US5641764A - Halogenated DNA ligand radiosensitizers for cancer therapy - Google Patents

Halogenated DNA ligand radiosensitizers for cancer therapy Download PDF

Info

Publication number
US5641764A
US5641764A US08/441,116 US44111695A US5641764A US 5641764 A US5641764 A US 5641764A US 44111695 A US44111695 A US 44111695A US 5641764 A US5641764 A US 5641764A
Authority
US
United States
Prior art keywords
dna
halogen
halogenated
alkoxy
hydroxy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/441,116
Inventor
Roger Francis Martin
David Patterson Kelly
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Inner and Eastern Health Care Network
Original Assignee
Anti-Cancer Council of Victoria
MacCallum Peter Institute
University of Melbourne
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AUPJ346889 priority Critical
Priority to AUPJ3468 priority
Priority to US76858891A priority
Application filed by Anti-Cancer Council of Victoria, MacCallum Peter Institute, University of Melbourne filed Critical Anti-Cancer Council of Victoria
Priority to US08/441,116 priority patent/US5641764A/en
Assigned to UNIVERSITY OF MELBOURNE, ANTI-CANCER COUNCIL OF VICTORIA, PETER MACCALLUM INSTITUTE reassignment UNIVERSITY OF MELBOURNE CORRECTIVE ASSIGNMENT TO CORRECT THE FIRST AND THIRD ASSIGNEES NAME ON AN INSTRUMENT PREVIOUSLY RECORDED AT REEL 6790, FRAME 0822. Assignors: KELLY, DAVID P., MARTIN, ROGER F.
Publication of US5641764A publication Critical patent/US5641764A/en
Application granted granted Critical
Assigned to UNIVERSITY OF MELBOURNE, PETER MACCALLUM CANCER INSTITUTE, ANTI-CANCER COUNCIL OF VICTORIA reassignment UNIVERSITY OF MELBOURNE CORRECTIVE ASSIGNMENT TO CORRECT THE NAME OF THE ASSIGNEE, FILED ON 08/07/96 RECORDED ON REEL 8023 FRAME 0877 ASSIGNOR HEREBY CONFIRMS THE ASSIGNMENT OF THE ENTIRE INTEREST. Assignors: KELLY, DAVID P., MARTIN, ROGER F.
Assigned to ANTI-CANCER COUNCIL OF VICTORIA, MELBOURNE, UNIVERSITY OF, INNER AND EASTERN HEALTH CARE NETWORK reassignment ANTI-CANCER COUNCIL OF VICTORIA CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: PETER MACCALLUM CANCER INSTITUTE
Assigned to INNER AND EASTERN HEALTH CARE NETWORK reassignment INNER AND EASTERN HEALTH CARE NETWORK ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ANTI-CANCER COUNCIL OF VICTORIA, MELBOURNE, UNIVERSITY OF
Assigned to PETER MACCALLUM CANCER INSTITUTE reassignment PETER MACCALLUM CANCER INSTITUTE ALLOCATION OF PROPERTY, RIGHTS AND LIABILITES Assignors: INNER AND EASTERN HEALTH CARE NETWORK
Anticipated expiration legal-status Critical
Application status is Expired - Lifetime legal-status Critical

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K41/00Medicinal preparations obtained by treating materials with wave energy or particle radiation; Therapies using these preparations
    • A61K41/0038Radiosensitizing, i.e. administration of pharmaceutical agents that enhance the effect of radiotherapy

Abstract

A radiosensitizer for use in radiotherapy comprises a halogenated DNA ligand. The susceptibility of DNA to radiation damage is enhanced by causing or allowing the halogenated DNA ligand to bind to the DNA before subjecting the DNA or the locus thereof to ionizing or ultraviolet radiation. Radiation damage in DNA is also induced by causing or allowing a halogenated DNA ligand to bind to DNA and irradiating the DNA and said bound ligand or the locus thereof with ionizing or ultraviolet radiation.

Description

This is a continuation of application Ser. No. 07/768,588 filed Nov. 4, 1991, now abandoned.

This invention relates to the use in cancer therapy of halogenated DNA ligands which induce radiation damage in DNA in response to ionising or ultraviolet radiation. More particularly, the invention is concerned with the use of such ligands as radiosensitisers.

Radiosensitisers are substances which when present during irradiation, enhance the cytotoxic effects of radiation. For example, the hypoxic radiosensitiser Misonidazole, enhances the cytotoxic effect of X- and γ-radiation. Although studied for many years, the interaction between radiation and radiosensitiser is complex and difficult to predict. Moreover, as both the radiosensitiser and the radiation are cytotoxic per se, their use in therapy is limited.

Photosensitisers are substances which when present, enhance the cytotoxic effects of ultraviolet or visible radiation. For the purposes of this specification photosensitisers are included in the term radiosensitisers.

The term ionising radiation is used herein to include photons having enough energy to ionise a bond, such as, α, β, γ rays from radioactive nuclei and x-rays.

Incorporation of a bromine or iodine atom into DNA using BUdR or IUdR is known to sensitise DNA to breakage by ionising or ultraviolet radiation. The sensitisation is mediated by the uracilyl free radical formed by dissociation of the carbon-halogen bond in the BUdR or IUdR by UV and the same free radical is formed by a reaction of hydrated electrons produced by ionising radiation. It has been proposed that the uracilyl free radical initiates strand cleavage by abstraction of the hydrogen atom from the 2'-deoxyribose carbon on the adjacent nucleotide.

We have investigated the induction of DNA strand breaks by UV-irradiation of DNA-bound iodoHoechst 33258 (4-[5"-(4'"-methylpiperazin-1'"-yl)- 2", 5'-bi-1H- benzimidazol-2'-yl]phenol), a sequence-selective DNA ligand that binds in the minor groove of DNA. Analysis of the fragmentation products on DNA sequencing gels indicates that strand cleavage results from hydrogen atom abstraction at the 5'-deoxyribose-carbon, by analogy with cleavage by neocarcinostatin. It is believed that photolytic deiodination of the DNA ligand leaves a carbon-centred free radical adventitiously located in the minor groove, resulting in hydrogen atom abstraction and consequent strand cleavage.

