GB2374597A - Probes for myctophid fish - Google Patents
Probes for myctophid fish Download PDFInfo
- Publication number
- GB2374597A GB2374597A GB0108104A GB0108104A GB2374597A GB 2374597 A GB2374597 A GB 2374597A GB 0108104 A GB0108104 A GB 0108104A GB 0108104 A GB0108104 A GB 0108104A GB 2374597 A GB2374597 A GB 2374597A
- Authority
- GB
- United Kingdom
- Prior art keywords
- gene
- oligonucleotide
- primer
- loops
- dimers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
Abstract
A method for the preparation of specific gene probes for the identification of larval and adult life history stages of myctophids, i.e Lantern fish, including species <I>Tarletonbeania crenularis, Protomyctophum crockeri, Lampanyctus regalis, Diaphus theta</I> and <I>Stenobrachius leucosparus</I>. Gene probes are produced for cytochrome b, the Internal Transcribed Spacer region (ITS), mitochondrial D-loop, 12S and 16S rRNA and rhodopsin genes. Also claimed are complete nucleotide sequences for cytochrome b, ITS-2, D-loop and rhodopsin for <I>Stenobrachius leucosparus</I>.
Description
<Desc/Clms Page number 1>
PROBES FOR MYCTOPHID FISH Field of invention This invention relates to the molecular cloning and characterization of specific gene region sequences. More particularly the invention relates to genetic markers which have been identified in several genes such as Cytochrome b (cyt b); Mitochondrial control region (D-Loop); Inter Transcribed Spacers (ITS2) and Rhodopsin (ROD) in a mesopelagic lantern fish which are found in the mesopelagic zones and associate themselves with the oxygen minimum layer. The invention is also concerned with the recombinant DNA techniques for the preparation of specific gene probes useful for identification of larval and adult life history stages of myctophids i. e. Lantern fishes. The invention also deals with construction of species specific primer sequences.
Background of the Invention Among the mesopelagic fishes, the lantern fishes (Family Myctophidae) are extremely common and numerous in both species and individuals in the open ocean midwaters of the world oceans. The myctophid fishes are generally found associated with the oxygen minimum layer of the midwaters and are active vertical migrators. They have adapted themselves to low oxygen conditions and low/dark light intensity conditions.
Most studies on midwater fish have been restricted to investigations of the oxygen minimum layer in the eastern tropical pacific and/or morphological adaptations (Kinzer et al. Deep Sea Research II, 40 (3): 783-800 (1993).
Little is known about the biology and ecology of this group particularly the dynamics of the interaction between mesozooplankton stocks and abundant migratory myctophids.
The extreme oxygen deficiency of the Arabian Sea at mid depth has been well documented. Dissolved oxygen slowly increases below 1000 meter depth from about 0.2 ml per liter to 2.5 milliliter per liter at 2000 meter depth. Near the bottom at 3000 meter oxygen values average 3.5 ml per liter (SenGupta, R and S. W. A. Naqvi, Deep Sea Research, 31: 671-706, (1984).
<Desc/Clms Page number 2>
i. Ow/dark light i-Liteiis-IL-Y The myctophid fish are adapted to low oxygen conditions and low/dark light intensity conditions. Their physiological adaptations to these varying abiotic and biotic factors have enabled them to survive in the vast sub-oxia below 150 meter depth zone.
The myctophids are strong vertical migrators and active swimmers. Most of them are black/dark brown in color and possess fluorescent organs called photophores. They constitute food for higher fishes of commercial importance such as Tuna, Sharks and marine mammals.
In the northern and western Arabian Sea itself the US GLOBEC Report No. 9 (1993) reported a biomass of about 100 million metric tonnes per year (present world fishery catch is around seventy million metric tonnes). Their dominance could be due to their ability to live in the suboxic middle depths and avoid predators.
Due to high protein content vast myctophid populations can form an excellent fish meal and poultry feed to support aquaculture and other farming activities. The myctophids can facilitate the assessment of water bodies, estimation of genetic resources, genetic variability and the level of gene flow between various stocks and populations in the world oceans.
Traditionally, various investigators including; Gunther, A. Report on the deep-Sea Fishes collected by H. M. S. Challenger during the years 1873-1876, Reprint 1963, Text volume, J. Cramer, Weinheim, Hafner, New York, 1-135 (1887); Gilbert, Proceedings of the U. S.
National Museum, 48: 305-380 (1915), and Fraser-Brunner, proceedings of the Zoological society of London, 118 (4): 1019-1106 (1949), classified the species in the family Myctophidae by using differences in the position and numbers of photophores located on head and body of fish.
While photophore differences are still of primary importance, the morphometry is also used statistically (Paxton, Bulletin of the natural history museum of Los Angeles County, Science, No. 13 (1972).
<Desc/Clms Page number 3>
The methods are incompetent to identify the closely allied species, populations and the life history stages. This is the major bottleneck for the proper identification, population dynamics and stock assessment of these fishes leaving their systematics unjustified.
There are several reasons for this confusion. In the first place, the fish are particularly fragile and easily damaged in collecting nets, so most specimens collected tend to be in poor condition.
Second, the group contains many morphologically similar species from all parts of the world.
Third though there is only small amount of variability in most characters, there is enough in some cases for similar species to overlap even in those characters wherein they differ most significantly (Zahuranec, B, Zoogeography and Systematics of the lantern fishes of the genus Nannobrachium (Lampanyctini: Myctophidae) PhD Thesis, Scripps Institution of Oceanography, University of California, San Diego, 1995).
The problems have been compounded since specimens of many forms have not been numerous. It is difficult to collect ample material for the taxonomic studies using the existing conventional methods.
The midwater habitat of the fish make them a uncommon and difficult material to get for work as special gears are required on board of ship.
The mesopelagic habitats of the north Arabian sea support rich and varied fauna. Most of these fishes belong to Myctophidae, Gonostomitids, Stemoptychids etc. The richness of this resource in the mesopelagic regime of the oceans all the world over has been well documented (Boltachev, A. R. J. Ichthyol, 27 (4): 539-547 (1987); Hussain and Ali Khan, Deep Sea Research, 34 (7A): 1293-1299 (1987); Alikhan and Aftab, Marine Research, 2 (1-2): 1-9 (1993).
<Desc/Clms Page number 4>
US Globec, 1993 has reported a biomass of 100 million Tonnes of Myctophids in the Arabian Sea believed to be constituted by Benthosema pterotum and Diaphus sp. The true identity of stocks is, however, unknown.
In class Pisces there is a large body of population genetic data available on CD-ROMs and fish data bases (Agustin and Palomares, 5th International Symposium on Genetics in aquaculture, 19-25,1994). However, very little information pertains to the families of lantern fishes. There is only one paper on myctophids by Afanas-yev et al., J. Ichthiology, 30 (1): 28-37 (1990).
The earlier workers have described genetic diversity amongst conspecific and closely related species using protein electrophoresis. However, in the recent years, the molecular techniques using DNAs as the genetic markers have almost replaced these traditional methods with many shortcomings and providing information about only 1 % of the genome.
Several workers have applied the new methods of DNAs for quantifying genetic relatedness among group of fish in stock assessments among wild and cultured populations and in studies of taxonomy and population genetic (Datta et al. , Gene, 62: 331-336. 1988; Devlin et al. Canadian Journal of Fishery and Aquatic Sciences, 48 (9): 1606-1612,1991 ; Berson et al. Molecular Microbiology, 5 (9), 2261-2264,1991 ; Martinez et al. Genome, 36: 1119-1123,1993 ; Du Jun et al. DNA and cell Biology, 12 (8): 739-751, Cytogenetic and cellular genetics, 65: 233-237,1993 ; Pogson et al.
Genetics, 139: 375-3851994 and Carr et al. Molecular Ecology, 4: 79-88,1995.
There is a great lacunae in our knowledge of myctophid resource and stock assessment using genetic techniques. The only information so far available in related isozyme studies on 3 species endemic to the eastern pacific (Afanas-yev et al. 1990).
There is absolutely no literature available on genetic assessment of stocks from the other oceans.
<Desc/Clms Page number 5>
A judicious exploitation and resource management requires proper identification of the larval and adult stages of huge myctophid populations in the world oceans. The genetic resource assessment, species identification, characterzation of life history stages, estimation of genetic variability and level of gene flow between various stocks for proper utiliztion of this vast fishery potential and for assessment and evaluation of trophic dynamics at the top end of the marine food chain.
Various authors have described methods of making DNA probes and their use as genetic markers in various organisms using mostly cDNA approach. Some patents pertain to improvement of DNA amplification related methods and formulation of different primers.
Weissman et al. 1983 patented Method for cloning genes (United States Patent No.
4,394, 443 published on Jul. 19,1983). Mullis et al. In US patent No. 4,683, 195 published on Jul. 28,1987 describe process for amplifying, detecting, and/or cloning nucleic acid sequences. The methods provided recombinant clones coding for human histocompatibility antigens, in particular clones for HLA-B antigens. The recombinant DNA expression system is developed for use in control of larval and adult insects and conferring pesticide resistance to crop plants.
Erlich et al. (US Patent No. 5,314, 809 published on May 24,1994) provide methods for enhanced specificity and sensitivity of nucleic acid amplification. The methods are simplified nested amplification procedures wherein both inner and outer primer pairs are present in the amplification reaction mixture.
Grosz, et al. In US patent No. 5,340, 728 published on Aug. 23,1994 describe method for amplification of targeted segments of nucleic acid using nested polymerase chain reaction. Nuovo et al. (1996) in US Patent No. 5,538, 871, published on Jul. 23,1996 describe in improved In situ polymerase chain reaction. Barry et al. In US patent No.
5,574, 145 published on Nov. 12,1996 isolated nucleic acid molecules targeted to the
<Desc/Clms Page number 6>
region intermediate to the 16 S and 23 S rRNA genes useful as probes for determining bacteria. They describe a method for generating DNA probes specific for an organism and capable of distinguishing in a non-empirical manner between species.
Cossart et al. (US patent No. 5,523, 205 published on Jun 4,1996) describe DNA probes specific for hemolytic listera bacteria. Trent et al. In the US patent No. 5,693, 464 published on Dec. 2,1997 report rapid reproducible procedures for generating chromosome region-specific (CRSPs) for diagnostic and research applications.
Scott and Tomita (1998) give uses of cytochrome P450. Sub. Ipr gene (US Patent No. 5,734, 086, published on Mar 31,1998). Harris et al. (1998, US Patent, No.
5,849, 544, Dec. 15,1998) give method of characterization and provide method for the detection of diagnostic base sequences in one or more nucleic acids contained in a sample.
Jeffreys et al (1998, US Patent No. 5,853, 989, published on, Dec 29,1998) describe method of characterisation of genomic DNA. They used primers which selectively prime specific type of internal repeat unit in a tandemly repeated region. Ryder et al. (1998, US Patent No. 5,786, 183, published on Jul 28,1998) give methods of enhancing nucleic acid amplification. Dandliker et al. (1998, US Patent No. 5,707, 813, published on Jan 13,1998) report nucleic acid probes and methods. Kuhns (1999, US Patent No. 5,981, 171, published on Nov. 9,1999) describe diagnostic assays using nucleic acid probes. He describes methods and compositions for a rapid quantitative nucleic acid hybridization assay fpr detecting a DNA or RNA sequence in a biological sample.
Caetano-Anolles (1999, US Patent No. 5,962, 221, published on Oct. 5,1999) give oligonucleotide constructs and methods for the generation of sequence signatures from nucleic acids.
Bebbington et al (1999, US Patent No. 5,891, 693, published on April 6,1999) describe recombinant DNA methods vectors and host cells.
<Desc/Clms Page number 7>
Rothschild et al. In US patent No. 5,939, 264 published on Aug 17,1999) describe genetic markers in pigs for reproductive traits using polymorphism in the reproductive genes.
Molecular cloning and characterization of a further gene sequences coding for human relaxin is given in US. Patent No. 4,758, 516 by Hudson et al. published on Jul 19, 1988.
Some patents related to the genes reported by us is available on humans and other organisms. Aguirre et al. (1998) developed progressive rod-cone degeneration disease genetic markers and assays in a canine (US patent No. 5,804, 388). Reports on diagnosis of hereditary retinal degenerative diseases is given by Dry) a et al. In US patent No. 5,262, 529 published on Nov. 16,1993 They developed a probe for identifying region of photoreceptor protein of humans and also made the primers. Dryja et al in Mar. 1996, US Patent No. 5.498, 521 published on Mar. 12,1996 later report the method which involves analyzing the DNA of the subject to determine the presence or absence of a mutation in a gene for photoreceptor protein. Shassere, et al. (1997 US Patent, 5,698, 398 published on Dec. 16,1997) disclosed quality control compositions suitable as sample specimens to measure performance of DNA probe tests which determine cytogenetic abnormalities, such as chromosome copy number, of cells in a tissue sample.
However, all of these are related to making cDNA probes and the work is mostly on humans, canines, bacteria and other organisms, mostly of terrestrial origin.
No patent is available on fish DNA probes and sequences as genetic markers particularly in the myctophid fish. Nor are primer sequences designed for these fishes.
