US5786144A - Method and compositions for identification of species origin of caviar - Google Patents

Method and compositions for identification of species origin of caviar Download PDF

Info

Publication number
US5786144A
US5786144A US08/647,584 US64758496A US5786144A US 5786144 A US5786144 A US 5786144A US 64758496 A US64758496 A US 64758496A US 5786144 A US5786144 A US 5786144A
Authority
US
United States
Prior art keywords
seq
dna
primer
species
type
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US08/647,584
Inventor
Rob DeSalle
Vadim J. Birstein
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
American Museum of Natural History
Original Assignee
American Museum of Natural History
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by American Museum of Natural History filed Critical American Museum of Natural History
Priority to US08/647,584 priority Critical patent/US5786144A/en
Priority to DE69714906T priority patent/DE69714906T2/en
Priority to PCT/US1997/008136 priority patent/WO1997043618A2/en
Priority to EP97107809A priority patent/EP0807690B1/en
Priority to AT97107809T priority patent/ATE222962T1/en
Assigned to AMERICAN MUSEUM OF NATURAL HISTORY, THE reassignment AMERICAN MUSEUM OF NATURAL HISTORY, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DESALLE, ROBERT J., BIRSTEIN, VADIM J.
Application granted granted Critical
Publication of US5786144A publication Critical patent/US5786144A/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes

Definitions

  • the present invention is related to the identification of the species origin of fish eggs and involves the use of the polymerase chain reaction (PCR) to amplify regions of the mitochondrial genome from total cellular DNA with species-specific primers and subsequent analysis of the PCR products.
  • PCR polymerase chain reaction
  • Sturgeons are primarily known as producers of caviar and uncontrolled overfishing threatens the survival of many species.
  • the three commercial Russian species inhabiting the Volga River-Caspian Sea basin, the beluga sturgeon, Huso huso, the Russian sturgeon, Acipenser gueldenstaedti, and the servuga sturgeon, A. stellatus, are especially vulnerable because of the great value of their eggs.
  • the beluga sturgeon is the source of beluga caviar, the most highly prized, while the Russian sturgeon yields osetra and the servuga sturgeon, servuga caviar. Identification of sturgeon species is essential for monitoring the use of these fish in the caviar industry as worldwide populations become smaller and smaller.
  • the large number of eggs required for a protein electrophoresis identification test is a further problem because commercial caviar can be a mixture of the roe from two or more sturgeon species. Such mixtures will yield electrophoresis patterns that will be the sum of the electrophoresis patterns of the mixed species. These mixed patterns are uninterpretable unless the component parts of the sum can be separately identified. Because a large quantity of eggs is required for the protein electrophoresis method, separation and identification of the component parts is impractical. Therefore, a reliable method for caviar species identification from single eggs is needed.
  • the present invention provides a method and compositions for species identification from small samples of fish tissue.
  • the method includes the use of the polymerase chain reaction (PCR) to amplify regions of the mitochondrial genome from total cellular DNA with species-specific primers and subsequent analysis of the PCR products.
  • PCR polymerase chain reaction
  • the method provides an accurate and rapid determination of the species of origin for a single egg of processed caviar.
  • Compositions for PCR primers specific for 27 species of sturgeon are provided.
  • the method includes the steps of: removing salt and other debris from the outer surface of a sample of caviar; isolating clean template DNA; running PCR on the clean template DNA using a cocktail of primers containing at least a pair of primers in which one primer is specific for a sturgeon species of interest and the other primer is a matched anchor; assaying the PCR reaction products and detecting the results.
  • the steps of the method may be repeated using primers specific for different species until a positive identification is made.
  • An embodiment of the invention relates to the composition of primers specific for servuga, osetra and beluga caviar species of origin and the composition of additional primers specific for the other twenty-four known, living species of sturgeon.
  • FIG. 1 shows the results of PCR assays run on DNA from single caviar eggs prepared using different procedures.
  • Panel A shows PCR products obtained from template DNA purified by boiling a single, crushed egg with 5% Chelex.
  • Panel B shows PCR products obtained from template DNA purified by phenol/chloroform extraction.
  • Lane 1 shows the results obtained when an egg was processed without washing;
  • Lane 2 shows results from eggs pre-washed with 0.525% sodium hypochlorite before crushing;
  • Lane 3 shows eggs pre-washed in homogenization buffer;
  • Lane 4 shows DNA preparation blanks; and
  • Lane 5 shows negative PCR controls. Only Lanes B2 and B3 show PCR products.
  • Lanes 6, 7 and 8 show PCR products produced from template DNA purified by the Chelex method from other sturgeon tissue; Lane 6 is the Chelex preparation blank, Lane 7 is a Chelex preparation from A. stellatus blood used as a positive control, and Lane 8 is a negative PCR control. Lanes 6, 7 and 8 in Panel B are deliberately left blank.
  • FIG. 2 shows the performance of three of the primer pairs used in the diagnosis of servuga (S), beluga (B), and osetra (G) caviar.
  • the following primer pairs were used in the reactions: B3/B3an (Panel B); S2/S2an (Panel S); and, G3/S2an (Panel G).
  • Lane a in all three panels is the PCR product generated from DNA made from caviar of the three species (from beluga caviar in Panel B, from servuga caviar in Panel S, and from osetra caviar in Panel G).
  • Lanes m and n in Panel B were PCR products from A. stellatus and A. gueldenstaedti, respectively.
  • Lanes d and e in Panel S were products from H. huso and A. gueldenstaedti, respectively.
  • Lanes d and e in Panel G were products from H. huso and A. stellatus, respectively.
  • Lanes n in Panel B, f in Panel S, and f in Panel G were PCR water negative controls.
  • FIG. 3 shows the results of a PCR assay on DNA isolated from single eggs from lots of commercially available caviar. DNA from five to ten individual eggs was isolated for each commercial lot. Only a single representative is shown from each odd-numbered lot as all eggs from a given lot gave the same results. Results for odd-numbered lots 1 through 21 are shown. PCR products using beluga (Panel B; B3/B3an), servuga (Panel S; S2/S2an) and osetra (Panel G; G3/S2an) primer pairs are shown in this figure. A fourth primer pair was used as a positive control and was designed to amplify all sturgeon samples (C).
  • FIG. 4 shows a flow chart for optimization of the PCR procedure.
  • the term "caviar” refers to edible fish eggs, processed by a number of methods known to those skilled in the art.
  • caviar is prepared from immature eggs still confined in the fish ovary in a hard, solid formation (hard roe).
  • caviar includes mature fish eggs, fresh, processed or preserved in alcohol and the like.
  • Caviar prepared as food product includes immature or mature eggs obtained from carp, herring, pollock, bleak, lumpfish, pink salmon, whitefish, chum salmon, trout, flying fish, and bowfish.
  • the source of the fish eggs is sturgeon or salmon roe, with sturgeon eggs being most preferable.
  • primer refers to a single stranded DNA oligonucleotide sequence, preferably produced synthetically, which is capable of acting as a point of initiation for synthesis of a primer extension product that is complementary to a nucleic acid strand to be copied.
  • the length of the primer must be sufficient to prime the synthesis of extension products in the presence of a polymerization enzyme.
  • the length of the primer is from about 10 to 50 nucleotides, more preferably from about 15 to 25, and most preferably from about 17 to 21 nucleotides.
  • Primers of the invention are of sufficient length that random priming does not occur; that is, the primers anneal only to unique and diagnostic segments of the genome. Longer primers may be used in the invention, although primers of no more than about 50 nucleotides are preferred when it is desirable to keep costs low.
  • the present invention is directed to a PCR-based process for determining the species source for a sample of caviar as small as one egg and is particularly well-suited to identify the three major sources of commercial caviar, osetra, servuga and beluga.
  • the method distinguishes osetra caviar, also known as oscetra and ossetra, which are processed immature eggs of the species A. gueldenstaedti, from beluga caviar (H. huso), from servuga caviar (A. stellatus), and from the eggs of all other known living species of sturgeon.
  • the species origin of a single egg from a sample of commercial caviar can conveniently and inexpensively be determined in about 8 hours or less.
  • a previously known method of Graves et al., for species identification by restriction fragment length polymorphism analysis of mtDNA obtained from single fresh or ethanol-preserved bass fish eggs requires several days to a week for processing as well as considerably more expensive materials.
  • the method of the present invention is based on the species specificity of the nucleotide sequences of mitochondrial genes. This specificity has been established through examination of sequenced parts of genes for 12S rRNA, 16S rRNA, and cytochrome b (cyt b) mitochondrial genes for all known living sturgeon species. Cyt b gene sequences are the most variable among sturgeon species and were used in the design of the sturgeon-species-specific primer systems. Ordinarily, primers for PCR amplification of DNA are designed to be specific to a constant region of a gene; that is, a region that is conserved across species. Primers specific to a variable region of any gene are useful only for amplification of DNA from the single species from which the gene was obtained, an object of the present invention.
  • the cyt b gene is well-suited as a primer template for the invention. It codes for a transmembrane protein, the imbedded portions of which are highly conserved across species. The protein makes seven loops through the membrane, all of which are conserved, whereas the regions of protein between the loops are variant.
  • the primers of the present invention are made to the DNA coding for the variant regions of the protein. In a similar fashion, primers made to the DNA coding for variable regions of other proteins may be employed in the process of the present invention.
  • a key feature of a primer of the invention is that it includes a diagnostic nucleotide position found within the variable region of several individuals known to belong to the species of interest.
  • An appropriate primer must give uniform results with all individuals of a species for that primer to be considered diagnostic for the species. In the case where only a small number of individuals for a species of interest is available, it is desirable to use multiple primers to identify the species to allow for individual variation.
  • the method of the present invention involves: preparing a sample of caviar by washing with an agent capable of removing salt and other debris from its outer surface; isolating clean template DNA from the sample; running PCR on the clean template DNA using a cocktail of sturgeon primers containing at least a pair of primers in which one member of the pair is a primer is specific for a sturgeon species of interest and the second member is a matched anchor primer; assaying the PCR reaction products and detecting the results.
  • the steps of the method may be repeated using primers specific for different species until a positive identification is made.
  • Removal of salt and other debris from the outer surface of commercially prepared caviar eggs prior to extraction of template DNA is an important aspect of the invention. This removal may be accomplished by washing with dilute saline solution, buffers such as DNA extraction buffer and the like, dilute aqueous acids or bases, and mild soap and detergent solutions such as sodium dodecyl sulfate (SDS) and the like.
  • concentration of an active ingredient in the washing solution is such that the solution removes salts and debris, but does not damage the integrity of the eggs being cleaned. Washing with DNA extraction buffer is preferred and washing with a 5-15% vol./vol. dilution of a standard 5.25% solution of sodium hypochlorite, such as commercial CloroxTM, is most preferred.
  • washing is meant that the egg or eggs being prepared are contacted with the cleaning solution and the liquid is allowed to run off, thus carrying away salts and any cellular or other debris.
  • about a milliliter of cleaning solution is added to a suitable container holding a single caviar egg, and the egg and solution are gently drawn up and down in a pipette for about three minutes. After the wash period, the solution is gently drawn off from the egg with a pipette such that the caviar is not punctured or otherwise disrupted.
  • Isolation of clean template DNA from the washed egg or eggs is the next step of the invention.
  • "Quick" DNA preparations that exist for the isolation of DNA from tissues for PCR experiments such as direct amplification (i.e., amplification of the eggs without actual DNA isolation) or Chelex preparations yield DNA of insufficient purity for use in the method of the present invention.
  • Methods yielding highly purified DNA such as ultracentrifugation in cesium chloride gradients and use of commercial preparation kits such as Sephadex spin columns and GeneClean (BIO 101) glass milk techniques and the like, may be used.
  • Suitable, highly purified DNA is free from enzymes, such as DNAses and RNases, and other proteins that may interfere with the activity of TAQ polymerase used in PCR amplification.
  • a phenol/chloroform extraction technique such as that described by DeSalle, R., et al. Methods in Enzymology. Vol. 224. Molecular Evolution: Producing the Biochemical Data (eds. Zimmer, E. A., et al.) 176-204 (Acad. Press, San Diego, 1993)!, is used. Briefly, a washed, then crushed, egg is treated with Proteinase K in a buffer at 60° C. for one hour, followed by extraction by centrifugation with aqueous phenol, then chloroform, then ethanol, yielding pelleted DNA. Such a preparation gives large amounts of clean template DNA (0.5 to 1.0 micrograms total DNA per egg) suitable for PCR reactions.
  • Running PCR using a cocktail of sturgeon primers containing at least a pair of primers in which one primer is specific for a species of interest to amplify the clean template DNA is a further step of the present invention.
  • Amplification of DNA using the polymerase chain reaction is known to those skilled in the art and is generally described in U.S. Pat. Nos. 4,683,195 and 4,683,202 to Mullis.
  • the PCR consists of many repetitions of a cycle that consists of: (a) a denaturation step, which melts both strands of a DNA molecule; (b) an annealing step, which allows added primers to anneal specifically to the melted strands of the DNA molecule; and (c) an extension step, which incorporates to the primers deoxyribonucleotides complementary to those of the strand of DNA to which the primers are annealed.
  • the PCR process may be conducted using a thermocycler apparatus, such as a Cetus Perkin-Elmer 486 Thermal Cycler and a 9600 Thermal Cycler.
  • the conditions used for the PCR will depend on the specific primers used for a given species of interest. The concentrations of primers and buffers used will be apparent from the Examples that follow.
  • the temperature for annealing primers to the template DNA for each primer is optimized as shown in FIG. 4. Beginning at the theoretical melting temperature (T M ) minus 5° C. (T M -5° C.), PCR is carried out. If a product is obtained, then no further optimization is required. If no PCR product is obtained, then the annealing temperature is lowered by 5° C. and the process continued until a product is obtained. To determine that this new temperature is indeed the optimum, the annealing temperature is increased by 1° C. increments until no product is observed.
  • the optimum annealing temperature is then established as 1° C. less than the temperature at which no product was produced. Optimization of the number of reaction cycles is dependant upon the concentration of the template DNA. In the method of the present invention, cycle numbers from about 20 to about 40 may be used, with about 25 to 30 cycles being preferred.
  • the PCR cycles are carried out with at least a pair of primers, one of which is specific for a species of interest, hereinafter the "diagnostic primer,” and the other is an “anchor primer.”
  • the present invention includes the composition of diagnostic primers specific for each of the three commercial Russian sturgeon species: H. huso (beluga), A. gueldenstaedti (osetra), and A. stellatus (sevruga).
  • the invention further includes the composition of primers specific for the other twenty-four known, living species of sturgeon.
  • the primers may be employed in the method of the present invention as pairs or as a mixture of primer pairs.
  • the primers in matched pairs with one diagnostic primer and one anchor primer is preferred in the case where the sample to be diagnosed is likely to be from one of the three most common commercial species. In the case where the presence of a less common species is suspected, use of a mixture, or "cocktail,” containing pairs of primers for identification of two or more species is preferred. In this embodiment, the method of the present invention may be repeated with fewer and fewer primer pairs until the species is positively identified. Alternatively, a cocktail containing diagnostic and anchor primers of varying lengths, such that the resultant PCR products will not overlap when run out on a gel for visualization, may be employed.
  • a matched anchor primer is designed downstream to the 3' end of the diagnostic member of the primer pair and for the other strand of the double helix. Since PCR proceeds best with two primers placed relatively close to each other (and on opposite strands), the anchor primer is designed to be specific for a part of the gene no more than about 250 nucleotides away from the diagnostic nucleotide position of the diagnostic primer.
  • the anchor primer sequence may begin one nucleotide away from the diagnostic position in either the 3' or the 5' direction, in the case where a complementary diagnostic primer sequence is used.
  • the anchor primer sequence occurs from about 50 to about 200 nucleotides away, and most preferably, from about 100 to about 200 nucleotides away.
  • the anchor primer is designed to work with as wide a range of species as possible.
  • the advantage of designing the anchor primer less than about 250 nucleotides away from the diagnostic nucleotide position of the diagnostic primer is that highly degraded DNA samples, such as might be expected from commercially treated caviar, will be amplifiable with such primers.
  • the primers are designed so that a high stringency PCR reaction with primers for a given species gives a positive reaction (a band of the correct length on an agarose gel) and a primer pair that is not specific for a particular species gives a negative reaction (a lack of the PCR band).
  • PCR primers are usually designed in a 5' to 3' direction.
  • the 3'-most base on the primer is critical, because if it does not match perfectly, synthesis is blocked.
  • Diagnostic and anchor primers of the invention match the diagnosable species in all positions of the primer, especially on the 3'-most nucleotide of the primer.
  • sequences of primers of the invention are given in the Examples following.
  • the diagnostic and anchor primers of the present invention may be synthesized using any suitable method known to those skilled in the art, such as phosphotriester and phosphodiester methods and the like. Conveniently, primers are synthesized by automated oligonucleotide synthesizers, such as those manufactured by ABI and OPERON. Primers may also be isolated from a naturally occuring or a genetically engineered biological source using appropriate restriction endonucleases that cut double-stranded DNA at or near a nucleotide sequence of interest.
  • a further step in the method of the present invention is detection of the PCR products.
  • the reactions may be assayed in a number of ways including separation of the products by gel electrophoresis and detection of the resulting bands.
  • the reaction products are preferably assayed on agarose gel in a suitable buffer, such as 1X Tris borate EDTA (TBE) and 1X Tris EDTA acetate (TEA) and the like.
  • TBE 1X Tris borate EDTA
  • TAA 1X Tris EDTA acetate
  • the gels may be stained by a variety of methods including with ethidium bromide, propidium iodide or silver.
  • the PCR product fragments may be radioactively end-labeled and visualized after autoradiography or a southern blot can be performed and the presence of fragments observed after probing with a radioactively labeled probe.
  • the gels are stained in ethidium bromide and the PCR products visualized under ultraviolet light. The presence/absence of a PCR product is easily detected by the presence or absence of a fluorescent PCR product band on the agarose gel. Positive PCR control reactions are run to ensure that the caviar DNA is of good enough quality to amplify. Negative PCR reactions are run to ensure that there are no contaminating factors that might obscure the results of the assay. Interpretation of the assay is straightforward: presence of a PCR product indicates a match with the target caviar DNA of the particular primer and absence of a PCR product indicates a mismatch with the target caviar DNA.
  • the primers of the invention may be provided as a kit.
  • the kit may contain appropriate amounts of primer pairs for various species of interest, suitable containers in which to carry out the steps of the invention, supplies of washing solutions, and the like, such that the method of the invention may be conveniently carried out.
  • An important advantage of the present invention is the capability of the method to isolate useable template DNA from a single egg of commercially processed caviar.
  • Commercial caviar can be a mixture of two or more species. Only by examining several eggs individually from a batch of caviar can this mixing be detected. PCR performed on DNA isolated from large batches of eggs can give positive signals for primers specific for multiple species, thereby causing possible inaccurate diagnosis of the species origin.
  • the method of the present invention is further advantageous because it allows identification of the species origin of caviar eggs that have been roughly treated or subjected to conditions that cause degradation of the DNA.
  • the present invention can be differentiated from other PCR-based species identification methods in that it depends upon diagnostic characteristics, the diagnostic nucleotide positions, found in all individuals within a species, but not found in individuals outside the species. Other methods, such as that of Davidson and Bartlett, rely on primers conserved across species, and across genera in some cases.
  • the method is therefore unlike conventional fingerprinting, in which one tries to match a found fingerprint against a collection of known fingerprints. Instead, a diagnostic characteristic identifies an individual as a member of a species, as a fingerprint can be identified as human or non-human.
  • the second method was the standard Chelex preparation (Walsh et al., Bio Techniques 10, 506-513 (1991)!, where a dilution series was also used to examine a range of preparation template concentrations.
  • the third method required treatment of a crushed egg in buffer with Proteinase K at 60° C. for one hour followed by a full phenol/chloroform preparation (DeSalle et al., 1993). The first two simple procedures did not produce suitable templates for PCR while the phenol/chloroform extraction procedure did. More importantly, the phenol preparation procedure produced a large quantity of suitable template in that over 1 ⁇ g of total DNA was easily isolated from a single egg.
  • FIG. 1 shows the results of PCR assays run on DNA from single caviar eggs prepared using different egg-washing and DNA extraction procedures.
  • Panel A shows PCR products obtained from template DNA purified by boiling a single, crushed egg with 5% Chelex DNA.
  • Panel B shows PCR products obtained from template DNA purified by phenol/chloroform extraction.
  • Lane 1 shows the results obtained when an egg was processed without washing;
  • Lane 2 shows results from eggs pre-washed with 0.525% sodium hypochlorite before crushing;
  • Lane 3 shows eggs pre-washed in homogenization buffer;
  • Lane 4 shows DNA preparation blanks; and Lane 5 shows negative PCR controls.
  • Lanes B2 and B3 show PCR products, demonstrating that the phenol/chloroform extraction procedure performed on eggs pre-washed with either 0.525% sodium hypochlorite or extraction buffer is satisfactory.
  • the Chelex procedure does produce PCR products when used to purify template DNA from other sturgeon tissue (blood from A. stellatus), as shown in Panel A, Lanes 6, 7 and 8.
  • Lane 6 Chelex preparation blank Lane 7 is a Chelex preparation from blood from A. stellatus used as a positive control, and Lane 8 is a negative PCR control. Lanes 6, 7 and 8 in Panel B are deliberately left blank.
  • Table 1 lists the sturgeon species used in this study and where they were obtained. With three exceptions (Acipenser brevirostrum, A. mikadoi, and A. oxyrinchus), blood samples were taken, mixed with buffer (100 mM Tris, 100 MM EDTA, and 2% SDS; 0.5 ml of blood and 5 ml of buffer), and the blood cells lysed in this solution were kept in a freezer at -70° C. Most Russian specimens examined were the same individuals used for DNA content measurements by Birstein et al., Genetica 73: 3-12 (1993). DNA was isolated from alcohol-fixed samples of muscles of Amia calva and Polypterus senegalus provided by Paul Vrana (American Museum of Natural History, New York).
  • PCR products of the mitochondrial genes (12S, 16S, and cytochrome b) were either GeneCleaned and directly sequenced or cloned into the TA vector (INVITROGEN) and sequenced (in such cases, at least two clones for each taxon were used to establish the sequence).
  • the following primers were used: in the 18S gene region, 18sai0.7 (5'-ATTAAAGTTGTTGCGGTTT-3') (SEQ ID NO: 1) and 18sai0.79 (5'-GGTGGCATTTTATTTTATTAGAGG-3') (SEQ ID NO:2) and 12SB (5'-CCGGTCTGAACTCAGATCACGT-3') (SEQ ID NO:3) Kocher et al., Proc. Natl. Acad.
  • DNA was isolated from single eggs after washing with 5.25% sodium hypochlorite by crushing the egg in homogenization buffer followed by Proteinase K (1 mg/ml final concentration) digestion for one hour at 65° C. Standard phenol/chloroform extraction (DeSalle et al., 1993) followed by two ethanol precipitations was performed to purify the DNA for PCR. PCR was performed using the primer pair (with one diagnostic primer and one anchor primer) indicated in Table 2 at 10M in 25 Ktl reactions. Gel electrophoresis results are shown in FIG. 2. DNA from 11 individuals of H. huso (Panel B, Lanes b through 1), two individuals of A. stellatus (Panel S, Lanes b and c) and two individuals of A.
  • gueldenstaedti (Panel G, Lanes b and c) was isolated from either tissue or blood and used as template for PCR reactions.
  • Lane a in all three Panels is the PCR product generated from DNA made from caviar of the three species (from beluga caviar in Panel B, from servuga caviar in Panel S, and from osetra caviar in Panel G).
  • Lanes m and n in Panel B were PCR products from A. stellatus and A. gueldenstaedti, respectively.
  • Lanes d and e in Panel S were products from H. huso and A. gueldenstaedti, respectively.
  • Lanes d and e in Panel G were products from H.
  • Lanes n in Panel B, f in Panel S, and f in Panel G were PCR water negative controls.
  • the following primer pairs (see Table 2) were used in the reactions: B3/B3an (Panel B); S2/S2an (Panel S); and, G3/S2an (Panel G).
  • the PCR conditions were 94° C. for 1 minute, 55° C. for 1 minute, and 72° C. for 1 minute for 25 cycles.
  • PCR products were assayed on 1.5% agarose in 1X TBE at 140 V for 20 to 30 minutes in a BioRad miniature submersible electrophoresis rig. DNA was visualized under UV light after staining the gel in ethidium bromide. For all figures the gels were photographed using Polaroid film and scanned into Adobe Photoshop and manipulated using this program.
  • the G primers were difficult to design as entirely specific for A. gueldenstaedti (osetra) because of the close relatedness of this species to the other members of the clade of Eurasian sturgeons (A. baieri, A. persicus, A. naccarii, A. nudiventris, and A. dabryanus). Hence, two primers were designed that in combination could diagnose the osetra caviar.
  • the G3 primer pair is specific for A. gueldenstaedti, A. persicus, A. naccarii, A. baerii, A. nudiventris, A. dabryanus, and A. brevirostrum.
  • the G4 primer pair is specific for A. gueldenstaedti, Scaphirhynchus albus, Polyodon spathula, and Psephurus gladius.
  • DNA is isolated from single eggs after washing with 5.25% sodium hypochlorite by crushing the egg in homogenization buffer followed by Proteinase K (1 mg/ml final concentration) digestion for one hour at 65° C. Standard phenol/chloroform extraction (DeSalle et al., 1993) followed by two ethanol precipitations is performed to purify the DNA for PCR.
  • PCR is performed as described in the previous examples using a cocktail made up of two or more primer pairs, where one member of the pair is a diagnostic primer given in Table 3 and the other member of the pair is a matched anchor primer. PCR products are assayed on 1.5% agarose in 1X TBE at 140 V for 20 to 30 minutes in a BioRad miniature submersible electrophoresis rig. DNA is visualized under UV light after staining the gel in ethidium bromide. If no PCR products are visible, the process is repeated with other cocktails of primer pairs until the species origin of the sample is identified.
  • Table 3 lists sequences in the 5' to 3' direction for primers specific to the sturgeon species given.
  • the diagnostic 3'-most base is designated by a space between it and the rest of the primer.
  • Table 4 lists sequences in the 3' to 5' direction for additional diagnostic primers for the sturgeon species given.
  • the diagnostic 3'-most base is designated by a space between it and the rest of the primer.
  • the primer code used for these "reverse" primers includes a lower case "r" to indicate that these sequences run in the 3' to 5' direction.
  • the sturgeon genus is Acipenser unless otherwise specified.
  • Samples 4 and 12 were the only samples that were negative for all three primer pairs, but positive for the control primers.
  • Control PCR of these three lots of caviar as well as lots Nos. 1, 9, 13, and 16 were GeneCleaned and sequenced to determine the source species used for making these caviars (see Table 5). As is evident from Table 5, the source species for five of the twenty-five commercial samples of caviar tested did not correspond to the species given on the product label.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Dental Preparations (AREA)