We have also found that the iodinated DNA ligand is a potent sensitiser of cell-kill by near UV. When the ligand is attached to the DNA, irradiation with ionising or ultraviolet radiation generates free radicals very close to, but not actually on, the DNA. DNA breaks are produced following abstraction of hydrogen atoms from DNA near the binding sites of the halogenated ligand. Our results indicate that halogenated DNA ligands may also act as sensitisers of ionising radiation. Ultraviolet radiation is more effective at producing free radicals than ionising radiation. However, ultraviolet radiation has a low tissue penetration and could only be used in the treatment of superficial tumours or in the specific killing of isolated tumour cells for example, in samples of bone marrow prior to bone marrow transplantation.

Thus, according to one aspect of the present invention there is provided a radiosensitiser for use in cancer therapy which comprises a halogenated DNA ligand.

According to another aspect of the present invention there is provided a method for enhancing the susceptibility of DNA to radiation damage, which comprises causing or allowing a halogenated DNA ligand to bind to the DNA before subjecting the DNA or the locus thereof to ionising or ultraviolet radiation.

According to a further aspect of the present invention there is provided a method for inducing radiation damage in DNA, which comprises causing or allowing a halogenated DNA ligand to bind to DNA and irradiating the DNA and said bound ligand or the locus thereof with ionising or ultraviolet radiation.

The DNA ligand may be of any suitable known type e.g. an intercalating ligand such as an aminoacridine or a minor groove binding ligand such as bis-benzimidazole and those described in Baguley, V. C., (1982) J. Mol. Cell. Biochem. 43: 167-181, for example, compounds having the following structural formulae: ##STR1## wherein X is halogen.

Advantageously, the ligand (with its attached halogen atom) is of a type which allows enhanced uptake, by endocytosis or other means, of the radiosensitiser into cells.

In a preferred embodiment the minor groove binding ligand is a halogenated bis-benzimidazole of the general formula: ##STR2## wherein R1, R2, R3, R4 and R5, which may be the see or different, are selected from the group consisting of hydrogen, halogen, hydroxy, alkoxy, nitro or any other suitable non-deleterious substituent; and

R6 is alkyl; phenyl; phenyl optionally substituted with halogen, hydroxy, alkoxy, nitro or any other suitable non-deleterious substituent; or phenylalkyl optionally substituted with halogen, hydroxy, alkoxy, nitro or any other suitable non-deleterious substituent.

Particularly preferred compounds of formula (I) are those wherein

R1, R2, R3, R4 and R5, which are either the same or different, are selected from hydrogen, hydroxy, alkoxy, iodo and bromo; and

R6 is methyl, phenyl or phenylalkyl.

The halogenated ligand is preferably selected so as to bind at a location near the sugar chain of DNA so that the halogen free radical is sufficiently close to the potential target area in the sugar chain.

The basis of the invention is further shown by reference to the accompanying drawings in which:

FIG. 1 shows the 1.7% agarose gel of UV-B irradiated mixtures of plasmid DNA and iodoHoechst 33528;

FIG. 2 shows the DNA-sequencing gels of fractionated 5'-32 P-end-labelled restriction fragment cleavage products (SEQ ID NO. 2);

FIG. 3 shows the pBR322 restriction fragment used in the experiments involving higher resolution (16% acrylamide) sequencing gels (SEQ ID NO. 1);

FIG. 4 shows the relationship between UV-A dose and cell survival when iodoHoescht is added to the cell medium to a concentration of 4 μM; and

FIG. 5 shows the analysis of a large number of binding sites of DNA substrates derived from M13 clones of human alpha-DNA (SEQ ID NOS. 3 and 4).

Details of the experimental methods are given in the Examples which follow.

The UV spectrum of Hoechst 33258 has an absorption maximum at 338 nm which shifts to 356 nm upon binding to DNA. Substitution of iodine with the phenyl ring of the bis-benzimidazole shifts the maximum to 345 nm. Therefore, UV-A (320-400 nm) was used in preference to UV-B which closely coincides with the absorption of the halogenated nucleotides.

Irradiation of mixtures of plasmid DNA and iodoHoechst 33258 clearly resulted in marked strand cleavage (FIG. 1) which was detectable at input ratios below one DNA ligand per 50 bp. No detectable cleavage was obtained by UV irradiation of DNA with the same dose of UV-A in the presence of unsubstituted Hoechst 33258 (not shown), nor with UV irradiation only.

Similar results have been obtained with the following compounds of formula (I) wherein

R1 =R4 =R5 =H, R2 =I, R3 =OH, R6 =CH3 ;

R1 =R5 =H, R2 =R4 =I, R3 =OH, R6 =CH3 ;

R1 =R4 =R5 =H, R2 =I, R3 =OCH3, R6 =CH3 ;

R1 =R5 =H, R2 =R4 =I, R3 =OCH3, R6 --CH3 ; and

R1 =R3 =R4 =R5 =H, R2 =Br, R6 =CH3.

To analyse the strand breaks in more detail 5'-32 P-end-labelled restriction fragments were used and the cleavage products were fractionated on DNA-sequencing gels. As illustrated in FIG. 2, these experiments showed that the UV-induced cleavage was at discrete sites along the DNA and always Just to the 3' side of a ligand binding site comprised of 3 or more consecutive AT base pairs. The extent of breakage generally increased with higher concentrations of the iodinated ligand but at 20 μM (compared to 75 μM DNA bp) more generalised breakage was apparent. Experiments with DNA substrate derived from M13 clones of human alpha-DNA enabled the analysis of a large number of binding sites and for all the stronger cleavage sites, the cleavage occurred at the 3'-end of the indicated binding site. The results are set out in FIG. 5.