Earlier Mitochondrial DNA control region and Ribosomal Internal transcribed spacer (ITS2) are used for systematic relationships. Reed K. M, et al. (1998) studied sequence analysis of the mitochondrial DNA control region of ciscoes (genus Coregonus) with taxonomic implications for the Great Lakes species flock.
<Desc/Clms Page number 8>
Molecular cloning of rod opsin (rhodopsin) cDNA from retinas of various teleost fishes, octopus, squids, shrimps, Lamprey and screening of cDNA libraries of rhodopsin is done by several workers (O'Brien and Al-Ubaidi, M. R. , Gene, 193 (2): 141-150; Crescitclli, F, et al. Journal of Comparative Physiology, 1985: 157 (3): 323-333; Tsai, H. J. et al.,
Biochemical molecular Biology, 109,91 : 81-88; Hara-Nishimura et al. FEBS-LETT,
317 (1-2): 5-11,1993). Crandall, K. A. and Hillis, D. M. Nature, 387 (No. 6634), 667- 668,1997, describe rhodopsin protein evolution in the dark in cave dwelling cray fish. Fitzgibbon, j et al., Gene, 1995,164 (2), 273-277. Harada, Y et al. Journal of Biochemistry, 110 (4), 501-507, 1991 report synthesis and expression of rhodopsin gene in Octopus. But all these reports deal with the protein rhodopsin, not much has been said about its gene even in these species.
Douzery E, et al. Molecular Biology and Evolution, 14 (11): 1154-66 (1997) use the mitochondrial control region of Cervidae : evolutionary patterns and phylogenetic content. Barreto G, et al. American Journal of Human Genetics 58 (3): 609-16 (1996) report Mitochondrial D-loop"signatures"produced by low-stringency single specific primer PCR constitute a simple comparative human identity test. Brown JR, et al.
Genetics. 142 (2): 525-35.1996 describe Length variation, heteroplasmy and sequence divergence in the mitochondrial DNA of four species of sturgeon (Acipenser). Lee WJ, et al. J Mol Evol. 1995 Jul ; 41 (1) : 54-66 report structure and evolution of teleost mitochondrial control regions. No reports of DNA probes for genetic marking of any marine species is come across.
Jobst J, et al (1998) give information on Molecular evolution of the internal transcribed spacers (ITS 1 and ITS2) and phylogenetic relationships among species of the family Cucurbitaceae. Odorico DM, et al. (1997) describe Variation in the ribosomal internal transcribed spacers and 5.8S rDNA among five species of Acropora (Cnidaria; Scleractinia): patterns of variation consistent with reticulate evolution. Despres L, et al (1995) describe ITS2 ribosomal RNA indicates Schistosoma hippopotami is a distinct species. Crabtree MB, et al. (1995) study development of a species-diagnostic polymerase chain reaction assay for the identification of Culex vectors of St. Louis
<Desc/Clms Page number 9>
encephalitis virus based on interspecies sequence variation in ribosomal DNA spacers.
Mukhamedov RS, et al. (1994) report [Nucleotide sequence of internal transcribed spacers and 5.8S rDNA for the ribosomal operon from alfalfa Medicago sativa and cotton Gossypium hirsutum L]. No reports of DNA probes in open ocean marine fish are seen.
Goswami and Bernard (1999) described nucleotide gene sequences of 16 S and 12 S
genes of five myctophid species viz : Tarletonbeania crenularis ; Protomyetophum crockeri ; Lampanyctus regalis ; Diaphus theta ; Stenobrachius leucosparus in the National center of Biotechnology information GenBank. These sequences were published on 20 April, 1999 and can be screened at http://www. ncbi. nlm. nih. gov/ Genbank databases. The respective accession numbers are AF134250; AF 134249; AF 134248; AF 134247; AF 134246; AF 134245; AF 134244; AF134243; AF 134242 and AF 134241.
As such, in order to obcriate the draw backs listed in the use of conventional taxonomic methods for identification of open ocean midwater fish, the applicants developed a novel method and approach, using molecular biology.
The invention relates to the molecular cloning and characterization of specific gene region sequences. More particularly the invention relates to genetic markers which have been identified in several genes such as Cytochrome b (cyt b); Mitochondrial control region (D-Loop); Internal Transcribed spacer between nuclear ribosomal genes (ITS2) & Rhodopsin gene of visual pigments (Rod) and mitochondrial ribosomal RNA genes for myctophid fishes.
As discussed above, prior art patents and reports deal with different groups of organisms. The invention on the other hand concerns an economically important group of open ocean midwater fish found in all the world oceans which has adapted itself to the oxygen minimum conditions and to low/dark light intensities for vision, the genetic information of which has not been reported so far.
<Desc/Clms Page number 10>
The genomic DNA probes are sequence specific and are ideal for identification of complimentary regions of species specific genes. Cytochrome b is an important component of mitochondrial electron transport chain and plays important role in respiratory physiology (William, F. Ganong, Chapter 17 199-235 in Review of medical physiology pp. 599; 1977). The gene encoding cytochrome b, termed Cyt b ofmyctophid fishes plays an important role in adaptations and survivals of these fishes in the suboxic regions.
The Rod gene encoding for rhodopsin of the retinal rods is important for adapations of these fishes to varying light intensities which varies with the depth.
The mitochondrial control region D-Loop an Internal transcribed spacer ITS2 gene regions are highly prone to rapid mutations and can be suitable gene candidates for identification of variants at the intra species and population level.
The invention discloses species specific DNA probes for detection of genes such as cyt b, Rod, D-Loop, ITS2. This invention is useful for identification of early and adult life history stages of myctophids i. e. Lantern fishes.
This is the first report of preparation of DNA probes useful for molecular genetic identification of myctophid fish. Novelty of the invention is in use of novel gene region DNA probes for identification of eggs and early larvae of mesopelagic fish which live in oxygen minimal and low light conditions.
Objects of the invention The main object of the invention is to provide an effective method for identifying stock and population of myctophids.
Another object is to provide a method using polymerase chain reaction with specific primers to detect and quantify the expression of genes like cytochrome b, Rod, D-Loop, ITS2 etc. in myctophid fishes.
<Desc/Clms Page number 11>
Another object of the present invention is to develop specific DNA probes for identification of populations of mesopelagic fish of the type myctophids.
Yet another object of the invention is to develop DNA probes comprising specific nucleotide sequences which specifically can detect mitochondrial genes such as Cyt b, D-Loop in myetophid fishes.
Still another objective is to develop DNA probes comprising specific nucleotide sequences which specifically can detect nuclear genes such as Rod and ITS2 in fishes.
Another objective of the invention is design specific primers for specific gene regions.
Still another object is to develop kits containing primer sets.
Detailed Description of the invention The present invention seeks to overcome the drawbacks inherent in the prior art by providing the highly efficient and selective means for identifying the stocks and populations of myctophids using specific nucleic acid probes of certain genes. As used herein the, term'probes'and'probe'are used to designate the collection of DNA segments produced by amplification of specific regions.
Accordingly, the invention provides a method for development of DNA probes for myctophids which comprises: (i) Extracting the DNA from the tissue of an identified myctophid fish, (ii) Selecting primers for species and population level, (iii) Amplifying the extracted DNA using polymerase chain reaction (PCR) using the selected primers, (iv) Eluting the amplified DNA from the PCR reactions, (v) Cycle sequencing of 5 mu L. eluted DNA using single primer, (vi) Purifying extension products,
<Desc/Clms Page number 12>
(vii) Sequencing on acrylamide gel in an automated sequencer.
(viii) Cloning a part of the eluted DNA (IV) from the resulting PCR product into a suitable vector, and growing in competent transformed host cells, (ix) Purifying recombinant plasmid DNA having the cloned gene probes from the transformed host cells.
(x) Checking purity and specificity of the cloned DNA probe insert, (xi) Confirming the molecular size of the DNA probe insert, (xii) Sequencing of the cloned DNA probe.
(xiii) Comparing the DNA sequences of the prepared DNA probe with the sequences of the same gene region done in the automated sequencer, (xiv) Comparing the DNA sequence of the DNA probes using"BLAST" program against the known sequences of similar genes in the genome data bases.
Thus, the invention provides nucleoticle sequences, primers and probes which exhibit myctophid specificity in nucleic acid amplification reactions. The invention relates to nucleotide sequences specific to mitochondrial genes in myctophid fishes. The invention also provides nucleotide sequences specific for the nuclear genes of myctophid fishes. Thus, the invention provides oligonucleotide primers that can be used for amplification of target sequence in myctophid fishes. These primers can amplify specific regions of gene by PCR.
In an embodiment the mitochondrial genes are Cyt b and D-loop genes.
In another embodiment the nuclear genes are Rod and ITS-2 genes.
In yet another embodiment the myctophid fishes are selected from the group comprising
the steps of Stenobrachius leucospara, Diaphus theta, Protomyctophum crockeri, Tarletonbeania crenularis, Lampanyctus regalis, Symbolophorus sp., Triphoturus sp. and Lampanyctus sp.
<Desc/Clms Page number 13>
In still another embodiment the primer set (forward and backward primers) used for amplification and detection of Cyt b gene contains oligonucleotides with the sequences:
CYT1 : 5'TGAYTTGAARAACCAYCGTTG 3'
CYT2 : 5'CTCCARTCTTCGRYTTACAAG 3' In another embodiment (forward and backward primers) used for reamplification and detection of Cyt b gene contains oligonucleotides with the sequences : CBI-L : 5'CCA TCC AAC ATC TCA GCA TGA TGA AA 3' CYT2 : 5'CTCCARTCTTCGRYTTACAAG 3' In another embodiment the primer set (forward and backward primers) used for PCR amplification and detection of D-Loop gene contains oligonucleotides with the sequences:
PRO-L: 5'CTA CC 3'
D-LOOP H : 5'CCT GAA GTA GGA ACC AGA TG 3' In another embodiment (forward and backward primers) used for PCR amplification of ITS2 gene contains oligonucleotides with the sequences:
ITS2-F : 5'CTA CGC CTG TCT GAG TGT C 3' ITS2-R : 5'ATA TGC TTA AAT TCA GCG GG 3' In yet another embodiment the primer set (forward and backward primers) used for PCR amplification of Rhodopsin gene Rod contains oligonucleotides with the sequences:
ROD-R: 5'TCT TTC CGC AGC ACA ACG TGG 3'
ROD-F: 5'CATATGAATACCCTCAGTACTACC 3' In still another embodiment the primer set (forward and backward primers) used for PCR amplification of 12S RNA gene contains oligonucleotides with the sequences:
12 SA-L : 5'AAA CTG GGA TTA GAT ACC CCA CTA T 3' 12 SB-H : 5'AGAGTGACGGGCGGTGTGT 3'
<Desc/Clms Page number 14>
In another embodiment the primer set (forward and backward primers) used for PCR amplification of 16S RNA gene contains oligonucleotides with the sequences: 16SAR-L : 5'CGC CTG TTT ATC AAA AAC AT 3' 16 SBR-H: 5'CCG GTC TGA ACT CAG ATC ACG T 3' In yet another embodiment the vector used for cloning was Bluescript KS-phagemid.
In still another embodiment the vector used for cloning had ampicillin resistance gene for selection.
In another embodiment the vector used for cloning had Lac Z gene for blue white colony selection.
In another embodiment the Col E I was the origin for replication of phagemid in the absence of helper phage.
In another embodiment F 1 (-) origin for recovery of antisense strand of lac Z gene when a host strain containing the bluescript II phagemid (Fig. 1).
In another embodiment the host cells used for transformation were E. coli blue bacteria (Bacteria Strain XL 1 blue) XL1-Blue :-F' :: TnlO, pro Alaclq (lacZ) M15/recAlendAlgyrA96 (Nar) thi hsdR17 (rk- mk +) supE44reIA 1 lac.
