extent of microvascular versus large vessel.
  • the relative amounts of EPCR to cytokines, leukocyte activation markers and complement factors or activation markers can also be used to indicate disease state.
  • EPCR is present on endothelial cells, it is useful as a marker of endothelial cell damage. It can be used as an indicator of drug effect, both toxicity as well as efficacy. For example, in lupus patients, drugs effectively minimizing inflammatory/coagulation mediated, large vessel injury would result in decreasing EPCR levels.
  • rsEPCR recombinant soluble EPCR with the HPC4 epitope inserted in place of the transmembrane domain and cytosolic tail
  • mAb monoclonal antibody
  • SDS-PAGE sodium dodecylsulfate polyacrylamide gel electrophoresis.
  • reagents were purchased from the indicated vendors: Porcine intestinal mucosal heparin, diisopropyl fluorophosphate, biotinamidocaproateN-hydroxysuccinimide ester, bovine serum albumin, Sigma (St. Louis, Mo.); Spectrozyme PCa, American Diagnostica (Greenwich, Conn.); ELISA amplification kit, GibcoBRL (Gaithersburg, Md.); AffiGel-10, BioRad (Hercules, Calif.); Hank's balanced salt solution, 3-(N-morpholine)propane sulfonic acid (MOPS), Fisher Scientific (Fair Lawn, N.J.). All other reagents were of the highest quality commercial available.
  • Recombinant soluble EPCR rsEPCR
  • rsEPCR Recombinant soluble EPCR consists of the extracellular domain of EPCR truncated at residue 210 just before the transmembrane domain, followed by a 12 residue sequence that permits calcium-dependent immunoaffinity purification on the HPC4 monoclonal antibody (Takahashi, et al. 1992; Stearns, et al. 1988. J. Biol. Chem. 263:826-832).
  • the construction, purification, and protein C/APC binding characteristics of rsEPCR (Fukudome, et al. 1996). Goat preimmune serum and polyclonal antiserum to rsEPCR was prepared and the IgG purified (Fukudome, et al. 1996).
  • Goat anti-rsEPCR polyclonal antibody was biotinylated with biotinamidocaproate N-hydroxysuccinimide ester using standard procedures.
  • Monoclonal antibodies Monoclonal antibodies (mAb) against rsEPCR were obtained as described for other proteins (Esmon, et al. 1993).
  • the 1494, 1495, and 1496 mAb are IgG1k antibodies that bind to rsEPCR and to cell surface-expressed EPCR.
  • the 1494 and 1496 mAb block the binding of protein C and APC to EPCR and inhibit the ability of cellular EPCR to facilitate protein C activation by the thrombin-thrombomodulin complex (Stearns-Kurosawa, et al. 1996).
  • the 1495 mAb does not block ligand binding to EPCR, does not alter cell surface protein C activation and has a binding epitope distinct from that for 1494 or 1496 mAb.
  • the 1494 and 1495 mAbs were biotinylated with biotinamidocaproate N-hydroxysuccinimide ester using standard procedures.
  • the 1494 mAb was coupled to AffiGel-10, according to the manufacturer's directions, for immunoaffinity purification of plasma EPCR.
  • the screening of anti-EPCR mAb was done using methods described by Stearns-Kurosawa, et al. (1996); Fukudome, et al. (1996).
  • Clotting Assay The effect of rsEPCR or purified plasma EPCR on APC (25 nM) anticoagulant activity in a one-stage factor Xa clotting assay was performed (Regan, et al. 1996) in the presence or absence of 83 ⁇ g/ml 1496 mAb, an antibody that blocks APC-EPCR interaction (Stearns-Kurosawa, et al. 1996). The soluble EPCRs and 1496 mAb were pre-incubated for 15 minutes before assay.
  • EA.hy926 cells a transformed human endothelial cell line (Edgell, et al. 1983. Proc. Natl. Acad. Sci. (USA) 80:3734-3737), were kindly provided by Cora-Jean Edgell (University of North Carolina at Chapel Hill).
  • APC was labeled with fluorescein in the active site (fl-APC) as described (Fukudome and Esmon, 1994; Bock, P. E. 1988. Biochemistry 27:6633-6639).
  • fluorescein in the active site (fl-APC) as described (Fukudome and Esmon, 1994; Bock, P. E. 1988. Biochemistry 27:6633-6639).
  • the effect of rsEPCR or plasma EPCR on APC binding to EA.hy926 cells was studied by flow cytometry (Fukudome, et al. 1996). Briefly, harvested cells were incubated for 30 min on ice with 60 nM fl-APC in the absence or presence of increasing concentrations of either soluble EPCR preparation, washed, and cell-bound fluorescence was determined by flow cytometry with 10,000 events counted per sample. All assays were done in Hank's balanced salt solution supplemented with 1% bovine serum albumin, 3 mM Ca
  • EA.hy926 cells were cultured in 96-well tissue culture dishes (Stearns-Kurosawa, et al. 1996). The confluent monolayers were washed three times with Hank's balanced salt solution supplemented with 1% (w/v) bovine serum albumin, 3 mM CaCl 2 , 0.6 mM MgCl 2 , and 0.02% sodium azide. All assays were done at room temperature in the same buffer in 60 ⁇ l final volume, and all protein concentrations represent the final concentration in the assay.
  • Protein C was added (0.1 ⁇ M) in the absence or presence of rsEPCR, plasma EPCR, or 1494 mAb at the indicated concentrations and pre-incubated with the cells for 15 minutes.
  • Thrombin was added to the mixtures (2 nM) to start the activation reactions.
  • 50 ⁇ l aliquots were removed and added to 10 ⁇ l of antithrombin (0.7 ⁇ M final) and heparin (5 U/ml final) in a 96-well microtiter plate.
  • APC amidolytic activity was determined by addition of Spectrozyme PCa substrate (0.2 mM) and the rate of change in absorbance at 405 nm (mOD/min) was measured on a Vmax kinetic microplate reader (Molecular Devices, Menlo Park, Calif.). All assay points were done in triplicate wells and less than 10% of the protein C substrate was activated as determined by reference to a standard curve of fully activated protein C versus mOD/min.
  • Plasma and Serum Collection Whole blood was collected from normal adult volunteers (12 females and 10 males) by venipuncture into 3.8% buffered citrate solution or into tubes without anticoagulant (Vacutainer tubes; Becton Dickinson, Franklin Lakes, N.J.). No screening of donors was attempted with respect to age, diet or other variables. All volunteers were informed of the study and gave their written consent. The blood was centrifuged at 1160 ⁇ g for 10 min. The plasma and serum were aliquoted and stored frozen at -80° C. until assay.
  • ELISA for quantitation of plasma EPCR.
  • An enzyme-linked immunosorbent assay for detection of EPCR antigen in plasma was developed. Microtitre plates (Maxisorp; Nunc, Roskilde, Denmark) were coated with 50 ⁇ l of 4 ⁇ g/ml 1495 mAb in 15 mM Na 2 CO 3 , 35 mM NaHCO 3 , pH 9.6 at 4° C. overnight. The following steps were done at room temperature. The wells were washed three times with 20 mM Tris-HCl, 0.1M NaCl, 0.05% Tween 20, pH 7.5 (assay buffer) and blocked with assay buffer containing 0.1% (w/v) gelatin for at least one hour.
  • the wells were washed, 50 ⁇ l samples were added in triplicate wells, and the plates were incubated for one hour.
  • the wells were aspirated, washed three times with assay buffer and 50 ⁇ l of 2 ⁇ g/ml biotin-1494 mAb was added.
  • the plates were incubated for one hour, washed three times and 50 ⁇ l of 0.25 ⁇ g/ml streptavidin-alkaline phosphatase conjugate (GibcoBRL) was added and incubated for an additional one hour.
  • the wells were washed five times and the substrate and amplifier reagents from an ELISA amplification kit (GibcoBRL) were added sequentially at 15 minute intervals according to the manufacturer's directions.
  • the color development was stopped with 0.3M H 2 SO 4 and the endpoint absorbance at 490 nm was read on a Vmax microplate reader.
  • Each plate contained standards in triplicate wells from 1.5-100 ng/ml rsEPCR in 20 mM Tris-HCl, 0.1M NaCl, 1 mM EDTA, 0.1% gelatin, pH 7.5.
  • Preliminary experiments determined that a final concentration of 1-2% human plasma did not affect the linearity or sensitivity of the standard curve.
  • Plasma samples from healthy volunteers were diluted with assay buffer containing 1 mM EDTA to a final 2% plasma and EPCR L, antigen levels were calculated from the average of triplicate wells by reference to a standard curve determined on the same plate.
  • membranes were incubated with mouse anti-goat IgG-horseradish peroxidase conjugate (Pierce, Rockford, Ill.) at a 1:20,000 dilution for 30 minutes. Membranes were washed and bound antibody-enzyme conjugate was detected with an enhanced chemiluminescent substrate (Pierce) according to the manufacturer's instructions.
  • Serum or citrated plasma samples 400 ⁇ l from healthy volunteers were incubated with 50 ⁇ l of 1495 mAb conjugated to AffiGel-10 (5 mg IgG/ml resin) overnight at 4° C. with mixing. The samples were centrifuged, the supernatant was removed, and the resin was washed three times with 1 ml of 20 mM Tris-HCl, 0.1M NaCl, 0.02% sodium azide, pH 7.5. SDS-PAGE sample buffer containing a final 20 mM dithiothreitol was added to the washed resin, the samples were boiled for three minutes, and processed for SDS-PAGE and Western blotting.
  • Membranes were probed with biotinylated-goat anti-rsEPCR polyclonal antibody at 4 ⁇ g/ml and bound antibody was detected with a streptavidin-horseradish peroxidase conjugate (Pierce) and enhanced chemiluminescent detection system.
  • Pierce streptavidin-horseradish peroxidase conjugate
  • Preliminary experiments determined that pre-adsorption of samples with 100 ⁇ l of Tris-inactivated AffiGel-10 resin for 1-4 hours at room temperature, followed by overnight immunoadsorption with the 1495 mAb-AffiGel-10 gave identical Western blotting results.
  • Plasma EPCR as purified from human citrated plasma (Oklahoma Blood Institute) using a combination of ion-exchange chromatography, anti-rsEPCR mAb immunoaffinity chromatography, and chromatography on protein C affinity columns. Two preparations were done in slightly different ways.
  • plasma (1L) was diluted with an equal volume of 20 mM Tris-HCl, pH 7.5, 10 mM benzamidine, 400 units sodium heparin and batch-adsorbed for 1 hour with 1 g pre-swollen QAE resin. After settling, the resin was processed for purification of protein C (Esmon, et al. 1993). Solid ammonium sulfate was added to the supernatant at 4° C. to 40% saturation, centrifuged, and additional ammonium sulfate was added to that supernatant to achieve 70% saturation.
  • the soft pellet was placed in dialysis bags and dialyzed overnight against 12 L of 20 mM Tris-HCl, 0.02% sodium azide, pH 7.4.
  • the dialysate was applied to a 1496 mAb-AffiGel-10 immunoaffinity column (6 ml resin; 5 mg IgG/ml resin) equilibrated in 20 mM Tris-HCl, 0.1M NaCl, 0.02% sodium azide, pH 7.4.
  • the column was washed with more than 12 ml of the same buffer and eluted with 50% (v/v) ethylene glycol in 20 mM Tris-HCl, pH 7.4 (Jun Xu, unpublished observations).
  • the peak fractions from the elution were pooled (0.37 total OD 280 ), concentrated (Centriprep 30, Millipore), and the buffer exchanged to 20 mM Tris-HC1, 0.1M NaCl, 3 mM CaCl 2 , 0.6 mM MgCl 2 , 0.02% sodium azide, pH 7.4.
  • This material was applied to a protein C affinity column that had been previously prepared by applying the purified protein C (3 mg) to an HPC4-AffiGel-10 column (5 mg IgG/ml resin; 0.9 ⁇ 8 cm) in the same buffer.
  • the HPC4 mAb binds the protein C activation region in a calcium-dependent fashion (Esmon, et al.
  • the eluate containing both protein C and plasma EPCR was applied to an FPLC (Pharmacia-LKB, Uppsala, Sweden) Mono Q column and the column developed with a linear gradient of 0.1-1M NaCl in 20 mM Tris-HCl , pH 7.5. About half of the plasma EPCR did not bind to the Mono Q column, half eluted at about 0.2M NaCl, and the protein C eluted at approximately 0.5M NaCl.
  • the second preparation of plasma EPCR was done starting with 4L of plasma to purify enough protein for functional studies.
  • the 1496-AffiGel-10 resin (20 ml of 5 mg IgG/ml resin) was added directly to the citrated plasma, along with final concentrations of 10 mM benzamidine, 1 mM diisopropylfluorophosphate, and 0.5 units/ml sodium heparin.
  • the plasma was batch-adsorbed overnight at 4° C. with gentle mixing. After the resin settled, the supernatant was processed for protein C purification (Esmon, et al. 1993).
  • the resin was packed into a 2.5 ⁇ 30 cm column, washed extensively with 20 mM Tris-HCl, 0.1M NaCl, 0.02% sodium azide, pH 74 and eluted with 50% ethylene glycol in 20 mM Tris-HC1, pH 7.4.
  • the eluate was pooled and concentrated (5.5 total OD 280 ), applied to a Mono Q column and the two ionic species (breakthrough and 0.2M NaCl eluate peak) were re-applied to the 1496-AffiGel-10 resin (1.5 ⁇ 11 cm).
  • the column was eluted with 50% ethylene glycol as before.
  • the eluate (0.71 ODs) was concentrated and the buffer exchanged to 20 mM Tris-HCl, 0.1M NaCl, 3 mM CaCl 2 , 0.6 mM MgCl 2 , 0.02% sodium azide with a Centriprep 30. This material was then applied to an affinity column in which protein C (2.9 mg) had been initially applied in the same buffer to an HPC2-AffiGel-10 column (0.6 ⁇ 17 cm).
  • the HPC2 mAb binds to the protein C serine protease domain and does not interfere with EPCR binding (Fukudome, et al. 1996).
  • the bound EPCR was eluted with buffer containing 5 mM EDTA.
  • Contaminating serum amyloid P was removed by ion-exchange chromatography on the FPLC Mono Q column.
  • the sample was applied in 0.2M NaCl, so that the plasma EPCR did not bind, and was separated from the contaminants which eluted at 0.4-0.5M NaCl.
  • the resultant purified plasma EPCR (0.193 OD 280 ) appeared homogenous by SDS-PAGE with silver staining and by Western blotting with polyclonal anti-rsEPCR. This material was used for the functional studies and amino-terminal sequence analysis.
  • Plasma and serum samples from three healthy volunteers were diluted (4% v/v), run on 10% SDS-PAGE gels under non-reducing conditions, and processed for Western blotting using a goat polyclonal antibody raised against rsEPCR.
  • Plasma and serum samples (4% v/v) from healthy volunteers were processed for SDS-PAGE on 10% gels under non-reducing conditions, transferred to membranes and the membranes probed with goat anti-rsEPCR polyclonal antibody. Results were compared to rsEPCR (0.2 ng). Bound antibody was detected with mouse anti-goat IgG and an enhanced chemiluminescence detection system.
  • Plasma samples from two healthy volunteers were immunoadsorbed with 1495 AffiGel-10 resin. The washed resin was eluted and processed for SDS-PAGE under reducing conditions. Western blotting was done using biotin-goat anti-rsEPCR as a probe.
  • Plasma EPCR purity was determined from silver stained SDS-PAGE 10% gels and western blots of membranes probed with biotin-goat anti-rsEPCR (reduced and non-reduced). A single band of approximately 43,000 Da appears in both the serum and plasma samples after the membrane is probed with the polyclonal antibody. The size of the protein detected appears slightly larger than the rsEPCR. The other bands detected were background binding of IgG as judged by probing with preimmune IgG and longer exposure times.
  • Soluble EPCR was purified from human plasma by a combination of ion-exchange chromatography, precipitation with ammonium sulfate, and immunoadsorption by anti-EPCR 1496 mAb-AffiGel-10 column chromatography as described in Experimental Procedures.
  • This plasma EPCR (approximately 110 ⁇ g) was applied to a protein C affinity column prepared by applying protein C (3 mg) to an anti-protein C HPC4 mAb-AffiGel-10 column in buffer containing 3 mM CaCl 2 , 0.6 mM MgCl 2 The column was washed and plasma EPCR was applied at fraction 19. The column was washed and eluted with buffer containing 5 mM EDTA starting at fraction 35. Absorbance at 280 nm and EPCR antigen was determined for the fractions. EPCR antigen was determined by ELISA.
  • EPCR was purified from 4L of plasma using a similar, but slightly modified procedure. After elution from a protein C-antibody affinity column, residual contaminating proteins were removed by ion-exchange chromatography on an FPLC Mono Q column. The resultant preparation of plasma EPCR appeared homogenous on SDS-PAGE 10% gels with silver staining and identical results were obtained with western blots probed with biotin-goat anti-rsEPCR polyclonal antibody under both reducing and non-reducing conditions.
  • Amino-terminal sequence analysis of the purified protein yielded only one sequence, S-Q-D-A-S-D, which is identical to the amino-terminal sequence of recombinant soluble EPCR (Sequence ID No. 2). This is the first amino-terminal sequence determination of EPCR from a natural source.
  • Undiluted pediatric urine samples were compared to a 4% normal plasma and recombinant soluble EPCR (1 ng). The samples were incubated with biotin-goat-anti-rsEPCR and a streptavidin-alkaline phosphatase detection system.
  • the western blot indicates that a) soluble EPCR is present in urine, and b) the soluble EPCR antigen is present at a size similar to that observed in plasma. Obvious degradation is not observed.
  • the amount of soluble EPCR in the four samples as quantified by ELISA was 40.3, 6.1, 35.6, and 90.1 ng/ml.
  • Normal human plasma EPCR concentration are about 100 ng/ml (98.4 ⁇ 27.8 ng/ml; 2.5 nM), as discussed above.
  • Sepsis (accp/sccm consensus conference, chest 1992; 101:1644-1655) is defined as the systemic inflammatory response to infection, including, but not limited to, more than one of the following clinical manifestations:
  • body temperature greater than 38° C. or less than 36°C.
  • hyperventilation as from PaCO 2 of less than 32 mm Hg;
  • WBC count greater than 12,000/mm 3 or less than 4,000/mm 3 , or presence of more than 10% immature neutrophils (bands).
  • Samples were obtained from patients with post-surgical complications with or without severe sepsis, as defined by sepsis associated with organ dysfunction, hypoperfusion or hypotension. Perfusion abnormalities may include lactic acidosis, oliguria, or acute alterations in mental status. Septic shock refers to sepsis with hypotension requiring vasoactive drugs for more than 24 hours in spite of adequate fluid resuscitation and the absence of cardiogenic shock.
  • Plasma soluble EPCR and soluble thrombomodulin (TM) were assayed only on time 0 samples.
  • soluble plasma EPCR inhibits both protein C activation and activated protein C anticoagulant activity indicates that the elevated plasma EPCR levels in these patients poses an additional thrombotic risk and marks evidence of vascular injury/responsiveness. Examples of conditions these are indicative of include disorders associated with endothelial cell stimulation, atherogenesis, leukocyte adhesion and plaque rupture.
  • RT-PCR reverse transcriptase-PCR
  • RNA is isolated from homogenized tissue.
  • the RNA is mixed with a specific antisense primer, nucleotides and the reverse transcriptase enzyme.
  • the RNA serves as a template for the reverse transcriptase to create a first strand cDNA.
  • This new cDNA template is then amplified by conventional PCR using specific primers and Taq polymerase. Primers that would amplify both the membrane form of EPCR (424 bp) and the predicted alternatively spliced product (674 bp) were chosen. Products corresponding to both forms of EPCR were amplified from a variety of baboon tissues (FIG. 4) and human lung and placenta. Possible contamination with genomic DNA was unlikely as judged by controls without reverse transcriptase and the lack of a 1,885 bp band in the reactions with the tissues.
  • the intron sequence from baboon kidney genomic DNA was amplified by conventional PCR. The assumption was made that the genomic structure was retained between the species and primers were used (human sequence) that flank intron III. This is the intron (human sequence) believed to contain the alternatively spliced sequence.
  • Baboon kidney tissue was homogenized and the DNA extracted. The DNA was mixed with the specific primers and a product amplified by PCR. The DNA product was purified and electrophoresed on an agarose gel.
  • EPCR ELISA The coating antibody is 1494 mAb that binds to the ligand binding domain of EPCR.
  • the detecting antibody is biotinylated 1495 mAb, which does not block protein C/APC binding, and does not cross-react with 1494 mAb.
  • the detection system is streptavidin-alkaline phosphatase and BluePhos substrate (from KPL).
  • RNA (1-5 ⁇ g) was mixed with nucleotides, the CREA antisense primer, and reverse transcriptase in the appropriate buffer according to the manufacturer's directions (SuperscriptTM Preamplification system for first strand cDNA synthesis, Gibco BRL). The cDNA product was amplified by conventional PCR using the CRES and CREA primers for 30 cycles.
  • the cDNA products were purified by chloroform extraction and alcohol precipitation, solubilized in water and electrophoresed in a 2% agarose gel using standard procedures. Gels were stained with Vistra Green (Amersham) and imaged on a phosphoimager (StormTM scanner, Molecular Dynamics, Inc.).
  • PCR of baboon genomic DNA Baboon kidney DNA (82 mg) was homogenized in Trizol reagent. The lower phase containing DNA was extracted, precipitated and solubilized in sterile water. The DNA was amplified by conventional PCR in a mix with buffer, nucleotides, and the HRT-1 and HRT-2 primers for 30 cycles. The amplified DNA was extracted, precipitated, solubilized in sterile water and electrophoresed on a 2% agarose gel using standard procedures. The single band (465 bp) was visualized with ethidium bromide, cut out and the PCR product purified on a spin column according to the manufacturer's directions (Qiagen). The PCR product was sequenced using the same primers.
  • HRT-1 5'-AGCAGCTCAATGCCTACAACCG-3' (5' sense primer near end of exon III)
  • HRT-2 5'-CCGTAGAAGGACACGTGTCCACCTGCCGC-3' (3' antisense primer within exon IV)
  • the working model is that plasma levels of proteolyzed soluble EPCR will report endothelial injury, whereas levels of alternatively spliced soluble EPCR will report an endothelial response to stimuli. It is anticipated that the relative plasma levels of the soluble EPCR isoforms will provide information on large vessel endothelial dysfunction and injury in specific pathologies.
  • RT-PCR products from human tissues placenta, lung, and tongue, were electrophoresed using the CRES/CREA primers specific for EPCR. The procedures were the same as used for the baboon tissues. Products corresponding to the membrane isoform of EPCR (mEPCR) and the alternatively-spliced soluble EPCR isoform (sEPCR) were observed. The products look essentially the same as that seen using the baboon tissues. The only difference is that the placental tissue appears to have additional products.
  • mEPCR membrane isoform of EPCR
  • sEPCR alternatively-spliced soluble EPCR isoform