A more detailed appreciation of the mechanism of photolytic cleavage came from experiments with higher resolution (16% acrylamide) sequencing gels, using a 100 bp pBR322 restriction fragment end-labelled 3' or 5', at either end of the fragment (FIG. 3). With 5'-labelled target DNA, the site of cleavage is always 3' to the ligand binding site and the mobility of the cleavage products coincide with corresponding bands in the Maxam-Gilbert sequencing tracks, regardless of whether or not the photolysis samples are treated with hot piperidine. On the other hand, the situation was more complex for experiments with 3'-labelled target DNA fragments. The major 3'-labelled fragment species was always about 2 nucleotides longer than anticipated from the 5'-labelled data, and its mobility sometimes different from the "nearest" Maxam-Gilbert band.

Alternatively, treatment of the photolysis samples with hot piperidine shortened the major species, bringing the cleavage site to the same nucleotide as seen for the corresponding 5'-labelled experiment. Moreover, the mobility of the piperidine-treated 3'-labelled species was coincident with the Maxam-Gilbert band. This pattern of mobilities is exactly the same as that described for neocarcinostatin cleavage of DNA.

Extensive investigations have indicated that a free radical species in neocarcinostatin abstracts a hydrogen atom from the 5'-carbon of deoxyribose and that subsequent oxidation at that carbon results in a strand break leaving the termini of a 5'-carbon aldehyde and 3'-phosphoryl. Subsequent piperidine treatment removes the base-sugar aldehyde leaving a 5'-phosphoryl group.

It is concluded by analogy that iodoHoeshst 33258 photolysis involves a similar cleavage mechanism, initiated by photolysis of the carbon-iodine bond and formation of a carbon-centred free radical on the DNA ligand, which subsequently abstracts a hydrogen atom from the 5'-carbon.

Cytotoxicity studies have shown that iodoHoechst is also a potent sensitiser in situ. When the DNA ligand was added to the medium to a concentration of 4 μM, irradiation resulted in 3-4-log cell kill at a UV-A dose that only marginally reduces cell survival in the absence of a sensitiser (FIG. 4). It is believed that the cell kill is mediated by DNA strand breakage.

Details of the above results and experimental procedures are given in the non-limiting Examples which follow.

The following abbreviations are used:

PBS phosphate buffered saline

EDTA ethylene diamine tetraacetic acid

EXAMPLE 1 (FIG. 1)

Mixtures containing pBR322 DNA (1 μg) and various amounts of HPLC-purified iodoHoechst 33258, in 20 μl of 5 mM Tris (PH 7.5)/20 mM NaCl/1 mM EDTA were irradiated for 20 minutes in an open 1.5 ml Eppendorf tube under a UV-A lamp, at a measured fluence of 75 μW cm-2 (UV Radiometer with UVX-36 detector; U.V. Products, California, USA). The samples were fractionated on 1.7% agarose gels containing ethidium bromide. Control samples (lanes 1 and 3) were not irradiated and kept in the dark. A further control was irradiated but did not contain iodoHoechst (lane 2). The final iodoHoechst concentrations in the samples were 1 μM (lane 4), 5 μM (lanes 3 and 5) and 20M (lane 6).

EXAMPLE 2 (FIG. 2)

EcoR1-cut pBR322 DNA was 5'-32 P-end labelled, cut with BamH1 and the 375 bp labelled fragment isolated by preparative polyacrylamide gel electrophoresis. Samples of the labelled fragment were mixed with carrier DNA and iodoHoechst 33258 and photolysed as described in Example 1. The final concentrations of iodoHoechst were 1 μM (lane 1), 2.5 μM (lane 4), and 5 μM (lanes 2 & 5), 10 μM (lane 6), 20 μM (lane 7), and 40 μM (lane 8). The samples with matched amounts of 32 P were then analysed on a 16% polyacrylamide sequencing gel. Samples for lanes 1 and 2 were unirradiated controls and lane 8 was a Maxam-Gilbert G+A track.

EXAMPLE 3 (FIG. 3)

End-labelled restriction fragments were derived from pBR322. The 375 bp fragments were prepared by 3'- or 5'-32 P end labelling at the EcoR1 site, followed by subsequent cleavage with BamH1 and then isolation by preparative polyacrylamide gel electrophoresis. Similarly, the 100bp fragments were obtained by end-labelling at the Hind IV site and subsequent cleavage with DdeI and preparative electrophoresis. Samples of each of the four labelled fragments were mixed with carrier DNA and subjected to UV-A photolysis with 5 μM iodoHoechst 33258 as described in Example 1. The samples were then analysed on 16% sequencing gels together with Maxam-Gilbert sequencing samples as in Example 1. In some cases (denoted pip+) the photolysed samples were subjected to treatment with 1M piperidine at 90° C. for 30 minutes prior to sequencing gel analysis. The arrows indicate the sites of photolysis cleavage relative to Maxam-Gilbert references bands. The intensity of the bands vary considerably. The asterisked arrows denote particularly weak sites. The bp number in the pBR322 nucleotide sequence is shown and the sequence is aligned with the zero in each number.

EXAMPLE 4 (FIG. 4)

Mid-log phase V79 cells in 5ml alpha-MEM with 10% foetal calf serum in 25 cm2 plastic flasks were incubated in the dark with 4 μM iodoHoechst 33258 (HPLC purified) for 2 hours at 37° C. and then chilled on ice for 30 minutes. The cultures were kept on ice during UV-A irradiation. The flasks were irradiated from above. After allowing for attentuation by the flask and medium, the dose-rate delivered to the monolayer was calculated to be approximately 50 μW cm-2. After the appropriate irradiation time (0-20 minutes) the flasks were covered with black adhesive vinyl, washed twice with ice cold PBS/EDTA and suspended with 2 ml, 0.01% Pronase. A portion of the cell suspension was washed twice with BSS, samples counted in a Coulter Counter, and various aliquots plated-out in 50 nun plastic petri dishes. The colonies were fixed and stained after 7 days and the colonies of >50 cells scored. The control cloning efficiency (>60%) was used to calculate the relative cloning efficiency of treated cells. The data shown are derived from four separate experiments, indicated by different symbols. Open symbols depict controls without iodoHoechst 33258.