The invention also relates to specific DNA sequences for the cloned DNA probe inserts for the Cyt b, D-Loop, Rod, ITS2 genes. The invention provides species specific primer sequences for amplification and detection of Cyt b, D-Loop, Rod, ITS2,12S RNA and 16 S RNA genes of Stenobrachius leucopsarus (SLMB) myctophid fish. The sequences of the species specific primer 12S rRNA-H and 12S rRNA-L of Stenobrachius
leucopsarus (SLMB) designed were such as : 12S-H 5'CCC ACT CAC TGC TAA CTC C 3' 12S-L 5'GGC TAA CTA CAA TCA TCT GCT 3'
<Desc/Clms Page number 15>
The sequences of the species specific primer 16S rRNA-H and 16S rRNA-L of Stenobrachius leucopsarus (SLMB) designed were such as : 16S-H 5'TAC GCA TAA CGG CTC TGG 3' 16S-L 5'CTACTACACCTCAACTACATCT 3' The sequences of the species specific primer Cyt-H and Cyt-L of Stenobrachius leucopsarus (SLMB) designed were such as:
Cyt-H 5'GCT CGG GCT GCT GGA ATC TT3'
Cyt-L 5'CAACCT CAT CTGTCGTAAAC 3' The sequences of the species specific primer ITS2-H and ITS2-L (Forward) of Stenobrachius leucopsarus (SLMB) designed were such as:
ITS2-H 5'ATA CTC TGC GGA CAT ACT TGA CTG 3' ITS2-F 5'ACT TGA CTGACC TTC TTACT 3' The sequences of the species specific primer Pro-L and
D Loop-H of Stenobrachius leucopsarus (SLMB) designed were such as:
Pro-L 5' CAG TCT CGT CAA ACC AAG TCA AAC 3'
Dloop-H 5'ATAATCATCCAGCAT AAACACAC 3' The sequences of the species specific primer ROD-L and ROD-H of Stenobrachius leucopsarus (SLMB) designed were such as:
ROD-L 5'CCT GGT AGA GTT CGC CGT CA 3' ROD-H 5'CGT GTT CCT TAT CAT TGT GCC T 3' The sequences of the species specific primer 16S rRNA-H and 16S rRNA-L of yet another myctophid Lampanyctus regalis (LRMB) designed were such as:
16S-H 5'TCG TAG TTC AGC AGT CAG 3' 16S-L 5'CAC CAG CCA AGT ATG TTT CTC 3'
<Desc/Clms Page number 16>
The sequences of the species specific primer 12S rRNA-H and 12S rRNA-L of yet i n another myctophid Lampanyctus regalis (LRMB) designed were such as : 12S-H 5'GCC TCC ATC ATC CCT CAC CTT AC 3'
12S-L 5'CTATTCGCCTCGCTCAGAC 3' The sequences of the species specific primer 16S rRNA-H and 16S rRNA-L of yet another myctophid Diaphus theta (DTMB) designed were such as:
16S-H 5'CTC CGT CCG TCT CGC CTC TG 3' 16S-L 5'AAA TCC GCC CTT ATG TGT GTT C 3' The sequences of the species specific primer 12S rNA -H and 12S rRNA-L of yet another myctophid Diaphus theta (DTMB) designed were such as:
12S-H 5'CAT CGG CTT GCT CTA TTC CTT G 3' 12S-L 5'TCT ATC GGC GGC GTA TCA C 3' The sequences of the species specific primer 16S rRNA -H and 16S rRNA-L of yet another myctophid Tarletonbaenia crenularis (TCMB) designed were such as:
16S-H 5'GGC GAT TCT ACG GCA CGG GCG 3' 16S-L 5'AAA CTG GTC CTC AAC TAT GTC A 3' The sequences of the species specific primer 12S rRNA -H and 12S rRNA-L of yet another myctophid Tarletonbaenia crenularis (TCMB) designed were such as:
12S-H 5'CCG ATT CAG CCA CGA TTC CCT C 3' 12S-L 5'CCT AAAGCCCAGATAACT ACA 3' The sequences of the species specific primer 16S rRNA -H and 16S rRNA-L of yet another myctophid Protomyctophum crockeri (PCMB) designed were such as:
16S-H 5'CGTGTTCTGATGATGATGTGCT 3' 16S-L 5'ATT CCT TCC TCT TAG TAT G 3'
<Desc/Clms Page number 17>
The sequences of the species specific primer 12S rRNA-H and 12S rRNA-L of yet another myctophid Protomyctophum crockeri (PCMB) designed were such as:
12S-H 5'GCTGAACTT ACT ATG CCC TAC T 3'
12S-L 5'CCG ATT GAC GCC GAA CTA TG 3' Tablel-Forward primer designed for cytochrome b gene of Stenobrachius leucopsarus (slmb primer cyt L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 2-Backward primer designed for cytochrome b gene of Stenobrachius leucopsarus (slmb primer cyt H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table3-Forward primer designed for Internal Transcribed Spacer (ITS2) of
Stenobrachius leucopsarus (s1mb primer ITS2 F) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 4-Backward primer designed for Internal Transcribed Spacer (ITS2)
Stenobrachius leucopsarus (slmb primer ITS2-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 5-Forward primer designed for mitochondrial Control region d-Loop of Stenobrachius leucopsarus (s1mb primer pro-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 6-Backward primer designed for mitochondrial Control region d-Loop
Stenobrachius leucopsarus (shnb primer D loop-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 7-Forward primer designed for Rhodopsin gene region of Stenobrachius leucopsarus (shnb primer ROD-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
<Desc/Clms Page number 18>
Table 8-Backward primer designed for Rhodopsin gene region of Stenobrachius leucopsarus (slmb primer ROD-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 9-Forward primer designed for mitochondrial 16S ribosomal RNA region of Lampanyctus regalis (LRMB primer 16 S-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 10-Backward primer designed for mitochondrial 16S ribosomal RNA region of Lampanyctus regalis (LRMB primer 16 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 11-Forward primer designed for mitochondrial 12 S ribosomal RNA region of Lampanyctus regalis (LRMB primer 12 S-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 12-Backward primer designed for mitochondrial 12 S ribosomal RNA region of Lampanyctus regalis (LRMB primer 12 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 13-Backward primer designed for mitochondrial 16 S ribosomal RNA region of Diaphus theta (DTMB primer 16 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 14-Forward primer designed for mitochondrial 16 S ribosomal RNA region of
Diaphus theta (DTMB primer 16 S-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 15-Backward primer designed for mitochondrial 12 S ribosomal RNA region
ofDMp/ : M Aa (DTMB primer 12 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 16 - Forward primer designed for mitochondrial 12 S ribosomal RNA region of
Diaphus theta (DTMB primer 12 S-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
<Desc/Clms Page number 19>
Table 17-Backward primer designed for mitochondrial 16 S ribosomal RNA region of Tarletonbeania crenularis (TCMB primer 16 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 18-Forward primer designed for mitochondrial 16 S ribosomal RNA region of
Tarletonbeania crenularis (TCMB primer 16 S-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 19-Backward primer designed for mitochondrial 12 S ribosomal RNA region of Tarletonbeania crenularis (TCMB primer 12 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 20-Forward primer designed for mitochondrial 12 S ribosomal RNA region of
Tarletonbeania crenularis (TCMB primer 12 S-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 21-Backward primer designed for mitochondrial 16 S ribosomal RNA region of Protomyctophum crockeri (PCMB primer 16 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 22-Forward primer designed for mitochondrial 16 S ribosomal RNA region of
Protomyeophum crockeri (PCMB primer 16 S-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 23-Backward primer designed for mitochondrial 12 S ribosomal RNA region of Protomyetophum crockeri (PCMB primer 12 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 24-Forward primer designed for mitochondrial 12 S ribosomal RNA region of
Protomyctophum crockeri (PCMB primer 12 S-L) with 5'to 3'end
<Desc/Clms Page number 20>
sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 25-Backward primer designed for mitochondrial 16 S ribosomal RNA region of Stenobrachius leucopsarus (SLMB primer 16 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 26-Forward primer designed for mitochondrial 16 S ribosomal RNA region of Stenobrachius leucopsarus (SLMB primer 16 S-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Table 27-Backward primer designed for mitochondrial 12 S ribosomal RNA region of Stenobrachius leucopsarus (SLMB primer 12 S-H) with 5'to 3'end sequences (ANTISENSE) and summaries of oligonucleotide and structural analyses.
Table 28-Forward primer designed for mitochondrial 12 S ribosomal RNA region of
Stenobrachius leucopsarus (SLMB primer 12 S-L) with 5'to 3'end sequences (SENSE) and summaries of oligonucleotide and structural analyses.
Details of the invention This invention of DNA probes developed can be utilized for chromosomal mapping of the myctophid species.
The present invention also contemplates the use of lantern fish primer sets and specific probes in kit form.
Thus in a preferred mode of use, the species specific primers will be employed to conveniently amplify a selected gene region to produce DNA probe directed for use as genetic markers.
<Desc/Clms Page number 21>
The invention would be advantageous for identification of myctophid larvae and hence can facilitate the assessment of water bodies, estimation of genetic resources and genetic variability between myctophid population.
Cyt b probe sequences of myctophids will be advantageous to be used for study of comparative human genomics of the genes related to acclimitisation to low oxygen at high altitudes and deep oceanic explorations.
Rod gene probe sequences will be advantageous to be used for study of comparative human genomics of the genes related to acclimitisation to low light like night blindness.
Example 1: Chemicals, Reagents, Apparatus used and their sources.
LIST OF CHEMICALS
Name Company Catalogue Number 8- Hydroxyquinoline HIMEDIA RM1061 Acrylamide 3Xcryst SRL 0144139 free from DNase, RNase, Protease Agar powder HIMEDIA RM 026 Agarose SRL 014011 Agarose HIMEDIA RM 187 Benzimidazole SRL 024727 (1,3Benzodiazole) Extrapure Bromophenol blue BDH 20015 Buffer Tablets QUALIGENS 17301 pH 7. 0 Butan-l-01 GLAXO 12045 A. R Chloroform A. R S. D. FINE CHEM 20077 Chloroform for HPLC SRL 0322123 E. D. T. A. Disodium salt HIMEDIA RM 1195 (Hydroxy Methyl) free from DNase, RNase, protease EDTA HIMEDIA RM 678 EDTA Disodium salt S. D. FINE CHEM 38025 L. R Ethanol MERCK UN 1170 Ethanol (Absolute) FARCO 971109 CHEMICALS
<Desc/Clms Page number 22>
Ethidium Bromide HIMEDIA RM 813 Hydrochloric acid Isoamyl alcohol MERCK 8.18969 For synthesis Magnesium Chloride HIMEDIA RM 728 A. R Methanol SRL 132977 Extrapure A. R N, N-Dimethyl Fonnamide SRL 042825 Phenol RANBAXY P0130 A. R Potassium Acetate HIMEDIA RM 1091 Potassium Chloride MERCK 17533 Purified Potassium Dihydrogen HIMEDIA RM 249 Orthophosphate A. R Propanol QUALIGENS 73827 A. R Sodium Acetate HIMEDIA RM 410 Anhydrous Sodium Chloride HIMEDIA RM 853 A. R Sodium dihydrogen MERCK 17845 Phosphate 2-hydrate Cryst. Pure Sodium Hydroxide HIMEDIA RM 467 A. R Sodium Lauryl Sulphate HIMEDIA RM 205 Sodium Nitrite QUALIGENS 15935 Excela R Sodium Phosphate dibasic LOBA CHEMIE 35986 Anhydrous purified Sucrose SRL 194957 From sugar cane A. R Tris Aminomethane SRL 2044122 (Tris Buffer) Tris Aminomethane SRL 204982 Hydroxy Methyl (Tris buffer) Extrapure A. R Tris buffer HIMEDIA RM 262 A. R Tris Hydrochloride HIMEDIA RM 613 Tri-Sodium Citrate HIMEDIA RM 255 A. R Trypsin 3X Cryst. SRL 204013 Trypsin 1: 250 SRL 2040106
<Desc/Clms Page number 23>
Vitamin B, 2 HIMEDIA RM184 (Cyanocobalamin) Yeast Extract powder SRL 254011 DNA extractions and quality and quantity check : Total DNA of Stenobrachius leucopsarus was extracted from the muscle tissue by putting in the cocktail of
613. Oul Lysis Buffer (Lysis Buffer recipe: I0mM Tris, 400mM NaCl, 2mM Na2 EDTA) ;
30.0 l 20% SDS (40g/200 ml water) ;
7. 0 1 Proteinase K (20 ug/p. l) which was stored at-20 C and about 0. 1-0. 5 grams of the muscle tissue.
Incubated the eppendorfat 550C for 12-14 hrs. Added 375 R I of 6 M NaCl and left for 30 min at room temperature.
Centrifuged for 30min. @ 14000 rpm. Removed the supernatant and added Chloroform (800 l) & Centrifuged for 10 min @ 12000 rpm. Removed the supernatant and added
1Jll RNAase (10 mg/ml, stored at-20 C) and kept at 370 C for 10 min. Added 750 u. l volume of isopropanol.
Left the tube at-20 C for 30 min for DNA precipitation followed by Centrifugation for 30 min. @14000 rpm.
Removed the liquid and dried the pellet under vacuum.
After 1-2 hrs dissolved DNA pellet in 100 RI of sterilized ultrapure water. Stored at 4 C.
The DNA extracted was checked for its quality and quantity using UV Spectrophotometer (OD26o - OD28orange of wavelengths ofUV. 10. D = 50 jug DNA/ml.
1.80-2. 00 range of A1 : A2 ratios.
Agarose gel electrophoresis was done to check the molecular weight of DNA.
Agarose gel (0.8%) was prepared in IX TBE buffer and 2 Jll etBr was added to it.
The samples were loaded and 1 Kb DNA Ladder was used as the Marker. The samples were run for 40-45 min. at 72 volts.
The results were viewed in Biorad Gel Doc. 1000.
<Desc/Clms Page number 24>
The computer program used was Molecular analyst.
Example 2: The DNA preparation and quality & quantity of Tarletonbeania crenularis was done as given in example 1.
Example 3: The DNA preparation and quality & quantity of Protomyctophum crockeri was done as given in example 2.
Example 4: The DNA preparation and quality & quantity of Lampanyctus regalis was done as given in example 3.
Example 5: The DNA preparation and quality & quantity of Diaphus theta was done as given in example 4.
Example 6: PCR amplification using forward and backward D-Loop primers of Stenobrachius leucopsarus.
