US5476785A - Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum - Google Patents

Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum Download PDF

Info

Publication number
US5476785A
US5476785A US08/161,406 US16140693A US5476785A US 5476785 A US5476785 A US 5476785A US 16140693 A US16140693 A US 16140693A US 5476785 A US5476785 A US 5476785A
Authority
US
United States
Prior art keywords
pfhrp
amino acid
pfhrpii
seq
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/161,406
Inventor
Thomas E. Wellems
Russell J. Howard
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
Original Assignee
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Health and Human Services filed Critical US Department of Health and Human Services
Priority to US08/161,406 priority Critical patent/US5476785A/en
Application granted granted Critical
Publication of US5476785A publication Critical patent/US5476785A/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • C07K14/445Plasmodium
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention is related to malarial antigens and the genes encoding the same. More particularly, the present invention is related to a recombinant DNA clone (pDL4.1) containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum.
  • pDL4.1 recombinant DNA clone
  • malaria remains one of the most menacing conditions. Substantial progress has been made in identifying the pathogenic factors causing malaria and Plasmodium falciparum has been recognized as the major pathogen of human malarial disease.
  • the present invention relates to one such discovery.
  • An object of the present invention is to provide a new, soluble, histidine-rich protein, designated PfHRPII, from P. falciparum infected erythrocytes.
  • a further object of the present invention is to provide a recombinant DNA clone containing a genomic fragment capable of encoding PfHRP-II protein.
  • a still further object of the present invention is to provide a method of early detection or diagnosis of malarial infection employing the PfHRP-II antigen or an antibody having specificity against said PfHRP-II antigen.
  • FIG. 1 shows the genomic map and sequencing strategy for PfHRP-II. Coding regions are directed from left to right and are marked by heavy lines on the genomic maps. Comparison of the Alu I and Dra I restriction fragments from genomic DNA with those from ⁇ MAB1 revealed a 279 bp deletion occurring within the region of tandem repeats but the reading frame having been preserved. Restriction patterns of inserts from clones pDL4.1 and pDL11.3 were compared with corresponding restriction digests of genomic DNA by Southern blotting and showed no evidence of deletion or rearrangement. Nucleotide sequence analysis was performed on subclones in M13mp18 having targeted deletions generated by timed exonuclease III digestions.
  • the coding strand of the pDS11.1 insert was determined from fragments digested with Pvu II and subcloned into M13mp19.
  • Sp splice site at 3' end of intron.
  • A Alu I; D, Dra I; F, Fok I; H, Hinf I; N, Nde I; P, Pvu II; S, Ssp I;
  • FIG. 2 (A) [SEQ. ID. NO. :1] shows the genomic and deduced amino acid sequences of PfHRP-II displayed by automated plotting.
  • the register of the open reading frame of PfHRP-II is in phase with the gene for ⁇ -galactosidase in ⁇ MAB1 as expected, since this clone produces a fusion protein reacting with both McAb87 and anti- ⁇ -galactosidase.
  • the sequence shown for PfHRP-II does not include the nucleotides added by ligation of Eco RI linkers (GGAATTCC) to the genomic fragment during library construction.
  • FIG. 2(B) [SEQ. ID. NO. :3] shows the sequence of PfHRP-II mRNA obtained by primer extension analysis. The splice junction is indicated by the arrow. The hydrophobic leader sequence is underlined;
  • FIG. 3 shows the schematic representation of the gene for PfHRP-II.
  • the lengths of the coding regions, represented by boxes, are drawn to scale.
  • Intervening sequences (I) and repeat domains (R II ) are shown; and
  • FIG. 4 shows immunoprecipitation of PfHRP-II from infected culture supernatant with McAb87 (identified in FIG. 4 as M87) and rabbit antiserum (identified in FIG. 4 as R ⁇ P) to the synthetic oligopeptide AHH(AHHAAD) 2 [SEQ. ID. NO. :5].
  • the PfHRP-II is labelled with 3 H-alanine.sup.(A) and 3 H-histidine.sup.(H) but not with 3 H-isoleucine.sup.(I).
