US5723311A - Human DNA topoisomerase I α - Google Patents
Human DNA topoisomerase I α Download PDFInfo
- Publication number
- US5723311A US5723311A US08/458,477 US45847795A US5723311A US 5723311 A US5723311 A US 5723311A US 45847795 A US45847795 A US 45847795A US 5723311 A US5723311 A US 5723311A
- Authority
- US
- United States
- Prior art keywords
- polynucleotide
- polypeptide
- dna
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is human DNA topoisomerase I alpha (hTopI- ⁇ ). The invention also relates to inhibiting the action of such polypeptides.
- DNA topoisomerase I and II catalyze the breaking and rejoining of DNA strands in a way that allows the strands to pass through one another, thus altering the topology of DNA.
- Type I topoisomerase recognizes double-stranded DNA but only breaks on strand in the process of relaxing DNA, while the type II enzyme breaks both strands of duplex DNA. Both enzymes can perform a variety of similar topological inter-conversions, including relaxation of super coiled DNA, knotting and unknotting and catenation and decatenation of duplex DNA.
- Topoisomerase I is ATP-independent, while Topoisomerase II requires energy.
- topoisomerase I and II can provide the topological inter-conversions necessary for transcription and replication.
- topoisomerase I can provide the necessary unlinking activity for efficient in vitro DNA replication (Minden, et al., J. Biol. Chem., 260:9316, (1985))
- topoisomerase II can also facilitate the replication of SV40 DNA by HeLa cell lysates (Yang, et al., Proceedings of the National Academy of Sciences, U.S.A., 84:950, (1987)).
- topoisomerase I normally functions during transcription.
- the enzyme has been shown to be localized preferentially to actively transcribed loci by immunofluorescence (Fleishmann, et al., Proceedings of the National Academy of Sciences, U.S.A., 81:6958 (1984)), andby co-immunoprecipitation with transcribed DNA (Gilmore, et al., Cell, 44:401, (1986)).
- topoisomerase I cleavage sites have been mapped to regions in and around transcribed DNA (Bonner, et al., Cell, 41:541 (1985)). Nonetheless, at least in yeast, topoisomerase II can apparently substitute for the functions of topoisomerase I in transcription.
- Topoisomerase I and II While all cells utilize Topoisomerase I and II for transcription and replication, cells with a high amount of transcription and replication, eg. cancerous cells, have a much higher concentration of Topoisomerase I and II.
- Topoisomerase I has been used to classify autoimmune disease.
- Autoimmune diseases are diseases in which an animal's immune system attacks its own tissues. Often the various types of autoimmune disease can be characterized based upon the specificity of autoantibodies which are produced.
- the serum of patients having the connective tissue autoimmune disease progressive systemic sclerosis, also known as scleroderma frequently contain antibodies to such nuclear antigens as topoisomerase I.
- the ability to accurately detect the presence of antibodies reactive with topoisomerase I can greatly assist in evaluating the prognosis and planning, or monitoring, of the appropriate therapy for patients with scleroderma.
- a 3645-base pair human topoisomerase I cDNA clone and a mutated version of the cDNA encoding a protein with phenylalanine instead of tyrosine at position 723 have been overexpressed two to five fold in stably transfected baby hamster kidney cells.
- the results of this overexpression indicate that tyrosine 723 is essential for enzyme activity and is consistent with predictions based on homology comparisons with the yeast enzymes, that this is the active-site tyrosine in the human topoisomerase I. (Madden, K. R. and Champoux, J. J., Cancer Research, 52:525-532, (1992)).
- cDNA clones encoding human topoisomerase I have been isolated from an expression vector library screened with autoimmune anti-topoisomerase I serum.
- the sequence data shows that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus, (D'Arpa, P. et al., Proc. Natl. Acad. Sci. U.S.A., 85:2543-2547, (1988)).
- cDNA molecules coding for eukaryotic topoisomerase I polypeptide which encode at least one epitope for autoantibodies to eukaryotic topoisomerase I and cloning vehicles capable of expressing these cDNA molecules are disclosed in U.S. Pat. No. 5,070,192.
- polypeptide of the present invention is of human origin.
- nucleic acid molecules encoding a polypeptide of the present invention including mRNAs, DNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically useful fragments thereof.
- a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and subsequent recovery of said protein.
- nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to a nucleic acid sequence of the present invention.
- antagonists to such polypeptides which may be used to inhibit the action of such polypeptides, for example, to treat and/or prevent neoplasia, for example, tumors and adenocarcinoma of the colon, and retroviral infections.
- diagnostic assays for detecting diseases or susceptibility to diseases related to mutations in the nucleic acid sequences encoding a polypeptide of the present invention.
- FIGS. 1A-1H collectively show the cDNA sequence (SEQ ID NO:1) and corresponding deduced amino acid sequence (SEQ ID NO:2) of hTopI- ⁇ .
- the polypeptide encoded by the amino acid sequence shown is the mature form of the polypeptide.
- the standard one letter abbreviation for amino acids is used. Sequencing was performed using a 373 automated DNA sequencer (Applied Biosystems, Inc.).
- FIGS. 2A-2C collectively, show a comparison of hTOPI- ⁇ (SEQ ID NO:2) and human topoisomerase I (SEQ ID NO:5) at the amino acid level.
- the upper line is hTOPI- ⁇ .