The PCR master mix (100 J. I) comprised of Taq Buffer MgCl2 free (10. 0 p. l), dNTP all the four nucleotides in the ratio of 1 : 1 : 1 : 1 (08. 0 ! -t1) ; D-Loop forward primer 01. 0 gel with sequences (PRO-L : 5'CTA CC 3'), D-Loop backward 01. 0 Al, with sequences (D-Loop H : 5'CCT GAA GTA GGA ACC AGA TG 3') ; MgClz (01. 0 Ill) ; Taq Polymerase (0. 5 pal) ; and ultrapure water (78. 2 Ill).
This master mix was divided into 4 equal parts and put in separate eppendorf tubes. To each tube 0. 3 p. l of DNA ofeoc/eMcopaM was added and run for 35 cycles in DNA thermo cycler. (Each cycle consisted of 94 degree C for 45 Seconds, 48 degree for 45 seconds, and 72 degree C for 1 minute) and hold at 4 degree Centigrade.
Thermal Cycler used was DNA Thermal Cycler, Perkin Elmer 480.
Example 7: As given in example 6, PCR amplification master mix was prepared using forward and backward 12 S RNA primers; 16 S RNA primers, Cyt b primers; ROD, ITS2 primers and
<Desc/Clms Page number 25>
DNA 0. 3 pi of of Stenobrachius leucopsarus was added individually to all tubes and
amplified. The primers used were ROD-F : 5'CAT ATG AAT ACC CTC AGT ACT ACC 3'and ROD-R : 5'TCT TTC CGC AGC ACA ACG TGG 3'for Rhodopsin DNA probe; 16SBR-H 5'CCG GTC TGA ACT CAG ATC ACG T 3'and 16SAR-L 5'CGC
CTG TTT ATC AAA AAC AT 3'16S for 16 S RNA gene probe; 12SA-L: 5'AAA CTG GGA TTA GAT ACC CCA CTA T 3'and 12SB-L: 5'AGA GTG ACG GGC GGT GTG T 3'for 12S RNA gene probe and run for 35 cycles in DNA thermo cycler. (Each cycle consisted of 94 degree C for 45 Seconds, 48 degree for 45 seconds, and 72 degree C for 1 minute) and hold at 4 degree Centigrade.
Example 8: Cytochrome b DNA probe was amplified by using Cyt 1: 5'TGA YTT GAA RAA CCA YCG TTG 3'and Cyt 2: 5'CTC CAR TCT TCG RYT TAC AAG 3'primers followed by reamplification by using CBI-L 5'CCA TCC AAC ATC TCA GCA TGA TGA AA 3'and Cyt 2: 5'CTC CAR TCT TCG RYT TAC AAG 3'primers. The DNA template was of Stenobrachius leucopsarus and run for 35 cycles in DNA thermo cycler. (Each cycle consisted of 94 C for 45 Seconds, 48 degree for 45 seconds, and 72 degree C for 1 minute) and hold at 4 degree Centigrade.
Example 9: Similarly, primer ITS1F-ITS2R of Internal transcribed spacers was used for the nested PCR's (ITS1-F : 5'TTG TAC ACA CCG CCC GTC GC 3'and ITS2-R: 5'ATA TGC TTA AAT TCA GCG GG 3') and amplified by PCR. Later the ITS2 was reamplified using primers ITS2-F: 5'CTA CGC CTG TCT GAG TGT C 3'and ITS2-R: 5'ATA TGC TTA AAT TCA GCG GG 3'. The DNA template was of Stenobrachius leucopsarus myctophid fish and run for 35 cycles in DNA thermo cycler.
(Each cycle consisted of 94 C for 45 Seconds, 48 C for 45 seconds, and 72 C for 1 minute) and hold at 4 degree Centigrade.
Example 10.
The PCR amplified and PCR reamplified DNA's were cleaned using QIAquick1M PCR purification Kit which is a product of QIAGEN Inc following their protocols.
<Desc/Clms Page number 26>
Example 11 : Cycle sequencing was done after following protocols of Perkin Elmer's ABI PRISM 1M Dye terminator Cycle sequencing ready reaction kit with AmpliTaq R DNA polymerase.
Single primer for each gene was used and PCR amplification was done following 25 cycles (each cycle comprised of 96 C for 30 seconds; Rapid thermal ramp to 46 degree C; 46 C for 15 seconds; rapid Thermal ramp to 60 degree C and 60 degree C for 4 minutes).
Example 12 : Purified extension products was done after the same protocol as given on page 8. The DNA pellet was dried under vacuum and stored the dry pellet at-20 C.
Example 13: Sequencing on acrylamide gel was done in automated sequencer.
Model 373, DNA sequencing System, Applied Biosystems. A Division of Perkin Elmer. The protocols were used after Sambrook, Fritsch, Maniatis, Molecular Cloning a laboratory manual, second edition, Vol. 2, DNA sequencing 13.47.
40% acrylamide solution was made by acrylamide DNA sequencing grade 380 g; N, N'methylenebisacrylamide (20 g) and distilled water 600 ml. The TBE buffer (5X) was used. It was made up with Tris Base (54.00 g); Boric acid (27.50 g) Na2 EDTA (4.65 g) and remaining ultra pure autoclaved water to make the volume 1 litre.
Example 14: For computation of sequence data program used was"Sequence Navigator, DNA, Applied Systems. A division of Perkin Elmer Corporation". The sequences were sent to Blast email and confirmed by checking for the respective gene segments.
Example 15: Ligating the eluted PCR product in to a suitable vector: Eluted DNA of Stenobrachius leucopsarus of cyt b gene was ligated. The total mixture of 20 Ill comprised of Water (9 Ill) ; T 4 DNA Ligase Buffer (4 Ill) ; 1 III Vectors (KS-, cut with ECOR V); 5 III eluted DNA; 1 III T 4 DNA Ligase.
The vector and the host cells used for cloning was Bluescript KS-phagemid with the ampicillin resistance gene for selection.
<Desc/Clms Page number 27>
Lac Z gene for blue white colony selection. ColEl origin for replication of phagemid in the absence of helper phage.
F 1 (-) origin for recovery of antisense strand of lac Z gene when a host strain containing the bluescript II phagemid.
The host cells used for transformation were E. coli blue bacteria (Bacteria Strain XL 1 blue) Xi-bue :- F' :: TnlO, pro A+B+lac1Q (lacZ) M15/recAlendAlgyrA96 (Na1) thi hsdR17 (rk-mklsupE44relAl1ac.
All these were put in a PCR tube and left for 24 hrs at 4 degree Centigrade cold room for legation. It was labeled as"# SLMB 1, Cytb, DNA Lig." Example 16: Similarly the DNA ligase for genes ROD, ITS2,12 S RNA and 16 S RNA was prepared.
Example 17: Preparation of electro-competent cells for use in electro-transformation.
Prepared 3 litre of LB broth media (10 g Bacto-Tryptone per litre, 5 g Bacto-Yeast per litre and 5g NaC1 per litre) and divided into 4 parts.
From this 2 litres were used for E. coli culture (E. coli strain XL 1 blue was not ampicillin resistant & so no antibiotic was added). It was poured in 4 no. of 1 Litre glass bottles with 500 ml in each.
500 ml was put in a 1 litre bottle to make plates for growing transformed bacteria after electroporation. Prior to autoclaving added only 10 gms of granulated agar (2% agar solution) and later added antibiotic.
250 ml LB was distributed in 20 ml KIMAKAP NO. 73660 tubes @ 5 ml in each (no antibiotic was added). These tubes were meant for initial growing of electro-competent cells i. e. bacteria.
Last 250 ml was put in a 250 ml glass bottle for use while electroporating to put into the cuvettes.
Example 18: Making agar plates to grow transformed bacteria after Electroporation:
<Desc/Clms Page number 28>
After autoclaving the LB broth bottle with 500 ml LB + 10 g granulated Agar for
bacteriological work was allowed to cool down on the bench to about 50oC.
Then added, X gal-500 jul, 500 ul* Ampicillin sodium salt prepared by dissolving 75 mg (0.075 g) in 1.5 ml water, 200 gel * IPTG under sterile conditions. Poured in petridishes. The procedures followed were after Sambrook, Fritsch, Maniatis, Molecular Cloning a laboratory manual, second edition, Vol. 1.
Example 19.
Electro-transformation of E. coli Apparatus used was: E. coli Pulser Transformation Apparatus
Bio Rad Took E. coli and DNA ligase in 0.2 cm cuvettes. Set the E. Coli Pulser apparatus to 2.50 kV and followed the protocols given in Bio Rad catalogue. The white colonies were plated and replated for 3 consective times.
Example 20: PCR for confirmation that transformed bacteria has the plasmids with the D-Loop gene inserts.: PCR amplification using forward and backward D-Loop primers of Stenobrachius leucopsarus.
The PCR master mix (100 ul) comprised of Taq Buffer MgClz free (10. 0/-11), dNTP all the four nucleotides in the ratio of 1 : 1 : 1 : 1 (08. 0 p, I) ; D-Loop forward primer 01. zu with sequences (PRO-L : 5'CTA CC 3'), D-Loop backward 01. 0 pl, with sequences (D-Loop H: 5'CCT GAA GTA GGA ACC AGA TG 3'); MgCl2 (01. 0 l) ; Taq Polymerase (0. 5 l) ; and ultrapure water (78. 2 l).
This master mix was divided into 4 equal parts and put in separate eppendorf tubes. To each tube DNA was added by getting a pick from the replated last set of white colonies and run for 35 cycles in DNA thermo cycler. (Each cycle consisted of 940C for 45
<Desc/Clms Page number 29>
Seconds, 48 degree for 45 seconds, and 72 C for 1 minute) and hold at 4 degree
Centigrade.
Thermal Cycler used was: DNA Thermal Cycler, Perkin Elmer 480.
Example 21:
Similarly using DNA from the colonies did PCR for gene Cytb, ITS2,12 S RNA and 16
S RNA by using the respective primers as mentioned above in example 6-9. The amplified DNA was checked on the gel with the 1 Kb DNA marker and checked for the size of the insert.
Example 22: The colonies showing the brightest band for the particular gene insert were inoculated in LB broth under sterile conditions with flame, added dz of Ampicillin and grown at 37 degree Centigrade.
Example 23: Plasmid DNA purification was followed from Wizard minipreps DNA Purification system Technical bulletin, revised 1/94. part #TB 117 and cloned gene probes were thus developed for D-Loop, ITS2, Cyt b, 12 S and 16 s of Stenobrachius leucosparus myctophid fish.
Example 24: Checking purity and specificity of the probe: The plasmid with insert was first cut with ECOR I restriction enzyme and following were
added in a PCR tube (lul DNA (plasmid), 21 ECOR Bufier, 11 ECOR Enzyme, 16ul MQ water to make the volume 20 pu1).
Run at 0.7% agarose gel on 72 volts with 1 kb DNA ladder. And keeping negative control of plasmids from the blue colonies.
The band shown will be of the size ofplasmid+gene. In this case the 12 S gene is 41 lbp and plasmid is 3000 bp. So the position of the band was between the 3054 and 4072 bp bands. The DNA probe of 12 S with us is the pure cloned gene from myctophid Stenobrachius leucopsarus.
Example 25: Similarly we have developed pure DNA probes of the gene segment from 16 S RNA, DLoop, Cytb, and ITS2 genes.
<Desc/Clms Page number 30>
Example 26: Sequencing of probe: Once the Species specific probe was ready it was sequenced to see the sequences to ascertain that these were the same sequences that we started with. The steps of example 6 - 14 were followed in the same manner. Only the DNA template is of the probes from example 23.
Example 27: The blast operation was performed by sending pasta format of all the gene sequences to the Blast @ NCBI and asking for related sequences. The results confirmed that the genes probed belonged to the Cytb, D-Loop, Rod and ITS2,12 S rRNA and 16 S rRNA genes.
Example 28: The species specific primers of cyt b, D-Loop, ROD, ITS2,12S rRNA and 16S rRNA gene regions of the myctophid Stenobrachius leucopsarus (SLMB) and 12S rRNA and 16S rRNA gene regions of four more myctophids like Lampanyctus regals, Diaphus theta ; Tarletonbeania crenularis & Protomyetophum crockeri are designed using the "Generunner".
Example 29: The sequences of the species specific primers of cyt b, D-Loop, ROD, ITS2,12S rRNA and 16S rRNA gene regions of the myctophid Stenobrachius leucopsarus (SLMB) and 12S rRNA and 16S rRNA gene regions of four more myctophids like Lampanyctus
regals, Diaphus theta ; Tarletonbeania crenularis & Protomyctophum crockeri are designed using the"Generunner"program for the first time.
Example 30: Both the Forward (also written as"L"and"Sense") and Backward primers (also written as"H"and"Antisense") sequences for all the above said gene regions for all the species are designed.
Example 31: All the primers designed had no Hairpin Loops, Dimers, Bulge Loops and Internal Loops.
There are no palindromes.
<Desc/Clms Page number 31>
SEQUENCE LISTING
APPLICANTS: Goswami. Usha (NfO, Goa. India) ;
Bernardi ;
Giacomo (UCSC. CAUSA) : Goswami,
Subhash Chander (NIO, Goa, India):
Johnson. Robert K (Charleston, SC. USA)
TITLE : Gene probes and sequences useful for genetic marking of midwater oceanic fish.