  • PfHRP-II as used herein means a protein whose amino acid sequence and encoding genetic map (nucleotide sequence) are shown in FIG. 2A.
  • a genomic expression library in the vector ⁇ Agt11 was constructed from Plasmodium falciparum DNA digested with mung bean nuclease. The description of this library and the methods of construction was the same as described by McCutchan et al. (Science 225:625-628). DNA from the 7G8 clone of the Brazil isolate IMT22 of P. falciparum (Burkot et al., Trans. R. Soc. Trop. Med. Hyg., 78:339-341) was used to construct the library.
  • McAb87 A monoclonal antibody, McAb87, was prepared which reacts specifically with the histidine-rich protein PfHRP-II. The methods of preparation and characterization of McAb87 was the same as described by Howard et al. (J. Cell. Biol., 1986).
  • a recombinant DNA clone ( ⁇ MAB1) was isolated from the genomic expression library by immunoscreening with McAb87. The methods used in the immunoscreening was the same as described by Young and Davis (Proc. Natl. Acad. Sci. USA, 80:1194-1198; Science, 222:778-782) and Symbol et al. (Science 225:593-599). Immunoblot analysis of the recombinant clone showed that ⁇ MAB1 produced an inducible fusion protein of approximate Mr 144,000 which reacted with both McAb87 and anti- ⁇ -galactosidase.
  • P. falciparum DNA was restricted with the enzyme Dra I and ligated into the Sma I site of the plasmid pUC18 using standard methods (Maniatis supra). Two clones, pDL4.1 and pDL11.3, were obtained having identical inserts oriented in opposite direction in the vector. Restriction analysis and comparative DNA transfer blotting were performed as described herein supra and showed no evidence of deletion or rearrangement.
  • RNA transfer blots were performed to confirm that the cloned DNA was transcribed.
  • RNA was isolated from saponin purified P. falciparum parasites suspended in 100 mM NaCl, 10 mM tris pH 8.0, 2 mM MgCl 2 , 10 mM vanadyl-ribonucleoside comlexes and 1% NaDodSO 4 . Sequential extraction was carried out with hot phenol and chloroform according to the method of Hyde et al. (Mol. Biochem. Parasitol., 4:283-290). RNA transfer and hybridization with nick-translated pDL4.1 were performed according to the protocols described by Mehdy et al. (Cell 32:763-771).
  • FIGS. 1, 2 and 3 show the map and sequence obtained for the region of the PfHRP-II gene extending from the 3' splice junction of the intron to and through the stop codon.
  • RNA transcript extending from the initiating codon to the intron splice junction was obtained by primer extension analysis according to the protocol of Belfort et al. (Cell 41:375-382). Oligonucleotide primers (synthesized as recommended by the manufacturer, Applied Biosystems DNA synthesizer, Foster City, Calif.) were used which were complementary to nucleotides 64-83 and 114-135 of the PfHRP-II genomic sequence (FIG. 2). Reactions were carried out using 0.5 pmol of 5' labelled synthetic oligonucleotide and 10 ⁇ g of P. falciparum RNA.
  • the oligopeptide was desalted using a Biogel P-2 column and coupled to Keyhole Limpet hemocyanin (KLH). Rabbits were immunized with biweekly injections of a 1:1 mixture of the synthetic oligopeptide, AHH(AHHAAD) 2 , [SEQ. ID. NO. :5] and KLH in Freund's complete adjuvant and antisera were obtained during the 7th week following the first injection. The antiserum thus obtained and McAb87 reacted with specificity with the protein (PfHRP-II) obtained from infected erythrocyte, thus demonstrating the identical nature of the synthetic and the naturally occurring PfHRP-II epitope (FIG. 4). The observed specificity of reaction between the antigen (PfHRP-II) and the antibodies indicates neutralizing efficacy of the antibodies against PfHRP-II.