Abstract

The present invention provides a method and compositions for species identification from small samples of fish tissue. The method includes the use of the polymerase chain reaction (PCR) to amplify regions of the mitochondrial genome from total cellular DNA with species-specific primers and subsequent analysis of the PCR products. The method provides an accurate and rapid determination of the species of origin for a single egg of processed caviar. Compositions for PCR primers specific for 27 species of sturgeon are provided.

Description

INTRODUCTION TECHNICAL FIELD
The present invention is related to the identification of the species origin of fish eggs and involves the use of the polymerase chain reaction (PCR) to amplify regions of the mitochondrial genome from total cellular DNA with species-specific primers and subsequent analysis of the PCR products.
BACKGROUND
Species identification using genetic markers has become an important part of conservation studies in vertebrates. The order Acipenseriformes is an ancient group of fishes ("living fossils"), which includes sturgeons from the family Acipenseridae and paddlefishes from the family Polyodontidae (Gardiner, B. G. in Living Fossils, eds., Eldredge, N. & Stanley, S. M., Springer Verlag, New York, 1984, pp. 148-152). Almost all of the 27 members of the order Acipenseriformes are now endangered Birstein, V. J. Conserv. Biol. 7, 773-787 (1993)!. Sturgeons are primarily known as producers of caviar and uncontrolled overfishing threatens the survival of many species. The three commercial Russian species inhabiting the Volga River-Caspian Sea basin, the beluga sturgeon, Huso huso, the Russian sturgeon, Acipenser gueldenstaedti, and the servuga sturgeon, A. stellatus, are especially vulnerable because of the great value of their eggs. The beluga sturgeon is the source of beluga caviar, the most highly prized, while the Russian sturgeon yields osetra and the servuga sturgeon, servuga caviar. Identification of sturgeon species is essential for monitoring the use of these fish in the caviar industry as worldwide populations become smaller and smaller.
In the absence of a reliable method of species identification, caviar dealers have relied upon the appearance, smell, texture and color of the roe and the size of eggs in a crude attempt to identify a particular shipment of caviar by species. Isoelectric focusing of egg soluble proteins on ultrathin polyacrylamide gels has been used for caviar species identification Rehbein, H. Z. Lebensm. Unters. Forsch. 180, 457-462 (1985)!. This approach suffers from the fact that large amounts (2-20 g or roughly 100 and more eggs) of material are needed for the assay. Also, this method can be unreliable Keyvanfar, A. C., et al., R. Acad. Sci. Paris 304, Ser. III, 191-193 (1987); Keyvanfar, A. Ann. Inst. Oceanogr. (Paris) 64, 25-64 (1988)!.
An international demand for high quality caviar encourages poaching in regulated, but overfished commercial sturgeon populations. Fragile, traditionally non-commercial species are being increasingly substituted for the disappearing commercial species. A reliable, inexpensive species identification test for monitoring the production and importation of caviar is important for purposes of enforcing conservation strategies throughout the world.
The large number of eggs required for a protein electrophoresis identification test is a further problem because commercial caviar can be a mixture of the roe from two or more sturgeon species. Such mixtures will yield electrophoresis patterns that will be the sum of the electrophoresis patterns of the mixed species. These mixed patterns are uninterpretable unless the component parts of the sum can be separately identified. Because a large quantity of eggs is required for the protein electrophoresis method, separation and identification of the component parts is impractical. Therefore, a reliable method for caviar species identification from single eggs is needed.
Relevant Literature
Full and partial sequences for various mitochrondrial genes for certain sturgeon species are known: J. R. Brown et al., Nucl. Acids Res. 17(11) 4389 (1989); J. R. Brown et al., Genetics 142, 525-535 (1996); T.-L. Ong et al., Copeia 2,464,469 (1996); and A. L. Miracle and D. E. Campton J. Heredity 86(1), 22-27 (1995).
Amato and Gatesy used PCR assays involving mtDNA species-specific haplotypes in crocodiles and caiman to identify the species source of skins used in the production of leather items "PCR assays of variable nucleotide sites for identification of conservation units," in Molecular Approaches to Ecology and Evolution, Schierwater, B. et al., eds., 215-226 (1993)!. Baker and Palumbi identified the species origin of processed whale meat using a portable laboratory equipped to perform the polymerase chain reaction Science 265, 1538-1539 (1994)!. Cronin, et al., Wildl. Soc. Bull. 19: 94-105 (1991)! and Milner-Gulland and Mace Biol. Conservation 55: 215-229 (1991)! have also used genetic markers in conservation studies.
Graves et al. used restriction fragment length polymorphism techniques on mtDNA obtained from various Paralabrax (bass) tissues including a single mature egg to identify different species Fish. Bull. 88. 59-66 (1989)!. Davidson and Bartlett, PCT application WO 92/05277, disclose a PCR-based method for determining the genus species origin of processed food products and PCR primer compositions comprised of coding sequences of cyt b genes of tuna fish species.
SUMMARY OF THE INVENTION
The present invention provides a method and compositions for species identification from small samples of fish tissue. The method includes the use of the polymerase chain reaction (PCR) to amplify regions of the mitochondrial genome from total cellular DNA with species-specific primers and subsequent analysis of the PCR products. The method provides an accurate and rapid determination of the species of origin for a single egg of processed caviar. Compositions for PCR primers specific for 27 species of sturgeon are provided.
The method includes the steps of: removing salt and other debris from the outer surface of a sample of caviar; isolating clean template DNA; running PCR on the clean template DNA using a cocktail of primers containing at least a pair of primers in which one primer is specific for a sturgeon species of interest and the other primer is a matched anchor; assaying the PCR reaction products and detecting the results. Optionally, the steps of the method may be repeated using primers specific for different species until a positive identification is made. An embodiment of the invention relates to the composition of primers specific for servuga, osetra and beluga caviar species of origin and the composition of additional primers specific for the other twenty-four known, living species of sturgeon.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the results of PCR assays run on DNA from single caviar eggs prepared using different procedures. Panel A shows PCR products obtained from template DNA purified by boiling a single, crushed egg with 5% Chelex. Panel B shows PCR products obtained from template DNA purified by phenol/chloroform extraction. In both Panels, Lane 1 shows the results obtained when an egg was processed without washing; Lane 2 shows results from eggs pre-washed with 0.525% sodium hypochlorite before crushing; Lane 3 shows eggs pre-washed in homogenization buffer; Lane 4 shows DNA preparation blanks; and Lane 5 shows negative PCR controls. Only Lanes B2 and B3 show PCR products. Panel A, Lanes 6, 7 and 8 show PCR products produced from template DNA purified by the Chelex method from other sturgeon tissue; Lane 6 is the Chelex preparation blank, Lane 7 is a Chelex preparation from A. stellatus blood used as a positive control, and Lane 8 is a negative PCR control. Lanes 6, 7 and 8 in Panel B are deliberately left blank.
FIG. 2 shows the performance of three of the primer pairs used in the diagnosis of servuga (S), beluga (B), and osetra (G) caviar. The following primer pairs were used in the reactions: B3/B3an (Panel B); S2/S2an (Panel S); and, G3/S2an (Panel G). Lane a in all three panels is the PCR product generated from DNA made from caviar of the three species (from beluga caviar in Panel B, from servuga caviar in Panel S, and from osetra caviar in Panel G). Lanes m and n in Panel B were PCR products from A. stellatus and A. gueldenstaedti, respectively. Lanes d and e in Panel S were products from H. huso and A. gueldenstaedti, respectively. Lanes d and e in Panel G were products from H. huso and A. stellatus, respectively. Lanes n in Panel B, f in Panel S, and f in Panel G were PCR water negative controls.
FIG. 3 shows the results of a PCR assay on DNA isolated from single eggs from lots of commercially available caviar. DNA from five to ten individual eggs was isolated for each commercial lot. Only a single representative is shown from each odd-numbered lot as all eggs from a given lot gave the same results. Results for odd-numbered lots 1 through 21 are shown. PCR products using beluga (Panel B; B3/B3an), servuga (Panel S; S2/S2an) and osetra (Panel G; G3/S2an) primer pairs are shown in this figure. A fourth primer pair was used as a positive control and was designed to amplify all sturgeon samples (C).
FIG. 4 shows a flow chart for optimization of the PCR procedure.
DETAILED DESCRIPTION OF THE SPECIFIC EMBODIMENTS
As used herein, the term "caviar" refers to edible fish eggs, processed by a number of methods known to those skilled in the art. In the case of commercially available food product, caviar is prepared from immature eggs still confined in the fish ovary in a hard, solid formation (hard roe). Alternatively, caviar includes mature fish eggs, fresh, processed or preserved in alcohol and the like. Caviar prepared as food product includes immature or mature eggs obtained from carp, herring, pollock, bleak, lumpfish, pink salmon, whitefish, chum salmon, trout, flying fish, and bowfish. Preferably, the source of the fish eggs is sturgeon or salmon roe, with sturgeon eggs being most preferable.
The term "primer," as used herein, refers to a single stranded DNA oligonucleotide sequence, preferably produced synthetically, which is capable of acting as a point of initiation for synthesis of a primer extension product that is complementary to a nucleic acid strand to be copied. In the case of primers intended for use in synthesizing mitochondrial DNA molecules by PCR products, the length of the primer must be sufficient to prime the synthesis of extension products in the presence of a polymerization enzyme. Preferably, the length of the primer is from about 10 to 50 nucleotides, more preferably from about 15 to 25, and most preferably from about 17 to 21 nucleotides. Primers of the invention are of sufficient length that random priming does not occur; that is, the primers anneal only to unique and diagnostic segments of the genome. Longer primers may be used in the invention, although primers of no more than about 50 nucleotides are preferred when it is desirable to keep costs low.
The present invention is directed to a PCR-based process for determining the species source for a sample of caviar as small as one egg and is particularly well-suited to identify the three major sources of commercial caviar, osetra, servuga and beluga. Specifically, the method distinguishes osetra caviar, also known as oscetra and ossetra, which are processed immature eggs of the species A. gueldenstaedti, from beluga caviar (H. huso), from servuga caviar (A. stellatus), and from the eggs of all other known living species of sturgeon. Using the method of the present invention, the species origin of a single egg from a sample of commercial caviar can conveniently and inexpensively be determined in about 8 hours or less. A previously known method of Graves et al., for species identification by restriction fragment length polymorphism analysis of mtDNA obtained from single fresh or ethanol-preserved bass fish eggs requires several days to a week for processing as well as considerably more expensive materials.
The method of the present invention is based on the species specificity of the nucleotide sequences of mitochondrial genes. This specificity has been established through examination of sequenced parts of genes for 12S rRNA, 16S rRNA, and cytochrome b (cyt b) mitochondrial genes for all known living sturgeon species. Cyt b gene sequences are the most variable among sturgeon species and were used in the design of the sturgeon-species-specific primer systems. Ordinarily, primers for PCR amplification of DNA are designed to be specific to a constant region of a gene; that is, a region that is conserved across species. Primers specific to a variable region of any gene are useful only for amplification of DNA from the single species from which the gene was obtained, an object of the present invention.
The cyt b gene is well-suited as a primer template for the invention. It codes for a transmembrane protein, the imbedded portions of which are highly conserved across species. The protein makes seven loops through the membrane, all of which are conserved, whereas the regions of protein between the loops are variant. The primers of the present invention are made to the DNA coding for the variant regions of the protein. In a similar fashion, primers made to the DNA coding for variable regions of other proteins may be employed in the process of the present invention.
A key feature of a primer of the invention is that it includes a diagnostic nucleotide position found within the variable region of several individuals known to belong to the species of interest. An appropriate primer must give uniform results with all individuals of a species for that primer to be considered diagnostic for the species. In the case where only a small number of individuals for a species of interest is available, it is desirable to use multiple primers to identify the species to allow for individual variation.
Generally, the method of the present invention involves: preparing a sample of caviar by washing with an agent capable of removing salt and other debris from its outer surface; isolating clean template DNA from the sample; running PCR on the clean template DNA using a cocktail of sturgeon primers containing at least a pair of primers in which one member of the pair is a primer is specific for a sturgeon species of interest and the second member is a matched anchor primer; assaying the PCR reaction products and detecting the results. Optionally, the steps of the method may be repeated using primers specific for different species until a positive identification is made.
Removal of salt and other debris from the outer surface of commercially prepared caviar eggs prior to extraction of template DNA is an important aspect of the invention. This removal may be accomplished by washing with dilute saline solution, buffers such as DNA extraction buffer and the like, dilute aqueous acids or bases, and mild soap and detergent solutions such as sodium dodecyl sulfate (SDS) and the like. The concentration of an active ingredient in the washing solution is such that the solution removes salts and debris, but does not damage the integrity of the eggs being cleaned. Washing with DNA extraction buffer is preferred and washing with a 5-15% vol./vol. dilution of a standard 5.25% solution of sodium hypochlorite, such as commercial Clorox™, is most preferred. By "washing" is meant that the egg or eggs being prepared are contacted with the cleaning solution and the liquid is allowed to run off, thus carrying away salts and any cellular or other debris. Conveniently, about a milliliter of cleaning solution is added to a suitable container holding a single caviar egg, and the egg and solution are gently drawn up and down in a pipette for about three minutes. After the wash period, the solution is gently drawn off from the egg with a pipette such that the caviar is not punctured or otherwise disrupted.
Isolation of clean template DNA from the washed egg or eggs is the next step of the invention. "Quick" DNA preparations that exist for the isolation of DNA from tissues for PCR experiments such as direct amplification (i.e., amplification of the eggs without actual DNA isolation) or Chelex preparations yield DNA of insufficient purity for use in the method of the present invention. Methods yielding highly purified DNA, such as ultracentrifugation in cesium chloride gradients and use of commercial preparation kits such as Sephadex spin columns and GeneClean (BIO 101) glass milk techniques and the like, may be used. Suitable, highly purified DNA is free from enzymes, such as DNAses and RNases, and other proteins that may interfere with the activity of TAQ polymerase used in PCR amplification. Preferably, a phenol/chloroform extraction technique, such as that described by DeSalle, R., et al. Methods in Enzymology. Vol. 224. Molecular Evolution: Producing the Biochemical Data (eds. Zimmer, E. A., et al.) 176-204 (Acad. Press, San Diego, 1993)!, is used. Briefly, a washed, then crushed, egg is treated with Proteinase K in a buffer at 60° C. for one hour, followed by extraction by centrifugation with aqueous phenol, then chloroform, then ethanol, yielding pelleted DNA. Such a preparation gives large amounts of clean template DNA (0.5 to 1.0 micrograms total DNA per egg) suitable for PCR reactions.
Running PCR using a cocktail of sturgeon primers containing at least a pair of primers in which one primer is specific for a species of interest to amplify the clean template DNA is a further step of the present invention. Amplification of DNA using the polymerase chain reaction is known to those skilled in the art and is generally described in U.S. Pat. Nos. 4,683,195 and 4,683,202 to Mullis. In general, the PCR consists of many repetitions of a cycle that consists of: (a) a denaturation step, which melts both strands of a DNA molecule; (b) an annealing step, which allows added primers to anneal specifically to the melted strands of the DNA molecule; and (c) an extension step, which incorporates to the primers deoxyribonucleotides complementary to those of the strand of DNA to which the primers are annealed. The PCR process may be conducted using a thermocycler apparatus, such as a Cetus Perkin-Elmer 486 Thermal Cycler and a 9600 Thermal Cycler.
The conditions used for the PCR will depend on the specific primers used for a given species of interest. The concentrations of primers and buffers used will be apparent from the Examples that follow. The temperature for annealing primers to the template DNA for each primer is optimized as shown in FIG. 4. Beginning at the theoretical melting temperature (TM) minus 5° C. (TM -5° C.), PCR is carried out. If a product is obtained, then no further optimization is required. If no PCR product is obtained, then the annealing temperature is lowered by 5° C. and the process continued until a product is obtained. To determine that this new temperature is indeed the optimum, the annealing temperature is increased by 1° C. increments until no product is observed. The optimum annealing temperature is then established as 1° C. less than the temperature at which no product was produced. Optimization of the number of reaction cycles is dependant upon the concentration of the template DNA. In the method of the present invention, cycle numbers from about 20 to about 40 may be used, with about 25 to 30 cycles being preferred.