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Rehabilitation Therapy (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Rheumatology (AREA)
  • Zoology (AREA)
  • Peptides Or Proteins (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Plasma EPCR has been isolated, characterized and shown to block cellular protein C activation and APC anticoagulant activity. Plasma EPCR appears to be about 43,000 daltons and circulates at approximately 100 ng/ml (98.4+/-27.8 ng/ml, n=22). Plasma EPCR bound activated protein C with an affinity similar to that of recombinant soluble EPCR (Kdapp approximately 30 nM), and inhibits both protein C activation on an endothelial cell line and APC anticoagulant activity in a one-stage factor Xa clotting assay. Soluble plasma EPCR appears to attenuate the membrane-bound EPCR augmentation of protein C activation and the anticoagulant function of activated protein C. Soluble EPCR has also been detected in urine. Levels of soluble EPCR can rise in inflammatory disease associated with vascular injury and appear to be correlated with inflammation and disease states associated with abnormal coagulation. Since EPCR expression is restricted to larger vessels and is usually negative in cappillaries, these observations provide a mechanism for analyzing injury/stimulation of large vessel endothelial cells.

Description

The United States government has certain rights in this invention by virtue of national Institutes of Health grant PO1HL 54804 to Charles T. Esmon.
BACKGROUND OF THE INVENTION
The present invention is generally in the area of assays involving detection and/or measurement of endothelial cell protein C/activated protein C receptor or soluble forms thereof derived either by proteolysis or by alternative splicing.
The activation of protein C to its active serine protease, activated protein C (APC), initiates a series of events that play a key role in the regulation of blood coagulation. The clinical importance of the protein C pathway is evidenced by the multitude of dysfunctions in this pathway that result in thrombosis (Esmon and Schwarz. 1995. Trends Cardiovasc. Med. 5:141-148; Reitsma, et al. 1995. Thromb. Haemost. 73:876-879). Patients deficient in protein C usually exhibit life threatening thrombotic-complications in infancy (Seligsohn et al., 1984. N. Engi. J. Med. 310, 559-562; Esmon, 1992. Trends Cardiovasc. Med. 2, 214-220) that are corrected by protein C administration (Dreyfus et al., 1991. N. Engl. J. Med. 325, 1565-1568).
Protein C and APC have also been implicated in the regulation of the host response to inflammation. Activated protein C (APC) can prevent the lethal effects of E. coli in baboon models of gram negative sepsis (Taylor et al., 1987. J. Clin. Invest. 79; U.S. Pat. No. 5,009,889 to Taylor and Esmon) and preliminary clinical results suggest that protein C is effective in treating certain forms of human septic shock (Gerson et al., 1993. Pediatrics 91, 418-422). Inhibition of protein S, an important component of the protein C pathway, exacerbates the response of primates to sublethal levels of E. coli and augments the appearance of TNF in the circulation (Taylor et al., 1991. Blood 78, 357-363). These results suggest that protein C may both control coagulation and influence inflammation.
Protein C is activated when thrombin, the terminal enzyme of the coagulation system, binds to an endothelial cell surface protein, thrombomodulin (Esmon, 1989. J. Biol. Chem. 264, 4743-4746; Dittman and Majerus, 1990. Blood 75, 329-336; Dittman, 1991. Trends Cardiovasc. Med. 1, 331-336). In cell culture, thrombomodulin transcription is blocked by exposure of endothelial cells to tumor necrosis factor (TNF) (Conway and Rosenberg, 1988. Mol. Cell. Biol. 8, 5588-5592) and thrombomodulin activity and antigen are subsequently internalized and degraded (Lentz et al., 1991. Blood 77, 543-550, Moore, et.al., 1989. Blood 73, 159-165). C4bBP, a regulatory protein of the complement system, binds protein S to form a complex that is functionally inactive in supporting APC anticoagulant activity in vitro (Dahlback, 1986. J. Biol. Chem. 261, 12022-12027) and in vivo (Taylor,et al., 1991). C4bBP behaves as an acute phase reactant (Dahlback, 1991. Thromb. Haemostas. 66, 49-61). Thus, proteins of this pathway not only appear to regulate inflammation, but they also interact with components that regulate inflammation, and they themselves are subject to down regulation by inflammatory mediators.
Endothelial cells play a critical role in the protein C pathway in that they express two of the known receptors responsible for efficient protein C activation, thrombomodulin and the endothelial protein C/APC receptor (EPCR) (Fukudome and Esmon. 1994. J. Biol. Chem. 269:26486-26491; Stearns-Kurosawa, et al. 1996. Proc. Natl. Acad. Sci. (USA) 93:10212-10216). Thrombomodulin (CD141) is a transmembrane cofactor that binds circulating thrombin with high affinity and the resultant enzyme-cofactor complex is required for physiologically relevant protein C activation rates (Esmon and Owen. 1981. Proc. Natl. Acad. Sci. (USA) 78:2249-2252; Dittman, W. A. 1991. Trends Cardiovasc. Med. 1:331-336).
EPCR is a recently identified receptor with significant homology to the CD1/MHC class 1 family (Fukudome and Esmon, 1994; Fukudome, et al. 1996. J. Biol. Chem. 271:17491-17498; Regan, et al. 1996. J. Biol. Chem. 271:17499-17503). The cloning and biological role of the endothelial cell receptor for protein C was described in PCT/US95/09636 by Oklahoma Medical Research Foundation, entitled "Cloning and Regulation of an Endothelial Cell Protein C/Activated Protein C Receptor". The protein was predicted to consist of 238 amino acids, which includes a 15 amino acid signal sequence at the N-terminus, and a 23 amino acid transmembrane region which characterizes the receptor as a type 1 transmembrane protein.
EPCR binds both protein C and APC with similar affinity (Kdapp ˜30 nM) (Fukudome, et al., 1996) in the presence of calcium and facilitates protein C activation by presenting the protein C substrate to the thrombin-thrombomodulin activation complex on cell surfaces (Stearns-Kurosawa, et al., 1996). Both endothelial cell receptors are type 1 transmembrane proteins in which the ligand binds to an extracellular domain and both have a short intracellular cytoplasmic tail (Fukudome, et al. 1996; Jackman, et al. 1987. Proc. Natl. Acad. Sci. (USA) 84:6425-6429; Wen, et al., 1987. Biochemistry 26:4350-4357; Suzuki, et al. 1987. EMBO J. 6:1891-1897). In addition, their in vitro cell surface expression is down-regulated similarly by tumor necrosis factor-α (Fukudome and Esmon 1994). However, the characteristics of soluble forms of thrombomodulin and EPCR differ in several respects. Recombinant soluble thrombomodulin has reduced cofactor activity relative to the membrane form (Galvin, et al. 1987. J. Biol. Chem. 262:2199-2205; Parkinson, et al. 1990. J. Biol. Chem. 265:12602-12610). With both purified components and with cells, the changes in thrombin's substrate specifically induced by thrombomodulin result from competition for a shared binding domain on thrombin as well as conformational alterations in the active site pocket (Ye, et al. 1991. J. Biol. Chem. 266:23016-23021; Lu, et al. 1989. J. Biol. Chem. 264:12956-12962; Ye, et al. 1992. J. Biol. Chem. 267:11023-11028; Hofsteenge, et al. 1986. Biochem. J. 237:243-251; Mathews, 1994. Biochemistry 33:13547-13552; Esmon, et al. 1982. J. Biol. Chem. 257:7944-7947; Sadler, et al. 1993. Haemostasis 23:183-193). Soluble thrombomodulin also accelerates inactivation of thrombin by a variety of inhibitors (Bourin and Lindahl. 1993. Biochem. J. 289:313-330; Rezaie, 1995. J. Biol. Chem. 270:25336-25339). Both plasma and urine contain detectable thrombomodulin (Takano, et al. 1990. Blood. 76:2024-2029; Ishii and Majerus. 1985. J. Clin. Invest. 76:2178-2181) and because the thrombomodulin gene does not contain introns (Jackman, et al., 1987), these soluble forms are due to proteolysis of the extracellular domain at the cell surface.
Soluble degradation products of thrombomodulin in plasma are a known marker of endothelial cell damage in a variety of disease states (Takano, et al., 1990; Tanaka, et al. 1991. Clin. Chem. 37:269-272; Takahashi, et al. 1991. Am. J. Hematol. 38:174-177; Asakura, et al. 1991. Am. J. Hematol. 38:281-287; Wada, et al. 1992. Am. J. Hematol. 39:20-24; Takahashi, et al. 1992. Am. J. Hematol. 41:32-39; Ohdama, et al. 1994. Chest 106:666-671) and are comprised of a mixture of thrombin-binding fragments with varying reduced affinities, as well as non-binding fragments (Takano, et al., 1990).
In contrast, recombinant soluble EPCR (rsEPCR), truncated just before the transmembrane domain, binds both protein C and APC with an affinity similar to that observed for intact cell-surface expressed EPCR (Fukudome, et al. 1996). APC anticoagulant activity is inhibited effectively when bound to rsEPCR (Regan, et al., 1996), presumably because both rsEPCR and factor Va share binding determinants in a groove reminiscent of the anion binding exosite I in thrombin occupied by thrombomodulin (Mather, et al. 1996. EMBO J. 15:6822-6831). However, rsEPCR does not appear to influence proteolysis of small synthetic substrates by APC, nor inactivation of APC by α1-antitrypsin or protein C inhibitor (Regan, et al., 1996). Unlike membrane-bound EPCR which enhances protein C activation (Stearns-Kurosaw, at al., 1996), rsEPCR has little effect on protein C activation by the soluble thrombin-thrombomodulin complex (Regan, et al., 1996), suggesting that any soluble forms of EPCR might inhibit protein C activation by competing with membrane-associated EPCR for protein C.
Immunohistochemistry indicates that EPCR is present primarily on the surface of endothelial cells from large vessels and is absent or present at low levels on most capillary endothelial cells.
It is therefore an object of the present invention to identify therapeutic and diagnostic uses for naturally occurring soluble EPCR.
It is a further object of the present invention to characterize naturally occurring soluble EPCR.
SUMMARY OF THE INVENTION
Plasma EPCR (has been isolated, characterized and shown to block cellular protein C activation and APC anticoagulant activity. Plasma EPCR appears to be about 43,000 daltons and circulates at approximately 100 ng/ml (98.4±27.8 ng/ml, n=22). Plasma EPCR was purified from human citrated plasma using ion-exchange, immunoaffinity, and protein C affinity chromatography. Flow cytometry experiments demonstrated that plasma EPCR bound activated protein C with an affinity similar to that previously determined from recombinant truncated EPCR (Kdapp approximately 30 nM), defined as EPCR not including the transmembrane and cytoplasmic domains. Furthermore, plasma EPCR inhibited both protein C activation on an endothelial cell line and APC anticoagulant activity in a one-stage factor Xa clotting assay. Soluble EPCR has also been detected in human urine. Cloning of the gene encoding EPCR demonstrates that at least human EPCR can be alternatively spliced, yielding a truncated soluble EPCR including an insert unique to the alternatively spliced form (sEPCR). These results indicate that plasma EPCR can be derived either by proteolysis at the cell surface or by alternative splicing.
If the local concentrations of plasma EPCR are sufficiently high, particularly in disease states, the data indicates that the truncated soluble plasma EPCR could attenuate the membrane-bound EPCR augmentation of protein C activation and the anticoagulant function of activated protein C. As demonstrated by the examples comparing normal plasma EPCR with levels of EPCR from patients with an autoimmune disease (systemic lupus erythematosus, SLE) and sepsis (a disorder involving both inflammation and coagulation abnormalities), levels of soluble EPCR appear to be correlated with inflammation and disease states associated with abnormal coagulation. Assays are described based on measurement of soluble EPCR which are indicative of disease conditions involving coagulation, inflammation, and large vessel disease. Assay reagents are described, including isolated purified soluble EPCR, recombinant truncated soluble EPCR, and antibodies to the soluble EPCRs.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic of the two known mechanisms for producing a soluble receptor as applied to EPCR, by proteolysis of the membrane-bound receptor to release an extracellular domain and leave the membrane anchor behind, and by alternative splicing of the mRNA, showing the sequences unique to membrane bound EPCR (mEPCR) and to proteolyzed plasma EPCR (pEPCR), and the sequence unique to soluble EPCR (sEPCR).
FIG. 2 is a schematic comparing mEPCR and sEPCR, showing the nucleotide insert and encoded amino acid sequence unique to sEPCR.
FIG. 3 shows the sequence inserted into human, bovine, murine, and baboon EPCR by alternative splicing.
FIG. 4a is a graph showing that soluble plasma EPCR binds to human protein C and APC. EA.hy926 cells were incubated with 60 nM fl-APC in the presence of 0-500 nM rsEPCR () or plasma EPCR (◯) for 30 minutes on ice. The cells were washed and cell-bound fluorescence was determined by flow cytometry as described. The intrinsic cell fluorescence in the absence of added fl-APC is indicated by the arrow. The mean cell fluorescence (MCF) plotted represents the average of duplicate MCF determinations.
FIGS. 4b and 4c are graphs showing soluble plasma EPCR and rsEPCR inhibit protein C activation on cell surfaces. In FIG. 4b, EA.hy926 cell monolayers were pre-incubated for 15 minutes at room temperature with 0.1 μM protein C alone (□) or with 1 μM rsEPCR (), or 2 μg/ml 1494 mAb (◯). Protein C activation was initiated by the addition of thrombin (2 nM final) and the reactions were stopped at the indicated times. Activated protein C was determined with an amidolytic assay and the activity rates in mOD/min are plotted for each time point. Control wells without added thrombin were included (▪). Each data point represents the average of triplicate well determinations. In FIG. 4c, EA.hy926 cell monolayers were pre-incubated for 15 minutes at room temperature with 0.1 μM protein C and the indicated concentrations of plasma EPCR (◯) or rsEPCR (). Thrombin (final 2 nM) was added and the activation proceeded for 60 minutes at room temperature. The supernatants were added to a mixture of antithrombin and heparin and activated protein C activities (mOD/min) were determined with an amidolytic assay. Each data point represents the average of triplicate well determinations.
FIG. 4d is a graph showing soluble plasma EPCR inhibits APC anticoagulant activity The anticoagulant activity of APC (25 nM) was determined with a one-stage Xa clotting assay in the presence of 460 nM plasma EPCR or rsEPCR. The effect was reversed when either soluble EPCR was pre-incubated for 5 minutes with 42 μg/ml of 1496 mAb which blocks binding of APC to EPCR. The data represent the average of 4-6 determinations±S.D.
FIG. 5 is a graph comparing levels of soluble plasma TM to soluble plasma PCR in lupus patients, demonstrating that there is no correlation between TM and EPCR values, but that the majority of lupus patients exhibit extremely elevated levels of soluble plasma EPCR.
FIG. 6 is a graph of soluble receptor concentration (ng/ml) for sTM (normal), sTM (sepsis), sEPCR (normal), and sEPCR (sepsis). No correlation between sTM and sEPCR, V2 =0.034.
DETAILED DESCRIPTION OF THE INVENTION Definitions
Endothelial Protein C Receptor, EPCR.
Soluble, in solution and not bound to a cell surface.
Truncated, not including the transmembrane and cytoplasmic domains; can be a result of either proteolysis or alternative splicing.
Detection and Characterization of Soluble EPCR; Physiological Role and Utility as a Marker
Previous investigations into the function of EPCR found that protein C binding to the membrane form of EPCR resulted in facilitation of protein C activation by the thrombin-thrombomodulin complex on cell surfaces (Stearns-Kurosawa, et al., 1996), but that soluble recombinant EPCR inhibited APC anticoagulant activity (Regan, et al. 1996). These observations, along with the knowledge that soluble thrombomodulin degradation products in plasma are a marker of endothelial damage in various disease states, led to the question of whether a soluble circulating form(s) of EPCR existed and, if so, what role it may have in the protein C pathway.
The examples demonstrate that a soluble form of EPCR circulates in plasma and is present in urine. In a healthy donor population, the plasma EPCR level was about 100 ng/ml and it appeared to be a single antigen species of approximately 43,000 daltons. Subsequent purification of the soluble EPCR from plasma and functional studies determined that it was capable of binding both protein C and APC with an affinity similar to intact membrane-bound EPCR. The in vitro studies using an endothelial cell line demonstrated that plasma EPCR inhibited protein C activation at near physiological concentrations of protein C and thrombin. In addition, direct addition of purified plasma EPCR to plasma resulted in inhibition of APC anticoagulant activity that was reversed with monoclonal antibodies to rsEPCR.
The identification of the purified plasma protein as being EPCR was based on comparison with the properties of rsEPCR. These proteins both reacted with the same battery of monoclonal and polyclonal antibodies, had the same amino-terminal sequence, bound to immobilized protein C in a Ca2+ -dependent fashion, and blocked protein C activation and APC anticoagulant activity with similar dose response curves. In addition, the affinities of both protein C and APC for rsEPCR and plasma EPCR are similar to the affinity of intact membrane-bound EPCR. These properties appear to be unique to EPCR.
Previous studies demonstrated that membrane-bound EPCR expressed on endothelial cells augments protein C activation by a factor of between three and five fold, whereas the examples demonstrate that the soluble form of EPCR purified from plasma inhibits protein C activation on endothelial cells and APC anticoagulant activity. This predicts that EPCR could modulate the protein C pathway in several ways. First, in the larger vessels where thrombomodulin concentration is low to the microcirculation, EPCR expression is correspondingly increased (Laszik, et al., Circulation 1997). Immunohistochemistry shows that in most organs, EPCR expression is most intense on large vessels and decreases progressively with decreasing vessel size, with little or no expression in the most abundant endothelial cell type, the capillary endothelium. EPCR expression may play a critical role in capturing the protein C substrate from the circulation and presenting it to the thrombin-thrombomodulin complex for activation. This is supported by in vitro observations that both the EA.hy926 endothelial cell line and human umbilical vein endothelial cells have at least six times more surface-expressed EPCR antigen than thrombomodulin. In the microcirculation where thrombomodulin concentration is high and EPCR is low, one would predict little influence on protein C activation. Finally, circulating soluble EPCR may reduce the generation of APC and the ability of APC to inactivate factor Va.
In a healthy individual, the soluble EPCR levels are about 2.5 nM, a concentration well below both the Kdapp (approximately 30 nM) and the 80 nM protein C concentration in the circulation. Both of the effects of soluble plasma EPCR (inhibition of APC anticoagulant activity and protein C activation) required considerably higher concentrations than that present in normal plasma, leaving the question of the physiological role of the plasma EPCR uncertain. Patients with soluble EPCR levels that exceed 40 nM have been identified, as described in Example 3 (lupus). Thus, if the local concentration near the endothelial cell surface exceeds the systemic concentration, the soluble EPCR concentration would reach levels that would attenuate both APC generation and activity, contributing to thrombotic risk.