NO. OF SEQUENCES : FOUR
CONTACT DETAILS: National Institute of Oceanography, Dona-Paula, Goa. 403004. India.
INFORMATION FOR SEQUENCE ID NO. 1 Location qualifier Source : Lantern fish Stenobrachius leucopsarus Organism: Stenobrachius Jeucopsarus Eukaryota ; Metazoa; Chordata : craniata: vertebrata; Euteleostomi : Actinopterygii; Neopterygii ; Teleostei ; Euteleostei ; Neoteleostei ; Scopelomorpha ;; Myctophiformes ; Myctophidae : Stenobrachius.
Gene : Mitochondrial gene IDS : PSL CYTL Gene name : Cyt b Name/key : Cytochrome b Length: 747 bp Type: Mitochondrial DNA Start codon 1 : Not applicable Protein id: Cytochrome B Translation : Not applicable Product: Cyt L DNA < l.. > 747
Base sequences : 5' 1. CTTNCCCATT TTGGGCGCTT NGGCNCGCTN CTCCNCGAGA 41. CTCTGCGTAN TAATCCAANT CNCTNCGGGC CNCTCCCTAC 81. CANTNCNCTA CACCNCAAAT TNCAACCCNG TTTCCTCATC
<Desc/Clms Page number 32>
121. ANTCAACCAC ATCTGTCGAAAACNTCAACT ACGGCTGACT
161. AATCCGAAAA CATGCACGCT AACGGTGCCT
CTTTCTTCTT
201. CATCTGTATT TATCTNCNCN TTGGANGAGG
ACTATNCTAC
24]. GGATCCTACC TCTACGAAGA GACGTGAGGT GTTGGTGTTA 281. TTCTTCTCCT TCTAATAATG ATGACTGCNT TTGTTGGCTA 321. TGTGCTNCCC NGAGGACAAATGTCCTTTTG AGGTGCTACT 36L GTCATTACAA NCCTACTCTC TGCTGTNCCG TNTGTINGCG 401. GCNCTCTANT TCAATGAATT TGAGGTGGCT TCTCCGTAAA 441. CACGCAACGC TCACTCGTTT CTTCGCNTTC CACTTCTTGT 481. TCCCA TITGT TGTCGCNGCT ATAACCNNGG TTCACCNGAT
521. TTNCCGACAT CAAACAGGCT CTAAANCCCC CCCGGNTTGA 361. CTCCATACAA CAAAACCCTC CACCCTATTC NCTATAAAAC 601. TCTAGGTTCG TGCCCGTATT GGCTTACTTC ATGNCTATTT 641. CCCNGNCGGA GGGACNAAAA TTCCTGCACC CCCTCCCCNC 681. AAAATAAANA ATGTGTCTNT CCTACCANAA AACAACNNAN 721. ACGGGGTNTG CNCTTCCATCATCCACN 3' SEQUENCE LISTING APPLICANTS: Goswami, Usha (NIO, Goa. India) ; Bemardi ; Giacomo (UCSC, CA, USA) ; Goswami, Subhash Chander (NIO, Goa, India) : Jolmson, Robert K (Charleston, SC. USA) TITLE: Gene probes and sequences useful for genetic marking of midwater oceanic fish.
<Desc/Clms Page number 33>
NO. OF SEQUENCES : FOUR
CONTACT DETAILS : National Institute of Oceanography,
Dona-Paula. Goa. 403004. India.
INFORMATION FOR SEQUENCE ID NO. 2
Location qualifier
Source: Lantern fish Stenobrachius leucopsarus Organism : Stenobrachius leucopsarus Eukaryota ; Metazoa; Chordata; craniata; vertebrata : Euteleostorni ; Actinopterygii : Neopterygii ; Teleostei : Euteleostei ; Neoteleostei ; Seopeiomorpha ; ; Myctophiformes, Myctophidae; Stenobrachius.
Gene: Nuclear gene IDS : PSL ITS2F Gene name : ITS2 Name/key : Internal transcribed spacer 2, Length: 225 bp Type: Nuclear DNA Start codon I : Not applicable Protein id: Not applicable Translation: Not applicable Product: ITS2 < 1.. > 225
Base sequences : 5' 1. TCTACGATCT ACCGGCNTTTNNTGTGGAAA GACGATCATG 41. CATTTATGTG TGTCTTTCTA TGGATTTGAA CCGTGTGGTA 81. CGTCTTTGCG TACTGCTTGG AAGGCTCAAC TTGCTTCTGT 121. CCTTCTCTTG CAGTCTCGCA CTGTCTATGC AACGTGTTCT 161. ACTTCGACTT CTGTCGAAAA ATQTACTTT TGACCTCAGA 201. TCAGACAAGA CTACCCGCTG AATTT 3'
SJbUbfUbU & nU APPLICANTS : Goswami, Usha (NIO, Goa. India) ; Bernard ; Giacomo (UCSC, CA, USA) ; Goswami, Subhash Chander (nit, Goa, India) : Johnson, Robert K (Charleston, SC. USA) TITLE : Gene probes and sequences useful for genetic marking of midwater oceanic fish.
<Desc/Clms Page number 34>
NO. OF SEQUENCES : FOUR
CONTACT DETAILS: National Institute of Oceanography, Dona-Paula. Goa. 403004. India.
INFORMATION FOR SEQUENCE ID NO. 3
Location qualifier
Source: Lantern fish Stenobrachius leucopsarus
Organism : Stenobrachius leucopsarus
Eukaryota : Metazoa;
Chordata ; craniata; vertebrata ; Euteleostomi : Actinopterygii ; Neopterygii, Teleostei ; Euteleostei ; Neoteleostei ; Scopelomorpha : ; Myctophiformes ; Myctophidae; Stenobrachius.
Gene: Mitochondrial gene IDS: PSL PROL Gene name: D-Loop Name/key : Mitochondrial D-Loop Length: 749 bp Type : Mitochondrial DNA Start codon 1 : Not applicable Protein id: Not applicable Translation: Not applicable Product: D-Loop < t.. > 750
5' ]. CCTTTTCGGN ATAGGCCCAN CTCAAATGAA TTCCTTCTCT
41. CCTGGTCCAA GCCCAAACTG TGGACGGCAG GTTGACAATG
81. GTTACAAATC GTGACAAATC GGCTACATAA TTGCCGATAG 121. CGATGTCGTC AAACCAAGTC AAACAATGGC CGATGTATAT
161. CGGCCAAACC CATATATGGG TCTGGCTGTA GTTTGTGTTG 201. AGCAACGTCA CACCAGTGTC TGGTCAGCAT ATAAGATGTT 241. GACATCTTGC AACATCTTAC CCACAGACAG ACAGTTACGG 281. CTGCTTACGA ANGGCGCTAG TGTTGTGGTG AGAAACGA. AG 321. ATACATACGT CAAACAGACG CCGGTGCACT TGAAGACACT 361. GTTTGAAGGT GCCGCACTAC TTGACAGACA GCCCATGATG 401. CGCTGGACAG TGACCAAAGC TACNGGAGGA CCANATGGAA 441. ATCCTGTTGG CGTTGCCGTG GGACTCAAGT TGTACACTTT 481. TGGATGGTTG ATCACTANAN CCGCTGCCGG GAGAAGCACT 52 L CGCTCCTGGTTCACTAATCA GATTGAGGTTAACCANATTG 56L ANGTAAACAT CTTCAACACA GTGTCTTTAT GCTGGATGAA 601. ATTNAGCCCA CNGGACACCA NAAAAGAATT NCCNCTGGTT 64 I. CTNNCGGGGG NCCCCNNNAA CGNNTNTTCC CCTTNTCTCN 681. NNNGCGGNGA AGTTNCCCCC CCCCACTNAN NTCTTCCTTC 721. AANANNTTTC CNCCNNNAGA GGTTTTCCCN 3'
<Desc/Clms Page number 35>
APPLICANTS: Goswami, Usha (NIO. Goa. Itidia) :
Bernardi :
Giacomo (UCSC, CA, USA) ; Goswami,
Subhash Chander (NIO, Goa. India);
Johnson, Robert K (Charleston, SC, USA)
TITLE: Gene probes and sequences useful for genetic marking of midwater oceanic fish.
NO. OF SEQUENCES: FOUR
CONTACT DETAILS: National Institute of Oceanography, Dona-Paula, Goa. 403004. India.
INFORMATION FOR SEQUENCE ID NO. 4
Location qualifier
Source: Lantern fish Stenobrachius leucopsarus
Organism: Stenobrachius leucopsarus
Eukaryota : Metazoa ;
Chordata ; craniata ; vertebrata ; Euteleostomi ;
Actinopterygii : Neopterygii; Teleostei : Euteleostei ; Neoteleostei; Scopelomorpha ; ; Myctophiforrnes ; Myctophidae; Stenobrachius.
Gene: Nuclear gene IDS: ROD PSL SLMB Gene name: ROD Name/key : Nuclear gene Length: 748 bp Type : Nuclear DNA Start codon 1 : Not applicable Protein id: Rhodopsin Translation ; Not applicable Product: ROD DNA < 1. > 748 Base sequences:
5' 1. CCTGGTAGGG TTCCCCGTCA ACTTCCTCACACTGTACCTC 41. ACNTTCGAGC ACAAGAAGCT ACTAACCCCC TTAAACTACA 81. TCCTGCTCAA CCTGGCGGTC GGAGACCTCC TGATGGTGTA 121. AGGAGGGTTC ACCACCACCA TCTACACCTC CATGCACGGC 161. TACTTCGTCC TAGGGAAACT GGGCTGCGCC ATCGAAGGTT 20 I. TCATGGCCAC CCA TGGTGGT CAGGTCGCCC TTTGGTCCCT 241. GGTGGTTTTG GCCGTGGAAA GGTGGCTGGT CGTCTGCAAN
28). CCCATCTCCA GCTTCCGCTT CCAGGAGTCC CACTCCCTCA 321. TGGGCC'TGGC CGTGACCTGG CTTGATGGCGA CGGCTTGTTC
<Desc/Clms Page number 36>
361. TGTGCCCCCC CTGGGTCGGC TGGTCTCGCT ACATCCCAGA
401. AGGCATGCAGTGCTCATGCGGAATGGACTA CTACACTCCC 44 1. GCGCCGGGCG TCAACAATGA AT (CTACGTN GTGTACATGT 481. TCNTCANAAA AANAA TNGGA CCNCNGGGCG A TCA 1NITGN 521. TANGNNAAGG CCAGNTGNTG NGAGCAGTCA AGGCGGCCGC 561.
CGCCGCCCAG CAAGAGTCCG AGACCACCCA GAGGGCCGAG 601.