The PCR cycles are carried out with at least a pair of primers, one of which is specific for a species of interest, hereinafter the "diagnostic primer," and the other is an "anchor primer." The present invention includes the composition of diagnostic primers specific for each of the three commercial Russian sturgeon species: H. huso (beluga), A. gueldenstaedti (osetra), and A. stellatus (sevruga). The invention further includes the composition of primers specific for the other twenty-four known, living species of sturgeon. The primers may be employed in the method of the present invention as pairs or as a mixture of primer pairs. Employing the primers in matched pairs with one diagnostic primer and one anchor primer is preferred in the case where the sample to be diagnosed is likely to be from one of the three most common commercial species. In the case where the presence of a less common species is suspected, use of a mixture, or "cocktail," containing pairs of primers for identification of two or more species is preferred. In this embodiment, the method of the present invention may be repeated with fewer and fewer primer pairs until the species is positively identified. Alternatively, a cocktail containing diagnostic and anchor primers of varying lengths, such that the resultant PCR products will not overlap when run out on a gel for visualization, may be employed.
A matched anchor primer is designed downstream to the 3' end of the diagnostic member of the primer pair and for the other strand of the double helix. Since PCR proceeds best with two primers placed relatively close to each other (and on opposite strands), the anchor primer is designed to be specific for a part of the gene no more than about 250 nucleotides away from the diagnostic nucleotide position of the diagnostic primer. The anchor primer sequence may begin one nucleotide away from the diagnostic position in either the 3' or the 5' direction, in the case where a complementary diagnostic primer sequence is used. Preferably, the anchor primer sequence occurs from about 50 to about 200 nucleotides away, and most preferably, from about 100 to about 200 nucleotides away. The anchor primer is designed to work with as wide a range of species as possible. The advantage of designing the anchor primer less than about 250 nucleotides away from the diagnostic nucleotide position of the diagnostic primer is that highly degraded DNA samples, such as might be expected from commercially treated caviar, will be amplifiable with such primers. The primers are designed so that a high stringency PCR reaction with primers for a given species gives a positive reaction (a band of the correct length on an agarose gel) and a primer pair that is not specific for a particular species gives a negative reaction (a lack of the PCR band).
Since DNA is synthesized in a 5' to 3' direction and a primer is necessary for synthesis, PCR primers are usually designed in a 5' to 3' direction. The 3'-most base on the primer is critical, because if it does not match perfectly, synthesis is blocked. Diagnostic and anchor primers of the invention match the diagnosable species in all positions of the primer, especially on the 3'-most nucleotide of the primer. The sequences of primers of the invention are given in the Examples following.
The diagnostic and anchor primers of the present invention may be synthesized using any suitable method known to those skilled in the art, such as phosphotriester and phosphodiester methods and the like. Conveniently, primers are synthesized by automated oligonucleotide synthesizers, such as those manufactured by ABI and OPERON. Primers may also be isolated from a naturally occuring or a genetically engineered biological source using appropriate restriction endonucleases that cut double-stranded DNA at or near a nucleotide sequence of interest.
A further step in the method of the present invention is detection of the PCR products. The reactions may be assayed in a number of ways including separation of the products by gel electrophoresis and detection of the resulting bands. The reaction products are preferably assayed on agarose gel in a suitable buffer, such as 1X Tris borate EDTA (TBE) and 1X Tris EDTA acetate (TEA) and the like. The gels may be stained by a variety of methods including with ethidium bromide, propidium iodide or silver. Alternatively, the PCR product fragments may be radioactively end-labeled and visualized after autoradiography or a southern blot can be performed and the presence of fragments observed after probing with a radioactively labeled probe. Preferably, the gels are stained in ethidium bromide and the PCR products visualized under ultraviolet light. The presence/absence of a PCR product is easily detected by the presence or absence of a fluorescent PCR product band on the agarose gel. Positive PCR control reactions are run to ensure that the caviar DNA is of good enough quality to amplify. Negative PCR reactions are run to ensure that there are no contaminating factors that might obscure the results of the assay. Interpretation of the assay is straightforward: presence of a PCR product indicates a match with the target caviar DNA of the particular primer and absence of a PCR product indicates a mismatch with the target caviar DNA.
The primers of the invention, and, optionally, the materials needed to perform the PCR reaction and analysis, may be provided as a kit. The kit may contain appropriate amounts of primer pairs for various species of interest, suitable containers in which to carry out the steps of the invention, supplies of washing solutions, and the like, such that the method of the invention may be conveniently carried out.
An important advantage of the present invention is the capability of the method to isolate useable template DNA from a single egg of commercially processed caviar. Commercial caviar can be a mixture of two or more species. Only by examining several eggs individually from a batch of caviar can this mixing be detected. PCR performed on DNA isolated from large batches of eggs can give positive signals for primers specific for multiple species, thereby causing possible inaccurate diagnosis of the species origin. The method of the present invention is further advantageous because it allows identification of the species origin of caviar eggs that have been roughly treated or subjected to conditions that cause degradation of the DNA.
The present invention can be differentiated from other PCR-based species identification methods in that it depends upon diagnostic characteristics, the diagnostic nucleotide positions, found in all individuals within a species, but not found in individuals outside the species. Other methods, such as that of Davidson and Bartlett, rely on primers conserved across species, and across genera in some cases. The method is therefore unlike conventional fingerprinting, in which one tries to match a found fingerprint against a collection of known fingerprints. Instead, a diagnostic characteristic identifies an individual as a member of a species, as a fingerprint can be identified as human or non-human.
The invention is illustrated by the following non-limiting examples.
EXAMPLES Example I Optimization of Method for Preparation of DNA for PCR from Caviar
The amount of gross sample preparation required for single caviar eggs before DNA extraction was first determined. Eggs were treated by different methods, then their total DNA extracted by a standard phenol/chloroform method DeSalle, R., et al., in Methods in Enzymology. Vol. 224. Molecular Evolution: Producing the Biochemical Data (eds. Zimmer, E. A., et al.) 176-204 (Acad. Press, San Diego, 1993)!, the DNA used as a template for PCR using 150-base control universal primers (Palumbi et al., The Simple Fool's Guide to PCR, Version 2, 1991), the PCR products run on 1X TBE 1.0% agarose gels, and the products visualized using ethidium bromide staining and observation under UV light.
Three extraction procedures for the isolation of DNA from processed caviar were tested. The first was a very simple procedure where a single egg was crushed in 100 microliters of 1X PCR buffer. A dilution series of this preparation was performed to examine the suitability of such extracts as templates for PCR. The second method was the standard Chelex preparation (Walsh et al., Bio Techniques 10, 506-513 (1991)!, where a dilution series was also used to examine a range of preparation template concentrations. The third method required treatment of a crushed egg in buffer with Proteinase K at 60° C. for one hour followed by a full phenol/chloroform preparation (DeSalle et al., 1993). The first two simple procedures did not produce suitable templates for PCR while the phenol/chloroform extraction procedure did. More importantly, the phenol preparation procedure produced a large quantity of suitable template in that over 1 μg of total DNA was easily isolated from a single egg.
FIG. 1 shows the results of PCR assays run on DNA from single caviar eggs prepared using different egg-washing and DNA extraction procedures. Panel A shows PCR products obtained from template DNA purified by boiling a single, crushed egg with 5% Chelex DNA. Panel B shows PCR products obtained from template DNA purified by phenol/chloroform extraction. In both Panels, Lane 1 shows the results obtained when an egg was processed without washing; Lane 2 shows results from eggs pre-washed with 0.525% sodium hypochlorite before crushing; Lane 3 shows eggs pre-washed in homogenization buffer; Lane 4 shows DNA preparation blanks; and Lane 5 shows negative PCR controls. Only Lanes B2 and B3 show PCR products, demonstrating that the phenol/chloroform extraction procedure performed on eggs pre-washed with either 0.525% sodium hypochlorite or extraction buffer is satisfactory. The Chelex procedure does produce PCR products when used to purify template DNA from other sturgeon tissue (blood from A. stellatus), as shown in Panel A, Lanes 6, 7 and 8. Lane 6 Chelex preparation blank, Lane 7 is a Chelex preparation from blood from A. stellatus used as a positive control, and Lane 8 is a negative PCR control. Lanes 6, 7 and 8 in Panel B are deliberately left blank.
Example II Construction of Sturgeon Genetic Database
Table 1 lists the sturgeon species used in this study and where they were obtained. With three exceptions (Acipenser brevirostrum, A. mikadoi, and A. oxyrinchus), blood samples were taken, mixed with buffer (100 mM Tris, 100 MM EDTA, and 2% SDS; 0.5 ml of blood and 5 ml of buffer), and the blood cells lysed in this solution were kept in a freezer at -70° C. Most Russian specimens examined were the same individuals used for DNA content measurements by Birstein et al., Genetica 73: 3-12 (1993). DNA was isolated from alcohol-fixed samples of muscles of Amia calva and Polypterus senegalus provided by Paul Vrana (American Museum of Natural History, New York).
DNA was isolated from each sample using a standard phenol/chloroform preparation (DeSalle et al., 1993). Partial sequences of three ribosomal genes (two mitochondrial 12S and 16S! and one nuclear 18S!) and over 600 bases of the mitochondrial cytochrome b gene were examined for all of the species listed in Table 1. PCR products were prepared for DNA sequencing in several ways. In all cases the nuclear 18S rDNA fragments were GeneCleaned (BIO 101; Palumbi et al., The Simple Fool's Guide to PCR, Version 2, 1991) and directly sequenced. PCR products of the mitochondrial genes (12S, 16S, and cytochrome b) were either GeneCleaned and directly sequenced or cloned into the TA vector (INVITROGEN) and sequenced (in such cases, at least two clones for each taxon were used to establish the sequence). The following primers were used: in the 18S gene region, 18sai0.7 (5'-ATTAAAGTTGTTGCGGTTT-3') (SEQ ID NO: 1) and 18sai0.79 (5'-GGTGGCATTTTATTTTATTAGAGG-3') (SEQ ID NO:2) and 12SB (5'-CCGGTCTGAACTCAGATCACGT-3') (SEQ ID NO:3) Kocher et al., Proc. Natl. Acad. Sci. USA, 86: 6196-6200 (1989); Hedges et al., Herpetological Monographs, 7: 64-76 (1993)!, in the 16S gene region 16SA (5'-CGCCTGTTTACCAAAACAT-3') (SEQ ID NO:4) and 16SB (5'-CCGGTCTGAATCAGATCACGT-3') (SEQ ID NO:5) Palumbi et al. 1991), and in the cytochrome b region, H15149 (5'-AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA-3') (SEQ ID NO:6) (ocher et al. 1989) and L14724 (5'-CGAAGCTTGATATGAAAAACCATCGTTG-3') (SEQ ID NO:7) Meyer et al., J. Mol. Evol., 31:359-364 (1990)!. All sequencing was performed using the Sequenase system (U.S. Biochemicals) and double-stranded templates. The results of this sequencing demonstrated that the variability in the mitochrondrial cyt b gene was most suitable for the design of diagnostic primers.
              TABLE 1                                                     
______________________________________                                    
            Geographical    Number or blood                               
Species     Region/Collector                                              
                            (or tissue samples)                           
______________________________________                                    
Acipenser baerii                                                          
            Lena River (Siberia,                                          
                            2                                             
            Russia)/V. Birstein                                           
A. brevirosrum                                                            
            Connecticut River (MA,                                        
                            (eggs)                                        
            USA)/B. Kynard                                                
A. dabryanus                                                              
            Yangtze River (China)/                                        
                            1                                             
            Q. Wei                                                        
A. fulvescens                                                             
            Great Lakes (WI, USA)/                                        
                            1                                             
            F. Binkowski                                                  
A. gueldenstaedti                                                         
            Caspian Sea, Northern                                         
                            7                                             
            part, (Russia)/A. Vlasenko                                    
A. medirostris                                                            
            Columbia River (OR,                                           
                            1                                             
            USA)/J. North                                                 
A. mikadoi  Tumnin River (Russia Far                                      
                            2                                             
            East)/E. Artyukhin                                            
                            (fragments                                    
                            of muscles)                                   
A. naccarii Ferrara, Italy  2                                             
A. nudiventris                                                            
            Aral Sea (Uzbekistan,                                         
                            2                                             
            Central Asia)/V. Birstein                                     
A. oxyrinchus                                                             
            Pearl River (LA, USA)/                                        
                            1                                             
desotoi     J. Waldman                                                    
A. oxyrinchus                                                             
            St. Lawrence (Quebec,                                         
                            2                                             
oxyrinchus  Canada)/J. Waldman                                            
                            (fragments                                    
                            of muscles)                                   
A. persicus Caspian Sea, Southern part                                    
                            1                                             
            (Iran)/Pourkazemi                                             
A. ruthenus Volga River (Russia/                                          
                            2                                             
            V. Birstein                                                   
A. schrencki                                                              
            Amur River (Siberia,                                          
                            1                                             
            Russia)/V. Svirskii                                           
A. sinensis Yangtze River/Q. Wei                                          
                            1                                             
A. stellatus                                                              
            Volga River/V. Birstein                                       
                            15                                            
A. sturio   Gironde River (France)/                                       
                            1                                             
            P. Williot                                                    
A. sturio   Northern Sea, near the                                        
                            1                                             
            Dutch coast/L. Debus                                          
A. transmontanus                                                          
            Columbia River (OR,                                           
                            2                                             
(White Sturgeon)                                                          
            USA)/J. North                                                 
Huso dauricus                                                             
            Amur River (Siberia,                                          
                            2                                             
(Kaluga Sturgeon)                                                         
            Russia)/V. Svirskii                                           
H. huso     Caspian Sea, Northern part                                    
                            20                                            
            (Russia)/A. Vlasenko                                          
S. albus    Yellowstone River (MT,                                        
                            1                                             
            USA)/H. Bollig                                                
Pseudoscaphirhynchus                                                      
            Amu-Darya River 2                                             
kaufmanni   (Uzbekistan)                                                  
(Large AmuDar                                                             
shovelnose)                                                               
Scaphirhynchus albus                                                      
            Yellowstone River (MT,                                        
                            2                                             
(Pallid sturgeon)                                                         
            USA)                                                          
Polyodon spathula           1                                             
(American                                                                 
Paddlefish)                                                               