EXAMPLE 5 (FIG. 5)

Clone alpha 32, which contains a 340 bp insert of human alpha RI-DNA in M13 mp9, was effectively 5'-end labelled as described below and UV irradiated in the presence of iodoHoechst 33258 as described in Example 1. Autoradiographs of DNA sequencing gels were analysed by laser densitometry and damage sites were quantified as very strong (VS), strong (S) or medium (M). DNA sequences are presented 5' to 3' left to right In FIG. 5, the cleavage site is underlined and its position is given to the left of the DNA sequence. The iodoHoechst 33258 binding site is in capital letters.

The procedure for effectively 5'-end labelling M13 clone alpha 32 briefly involves pulse labelling the DNA immediately after the 17 bp sequencing primer with [32 P]dATP, dGTP and dCTP (which effectively labels the synthesised strand at the 5'-end). This is followed by a chase with cold dATP and dTTP, which results in extensive synthesis of DNA--greater than 3000 bp.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 4(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 55 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(v) FRAGMENT TYPE: internal(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GAGGCCCTTTCGTCTTCAAGAATTCTCATGTTTGACAGCTTATCATCGATAAGCT55(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 29 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(v) FRAGMENT TYPE: internal(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:TTCGAATAGCTACTATTCGACAGTTTGTA29(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 10 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(v) FRAGMENT TYPE: internal(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:TGTAATTTGC10(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 11 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(v) FRAGMENT TYPE: internal(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:GCATATTATGC11__________________________________________________________________________

Claims (10)

We claim:
1. A method for enhancing the susceptibility of DNA to radiation damage, which comprises causing or allowing a halogenated minor groove binding DNA ligand to bind to the DNA before subjecting the DNA, or the locus thereof, to ionizing or ultraviolet radiation.
2. The method as claimed in claim 1, wherein the halogenated minor groove binding DNA ligand is a halogenated bis-benzimidazole compound.
3. The method as claimed in claim 2, wherein the halogenated minor groove binding DNA ligand is a halogenated bis-benzimidazole represented by the following formula (I): ##STR3## wherein R1, R2, R3, R4, R5 and R6, which are either the same or different, are selected from the group consisting of hydrogen; halogen; hydroxy; alkoxy; nitro; amino; alkyl; alkylphenyl; alkyl substituted with halogen, hydroxy, alkoxy, nitro or amino; alkylphenyl substituted with halogen, hydroxy, alkoxy, nitro or amino; alkenyl; alkenylphenyl; alkenyl substituted with halogen, hydroxy, alkoxy, nitro or amino; and alkenylphenyl substituted with halogen, hydroxy, alkoxy, nitro or amino, and wherein at least one of substituents R1, R2, R3, R4, R5 or R6 is halogen.
4. The method as claimed in claim 3, wherein
R1, R2, R3, R4, and R5, which are either the same or different, are selected from the group consisting of hydrogen, hydroxy, alkoxy, iodo and bromo; and
R6 is selected from the group consisting of methyl, phenyl and phenylalkyl.
5. The method as claimed in any of claims 1 to 4, wherein the halogenated minor groove binding DNA ligand is bound at a location near the sugar chain of DNA so that the halogen free radical is sufficiently close to the potential target area in the sugar chain.
6. A method for inducing radiation damage in DNA which comprises the steps of:
(a) causing or allowing a halogenated minor groove binding DNA ligand to bind to DNA; and
(b) irradiating the DNA and said bound ligand, or the locus thereof, with ionizing or ultraviolet radiation.
7. The method as claimed in claim 6, wherein the halogenated minor groove binding DNA ligand is a halogenated bis-benzimidazole compound.
8. The method as claimed in claim 7, wherein the halogenated minor groove binding DNA ligand is a halogenated bis-benzimidazole represented by the following formula (I): ##STR4## wherein R1, R2, R3, R4, R5, and R6, which are either the same or different, are selected from the group consisting of hydrogen; halogen; hydroxy; alkoxy; nitro; amino; alkyl; alkylphenyl; alkyl substituted with halogen, hydroxy, alkoxy, nitro or amino; alkylphenyl substituted with halogen, hydroxy, alkoxy, nitro or amino; alkenyl; alkenylphenyl; alkenyl substituted with halogen, hydroxy, alkoxy, nitro or amino; and alkenylphenyl substituted with halogen, hydroxy, alkoxy, nitro or amino, and wherein at least one of substituents R1, R2, R3, R4, R5 or R6 is halogen.
9. The method as claimed in claim 8, wherein
R1, R2, R3, R4, and R5 which are either the same or different, are selected from the group consisting of hydrogen, hydroxy, alkoxy, iodo and bromo; and
R6 is selected from the group consisting of methyl, phenyl and phenylalkyl.
10. The method as claimed in any one of claim 6 to 9, wherein the halogenated minor groove binding DNA ligand is bound at a location near the sugar chain of DNA so that the halogen free radical is sufficiently close to the potential target area in the sugar chain.
US08/441,116 1989-03-31 1995-05-15 Halogenated DNA ligand radiosensitizers for cancer therapy Expired - Lifetime US5641764A (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AUPJ346889 1989-03-31
AUPJ3468 1989-03-31
US76858891A true 1991-11-04 1991-11-04
US08/441,116 US5641764A (en) 1989-03-31 1995-05-15 Halogenated DNA ligand radiosensitizers for cancer therapy

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US08/441,116 US5641764A (en) 1989-03-31 1995-05-15 Halogenated DNA ligand radiosensitizers for cancer therapy

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US76858891A Continuation 1991-11-04 1991-11-04

Publications (1)

Publication Number Publication Date
US5641764A true US5641764A (en) 1997-06-24

Family

ID=25643654

Family Applications (1)

Application Number Title Priority Date Filing Date
US08/441,116 Expired - Lifetime US5641764A (en) 1989-03-31 1995-05-15 Halogenated DNA ligand radiosensitizers for cancer therapy

Country Status (1)