A soluble form of a receptor can be produced by proteolytic cleavage of the membrane-bound receptor or by alternative splicing mechanisms. Proteolysis at the membrane surface releases soluble thrombomodulin, and receptors for TNF, IL-1, IL-2, M-CSF, PDGF, and NGF (Heaney, et al. 1996. Blood 87:847-857). Soluble receptors have a multitude of potential functions including acting as antagonists of the membrane receptor, stabilizing the ligand, initiating ligand-mediated signaling, downmodulation of the membrane form, and binding to receptor inhibitors to indirectly facilitate receptor-ligand activity. The latter mechanism is used by the IL-1 receptor system in which the soluble isoforms of both IL-1 receptors are generated by proteolytic cleavage and tightly regulate the responsiveness to IL-1α and IL-1β (Arend, et al. 1994. J. Immunol. 153:4766-4774). The EPCR genomic structure contains an alternative splicing site which would code for a soluble protein truncated just before the transmembrane domain (Fukudome and Esmon. 1995. J. Biol. Chem. 270:5571-5577), as discussed below. Soluble IL-6 receptors appear to be generated by both proteolytic and alternative splicing mechanisms (Mullberg, et al. 1994. J. Immunol. 152:4958-4968; Lust, et al. 1992. Cytokine 4:96-100; Horiuchi, et al. 1994. Eur. J. Immunol. 24:1945-1948). This cleavage site can also be useful in recovering large quantities of soluble EPCR, by constructing an expression vector encoding the truncated EPCR immediately followed by a peptide sequence to which an antibody is specifically directed, as described in U.S. Pat. No. 5,298,599 to Morrissey and Esmon, the teachings of which are incorporated herein. The epitope will then be cleaved by proteolysis, before or after administration to a patient. See also U.S. Pat. No.4,782,137 to Hopp et al.
Immunohistochemical studies have indicated that EPCR is located primarily on endothelium of large vessels and is barely detectable in capillaries. Plasma EPCR derived from membrane-bound EPCR, can therefore serve as a marker of large vessel disease processes. Plasma EPCR may serve as a useful comparison with plasma thrombomodulin levels which have been shown to be modulated in a variety of disease states, but which would reflect both large and small vessel disease processes, but probably would be dominated by small vessel contributions since most endothelium is microvascular.
Nucleotide and Predicted Protein Structure Analysis of EPCR
The cDNA for EPCR is predicted to code for a protein of 238 amino acids (Sequence ID No. 2), which includes a 15 amino acid signal sequence (von Heijne, (1986) Nucleic Acids Res. 14, 4683-4690) at the N-terminal. Therefore, the mature protein is predicted to contain 223 amino acids. Direct sequencing of the recombinant protein showed that the mature protein started at Ser18. Sequence ID No. 2 is the predicted amino acid sequence of EPCR. Amino acids 1-15 of Sequence ID No. 2 (MLTTLLPILLLSGWA) are the putative signal sequence determined by the method of von Heijne (von Heijne, 1986). Amino acids 211-236 of Sequence ID No. 2 (LVLGVLVGGFIIAGVAVGIFLCTGGR) are the putative transmembrane domain. Potential N-glycosylation sites are present at amino acids 47-49, 64-66, 136-138, and 172-174 of Sequence ID No. 2. Extracellular cysteine residues are present at amino acids 17 (removed in plasma EPCR), 114, 118, and 186 of Sequence ID No. 2. A potential transmembrane region (Engelman et al., (1986) Annu. Rev. Biophys. Chem. 15, 321-53) consisting of 23 amino acids was identified at the C-terminal end (beginning at amino acid 211 of Sequence ID No. 2).
The protein is a type 1 transmembrane protein. The extracellular domain contains four potential N-glycosylation sites and three Cys residues. Glycosylation is not essential for activity, as shown by N-glycanase digestion. The cytoplasmic region contains only three amino acids and terminates with a Cys, which is palmitoylated. If the terminal cysteine is not properly palmitoylated, the protein may be secreted. Altering the sequence of the EPCR to replace this cysteine with another amino acid thereby provides a means for making an essentially full length EPCR which is secreted instead of being membrane bound.
As used herein, the nucleotide sequences encoding the receptor include the sequence shown in Sequence ID No. 1, and sequences having conservative substitutions, additions or deletions thereof which hybridize to Sequence ID No. 1 under stringent conditions. As used herein, the amino acids sequences constituting the receptor include the sequence shown in Sequence ID No. 2, and sequences having conservative substitutions, additions or deletions thereof which form a receptor having functionally equivalent biological activity. It is well known to those skilled in the art what constitutes conservative substitutions, additions or deletions, and which could be readily ascertained as encoding, or forming, a functionally equivalent receptor molecule using the functional assays described herein. This is further illustrated by reference to FIG. 3, discussed below.
Alternative Splicing
Receptors are most often visualized as being proteins anchored in a cell membrane with the portion exposed to the outside of a cell responsible for binding a specific ligand to generate a physiological response. In many cases, a soluble form of the receptor exists that frequently is quite capable of binding its ligand, despite the fact that it is no longer restricted to a cell. Ligand binding to the soluble receptor isoform can also generate a response which takes many forms, including up- or down-modulation of the membrane-bound receptor interactions, or propagating a response by transporting the ligand to a cell that normally is not responsive (Heaney, ML and DW Golde. Soluble cytokine receptors. Blood 87:847-857, 1996).
There are two known mechanisms for producing a soluble receptor: by proteolysis of the membrane-bound receptor to release an extracellular domain and leave the membrane anchor behind, and by alternative splicing of the mRNA (FIG. 1). The latter mechanism can take many forms, but the simplest is when the reading frame continues through an exon-intron boundary and terminates with a stop codon before reaching the sequence coding for the transmembrance anchor. This creates a protein that is similar to the membrane form, but with important differences. It is made, and secreted, as a soluble protein and will have a unique carboxyl-terminal tail. This tail was formed by reading a portion of the intron mRNA sequence that is ignored in the formation of the membrane-bound receptor. Generation of a soluble receptor by alternative splicing can also be modulated independently from the membrane-bound receptor, despite the fact that they both originate from the same mRNA template (Heaney, et al. Proc. Natl. Acad. Sci. U.S.A. 92:2365-2369, 1995).
To demonstrate that a soluble receptor is generated by alternative splicing mechanisms, one must know the genomic sequence and intron-exon boundaries of the relevant region. It is also helpful to link the soluble receptor with a physiological response to distinguish it from aberrant mRNA splicing, found fairly frequently including during expression of the protein C and protein S genes (Berg, et al. Blood Coag Fibrinol. 7:625-631, 1996).
Details of the following studies and results are described in the examples. Human plasma contains about 100 ng/ml of soluble EPCR (Table 1). This was measured by an enzyme linked immunoassay (ELISA) using two monoclonal antibodies (1494 mAb and 1495 mAb) and standard techniques. Significantly elevated soluble EPCR levels were found in patients with systemic lupus erythematosus and sepsis. These levels seemed fairly high for a membrane-bound receptor that is present, with few exceptions, only on the surface of the large blood vessels. To put this in perspective, thrombomodulin (TM) is expressed on all endothelium, as well as some non-vascular cells, yet normal soluble TM levels are only about 10-40 ng/ml (Takano, et al., Blood 76:2024-2029, 1990). The soluble TM levels were elevated in the patients with lupus, but not sepsis. Importantly, there was no correlation between the plasma EPCR and TM levels in these patient groups (r2 =0.028 and 0.034, respectively).
              TABLE 1                                                     
______________________________________                                    
Plasma soluble receptor levels                                            
             Plasma EPCR                                                  
                       Plasma TM                                          
             ng/ml     ng/ml                                              
______________________________________                                    
Normal volunteers,                                                        
               133.4 ± 53.4                                            
                           35.5 ± 20.4                                 
n = 20                                                                    
Systemic lupus  262.1 ± 154.5*                                         
                           104.7 ± 77.5*                               
erythematosus, (P = 0.0004)                                               
                           (P = 0.0008)                                   
n = 40                                                                    
Sepsis, n = 24 224.9 ± 74.5*                                           
                           39.9 ± 73.1                                 
               (P = 0.00009)                                              
______________________________________                                    
 *Significant difference between the means relative to normal; unpaired   
 Student's t test.                                                        
The TM genomic structure does not contain introns (Jackman, et al. Proc. Natl. Acad. Sci. (USA) 84:6425-6429, 1987), so the only way to create a soluble TM isoform is by proteolysis of the membrane-bound receptor. Proteolysis of endothelial TM by neutrophil elastase and cathepsin G has been shown in vitro, suggesting that the elevated soluble TM levels found in a variety of disease states result from proteolysis mediated by products of activated inflammatory cells at the endothelial surface (Boehme, et al., Immunology 87:134-140, 1996 and Abe, et al. J. Lab. Clin. Med. 123:874-881, 1994).
The lack of correlation between the plasma EPCR and TM levels and the high plasma EPCR concentration is consistent with the concept that plasma EPCR originates from both proteolytic and alternative splicing mechanisms. The genomic structure of human EPCR contains four exons, separated by introns. Review of this sequence reveals an in-frame reading sequence after the exon III-intron III boundary (at the 5' GT) that includes a TAA stop codon at position 7527. Since this stop codon is upstream of exon IV that codes for the transmembrane domain, the predicted protein would contain a unique 48 residue carboxyl-terminal tail (coded for by the intron sequence) and would not contain a transmembrane anchor.
FIG. 1 is a diagram of two potential ways truncated EPCR can be derived: by proteolysis immediately before the transmembrane domain or by alternative splicing. As shown by FIG. 2, alternative splicing results in inclusion of a peptide sequence in the alternatively spliced truncated EPCR. As shown by FIG. 3, this sequence is highly conserved between species, although slight differences exist, resulting in a new carboxyl-terminal tail of 48 residues for human and bovine EPCR, 51 residues for murine EPCR, and 22 residues for baboon EPCR.
Screening of Patient Samples for Expression of Receptor Proteins.
Patient samples can be screened for the presence of, and amount of, sEPCR or EPCR, using antibodies to either EPCR, the unique insert present in the alternatively spliced insert in EPCR, or antibodies which bind with greater affinity to either EPCR or sEPCR due to conformational differences. Samples can also be screened using other standard techniques to specifically quantitate proteins which are present.
Generation of Antibodies for Diagnostic or Therapeutic Use
Antibodies to EPCR, and in particular, soluble EPCR ("sEPCR"), and recombinant soluble EPCR ("rsEPCR") can be generated which are useful in detection, characterization or isolation of receptor proteins, as well as for modifying receptor protein activity, in most cases, through inhibition of ligand binding. Antibodies are generated by standard techniques, using human or animal purified or recombinant receptor proteins or fragments thereof as the immunogen.
Monoclonal antibodies to EPCR were obtained as described for other proteins by Esmon, et al., 1993. Methods Enzymol. 222:359-385. The antibodies referred to as 1494, 1495, and 1496 mAbs are IgGlK antibodies that bind to recombinant soluble EPCR and to cell surface-expressed EPCR. The 1494 and 1496 mAbs block the binding of protein C and APC to EPCR, and inhibit the ability of cellular EPCR to facilitate protein C activation by the thrombin-thrombomodulin complex. The 1495 mAb does not block ligand binding to EPCR, does not alter cell surface protein C activation, and has a binding epitope distinct from that for 1494 or 1486 mAb. The antibodies can be labelled using standard techniques, such as radiolabelling, enzyme labelling, fluorescent labels such as fluorescein, gold particles, dyes, and other means for detection of the antibodies. For example, antibody can be biotinylated with biotinamidocaproate N-hydroxysuccinimide ester using standard procedures. Antibody can be immobilized to a solid support for use in immunoassays, for example, AffiGel-10™, nitrocellulose, or microtiter wells, or use in solution phase immunoassays.
In a preferred embodiment, EPCR is measured using microtiter plates (Maxisorp™, NUNC NS, Roskilde, Denmark) coated with 50 microliters of 4 micrograms/ml 1495 mAb in 15 mM Na2 CO3, 35 mM NaHCO3, pH 9.6, at 4° C. overnight. At room temperature, the plates are then washed three times with 20 mM Tris-HCl, 0.1M NaCl, 0.05% Tween 20, pH 7.5 (assay buffer), and blocked with assay buffer containing 0.1% (wt/vol) gelatin for at least one hour. The wells are then washed, 50 microliter samples added in triplicate wells, and the plates incubated for one hour. The wells are aspirated, washed three times with assay buffer, and 50 microliters of 2 micrograms/ml biotin-1494 mAb added. The plates are incubated for 1 hour, washed three times, and 50 microliters of 0.25 micrograms/ml streptavidin-alkaline phosphatase conjugate (GIBCO BRL) added and incubated for an additional hour. The wells are washed five times, and the substrate and amplifier reagents from an ELISA amplification kit (GIBCO BRL) added sequentially at 15-min intervals according to the manufacturer's directions. The color development is stopped with 0.3M H2 SO4, and the endpoint absorbance read at 490 nm on a Vmax microplate reader. Standards in triplicate wells are from 1.5 to 100 ng rsEPCR/ml in 20 mM Tris-HCl, 0.1M NaCl, and 1 mM EDTA, 0.1% gelatin, pH 7.5. The standard curve is linear from 1.5 to 12.5 ng/ml, and samples are diluted with the same buffer to fall within the linear range. Studies show that between one and two percent plasma does not affect the linearity of the assay or the sensitivity of the standard curve. Plasma samples from healthy volunteers were diluted with assay buffer containing 1 mM EDTA to a final 2% plasma, and EPCR antigen levels are calculated from the average of triplicate wells by reference to standard curve determined on the same plate.
Disorders
The assay for soluble EPCR is useful in detection and analysis of coagulation and inflammatory states and disorders as discussed herein, such as autoimmune diseases like lupus, in transplant monitoring, sepsis, shock, pre-eclampsia, diabetes, cardiopulmonary bypass, unstable angina, restenosis, angioplasty (i.e., vascular disease), kidney or liver disease. For example, the EPCR is a marker for large blood vessels, and therefore for damage to large blood vessels. An increase in the amount of soluble EPCR is indicative of large vessel injury, resulting either in proteolysis of EPCR or stimulation of sEPCR synthesis. The ratio of EPCR to thrombomodulin can also be determined, based on either blood or urine samples, which is indicative of the relative extent of microvascular versus large vessel. The relative amounts of EPCR to cytokines, leukocyte activation markers and complement factors or activation markers can also be used to indicate disease state.
Since EPCR is present on endothelial cells, it is useful as a marker of endothelial cell damage. It can be used as an indicator of drug effect, both toxicity as well as efficacy. For example, in lupus patients, drugs effectively minimizing inflammatory/coagulation mediated, large vessel injury would result in decreasing EPCR levels.
The present invention will be further understood by reference to the following non-limiting examples.
EXAMPLE 1 Identification of Functional Endothelial Protein C Receptor in Human Plasma
The following abbreviations are used: rsEPCR, recombinant soluble EPCR with the HPC4 epitope inserted in place of the transmembrane domain and cytosolic tail; mAb, monoclonal antibody; SDS-PAGE, sodium dodecylsulfate polyacrylamide gel electrophoresis.
METHODS
Materials. The following reagents were purchased from the indicated vendors: Porcine intestinal mucosal heparin, diisopropyl fluorophosphate, biotinamidocaproateN-hydroxysuccinimide ester, bovine serum albumin, Sigma (St. Louis, Mo.); Spectrozyme PCa, American Diagnostica (Greenwich, Conn.); ELISA amplification kit, GibcoBRL (Gaithersburg, Md.); AffiGel-10, BioRad (Hercules, Calif.); Hank's balanced salt solution, 3-(N-morpholine)propane sulfonic acid (MOPS), Fisher Scientific (Fair Lawn, N.J.). All other reagents were of the highest quality commercial available.
Proteins. Human protein C (Esmon, et al. 1993. Methods Enzymol. 222:359-385), bovine thrombin (Owen, et al. 1974. J. Biol. Chem. 249:594-605), and bovine antithrombin (Esmon 1977. "Factors regulating the inhibition of thrombin by antithrombin III. In Chemistry and Biology of Thrombin". R. L. Lundblad, J. W. Fenton, II, and K. G. Mann, editors. Ann Arbor Science, Ann Arbor. 403-411) were purified as described. Recombinant soluble EPCR, rsEPCR, consists of the extracellular domain of EPCR truncated at residue 210 just before the transmembrane domain, followed by a 12 residue sequence that permits calcium-dependent immunoaffinity purification on the HPC4 monoclonal antibody (Takahashi, et al. 1992; Stearns, et al. 1988. J. Biol. Chem. 263:826-832). The construction, purification, and protein C/APC binding characteristics of rsEPCR (Fukudome, et al. 1996). Goat preimmune serum and polyclonal antiserum to rsEPCR was prepared and the IgG purified (Fukudome, et al. 1996). Goat anti-rsEPCR polyclonal antibody was biotinylated with biotinamidocaproate N-hydroxysuccinimide ester using standard procedures.
Monoclonal antibodies. Monoclonal antibodies (mAb) against rsEPCR were obtained as described for other proteins (Esmon, et al. 1993). The 1494, 1495, and 1496 mAb are IgG1k antibodies that bind to rsEPCR and to cell surface-expressed EPCR. The 1494 and 1496 mAb block the binding of protein C and APC to EPCR and inhibit the ability of cellular EPCR to facilitate protein C activation by the thrombin-thrombomodulin complex (Stearns-Kurosawa, et al. 1996). The 1495 mAb does not block ligand binding to EPCR, does not alter cell surface protein C activation and has a binding epitope distinct from that for 1494 or 1496 mAb. The 1494 and 1495 mAbs were biotinylated with biotinamidocaproate N-hydroxysuccinimide ester using standard procedures. The 1494 mAb was coupled to AffiGel-10, according to the manufacturer's directions, for immunoaffinity purification of plasma EPCR. The screening of anti-EPCR mAb was done using methods described by Stearns-Kurosawa, et al. (1996); Fukudome, et al. (1996).