  • KLH Keyhole Limpet hemocyanin
  • a deposit of the recombinant DNA clone (pDL4.1) prepared in accordance with the present invention has been made at the American Type Culture Collection, Rockville, Md. under accession number 40248. It is noted that the deposit made at the ATCC shall be viably maintained for the life of the patent if issued or for at least 30 years from the date of the deposit and made available without restriction to the public upon issuance of the patent, of course, consistent with the provisions of the law.
  • the PfHRP-II gene has an interrupted structure, with an intron separating a short (69 bp) exon encoding a hydrophobic leader from a 927 bp exon encoding numerous tandem repeats of very high histidine, alanine and aspartate content (FIGS. 2 and 3).
  • RNA transcript of approximately 2.1 kb.
  • the nucleotide sequence encodes a protein of approximate molecular weight 35,138, a value much lower than the Mr of 60,000-80,000 obtained by SDS-PAGE. Without being bound to any theory, possible explanations for this difference include post-translational events (e.g. dimerization) and anomalous migration during SDS-PAGE.
  • the deduced sequence contains about 34% histidine, 37% alanine and 10% aspartate.
  • PfHRP-II migrates as a multiplet of bands generally spanning 5,000-10,000 Mr which is indicative of post-translational processing.
  • the protein is exported from the parasite into the body fluid.
  • PfHRP-II passes through the host erythrocyte in concentrated "packets" and is released from the infected erythrocyte into the body fluid in vivo or into the culture supernatant in vitro.
  • the mature protein recovered from culture supernatant corresponds to the slowest moving band of the multiplet reactive with McAb87.
  • the mature protein is glycosylated and incorporates radiolabelled galactose.
  • the protein exhibits strong binding to the divalent cations Zn++ and Cu++ (Table 1). Binding of Zn++ to PfHRP-II can be reversed by imidazole, the side group of histidine. Other cations forming chelation complexes with histidine (such as Cd, Hg, Co, Ni) would likewise bind with PfHRP-II.
  • PfHRP-II binds strongly to heparin-Sepharose (Pharmacia) and cannot be eluted by a gradient of NaCl up to 2M NaCl, whereas other proteins which bind to heparin-Sepharose are eluted by ⁇ 1.5M NaCl, indicating the polycationic nature of multiple imidazole groups of PfHRP-II.
  • PfHRP-II has a histidine content that is similar to that of a Mr 30,000 fragment obtained from a histidine-rich glycoprotein (HRG) that has been isolated from normal human serum (Morgan, Biochim. Biophys. Acta. 533:319). HRG interacts with divalent metal ions, heparin, thrombospondin, and autorosette-forming thymocytes. Levels of HRG are decreased in immunosuppressed states indicating that HRG may be linked to immune function. The properties common to PfHRP-II and HRG indicate similarity of the functional role in vivo and that PfHRP-II may alter the physiologic role of HRG.
  • HRG histidine-rich glycoprotein
  • amino acid composition and the biochemical and biological properties of the PfHRP-II and its encoding gene clearly distinguish the recombinant clone from any other recombinant heretofore known.
  • the malarial antigen of the present invention prepared from the recombinant PfHRP-II clone or synthesized from the known amino acid sequence (FIG. 2) allows the preparation of a pharmaceutical composition comprising immunogenic amount of PfHRP-II to immunize against malaria in a host to whom said pharmaceutical composition is administered in a pharmaceutically acceptable vehicle or carrier such as physiological saline, nontoxic buffers, fillers or adjuvants and the like.
  • a pharmaceutically acceptable vehicle or carrier such as physiological saline, nontoxic buffers, fillers or adjuvants and the like.
  • kits comprising containers containing antigen and/or antibodies having specificity against PfHRP-II in suitable preservative medium such as physiological saline, nontoxic buffers and the like, and preferably lyophilized or cryopreserved, can be utilized by standard immunological assays, well known in the art, to detect or diagnose even low level or early malarial infection which otherwise cannot be detected by conventional methods such as thin and thick blood smears and the like.