Country Link
US (1) US5641764A (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6194414B1 (en) * 1995-07-28 2001-02-27 The Inner And Eastern Health Care Network Radioprotectors
US6331286B1 (en) 1998-12-21 2001-12-18 Photogen, Inc. Methods for high energy phototherapeutics
US20020001567A1 (en) * 1998-12-21 2002-01-03 Photogen, Inc. Intracorporeal medicaments for high energy phototherapeutic treatment of disease
WO2003011219A2 (en) * 2001-07-27 2003-02-13 Curis, Inc. Mediators of hedgehog signaling pathways, compositions and uses related thereto
US6547812B1 (en) * 2000-12-29 2003-04-15 Advanced Cardiovascular Systems, Inc. Radiation therapy using a radioactive implantable device and a radiosensitizer agent
US20040047804A1 (en) * 1998-10-29 2004-03-11 The General Hospital Corporation, A Massachusetts Corporation Enhanced radiation therapy
US20040191843A1 (en) * 2003-02-03 2004-09-30 Palo Alto Institute Of Molecular Medicine Cell-killing molecules and methods of use thereof
US20050080019A1 (en) * 2002-09-05 2005-04-14 Nanodynamics Inc. Radiotherapy method using x-rays
US20070208076A1 (en) * 1998-12-21 2007-09-06 Dees H C Intracorporeal medicaments for high energy phototherapeutic treatment of disease
US20080118567A1 (en) * 1998-08-06 2008-05-22 Provectus Pharmatech. Inc, Medicaments for Chemotherapeutic Treatment of Disease
US20080118578A1 (en) * 1997-12-11 2008-05-22 Dees H Craig Topical Medicaments and Methods for Photodynamic Treatment of Disease
US7384623B1 (en) 1998-12-21 2008-06-10 Provectus Pharmatech, Inc. High energy phototherapeutic agents
US20090117199A1 (en) * 1998-08-06 2009-05-07 Scott Timothy C Method of treatment of cancer
EP2181704A2 (en) 2002-12-30 2010-05-05 Angiotech International Ag Drug delivery from rapid gelling polymer composition
US7981928B2 (en) 2002-09-05 2011-07-19 Nanodynamics, Inc. Chemotherapy method using x-rays

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4415589A (en) * 1981-11-06 1983-11-15 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Use of carnitine and of lower acyl-carnitines in the therapeutic treatment of the pathology of the veins
US4415588A (en) * 1981-07-09 1983-11-15 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Therapeutical method of treating patients with impaired immune system
US4464393A (en) * 1982-12-09 1984-08-07 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Use of alkanoyl L-carnitines in the therapeutical treatment of myopathies and muscular dystrophies
US4663352A (en) * 1985-06-11 1987-05-05 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Use of some alkanoyl L-carnitines for the therapeutical treatment of idiopathic and induced Parkinsonism
US4751242A (en) * 1986-08-04 1988-06-14 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Use of acetyl L-carnitine in the therapeutical treatment of peripheral neuropathies
US5096694A (en) * 1987-04-17 1992-03-17 Ire-Celltarg S.A. Compounds which are useful, in particular, for radiotherapy or imaging of cancer

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4415588A (en) * 1981-07-09 1983-11-15 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Therapeutical method of treating patients with impaired immune system
US4415589A (en) * 1981-11-06 1983-11-15 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Use of carnitine and of lower acyl-carnitines in the therapeutic treatment of the pathology of the veins
US4464393A (en) * 1982-12-09 1984-08-07 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Use of alkanoyl L-carnitines in the therapeutical treatment of myopathies and muscular dystrophies
US4663352A (en) * 1985-06-11 1987-05-05 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Use of some alkanoyl L-carnitines for the therapeutical treatment of idiopathic and induced Parkinsonism
US4751242A (en) * 1986-08-04 1988-06-14 Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. Use of acetyl L-carnitine in the therapeutical treatment of peripheral neuropathies
US5096694A (en) * 1987-04-17 1992-03-17 Ire-Celltarg S.A. Compounds which are useful, in particular, for radiotherapy or imaging of cancer

Non-Patent Citations (52)