Clotting Assay. The effect of rsEPCR or purified plasma EPCR on APC (25 nM) anticoagulant activity in a one-stage factor Xa clotting assay was performed (Regan, et al. 1996) in the presence or absence of 83 μg/ml 1496 mAb, an antibody that blocks APC-EPCR interaction (Stearns-Kurosawa, et al. 1996). The soluble EPCRs and 1496 mAb were pre-incubated for 15 minutes before assay.
Cell Culture. All human cell lines were maintained as described previously (Fukudome, et al. 1996). EA.hy926 cells, a transformed human endothelial cell line (Edgell, et al. 1983. Proc. Natl. Acad. Sci. (USA) 80:3734-3737), were kindly provided by Cora-Jean Edgell (University of North Carolina at Chapel Hill).
Flow Cytometric Analysis. To serve as a fluorescent probe, APC was labeled with fluorescein in the active site (fl-APC) as described (Fukudome and Esmon, 1994; Bock, P. E. 1988. Biochemistry 27:6633-6639). The effect of rsEPCR or plasma EPCR on APC binding to EA.hy926 cells was studied by flow cytometry (Fukudome, et al. 1996). Briefly, harvested cells were incubated for 30 min on ice with 60 nM fl-APC in the absence or presence of increasing concentrations of either soluble EPCR preparation, washed, and cell-bound fluorescence was determined by flow cytometry with 10,000 events counted per sample. All assays were done in Hank's balanced salt solution supplemented with 1% bovine serum albumin, 3 mM CaCl2, 0.6 mM MgCl2, and 0.02% sodium azide.
Cell surface protein C activation. EA.hy926 cells were cultured in 96-well tissue culture dishes (Stearns-Kurosawa, et al. 1996). The confluent monolayers were washed three times with Hank's balanced salt solution supplemented with 1% (w/v) bovine serum albumin, 3 mM CaCl2, 0.6 mM MgCl2, and 0.02% sodium azide. All assays were done at room temperature in the same buffer in 60 μl final volume, and all protein concentrations represent the final concentration in the assay. Protein C was added (0.1 μM) in the absence or presence of rsEPCR, plasma EPCR, or 1494 mAb at the indicated concentrations and pre-incubated with the cells for 15 minutes. Thrombin was added to the mixtures (2 nM) to start the activation reactions. At the indicated time, 50 μl aliquots were removed and added to 10 μl of antithrombin (0.7 μM final) and heparin (5 U/ml final) in a 96-well microtiter plate. APC amidolytic activity was determined by addition of Spectrozyme PCa substrate (0.2 mM) and the rate of change in absorbance at 405 nm (mOD/min) was measured on a Vmax kinetic microplate reader (Molecular Devices, Menlo Park, Calif.). All assay points were done in triplicate wells and less than 10% of the protein C substrate was activated as determined by reference to a standard curve of fully activated protein C versus mOD/min.
Plasma and Serum Collection. Whole blood was collected from normal adult volunteers (12 females and 10 males) by venipuncture into 3.8% buffered citrate solution or into tubes without anticoagulant (Vacutainer tubes; Becton Dickinson, Franklin Lakes, N.J.). No screening of donors was attempted with respect to age, diet or other variables. All volunteers were informed of the study and gave their written consent. The blood was centrifuged at 1160×g for 10 min. The plasma and serum were aliquoted and stored frozen at -80° C. until assay.
ELISA for quantitation of plasma EPCR. An enzyme-linked immunosorbent assay for detection of EPCR antigen in plasma was developed. Microtitre plates (Maxisorp; Nunc, Roskilde, Denmark) were coated with 50 μl of 4 μg/ml 1495 mAb in 15 mM Na2 CO3, 35 mM NaHCO3, pH 9.6 at 4° C. overnight. The following steps were done at room temperature. The wells were washed three times with 20 mM Tris-HCl, 0.1M NaCl, 0.05% Tween 20, pH 7.5 (assay buffer) and blocked with assay buffer containing 0.1% (w/v) gelatin for at least one hour. The wells were washed, 50 μl samples were added in triplicate wells, and the plates were incubated for one hour. The wells were aspirated, washed three times with assay buffer and 50 μl of 2 μg/ml biotin-1494 mAb was added. The plates were incubated for one hour, washed three times and 50 μl of 0.25 μg/ml streptavidin-alkaline phosphatase conjugate (GibcoBRL) was added and incubated for an additional one hour. The wells were washed five times and the substrate and amplifier reagents from an ELISA amplification kit (GibcoBRL) were added sequentially at 15 minute intervals according to the manufacturer's directions. The color development was stopped with 0.3M H2 SO4 and the endpoint absorbance at 490 nm was read on a Vmax microplate reader. Each plate contained standards in triplicate wells from 1.5-100 ng/ml rsEPCR in 20 mM Tris-HCl, 0.1M NaCl, 1 mM EDTA, 0.1% gelatin, pH 7.5. The standard curve was linear (r=0.99) from 1.5-12.5 ng/ml and plasma samples were diluted with the same buffer to fall within the linear range. Preliminary experiments determined that a final concentration of 1-2% human plasma did not affect the linearity or sensitivity of the standard curve. Plasma samples from healthy volunteers were diluted with assay buffer containing 1 mM EDTA to a final 2% plasma and EPCR L, antigen levels were calculated from the average of triplicate wells by reference to a standard curve determined on the same plate.
An alternative assay was developed in which the coating and detecting antibodies were reversed (1494 mAb coating; biotin-1495 mAb detecting) and antibody binding was detected with the Blue Phos substrate (KPL Laboratories; Gaithersburg, Md.). this method was used to assay plasma EPCR in the sepsis patients. This assay was more sensitive, probably because of affinity differences, but both assays gave qualitatively similar results.
Western Blot. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of plasma or serum samples was done with 10% acrylamide gels with the Laemmli buffer system (Nature 227:680-685) under non-reducing conditions using standard procedures. Gels were transferred to polyvinylidine membranes (PVDF; Millipore, Bedford, Mass.), the membranes blocked, and then incubated for 30 minutes with either pre-immune goat IgG (50 μg/ml) or a goat anti-rsEPCR polyclonal IgG (50 μg/ml). After washing, membranes were incubated with mouse anti-goat IgG-horseradish peroxidase conjugate (Pierce, Rockford, Ill.) at a 1:20,000 dilution for 30 minutes. Membranes were washed and bound antibody-enzyme conjugate was detected with an enhanced chemiluminescent substrate (Pierce) according to the manufacturer's instructions.
Immunoadsorption. Serum or citrated plasma samples (400 μl) from healthy volunteers were incubated with 50 μl of 1495 mAb conjugated to AffiGel-10 (5 mg IgG/ml resin) overnight at 4° C. with mixing. The samples were centrifuged, the supernatant was removed, and the resin was washed three times with 1 ml of 20 mM Tris-HCl, 0.1M NaCl, 0.02% sodium azide, pH 7.5. SDS-PAGE sample buffer containing a final 20 mM dithiothreitol was added to the washed resin, the samples were boiled for three minutes, and processed for SDS-PAGE and Western blotting. Membranes were probed with biotinylated-goat anti-rsEPCR polyclonal antibody at 4 μg/ml and bound antibody was detected with a streptavidin-horseradish peroxidase conjugate (Pierce) and enhanced chemiluminescent detection system. Preliminary experiments determined that pre-adsorption of samples with 100 μl of Tris-inactivated AffiGel-10 resin for 1-4 hours at room temperature, followed by overnight immunoadsorption with the 1495 mAb-AffiGel-10 gave identical Western blotting results.
Purification of plasma EPCR. Plasma EPCR as purified from human citrated plasma (Oklahoma Blood Institute) using a combination of ion-exchange chromatography, anti-rsEPCR mAb immunoaffinity chromatography, and chromatography on protein C affinity columns. Two preparations were done in slightly different ways.
In the first preparation, plasma (1L) was diluted with an equal volume of 20 mM Tris-HCl, pH 7.5, 10 mM benzamidine, 400 units sodium heparin and batch-adsorbed for 1 hour with 1 g pre-swollen QAE resin. After settling, the resin was processed for purification of protein C (Esmon, et al. 1993). Solid ammonium sulfate was added to the supernatant at 4° C. to 40% saturation, centrifuged, and additional ammonium sulfate was added to that supernatant to achieve 70% saturation. After centrifugation, the soft pellet was placed in dialysis bags and dialyzed overnight against 12 L of 20 mM Tris-HCl, 0.02% sodium azide, pH 7.4. The dialysate was applied to a 1496 mAb-AffiGel-10 immunoaffinity column (6 ml resin; 5 mg IgG/ml resin) equilibrated in 20 mM Tris-HCl, 0.1M NaCl, 0.02% sodium azide, pH 7.4. The column was washed with more than 12 ml of the same buffer and eluted with 50% (v/v) ethylene glycol in 20 mM Tris-HCl, pH 7.4 (Jun Xu, unpublished observations). The peak fractions from the elution were pooled (0.37 total OD280), concentrated (Centriprep 30, Millipore), and the buffer exchanged to 20 mM Tris-HC1, 0.1M NaCl, 3 mM CaCl2, 0.6 mM MgCl2, 0.02% sodium azide, pH 7.4. This material was applied to a protein C affinity column that had been previously prepared by applying the purified protein C (3 mg) to an HPC4-AffiGel-10 column (5 mg IgG/ml resin; 0.9×8 cm) in the same buffer. The HPC4 mAb binds the protein C activation region in a calcium-dependent fashion (Esmon, et al. 1993; Stearns, et al. 1988) and does not interfere with subsequent binding of EPCR to protein C. After applying the sample containing plasma EPCR, the column was washed with approximately 12 ml of buffer and eluted with 20 mM Tris-HCl, 0.1M NaCl 5 mM EDTA, 10 mM MOPS, 0.02% sodium azide, pH 7.5. Fractions were monitored for absorbance at 280 nm and for EPCR antigen using the ELISA described above. The eluate containing both protein C and plasma EPCR was applied to an FPLC (Pharmacia-LKB, Uppsala, Sweden) Mono Q column and the column developed with a linear gradient of 0.1-1M NaCl in 20 mM Tris-HCl , pH 7.5. About half of the plasma EPCR did not bind to the Mono Q column, half eluted at about 0.2M NaCl, and the protein C eluted at approximately 0.5M NaCl. Both ionic species of plasma EPCR appeared identical on SDS-PAGE gels under reducing or non-reducing conditions with silver staining, with Coomassie BB staining or with gold staining (Pierce) after transfer to PVDF membranes, and on Western blots with the biotin-polyclonal anti-rsEPCR antibody probe.
The second preparation of plasma EPCR was done starting with 4L of plasma to purify enough protein for functional studies. In this case, the 1496-AffiGel-10 resin (20 ml of 5 mg IgG/ml resin) was added directly to the citrated plasma, along with final concentrations of 10 mM benzamidine, 1 mM diisopropylfluorophosphate, and 0.5 units/ml sodium heparin. The plasma was batch-adsorbed overnight at 4° C. with gentle mixing. After the resin settled, the supernatant was processed for protein C purification (Esmon, et al. 1993). The resin was packed into a 2.5×30 cm column, washed extensively with 20 mM Tris-HCl, 0.1M NaCl, 0.02% sodium azide, pH 74 and eluted with 50% ethylene glycol in 20 mM Tris-HC1, pH 7.4. The eluate was pooled and concentrated (5.5 total OD280), applied to a Mono Q column and the two ionic species (breakthrough and 0.2M NaCl eluate peak) were re-applied to the 1496-AffiGel-10 resin (1.5×11 cm). The column was eluted with 50% ethylene glycol as before. The eluate (0.71 ODs) was concentrated and the buffer exchanged to 20 mM Tris-HCl, 0.1M NaCl, 3 mM CaCl2, 0.6 mM MgCl2, 0.02% sodium azide with a Centriprep 30. This material was then applied to an affinity column in which protein C (2.9 mg) had been initially applied in the same buffer to an HPC2-AffiGel-10 column (0.6×17 cm). The HPC2 mAb binds to the protein C serine protease domain and does not interfere with EPCR binding (Fukudome, et al. 1996). The bound EPCR was eluted with buffer containing 5 mM EDTA. Contaminating serum amyloid P (from the protein C sample) was removed by ion-exchange chromatography on the FPLC Mono Q column. The sample was applied in 0.2M NaCl, so that the plasma EPCR did not bind, and was separated from the contaminants which eluted at 0.4-0.5M NaCl. The resultant purified plasma EPCR (0.193 OD280) appeared homogenous by SDS-PAGE with silver staining and by Western blotting with polyclonal anti-rsEPCR. This material was used for the functional studies and amino-terminal sequence analysis.
Protein Sequencing. The amino-terminal sequence analysis of soluble plasma EPCR was performed in Dr. Kenneth Jackson's laboratory at the Molecular Biology Research Facility, W. K. Warren Medical Research Institute, Oklahoma City. Amino acids are designated by the standard one letter code.
RESULTS
As a first approach, plasma and serum samples from three healthy volunteers were diluted (4% v/v), run on 10% SDS-PAGE gels under non-reducing conditions, and processed for Western blotting using a goat polyclonal antibody raised against rsEPCR. Plasma and serum samples (4% v/v) from healthy volunteers were processed for SDS-PAGE on 10% gels under non-reducing conditions, transferred to membranes and the membranes probed with goat anti-rsEPCR polyclonal antibody. Results were compared to rsEPCR (0.2 ng). Bound antibody was detected with mouse anti-goat IgG and an enhanced chemiluminescence detection system. Plasma samples from two healthy volunteers were immunoadsorbed with 1495 AffiGel-10 resin. The washed resin was eluted and processed for SDS-PAGE under reducing conditions. Western blotting was done using biotin-goat anti-rsEPCR as a probe.
Plasma EPCR purity was determined from silver stained SDS-PAGE 10% gels and western blots of membranes probed with biotin-goat anti-rsEPCR (reduced and non-reduced). A single band of approximately 43,000 Da appears in both the serum and plasma samples after the membrane is probed with the polyclonal antibody. The size of the protein detected appears slightly larger than the rsEPCR. The other bands detected were background binding of IgG as judged by probing with preimmune IgG and longer exposure times. overnight incubation of plasma samples with the anti-EPCR 1495 mAb coupled to AffiGel-10 resin, followed by washing and elution of bound antigen under reducing conditions, resulted in a single band detected by Western blotting with biotin-goat anti-rsEPCR polyclonal antibody.
Determination of soluble EPCR antigen in plasma from healthy volunteers by ELISA using mAb 1495 as the coating antibody found antigen levels of 91.1 +/- 24.5 ng/ml in females (n=12) and 107.2 +/- 30.2 ng/ml in males (n=10). When calculated together, the average plasma EPCR antigen level was 98.4 +/- 27.8 ng/ml. The value for males appeared to be slightly higher than for females, similar to thrombomodulin (Quehenberger, et al. Thromb. Haemost. 76: 729-734), although the population studied was too limited for statistical analysis and this study was not designed to assess differences due to gender, age, diet or other variables.
Since the plasma EPCR appeared to be a single species at approximately 100 ng/ml, it became important to determine whether the circulating EPCR could bind protein C and APC. Soluble EPCR was purified from human plasma by a combination of ion-exchange chromatography, precipitation with ammonium sulfate, and immunoadsorption by anti-EPCR 1496 mAb-AffiGel-10 column chromatography as described in Experimental Procedures.
This plasma EPCR (approximately 110 μg) was applied to a protein C affinity column prepared by applying protein C (3 mg) to an anti-protein C HPC4 mAb-AffiGel-10 column in buffer containing 3 mM CaCl2, 0.6 mM MgCl2 The column was washed and plasma EPCR was applied at fraction 19. The column was washed and eluted with buffer containing 5 mM EDTA starting at fraction 35. Absorbance at 280 nm and EPCR antigen was determined for the fractions. EPCR antigen was determined by ELISA.
More than 98% of the applied plasma EPCR antigen bound to the protein C affinity column. The absorbance profile indicates co-elution of EPCR and protein C from the antibody column, consistent with the calcium-dependence of protein C binding to this antibody (Stearns, et al. 1988).
To purify sufficient protein for functional and structural studies, EPCR was purified from 4L of plasma using a similar, but slightly modified procedure. After elution from a protein C-antibody affinity column, residual contaminating proteins were removed by ion-exchange chromatography on an FPLC Mono Q column. The resultant preparation of plasma EPCR appeared homogenous on SDS-PAGE 10% gels with silver staining and identical results were obtained with western blots probed with biotin-goat anti-rsEPCR polyclonal antibody under both reducing and non-reducing conditions. Amino-terminal sequence analysis of the purified protein yielded only one sequence, S-Q-D-A-S-D, which is identical to the amino-terminal sequence of recombinant soluble EPCR (Sequence ID No. 2). This is the first amino-terminal sequence determination of EPCR from a natural source.
The ability of plasma EPCR to bind to APC was assessed by competition studies in which plasma EPCR was allowed to compete with cellular EPCR for APC, and the resultant free APC that could bind to cellular EPCR was assessed by flow cytometry (FIG. 4a). APC labeled with fluorescein in the active site (fl-APC) was incubated with EA.hy926 cells in the presence or absence of either plasma EPCR or rsEPCR. The EPCR concentration dependence for inhibition of APC binding to the cells was similar for both soluble forms of EPCR. This observation indicates that the affinity of plasma EPCR for binding APC is similar to that previously determined for the rsEPCR-APC binding interaction (Kdapp approximately 30 nM).
While rsEPCR has little effect on protein C activation in a soluble system (Regan, et al. 1996), membrane-bound EPCR has a very potent ability to facilitate activation on cell surfaces (Stearns-Kurosawa, et al. 1996). The current data demonstrating the existence of a circulating form of EPCR capable of binding protein C and APC suggested that plasma EPCR has the potential to alter cell-surface activation of protein C. The thrombin-dependent activation of an approximately physiological level of protein C (0.1 μM) on EA.hy926 cells was inhibited by excess rsEPCR almost to the level of that observed with the anti-rsEPCR 1494 mAb that blocks the EPCR-protein C binding interaction, as shown by FIG. 4b. Previous studies have demonstrated that rsEPCR has no effect on APC amidolytic activity using small synthetic substrates (Regan, et al. 1996). The plasma EPCR was slightly more effective in its ability to inhibit cell-surface protein C activation on the EA.hy926 cells relative to the rsEPCR, as shown by FIG. 4c.
In a one-stage factor Xa clotting assay, purified plasma and soluble recombinant EPCR inhibited the APC prolongation of clotting times similarly (FIG. 4d). Inhibition of APC anticoagulant activity by rsEPCR had been observed previously (Regan, et al. 1996). As expected, the 1496 mAb reversed this effect by blocking the APC-plasma EPCR binding interaction.
EXAMPLE 2 Detection of Soluble EPCR in Urine.
To address the question of whether soluble EPCR is present in urine, four urine samples were collected (first morning void) and analyzed for the presence of soluble EPCR by western blotting and ELISA.
Undiluted pediatric urine samples were compared to a 4% normal plasma and recombinant soluble EPCR (1 ng). The samples were incubated with biotin-goat-anti-rsEPCR and a streptavidin-alkaline phosphatase detection system.
The western blot indicates that a) soluble EPCR is present in urine, and b) the soluble EPCR antigen is present at a size similar to that observed in plasma. Obvious degradation is not observed. The amount of soluble EPCR in the four samples as quantified by ELISA was 40.3, 6.1, 35.6, and 90.1 ng/ml.
EXAMPLE 3 Measurement of Plasma EPCR from Lupus Patients.