- nucleic acid which encodes for the mature polypeptide having the deduced amino acid sequence of FIGS. 1A-1H (collectively, SEQ ID NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75714 on Mar. 18, 1994.
- the ATCC number referred to above is directed to a biological deposit with the ATCC, 12301 Parklawn Drive, Rockville, Md. 20852. Since the strain referred to is being maintained under the terms of the Budapest Treaty, it will be made available to a patent office signatory to the Budapest Treaty.
- a polynucleotide encoding a polypeptide of the present invention was obtained from a fetal brain cDNA library. It is homologous to human topoisomerase I. It contains an open reading frame encoding a protein of 601 amino acid residues and it is structurally related to human DNA topoisomerase I showing 86% similarity and 70% identity at the amino acid level. Further, hTopI- ⁇ shows 83% similarity and 67% identity to human topoisomerase I as published by D'Arpa et al.
- the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
- the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
- the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in FIGS. 1A-1H (collectively, SEQ ID NO:1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of FIGS. 1A-1H (collectively, SEQ ID NO:1) or the deposited cDNA.
- the polynucleotide which encodes for the mature polypeptide of FIGS. 1A-1H (collectively, SEQ ID NO:2) or for the mature polypeptide encoded by the deposited cDNA may include, but is not limited to: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
- polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
- the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of FIGS. 1A-1H (collectively, SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone.
- the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
- the present invention includes polynucleotides encoding the same mature polypeptide as shown in FIGS. 1A-1H (collectively, SEQ ID NO:2) or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of FIGS. 1A-1H (collectively, SEQ ID NO:2) or the polypeptide encoded by the cDNA of the deposited clone.
- Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
- the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in FIGS. 1A-1H (collectively, SEQ ID NO:1) or of the coding sequence of the deposited clone.
- an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
- the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
- the marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
- the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
- gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
- Fragments of the full length hTopI- ⁇ gene may be used as a hybridization probe for a cDNA library to isolate the full length CysE gene and to isolate other genes which have a high sequence similarity to the hTopI- ⁇ gene or similar biological activity.
- Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases.
- the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene including regulatory and promotor regions, exons, and introns.
- An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
- the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences.
- the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
- stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
- polypeptides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of FIGS. 1A-1H (collectively, SEQ ID NO:1) or the deposited cDNA(s).
- the polynucleotide may have at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity.
- such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
- the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides.
- the present invention further relates to a polypeptide which has the deduced amino acid sequence of FIGS. 1A-1H (collectively, SEQ ID NO:2) or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
- fragment when referring to the polypeptide of FIGS. 1A-1H (collectively, SEQ ID NO:2) or that encoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as such polypeptide.
- an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
- the fragment, derivative or analog of the polypeptide of FIGS. 1A-1H (collectively, SEQ ID NO:2) or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
- Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the
- polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
- isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
- Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
- polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at least a 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least a 90% similarity (more preferably at least a 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least a 95% similarity (still more preferably a 95% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
- similarity between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
- Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
- the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
- Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
- the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
- the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention.
- the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
- the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
- the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
- Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
- any other vector may be used as long as it is replicable and viable in the host.
- the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
- the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
- the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
- promoter for example, LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
- the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
- the vector may also include appropriate sequences for amplifying expression.
- the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
- the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transforman appropriate host to permit the host to express the protein.
- bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium
- fungal cells such as yeast
- insect cells such as Drosophila S2 and Spodoptera Sf9
- animal cells such as CHO, COS or Bowes melanoma
- adenoviruses plant cells, etc.
- the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
- the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
- the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
- a promoter operably linked to the sequence.
- Bacterial pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.
- Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
- Two appropriate vectors are pKK232-8 and pCM7.
- Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda P R , P L and trp.
- Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
- the present invention relates to host cells containing the above-described constructs.
- the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
- Introduction of the construct into the host cell can be effected bycalcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
- constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
- the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
- Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
- Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
- recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
- promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
- the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
- the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
- Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
- the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
- Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
- useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017).
- cloning vector pBR322 ATCC 37017
- Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, Wis., U.S.A.). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
- the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
- Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
- Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled in the art.
- mammalian cell culture systems can also be employed to express recombinant protein.
- mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
- Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
- the polypeptide can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
- HPLC high performance liquid chromatography
- polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.
- polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease.
- the present invention is also directed to an assay to identify compounds which inhibit hTopI- ⁇ .
- DNA, hTopI- ⁇ and a potential compound are combined under appropriate conditions for a length of time sufficient for hTopI- ⁇ to act on the single strand DNA.
- the DNA is then analyzed, for example, by gel electrophoresis, to determine whether hTopI- ⁇ functioned properly and in this way it could be determined whether the compound effectively inhibits hTopI- ⁇ .
- Potential antagonists include an antibody, or in some cases, an oligopeptide, which bind to the polypeptide.
- a potential antagonist may be a closely related polypeptide which is a mutant or inactive form of the polypeptide such that substrate is occupied and the action of hTopI- ⁇ is prevented. Since the polypeptide of the present invention acts intra-cellularly the antibodies may be produced intra-cellularly as a single chain antibody by procedures known in the art, such as transforming the appropriate cells with DNA encoding the single chain antibody to prevent the function of hTopI- ⁇ .
- Another antagonist compound is an antisense construct prepared using antisense technology.
- Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
- the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
- a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix--see Lee et al., Nucl.
- the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into hTopI- ⁇ polypeptide (Antisense--Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988)).
- the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the polypeptide of the present invention.
- Another potential antagonist compound includes a small molecule which is capable of passing through the cell membrane and which binds to and occupies the catalytic site of the polypeptide thereby making the catalytic site inaccessible to substrate such that normal biological activity is prevented.
- small molecules include but are not limited to small peptides or peptide-like molecules.
- the antagonist compounds may be employed to treat tumors since specific inhibition of htopI- ⁇ will inhibit tumor cell growth by blocking tumor cell DNA replication.
- the antagonists may also be used to treat retroviral infections by inhibiting hTopI- ⁇ and therefore blocking initiation and replication of the virus.
- the antagonists may also be used to treat adenocarcinoma of the colon, since metastases are prevented by blocking DNA transcription of the cancerous cells.
- the antagonist compounds may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
- compositions comprise a therapeutically effective amount of the compound and a pharmaceutically acceptable carrier or excipient.
- a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
- the formulation should suit the mode of administration.
- the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
- a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
- Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
- the compounds of the present invention may be employed in conjunction with other therapeutic compounds.
- the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, parenterally, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes.
- the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
- the antagonists which are polypeptides may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy.”
- cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
- a polynucleotide DNA or RNA
- cells may be engineered by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.
- cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
- a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest.
- These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
- Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, arian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
- the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
- the vector includes one or more promoters.
- Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ⁇ -actin promoters).
- CMV cytomegalovirus
- Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
- the nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter.
- suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described); the ⁇ -actin promoter; and human growth hormone promoters.
- the promoter also may be the native promoter which controls the gene
- the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
- packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ⁇ -2, ⁇ -AM, PA12, T19-14X, VT-19-17-H2, ⁇ CRE, ⁇ CRIP, GP+E-86, GP+envAm12, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety.
- the vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO 4 precipitation.
- the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
- the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides.
- retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo.
- the transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide.
- Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
- This invention is also related to the use of the gene of the present invention as a diagnostic. Detection of a mutated form of hTopI- ⁇ will allow a diagnosis of a disease or a susceptibility to a disease, for example, related to improper transcription and replication.
- Nucleic acids for diagnosis may be obtained from a patient's cells, including but not limited to blood, urine, saliva, tissue biopsy and autopsy material.
- the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis.
- RNA or cDNA may also be used for the same purpose.
- PCR primers complementary to the nucleic acid encoding hTopI- ⁇ can be used to identify and analyze mutations.
- deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
- Point mutations can be identified by hybridizing amplified DNA to radiolabeled hTopI- ⁇ RNA or alternatively, radiolabeled hTopI- ⁇ antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
- Sequence differences between the reference gene and genes having mutations may be revealed by the direct DNA sequencing method.
- cloned DNA segments may be employed as probes to detect specific DNA segments.
- the sensitivity of this method is greatly enhanced when combined with PCR.
- a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
- the sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
- DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230:1242 (1985)).
- Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., PNAS, U.S.A., 85:4397-4401 (1985)).
- nuclease protection assays such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., PNAS, U.S.A., 85:4397-4401 (1985)).
- the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
- restriction enzymes e.g., Restriction Fragment Length Polymorphisms (RFLP)
- mutations can also be detected by in situ analysis.
- the present invention also relates to a diagnostic assay for detecting altered levels of hTopI- ⁇ protein in various tissues since an over-expression of the proteins compared to normal control tissue samples can detect the presence of abnormal cellular proliferation, i.e., cancer.
- a high level of this protein is indicative of cancer since some human colon carcinoma cells have increased levels of hTopI- ⁇ . They may also be indicative of autoimmune diseases, such as scleroderma, rheumatoid arthritis and AIDS related complex.
- Assays used to detect levels of hTopI- ⁇ protein in a sample derived from a host are well-known to those of skill in the art and include radioimmunoassays, competitive-binding assays, Western Blot analysis and preferably an ELISA assay.
- An ELISA assay initially comprises preparing an antibody specific to the hTopI- ⁇ antigen, preferably a monoclonal antibody.
- a reporter antibody is prepared against the monoclonal antibody.
- a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme.
- a sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin.
- the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any hTopI- ⁇ proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
- the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to hTopI- ⁇ . Unattached reporter antibody is then washed out.
- Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of hTopI- ⁇ protein present in a given volume of patient sample when compared against a standard curve.
- a competition assay may be employed wherein antibodies specific to hTopI- ⁇ are attached to a solid support and labeled hTopI- ⁇ and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of hTopI- ⁇ in the sample.
- sequences of the present invention are also valuable for chromosome identification.
- the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
- Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
- the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
- sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
- PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
- sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
- Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
- Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
- This technique can be used with cDNA having at least 50 or 60 bases.
- Verma et al. Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).
- a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
- polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
- These antibodies can be, for example, polyclonal or monoclonal antibodies.
- the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
- Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
- any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milsrein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
- Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
- the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
- equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
- “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
- the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
- For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
- For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37° C. are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
- Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al., Nucleic Acids Res., 8:4057 (1980).
- Ligase refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
- ligase T4 DNA ligase
- pcDNAtopI HA The expression of plasmid, pcDNAtopI HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E. coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
- a DNA fragment encoding the entire hTopI- ⁇ precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
- the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I.