  • the kit may also include such standard items as microtiter plates, micropipettes, agglutination reading means and the like which are normally found in such kits.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention relates to isolated clones of DNA from Plasmodium falciparum that encode a histidine-rich protein from that organism. The PfHRPII protein is expressed in P. falciparum-infected erythrocytes. The cloned gene segment includes an intron-exon boundary near the amino-terminus of the coding sequence. The PfHRPII protein has a Mr of 60-80 kDa as determined by SDS-PAGE. This is substantially higher than the molecular weight of about 35 kDa as estimated from the predicted amino acid sequence of PfHRPII. The PfHRPII amino acid sequence includes a hydrophobic leader sequence, consistent with secretion of PfHRPII observed in vivo and in vivo. The amino acid sequence of PfHRPII is also characterized by a number of tandem repeats having a high content of histidine, alanine and aspartic acid.

Description

This application is a divisional of application Ser. No. 07/791,392, filed on Nov. 14, 1991, issued as U.S. Pat. No. 5,296,382, the entire contents of which are hereby incorporated by reference, which in turn is a divisional of Ser. No. 07/518,299 filed May 3, 1990 and issued as U.S. Pat. No. 5,130,416, which in turn is a continuation of Ser. No. 07/279,245 filed Dec. 1, 1988, now abandoned, which is a divisional of Ser. No. 06/895,942 filed Aug. 13, 1986, now abandoned.
BACKGROUND OF THE INVENTION
1. Technical Field
The present invention is related to malarial antigens and the genes encoding the same. More particularly, the present invention is related to a recombinant DNA clone (pDL4.1) containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum.
2. State of the Art
Of various parasitic diseases, malaria remains one of the most menacing conditions. Substantial progress has been made in identifying the pathogenic factors causing malaria and Plasmodium falciparum has been recognized as the major pathogen of human malarial disease.
Recent advances in biochemical, immunological and genetic technologies have led to the recognition of certain antigens and to the characterization of certain genes or gene-fragments encoding the synthesis of malarial pathogenic antigens. The present invention relates to one such discovery.
SUMMARY OF INVENTION
An object of the present invention is to provide a new, soluble, histidine-rich protein, designated PfHRPII, from P. falciparum infected erythrocytes.
A further object of the present invention is to provide a recombinant DNA clone containing a genomic fragment capable of encoding PfHRP-II protein.
A still further object of the present invention is to provide a method of early detection or diagnosis of malarial infection employing the PfHRP-II antigen or an antibody having specificity against said PfHRP-II antigen.
It is another object of the present invention to provide a pharmaceutical composition comprising immunogenic amount of PfHRP-II to induce protective immunity in a host to which said pharmaceutical composition is administered in a pharmaceutically acceptable vehicle or carrier.
Other objects and advantages will become evident as the detailed description of the invention proceeds.
BRIEF DESCRIPTION OF DRAWINGS
These and other objects, features and many of the attendant advantages of the invention will be better understood upon a reading of the following detailed description when considered in connection with the accompanying drawings wherein:
FIG. 1 shows the genomic map and sequencing strategy for PfHRP-II. Coding regions are directed from left to right and are marked by heavy lines on the genomic maps. Comparison of the Alu I and Dra I restriction fragments from genomic DNA with those from λMAB1 revealed a 279 bp deletion occurring within the region of tandem repeats but the reading frame having been preserved. Restriction patterns of inserts from clones pDL4.1 and pDL11.3 were compared with corresponding restriction digests of genomic DNA by Southern blotting and showed no evidence of deletion or rearrangement. Nucleotide sequence analysis was performed on subclones in M13mp18 having targeted deletions generated by timed exonuclease III digestions. The coding strand of the pDS11.1 insert was determined from fragments digested with Pvu II and subcloned into M13mp19. Sp, splice site at 3' end of intron. A, Alu I; D, Dra I; F, Fok I; H, Hinf I; N, Nde I; P, Pvu II; S, Ssp I;
FIG. 2 (A) [SEQ. ID. NO. :1] shows the genomic and deduced amino acid sequences of PfHRP-II displayed by automated plotting. The register of the open reading frame of PfHRP-II is in phase with the gene for β-galactosidase in λMAB1 as expected, since this clone produces a fusion protein reacting with both McAb87 and anti-β-galactosidase. The sequence shown for PfHRP-II does not include the nucleotides added by ligation of Eco RI linkers (GGAATTCC) to the genomic fragment during library construction.