Normal human plasma EPCR concentration are about 100 ng/ml (98.4±27.8 ng/ml; 2.5 nM), as discussed above. A panel of samples from patients with lupus erythematosus (n=54) was assayed and soluble EPCR levels were found to range from non-detectable levels to greater than 1,700 ng/ml. Fifteen patients had soluble EPCR levels greater than 200 ng/ml.
Previous studies have shown elevated soluble plasma TM levels in lupus patients due to endothelial damage and the current lupus patient samples were assayed for plasma TM as a reference. It was found that their soluble TM levels had absolutely no correlation with their soluble EPCR levels, as shown by FIG. 5. This is an important observation that suggests that the source of the soluble plasma EPCR is not simply from randomly damaged endothelium. In contrast to TM, membrane-bound EPCR expression in humans and primates is restricted primarily to the endothelium of large vessels, with capillaries expressing little EPCR. The distinctive localization of EPCR is expected to augment protein C activation locally to prevent large vessel thrombosis. The primary localization of membrane-bound EPCR to the large vessels points to a targeted thrombotic risk in the large vessels that may be predicted by soluble plasma EPCR concentrations.
EXAMPLE 4 Plasma Soluble EPCR in Septic Shock Patients.
Sepsis (accp/sccm consensus conference, chest 1992; 101:1644-1655) is defined as the systemic inflammatory response to infection, including, but not limited to, more than one of the following clinical manifestations:
1) body temperature greater than 38° C. or less than 36°C.;
2) heart rate greater than 90 beats per minute;
3) tachypnea manifested by:
a) respiratory rate greater than 20 breaths per minute;
b) hyperventilation as from PaCO2 of less than 32 mm Hg;
4) WBC count greater than 12,000/mm3 or less than 4,000/mm3, or presence of more than 10% immature neutrophils (bands).
Samples were obtained from patients with post-surgical complications with or without severe sepsis, as defined by sepsis associated with organ dysfunction, hypoperfusion or hypotension. Perfusion abnormalities may include lactic acidosis, oliguria, or acute alterations in mental status. Septic shock refers to sepsis with hypotension requiring vasoactive drugs for more than 24 hours in spite of adequate fluid resuscitation and the absence of cardiogenic shock.
All the patients included in the study fullfilled the following criteria:
a) admission to the intensive care unit because of sepsis and/or post surgical complications requiring respiratory (controlled ventilation for more than 24 hours) and or hemodynamic support (requirement of inotropic drugs, dopamine or dobutamine at greater than or equal to 5 micrograms/Kg/min and/or vasoactive amines, epinephrine or nor-epinephrin);
b) age between 18 and 75 years;
c) antithrombin activity less than 70% (tested locally). Patients were excluded if they had polytrauma, liver cirrhosis or acute liver failure, cancer in terminal phase, immunodeficiency, leukemia, pregnancy, or heparin therapy.
Patient blood samples were taken at time 0 (entry into the Intensive Care Unit, ICU) and at two days and six days after treatment with anti-thrombin II (ATIII) or a placebo. Plasma soluble EPCR and soluble thrombomodulin (TM) were assayed only on time 0 samples.
sEPCR:
normal: 133.4±53.4 ng/ml (mean±SD)
sepsis: 224.9±74.5 ng/ml
Significant difference between the means, P=0.00009
sTM:
normal: 35.5±20.4 ng/ml (mean±SD)
sepsis: 39.9±73.1 ng/ml
No significant difference between the means, P=0.81 No correlation between sEPCR and sTM levels in plasma, r2 =0.34.
These results are shown graphically in FIG. 6. As in the lupus patients, patients with sepsis show very significant elevations in plasma EPCR levels, not correlated with soluble TM levels.
The observation that soluble plasma EPCR inhibits both protein C activation and activated protein C anticoagulant activity indicates that the elevated plasma EPCR levels in these patients poses an additional thrombotic risk and marks evidence of vascular injury/responsiveness. Examples of conditions these are indicative of include disorders associated with endothelial cell stimulation, atherogenesis, leukocyte adhesion and plaque rupture.
EXAMPLE 5 Identification of Alternatively Spliced forms of EPCR in Baboon and Human Tissues.
As an initial approach to determine whether a soluble EPCR isoform could be generated by alternative splicing mechanism, RNA was isolated from human and baboon tissues and reverse transcriptase-PCR (RT-PCR) performed with gene-specific primers. Although the baboon EPCR genomic sequence is not known, primers based on the human sequence were used based on the reasoning that baboons and humans are closely related on the evolutionary scale.
In the RT-PCR procedure generally, total RNA is isolated from homogenized tissue. The RNA is mixed with a specific antisense primer, nucleotides and the reverse transcriptase enzyme. In the mix, the RNA serves as a template for the reverse transcriptase to create a first strand cDNA. This new cDNA template is then amplified by conventional PCR using specific primers and Taq polymerase. Primers that would amplify both the membrane form of EPCR (424 bp) and the predicted alternatively spliced product (674 bp) were chosen. Products corresponding to both forms of EPCR were amplified from a variety of baboon tissues (FIG. 4) and human lung and placenta. Possible contamination with genomic DNA was unlikely as judged by controls without reverse transcriptase and the lack of a 1,885 bp band in the reactions with the tissues.
To confirm that the baboon genomic DNA sequence has the appropriate exon-intron boundary and the intron-inframe reading sequence for alternative splicing, the intron sequence from baboon kidney genomic DNA was amplified by conventional PCR. The assumption was made that the genomic structure was retained between the species and primers were used (human sequence) that flank intron III. This is the intron (human sequence) believed to contain the alternatively spliced sequence. Baboon kidney tissue was homogenized and the DNA extracted. The DNA was mixed with the specific primers and a product amplified by PCR. The DNA product was purified and electrophoresed on an agarose gel.
Procedural Details
A. EPCR ELISA: The coating antibody is 1494 mAb that binds to the ligand binding domain of EPCR. The detecting antibody is biotinylated 1495 mAb, which does not block protein C/APC binding, and does not cross-react with 1494 mAb. The detection system is streptavidin-alkaline phosphatase and BluePhos substrate (from KPL).
B. RT-PCR of tissues: Tissues (50-100 mg) were homogenized in Trizol (Gibco BRL). The upper phase containing RNA was extracted with chloroform, precipitated with isopropanol, washed and solubilized in DEPC-water. RNA (1-5 μg) was mixed with nucleotides, the CREA antisense primer, and reverse transcriptase in the appropriate buffer according to the manufacturer's directions (Superscript™ Preamplification system for first strand cDNA synthesis, Gibco BRL). The cDNA product was amplified by conventional PCR using the CRES and CREA primers for 30 cycles. The cDNA products were purified by chloroform extraction and alcohol precipitation, solubilized in water and electrophoresed in a 2% agarose gel using standard procedures. Gels were stained with Vistra Green (Amersham) and imaged on a phosphoimager (Storm™ scanner, Molecular Dynamics, Inc.).
C. PCR of baboon genomic DNA: Baboon kidney DNA (82 mg) was homogenized in Trizol reagent. The lower phase containing DNA was extracted, precipitated and solubilized in sterile water. The DNA was amplified by conventional PCR in a mix with buffer, nucleotides, and the HRT-1 and HRT-2 primers for 30 cycles. The amplified DNA was extracted, precipitated, solubilized in sterile water and electrophoresed on a 2% agarose gel using standard procedures. The single band (465 bp) was visualized with ethidium bromide, cut out and the PCR product purified on a spin column according to the manufacturer's directions (Qiagen). The PCR product was sequenced using the same primers.
D. Primer Sequences:
CRES: 5'-TCGTGCGCCTGGTGCACCAGGAGC-3' (5' sense primer near end of exon II)
CREA: 5'-CGCCGTCCACCTGTGCACAGGAAG-3' (3' antisense primer within exon IV)
HRT-1: 5'-AGCAGCTCAATGCCTACAACCG-3' (5' sense primer near end of exon III)
HRT-2: 5'-CCGTAGAAGGACACGTGTCCACCTGCCGC-3' (3' antisense primer within exon IV)
Results with Baboon Tissues
There was a single band amplified from teh kidney genomic DNA that was cut out of the gel, purified and sequenced. The sequence was 92% identical to the human sequence and the exon-intron boundaries were conserved. The high level of similarity in this intron sequence is notable, because intron sequences are typically not well conserved between species. There was also an in-frame reading sequence within the intron that contained a stop codon, predicting a unique 22 residue carboxyl-terminal tail in the baboon alternatively spliced soluble protein.
The observation that the predicted soluble EPCR isoforms will have unique carboxyl terminal tails provides a structural difference for distinguishing between the isoforms using isoform-specific antibodies. The working model is that plasma levels of proteolyzed soluble EPCR will report endothelial injury, whereas levels of alternatively spliced soluble EPCR will report an endothelial response to stimuli. It is anticipated that the relative plasma levels of the soluble EPCR isoforms will provide information on large vessel endothelial dysfunction and injury in specific pathologies.
Results with Human Tissues
RT-PCR products from human tissues: placenta, lung, and tongue, were electrophoresed using the CRES/CREA primers specific for EPCR. The procedures were the same as used for the baboon tissues. Products corresponding to the membrane isoform of EPCR (mEPCR) and the alternatively-spliced soluble EPCR isoform (sEPCR) were observed. The products look essentially the same as that seen using the baboon tissues. The only difference is that the placental tissue appears to have additional products.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 8                                              
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1302 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 1..1302                                                     
(D) OTHER INFORMATION: /note= "Nucleotides 25 through 738                 
encode the Endothelial Cell Protein Receptor of                           
Sequence ID No. 2."                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
CAGGTCCGGAGCCTCAACTTCAGGATGTTGACAACATTGCTGCCGATACTGCTGCTGTCT60            
GGCTGGGCCTTTTGTAGCCAAGACGCCTCAGATGGCCTCCAAAGACTTCATATGCTCCAG120           
ATCTCCTACTTCCGCGACCCCTATCACGTGTGGTACCAGGGCAACGCGTCGCTGGGGGGA180           
CACCTAACGCACGTGCTGGAAGGCCCAGACACCAACACCACGATCATTCAGCTGCAGCCC240           
TTGCAGGAGCCCGAGAGCTGGGCGCGCACGCAGAGTGGCCTGCAGTCCTACCTGCTCCAG300           
TTCCACGGCCTCGTGCGCCTGGTGCACCAGGAGCGGACCTTGGCCTTTCCTCTGACCATC360           
CGCTGCTTCCTGGGCTGTGAGCTGCCTCCCGAGGGCTCTAGAGCCCATGTCTTCTTCGAA420           
GTGGCTGTGAATGGGAGCTCCTTTGTGAGTTTCCGGCCGGAGAGAGCCTTGTGGCAGGCA480           
GACACCCAGGTCACCTCCGGAGTGGTCACCTTCACCCTGCAGCAGCTCAATGCCTACAAC540           
CGCACTCGGTATGAACTGCGGGAATTCCTGGAGGACACCTGTGTGCAGTATGTGCAGAAA600           
CATATTTCCGCGGAAAACACGAAAGGGAGCCAAACAAGCCGCTCCTACACTTCGCTGGTC660           
CTGGGCGTCCTGGTGGGCGGTTTCATCATTGCTGGTGTGGCTGTAGGCATCTTCCTGTGC720           
ACAGGTGGACGGCGATGTTAATTACTCTCCAGCCCCGTCAGAAGGGGCTGGATTGATGGA780           
GGCTGGCAAGGGAAAGTTTCAGCTCACTGTGAAGCCAGACTCCCCAACTGAAACACCAGA840           
AGGTTTGGAGTGACAGCTCCTTTCTTCTCCCACATCTGCCCACTGAAGATTTGAGGGAGG900           
GGAGATGGAGAGGAGAGGTGGACAAAGTACTTGGTTTGCTAAGAACCTAAGAACGTGTAT960           
GCTTTGCTGAATTAGTCTGATAAGTGAATGTTTATCTATCTTTGTGGAAAACAGATAATG1020          
GAGTTGGGGCAGGAAGCCTATGCGCCATCCTCCAAAGACAGACAGAATCACCTGAGGCGT1080          
TCAAAAGATATAACCAAATAAACAAGTCATCCACAATCAAAATACAACATTCAATACTTC1140          
CAGGTGTGTCAGACTTGGGATGGGACGCTGATATAATAGGGTAGAAAGAAGTAACACGAA1200          
GAAGTGGTGGAAATGTAAAATCCAAGTCATATGGCAGTGATCAATTATTAATCAATTAAT1260          
AATATTAATAAATTTCTTATATTTAAAAAAAAAAAAAAAAAA1302                            
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 238 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(iii) HYPOTHETICAL: NO                                                    
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 1..365                                                      
(D) OTHER INFORMATION: /note= "Endothelial Cell Protein                   
Receptor encoded by nucleotides 1 through 1302 of                         
Sequence ID No. 1."                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: Modified-site                                               
(B) LOCATION: 1..15                                                       
(D) OTHER INFORMATION: /note= "Amino acids 1-15 represent                 
a putative signal sequence."                                              
(ix) FEATURE:                                                             
(A) NAME/KEY: Domain                                                      
(B) LOCATION: 211..236                                                    
(D) OTHER INFORMATION: /note= "Amino acids 211-236                        
represent a putative transmembrane domain."                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Active-site                                                 
(B) LOCATION: 47..174                                                     
(D) OTHER INFORMATION: /note= "Amino acids 47-49, 64-66,                  
136-138 and 172-174 represent potential                                   
N- glycosylation sites."                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: Active-site                                                 
(B) LOCATION: Cys 17                                                      
(D) OTHER INFORMATION: /note=immediately preceeds amino acid              
cleavage site                                                             
(ix) FEATURE:                                                             
(A) NAME/KEY: Active-site                                                 
(B) LOCATION: Gly 201                                                     
(D) OTHER INFORMATION: /note=peptide inserts in alternatively             
spliced EPCR                                                              
(ix) FEATURE:                                                             
(A) NAME/KEY: Modified-site                                               
(B) LOCATION: 17..186                                                     
(D) OTHER INFORMATION: /note= "Amino acids 17, 114, 118                   
and 186 represent extracellular cysteine residues."                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
MetLeuThrThrLeuLeuProIleLeuLeuLeuSerGlyTrpAlaPhe                          
151015                                                                    
CysSerGlnAspAlaSerAspGlyLeuGlnArgLeuHisMetLeuGln                          
202530                                                                    
IleSerTyrPheArgAspProTyrHisValTrpTyrGlnGlyAsnAla                          
354045                                                                    
SerLeuGlyGlyHisLeuThrHisValLeuGluGlyProAspThrAsn                          
505560                                                                    
ThrThrIleIleGlnLeuGlnProLeuGlnGluProGluSerTrpAla                          
65707580                                                                  
ArgThrGlnSerGlyLeuGlnSerTyrLeuLeuGlnPheHisGlyLeu                          
859095                                                                    
ValArgLeuValHisGlnGluArgThrLeuAlaPheProLeuThrIle                          
100105110                                                                 
ArgCysPheLeuGlyCysGluLeuProProGluGlySerArgAlaHis                          
115120125                                                                 
ValPhePheGluValAlaValAsnGlySerSerPheValSerPheArg                          
130135140                                                                 
ProGluArgAlaLeuTrpGlnAlaAspThrGlnValThrSerGlyVal                          
145150155160                                                              
ValThrPheThrLeuGlnGlnLeuAsnAlaTyrAsnArgThrArgTyr                          
165170175                                                                 
GluLeuArgGluPheLeuGluAspThrCysValGlnTyrValGlnLys                          
180185190                                                                 
HisIleSerAlaGluAsnThrLysGlySerGlnThrSerArgSerTyr                          
195200205                                                                 
ThrSerLeuValLeuGlyValLeuValGlyGlyPheIleIleAlaGly                          
210215220                                                                 
ValAlaValGlyIlePheLeuCysThrGlyGlyArgArgCys                                
225230235                                                                 
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 48 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(iii) HYPOTHETICAL: NO                                                    
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
MetMetGlyArgGlyProGlyLysGlnAlaGlyGluArgAlaGlySer                          
151015                                                                    
ArgGlnMetAspGlyProGluGlyTrpMetProArgAlaThrArgGly                          
202530                                                                    
ProGlnLysGlyValTrpAspArgThrHisAlaAlaSerValSerTrp                          
354045                                                                    
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 148 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
ATGATGGGACGGGGCCCAGGCCTGCAAGCTGGGGAGAGGGCGGGTTCCAGACAAATGGAT60            
GGACCTGAAGGATGGATGCCTAGAGCAACAAGAGGCCCACAGCTGGGGGTTTGGGACAGA120           
ACACACGCAGCTTCAGTCAGTTGGTAAA148                                           
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 1..24                                                       
(D) OTHER INFORMATION: /note= "5'sense primer near end of                 
exon II."                                                                 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
TCGTGCGCCTGGTGCACCAGGAGC24                                                
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 1..24                                                       
(D) OTHER INFORMATION: /note= "3'antisense primer within                  
exon IV."                                                                 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
CGCCGTCCACCTGTGCACAGGAAG24                                                
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 1..22                                                       
(D) OTHER INFORMATION: /note= "5'sense primer near end of                 
exon III."                                                                
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
AGCAGCTCAATGCCTACAACCG22                                                  
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(iii) HYPOTHETICAL: NO                                                    
(iv) ANTI-SENSE: NO                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: misc.sub.-- feature                                         
(B) LOCATION: 1..29                                                       
(D) OTHER INFORMATION: /note= "3'antisense primer within                  
exon IV."                                                                 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
CCGTAGAAGGACACGTGTCCACCTGCCGC29                                           
__________________________________________________________________________