- the plasmid construction strategy is described as follows:
- the expression plasmid pcDNATopI- ⁇ ATCC #75714, encoding for hTopI- ⁇ was constructed by PCR on the pBLTopI- ⁇ using two primers: the 5' primer 5' CGGGATCCATGCGCGTGGTGCGG 3' (SEQ ID NO:3) contains a BamHI site followed by 15 nucleotides of HhTopI- ⁇ coding sequence starting from the initiation codon; the 3' sequence 5' CGCTCTAGATCAAGCGTAGTCT GGGACGTCGTATGGGTAGAATTCAAAGTCTTCTCC 3' (SEQ ID NO:4) contains complementary sequences to an Xba I site, translation stop codon, HA tag and the last 18 nucleotides of the hTopI- ⁇ coding sequence (not including the stop codon).
- the PCR product contains a Bam HI site, active hTopI- ⁇ coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xba I site.
- the PCR amplified DNA fragment and the vector, pcDNAI/Amp were digested with Bam HI and Xba I restriction enzyme and ligated.
- the ligation mixture was transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, Calif. 92037) the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment.
- hTopI- ⁇ For expression of the recombinant hTopI- ⁇ , COS cells were transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the hTopI- ⁇ HA protein was detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with 35 S-cysteine two days post transfection.
- the in vitro transcription and translation of the hTopI- ⁇ was carried out using the TNT Coupled Reticulocyte Lysate System (Promega, Madison, Wis.).
- the plasmid vector used is pBLSK.
- the cDNA encoding for hTopI- ⁇ was cloned directionally EcoRI to XhoI with the EcoRI site defining the 5' end of the gene and the XhoI site defining the 3' end of the gene.
- the gene was inserted in the T3 direction.
- T3 defines a bacteriophage RNA polymerase which recognizes a specific promoter, and transcribes the DNA into a mRNA.
- One microgram of the pBLSKhTOPI ⁇ was incubated with 25 ⁇ l of TNT rabbit reticulocyte lysate, 2 ⁇ l TNT reaction buffer, 1 ⁇ l T3 RNA polymerase, 1 ⁇ l of amino acid mixture minus methionine (1 mM), 4 ⁇ l of 35 S-methionine (1,000 Ci/mmol) at 10 mCi/ml, 1 ⁇ l RNasin ribonuclease inhibitor (40 U/ ⁇ l) in 50 ⁇ l of final volume at 37° C. for 1.5 hour. 5 ⁇ l of the reaction mixture was mixed with loading buffer, boiled for 5 minutes and loaded on a 10% SDS polyacrylamide gel to separate the protein.
- the gel was then fixed 10% acetic acid, 10% methanol at room temperature for 30 minutes, soaked in Amplify solution (Amersham) at room temperature for 1.5 hours, dried, and subjected to autoradiograph.
- the observed molecular weight of the hTopI- ⁇ in this system is 70 kD, which agrees with the predicted molecular weight by the sequence.
- RNAzolTM B system Biotecx Laboratories, Inc. Houston, Tex. 77033. About 10 ⁇ g of total RNA isolated from each human tissue specified was separated on 1% agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch, and Manjarls, Molecular Cloning, Cold Spring Harbor Press, (1989)). The labeling reaction was done according to the Stratagene Prime-It kit with 50 ng DNA fragment. The labeled DNA was purified with a Select-G-50 column. (5 Prime--3 Prime, Inc. 5603 Arapahoe Road, Boulder, Colo. 80303).
- the filter was then hybridized with radioactive labeled full length hTopI- ⁇ gene at 1,000,000 cpm/ml in 0.5M NaPO 4 , pH 7.4 and 7% SDS overnight at 65° C. After wash twice at room temperature and twice at 60° C. with 0.5 ⁇ SSC, 0.1% SDS, the filter was then exposed at -70° C. overnight with an intensifying screen.
- the message RNA for hTopI ⁇ is present in all the tissues with abundance in ovary, testes, lung, spleen and prostate.
- Fibroblasts are obtained from a subject by skin biopsy.
- the resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask.
- the flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37° C. for approximately one week. At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.
- fresh media e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin
- pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase.
- the linear vector is fractionated on agarose gel and purified, using glass beads.
- the cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively.
- the 5' primer containing an EcoRI site and the 3' primer further includes a HindIII site.
- Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and HindIII fragment are added together, in the presence of T4 DNA ligase.
- the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
- the ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
- the amphotropic pA317 or GP+am12 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin.
- DMEM Dulbecco's Modified Eagles Medium
- CS calf serum
- penicillin and streptomycin The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector.
- the packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).
- Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells.
- the spent media containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells.
- Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
- the engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads.