Psephurus gladius                                                         
            Yangtze River (China)/                                        
                            1                                             
            Q.Wei                                                         
______________________________________
Example III Use of Primer Pairs on Authentic Samples
DNA was isolated from single eggs after washing with 5.25% sodium hypochlorite by crushing the egg in homogenization buffer followed by Proteinase K (1 mg/ml final concentration) digestion for one hour at 65° C. Standard phenol/chloroform extraction (DeSalle et al., 1993) followed by two ethanol precipitations was performed to purify the DNA for PCR. PCR was performed using the primer pair (with one diagnostic primer and one anchor primer) indicated in Table 2 at 10M in 25 Ktl reactions. Gel electrophoresis results are shown in FIG. 2. DNA from 11 individuals of H. huso (Panel B, Lanes b through 1), two individuals of A. stellatus (Panel S, Lanes b and c) and two individuals of A. gueldenstaedti (Panel G, Lanes b and c) was isolated from either tissue or blood and used as template for PCR reactions. Lane a in all three Panels is the PCR product generated from DNA made from caviar of the three species (from beluga caviar in Panel B, from servuga caviar in Panel S, and from osetra caviar in Panel G). Lanes m and n in Panel B were PCR products from A. stellatus and A. gueldenstaedti, respectively. Lanes d and e in Panel S were products from H. huso and A. gueldenstaedti, respectively. Lanes d and e in Panel G were products from H. huso and A. stellatus, respectively. Lanes n in Panel B, f in Panel S, and f in Panel G were PCR water negative controls. The following primer pairs (see Table 2) were used in the reactions: B3/B3an (Panel B); S2/S2an (Panel S); and, G3/S2an (Panel G). The PCR conditions were 94° C. for 1 minute, 55° C. for 1 minute, and 72° C. for 1 minute for 25 cycles. PCR products were assayed on 1.5% agarose in 1X TBE at 140 V for 20 to 30 minutes in a BioRad miniature submersible electrophoresis rig. DNA was visualized under UV light after staining the gel in ethidium bromide. For all figures the gels were photographed using Polaroid film and scanned into Adobe Photoshop and manipulated using this program.
The G primers were difficult to design as entirely specific for A. gueldenstaedti (osetra) because of the close relatedness of this species to the other members of the clade of Eurasian sturgeons (A. baerii, A. persicus, A. naccarii, A. nudiventris, and A. dabryanus). Hence, two primers were designed that in combination could diagnose the osetra caviar. The G3 primer pair is specific for A. gueldenstaedti, A. persicus, A. naccarii, A. baerii, A. nudiventris, A. dabryanus, and A. brevirostrum. The G4 primer pair is specific for A. gueldenstaedti, Scaphirhynchus albus, Polyodon spathula, and Psephurus gladius.
              TABLE 2                                                     
______________________________________                                    
Primer   Species   SEQ ID                                                 
Pair     Specificity                                                      
                   NO         Primer Sequence                             
______________________________________                                    
B2       Huso huso 8          gcaaacggggcctcctc                           
B2a      B2 anchor 9          cagaatgatatttggcctca                        
B3       Huso huso 10         cactacacagctgacatc                          
B2an     B3 anchor 11         cagaatgatatttggcctca                        
S1       A. stellatus                                                     
                   12         ctttctgccttcccgtat                          
S1an     S1 anchor 13         gaagaaagtggaaggcg                           
S2       A. stellatus                                                     
                   14         ggagtcctaggccctcctg                         
S2an     S2 anchor 15         cctccaattcatgtgagtact                       
G3       A. guelden-                                                      
                   16         aataaactaggtggagtt                          
         staedti                                                          
S2an     G3 anchor 17         cctccaattcatgtgagtact                       
G4       A. guelden-                                                      
                   18         atgaatctgaggcggcttc                         
         staedti                                                          
S1an     G4 anchor 19         gaagaaagtggaaggcg                           
______________________________________
Example IV Use of Primers for Identification of Less Common Species
DNA is isolated from single eggs after washing with 5.25% sodium hypochlorite by crushing the egg in homogenization buffer followed by Proteinase K (1 mg/ml final concentration) digestion for one hour at 65° C. Standard phenol/chloroform extraction (DeSalle et al., 1993) followed by two ethanol precipitations is performed to purify the DNA for PCR. PCR is performed as described in the previous examples using a cocktail made up of two or more primer pairs, where one member of the pair is a diagnostic primer given in Table 3 and the other member of the pair is a matched anchor primer. PCR products are assayed on 1.5% agarose in 1X TBE at 140 V for 20 to 30 minutes in a BioRad miniature submersible electrophoresis rig. DNA is visualized under UV light after staining the gel in ethidium bromide. If no PCR products are visible, the process is repeated with other cocktails of primer pairs until the species origin of the sample is identified.
Table 3 lists sequences in the 5' to 3' direction for primers specific to the sturgeon species given. The diagnostic 3'-most base is designated by a space between it and the rest of the primer. Table 4 lists sequences in the 3' to 5' direction for additional diagnostic primers for the sturgeon species given. The diagnostic 3'-most base is designated by a space between it and the rest of the primer. The primer code used for these "reverse" primers includes a lower case "r" to indicate that these sequences run in the 3' to 5' direction. In both Table 3 and 4, the sturgeon genus is Acipenser unless otherwise specified.
                                  TABLE 3                                 
__________________________________________________________________________
    Species                                                               
           SEQ.                                                           
Primer                                                                    
    Specificity                                                           
           ID NO                                                          
               Primer Sequence                                            
__________________________________________________________________________
N16 nudiventris                                                           
           20  CGCAACCGTGATCACCAACCTCCTTT A                               
S17 stellatus                                                             
           21  CGCAACCGTGATCACCAACCTCCTTTC T                              
M20 medirostris                                                           
           22  CGCAACCGTGATCACTAACCTCCTTTCCGC T                           
P35 Polyodon                                                              
           23  CCTCCTTTCCGCCTTCCCCTACATCGG G                              
Ps35                                                                      
    Psepherus                                                             
           24  CCTCCTTTCCGCCTTCCCCTAGATCGG A                              
O41 oxyrhincus                                                            
           25  TCTCCGCCTTCCCATACATCGGCGACAC G                             
P41 Polyodon                                                              
           26  TCTCCGCCTTCCCCTACATCGGGGACAC C                             
O46 oxyrhincus                                                            
           27  TTCCCATACATCGGCGACACGCTAG G                                
O50 oxyrhincus                                                            
           28  TTCCCATACATCGGCGACACGCTAGGTCA G                            
B42 brevirostrum                                                          
           29  TCTCCGCCTTCCCGTACATCGGCGACACA T                            
P62 Polyodon                                                              
           30  GACACCCTAGTACAATGAATCTGAGG T                               
Nc62                                                                      
    nacarri                                                               
           31  GACACACTAGTACAATGAATCTGAGG T                               
T72 transmontanus                                                         
           32  AGTTCAATGAATCTGAGGCGGCTTTTCA C                             
P89 Polyodon                                                              
           33  TGGGTTCTCAGTAGACAACGCCACCCT A                              
Ps89                                                                      
    Psepherus                                                             
           34  TGGGTTCTCAGTAGACAACGCCACCCT G                              
Si101                                                                     
    schrenki                                                              
           35  TAGACAATGCCACCCTTACCCGATTCTT T                             
P107                                                                      
    Polyodon                                                              
           36  ACCCTAACCCGATTCTTCGCCT A                                   
Hd115                                                                     
    H. dauricus                                                           
           37  CCCGATTTTTCGCCTTCCACTTT G                                  
St47                                                                      
    sturio 38  ATACATCGGCGACACACTAGT G                                    
B29 baerii 39  TCACTAACCTCCTCTCCGCCTTTCCGTA T                             
B91 baerii 40  CTTTTCAGTAGACAACGCCACCCTTA G                               
G68 gueldenstadti                                                         
           41  TACAATGAATCTGAGGCGGCTT C                                   
G114                                                                      
    gueldenstadti                                                         
           42  CCGATTCTTCGCCTTCCACTT C                                    
T133                                                                      
    transmontanus                                                         
           43  CACCCCCACACATCAAACCCGAATG G                                
Ps160                                                                     
    Psepherus                                                             
           44  GTGATACTTCCTCTTTGCCTACGCCATCCT T                           
R171                                                                      
    ruthenus                                                              
           45  TTTGCCTACGCCATTCTCCGATCCATCC T                             
S190                                                                      
    stellatus                                                             
           46  CGATCTATCCCAAACAAACTAGGCGGAGT C                            
P202                                                                      
    Polyodon                                                              
           47  ACAAACTAGGTGGGGTACTGGCCCTACT T                             
S202                                                                      
    stellatus                                                             
           48  ACAAACTAGGCGGAGTCCTAGCCCTCCT G                             
P205                                                                      
    Psepherus                                                             
           49  GGAGTACTAGCCCTACTATT A                                     
T115                                                                      
    transmontanus                                                         
           50  GAGTACTAGCCCTTCTATTTTCCATCCT G                             
T221                                                                      
    transmontanus                                                         
           51  GCCCTTCTATTTTCCATCCTGGTCCTA G                              
T222                                                                      
    transmontanus                                                         
           52  GCCCTTCTATTTTCCATCCTGGTCCTAG C                             
S250                                                                      
    stellatus                                                             
           53  TAGTGCCAATGCTTCACACCTCTAA G                                
O274                                                                      
    oxyrhincus                                                            
           54  CAAACAACGAGGAAATACATTTCGGCC T                              
O284                                                                      
    oxyrhincus                                                            
           55  GAGGAAATACATTTCGGCCTCTCTCCCAA G                            
Si281                                                                     
    schrenki                                                              
           56  CGCCATTCTCGGAAACACATTCCGACCCCTCCGG T                       
Si279                                                                     
    schrenki                                                              
           57  CGCCATTCTCGGAAACACATTCCGACCCCTCC G                         
T286                                                                      
    transmontanus                                                         
           58  ATTCTCGGAAACACATTCCGACCCCTTTCTCAAAT G                      
F318                                                                      
    fulvus 59  ATTCTGGACCCTAGTGGCGACATACTAGT G                            
P306                                                                      
    Polyodon                                                              
           60  CTCAAATCCTATTCTGGACCTAGTAGG T                              
M395                                                                      
    mikaido                                                               
           61  ATTATTTCTCGCAATACACTA T                                    
Hd405                                                                     
    H. dauricus                                                           
           62  GCAATACACTACACAGCTG G                                      
Hh408                                                                     
    H. huso                                                               
           63  GCAATACACTACACAGCTGACAT C                                  
Hh457                                                                     
    H. huso                                                               
           64  CACATCTGCCGAGACGTAAATTA T                                  
Hd459                                                                     
    H. dauricus                                                           
           65  GCCCACATCTGCCGGGATGTAAATTACGG C                            
Hd465                                                                     
    H. dauricus                                                           
           66  GCCCACATCTGCCGGGATGTAAATTACGGCTGA T                        
Br461                                                                     
    brevirostrum                                                          
           67  GCCCACATCTGCCGAGACGTAAATTACGGAT A                          
M466                                                                      
    mikaido                                                               
           68  AGATGTAAATTACGGATGGCT T                                    
Sc475                                                                     
    Scaphyrhincus                                                         
           69  ACGGGTGACTAATCCGAAAC G                                     
Sc489                                                                     
    Scaphyrhincus                                                         
           70  CGAAACGTCCACGCAAATGG C                                     
Si489                                                                     
    schrenki                                                              
           71  CGAGATGTGAATTACGGATG C                                     
Hd471                                                                     
    H. dauricus                                                           
           72  GGATGTAAATTACGGCTGATTAATCCG C                              
P441                                                                      
    Polyodon                                                              
           73  CCTCCGTCGCCCACATCTG T                                      
D492                                                                      
    dabyrynus                                                             
           74  AAATATTCATGCAAACGGGGC T                                    
Hh498                                                                     
    H. huso                                                               
           75  TCCGAAATATTCATGCAACGGGGCCTCCT C                            
Hh536                                                                     
    H. huso                                                               
           76  ATCTTCACGTAGCACGAGGT T                                     
Hh540                                                                     
    H. huso                                                               
           77  ATCTTCACGTAGCACGAGGTTTGTA T                                
N549                                                                      
    naccari                                                               
           78  CGGGGTATATACTATGGTTC G                                     
N573                                                                      
    naccari                                                               
           79  TCCAAAAAGAAACCTGAAA T                                      
Hh556                                                                     
    H. huso                                                               
           80  CGTAGCACGAGGTTTGTATTACGGTTCATACCT T                        
Hd552                                                                     
    H. dauricus                                                           
           81  GCATGTACTACGCTTCCTA T                                      
Pc565                                                                     
    persicus                                                              
           82  GTTCATACCTCCAAAAAGA G                                      
__________________________________________________________________________