Claims (11)

We claim:
1. An assay for soluble endothelial protein C receptor comprising
obtaining a sample from a patient to be tested, and
measuring the amount of soluble endothelial protein C receptor.
2. The assay of claim 1 wherein the sample is selected from the group consisting of urine, plasma, serum, tissue samples, and interstitial fluid.
3. The assay of claim 1 further comprising the step of correlating the amount of soluble endothelial protein C receptor with calibration standards.
4. The assay of claim 1 wherein the patient has a disorder or disease selected from the group consisting of coagulation and inflammatory states and disorders, disorders or diseases involving damage to endothelium, and large blood vessel disease.
5. The assay of claim 4 wherein the disorder or disease is selected from the group consisting of autoimmune diseases, transplantation, sepsis, shock, pre-eclampsia, diabetes, vascular disease, kidney disease and liver disease.
6. The assay of claim 5 wherein the vascular disease is selected from the group consisting of cardiopulmonary bypass, unstable angina, restenosis, and angioplasty.
7. The assay of claim 1 to detect damage to large blood vessels.
8. A kit for detection and measurement of endothelial protein C receptor comprising
an antibody immunoreactive with endothelial protein C receptor,
reagents to detect a reaction between the antibody and endothelial protein C receptor in a sample from a patient, and
standards to correlate the amount of reaction to normal and abnormal levels of endothelial protein C receptor.
9. The kit of claim 8 where the antibody has a higher affinity for endothelial protein C receptor including the transmembrane domain than for endothelial protein C receptor not including the transmembrane domain.
10. The kit of claim 8 wherein the antibody is immunoreactive with the insert in an alternatively spliced endothelial protein C receptor.
11. The kit of claim 8 wherein the antibodies block binding of endothelial protein C receptor and activated protein C or protein C.
US08/884,203 1997-06-27 1997-06-27 Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor Expired - Lifetime US5804392A (en)