* Cited by examiner, † Cited by third party
Title
Adams et al, Structure Activity Relationships in the Development of Hypoxic Cell Radiosensitizers, Int. J. Radiat. Biol ., 35(2):133 150 (1979). *
Adams et al, Structure-Activity Relationships in the Development of Hypoxic Cell Radiosensitizers, Int. J. Radiat. Biol., 35(2):133-150 (1979).
Brown, Clinical Trails of Radiosensitizers: What Should We Expect , Int. Radiat. Oncol. Biol. Phys ., 10:425 429 (1984). *
Brown, Clinical Trails of Radiosensitizers: What Should We Expect?, Int. Radiat. Oncol. Biol. Phys., 10:425-429 (1984).
Loewe et al, Basic Substituted 2,6 Bisbenzimidazole Derivatives, a Novel Series of Substances with Chemotherapeutic Activity, J. Arzneim. Forsch. ( Drug Res. ), 24:1927 1933 (1974) (with transl.). *
Loewe et al, Basic-Substituted 2,6-Bisbenzimidazole Derivatives, a Novel Series of Substances with Chemotherapeutic Activity, J. Arzneim.-Forsch. (Drug Res.), 24:1927-1933 (1974) (with transl.).
Marcus, Clinical Photodynamic Therapy: The Continuing Evolution, pp. 219 268. *
Marcus, Clinical Photodynamic Therapy: The Continuing Evolution, pp. 219-268.
Martin et al, Comparative Studies of UV induced DNA Cleavage by Structural Isomers of an Iodinated DNA Ligand, Int. J. Radiat. Oncol. Biol. Phys. (in press) (1993). *
Martin et al, Comparative Studies of UV-induced DNA Cleavage by Structural Isomers of an Iodinated DNA Ligand, Int. J. Radiat. Oncol. Biol. Phys. (in press) (1993).
Martin et al, Cytotoxicity of an 125 I labelled DNA binding Compound that Induces Double Stranded DNA Breaks, Cancer Res ., 39:3244 3247 (1979). *
Martin et al, Cytotoxicity of an 125 I-labelled DNA-binding Compound that Induces Double-Stranded DNA Breaks, Cancer Res., 39:3244-3247 (1979).
Martin et al, DNA Damage by Auger Emitters, Taylor & Francis, pp. 55 68 (1988). *
Martin et al, DNA Damage by Auger Emitters, Taylor & Francis, pp. 55-68 (1988).
Martin et al, DNA: A Molecular Framework for Studying Reactive Species, Recueil des Travaux Chimiques des Pays Bas , 106:178 (1987). *
Martin et al, DNA: A Molecular Framework for Studying Reactive Species, Recueil des Travaux Chimiques des Pays-Bas, 106:178 (1987).
Martin et al, Preparation of Carrier Free 125 I IodoHoechst 33258, Int. J. Appl. Radiat. Isot ., 36(9):745 747 (1985). *
Martin et al, Preparation of Carrier Free[125 I]IodoHoechst 33258, Int. J. Appl. Radiat. Isot., 36(9):745-747 (1985).
Martin et al, Rapid Communication, Radiation Sensitization by an Iodine labelled DNA Ligand, Int. J. Radiat. Biol ., 57(5):939 946 (1990). *
Martin et al, Rapid Communication, Radiation Sensitization by an Iodine-labelled DNA Ligand, Int. J. Radiat. Biol., 57(5):939-946 (1990).
Martin et al, Synthesis and Characterization of 2 Iodo 4 5 (4 methylpiperazin 1 yl) 2 ,5 bi 1H benzimidazol 2 yl phenol (iodoHoechst 33258) and 2,5 Disubstituted Benzimidazole Model Compounds, Aust. J. Chem ., 39:373 381 (1986). *
Martin et al, Synthesis and Characterization of 2-Iodo-4-[5"-(4'"-methylpiperazin-1'"-yl)-2",5'-bi-1H-benzimidazol-2'-yl]phenol (iodoHoechst 33258) and 2,5-Disubstituted Benzimidazole Model Compounds, Aust. J. Chem., 39:373-381 (1986).
Martin et al, Synthesis and N.M.R. Spectra of Substituted Aminoiodoacridines, Aust. J. Chem ., 32:2637 2646 (1979). *
Martin et al, Synthesis and N.M.R. Spectra of Substituted Aminoiodoacridines, Aust. J. Chem., 32:2637-2646 (1979).
Martin et al, Use of an 125 I labelled DNA Ligand to Probe DNA Structure, Nature , 302(5907):452 454 (1983). *
Martin et al, Use of an 125 I-labelled DNA Ligand to Probe DNA Structure, Nature, 302(5907):452-454 (1983).
Martin et al. Chem. Abstr. No. 106:32923b, p. 539, 1987; Aus. J. Chem. 39(2):373 381, 1986. *
Martin et al. Chem. Abstr. No. 106:32923b, p. 539, 1987; Aus. J. Chem. 39(2):373-381, 1986.
Martin et al. Chemical Abstracts 93:46379d, 1980, Aust. J. Chem. 32(12):2637 2646, 1979. *
Martin et al. Chemical Abstracts 93:46379d, 1980, Aust. J. Chem. 32(12):2637-2646, 1979.
Martin, Induction of Double Stranded Breaks in DNA by Binding with an 125 I labelled Acridine, Int. J. Radiat. Biol ., 32(5):491 497 (1977). *
Martin, Induction of Double-Stranded Breaks in DNA by Binding with an 125 I-labelled Acridine, Int. J. Radiat. Biol., 32(5):491-497 (1977).
Murray et al, Sequence Specificity of 125 I labelled Hoechst 33258 Damage in Six Closely Related DNA Sequences, J. Mol. Biol ., 203:63 73 (1988). *
Murray et al, Sequence Specificity of 125 I labelled Hoechst 33258 in Intact Human Cells, J. Mol. Biol ., 201:437 442 (1988). *
Murray et al, Sequence Specificity of 125 I-labelled Hoechst 33258 Damage in Six Closely Related DNA Sequences, J. Mol. Biol., 203:63-73 (1988).
Murray et al, Sequence Specificity of 125 I-labelled Hoechst 33258 in Intact Human Cells, J. Mol. Biol., 201:437-442 (1988).
Murray et al, The Degree of Ultraviolet Light Damage to DNA Containing Iododeoxyuridine or Bromodeoxyuridine is Dependent on the DNA Sequence, Nucleic Acids Res ., 17(7):2675 2691 (1989). *
Murray et al, The Degree of Ultraviolet Light Damage to DNA Containing Iododeoxyuridine or Bromodeoxyuridine is Dependent on the DNA Sequence, Nucleic Acids Res., 17(7):2675-2691 (1989).
Murray et al. J. Mol. Biol. 201:437 442, 1988. *
Murray et al. J. Mol. Biol. 201:437-442, 1988.
Ridley et al, A New Synthesis of Benzimidazoles and Aza analogs, J. Het. Chem ., 2:453 456 (1965). *
Ridley et al, A New Synthesis of Benzimidazoles and Aza-analogs, J. Het. Chem., 2:453-456 (1965).
Rodriguez et al, Continuous Infusion of Halogenated Pyrimidines, I. J. Radiation Oncology, Biology, Phsics , 20(6):1380 1381 (1991). *
Rodriguez et al, Continuous Infusion of Halogenated Pyrimidines, I. J. Radiation Oncology, Biology, Phsics, 20(6):1380-1381 (1991).
Russell et al, In Vitro and in Vivo Radiation Sensitization by the Halogenated Pyrimidine 5 Chloro 2 deoxycytidine, Cancer Res ., 46:2883 2887 (1986). *
Russell et al, In Vitro and in Vivo Radiation Sensitization by the Halogenated Pyrimidine 5-Chloro-2'-deoxycytidine, Cancer Res., 46:2883-2887 (1986).
Sano et al. Chem. Abstr. No. 70:6805, p. 672, 1969; No to Shinkei, 19:339 344, 1967. *
Sano et al. Chem. Abstr. No. 70:6805, p. 672, 1969; No to Shinkei, 19:339-344, 1967.
Smith et al. Chem. Abstr. 102:92205w, p. 269, 1985; Int. J. Radiation Biol. Relat. Stud. Phys. Chem. Med. 46(4): 331 334, 1984. *
Smith et al. Chem. Abstr. 102:92205w, p. 269, 1985; Int. J. Radiation Biol. Relat. Stud. Phys. Chem. Med. 46(4): 331-334, 1984.
Teng et al, The Molecular Structure of the Complex of Hoechst 33258 and the DNA Dodecamer d(CGCGAATTCGCG), Nucleic Acids Res ., 16(6):2671 2690 (1988). *
Teng et al, The Molecular Structure of the Complex of Hoechst 33258 and the DNA Dodecamer d(CGCGAATTCGCG), Nucleic Acids Res., 16(6):2671-2690 (1988).