                                  TABLE 4                                 
__________________________________________________________________________
    Species                                                               
           SEQ                                                            
Primer                                                                    
    Specificity                                                           
           ID NO                                                          
               Primer Sequence                                            
__________________________________________________________________________
rN16                                                                      
    nudiventris                                                           
           83  T GCGGAAGGGCATGTAGCCGCTGTG                                 
rS17                                                                      
    stellatus                                                             
           84  A CGGAAGGGCATATAGCCGCTGTG                                  
rM20                                                                      
    medirostris                                                           
           85  A AAGGGCATGTAGCCGCTGTG                                     
rP35                                                                      
    Polyodon                                                              
           86  C CTGTGGGATCATGTTACTTAGACTC                                
rPs35                                                                     
    Psepherus                                                             
           87  T CTGTGTGATCATGTTACTTAGACTC                                
rO41                                                                      
    oxyrhincus                                                            
           88  C GATCCAGTCACTTAGACTC                                      
rP41                                                                      
    Polyodon                                                              
           89  G GATCATGTTACTTAGACTC                                      
rO46                                                                      
    oxyrhincus                                                            
           90  C AGTCACTTAGACTCCGCCGAAAAGTCACCTGTTG                       
rO50                                                                      
    oxyrhincus                                                            
           91  C ACTTAGACTCCGCCGAAAAGTCACCTGTTG                           
rB42                                                                      
    brevirostrum                                                          
           92  A ATCACGTTACTTAGACTCCGCCGAAAAG                             
rP62                                                                      
    Polyodon                                                              
           93  A CCCAAGAGTCATCTGTTGCGGTGGGATT                             
rNc62                                                                     
    naccari                                                               
           94  A CCGAAAAGTCATCTGTTGCGGTGGG                                
rT72                                                                      
    transmontanus                                                         
           95  G ATCTGTTACGGTGGGAATGGG                                    
rP89                                                                      
    Polyodon                                                              
           96  T TGGGCTAAGAAGCGGATGGTG                                    
rPs89                                                                     
    Psepherus                                                             
           97  C TGGGCTAAGAAGCGGAAGGTG                                    
rSi101                                                                    
    schrenki                                                              
           98  A CGGAAGGTGAAAGAGGATGG                                     
rP107                                                                     
    Polyodon                                                              
           99  T GGTGAAAGAAGATGGCATTC                                     
rHd115                                                                    
    H. dauricus                                                           
           100 C AAGATGGTAAGCATTAGCGGCCTCGATCG                            
rSt47                                                                     
    sturio 101 C GTTACTTAGACTCCGCCGA                                      
rB29                                                                      
    baeriI 102 A TAGCCGCTGTGTGATCATG                                      
rB91                                                                      
    baerii 103 C GGCTAAAAAGCGGAAGGTGA                                     
rG68                                                                      
    gueldenstadti                                                         
           104 G AGTCATCTGTTGCGGTGGGA                                     
rG114                                                                     
    gueldenstadti                                                         
           105 G GAGGACGGTAAACATTAGCGGCCTCGA                              
rT133                                                                     
    transmontanus                                                         
           106 C ATGAAAGAGAAACGGATGCGGTAAGAG                              
rPs160                                                                    
    Psepherus                                                             
           107 A GCTAGGTAGGGTTTGTTTGA                                     
rR171                                                                     
    ruthenus                                                              
           108 A TTTATTTGATCCACCTCAT                                      
rS190                                                                     
    stellatus                                                             
           109 G GATCGGGAGGACAAGAGATA                                     
rP202                                                                     
    Polyodon                                                              
           110 A AAGAGGTAGGATCATGATTA                                     
rS202                                                                     
    stellatus                                                             
           111 C AAGAGATAGGATCATGATTA                                     
rP205                                                                     
    Psepherus                                                             
           112 T AGGTAGGATCATGATTATGA                                     
rT115                                                                     
    transmontanus                                                         
           113 C CAGGATCGTAACCATGGTT                                      
rT221                                                                     
    transmontanus                                                         
           114 C GTAACCATGGTTATGAGGT                                      
rT222                                                                     
    transmontanus                                                         
           115 G TAACCATGGTTATGAGGT                                       
rS250                                                                     
    stellatus                                                             
           116 G TTGCTCCTTTGTGCAAAGC                                      
rO274                                                                     
    oxyrhincus                                                            
           117 A GAGAGGGTTCAGGATAAAA                                      
rO284                                                                     
    oxyrhincus                                                            
           118 C AGGATAAAACTCGGGATCACC                                    
rSi281                                                                    
    schrenki                                                              
           119 A TTTAGGATAAGACCCGGGA                                      
rSi279                                                                    
    schrenki                                                              
           120 C CATTTAGGATAAGACCCGGGA                                    
rT286                                                                     
    transmontanus                                                         
           121 C GATAAGACCCGGGATCACCG                                     
rF318                                                                     
    fulvus 122 C GAGTGTACTTAGCCTCCGGTTGGTCAGCTTGTGGG                      
rP306                                                                     
    Polyodon                                                              
           123 A CTATACAATCATGAGTGTA                                      
rM395                                                                     
    mikaido                                                               
           124 A TGTCGACTGTAAAGTTGTC                                      
rHd405                                                                    
    H. dauricus                                                           
           125 C GTAAAGTTGTCGGAAGAGG                                      
rHh408                                                                    
    H. huso                                                               
           126 G AGTTGTCGGAAGAGGAGGC                                      
rHh457                                                                    
    H. huso                                                               
           127 A CCTACTGATTAGGCTTTATA                                     
rHd459                                                                    
    H. dauricus                                                           
           128 G ACTAATTAGGCGTTATAAGTACG                                  
rHd465                                                                    
    H. dauricus                                                           
           129 A ATTAGGCGTTATAAGTACG                                      
rBr461                                                                    
    brevirostrum                                                          
           130 T TGATTAGGCTTTATAAGTAC                                     
rM466                                                                     
    mikaido                                                               
           131 A TAGGCTTTATAAGTACGTTT                                     
rSc475                                                                    
    Scaphyrhincus                                                         
           132 C AGGTGCGTTTACCGCGGAGGA                                    
rSc489                                                                    
    Scaphyrhincus                                                         
           133 G CGGAGGAAGAAGAAATAGAC                                     
rSi489                                                                    
    schrenki                                                              
           134 G GATTAGGCTTTGTAAGTACG                                     
rHd47l                                                                    
    H. dauricus                                                           
           135 G ACTAATTAGGCGTTATAAGTA                                    
rP441                                                                     
    Polyodon                                                              
           136 A GCTCTACAATTGATGCCTAC                                     
rD492                                                                     
    dabyrynus                                                             
           137 A AGAAAGAAGAAATAGACGA                                      
rHh498                                                                    
    H. huso                                                               
           138 A ACATAATGCCAAGTATGGAAGTTTT                                
rHh536                                                                    
    H. huso                                                               
           139 A ATGCCAAGTATGGAAGTTTT                                     
rHh540                                                                    
    H. huso                                                               
           140 G GAAGAAGTAGACGAACATAGAAGTGC                               
rN549                                                                     
    naccari                                                               
           141 C ATGGAGGTTTTTCTTTGGAC                                     
rN573                                                                     
    naccari                                                               
           142 A TAACCTCATAAGGAGAACGAAGAGTGG                              
rHh556                                                                    
    H. huso                                                               
           143 A GTTTTTCTTTGGACTTTGTA                                     
rHd552                                                                    
    H. dauricus                                                           
           144 A GAGGTTTTTCTTTGGACTTT                                     
rPc565                                                                    
    persicus                                                              
           145 C TGGACTTTGTAGCCTCATA                                      
__________________________________________________________________________
Example V Determination of Species Origin for Commercial Caviar Samples
Initially, DNA from five to ten individual eggs was isolated for each commercial lot. Results are illustrated in FIG. 3, where only a single representative from each odd numbered lot is shown as all eggs from a lot gave the same results. Lot numbers were arbitrarily assigned to the commercially available lots. Results for even numbered lots are not shown, but are reported in Table 5. The species designations of the lots as given by the commercial suppliers are listed in Table 5. PCR products using beluga (Panel B; B3/B3an), servuga (Panel S; S2/S2an) and osetra (Panel G; G3/S2an) primer pairs (Table 2) are shown in FIG. 3. A fourth primer pair was used as a positive control and was designed to amplify all sturgeon samples (C).
None of the lots gave positive reactions for more than one of the diagnostic primer pairs (B, G or S). These results are verified using other primer pairs (Table 2) and, in some cases (see below), the double stranded fragment produced by the positive control (Panel C) for these four lots was GeneCleaned (BIO 101) and sequenced using an ABI Model 373 automated sequencer. Several positions in this fragment are diagnostic for other species and these nucleotide positions were used to type these four lots (Table 5). Sample 3 although showing a positive reaction in Panel G, did not show a positive reaction for the G4/S 1 an primer pair. The control PCR product was therefore sequenced and used to diagnose this lot of caviar. Samples 4 and 12 were the only samples that were negative for all three primer pairs, but positive for the control primers. Control PCR of these three lots of caviar as well as lots Nos. 1, 9, 13, and 16 were GeneCleaned and sequenced to determine the source species used for making these caviars (see Table 5). As is evident from Table 5, the source species for five of the twenty-five commercial samples of caviar tested did not correspond to the species given on the product label.
              TABLE 5                                                     
______________________________________                                    
Caviar   Designation by Supplier                                          
Lot      (Trade Name)    Diagnosis                                        
______________________________________                                    
1.       American sturgeon                                                
                         Osetra                                           
2.       Caspian beluga  Beluga                                           
3.       Caspian osetra  Ship sturgeon                                    
4.       Eastern beluga  Amur River sturgeon                              
5.       Caspian servuga Servuga                                          
6.       Fresh beluga malossol                                            
                         Servuga                                          
7.       Fresh ossetra malossol                                           
                         Osetra                                           
8.       Fresh servuga malossol                                           
                         Servuga                                          
9.       Caviar Russ (beluga)                                             
                         Beluga                                           
10.      Russian caviar (osetra)                                          
                         Osetra                                           
11.      Servuga malossol                                                 
                         Servuga                                          
12.      Beluga malossol Siberian sturgeon                                
13.      Osetra malossol Osetra                                           
14.      Servuga malossol                                                 
                         Servuga                                          
15.      Beluga malossol Beluga                                           
16.      Osetra malossol Osetra                                           
17.      Servuga malossol                                                 
                         Servuga                                          
18.      Sturgeon caviar Osetra                                           
19.      Russian caviar  Servuga                                          
20.      Servuga malossol                                                 
                         Servuga                                          
21.      Beluga prime Beluga                                              
                         Beluga                                           
22.      Oscetra malassol                                                 
                         Osetra                                           
23.      Beluga malossol Beluga                                           
24.      Ossetra malassol                                                 
                         Osetra                                           
25.      Servuga malossol                                                 
                         Servuga                                          
______________________________________
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the scope of the application and the appended claims.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 145                                            
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 19 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
ATTAAAGTTGTTGCGGTTT19                                                     
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
GGTGGCATTTTATTTTATTAGAGG24                                                
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
CCGGTCTGAACTCAGATCACGT22                                                  
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 19 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
CGCCTGTTTACCAAAACAT19                                                     
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
CCGGTCTGAATCAGATCACGT21                                                   
(2) INFORMATION FOR SEQ ID NO:6:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 34 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA34                                      
(2) INFORMATION FOR SEQ ID NO:7:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
CGAAGCTTGATATGAAAAACCATCGTTG28                                            
(2) INFORMATION FOR SEQ ID NO:8:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 17 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
GCAAACGGGGCCTCCTC17                                                       
(2) INFORMATION FOR SEQ ID NO:9:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
CAGAATGATATTTGGCCTCA20                                                    
(2) INFORMATION FOR SEQ ID NO:10:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 18 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
CACTACACAGCTGACATC18                                                      
(2) INFORMATION FOR SEQ ID NO:11:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
CAGAATGATATTTGGCCTCA20                                                    
(2) INFORMATION FOR SEQ ID NO:12:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 18 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
CTTTCTGCCTTCCCGTAT18                                                      
(2) INFORMATION FOR SEQ ID NO:13:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 17 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
GAAGAAAGTGGAAGGCG17                                                       
(2) INFORMATION FOR SEQ ID NO:14:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 19 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
GGAGTCCTAGGCCCTCCTG19                                                     
(2) INFORMATION FOR SEQ ID NO:15:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
CCTCCAATTCATGTGAGTACT21                                                   
(2) INFORMATION FOR SEQ ID NO:16:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 18 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
AATAAACTAGGTGGAGTT18                                                      
(2) INFORMATION FOR SEQ ID NO:17:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:                                  
CCTCCAATTCATGTGAGTACT21                                                   
(2) INFORMATION FOR SEQ ID NO:18:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 19 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:                                  
ATGAATCTGAGGCGGCTTC19                                                     
(2) INFORMATION FOR SEQ ID NO:19:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 17 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:                                  
GAAGAAAGTGGAAGGCG17                                                       
(2) INFORMATION FOR SEQ ID NO:20:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:                                  
CGCAACCGTGATCACCAACCTCCTTTA27                                             
(2) INFORMATION FOR SEQ ID NO:21:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:                                  
CGCAACCGTGATCACCAACCTCCTTTCT28                                            
(2) INFORMATION FOR SEQ ID NO:22:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:                                  
CGCAACCGTGATCACTAACCTCCTTTCCGCT31                                         
(2) INFORMATION FOR SEQ ID NO:23:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:                                  
CCTCCTTTCCGCCTTCCCCTACATCGGG28                                            
(2) INFORMATION FOR SEQ ID NO:24:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:                                  
CCTCCTTTCCGCCTTCCCCTAGATCGGA28                                            
(2) INFORMATION FOR SEQ ID NO:25:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:                                  
TCTCCGCCTTCCCATACATCGGCGACACG29                                           
(2) INFORMATION FOR SEQ ID NO:26:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:                                  
TCTCCGCCTTCCCCTACATCGGGGACACC29                                           