Priority Applications (17)

Application Number Priority Date Filing Date Title
US08/884,203 US5804392A (en) 1997-06-27 1997-06-27 Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor
US09/082,021 US6037450A (en) 1997-06-27 1998-05-20 Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor
CA002427749A CA2427749A1 (en) 1997-06-27 1998-06-26 Diagnostic assays using soluble endothelial cell protein c/activated protein c receptor
PCT/US1998/013385 WO1999000673A1 (en) 1997-06-27 1998-06-26 Diagnostic assays using soluble endothelial cell protein c/activated protein c receptor
EP98932912A EP0991946B1 (en) 1997-06-27 1998-06-26 Diagnostic assays using soluble endothelial cell protein c/activated protein c receptor
DE69814634T DE69814634T2 (en) 1997-06-27 1998-06-26 DIAGNOSTIC PROCESS FOR WATER-SOLUBLE ENDOTHELIAL CELL PROTEIN C / ACTIVATED PROTEIN C RECEPTOR
AU82694/98A AU748199B2 (en) 1997-06-27 1998-06-26 Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor
PT98932912T PT991946E (en) 1997-06-27 1998-06-26 DIAGNOSTIC TESTS USING PROTEIN SOLUBLE RECEPTOR C / PROTEIN C ACTIVATED OF ENDOTHELIAL CELLS
DK98932912T DK0991946T3 (en) 1997-06-27 1998-06-26 Diagnostic assays using soluble endothelial cell protein C / activated protein C receptor
AT98932912T ATE240523T1 (en) 1997-06-27 1998-06-26 DIAGNOSTIC PROCEDURE FOR WATER SOLUBLE ENDOTHELIAL CELL PROTEIN C/ ACTIVATED PROTEIN C RECEPTOR
JP50581099A JP3553616B2 (en) 1997-06-27 1998-06-26 Diagnostic assay using soluble endothelial cell protein C / activated protein C receptor
CA002294647A CA2294647C (en) 1997-06-27 1998-06-26 Diagnostic assays using soluble endothelial cell protein c/activated protein c receptor
ES98932912T ES2198727T3 (en) 1997-06-27 1998-06-26 DIAGNOSTIC TECHNIQUES USING THE PROTEIN SOLUBLE RECEIVER C / PROTEIN C ACTIVATED FROM ENDOTHELIAL CELLS.
JP2001365405A JP4308900B2 (en) 1997-06-27 2001-11-29 Diagnostic assay using soluble endothelial cell protein C / activated protein C receptor
JP2003017832A JP2003301000A (en) 1997-06-27 2003-01-27 Diagnostic assay using soluble endothelial cell protein C / activated protein C receptor
JP2006200128A JP2006321811A (en) 1997-06-27 2006-07-21 Diagnostic assay using soluble endothelial cell protein C / activated protein C receptor
JP2008066863A JP2008164635A (en) 1997-06-27 2008-03-14 Diagnostic assay using soluble endothelial cell protein C / activated protein C receptor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US08/884,203 US5804392A (en) 1997-06-27 1997-06-27 Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor

Publications (1)

Publication Number Publication Date
US5804392A true US5804392A (en) 1998-09-08

Family

ID=25384174

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/884,203 Expired - Lifetime US5804392A (en) 1997-06-27 1997-06-27 Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor
US09/082,021 Expired - Lifetime US6037450A (en) 1997-06-27 1998-05-20 Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor

Family Applications After (1)

Application Number Title Priority Date Filing Date
US09/082,021 Expired - Lifetime US6037450A (en) 1997-06-27 1998-05-20 Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor

Country Status (11)

Country Link
US (2) US5804392A (en)
EP (1) EP0991946B1 (en)
JP (5) JP3553616B2 (en)
AT (1) ATE240523T1 (en)
AU (1) AU748199B2 (en)
CA (2) CA2427749A1 (en)
DE (1) DE69814634T2 (en)
DK (1) DK0991946T3 (en)
ES (1) ES2198727T3 (en)
PT (1) PT991946E (en)
WO (1) WO1999000673A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999000673A1 (en) * 1997-06-27 1999-01-07 Oklahoma Medical Research Foundation Diagnostic assays using soluble endothelial cell protein c/activated protein c receptor
US6376169B1 (en) 1998-05-01 2002-04-23 Queens University At Kingston Method for diagnosing a vascular condition
US6399064B1 (en) 1994-08-12 2002-06-04 Oklahoma Medical Research Foundation Cloning and regulation of an endothelial cell protein C/activated protein C receptor
US20020068713A1 (en) * 2000-05-22 2002-06-06 Rade Jeffrey J. Genetic engineering of vascular grafts to resist disease
WO2002066981A3 (en) * 2001-02-20 2003-04-24 Oklahoma Med Res Found Monitoring soluble endothelial protein c receptor levels in anticoagulant therapy
US20050032140A1 (en) * 2003-06-27 2005-02-10 Oklahoma Medical Research Foundation Methods for predicting susceptibility to cardiovascular disease
US6953568B1 (en) 1998-08-25 2005-10-11 Oklahoma Medical Research Foundation Targeting of molecules to large vessel endothelium using EPCR
WO2011012832A2 (en) 2009-07-30 2011-02-03 Université Pierre Et Marie Curie (Paris 6) Method for diagnosing a cancer, for determining the thrombotic risk in an individual stricken with a cancer and for determining the severity of a cancer in an individual
US9229010B2 (en) 2009-02-06 2016-01-05 Astute Medical, Inc. Methods and compositions for diagnosis and prognosis of renal injury and renal failure

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2239532B1 (en) * 2004-02-06 2006-11-01 Proyecto De Biomedicina Cima S.L. METHOD FOR ASSESSING THE RISK AND PREDISPOSITION TO DEVELOP A PATHOLOGY RELATED TO THE PRESENCE OF AUTOANTIBODIES AGAINST EPCR.
US20070141625A1 (en) * 2005-02-03 2007-06-21 Santos Jose H Method for assessing risk of and predisposition to development of a pathology related to the presence of anti-epcr autoantibodies
ES2268961B1 (en) * 2005-03-17 2008-03-16 Proyecto De Biomedicina Cima, S.L. NEW EPCR SOLUBLE PROTEIN OF NON-PROTEOLITICAL ORIGIN AND ITS USE.
AU2011334548B2 (en) * 2010-11-26 2016-06-09 Immunexpress Pty Ltd Diagnostic and/or screening agents and uses therefor
EP3458861A4 (en) * 2016-05-17 2019-12-11 LDX Prognostics Limited Co. METHODS AND COMPOSITIONS FOR PROVIDING AN EVALUATION OF PRECLAMPSY
EP4269605A4 (en) * 2020-12-28 2024-11-20 Fujimori Kogyo Co., Ltd. Blood coagulation inspection method

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4782137A (en) * 1984-01-24 1988-11-01 Immunex Corporation Synthesis of protein with an identification peptide, and hybrid polypeptide incorporating same
US5009889A (en) * 1987-12-31 1991-04-23 Oklahoma Medical Research Foundation Treatment of dysfunctional vascular endothelium using activated protein C
US5298599A (en) * 1988-12-30 1994-03-29 Oklahoma Medical Research Foundation Expression and purification of recombinant soluble tissue factor
US5695993A (en) * 1994-08-12 1997-12-09 Oklahoma Medical Research Foundation Cloning and regulation of an endothelial cell protein C/activated protein C receptor

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5804392A (en) * 1997-06-27 1998-09-08 Oklahoma Medical Research Foundation Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4782137A (en) * 1984-01-24 1988-11-01 Immunex Corporation Synthesis of protein with an identification peptide, and hybrid polypeptide incorporating same
US5009889A (en) * 1987-12-31 1991-04-23 Oklahoma Medical Research Foundation Treatment of dysfunctional vascular endothelium using activated protein C
US5298599A (en) * 1988-12-30 1994-03-29 Oklahoma Medical Research Foundation Expression and purification of recombinant soluble tissue factor
US5695993A (en) * 1994-08-12 1997-12-09 Oklahoma Medical Research Foundation Cloning and regulation of an endothelial cell protein C/activated protein C receptor

Non-Patent Citations (84)