AGGGAAGTCA CCCGNA TGGT NA TNANGA TG GTNA TNTCNT 641. TCNTGGT AAG NAGGGNGCCA NACGCCAGCG TGGCCTGGTG 681. GATCTTNNGN AACCAGGGNG CAGAATTAGG CCCNGTNTTC 721. ATGACCCTGCCGGCNTTCTTTGCCAAGA 3'
Claims (1)
- Claims: 1. A method for development of nucleotide probes for myctophid fishes, said method comprising the steps of: (i) extracting the DNA from the muscle tissue of a myctophid fish, (ii) selecting gene regions in the extracted DNA with the selected primers and the amplifying the same using polymerase chain reaction (PCR), (iii) eluting the PCR amplified DNA, (iv) reamplifying the gene regions from PCR amplified DNA and eluting the same, (v) cycle sequencing of eluted DNA using a single primer, (vi) purifying extension products, (vii) sequencing the extension product on acrylamide gel, (viii) confirming the sequences for the target gene by Blast-Email, (ix) ligating the eluted PCR products in a vector, (x) preparing the electro-competent cells for electro transformation, (xi) electro transforming the host cells, (xii) growing and harvesting of transformed host cells, (xiv) confirming that the transformed bacteria has the plasmids with the gene inserts by PCR.(xv) purifying recombinant plasmid DNA having the cloned gene probes from the transformed host cells, (xvi) checking purity and specificity of the cloned DNA probe insert by cutting with restriction enzyme, (xvii) confirming the molecular size of the DNA probe insert, (xviii) PCR amplification of the gene insert from the probe using both primers, (xix) eluting of the amplified gene region, (xx) cycle sequencing of the gene region of the probe, (xxi) sequencing of the cloned DNA insert on acrylamide gel, (xxii) comparing the DNA sequence of the prepared DNA probes using"BLAST program"against the known sequences of similar genes in the genome data bases,<Desc/Clms Page number 38>(xxiii) confirming the sequences of the cloned probe by aligning with sequences of the claim l (vii), and (xxiv) designing species specific primers from the sequences.2. A method as claimed in claim 1 wherein the myctophid fishes are selected fromthe group comprising Stenobrachis leucopsarus, Diaphus theta, Protomyctophum crockeri, Tarletonbeania crenularis and Lampanyctus regalis.3. A method as claimed in claim 1 wherein the gene regions are selected from mitochondrial and nuclear genes.4. A method claimed in claim 1 wherein the mitochondrial genes taken for probe preparation are selected from the group comprising: Cyt b and D-loop genes, 12 S RNA and 16 S RNA genes.5. A method claimed in claim 1 wherein the nuclear genes taken for probe preparation are selected from Rod and ITS-2 genes.6. A method of claim 1 wherein the PCR amplified cleaned nuclear gene probe is Rod gene.7. A method claimed in claim I wherein the nuclear gene taken for the cloned probe preparation is ITS-2 gene.8. A method as claimed in claim I wherein the concentration of primers used for PCR amplification is 20 meu. L.9. A method as claimed in claim 1 wherein the primer set (forward and backward primers) used for amplification and detection of Cyt b gene contains oligonucleotides with the sequences: CYT1 : 5'TGAYTTGAARAACCAYCGTTG 3'CYT 2 : 5'CTCCARTCTTCGRYTTACAAG 3' 10. A method as claimed in claim I wherein the primer set (forward and backward primers) used for reamplification and detection of Cyt b gene contains oligonucleotides with the sequences:CBI-L : 5'CCA TCC AAC ATC TCA GCA TGA TGA AA 3' CYT 2 : 5'CTCCARTCTTCGRYTTACAAG 3'<Desc/Clms Page number 39>11. A method as claimed in claim 1 wherein the primer set (forward and backward primers) used for PCR amplification and detection of D-Loop gene contains oligonucleotides with the sequences : PRO-L: 5'CTA CC 3' D-LOOP H : 5'CCT GAA GTA GGA ACC AGA TG 3' 12. A method as claimed in claim 1 wherein the forward and backward primers used for PCR amplification of ITS2 gene were ITS 1 F: 5'TTG TAC ACA CCGCCCGTC GC 3' ITS2 R: 5'ATA TGC TTA AAT TCA GCG GG 3' 13. A method as claimed in claim 1 wherein the forward and backward primers used for PCR reamplification of ITS2 gene from ITS 1 F and ITS2 R PCR amplification were ITS2 F: 5'CTA CGC CTG TCT GAG TGT C 3' ITS2 R: 5'ATA TGC TTA AAT TCA GCG GG 3' 14. A method as claimed in claim 1 wherein the primer set (forward and backward primers) used for PCR amplification of Rhodopsin gene Rod contains oligonucleotides with the sequences: ROD-F: 5'CATATGAATACCCTCAGTACTACC 3' ROD-R: 5'TCT TTC CGC AGC ACA ACG TGG 3' 15. A method as claimed in claim 1 wherein the primer set (forward and backward primers) used for PCR amplification of 12S RNA gene contains oligonucleotides with the sequences: 12 SA-L : 5'AAA CTG GGA TTA GAT ACC CCA CTA T 3' 12 SB-H : 5'AGA GTG ACG GGC GGT GTG T 3' 16. A method as claimed in claim 1 wherein the primer set (forward and backward primers) used for PCR amplification of 16S RNA gene contains oligonucleotides with the sequences: 16 SAR-L : 5'CGC CTG TTT ATC AAA AAC AT 3' 16 SBR-H : 5'CCG GTC TGA ACT CAG ATC ACG T 3' 17. A method as claimed in claim 1 wherein the forward and backward primers used for PCR amplification of Rhodopsin gene Rod were:<Desc/Clms Page number 40>ROD-F : 5'CAT ATG AAT ACC CTC AGT ACT ACC 3' ROD-R : 5'TCT TTC CGC AGC ACA ACG TGG 3' 18. A method as claimed in claim 1 wherein the primer set (forward and backward primers) used for PCR amplification of 12S RNA gene were: 12 SA-L : 5'AAA CTG GGA TTA GAT ACC CCA CTA T 3' 12 SB-H : 5'AGA GTG ACG GGC GGT GTG T 3' 19. A method as claimed in claim 1 wherein the primer set (forward and backward primers) used for PCR amplification of 16S RNA gene were:16 SAP-L : 5'CGC CTG TTT ATC AAA AAC AT 3' SBR-H : 5'CCG GTC TGA ACT CAG ATC ACG T 3' 20. A method claimed in claim 1 wherein the 12S RNA gene and 16S RNA gene in the myctophid fish Stenobrachius leucopsarus were amplified by PCR.21. A method claimed in claim 1 wherein the 12S RNA and 16S RNA gene in myctophid fish Diaphus theta were eluted by PCR amplification.22. A method claimed in claim 1 wherein the elution of PCR amplification products of myctophid fishProtomyctophum crockeri, resulted in 12 S RNA.23. A method claimed in claim 1 wherein the elution of PCR amplification products of myctophid fish Protomyctophum crockeri, resulted in 16 S RNA.24. A method claimed in claim 1 wherein the elution of PCR amplification ofmyctophid fish Tarletonbeania crenularis, resulted in 12 S RNA.25. A method claimed in claim 1 wherein the elution of PCR amplification of myctophid fish Tarletonbeania crenularis, resulted in 16 S RNA.26. A method claimed in claim 1 wherein the elution of PCR amplification of myctophid fish Lampanyctus regals, resulted in 12 S RNA.27. A method claimed in claim 1 wherein the elution of PCR amplification of myctophid fish Lampanyctus regalis, resulted in 16 S RNA.28. A method claimed in claim 1 wherein the cycle sequencing primer concentration used was 2piu, 29. A method claimed in claim 1 wherein the cycle sequencing primer for CYT b gene consisted of oligonucleotides with the sequence: CYT1 : 5'TGAYTTGAARAACCAYCGTTG 3'<Desc/Clms Page number 41>30. A method claimed in claim 1 wherein the cycle sequencing primer for CYT bgene consisted of oligonucleotides with the sequence : CYT 2 : 5'CTCCAR TCTTCGRYTTACAAG 3' 31. A method claimed in claim 1 wherein the cycle sequencing primer for CYT b gene consisted of oligonucleotides with the sequence : CBI-L : 5'CCA TCC AAC ATC TCA GCA TGA TGA AA 3' 32. A method claimed in claim 1 wherein the cycle sequencing forward primer for D- Loop region consisted of oligonucleotides with the sequence: PRO-L: 5'CTA CC 3' 33. A method claimed in claim 1 wherein the backward cycle sequencing primer for D-Loop region consisted of oligonucleotides with the sequence: D-LOOP H : 5'CCT GAA GTA GGA ACC AGA TG 3' 34. A method as claimed in claim 1 wherein the forward primer used for cycle sequencing of ITS2 gene consisted of oligonucleotides with the sequence: ITS 1-F : 5'TTG TAC ACA CCG CCC GTC GC 3' 35. A method as claimed in claim 1 wherein the backward primer used for cycle sequencing of ITS2 gene consisted of oligonucleotides with the sequence: ITS2-R : 5'ATA TGC TTA AAT TCA GCG GG 3' 36. A method as claimed in claim 1 wherein the forward primer used for cycle sequencing of Rhodopsin gene Rod consisted of oligonucleotides with the sequence: ROD-F: 5'CAT ATG AAT ACC CTC AGT ACT ACC 3' 37. A method as claimed in claim 1 wherein the backward primer used for cyclesequencing consisted of oligonucleotides with the sequence : ROD-R : 5'TCTTTCCGCAGCACAACGTGG 3' 38. A method as claimed in claim 1 wherein the forward primer used for cycle sequencing of 12S RNA gene consisted of oligonucleotides with the sequence: 12 SA-L : 5'AAA CTG GGA TTA GAT ACC CCA CTA T 3' 39. A method as claimed in claim 1 wherein the backward primer used for cycle sequencing of 12S RNA gene consisted of oligonucleotides with the sequence: 12 SB-H: 5'AGA GTG ACG GGC GGT GTG T 3'<Desc/Clms Page number 42>40. A method as claimed in claim 1 wherein the forward primer used for cyclesequencing of 16S RNA gene consisted of oligonucleotides with the sequence : 16SAR-L : 5'CGC CTG TTT ATC AAA AAC AT 3' 41. A method as claimed in claim 1 wherein the backward primer used for cycle sequencing of 16S RNA gene consisted of oligonucleotides with the sequence : 16 SBR-H : 5'CCG GTC TGA ACT CAG ATC ACG T 3' 42. A method as claimed in claim 1 wherein the extension products of 12 S RNA gene region are purified by conventional methods.43. A method as claimed in claim 1 wherein the extension products of 16 S gene region are purified by conventional method.44. A method as claimed in claim 1 wherein the extension products of CYT b gene are purified by conventional method.45. A method as claimed in claim 1 wherein the extension products of ROD gene are purified by conventional method.46. A method as claimed in claim 1 wherein the extension products of D-Loop control region are purified by conventional method.47. A method as claimed in claim 1 wherein the extension products of ITS2 region are purified by conventional method.48. A method as claimed in claim 1 wherein the extension products of 12 S RNA gene region was sequenced in an automated sequencer.49. A method as claimed in claim 1 wherein the extension products of 16 S gene region was sequenced in an automated sequencer.50. A method as claimed in claim 1 wherein the extension products of CYT b gene was sequenced in an automated sequencer.51. A method as claimed in claim 1 wherein the extension products of ROD gene was sequenced in an automated sequencer.52. A method as claimed in claim 1 wherein the extension products of D-Loop control region was sequenced in an automated sequencer.53. A method as claimed in claim 1 wherein the extension products of ITS2 region was sequenced in an automated sequencer.<Desc/Clms Page number 43>54. A method as claimed in claim 1 wherein the identity of the gene 12S RNA is confirmed by Blast Email.55. A method as claimed in claim 1 wherein the identity of the gene 16S RNA is confirmed by Blast Email.56. A method as claimed in claim 1 wherein the identity of the gene CYT b is confirmed by Blast Email.57. A method as claimed in claim 1 wherein the identity of the gene ROD is confirmed by Blast Email.58. A method as claimed in claim I wherein the identity of the D-Loop is confirmed by Blast Email.59. A method as claimed in claim 1 wherein the identity of the gene ITS2 is confirmed by Blast Email.60. A method as claimed in claim 1 wherein the vector used for cloning was Bluescript KS-phagemid.61. A method as claimed in claim I wherein the vector used for cloning had ampicillin resistance gene for selection.62. A method as claimed in claim 1 wherein the vector used for cloning had Lac Z gene for blue white colony selection.63. A method as claimed in claim 1 wherein the Col E I was the origin for replication of phagemid in the absence of helper phage.64. A method as claimed in claim I wherein F I (-) origin for recovery of antisense strand of lac Z gene when a host strain containing the bluescript II phagemid.65. A method as claimed in claim I wherein the host cells used for transformation were E. coli blue bacteria (Bacteria Strain XL 1 blue) XLl-Blue :-F' :: TnlO, pro A'13+1aclQ (IacZ) M15/recAlendAlgyrA96 (Naf) thi hsdR17 (rk' msupE44relAl lac.66. A method as claimed in claim I wherein probes are containing oligonucleotide sequences are cloned Cyt b, D-Loop, ITS2 and Rod genes.67. A method as claimed in claim 1 wherein the probes of CYT b gene is an oligonucleotide sequence named as PSL CYTL.