(2) INFORMATION FOR SEQ ID NO:27:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:                                  
TTCCCATACATCGGCGACACGCTAGG26                                              
(2) INFORMATION FOR SEQ ID NO:28:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:                                  
TTCCCATACATCGGCGACACGCTAGGTCAG30                                          
(2) INFORMATION FOR SEQ ID NO:29:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:                                  
TCTCCGCCTTCCCGTACATCGGCGACACAT30                                          
(2) INFORMATION FOR SEQ ID NO:30:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:                                  
GACACCCTAGTACAATGAATCTGAGGT27                                             
(2) INFORMATION FOR SEQ ID NO:31:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:                                  
GACACACTAGTACAATGAATCTGAGGT27                                             
(2) INFORMATION FOR SEQ ID NO:32:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:                                  
AGTTCAATGAATCTGAGGCGGCTTTTCAC29                                           
(2) INFORMATION FOR SEQ ID NO:33:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:                                  
TGGGTTCTCAGTAGACAACGCCACCCTA28                                            
(2) INFORMATION FOR SEQ ID NO:34:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:                                  
TGGGTTCTCAGTAGACAACGCCACCCTG28                                            
(2) INFORMATION FOR SEQ ID NO:35:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:                                  
TAGACAATGCCACCCTTACCCGATTCTTT29                                           
(2) INFORMATION FOR SEQ ID NO:36:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 23 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:                                  
ACCCTAACCCGATTCTTCGCCTA23                                                 
(2) INFORMATION FOR SEQ ID NO:37:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:                                  
CCCGATTTTTCGCCTTCCACTTTG24                                                
(2) INFORMATION FOR SEQ ID NO:38:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:                                  
ATACATCGGCGACACACTAGTG22                                                  
(2) INFORMATION FOR SEQ ID NO:39:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:                                  
TCACTAACCTCCTCTCCGCCTTTCCGTAT29                                           
(2) INFORMATION FOR SEQ ID NO:40:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:                                  
CTTTTCAGTAGACAACGCCACCCTTAG27                                             
(2) INFORMATION FOR SEQ ID NO:41:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 23 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:                                  
TACAATGAATCTGAGGCGGCTTC23                                                 
(2) INFORMATION FOR SEQ ID NO:42:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:                                  
CCGATTCTTCGCCTTCCACTTC22                                                  
(2) INFORMATION FOR SEQ ID NO:43:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:                                  
CACCCCCACACATCAAACCCGAATGG26                                              
(2) INFORMATION FOR SEQ ID NO:44:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:                                  
GTGATACTTCCTCTTTGCCTACGCCATCCTT31                                         
(2) INFORMATION FOR SEQ ID NO:45:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:                                  
TTTGCCTACGCCATTCTCCGATCCATCCT29                                           
(2) INFORMATION FOR SEQ ID NO:46:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:                                  
CGATCTATCCCAAACAAACTAGGCGGAGTC30                                          
(2) INFORMATION FOR SEQ ID NO:47:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:                                  
ACAAACTAGGTGGGGTACTGGCCCTACTT29                                           
(2) INFORMATION FOR SEQ ID NO:48:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:                                  
ACAAACTAGGCGGAGTCCTAGCCCTCCTG29                                           
(2) INFORMATION FOR SEQ ID NO:49:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:                                  
GGAGTACTAGCCCTACTATTA21                                                   
(2) INFORMATION FOR SEQ ID NO:50:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:                                  
GAGTACTAGCCCTTCTATTTTCCATCCTG29                                           
(2) INFORMATION FOR SEQ ID NO:51:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:                                  
GCCCTTCTATTTTCCATCCTGGTCCTAG28                                            
(2) INFORMATION FOR SEQ ID NO:52:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:                                  
GCCCTTCTATTTTCCATCCTGGTCCTAGC29                                           
(2) INFORMATION FOR SEQ ID NO:53:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:                                  
TAGTGCCAATGCTTCACACCTCTAAG26                                              
(2) INFORMATION FOR SEQ ID NO:54:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:                                  
CAAACAACGAGGAAATACATTTCGGCCT28                                            
(2) INFORMATION FOR SEQ ID NO:55:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:                                  
GAGGAAATACATTTCGGCCTCTCTCCCAAG30                                          
(2) INFORMATION FOR SEQ ID NO:56:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 35 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:                                  
CGCCATTCTCGGAAACACATTCCGACCCCTCCGGT35                                     
(2) INFORMATION FOR SEQ ID NO:57:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 33 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:                                  
CGCCATTCTCGGAAACACATTCCGACCCCTCCG33                                       
(2) INFORMATION FOR SEQ ID NO:58:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 36 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:                                  
ATTCTCGGAAACACATTCCGACCCCTTTCTCAAATG36                                    
(2) INFORMATION FOR SEQ ID NO:59:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:                                  
ATTCTGGACCCTAGTGGCGACATACTAGTG30                                          
(2) INFORMATION FOR SEQ ID NO:60:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:                                  
CTCAAATCCTATTCTGGACCTAGTAGGT28                                            
(2) INFORMATION FOR SEQ ID NO:61:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:                                  
ATTATTTCTCGCAATACACTAT22                                                  
(2) INFORMATION FOR SEQ ID NO:62:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:                                  
GCAATACACTACACAGCTGG20                                                    
(2) INFORMATION FOR SEQ ID NO:63:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:                                  
GCAATACACTACACAGCTGACATC24                                                
(2) INFORMATION FOR SEQ ID NO:64:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:                                  
CACATCTGCCGAGACGTAAATTAT24                                                
(2) INFORMATION FOR SEQ ID NO:65:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:                                  
GCCCACATCTGCCGGGATGTAAATTACGGC30                                          
(2) INFORMATION FOR SEQ ID NO:66:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 34 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:                                  
GCCCACATCTGCCGGGATGTAAATTACGGCTGAT34                                      
(2) INFORMATION FOR SEQ ID NO:67:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 32 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:67:                                  
GCCCACATCTGCCGAGACGTAAATTACGGATA32                                        
(2) INFORMATION FOR SEQ ID NO:68:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:                                  
AGATGTAAATTACGGATGGCTT22                                                  
(2) INFORMATION FOR SEQ ID NO:69:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:69:                                  
ACGGGTGACTAATCCGAAACG21                                                   
(2) INFORMATION FOR SEQ ID NO:70:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:70:                                  
CGAAACGTCCACGCAAATGGC21                                                   
(2) INFORMATION FOR SEQ ID NO:71:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:71:                                  
CGAGATGTGAATTACGGATGC21                                                   
(2) INFORMATION FOR SEQ ID NO:72:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:72:                                  
GGATGTAAATTACGGCTGATTAATCCGC28                                            
(2) INFORMATION FOR SEQ ID NO:73:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:73:                                  
CCTCCGTCGCCCACATCTGT20                                                    
(2) INFORMATION FOR SEQ ID NO:74:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:74:                                  
AAATATTCATGCAAACGGGGCT22                                                  
(2) INFORMATION FOR SEQ ID NO:75:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:75:                                  
TCCGAAATATTCATGCAACGGGGCCTCCTC30                                          
(2) INFORMATION FOR SEQ ID NO:76:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:                                  
ATCTTCACGTAGCACGAGGTT21                                                   
(2) INFORMATION FOR SEQ ID NO:77:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:77:                                  
ATCTTCACGTAGCACGAGGTTTGTAT26                                              
(2) INFORMATION FOR SEQ ID NO:78:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:78:                                  
CGGGGTATATACTATGGTTCG21                                                   
(2) INFORMATION FOR SEQ ID NO:79:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:79:                                  
TCCAAAAAGAAACCTGAAAT20                                                    
(2) INFORMATION FOR SEQ ID NO:80:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 34 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:80:                                  
CGTAGCACGAGGTTTGTATTACGGTTCATACCTT34                                      
(2) INFORMATION FOR SEQ ID NO:81:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:81:                                  
GCATGTACTACGCTTCCTAT20                                                    
(2) INFORMATION FOR SEQ ID NO:82:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:82:                                  
GTTCATACCTCCAAAAAGAG20                                                    
(2) INFORMATION FOR SEQ ID NO:83:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 25 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:83:                                  
GTGTCGCCGATGTACGGGAAGGCGT25                                               
(2) INFORMATION FOR SEQ ID NO:84:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:84:                                  
GTGTCGCCGATATACGGGAAGGCA24                                                
(2) INFORMATION FOR SEQ ID NO:85:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:85:                                  
GTGTCGCCGATGTACGGGAAA21                                                   
(2) INFORMATION FOR SEQ ID NO:86:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:86:                                  
CTCAGATTCATTGTACTAGGGTGTCC26                                              
(2) INFORMATION FOR SEQ ID NO:87:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:87:                                  
CTCAGATTCATTGTACTAGTGTGTCT26                                              
(2) INFORMATION FOR SEQ ID NO:88:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:88:                                  
CTCAGATTCACTGACCTAGC20                                                    
(2) INFORMATION FOR SEQ ID NO:89:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:89:                                  
CTCAGATTCATTGTACTAGG20                                                    
(2) INFORMATION FOR SEQ ID NO:90:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 35 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:90:                                  
GTTGTCCACTGAAAAGCCGCCTCAGATTCACTGAC35                                     
(2) INFORMATION FOR SEQ ID NO:91:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 31 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:91:                                  
GTTGTCCACTGAAAAGCCGCCTCAGATTCAC31                                         
(2) INFORMATION FOR SEQ ID NO:92:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:92:                                  
GAAAAGCCGCCTCAGATTCATTGCACTAA29                                           
(2) INFORMATION FOR SEQ ID NO:93:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 29 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:93:                                  
TTAGGGTGGCGTTGTCTACTGAGAACCCA29                                           
(2) INFORMATION FOR SEQ ID NO:94:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:94:                                  
GGGTGGCGTTGTCTACTGAAAAGCCA26                                              
(2) INFORMATION FOR SEQ ID NO:95:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:95:                                  
GGGTAAGGGTGGCATTGTCTAG22                                                  
(2) INFORMATION FOR SEQ ID NO:96:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:96:                                  
GTGGTAGGCGAAGAATCGGGTT22                                                  
(2) INFORMATION FOR SEQ ID NO:97:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:97:                                  
GTGGAAGGCGAAGAATCGGGTC22                                                  
(2) INFORMATION FOR SEQ ID NO:98:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:98:                                  
GGTAGGAGAAAGTGGAAGGCA21                                                   
(2) INFORMATION FOR SEQ ID NO:99:                                         
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:99:                                  
CTTACGGTAGAAGAAAGTGGT21                                                   
(2) INFORMATION FOR SEQ ID NO:100:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 30 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:100:                                 
GCTAGCTCCGGCGATTACGAATGGTAGAAC30                                          
(2) INFORMATION FOR SEQ ID NO:101:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:101:                                 
AGCCGCCTCAGATTCATTGC20                                                    
(2) INFORMATION FOR SEQ ID NO:102:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:102:                                 
GTACTAGTGTGTCGCCGATA20                                                    
(2) INFORMATION FOR SEQ ID NO:103:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:103:                                 
AGTGGAAGGCGAAAAATCGGC21                                                   
(2) INFORMATION FOR SEQ ID NO:104:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:104:                                 
AGGGTGGCGTTGTCTACTGAG21                                                   
(2) INFORMATION FOR SEQ ID NO:105:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:105:                                 
AGCTCCGGCGATTACAAATGGCAGGAGG28                                            
(2) INFORMATION FOR SEQ ID NO:106:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:106:                                 
GAGAATGGCGTAGGCAAAGAGAAAGTAC28                                            
(2) INFORMATION FOR SEQ ID NO:107:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:107:                                 
AGTTTGTTTGGGATGGATCGA21                                                   
(2) INFORMATION FOR SEQ ID NO:108:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:108:                                 
TACTCCACCTAGTTTATTTA20                                                    
(2) INFORMATION FOR SEQ ID NO:109:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:109:                                 
ATAGAGAACAGGAGGGCTAGG21                                                   
(2) INFORMATION FOR SEQ ID NO:110:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:110:                                 
ATTAGTACTAGGATGGAGAAA21                                                   
(2) INFORMATION FOR SEQ ID NO:111:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:111:                                 
ATTAGTACTAGGATAGAGAAC21                                                   
(2) INFORMATION FOR SEQ ID NO:112:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:112:                                 
AGTATTAGTACTAGGATGGAT21                                                   
(2) INFORMATION FOR SEQ ID NO:113:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:113:                                 
TTGGTACCAATGCTAGGACC20                                                    
(2) INFORMATION FOR SEQ ID NO:114:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:114:                                 
TGGAGTATTGGTACCAATGC20                                                    
(2) INFORMATION FOR SEQ ID NO:115:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 19 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:115:                                 
TGGAGTATTGGTACCAATG19                                                     
(2) INFORMATION FOR SEQ ID NO:116:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:116:                                 
CGAAACGTGTTTCCTCGTTG20                                                    
(2) INFORMATION FOR SEQ ID NO:117:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:117:                                 
AAAATAGGACTTGGGAGAGA20                                                    
(2) INFORMATION FOR SEQ ID NO:118:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:118:                                 
CCACTAGGGCTCAAAATAGGAC22                                                  
(2) INFORMATION FOR SEQ ID NO:119:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:119:                                 
AGGGCCCAGAATAGGATTTA20                                                    
(2) INFORMATION FOR SEQ ID NO:120:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:120:                                 
AGGGCCCAGAATAGGATTTACC22                                                  
(2) INFORMATION FOR SEQ ID NO:121:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:121:                                 
GCCACTAGGGCCCAGAATAGC21                                                   
(2) INFORMATION FOR SEQ ID NO:122:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 36 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:122:                                 
GGGTGTTCGACTGGTTGGCCTCCGATTCATGTGAGC36                                    
(2) INFORMATION FOR SEQ ID NO:123:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:123:                                 
ATGTGAGTACTAACATATCA20                                                    
(2) INFORMATION FOR SEQ ID NO:124:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:124:                                 
CTGTTGAAATGTCAGCTGTA20                                                    
(2) INFORMATION FOR SEQ ID NO:125:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:125:                                 
GGAGAAGGCTGTTGAAATGC20                                                    
(2) INFORMATION FOR SEQ ID NO:126:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:126:                                 
CGGAGGAGAAGGCTGTTGAG20                                                    
(2) INFORMATION FOR SEQ ID NO:127:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:127:                                 
ATATTTCGGATTAGTCATCCA21                                                   
(2) INFORMATION FOR SEQ ID NO:128:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 24 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:128:                                 
GCATGAATATTGCGGATTAATCAG24                                                
(2) INFORMATION FOR SEQ ID NO:129:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:129:                                 
GCATGAATATTGCGGATTAA20                                                    
(2) INFORMATION FOR SEQ ID NO:130:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:130:                                 
CATGAATATTTCGGATTAGTT21                                                   
(2) INFORMATION FOR SEQ ID NO:131:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:131:                                 
TTTGCATGAATATTTCGGATA21                                                   
(2) INFORMATION FOR SEQ ID NO:132:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:132:                                 
AGGAGGCGCCATTTGCGTGGAC22                                                  
(2) INFORMATION FOR SEQ ID NO:133:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:133:                                 
CAGATAAAGAAGAAGGAGGCG21                                                   
(2) INFORMATION FOR SEQ ID NO:134:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:134:                                 
GCATGAATGTTTCGGATTAGG21                                                   
(2) INFORMATION FOR SEQ ID NO:135:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 22 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:135:                                 
ATGAATATTGCGGATTAATCAG22                                                  
(2) INFORMATION FOR SEQ ID NO:136:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:136:                                 
CATCCGTAGTTAACATCTCGA21                                                   
(2) INFORMATION FOR SEQ ID NO:137:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:137:                                 
AGCAGATAAAGAAGAAAGAA20                                                    
(2) INFORMATION FOR SEQ ID NO:138:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 26 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:138:                                 
TTTTGAAGGTATGAACCGTAATACAA26                                              
(2) INFORMATION FOR SEQ ID NO:139:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:139:                                 
TTTTGAAGGTATGAACCGTAA21                                                   
(2) INFORMATION FOR SEQ ID NO:140:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 27 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:140:                                 
CGTGAAGATACAAGCAGATGAAGAAGG27                                             
(2) INFORMATION FOR SEQ ID NO:141:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:141:                                 
CAGGTTTCTTTTTGGAGGTAC21                                                   
(2) INFORMATION FOR SEQ ID NO:142:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 28 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:142:                                 
GGTGAGAAGCAAGAGGAATACTCCAATA28                                            
(2) INFORMATION FOR SEQ ID NO:143:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:143:                                 
ATGTTTCAGGTTTCTTTTTGA21                                                   
(2) INFORMATION FOR SEQ ID NO:144:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 21 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:144:                                 
TTTCAGGTTTCTTTTTGGAGA21                                                   
(2) INFORMATION FOR SEQ ID NO:145:                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20 base pairs                                                 
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:145:                                 
ATACTCCGATGTTTCAGGTC20                                                    
__________________________________________________________________________