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6548505B1 (en) * 1995-07-28 2003-04-15 Peter Maccallum Cancer Institute Radioprotectors
US6194414B1 (en) * 1995-07-28 2001-02-27 The Inner And Eastern Health Care Network Radioprotectors
US20080118578A1 (en) * 1997-12-11 2008-05-22 Dees H Craig Topical Medicaments and Methods for Photodynamic Treatment of Disease
US8974363B2 (en) 1997-12-11 2015-03-10 Provectus Pharmatech, Inc. Topical medicaments and methods for photodynamic treatment of disease
US8557298B2 (en) 1998-08-06 2013-10-15 Provectus Pharmatech, Inc. Medicaments for chemotherapeutic treatment of disease
US20090117199A1 (en) * 1998-08-06 2009-05-07 Scott Timothy C Method of treatment of cancer
US20080118567A1 (en) * 1998-08-06 2008-05-22 Provectus Pharmatech. Inc, Medicaments for Chemotherapeutic Treatment of Disease
US20040047804A1 (en) * 1998-10-29 2004-03-11 The General Hospital Corporation, A Massachusetts Corporation Enhanced radiation therapy
US20070208076A1 (en) * 1998-12-21 2007-09-06 Dees H C Intracorporeal medicaments for high energy phototherapeutic treatment of disease
US8470296B2 (en) 1998-12-21 2013-06-25 Provectus Pharmatech, Inc. Intracorporeal medicaments for high energy phototherapeutic treatment of disease
US6331286B1 (en) 1998-12-21 2001-12-18 Photogen, Inc. Methods for high energy phototherapeutics
US20020001567A1 (en) * 1998-12-21 2002-01-03 Photogen, Inc. Intracorporeal medicaments for high energy phototherapeutic treatment of disease
US20070078076A1 (en) * 1998-12-21 2007-04-05 Xantech Pharmaceuticals, Inc. Intracorporeal medicaments for high energy phototherapeutic treatment of disease
US7384623B1 (en) 1998-12-21 2008-06-10 Provectus Pharmatech, Inc. High energy phototherapeutic agents
US6547812B1 (en) * 2000-12-29 2003-04-15 Advanced Cardiovascular Systems, Inc. Radiation therapy using a radioactive implantable device and a radiosensitizer agent
US8354397B2 (en) 2001-07-27 2013-01-15 Curis, Inc. Mediators of hedgehog signaling pathways, compositions and uses related thereto
JP2005507860A (en) * 2001-07-27 2005-03-24 キュリス インコーポレイテッド Hedgehog signaling pathway mediator, compositions and use related thereto
AU2002327390B2 (en) * 2001-07-27 2008-06-26 Curis, Inc. Mediators of hedgehog signaling pathways, compositions and uses related thereto
WO2003011219A2 (en) * 2001-07-27 2003-02-13 Curis, Inc. Mediators of hedgehog signaling pathways, compositions and uses related thereto
WO2003011219A3 (en) * 2001-07-27 2004-09-23 Curis Inc Mediators of hedgehog signaling pathways, compositions and uses related thereto
JP4658473B2 (en) * 2001-07-27 2011-03-23 キュリス,インコーポレイテッド Hedgehog signaling pathway mediator, compositions and use related thereto
US8772275B2 (en) 2001-07-27 2014-07-08 Curis, Inc. Mediators of hedgehog signaling pathways, compositions and uses related thereto
US20050085519A1 (en) * 2001-07-27 2005-04-21 Rubin Lee L. Mediators of hedgehog signaling pathways, compositions and uses related thereto
US8278315B2 (en) 2002-09-05 2012-10-02 Chia-Gee Wang Radiotherapy method using x-rays
US20050080019A1 (en) * 2002-09-05 2005-04-14 Nanodynamics Inc. Radiotherapy method using x-rays
US7981928B2 (en) 2002-09-05 2011-07-19 Nanodynamics, Inc. Chemotherapy method using x-rays
EP2181704A2 (en) 2002-12-30 2010-05-05 Angiotech International Ag Drug delivery from rapid gelling polymer composition
US20040191843A1 (en) * 2003-02-03 2004-09-30 Palo Alto Institute Of Molecular Medicine Cell-killing molecules and methods of use thereof