- the fibroblasts now produce the protein product.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 5 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1917 BASE PAIRS (B) TYPE: NUCLEIC ACID (C) STRANDEDNESS: SINGLE (D) TOPOLOGY: LINEAR (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GCAGATGCGCGTGGTGCGGCTGCTGCGGCTCCGGGCGGCTCTGACGCTGCTCGGGGAGGT60 CCCCCGCCGCCCGGCCTCCCGGGGTGTCCCGGGCTCGCGCAGGACGCAGAAGGGCAGTGG120 AGCCAGGTGGGAGAAGGAGAAGCACGAAGACGGGGTGAAGTGGAGACAGCTGGAGCACAA180 GGGCCCGTACTTCGCACCCCCATACHAGCCCCTTCCCGACGGAGTGCGTTTCTTCTATGA240 AGGAAGGCCTGTGAGATTGAGCGTGCCAGCGGAGGAGGTCCCCACTTTTTATGGGAGGAT300 GTTAGATCATGAATACACAACAAAGGAGGTTTTCCGGAAGAACTTCTTCAATGACTGGCG360 AAAGGAAATGGCGGTGGAAGAGAGGGAAGTCATCAAGAGCCTGGACAAGTGTGACTTCAC420 GGAGATCCACAGATACTTTGTGGACAAGGCCGCAGCCCGGAAAGTCCTGAGCAGGGAGGA480 GAAGCAGAAGCTAAAAGAAGAGGCAGAAAAACTTCAGCAAGAGTTCGGCTACTGTATTTT540 AGATGGTCACCAAGAAAAAATAGGCAACTTCAAGATTGAGCCGCCTGGCTTGTTCCGTGG600 CCGTGGCGACCATCCCAAGATGGGGATGCTGAAGAGAAGGATCACGCCAGAGGATGTGGT660 TATCAACTGCAGCAGGGACTCGAAGATCCCCGAGCCGCCGGCGgGGCACCAGTGGAAGGA720 GGTGCGCTCCGATAACACCGTCACGTGGCTGGACAGCTTGACCGAGAGCGTTCAGAACTC780 CATCAAGTACATCATGCTGAACCCTTGCTCGAAGCTGAAGGGGGAGACAGCTTGGCAGAA840 GTTTGAAACAGCTCGACGCCTGCGGGGATTTGTGGACGAGATCCGCTCCCAGTACCGGGC900 TGACTGGAAGTCTCGGGAAATGAAGACGAGACAGCGGGCGGTGGCCCTGTATTTCATCGA960 TAAGCTGGCACTGAGAGCAGGAAATGAGAAGGAGGACGGTGAGGCGGCCGACACCGTGGG1020 CTGCTGTTCCCTCCGCGTGGAGCACGTCCAGCTGCACCCGGAGGCCGATGGTTGCCAACA1080 CGTGGTGGAATTTGACTTCCTGGGGAAGGACTGCATCCGCTACTACAACAGAGTGCCGGT1140 GGAGAAGCCGGTGTACAAGAACTTACAGCTCTTTATGGAGAACAAGGACCCCCGGGACGA1200 CCTCTTCGACAGGCTGACCACGACCAGCCTGAACAAGCACCTCCAGGAGCTGATGGACGG1260 GCTGSCGGCCAAGGTGTTCCGGACCTACAACGCCTCCATCACTCTGCAGGAGCAGCTGCG1320 GGCCCTGACGCGCGCCGAGGACAGCATAGCAGCTAAGATCTTATCCTACAACCGAGCCAA1380 CCGAGTCGTGGCCATTCTCTGCAACCATCAGCGAGCAACCCCCAGTACGTTCGAGAAGTC1440 GATGCAGAATCTCCAGACGAAGATCCAGGCAAAGAAGGAGCAGGTGGCTGAGGCCAGGGC1500 AGAGCTGAGGAGGGCGAGGGCTGAGCACAAAGCCCAAGGGGATGGCAAGTCCAGGAGTGT1560 CCTGGAGAAGAAGAGGCGGCTCCTGGAGAAGCTGCAGGAGCAGCTGGCGCAGCTGAGTGT1620 GCAGGCCACGGACAAGGAGGAGAACAAGCAGGTGGCCCTGGGCACGTCCAAGCTCAACTA1680 CCTGGACCCCAGGATCAGCATTGCCTGGTGCAAGCGGTTCAGGGTGCCAGTGGAGAAGAT1740 CTACAGCAAAACACAGCGGGAGAGGTTCGCCTGGGCTCTCGCCATGGCAGGAGAAGACTT1800 TGAATTCTAACGACGAGCCGTGTTGAAACTTCTTTTGTATGTGTGTGTGTTTTTTTCACT1860 ATTAAAGCAGTACTGGGGAATTTTGTACAATAAAAAAAAAAAAAAAAAAAAAAAAAA1917 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 601 AMINO ACIDS (B) TYPE: AMINO ACID (C) STRANDEDNESS: (D) TOPOLOGY: LINEAR (ii) MOLECULE TYPE: PROTEIN (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: MetArgValValArgLeuLeuArgLeuArgAlaAlaLeuThrLeu 51015 LeuGlyGluValProArgArgProAlaSerArgGlyValProGly 202530 SerArgArgThrGlnLysGlySerGlyAlaArgTrpGluLysGlu 354045 LysHisGluAspGlyValLysTrpArgGlnLeuGlyHisLysGly 505560 ProTyrPheAlaProProTyrGluProLeuProAspGlyValArg 657075 PhePheTyrGluGlyArgProValArgLeuSerValProAlaGlu 808590 GluValProThrPheTyrGlyArgMetLeuAspHisGluTyrThr 95100105 ThrLysGluValPheArgLysAsnPhePheAsnAspTrpArgLys 110115120 GluMetAlaValGluGluArgGluValIleLysSerLeuAspLys 125130135 CysAspPheThrGluIleHisArgTyrPheValAspLysAlaAla 140145150 AlaArgLysValLeuSerArgGluGluLysGlnLysLeuLysGlu 155160165 GluAlaGluLysLeuGlnGlnGluPheGlyTyrCysIleLeuAsp 170175180 GlyHisGlnGluLysIleGlyAsnPheLysIleGluProProGly 185190195 LeuPheArgGlyArgGlyAspHisProLysMetGlyMetLeuLys 200205210 ArgArgIleThrProGluAspValValIleAsnCysSerArgAsp 215220225 SerLysIleProGluProProAlaGlyHisGlnTrpLysGluVal 230235240 ArgSerAspAsnThrValThrTrpLeuAlaAlaTrpThrGluSer 245250255 ValGlnAsnSerIleLysTyrIleMetLeuAsnProCysSerLys 260265270 LeuLysGlyGluThrAlaTrpGlnLysPheGluThrAlaArgArg 275280285 LeuArgGlyPheValAspGluIleArgSerGlnTyrArgAlaAsp 290295300 TrpLysSerArgGluMetLysThrArgGlnArgAlaValAlaLeu 