Claims (13)

We claim:
1. A method of determining a species origin of caviar, said method comprising the steps of:
a) obtaining a sample of caviar;
b) cleaning the surface of the caviar with an agent capable of removing salt and other debris from the surface of the caviar without damaging the caviar;
c) extracting template DNA from said sample;
d) amplifying extracted template DNA by using at least one primer pair consisting of a species-specific diagnostic primer which binds to a nucleotide position diagnostic of a species of said caviar and an anchor primer matched with the diagnostic primer such that the anchor primer binds to a nucleotide position no more than about 250 nucleotides away from said nucleotide position, wherein said diagnostic primer hybridizes one or more DNA fragments having a sequence complementary any of the sequences shown in SEQ. ID NO:8, SEQ. ID NO:10, SEQ. ID NO:12, SEQ. ID NO:14, SEQ. ID NO:16, SEQ. ID NO:18, or SEQ. ID NO:20 through SEQ. ID NO:145; and
e) analyzing the products for the presence or absence of amplified DNA.
2. A method according to claim 1, wherein said sample is a single egg of commercially processed caviar.
3. A method according to claim 1, wherein said agent for removing salt and other debris comprises a solution selected from the group consisting of saline solution, dilute acids, dilute bases, mild detergent solutions, DNA extraction buffer and sodium hypochlorite solution, wherein the concentration of said solution does not lyse the caviar eggs.
4. A method according to claim 1, wherein said extracting is by phenol/chloroform extraction.
5. A method according to claim 1, wherein said analyzing comprises the steps of assaying said products by gel electrophoresis and detecting said products.
6. A method according to claim 5, wherein said detecting is by staining with ethidium bromide, propidium iodide or silver.
7. A method for identifying a species from which fish tissue originates, said method comprising the steps of:
a) removing salt and debris from the outer surface of a fish egg from the same fish from which said fish tissue originated;
b) isolating template DNA from said egg;
c) amplifying said template DNA by use of the polymerase chain reaction (PCR) using a cocktail of primers containing at least a pair of primers in which one primer is a diagnostic primer specific for a sturgeon species of interest and which binds to a nucleotide position diagnostic of said sturgeon species and the other primer is an anchor primer matched with said diagnostic primer such that the anchor primer binds to a nucleotide position no more than about 250 nucleotides away from said nucleotide position, wherein said diagnostic primer hybridizes one or more DNA fragments having a sequence complementary any of the sequences shown in SEQ. ID NO:8, SEQ. ID NO:10, SEQ. ID NO:12. SEQ. ID NO:14, SEQ. ID NO:16, SEQ. ID NO:18, or SEQ. ID NO:20 through SEQ. ID NO:145;
d) assaying the PCR products; and
e) detecting the results.
8. The method of claim 7 wherein the steps of the method are repeated using primers specific for different species until a positive identification is made.
9. The method according to claim 7 wherein said removing is washing with a cleaning solution.
10. The method according to claim 7 wherein said isolating is by phenol/chloroform extraction.
11. The method according to claim 7 wherein said assaying is by gel electrophoresis and said detecting is by staining with ethidium bromide, propidium iodide or silver.
12. A primer which hybridizes one or more DNA fragments having a sequence complementary to one or more of the sequences set forth in SEQ. ID NO:8, SEQ. ID NO:10, SEQ. ID NO:12, SEQ. ID NO:14, SEQ. ID NO:16, SEQ. ID NO:18, and SEQ. ID NO:20 through SEQ. ID NO:145.
13. A primer cocktail comprising a plurality of primer pairs wherein said primer pairs each consist of a diagnostic primer specific for a sturgeon species of interest and which binds to a nucleotide position diagnostic of said sturgeon species and an anchor primer matched with said diagnostic primer such that the anchor primer binds to a nucleotide position no more than about 250 nucleotides away from said nucleotide position, wherein said diagnostic primer hybridizes one or more DNA fragments having a sequence complementary any of the sequences set forth in SEQ. ID NO:8, SEQ. ID NO:10, SEQ. ID NO:12, SEQ. ID NO:14, SEQ. ID NO:16, SEQ. ID NO:18, or SEQ. ID NO:20 through SEQ. ID NO:145.
US08/647,584 1996-05-13 1996-05-13 Method and compositions for identification of species origin of caviar Expired - Fee Related US5786144A (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US08/647,584 US5786144A (en) 1996-05-13 1996-05-13 Method and compositions for identification of species origin of caviar
DE69714906T DE69714906T2 (en) 1996-05-13 1997-05-13 Methods and compositions for identifying the origin of caviar species
PCT/US1997/008136 WO1997043618A2 (en) 1996-05-13 1997-05-13 Method and compositions for identification of species origin of caviar
EP97107809A EP0807690B1 (en) 1996-05-13 1997-05-13 Method and compositions for identification of species origin of caviar
AT97107809T ATE222962T1 (en) 1996-05-13 1997-05-13 METHODS AND COMPOSITIONS FOR IDENTIFYING THE SPECIES ORIGIN OF CAVIAR

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US08/647,584 US5786144A (en) 1996-05-13 1996-05-13 Method and compositions for identification of species origin of caviar

Publications (1)

Publication Number Publication Date
US5786144A true US5786144A (en) 1998-07-28

Family

ID=24597532

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/647,584 Expired - Fee Related US5786144A (en) 1996-05-13 1996-05-13 Method and compositions for identification of species origin of caviar

Country Status (5)

Country Link
US (1) US5786144A (en)
EP (1) EP0807690B1 (en)
AT (1) ATE222962T1 (en)
DE (1) DE69714906T2 (en)
WO (1) WO1997043618A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009256223A (en) * 2008-04-14 2009-11-05 Atena:Kk Extract liquid from egg of sturgeon
CN109097481A (en) * 2018-08-21 2018-12-28 福建省水产研究所（福建水产病害防治中心） Method based on high throughput sequencing technologies identification fish-egg larva and juvenile
CN109337962A (en) * 2018-08-24 2019-02-15 暨南大学 Primer and probe and its kit and method based on fluorescence quantitative PCR detection sturgeon
WO2024145639A3 (en) * 2022-12-30 2024-08-15 Hypercell Technologies Compositions, devices and methods for an improved rapid point-of-use diagnostic assay