Similar Documents

Publication Publication Date Title
Kaplan et al. Effect of halogenated pyrimidines on radiosensitivity of E. coli
Handschumacher et al. 5-Diazo-4-oxo-L-norvaline: Reactive asparagine analog with biological specificity
Kasid et al. Effect of antisense c-raf-1 on tumorigenicity and radiation sensitivity of a human squamous carcinoma
Zellweger et al. Enhanced radiation sensitivity in prostate cancer by inhibition of the cell survival protein clusterin
Sawicki et al. Coronavirus transcription: subgenomic mouse hepatitis virus replicative intermediates function in RNA synthesis.
De Lanerolle et al. Increased phosphorylation of myosin light chain kinase after an increase in cyclic AMP in intact smooth muscle
Kassis et al. Lethality of Auger electrons from the decay of bromine-77 in the DNA of mammalian cells
Shultz et al. Design synthesis of a sequence-specific DNA cleaving molecule.(Distamycin-EDTA) iron (II)
US6040181A (en) Regulation of bcl-2 gene expression
Schneider et al. Resveratrol inhibits intestinal tumorigenesis and modulates host-defense-related gene expression in an animal model of human familial adenomatous polyposis
Mew et al. Photoimmunotherapy: treatment of animal tumors with tumor-specific monoclonal antibody-hematoporphyrin conjugates.
O'toole et al. Cellular immunity to human urinary bladder carcinoma. II. Effect of surgery and preoperative irradiation
Wolff et al. Human lymphocytes exposed to low doses of ionizing radiations become refractory to high doses of radiation as well as to chemical mutagens that induce double-strand breaks in DNA
Wassermann et al. Effects of morpholinyl doxorubicins, doxorubicin, and actinomycin D on mammalian DNA topoisomerases I and II.
Kessel et al. The role of subcellular localization in initiation of apoptosis by photodynamic therapy
Alberts et al. Therapeutic synergism of hyperthermia-cis-platinum in a mouse tumor model
Rosenkranz et al. Silver sulfadiazine: effect on the growth and metabolism of bacteria
Ferrari et al. Coding sequence and growth regulation of the human vimentin gene.
Kawanishi et al. Photodynamic guanine modification by hematoporphyrin is specific for single-stranded DNA with singlet oxygen as a mediator.
Cheresh et al. Disialoganglioside GD3 on human melanoma serves as a relevant target antigen for monoclonal antibody-mediated tumor cytolysis
Jorritsma et al. Inhibition of repair of radiation-induced strand breaks by hyperthermia, and its relationship to cell survival after hyperthermia alone
Le Doan et al. Sequence-specific recognition, photocrosslinking and cleavage of the DNA double helix by an oligo-(α]-thymidylate covalently linked to an azidoproflavine derivative
JP4222628B2 (en) New rhodamine derivatives for in vitro purification of photodynamic therapy and leukemia cancer
US5292873A (en) Nucleic acids labeled with naphthoquinone probe
Bartelink et al. Therapeutic enhancement in mice by clinically relevant dose and fractionation schedules of cis-diamminedichloroplatinum (II) and irradiation

Legal Events

Date Code Title Description
AS Assignment

Owner name: ANTI-CANCER COUNCIL OF VICTORIA, AUSTRALIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE FIRST AND THIRD ASSIGNEES NAME ON AN INSTRUMENT PREVIOUSLY RECORDED AT REEL 6790, FRAME 0822;ASSIGNORS:MARTIN, ROGER F.;KELLY, DAVID P.;REEL/FRAME:008023/0877

Effective date: 19931119

Owner name: PETER MACCALLUM INSTITUTE, AUSTRALIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE FIRST AND THIRD ASSIGNEES NAME ON AN INSTRUMENT PREVIOUSLY RECORDED AT REEL 6790, FRAME 0822;ASSIGNORS:MARTIN, ROGER F.;KELLY, DAVID P.;REEL/FRAME:008023/0877

Effective date: 19931119

Owner name: UNIVERSITY OF MELBOURNE, AUSTRALIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE FIRST AND THIRD ASSIGNEES NAME ON AN INSTRUMENT PREVIOUSLY RECORDED AT REEL 6790, FRAME 0822;ASSIGNORS:MARTIN, ROGER F.;KELLY, DAVID P.;REEL/FRAME:008023/0877

Effective date: 19931119

STCF Information on status: patent grant

Free format text: PATENTED CASE

AS Assignment

Owner name: PETER MACCALLUM CANCER INSTITUTE, AUSTRALIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE NAME OF THE ASSIGNEE, FILED ON 08/07/96 RECORDED ON REEL 8023 FRAME 0877;ASSIGNORS:MARTIN, ROGER F.;KELLY, DAVID P.;REEL/FRAME:009845/0001

Effective date: 19931119

Owner name: UNIVERSITY OF MELBOURNE, AUSTRALIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE NAME OF THE ASSIGNEE, FILED ON 08/07/96 RECORDED ON REEL 8023 FRAME 0877;ASSIGNORS:MARTIN, ROGER F.;KELLY, DAVID P.;REEL/FRAME:009845/0001

Effective date: 19931119

Owner name: ANTI-CANCER COUNCIL OF VICTORIA, AUSTRALIA

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE NAME OF THE ASSIGNEE, FILED ON 08/07/96 RECORDED ON REEL 8023 FRAME 0877;ASSIGNORS:MARTIN, ROGER F.;KELLY, DAVID P.;REEL/FRAME:009845/0001

Effective date: 19931119

AS Assignment

Owner name: ANTI-CANCER COUNCIL OF VICTORIA, AUSTRALIA

Free format text: CHANGE OF NAME;ASSIGNOR:PETER MACCALLUM CANCER INSTITUTE;REEL/FRAME:010061/0683

Effective date: 19960701

Owner name: INNER AND EASTERN HEALTH CARE NETWORK, AUSTRALIA

Free format text: CHANGE OF NAME;ASSIGNOR:PETER MACCALLUM CANCER INSTITUTE;REEL/FRAME:010061/0683

Effective date: 19960701

Owner name: MELBOURNE, UNIVERSITY OF, AUSTRALIA

Free format text: CHANGE OF NAME;ASSIGNOR:PETER MACCALLUM CANCER INSTITUTE;REEL/FRAME:010061/0683

Effective date: 19960701

AS Assignment

Owner name: INNER AND EASTERN HEALTH CARE NETWORK, AUSTRALIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MELBOURNE, UNIVERSITY OF;ANTI-CANCER COUNCIL OF VICTORIA;REEL/FRAME:010263/0005

Effective date: 19980625

REMI Maintenance fee reminder mailed
FPAY Fee payment

Year of fee payment: 4

SULP Surcharge for late payment
AS Assignment

Owner name: PETER MACCALLUM CANCER INSTITUTE, AUSTRALIA

Free format text: ALLOCATION OF PROPERTY, RIGHTS AND LIABILITES;ASSIGNOR:INNER AND EASTERN HEALTH CARE NETWORK;REEL/FRAME:013392/0624

Effective date: 20000701

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12