305310315 TyrPheIleAspLysLeuAlaLeuArgAlaGlyAsnGluLysGlu 320325330 AspGlyGluAlaAlaAspThrValGlyCysCysSerLeuArgVal 335340345 GluHisValGlnLeuHisProGluAlaAspGlyCysGlnHisVal 350355360 ValGluPheAspPheLeuGlyLysAspCysIleArgTyrTyrAsn 365370375 ArgValProValGluLysProValTyrLysAsnLeuGlnLeuPhe 380385390 MetGluAsnLysAspProArgAspAspLeuPheAspArgLeuThr 395400405 ThrThrSerLeuAsnLysHisLeuGlnGluLeuMetAspGlyLeu 410415420 ThrAlaLysValPheArgThrTyrAsnAlaSerIleThrLeuGln 425430435 GluGlnLeuArgAlaLeuThrArgAlaGluAspSerIleAlaAla 440445450 LysIleLeuSerTyrAsnArgAlaAsnArgValValAlaIleLeu 455460465 CysAsnHisGlnArgAlaThrProSerThrPheGluLysSerMet 470475480 GlnAsnLeuGlnThrLysIleGlnAlaLysLysGluGlnValAla 485490495 GluAlaArgAlaGluLeuArgArgAlaArgAlaGluHisLysAla 500505510 GlnGlyAspGlyLysSerArgSerValLeuGluLysLysArgArg 515520525 LeuLeuGluLysLeuGlnGluGlnLeuAlaGlnLeuSerValGln 530535540 AlaThrAspLysGluGluAsnLysGlnValAlaLeuGlyThrSer 545550555 LysLeuAsnTyrLeuAspProArgIleSerIleAlaTrpCysLys 560565570 ArgPheArgValProValGluLysIleTyrSerLysThrGlnArg 575580585 GluArgPheAlaTrpAlaLeuAlaMetAlaGlyGluAspPheGlu 590595600 Phe (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 BASE PAIRS (B) TYPE: NUCLEIC ACID (C) STRANDEDNESS: SINGLE (D) TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: CGGGATCCATGCGCGTGGTGCGG23 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 BASE PAIRS (B) TYPE: NUCLEIC ACID (C) STRANDEDNESS: SINGLE (D) TOPOLOGY: LINEAR (ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTAGAATTCAAAGTCTTCTCC57 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 633 AMINO ACIDS (B) TYPE: AMINO ACID (C) STRANDEDNESS: (D) TOPOLOGY: LINEAR (ii) MOLECULE TYPE: PROTEIN (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: IleLysProLeuLysArgProArgAspGluAspAspValAspTyr 51015 LysProLysLysIleLysThrGluAspThrLysLysGluLysLys 202530 ArgLysLeuGluGluGluGluAspGlyLysLeuLysLysProLys 354045 AsnLysAspLysAspLysLysValProGluProAspAsnLysLys 505560 LysLysProLysLysGluGluGluGlnLysTrpLysTrpTrpGlu 657075 GluGluArgTyrProGluGlyIleLysTrpLysPheLeuGluHis 808590 LysGlyProValPheAlaProProTyrGluProLeuProGluAsn 95100105 ValLysPheTyrTyrAspGlyLysValMetLysLeuSerProLys 110115120 AlaGluGluValAlaThrPhePheAlaLysMetLeuAspHisGlu 125130135 TyrThrThrLysGluIlePheArgLysAsnPhePheLysAspTrp 140145150 ArgLysGluMetThrAsnGluGluLysAsnIleIleThrAsnLeu 155160165 SerLysCysAspPheThrGlnMetSerGlnTyrPheLysAlaGln 170175180 ThrGluAlaArgLysGlnMetSerLysGluGluLysLeuLysIle 185190195 LysGluGluAsnGluLysLeuLeuLysGluTyrGlyPheCysIle 200205210 MetAspAsnHisLysGluArgIleAlaAsnPheLysIleGluPro 215220225 ProGlyLeuPheArgGlyArgGlyAsnHisProLysMetGlyMet 230235240 LeuLysArgArgIleMetProGluAspIleIleIleAsnCysSer 245250255 LysAspAlaLysValProSerProProProGlyHisLysTrpLys 260265270 GluValArgHisAspAsnLysValThrTrpLeuValSerTrpThr 275280285 GluAsnIleGlnGlySerIleLysTyrIleMetLeuAsnProSer 290295300 SerArgIleLysGlyGluLysAspTrpGlnLysTyrGluThrAla 305310315 ArgArgLeuLysLysCysValAspLysIleArgAsnGlnTyrArg 320325330 GluAspTrpLysSerLysGluMetLysValArgGlnArgAlaVal 335340345 AlaLeuTyrPheIleAspLysLeuAlaLeuArgAlaGlyAsnGlu 350355360 LysGluGluGlyGluThrAlaAspThrValGlyCysCysSerLeu 365370375 ArgValGluHisIleAsnLeuHisProGluLeuAspGlyGlnGlu 380385390 TyrValValGluPheAspPheLeuGlyLysAspSerIleArgTyr 395400405 TyrAsnLysValProValGluLysArgValPheLysAsnLeuGln 410415420 LeuPheMetGluAsnLysGlnProGluAspAspLeuPheAspArg 425430435 LeuAsnThrGlyIleLeuAsnLysHisLeuGlnAspLeuMetGlu 440445450 GlyLeuThrAlaLysValPheArgThrTyrAsnAlaSerIleThr 455460465 LeuGlnGlnGlnLeuLysGluLeuThrAlaProAspGluAsnIle 470475480 ProAlaLysIleLeuSerTyrAsnArgAlaAsnArgAlaValAla 485490495 IleLeuCysAsnHisGlnArgAlaProProLysThrPheGluLys 500505510 SerMetMetAsnLeuGlnThrLysIleAspAlaLysLysGluGln 515520525 LeuAlaAspAlaArgArgAspLeuLysSerAlaLysAlaAspAla 530535540 LysValMetLysAspAlaLysThrLysLysValValGluSerLys 545550555 LysLysAlaValGlnArgLeuGluGluGlnLeuMetLysLeuGlu 560565570 ValGlnAlaThrAspArgGluGluAsnLysGlnIleAlaLeuGly 575580585 ThrSerLysLeuAsnTyrLeuAspProArgIleThrValAlaTrp 590595600 CysLysLysTrpGlyValProIleGluLysIleTyrAsnLysThr 605610615 GlnArgGluLysPheAlaTrpAlaIleAspMetAlaAspGluAsp 620625630 TyrGluPhe __________________________________________________________________________