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4927309B2 (en) * 2001-03-28 2012-05-09 カウンスィル オブ サイエンティフィック アンド インダストリアル リサーチ Universal primers for wildlife identification
GB2374597A (en) * 2001-03-30 2002-10-23 Council Scient Ind Res Probes for myctophid fish
FR2826021B1 (en) * 2001-06-13 2004-12-31 Centre Nat Rech Scient METHOD FOR DETECTION AND IDENTIFICATION OF THE PRESENCE OF BIOLOGICAL MATERIALS FROM FISH, AND OLIGONUCLEOTIDES FOR IMPLEMENTING SAME
FR2826022B1 (en) * 2001-06-13 2005-02-04 Centre Nat Rech Scient METHOD FOR DETERMINING THE EXISTENCE OF MIXTURES OF SPECIES OF ANIMAL OR VEGETABLE ORIGINS IN ORGANIC SUBSTRATES
ES2249176B1 (en) * 2004-09-09 2006-12-16 Universidad Complutense De Madrid IDENTIFICATION OF DNA IN RAW OR PROCESSED FOODS AND COMPOSITE FEEDS.
FR2858631A1 (en) * 2004-09-24 2005-02-11 Centre Nat Rech Scient Method for detecting material from gadiform fish, useful for detecting adulteration of foods, based on amplification of mitochondrial DNA, also new oligonucleotides and amplicons
WO2007092279A2 (en) * 2006-02-03 2007-08-16 The Regents Of The University Of California Detection of contaminating dna via amplification of sequences of less than 100 bp
CA2781557C (en) 2009-11-23 2018-01-09 Bayer Cropscience N.V. Elite event ee-gm3 and methods and kits for identifying such event in biological samples
AU2010321586C1 (en) 2009-11-23 2016-07-14 BASF Agricultural Solutions Seed US LLC Herbicide tolerant soybean plants and methods for identifying same

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
WO1992005277A1 (en) * 1990-09-26 1992-04-02 William Scott Davidson Test to determine an organism's species and/or population identity by direct nucleotide sequence analysis of defined segments of its genome

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (en) * 1985-03-28 1990-11-27 Cetus Corp
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (en) * 1986-01-30 1990-11-27 Cetus Corp
WO1992005277A1 (en) * 1990-09-26 1992-04-02 William Scott Davidson Test to determine an organism's species and/or population identity by direct nucleotide sequence analysis of defined segments of its genome

Non-Patent Citations (51)

* Cited by examiner, † Cited by third party
Title
Amato et al., PCR assays of variable nucleotide sites for identification of conservation units, in Molecular Approaches to Ecology and Evolution, Schierwater, B, et al., eds. *
Baker et al., "Which whales are hunted? A molecular genetic approach to monitoring whaling", American Assoc. for the Advancement of Science, Science, vol. 265, pp. 1538-1539.
Baker et al., Which whales are hunted A molecular genetic approach to monitoring whaling , American Assoc. for the Advancement of Science, Science, vol. 265, pp. 1538 1539. *
Birstein, et al. Tetraploid Octoploid relationships and karyological evolution in the order Acipenseriformes (Pisces) Karyotypes, nucleoli, and nucleolus organizer regions in four aceipenserid species, Genetica,vol. 73, pp. 3 12 (1987). *
Birstein, et al. Tetraploid-Octoploid relationships and karyological evolution in the order Acipenseriformes (Pisces) Karyotypes, nucleoli, and nucleolus-organizer regions in four aceipenserid species, Genetica,vol. 73, pp. 3-12 (1987).
Birstein, et al., Genetica, vol. 73, pp. 3 12 (1993). *
Birstein, et al., Genetica, vol. 73, pp. 3-12 (1993).
Birstein, V.J., "Sturgeons and Paddlefishes: Threatened Fishes in Need of Conversation", Conserv. Biol., vol. 7, pp. 773-787 (1993).
Birstein, V.J., Sturgeons and Paddlefishes: Threatened Fishes in Need of Conversation , Conserv. Biol., vol. 7, pp. 773 787 (1993). *
Brown et al. Genetics 142: 525 535, 1996. *
Brown et al. Genetics 142: 525-535, 1996.
Brown, J.R., et al., "Length Variation, Heteroplasmy and Sequence Divergence in the Mitocondrial DNA of Four Species of Sturgeon (Acipenser)", Genetics, vol. 142, pp. 525-535 (1996).
Brown, J.R., et al., "Nucleotide Sequence of the apocytochrome B Gene in White Surgeon Mitochondrial DNA", Nucleic Acids Research, vol. 17 (11), p. 4389 (1989).
Brown, J.R., et al., Length Variation, Heteroplasmy and Sequence Divergence in the Mitocondrial DNA of Four Species of Sturgeon ( Acipenser ) , Genetics, vol. 142, pp. 525 535 (1996). *
Brown, J.R., et al., Nucleotide Sequence of the apocytochrome B Gene in White Surgeon Mitochondrial DNA , Nucleic Acids Research, vol. 17 (11), p. 4389 (1989). *
Cronin, et al., Wildlife Society Bulletin, vol. 19, pp. 94 105 (1991). *
Cronin, et al., Wildlife Society Bulletin, vol. 19, pp. 94-105 (1991).
DeSalle et al. Methods in Enzymology 224: 176 204, 1993. *
DeSalle et al. Methods in Enzymology 224: 176-204, 1993.
DeSalle, R. et al., "Molecular Evolution: Producing the Biochemical Data", Methods in Enzymology, vol. 224, pp. 176-204 (1993).
DeSalle, R. et al., Molecular Evolution: Producing the Biochemical Data , Methods in Enzymology, vol. 224, pp. 176 204 (1993). *
Gardiner, B.G., "Sturgeons as Living Fossils", Living Fossils, eds. Eldredge, N. & Stanley, S.M., Living Fossils, pp. 148-152 (1984).
Gardiner, B.G., Sturgeons as Living Fossils , Living Fossils, eds. Eldredge, N. & Stanley, S.M., Living Fossils, pp. 148 152 (1984). *
Graves, et al., "Biochemical Genetics of Southern California Basses of the Genus Paralabrax: Specific Identification of Fresh and Ethanol-preserved individual Eggs and Early Larvae", Fishery Bulletin, vol. 88, pp. 59-66 (1989).
Graves, et al., Biochemical Genetics of Southern California Basses of the Genus Paralabrax: Specific Identification of Fresh and Ethanol preserved individual Eggs and Early Larvae , Fishery Bulletin, vol. 88, pp. 59 66 (1989). *
Hara et al. Bulletin of the Japan Sea NAtional Fisheries Research Institute (Abstract provided) vol. 44: 131 138, 1994. *
Hara et al. Bulletin of the Japan Sea NAtional Fisheries Research Institute (Abstract provided) vol. 44: 131-138, 1994.
Hedges, et al., "Caecilian Phylogeny and Biogeography Inferred from Mitochondrial DNA Sequences of the 12S rRNA and 16S rRNa Genes (Amphibia: Gymnophion A)", Herpetological.
Hedges, et al., Caecilian Phylogeny and Biogeography Inferred from Mitochondrial DNA Sequences of the 12S rRNA and 16S rRNa Genes (Amphibia: Gymnophion A) , Herpetological. *
Keyvanfan, A.C, et al C.R. Acad Sc. Paris Ser III No. 9, vol. 304, pp. 191 193, 1987. *
Keyvanfan, A.C, et al C.R. Acad Sc. Paris Ser III No. 9, vol. 304, pp. 191-193, 1987.
Keyvanfar A. Am Inst. Oceanog (Paris) vol. 64 pp. 25 64, 1988 for considered Feb. 16, 1998. *
Keyvanfar A. Am Inst. Oceanog? (Paris) vol. 64 pp. 25-64, 1988 for considered Feb. 16, 1998.
Kocher, et al., "Dynamics of mitochondrial DNA evolution in animals: Amplificatin and sequencing with conserved primers", Proceedings of the Natl. Academy of Science of the USA, vol. 86, pp. 6169-6200 (1989).
Kocher, et al., Dynamics of mitochondrial DNA evolution in animals: Amplificatin and sequencing with conserved primers , Proceedings of the Natl. Academy of Science of the USA, vol. 86, pp. 6169 6200 (1989). *
Meyer, et al., "Origin of Tetrapods Inferred from Their Mitochondrial DNA Affiliation to Lungfish", J. Mol. Evol., vol. 31, pp. 359-364 (1990).
Meyer, et al., Origin of Tetrapods Inferred from Their Mitochondrial DNA Affiliation to Lungfish , J. Mol. Evol., vol. 31, pp. 359 364 (1990). *
Milner Gulland and Mace, The Implact of the Ivory Trade on the African Elephant Loxodonta africana Population as Assessed by Data from the Trade , Biological Conservation, vol. 55. *
Milner-Gulland and Mace, "The Implact of the Ivory Trade on the African Elephant Loxodonta africana Population as Assessed by Data from the Trade", Biological Conservation, vol. 55.
Miracle, A.L. & Campton, D.E., "Tandem Repeat Sequence Variation and Length Heteroplasmy in the Mitochondrial DNA D-Loop of the Threatened Gulf of Mexico Sturgeon, Acipenser oxyrhynchus desotoi", Journal of Heredity, vol. 86(1), pp. 22-27 (1995).
Miracle, A.L. & Campton, D.E., Tandem Repeat Sequence Variation and Length Heteroplasmy in the Mitochondrial DNA D Loop of the Threatened Gulf of Mexico Sturgeon, Acipenser oxyrhynchus desotoi , Journal of Heredity, vol. 86(1), pp. 22 27 (1995). *
Ong, T.L., et al., "Genetic Divergence between Acipenser oxyrinchus oxyrichus and A. o. desotoi as Assessed by Mitochondrial DNA Sequencing Analysis", COPEIA 2, (1996).
Ong, T.L., et al., Genetic Divergence between Acipenser oxyrinchus oxyrichus and A. o. desotoi as Assessed by Mitochondrial DNA Sequencing Analysis , COPEIA 2, (1996). *
Palumbi, et al., The Simple Fool s Guide to PCR, Biol. 101, Version 2 (1991). *
Palumbi, et al., The Simple Fool's Guide to PCR, Biol. 101, Version 2 (1991).
Rehbein, H.Z., "Caviare: Proximate Composition, Amino Acid Content and Identification of Fish Species", LEBENSM, Unters, Forsch, vol. 180, pp. 457-462 (1985).
Rehbein, H.Z., Caviare: Proximate Composition, Amino Acid Content and Identification of Fish Species , LEBENSM, Unters, Forsch, vol. 180, pp. 457 462 (1985). *
Walsh, et al., "Chelex 100 as a Medium for Simple Extraction of DNA for PCR-Based Typing from Forensic Material", Biotechniques, vol. 10, No. 4, pp. 506-513 (1991).
Walsh, et al., Bio. Techniques, vol. 10, pp. 506 513 (1991). *
Walsh, et al., Bio. Techniques, vol. 10, pp. 506-513 (1991).
Walsh, et al., Chelex 100 as a Medium for Simple Extraction of DNA for PCR Based Typing from Forensic Material , Biotechniques, vol. 10, No. 4, pp. 506 513 (1991). *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009256223A (en) * 2008-04-14 2009-11-05 Atena:Kk Extract liquid from egg of sturgeon
CN109097481A (en) * 2018-08-21 2018-12-28 福建省水产研究所（福建水产病害防治中心） Method based on high throughput sequencing technologies identification fish-egg larva and juvenile
CN109337962A (en) * 2018-08-24 2019-02-15 暨南大学 Primer and probe and its kit and method based on fluorescence quantitative PCR detection sturgeon
WO2024145639A3 (en) * 2022-12-30 2024-08-15 Hypercell Technologies Compositions, devices and methods for an improved rapid point-of-use diagnostic assay

Also Published As

Publication number Publication date
EP0807690A1 (en) 1997-11-19
ATE222962T1 (en) 2002-09-15
DE69714906T2 (en) 2002-12-19
EP0807690B1 (en) 2002-08-28
DE69714906D1 (en) 2002-10-02
WO1997043618A2 (en) 1997-11-20
WO1997043618A3 (en) 1998-03-19

Similar Documents

Publication Publication Date Title
Supikamolseni et al. Molecular barcoding of venomous snakes and species-specific multiplex PCR assay to identify snake groups for which antivenom is available in Thailand
US5786144A (en) Method and compositions for identification of species origin of caviar
Lopez-Pinon et al. Identification of four scallop species using PCP and restriction analysis of the ribosomal DNA internal transcribed spacer region
JPS62208300A (en) Nucleotide sequence composition and method for detecting gonococcus and screening of nucleotide sequence specific to genetically clear group
Gadelhaq et al. Molecular characterization of Eimeria species naturally infecting Egyptian Baldi Chickens
CN108315442A (en) A kind of Huang lip fish microsatellite DNA mark and its screening technique
CN111254202A (en) Primer group, kit and detection method for detecting Atlantic salmon
EP0468812B1 (en) Gene of candida yeast
Fujita et al. DNA fingerprinting patterns of Candida species using HinfI endonuclease.
CN105950740A (en) LAMP (loop-mediated isothermal amplification) kit for early diagnosis of candida krusei and special primer
CN113046427A (en) Method for high-throughput sequencing and structural feature analysis of chicken mitochondrial genome
Heath et al. Monitoring Piscirickettsia salmonis by denaturant gel electrophoresis and competitive PCR
CN101636507A (en) Be used to detect the nucleic acid probe of yeast and fungal species
Ichikawa et al. DNA types of aspermic Fasciola species in Japan
Hosoi et al. Sequence and polymerase chain reaction-restriction fragment length polymorphism analysis of the large subunit rRNA gene of bivalve: Simple and widely applicable technique for multiple species identification of bivalve larva
Reed et al. Fasciola hepatica: stage-specific expression of novel gene sequences as identified by differential display
Bachvaroff et al. Expressed sequence tags from Amoebophrya sp. infecting Karlodinium veneficum: comparing host and parasite sequences
Kitaura et al. Genetic variation in populations of the diamond-shaped squid Thysanoteuthis rhombus as examined by mitochondrial DNA sequence analysis
Novoa et al. Hypnospores detected by RFTM in clam (Ruditapes decussatus) tissues belong to two different protozoan organisms, Perkinsus atlanticus and a Perkinsus-like organism
KR100843575B1 (en) Gene of a parasite causing death of Halocynthia roretzi and method for diagnosing the parasite
Vanersea et al. Identification of larval sea basses (Centropristis spp.) using ribosomal DNA-specific molecular assays
Skantar et al. Multiple displacement amplification (MDA) of total genomic DNA from Meloidogyne spp. and comparison to crude DNA extracts in PCR of ITS1, 28S D2-D3 rDNA and Hsp90
Elfékih et al. Molecular taxonomic identification of Dacus and Ceratitis species from sub-Saharan Africa using mitochondrial haplotypes
CN117821600B (en) Acipenser sinensis real-time fluorescence quantitative PCR reference gene and screening method and application thereof
KR101720969B1 (en) Composition for discrimination of Yeonsan Ogye

Legal Events

Date Code Title Description
AS Assignment

Owner name: AMERICAN MUSEUM OF NATURAL HISTORY, THE, NEW YORK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DESALLE, ROBERT J.;BIRSTEIN, VADIM J.;REEL/FRAME:008996/0092;SIGNING DATES FROM 19971218 TO 19980126

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20020728