<Desc/Clms Page number 44>68. A method as claimed in claim 1 wherein the probes of ITS 2 gene is an oligonucleotide sequence named as PSL ITS 2F.69. A method as claimed in claim I wherein the probes of D-Loop control region gene is an oligonucleotide sequence named as PSL PROL.70. A method as claimed in claim I wherein the PCR amplified sequence of ROD gene probe is named as ROD SLMB.71. A method as claimed in claim 1 wherein the PCR amplified sequence of D-Loop gene probe is named as D-Loop SLMB.72. A method as claimed in claim I wherein the PCR amplified sequence of ITS 2 gene probe is named as ITS 2 SLMB.73. A method as claimed in claim I wherein the PCR amplified sequence of Cyt b gene probe is named as Cyt L SLMB.74. The nucleotide base sequences of PSL CYTL (748 bp) comprising : 5' CTTNCCCATT TTGGGCGCTT NGGCNCGCTN CTCCNCGAGA CTCTGCGTAN TAATCCAANT CNCTNCGGGC CNCTCCCTAC CANTNCNCTA CACCNCAAAT TNCAACCCNG TTTCCTCATC ANTCAACCAC ATCTGTCGAA AACNTCAACT ACGGCTGACT AATCCGAAAA CATGCACGCT AACGGTGCCT CTTTCTTCTT CATCTGTATT TATCTNCNCN TTGGANGAGG ACTATNCTAC GGATCCTACC TCTACGAAGA GACGTGAGGT GTTGGTGTTA TTCTTCTCCT TCTAATAATG ATGACTGCNT TTGTTGGCTA TGTGCTNCCC NGAGGACAAA TOTCCTTTTG AGGTGCTACT GTCATTACAA NCCTACTCTC TGCTGTNCCG TNTGTTNGCG GCNCTCTANT TCAATGAATT TGAGGTGGCT TCTCCGTAAA CACGCAACGC TCACTCGTTT CTTCGCNTTC CACTTCTTGT TCCCATTTGT TGTCGCNGCT ATAACCNNGG TTCACCNGAT TTNCCGACAT CAAACAGGCT CTAAANCCCC CCCGGNTTGA CTCCATACAA CAAAACCCTC CACCCTATTC NCTATAAAAC TCTAGGTTCG TGCCCGTATT GGCTTACTTC ATGNCTATTT CCCNGNCGGA GGGACNAAAA TTCCTGCACC CCCTCCCCNC AAAATAAANA ATGTGTCTNT CCTACCANAA AACAACNNAN ACGGGGTNTG CNCTTCCATC ATCCACN 3'<Desc/Clms Page number 45>75. The nucleotide base sequences ofPSLITS2F comprises : (225BP) 5' TCTACGATCT ACCGGCNTTT NNTGTGGAAA GACGATCATG CATTTATGTG TGTCTTTCTA TGGATTTGAA CCGTGTGGTA CGTCTTTGCG TACTGCTTGG AAGGCTCAAC TTGCTTCTGT CCTTCTCTTG CAGTCTCGCA CTGTCTATGC AACGTGTTCT ACTTCGACTT CTGTCGAAAA ATCTTACTTT TGACCTCAGATCAGACAAGA CTACCCGCTG AATTT 3' 76. The nucleotide base sequences of PSL PROL comprises : (749 BP) 5' CCTTTTCGGN ATAGGCCCAN CTCAAATGAA TTCCTTCTCT CCTGGTCCAA GCCCAAACTG TGGACGGCAG GTTGACAATG GTTACAAATC GTGACAAATC GGCTACATAA TTGCCGATAG CGATGTCGTC AAACCAAGTC AAACAATGGC CGATGTATAT CGGCCAAACC CATATATGGG TCTGGCTGTA GTTTGTGTTG AGCAACGTCA CACCAGTGTC TGGTCAGCAT ATAAGATGTT GACATCTTGC AACATCTTAC CCACAGACAG ACAGTTACGG CTGCTTACGA ANGGCGCTAG TGTTGTGGTG AGAAACGAAG ATACATACGT CAAACAGACG CCGGTGCACT TGAAGACACT GTTTGAAGGT GCCGCACTAC TTGACAGACA GCCCATGATG CGCTGGACAG TGACCAAAGC TACNGGAGGA CCANATGGAA ATCCTGTTGG CGTTGCCGTG GGACTCAAGT TGTACACTTT TGGATGGTTG ATCACTANAN CCGCTGCCGG GAGAAGCACT CGCTCCTGGT TCACTAATCA GATTGAGGTT AACCANATTG ANGTAAACAT CTTCAACACA GTGTCTTTAT GCTGGATGAA ATTNAGCCCA CNGGACACCA NAAAAGAATT NCCNCTGGTT CTNNCGGGGG NCCCCNNNAA CGNNTNTTCC CCTTNTCTCN NNNGCGGNGA AGTTNCCCCC CCCCACTNAN NTCTTCCTTC AANANNTTTC CNCCNNNAGA GGTTTTCCCN 3'77. The nucleotide base sequences of ROD PSL SLMB comprises : (748 BP) 5' CCTGGTAGGG TTCCCCGTCA ACTTCCTCAC ACTGTACCTC ACNTTCGAGC ACAAGAAGCT ACTAACCCCC TTAAACTACA TCCTGCTCAA CCTGGCGGTC GGAGACCTCC TGATGGTGTA AGGAGGGTTC ACCACCACCA TCTACACCTC CATGCACGGC TACTTCGTCC TAGGGAAACT GGGCTGCGCC ATCGAAGGTT<Desc/Clms Page number 46>TCATGGCCAC CCATGGTGGT CAGGTCGCCC TTTGGTCCCT GGTGGTTTTG GCCGTGGAAA GGTGGCTGGT CGTCTGCAAN CCCATCTCCA GCTTCCGCTT CCAGGAGTCC CACTCCCTCA TGGGCCTGGC CGTGACCTGG GTGATGGCGA CGGCTTGTTC TGTGCCCCCC CTGGGTCGGC TGGTCTCGCT ACATCCCAGA AGGCATGCAG TGCTCATGCG GAATGGACTA CTACACTCCC GCGCCGGGCG TCAACAATGA ATCCTACGTN GTGTACATGT TCNTCANAAA AANAATNGGA CCNCNGGGCG ATCATNTTGN TANGNNAAGG CCAGNTGNTG NGAGCAGTCA AGGCGGCCGC CGCCGCCCAG CAAGAGTCCG AGACCACCCA GAGGGCCGAG AGGGAAGTCA CCCGNATGGT NATNANGATG GTNATNTCNT TCNTGGTAAG NAGGGNGCCA NACGCCAGCG TGGCCTGGTG GATCTTNNGN AACCAGGGNG CAGAATTAGG CCCNGTNTTC ATGACCCTGC CGGCNTTCTT TGCCAAGA 3' 78. A method as claimed in claim 1 wherein FORWARD (L) primers of CYT b gene region for myctophid fish Stenobrachius leucopsarus is an oligonucleotide comprising : 5'CAACCTCATCTGTCGTAAAC 3' and having the following characteristics: i. is a 20-mer DNA oligonucleotide (sense), ii. has melting temperature of 56.4 degree celius, iii. has a molecular weight of 6101. 0, iv. has no hairpin loops, v. has no single dimers, vi. has no other dimers, vii. has no single bulge loops or internal loops, and viii. has no palindromes.79. A method as claimed in claim I wherein BACKWARD (H) primer of CYT b generegion for myctophid fish Stenobrachius leucopsarus (SLMB) is an oligonuleotide comprising: 5'GCT CGG GCT GCT GGA ATC TT 3' and having the following characteristics: i. is a 20-mer DNA<Desc/Clms Page number 47>ii. is an antisense oligonuleotide iii. has a melting point of 70.8 degree celcius. iv. has a molecular weight of 6220.1. v. has no hairpin loops, no single bulge loops, no other internal loops, no single internal loops, no other bulge loops or palindromes. vi. no single dimers or other dimers.80. A method as claimed in claim 1 wherein forward primer of ITS2 F gene region for myctophid fish Stenobrachius leucopsarus (SLMB) is an oligonuleotide comprising: 5'ACTTGACTGACCTTCTTACT3' and having the following characteristics: i. is a 20-mer sense oligonucleotide, ii. has a melting point of 51.3 degree celcius, iii. has a molecular weight of 6098.0, iv. has no palindromes, loops and dimers, 81. A method as claimed in claim 1 wherein forward primer of ITS2 H gene region for myctophid fish Stenobrachius leucopsarus (SLMB) is an oligonuleotide comprising : 5'ATA CTC TGC GGA CAT ACT TGA CTG 3' and having the following characteristics: i. is a 24-mer antisense oligonucleotide,ii. has a melting point of 65. 4 degree celcius. iii. has a molecular weight of 7407. 9. iv. has no palindromes, loops and dimers.82. A method as claimed in claim 1 wherein forward primer of pro-L for myctophid fish Stenobrachius leucopsarus (SLMB) is an oligonuleotide comprising: 5'CAGTCTCGTCAAACCAAGTCAAAC 3' and having the following characteristics:<Desc/Clms Page number 48>i. is a 24-mer sense oligonucleotide ii. has a melting point of 67.8 degree celcius. iii. has a molecular weight of 7354.9. iv. has no palindromes, loops and dimers.83. A method as claimed in claim 1 wherein backward primer for Dloop for mitochondrial control region (dloop H) gene region for myctophid fish Stenobrachius leucopsarus is an oligonuleotide comprising : 5'ATA ATC ATC CAG CAT AAA CAC AC 3' and having the following characteristics : i. is a 23-mer antisense oligonucleotide, ii. has a melting point of 61.2 degree celcius. iii. has a molecular weight of 7033. 7. iv. has no palindromes, loops and dimers.84. A method as claimed in claim 1 wherein the FORWARD primer (ROD-L) for Rhodopsin gene region of myctophid fish Stenobrachius leucopsarus is an oligonucleotide comprising: 5'CCT GGT AGA GTT CGC CGT CA 3' and having the following characteristics: i. is a 20-mer sense oligonucleotide ii. has a melting point of 67.4 degree celcius. iii. has a molecular weight of 6189. 0. iv. has no palindromes, loops and dimers.85. A method as claimed in claim 1 wherein the backward primer (ROD-H) for Rhodopsin gene region of myctophid fish Stenobrachius leucopsarus is an oligonucleotide comprising: 5'CGT GTT CCT TAT CAT TGT GCC T 3' and having the following characteristics: i. is a 22-mer antisense oligonucleotide<Desc/Clms Page number 49>ii. has a melting point of 66.4 degree celcius. iii. has a molecular weight of 6738.4. iv. has no palindromes, loops and dimers.86. A method as claimed in claim 1 wherein the forward primer of 16S-L of the myctophid fish Lampanyetus regalis is an oligonucleotide comprising: 5'CAC CAG CCA AGT ATG TTT CTC 3' and having the following characteristics: i. is a 21-mer sense oligonucleotide ii. has a melting point of 61. 5 degree celcius. iii. has a molecular weight of 6421.4. iv. has no palindromes, loops and dimers.87. A method as claimed in claim 1 wherein the backward primer of 16s rRNA of myctophid fish Lampanctus regalis is an oligonucleotide comprising: 5'TCG TAG TTC AGC AGT CAG 3' and having the following characteristics: i. is a 18-mer antisense oligonucleotide ii. has a melting point of 51.2 degree celcius. iii. has a molecular weight of 5594.7. iv. has no palindromes, hairpin loops and dimers.88. A method as claimed in claim I wherein the forward primer 16S-L of myctophid fish Lampanyctus regalis is an oligonucleotide comprising: 5'CTA TTC GCC TCG CTC AGA C 3' and having the following characteristics: i. is a 19-mer sense oligonucleotide ii. has a melting point of 62.1 degree celcius. iii. has a molecular weight of 5779.8. iv. has no palindromes, hairpin loops and dimers.<Desc/Clms Page number 50>89. A method as claimed in claim 1 wherein a primer 12S-H for Lampanyctus regalis (LRMB) is an oligonucleotide comprising: 5'GCC TCC ATC ATC CCT CAC CTT AC 3' and having the following characteristics: i. is a 23-mer antisense oligonucleotide ii. has a melting point of 70. 8 degree celcius. iii. has a molecular weight of 6895.5 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.90. A method as claimed in claim 1 wherein the primer 12S-L for Lampanyctus regalis (LRMB) is an oligonucleotide comprising: 5'CTA TTC GCC TCG CTC AGA C 3' and having the following characteristics: i. is a 19-mer sense oligonucleotide ii. has a melting point of 62.1 degree celcius. iii. has a molecular weight of 5779.8 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.91. A method as claimed in claim 1 wherein 16S-L forward primer for Diaphus theta (DTMB) is an oligonucleotide comprising: 5'AAA TCC GCC CTT ATG TGT GTT C 3' and having the following characteristics: i. is a 22-mer sense oligonucleotide ii. has a melting point of 67.9 degree celcius. iii. has a molecular weight of 6756.4 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.<Desc/Clms Page number 51>92. A method as claimed in claim 1 wherein 16S-H backward primer for Diaphus theta (DTMB) is an oligonucleotide comprising: 5'CTC CGT CCG TCT CGC CTC TG 3' and having the following characteristics: i. is a 20-mer antisense oligonucleotide ii. has a melting point of 71.7 degree celcius. iii. has a molecular weight of 6052.0 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.93. A method as claimed in claim 1 wherein 12S-H forward primer for Diaphus theta (DTMB) is an oligonucleotide comprising: 5'CAT CGG CTT GCT CTA TTC CTT G 3' and having the following characteristics: i. is a 22-mer antisense oligonucleotide ii. has a melting point of 68.8 degree celcius. iii. has a molecular weight of 6723.4 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.94. A method as claimed in claim 1 wherein 12S-L forward primer for Diaphus theta (DTMB) is an oligonucleotide comprising: 5'TCT ATC GGC GGC GTA TCA C 3' and having the following characteristics: i. is a 19-mer sense oligonucleotide ii. has a melting point of 65.8 degree celcius. iii. has a molecular weight of 5859.8 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.<Desc/Clms Page number 52>95. A method as claimed in claim 1 wherein 16S-H primer for Tarletonbeania crenularis (TCMB) is an oligonucleotide comprising: 5'GGC GAT TCT ACG GCA CGG GCG 3' and having the following characteristics: i. is a 21-mer antisense oligonucleotide ii. has a melting point of 80.4 degree celcius. iii. has a molecular weight of 6568.3 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.96. A method as claimed in claim 1 wherein 16S-L forward primer for Tarletonbeania crenularis (TCMB) is an oligonucleotide comprising: 5'AAA CTG GTC CTC AAC TAT GTC A 3' and having the following characteristics: i. is a 22-mer sense oligonucleotide ii. has a melting point of 60.7 degree celcius. iii. has a molecular weight of 6758.5 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.97. A method as claimed in claim 1 wherein 16S-H backward primer for Tarletonbeania crenularis (TCMB) is an oligonucleotide comprising: 5'GGC GAT TCT ACG GCA CGG GCG 3' and having the following characteristics: i. is a 21-mer antisense oligonucleotide ii. has a melting point of 80.4 degree celcius. iii. has a molecular weight of 6568.3 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.<Desc/Clms Page number 53>98. A method as claimed in claim 1 wherein 12S-H backward primer for Tarletonbeania crenularis (TCMB) is an oligonucleotide comprising: 5'CCG ATT CAG CCA CGA TTC CCT C 3' and having the following characteristics: i. is a 22-mer antisense oligonucleotide ii. has a melting point of 74. 