Claims (19)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/458,477 US5723311A (en) | 1995-06-02 | 1995-06-02 | Human DNA topoisomerase I α |
| US09/325,430 US6255077B1 (en) | 1994-05-18 | 1999-06-04 | Human DNA topoisomerase I α |
| US09/871,615 US20020061527A1 (en) | 1994-05-18 | 2001-06-04 | Human DNA topoisomerase I alpha |
| US10/602,043 US20060234342A1 (en) | 1994-05-18 | 2003-06-24 | Human DNA topoisomerase I alpha |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/458,477 US5723311A (en) | 1995-06-02 | 1995-06-02 | Human DNA topoisomerase I α |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1994/005701 Continuation-In-Part WO1995031538A1 (en) | 1994-05-18 | 1994-05-18 | Human dna topoisomerase i-alpha |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/033,153 Division US5968803A (en) | 1994-05-18 | 1998-03-02 | Human DNA topoisomerase I α |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US5723311A true US5723311A (en) | 1998-03-03 |
Family
ID=23820938
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/458,477 Expired - Fee Related US5723311A (en) | 1994-05-18 | 1995-06-02 | Human DNA topoisomerase I α |
Country Status (1)
| Country | Link |
|---|---|
| US (1) | US5723311A (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6146871A (en) * | 1996-04-19 | 2000-11-14 | Sntibioticos, S. A. | Process for modifying the enzyme 7β-(4-carboxybutanamide) cephalosporinacylase and purifying said enzyme in a single chromatographic step |
| US6255077B1 (en) * | 1994-05-18 | 2001-07-03 | Human Genome Sciences, Inc. | Human DNA topoisomerase I α |
| WO2001012790A3 (en) * | 1999-08-17 | 2001-10-25 | Incyte Genomics Inc | Isomerase proteins |
| WO2002072630A3 (en) * | 2001-02-09 | 2004-04-29 | Incyte Genomics Inc | Nucleic acid-associated proteins |
| US20060234342A1 (en) * | 1994-05-18 | 2006-10-19 | Human Genome Sciences, Inc. | Human DNA topoisomerase I alpha |
| US20070154429A1 (en) * | 2005-12-22 | 2007-07-05 | Zimmer, Inc. | Perfluorocyclobutane crosslinked hydrogels |
| US20090062408A1 (en) * | 2007-08-31 | 2009-03-05 | Zimmer, Inc. | Hydrogels with gradient |
| US20090175919A1 (en) * | 2008-01-04 | 2009-07-09 | Zimmer, Inc. | Chemical composition of hydrogels for use as articulating surfaces |
| CN106191022A (en) * | 2016-02-22 | 2016-12-07 | 叶尚勉 | A kind of tumour specific antigen and application thereof |
-
1995
- 1995-06-02 US US08/458,477 patent/US5723311A/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| Voojis et al. Libraries for each human chromosome, constructed from sorter enriched chromosomes by using linker adaptor PCR Am. J. Human Genetics vol. 52 586 597, 1993. * |
| Voojis et al. Libraries for each human chromosome, constructed from sorter-enriched chromosomes by using linker-adaptor PCR Am. J. Human Genetics vol. 52 586-597, 1993. |
| Wetmore et al. Human lung expresses unique gamma glutamyl transpeptidase transcripts Proc. Natl. Acad. Sci. U.S.A. vol. 90 7461 7465, 1993. * |
| Wetmore et al. Human lung expresses unique gamma-glutamyl transpeptidase transcripts Proc. Natl. Acad. Sci. U.S.A. vol. 90 7461-7465, 1993. |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6255077B1 (en) * | 1994-05-18 | 2001-07-03 | Human Genome Sciences, Inc. | Human DNA topoisomerase I α |