* Cited by examiner, † Cited by third party
Title
Boehme, et al., "Release of thrombomodulin from endothelial cells by concentrated action of TNF-α and neutrophils: in vivo and in vitro studies," Immunology 87:134-140 (1996).
Boehme, et al., Release of thrombomodulin from endothelial cells by concentrated action of TNF and neutrophils: in vivo and in vitro studies, Immunology 87:134 140 (1996). *
Bourin and Lindahl, "Review Article: Glycosaminoglycans and the regulation of blood coagulation," Biochem. J. 289:313-330 (1993).
Bourin and Lindahl, Review Article: Glycosaminoglycans and the regulation of blood coagulation, Biochem. J. 289:313 330 (1993). *
Conway and Rosenberg, "Tumor Necrosis Factor Suppresses Transcription of the Thrombomodulin Gene in Endothelial Cells," Mol. Cell. Biol. 8(12):5588-5592 (1988).
Conway and Rosenberg, Tumor Necrosis Factor Suppresses Transcription of the Thrombomodulin Gene in Endothelial Cells, Mol. Cell. Biol. 8(12):5588 5592 (1988). *
Dahlb a ck, Inhibition of Protein C a Cofactor Function of Human and Bovine Protein S by C4b binding Protein, J. Biol. Chem. 261(26):12022 12027 (1986). *
Dahlb a ck, Protein S and C4b Binding Protein: Components Involved in the Regulation of the Protein C Anticoagulant System, Thromb. Haemostas. 66:49 61 (1991). *
Dahlback, "Inhibition of Protein Ca Cofactor Function of Human and Bovine Protein S by C4b-binding Protein," J. Biol. Chem. 261(26):12022-12027 (1986).
Dahlback, "Protein S and C4b-Binding Protein: Components Involved in the Regulation of the Protein C Anticoagulant System," Thromb. Haemostas. 66:49-61 (1991).
Dittman and Majerus, "Structure and Function of Thrombomodulin: A Natural Anticoagulant," Blood 75(2):329-336 (1990).
Dittman and Majerus, Structure and Function of Thrombomodulin: A Natural Anticoagulant, Blood 75(2):329 336 (1990). *
Dittman, W. A. "Thrombomodulin--Biology and Potential Cardiovascular Applications," Trends Cardiovasc. Med. 1(8):331-336 (1991).
Dittman, W. A. Thrombomodulin Biology and Potential Cardiovascular Applications, Trends Cardiovasc. Med. 1(8):331 336 (1991). *
Dreyfus et al., "Treatment of Homozygous Protein C Deficiency and Neonatal Purpura Fulminans with a Purified Protein C Concentrate," N. Engl. J. Med. 325(22):1565-1568 (1991).
Dreyfus et al., Treatment of Homozygous Protein C Deficiency and Neonatal Purpura Fulminans with a Purified Protein C Concentrate, N. Engl. J. Med. 325(22):1565 1568 (1991). *
Edgell, et al., "Permanent cell line expressing human factor VIII-related antigen established by hybridization," Proc. Natl. Acad. Sci. (USA) 80:3734-3737 (1983).
Edgell, et al., Permanent cell line expressing human factor VIII related antigen established by hybridization, Proc. Natl. Acad. Sci. ( USA ) 80:3734 3737 (1983). *
Engelman et al., "Identifying Nonpolar Transbilayer Helices in Amino Acid Sequences of Membrane Proteins," Annu. Rev. Biophys. Chem. 15:321-53 (1986).
Engelman et al., Identifying Nonpolar Transbilayer Helices in Amino Acid Sequences of Membrane Proteins, Annu. Rev. Biophys. Chem. 15:321 53 (1986). *
Esmon, et al., " 21! Protein C Activation," Methods Enzymol. 222:359-385 (1993).
Esmon, et al., 21 Protein C Activation, Methods Enzymol. 222:359 385 (1993). *
Fukudome and Esmon, "Identification, Cloning, and Regulation of a Novel Endothelial Cell Protein C/Activated Protein C Receptor*," J. Biol. Chem. 269(42):26486-26491 (1994).
Fukudome and Esmon, "Molecular Cloning and Expression of Murine and Bovine Endothelial Cell Protein C/Activated Protein C Receptor (EPCR)--The Structural and Functional Conservation in Human, Bovine and Murine EPCR*," J. Biol. Chem. 270(10):5571-5577 (1995).
Fukudome and Esmon, Identification, Cloning, and Regulation of a Novel Endothelial Cell Protein C/Activated Protein C Receptor*, J. Biol. Chem. 269(42):26486 26491 (1994). *
Fukudome and Esmon, Molecular Cloning and Expression of Murine and Bovine Endothelial Cell Protein C/Activated Protein C Receptor (EPCR) The Structural and Functional Conservation in Human, Bovine and Murine EPCR*, J. Biol. Chem. 270(10):5571 5577 (1995). *
Fukudome, et al., "The Endothelial Cell Protein C Receptor--Cell Surface Expression and Direct Ligand Binding by the Soluble Receptor," J. Biol. Chem. 271(29):17491-17498 (1996).
Fukudome, et al., The Endothelial Cell Protein C Receptor Cell Surface Expression and Direct Ligand Binding by the Soluble Receptor, J. Biol. Chem. 271(29):17491 17498 (1996). *
Galvin, et al., "Reconstitution of Rabbit Thrombomodulin Into Phospholipid Vesicles," J. Biol. Chem. 262(5):2199-2205 (1987).
Galvin, et al., Reconstitution of Rabbit Thrombomodulin Into Phospholipid Vesicles, J. Biol. Chem. 262(5):2199 2205 (1987). *
Gerson et al., "Severe Acquired Protein C Deficiency in Purpura Fulminans Associated with Disseminated Intravascular Coagulation: Treatment with Protein C Concentrate," Pediatrics 91(2):418-422 (1993).
Gerson et al., Severe Acquired Protein C Deficiency in Purpura Fulminans Associated with Disseminated Intravascular Coagulation: Treatment with Protein C Concentrate, Pediatrics 91(2):418 422 (1993). *
Heaney, et al., "Membrane-associated and soluble granylocyte/macrophoage-colony -stimulating factor receptor α submits are independently regulated in HL-60 cells," Proc. Natl. Acad. Sci. U.S.A. 92:2365-2369 (1995).
Heaney, et al., Membrane associated and soluble granylocyte/macrophoage colony stimulating factor receptor submits are independently regulated in HL 60 cells, Proc. Natl. Acad. Sci. U.S.A. 92:2365 2369 (1995). *
Heaney, ML and DW Golde, "Soluble cytokine receptors," Blood 87(3):847-857 (1996).
Heaney, ML and DW Golde, Soluble cytokine receptors, Blood 87(3):847 857 (1996). *
Hofsteenge, et al., "Effect of thrombomodulin on the kinetics of the interaction of thrombin with substrates and inhibitors," Biochem. J. 237:243-251 (1986).
Hofsteenge, et al., Effect of thrombomodulin on the kinetics of the interaction of thrombin with substrates and inhibitors, Biochem. J. 237:243 251 (1986). *
Horiuchi, et al., "Soluble interleukin-6 receptors released from T cell or granulocyte/macrophage cell lines and human peripheral blood mononuclear cells are generated thourgh an alternative splicing mechanism," Eur. J. Immunol. 24:1945-1948 (1994).
Horiuchi, et al., Soluble interleukin 6 receptors released from T cell or granulocyte/macrophage cell lines and human peripheral blood mononuclear cells are generated thourgh an alternative splicing mechanism, Eur. J. Immunol. 24:1945 1948 (1994). *
Ishii and Majerus, "Thrombomodulin is Present in Human Plasma and Urine," J. Clin. Invest. 76:2178-2181 (1985).
Ishii and Majerus, Thrombomodulin is Present in Human Plasma and Urine, J. Clin. Invest. 76:2178 2181 (1985). *
Jackman, et al., "Human thrombomodulin gene is intron depleted: Nucleic acid sequences of the cDNA and gene predict protein structure and suggest sites of regulatory control," Proc. Natl. Acad. Sci. (USA) 84:6425-6429 (1987).
Jackman, et al., Human thrombomodulin gene is intron depleted: Nucleic acid sequences of the cDNA and gene predict protein structure and suggest sites of regulatory control, Proc. Natl. Acad. Sci. ( USA ) 84:6425 6429 (1987). *
M u llberg, et al., The Soluble Human IL 6 Receptor, J. Immunol. 152:4958 4968 (1994). *
Mathews, "Structure of a Nonadecapeptide of the Fifth EGF Domain of Thrombomodulin Complexed with Thrombin," Biochemistry 33:13547-13552 (1994).
Mathews, Structure of a Nonadecapeptide of the Fifth EGF Domain of Thrombomodulin Complexed with Thrombin, Biochemistry 33:13547 13552 (1994). *
Moore, et.al., "Tumor Necrosis Factor Leads to the Internalization and Degradation of Thrombosis from the Surface of Bovine Aortic Endothelial Cells in Culture," Blood 73(1):159-165 (1989).
Moore, et.al., Tumor Necrosis Factor Leads to the Internalization and Degradation of Thrombosis from the Surface of Bovine Aortic Endothelial Cells in Culture, Blood 73(1):159 165 (1989). *
Mullberg, et al., "The Soluble Human IL-6 Receptor," J. Immunol. 152:4958-4968 (1994).
Ohdama, et al., "Clinical Thrombomodulin in Wegener's Granulomatosis as an Indicator of Vascular Injuries," Chest 106:666-671 (1994).
Ohdama, et al., Clinical Thrombomodulin in Wegener s Granulomatosis as an Indicator of Vascular Injuries, Chest 106:666 671 (1994). *
Owen, et al., "The Conversion of Prothrombin to Thrombin," J. Biol. Chem. 249(2):594-605 (1974).
Owen, et al., The Conversion of Prothrombin to Thrombin, J. Biol. Chem. 249(2):594 605 (1974). *
Parkinson, et al., "Stable Expression of a Secretable Deletion Mutant of Recombinant Human Thrombomodulin in Mammalian Cells," J. Biol. Chem. 265(21):12602-12610 (1990).
Parkinson, et al., Stable Expression of a Secretable Deletion Mutant of Recombinant Human Thrombomodulin in Mammalian Cells, J. Biol. Chem. 265(21):12602 12610 (1990). *
Quehenberger, et al., "Increased Levels of Activated Factor VII and Decreased Plasma Protein S Activity and Circulating Thrombomodulin During Use of Oral Contraceptives," Thromb. Haemost. 76:729-734 (1996).
Quehenberger, et al., Increased Levels of Activated Factor VII and Decreased Plasma Protein S Activity and Circulating Thrombomodulin During Use of Oral Contraceptives, Thromb. Haemost. 76:729 734 (1996). *
Regan, et al., "The Endothelial Cell Protein C Receptor--Inhibition of Activated Protein C Anticoagulant Function without Modulation of Reaction with Proteinase Inhibitors*," J. Biol. Chem. 271(29):17499-17503 (1996).
Regan, et al., The Endothelial Cell Protein C Receptor Inhibition of Activated Protein C Anticoagulant Function without Modulation of Reaction with Proteinase Inhibitors*, J. Biol. Chem. 271(29):17499 17503 (1996). *
Reitsma, et al., "Protein C Deficiency: A Database of Mutations, 1995 Update," Thromb. Haemost. 73:876-879 (1995).
Reitsma, et al., Protein C Deficiency: A Database of Mutations, 1995 Update, Thromb. Haemost. 73:876 879 (1995). *
Rezaie, et al., "Communication: Protein C Inhibitor Is a Potent Inhibitor of the Thrombin-Thrombomodulin Complex," J. Biol. Chem. 270(43):25336-25339 (1995).
Rezaie, et al., Communication: Protein C Inhibitor Is a Potent Inhibitor of the Thrombin Thrombomodulin Complex, J. Biol. Chem. 270(43):25336 25339 (1995). *
Takahashi, et al., "Circulating Thrombomodulin As a Novel Endothelial Cell Marker: Comparison of Its Behavior with von Willebrand Factor and Tissue Type Plasminogen Activator," Am. J. Hematol. 41:32-39 (1992).
Takahashi, et al., Circulating Thrombomodulin As a Novel Endothelial Cell Marker: Comparison of Its Behavior with von Willebrand Factor and Tissue Type Plasminogen Activator, Am. J. Hematol. 41:32 39 (1992). *
Takano, et al., "Plasma Thrombomodulin in Health and Diseases," Blood. 76(10):2024-2029 (1990).
Takano, et al., Plasma Thrombomodulin in Health and Diseases, Blood. 76(10):2024 2029 (1990). *
Tanaka, et al., "Increased Thrombomodulin Values in Plasma of Diabetic Men with Microangiopathy," Clin. Chem. 37(2):269-272 (1991).
Tanaka, et al., Increased Thrombomodulin Values in Plasma of Diabetic Men with Microangiopathy, Clin. Chem. 37(2):269 272 (1991). *
Taylor et al., "C4b-Binding Protein Exacerbates the Host Response to Escherichia coli," Blood 78(2):357-363 (1991).
Taylor et al., "Protein C Prevents the Coagulopathic and Lethal Effects of Escherichia coli Infusion in the Baboon," J. Clin. Invest. 79:918-925 (1987).
Taylor et al., C4b Binding Protein Exacerbates the Host Response to Escherichia coli , Blood 78(2):357 363 (1991). *
Taylor et al., Protein C Prevents the Coagulopathic and Lethal Effects of Escherichia coli Infusion in the Baboon, J. Clin. Invest. 79:918 925 (1987). *
von Heijne, "A New Method for Predicting Signal Sequence Cleavage Sites," Nucleic Acids Res. 14(11):4683-4690 (1986).
von Heijne, A New Method for Predicting Signal Sequence Cleavage Sites, Nucleic Acids Res. 14(11):4683 4690 (1986). *
Wada, et al., "Plasma Thrombomodulin as a Marker of Vascular Disorders in Thrombotic Thrombocytopenic Purpura and Disseminated Intravascular Coagulation," Am. J. Hematol. 39:20-24 (1992).
Wada, et al., Plasma Thrombomodulin as a Marker of Vascular Disorders in Thrombotic Thrombocytopenic Purpura and Disseminated Intravascular Coagulation, Am. J. Hematol. 39:20 24 (1992). *
Wen, et al., "Human Thrombomodulin: Complete cDNA Sequence and Chromosome Localization of the Gene," Biochemistry 26:4350-4357 (1987).
Wen, et al., Human Thrombomodulin: Complete cDNA Sequence and Chromosome Localization of the Gene, Biochemistry 26:4350 4357 (1987). *
Ye, et al., "The Active Site of Thrombin is Altered Upon Binding to Thrombomodulin--Two Distinct Structural Changes are Detected by Fluorescence, but only one Correlates with Protein C Activation," J. Biol. Chem., 266(34):23016-23021 (1991).
Ye, et al., "The Fifth and Sixth Growth Factor-like Domains of Thrombomodulin Bind to the Anion-binding Exosite of Thrombin and Alter Its Specificity," J. Biol. Chem. 267(16):11023-11028 (1992).
Ye, et al., The Active Site of Thrombin is Altered Upon Binding to Thrombomodulin Two Distinct Structural Changes are Detected by Fluorescence, but only one Correlates with Protein C Activation, J. Biol. Chem., 266(34):23016 23021 (1991). *
Ye, et al., The Fifth and Sixth Growth Factor like Domains of Thrombomodulin Bind to the Anion binding Exosite of Thrombin and Alter Its Specificity, J. Biol. Chem. 267(16):11023 11028 (1992). *

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7063843B1 (en) 1994-08-12 2006-06-20 Oklahoma Medical Research Foundation Cloning and regulation of an endothelial cell protein C/activated protein C receptor
US6399064B1 (en) 1994-08-12 2002-06-04 Oklahoma Medical Research Foundation Cloning and regulation of an endothelial cell protein C/activated protein C receptor
WO1999000673A1 (en) * 1997-06-27 1999-01-07 Oklahoma Medical Research Foundation Diagnostic assays using soluble endothelial cell protein c/activated protein c receptor
US6037450A (en) * 1997-06-27 2000-03-14 Oklahoma Medical Research Foundation Diagnostic assays using soluble endothelial cell protein C/activated protein C receptor
US6376169B1 (en) 1998-05-01 2002-04-23 Queens University At Kingston Method for diagnosing a vascular condition
US20020106634A1 (en) * 1998-05-01 2002-08-08 Adams Michael A. Method for diagnosing a vascular condition
US6953568B1 (en) 1998-08-25 2005-10-11 Oklahoma Medical Research Foundation Targeting of molecules to large vessel endothelium using EPCR
US20020068713A1 (en) * 2000-05-22 2002-06-06 Rade Jeffrey J. Genetic engineering of vascular grafts to resist disease
US7282488B2 (en) * 2000-05-22 2007-10-16 The Johns Hopkins Univeristy Genetic engineering of vascular grafts to resist disease
US7169573B2 (en) 2001-02-20 2007-01-30 Oklahoma Medical Research Foundation Method for monitoring coagulability and hypercoagulable states
AU2002245474B2 (en) * 2001-02-20 2007-05-17 Oklahoma Medical Research Foundation Monitoring soluble endothelial protein C receptor levels in anticoagulant therapy
WO2002066981A3 (en) * 2001-02-20 2003-04-24 Oklahoma Med Res Found Monitoring soluble endothelial protein c receptor levels in anticoagulant therapy
US20050032140A1 (en) * 2003-06-27 2005-02-10 Oklahoma Medical Research Foundation Methods for predicting susceptibility to cardiovascular disease
US9229010B2 (en) 2009-02-06 2016-01-05 Astute Medical, Inc. Methods and compositions for diagnosis and prognosis of renal injury and renal failure
WO2011012832A2 (en) 2009-07-30 2011-02-03 Université Pierre Et Marie Curie (Paris 6) Method for diagnosing a cancer, for determining the thrombotic risk in an individual stricken with a cancer and for determining the severity of a cancer in an individual

Also Published As

Publication number Publication date
JP2008164635A (en) 2008-07-17
DE69814634D1 (en) 2003-06-18
DE69814634T2 (en) 2004-03-25
CA2294647C (en) 2005-08-30
WO1999000673A1 (en) 1999-01-07
CA2427749A1 (en) 1999-01-07
JP2002193998A (en) 2002-07-10
ES2198727T3 (en) 2004-02-01
US6037450A (en) 2000-03-14
JP2001508876A (en) 2001-07-03
PT991946E (en) 2003-09-30
JP2003301000A (en) 2003-10-21
JP3553616B2 (en) 2004-08-11
CA2294647A1 (en) 1999-01-07
EP0991946A1 (en) 2000-04-12
AU748199B2 (en) 2002-05-30
AU8269498A (en) 1999-01-19
JP2006321811A (en) 2006-11-30
EP0991946B1 (en) 2003-05-14
JP4308900B2 (en) 2009-08-05
DK0991946T3 (en) 2003-09-08
ATE240523T1 (en) 2003-05-15

Similar Documents

Publication Publication Date Title
Kurosawa et al. Identification of functional endothelial protein C receptor in human plasma.
JP2008164635A (en) Diagnostic assay using soluble endothelial cell protein C / activated protein C receptor
Colman et al. Contact system: a vascular biology modulator with anticoagulant, profibrinolytic, antiadhesive, and proinflammatory attributes
Drake et al. Functional tissue factor is entirely cell surface expressed on lipopolysaccharide-stimulated human blood monocytes and a constitutively tissue factor-producing neoplastic cell line.
US6528299B1 (en) Protease for activating clotting factor VII
Ferro et al. High plasma levels of von Willebrand factor as a marker of endothelial perturbation in cirrhosis: relationship to endotoxemia
McConnell Inhibitors of kallikrein in human plasma
Scully et al. Activation of protein C and its distribution between its inhibitors, protein C inhibitor, α1-antitrypsin and α2-macroglobulin, in patients with disseminated intravascular coagulation
EP0690991B1 (en) Novel anticoagulant cofactor activity
Koppelman et al. Synergistic inhibition of the intrinsic factor X activation by protein S and C4b-binding protein
US20030124622A1 (en) Procedure for the determination of the activity of the protease which activates factor VII from protein solutions
Mohammed et al. High molecular weight kininogen interactions with the homologs prekallikrein and factor XI: importance to surface-induced coagulation
HARLEY et al. Fibrinogen up-regulates the expression of monocyte chemoattractant protein 1 in human saphenous vein endothelial cells
Kraus The anticoagulant potential of the protein C system in hereditary and acquired thrombophilia: pathomechanisms and new tools for assessing its clinical relevance
AU5593001A (en) Mutants of the factor VII-activating protease and detection methods using specific antibodies
Carson et al. Tissue factor and the extrinsic pathway of coagulation during
Lounes et al. Fibrinogen Alès: a homozygous case of dysfibrinogenemia (γ-Asp330→ Val) characterized by a defective fibrin polymerization site “a”
Weinstein et al. Abnormal factor VIII coagulant antigen in patients with renal dysfunction and in those with disseminated intravascular coagulation.
Austen Clinical Biochemistry of Blood Coagulation
Dahlbäck et al. Molecular coagulation and thrombophilia
Ingerslev Research methodologies in measurement of platelet function, endothelial proteins, coagulation factors and fibrinolysis
Moll et al. Coagulation disorders
Ford Thrombomodulin expression in adult and developing mice
Matsuo et al. Urinary excretion rate of antithrombin III related antigen in cerebral stroke
Berg et al. British Society for Haemostasis and

Legal Events

Date Code Title Description
AS Assignment

Owner name: NATIONAL INSTITUTE OF HEALTH, THE, MARYLAND

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:OKLAHOMA MEDICAL RESEARCH FOUNDATION;REEL/FRAME:008966/0330

Effective date: 19971218

AS Assignment

Owner name: HOWARD HUGHES MEDICAL INSTITUTE, MARYLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ESMON, CHARLES T.;REEL/FRAME:009167/0741

Effective date: 19970904

AS Assignment

Owner name: OKLAHOMA MEDICAL RESEARCH FOUNDATION, OKLAHOMA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ESMON, CHARLES T.;HOWARD HUGHES MEDICAL INSTITUTE;REEL/FRAME:009169/0062

Effective date: 19980409

STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: PAT HOLDER NO LONGER CLAIMS SMALL ENTITY STATUS, ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: STOL); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

REFU Refund

Free format text: REFUND - PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: R283); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 8

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:OKLAHOMA MEDICAL RESEARCH FOUNDATION;REEL/FRAME:021293/0858

Effective date: 19971218

FPAY Fee payment

Year of fee payment: 12