6 degree celcius. iii. has a molecular weight of 6671.4 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.99. A method as claimed in claim 1 wherein 12S-L forward primer for Tarletonbeania crenularis (TCMB) is an oligonucleotide comprising: 5'CCT AAA GCC CAG ATA ACT ACA 3' i. is a 21-mer sense oligonucleotide ii. has a melting point of 59.2 degree celcius. iii. has a molecular weight of 6432.3 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.100. A method as claimed in claim 1 wherein 16S-H backward primer for Protomyetophum crockeri (PCMB) is an oligonucleotide comprising: 5'CGTGTTCTGATGATGATGTGCT 3' i. is a 22-mer antisense oligonucleotide ii. has a melting point of 64.7 degree celcius. iii. has a molecular weight of 6867.5 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.101. A method as claimed in claim 1 wherein 16S-L forward primer for Protomyctophum crockeri (PCMB) is an oligonucleotide comprising: 5'ATTCCTTCCTCTTAGTATG 3'<Desc/Clms Page number 54>i. is a 19-mer sense oligonucleotide ii. has a melting point of 49.5 degree celcius. iii. has a molecular weight of 5799.8 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.102. A method as claimed in claim I wherein 12S-H backward primer for Protomyctophum crockeri (PCMB) is an oligonucleotide comprising: 5'GCTGAACTT ACT ATG CCC TAC T 3' i. is a 22-mer antisense oligonucleotide ii. has a melting point of 60.3 degree celcius. iii. has a molecular weight of 6725.4 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.103. A method as claimed in claim 1 wherein 12S-L forward primer for Protomyctophum crockeri (PCMB) is an oligonucleotide comprising: 5'CCG ATT GAC GCC GAA CTA TG 3' i. is a 20-mer sense oligonucleotide ii. has a melting point of 68.1 degree celcius. iii. has a molecular weight of 6182.1 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.104. A method as claimed in claim 1 wherein 16S-H backward primer for Stenobrachius leucopsarus (SLMB) is an oligonucleotide comprising: 5'TACGCA TAACGGCTCTGG 3' i. is a 18-mer DNA oligonucleotide (Antisense) ii. has a melting point of 61.4 degree celcius. iii. has a molecular weight of 5579. 7<Desc/Clms Page number 55>iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.105. A method as claimed in claim 1 wherein 16S-L forward primer for Stenobrachius leucopsarus (SLMB) is an oligonucleotide comprising: 5'CTA CTA CAC CTC AAC TAC ATC T 3' i. is a 22-mer sense oligonucleotide ii. has a melting point of 52.4 degree celcius. iii. has a molecular weight of 6638.4 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.106. A method as claimed in claim 1 wherein 12S-H forward primer for Stenobrachius leucopsarus (SLMB) is an oligonucleotide comprising: 5'CCC ACT CAC TGC TAA CTC C 3' i. is a 19-mer sense oligonucleotide ii. has a melting point of 58.4 degree celcius. iii. has a molecular weight of 5708.8 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.107. A method as claimed in claim 1 wherein 12S-L forward primer for Stenobrachius leucopsarus (SLMB) is an oligonucleotide comprising: 5'GGC TAA CTA CAA TCA TCT GCT 3' i. is a 21-mer sense oligonucleotide ii. has a melting point of 58.5 degree celcius. iii. has a molecular weight of 6445.2 iv. has no hairpin loops, dimers, palindromes or bulges and internal loops of either single or other kinds.<Desc/Clms Page number 56>108. A polynucleotide consisting of any of the sequences defined herein. 109. Use of any of the primer polynucleotides defined herein, for the amplification of a myctophid gene, or fragment thereof.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB0108104A GB2374597A (en) | 2001-03-30 | 2001-03-30 | Probes for myctophid fish |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GB0108104A GB2374597A (en) | 2001-03-30 | 2001-03-30 | Probes for myctophid fish |
Publications (2)
Publication Number | Publication Date |
---|---|
GB0108104D0 GB0108104D0 (en) | 2001-05-23 |
GB2374597A true GB2374597A (en) | 2002-10-23 |
Family
ID=9911985
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
GB0108104A Withdrawn GB2374597A (en) | 2001-03-30 | 2001-03-30 | Probes for myctophid fish |
Country Status (1)
Country | Link |
---|---|
GB (1) | GB2374597A (en) |
Cited By (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1900318B (en) * | 2006-06-23 | 2010-08-04 | 厦门大学 | High variation zone amplication primer of rockfish mitochondrial genome and its design method |
WO2012160277A1 (en) * | 2011-05-26 | 2012-11-29 | Universite Joseph Fourier (Grenoble 1) | Universal primers and the use thereof for the detection and identification of vertebrate species |
WO2012160278A1 (en) * | 2011-05-26 | 2012-11-29 | Universite Joseph Fourier (Grenoble 1) | Universal primers and the use thereof for the detection and identification of amphibia/fish species |
CN103131762A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biological method of identifying rhabdosargus sarba |
CN103131764A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biology method of identifying priacanthus macracanthus |
CN103131763A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biological method of identifying red porgy |
CN103131761A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biology method of identifying black sea bream |
CN103131759A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biological method of identifying sparus latus |
CN103131767A (en) * | 2011-12-02 | 2013-06-05 | 汕头大学医学院 | Molecular biological method of identifying nemipterus japonicus |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109182571A (en) * | 2018-08-15 | 2019-01-11 | 浙江海洋大学 | A kind of molecular labeling primer and method identifying China with Japan |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992005277A1 (en) * | 1990-09-26 | 1992-04-02 | William Scott Davidson | Test to determine an organism's species and/or population identity by direct nucleotide sequence analysis of defined segments of its genome |
EP0807690A1 (en) * | 1996-05-13 | 1997-11-19 | Karl-Schmitz-Scholl-Fonds für Umweltrecht und Umweltpolitik e.V. | Method and compositions for identification of species origin of caviar |
-
2001
- 2001-03-30 GB GB0108104A patent/GB2374597A/en not_active Withdrawn
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992005277A1 (en) * | 1990-09-26 | 1992-04-02 | William Scott Davidson | Test to determine an organism's species and/or population identity by direct nucleotide sequence analysis of defined segments of its genome |
EP0807690A1 (en) * | 1996-05-13 | 1997-11-19 | Karl-Schmitz-Scholl-Fonds für Umweltrecht und Umweltpolitik e.V. | Method and compositions for identification of species origin of caviar |
Non-Patent Citations (11)
Title |
---|
Biochim. Biophys. Acta, Vol.1352, 1997, Lim, J. et al., "A second type of rod opsin...", pp.8-12 * |
Can. J. Fish. Aquat. Sci., Vol.48, 1991, Bartlett, S. E. et al., "Identification of Thunnus Tuna...", pp.309-317. * |
Genetics, Vol.142, 1996, Brown, J. R. et al., "Length variation, heteroplasmy and sequence...", pp.525-535. * |
J. Fish Biol., Vol.48, 1996, Whitmore, D. H. et al., "Mitochondrial DNA cytochrome...", pp.695-705. * |
J. Food Sci., Vol.63, 1998, Cespedes, A. et al., "Identification of flatfish species...", pp.206-209 * |
J. Heredity, Vol.86, 1995, Bickham, J. W. et al., "Biogeographic implications...", pp.140-144. * |
Mol. Ecol., Vol.8, 1999, Doukakis, P. et al., "Molecular genetic analysis...", pp.S117-S127 * |
Mol. Ecol., Vol.9, 2000, Lovejoy, N. R. et al., "Molecular systematics, biogeography...", pp.259-268. * |
Mol. Phylogenet. Evol., Vol.1, 1992, Pleyte, K. A. et al., "Evolutionary relationships of the salmonid...", pp.223-230. * |
Mol. Phylogenet. Evol., Vol.15, 2000, Yamaguchi, M. et al., "Molecular phylogeny and larval...", pp.103-114. * |
Mol. Phylogenet.Evol., Vol.13, 1999, Burridge, C. P. "Molecular phylogeny of Nemadactylus...", pp.93-109. * |
Cited By (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1900318B (en) * | 2006-06-23 | 2010-08-04 | 厦门大学 | High variation zone amplication primer of rockfish mitochondrial genome and its design method |
WO2012160277A1 (en) * | 2011-05-26 | 2012-11-29 | Universite Joseph Fourier (Grenoble 1) | Universal primers and the use thereof for the detection and identification of vertebrate species |
WO2012160278A1 (en) * | 2011-05-26 | 2012-11-29 | Universite Joseph Fourier (Grenoble 1) | Universal primers and the use thereof for the detection and identification of amphibia/fish species |
FR2975696A1 (en) * | 2011-05-26 | 2012-11-30 | Univ Grenoble 1 | UNIVERSAL PRIMERS AND THEIR USE FOR THE DETECTION AND IDENTIFICATION OF VERTEBRATES SPECIES |
FR2975697A1 (en) * | 2011-05-26 | 2012-11-30 | Univ Grenoble 1 | UNIVERSAL PRIMERS AND THEIR USE FOR THE DETECTION AND IDENTIFICATION OF BATRICIAN SPECIES / FISH |
US10093988B2 (en) | 2011-05-26 | 2018-10-09 | Universite Grenoble Alpes | Universal primers and the use thereof for the detection and identification of amphibia/fish species |
CN103131762A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biological method of identifying rhabdosargus sarba |
CN103131764A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biology method of identifying priacanthus macracanthus |
CN103131763A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biological method of identifying red porgy |
CN103131761A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biology method of identifying black sea bream |
CN103131759A (en) * | 2011-12-01 | 2013-06-05 | 汕头大学医学院 | Molecular biological method of identifying sparus latus |
CN103131767A (en) * | 2011-12-02 | 2013-06-05 | 汕头大学医学院 | Molecular biological method of identifying nemipterus japonicus |
Also Published As
Publication number | Publication date |
---|---|
GB0108104D0 (en) | 2001-05-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Amann et al. | Phylogenetic identification and in situ detection of individual microbial cells without cultivation | |
Bartholomew et al. | The life cycle of Ceratomyxa shasta, a myxosporean parasite of salmonids, requires a freshwater polychaete as an alternate host | |
Amann | Fluorescently labelled, rRNA‐targeted oligonucleotide probes in the study of microbial ecology | |
Rudi et al. | Strain characterization and classification of oxyphotobacteria in clone cultures on the basis of 16S rRNA sequences from the variable regions V6, V7, and V8 | |
Guillemaud et al. | Contrasting levels of variability between cytoplasmic genomes and incompatibility types in the mosquito Culex pipiens | |
Taylor et al. | Duplication and divergence: the evolution of new genes and old ideas | |
Go et al. | The molecular epidemiology of iridovirus in Murray cod (Maccullochella peelii peelii) and dwarf gourami (Colisa lalia) from distant biogeographical regions suggests a link between trade in ornamental fish and emerging iridoviral diseases | |
Widmer | Genetic heterogeneity and PCR detection of Cryptosporidium parvum | |
de la Vega et al. | Differential expression of immune-related genes and transposable elements in black tiger shrimp (Penaeus monodon) exposed to a range of environmental stressors | |
Altinok et al. | Molecular diagnosis of fish diseases: a review | |
Saito et al. | Characterization of the rRNA locus of Pfiesteria piscicida and development of standard and quantitative PCR-based detection assays targeted to the nontranscribed spacer | |
Liu et al. | Control of insect pests with entomopathogenic nematodes: the impact of molecular biology and phylogenetic reconstruction | |
King et al. | A new high throughput sequencing assay for characterizing the diversity of natural Vibrio communities and its application to a Pacific oyster mortality event | |
Coffroth et al. | Identification of marine invertebrate larvae by means of PCR‐RAPD species‐specific markers | |
US7060434B2 (en) | Probes for myctophid fish and a method for developing the same | |
GB2374597A (en) | Probes for myctophid fish | |
Cross et al. | Molecular and cytogenetic characterization of Crassostrea angulata chromosomes | |
Billiones et al. | Genetic identification of Hyalodaphnia species and interspecific hybrids | |
Frischer et al. | Development of an Argopecten-specific 18S rRNA targeted genetic probe | |
Malloy et al. | Isolation and characterization of microsatellite loci in smallmouth bass, Micropterus dolomieu (Teleostei: Centrarchidae), and cross-species amplification in spotted bass, M. punctulatus. | |
Kiesling et al. | Rapid identification of adult and naupliar stages of copepods using DNA hybridization methodology | |
Klinbunga et al. | Genetic diversity and molecular markers of cupped oysters (Genera Crassostrea, Saccostrea, and Striostrea) in Thailand revealed by randomly amplified polymorphic DNA analysis | |
Lambert et al. | DNA science and conservation | |
Getchell et al. | Quantitative polymerase chain reaction assay used to measure the prevalence of Clostridium botulinum type E in fish in the lower Great Lakes | |
Saker et al. | DNA profiling of complex bacterial populations: toxic cyanobacterial blooms |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WAP | Application withdrawn, taken to be withdrawn or refused ** after publication under section 16(1) |