| US20060234342A1 (en) * | 1994-05-18 | 2006-10-19 | Human Genome Sciences, Inc. | Human DNA topoisomerase I alpha |
| US6146871A (en) * | 1996-04-19 | 2000-11-14 | Sntibioticos, S. A. | Process for modifying the enzyme 7β-(4-carboxybutanamide) cephalosporinacylase and purifying said enzyme in a single chromatographic step |
| WO2001012790A3 (en) * | 1999-08-17 | 2001-10-25 | Incyte Genomics Inc | Isomerase proteins |
| WO2002072630A3 (en) * | 2001-02-09 | 2004-04-29 | Incyte Genomics Inc | Nucleic acid-associated proteins |
| US20070154429A1 (en) * | 2005-12-22 | 2007-07-05 | Zimmer, Inc. | Perfluorocyclobutane crosslinked hydrogels |
| US8017107B2 (en) | 2005-12-22 | 2011-09-13 | Zimmer, Inc. | Perfluorocyclobutane crosslinked hydrogels |
| US20090062408A1 (en) * | 2007-08-31 | 2009-03-05 | Zimmer, Inc. | Hydrogels with gradient |
| US8062739B2 (en) | 2007-08-31 | 2011-11-22 | Zimmer, Inc. | Hydrogels with gradient |
| US20090175919A1 (en) * | 2008-01-04 | 2009-07-09 | Zimmer, Inc. | Chemical composition of hydrogels for use as articulating surfaces |
| CN106191022A (en) * | 2016-02-22 | 2016-12-07 | 叶尚勉 | A kind of tumour specific antigen and application thereof |
| CN106191022B (en) * | 2016-02-22 | 2019-08-20 | 叶尚勉 | A kind of tumour specific antigen and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0792370B1 (en) | Interleukin-1 beta converting enzyme like apoptosis protease-3 and 4 | |
| US5858705A (en) | Polynucleotides encoding human DNA ligase III and methods of using these polynucleotides | |
| EP0804591B1 (en) | Serum paraoxonase | |
| US5723311A (en) | Human DNA topoisomerase I α | |
| US5650313A (en) | Ubiquitin conjugating enzymes 8 and 9 | |
| US5851814A (en) | Human elastate IV | |
| US5747312A (en) | Human AlkB polypeptide | |
| US6552174B2 (en) | Human MutT2 antibodies | |
| US7083930B2 (en) | Human choline acetyltransferase | |
| US7416855B2 (en) | Immunoassay methods for detecting interleukin-1 β converting enzyme like apoptosis protease-3 | |
| US5849286A (en) | Ubiquitin conjugating enzymes 7,8 and 9 | |
| US6255077B1 (en) | Human DNA topoisomerase I α | |
| US20060234342A1 (en) | Human DNA topoisomerase I alpha | |
| US6455274B1 (en) | Human DNA Ligase IV | |
| US6849436B2 (en) | Human hypoxanthine-(guanine) phosphoribosyl transferase-2 | |
| US5798223A (en) | Polynucleotides encoding human amine transporter and methods of using the same | |
| AU778269B2 (en) | Serum paraoxonase | |
| AU704834C (en) | Serum paraoxonase | |
| JP2002020313A (en) | Human dna topoisomerase i-alpha |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: INSTITUTE FOR GENOMIC RESEARCH, THE, MARYLAND Free format text: ;ASSIGNORS:ADAMS, MARK D.;FLEISCHMANN, ROBERT D.;REEL/FRAME:008259/0720;SIGNING DATES FROM 19961114 TO 19961118 Owner name: HUMAN GENOME SCIENCES, INC., MARYLAND Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:WEI, YING-FEI;REEL/FRAME:008260/0366 Effective date: 19961105 Owner name: HUMAN GENOME SCIENCES, INC., MARYLAND Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:INSTITUTE FOR GENOMIC RESEARCH, THE;REEL/FRAME:008362/0887 Effective date: 19961115 Owner name: INSTITUTE FOR GENOMIC RESEARCH, THE, MARYLAND Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ADAMS, MARK D.;FLEISCHMANN, ROBERT D.;REEL/FRAME:008362/0884;SIGNING DATES FROM 19961114 TO 19961118 |
|
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| FPAY | Fee payment |
Year of fee payment: 8 |
|
| REMI | Maintenance fee reminder mailed | ||
| LAPS | Lapse for failure to pay maintenance fees | ||
| STCH | Information on status: patent discontinuation |
Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
|
| FP | Lapsed due to failure to pay maintenance fee |
Effective date: 20100303 |