FIG. 2(B) [SEQ. ID. NO. :3] shows the sequence of PfHRP-II mRNA obtained by primer extension analysis. The splice junction is indicated by the arrow. The hydrophobic leader sequence is underlined;
FIG. 3 shows the schematic representation of the gene for PfHRP-II. The lengths of the coding regions, represented by boxes, are drawn to scale. Intervening sequences (I) and repeat domains (RII) are shown; and
FIG. 4 shows immunoprecipitation of PfHRP-II from infected culture supernatant with McAb87 (identified in FIG. 4 as M87) and rabbit antiserum (identified in FIG. 4 as RαP) to the synthetic oligopeptide AHH(AHHAAD)2 [SEQ. ID. NO. :5]. The PfHRP-II is labelled with 3 H-alanine.sup.(A) and 3 H-histidine.sup.(H) but not with 3 H-isoleucine.sup.(I).
DETAILED DESCRIPTION OF INVENTION
The above and various other objects and advantages of the present invention are achieved by a recombinant DNA clone (pDL4.1) containing a genomic fragment of the PfHRP-II gene from P. falciparum.
Unless defined otherwise, all technical or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned hereunder are incorporated herein by reference.
The term "PfHRP-II" as used herein means a protein whose amino acid sequence and encoding genetic map (nucleotide sequence) are shown in FIG. 2A.
A. Methods of Isolation and Characterization of the Clone
1. A genomic expression library in the vector λAgt11 was constructed from Plasmodium falciparum DNA digested with mung bean nuclease. The description of this library and the methods of construction was the same as described by McCutchan et al. (Science 225:625-628). DNA from the 7G8 clone of the Brazil isolate IMT22 of P. falciparum (Burkot et al., Trans. R. Soc. Trop. Med. Hyg., 78:339-341) was used to construct the library.
2. A monoclonal antibody, McAb87, was prepared which reacts specifically with the histidine-rich protein PfHRP-II. The methods of preparation and characterization of McAb87 was the same as described by Howard et al. (J. Cell. Biol., 1986).
3. A recombinant DNA clone (λMAB1) was isolated from the genomic expression library by immunoscreening with McAb87. The methods used in the immunoscreening was the same as described by Young and Davis (Proc. Natl. Acad. Sci. USA, 80:1194-1198; Science, 222:778-782) and Dame et al. (Science 225:593-599). Immunoblot analysis of the recombinant clone showed that λMAB1 produced an inducible fusion protein of approximate Mr 144,000 which reacted with both McAb87 and anti-β-galactosidase.
4. The insert was excised with Eco RI from λMAB1 DNA purified by gel electrophoresis and cloned into the sequencing vector M13mp18 using standard procedures (Maniatis et al., Molecular cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 1982; Yanish-Perron et al., Gene 33:103-119). Sequence analysis was performed on subclones in M13mp18 having targeted deletions generated by exonuclease III digestion. Sequences were obtained by the dideoxynucleotide method (Sanger et al., Proc. Natl. Acad. Sci. USA, 74:5463-5467) using commercially supplied reagents (Bethesda Research Laboratories, Bethesda, Md.). The sequence revealed a region of tandem repeats extending from nucleotides 148-669 predominantly encoding the oligopeptides AHH and AHHAAD [residues 5-9 of SEQ. ID. NO. :5], wherein A=Alanine; H=Histidine and D=Aspartic acid. Restriction analysis identified a 544 bp fragment which spanned the repeats. This fragment was purified and used to probe DNA transfer blots of genomic DNA (Southern, J. Mol. Biol. 98:503). Comparison of the restriction fragments from genomic DNA with those from λMAB1 revealed that a 279 bp deletion had occurred in the repeat region but had preserved the reading frame.
5. To obtain the complete region of tandem repeats in the PfHRP-II gene, P. falciparum DNA was restricted with the enzyme Dra I and ligated into the Sma I site of the plasmid pUC18 using standard methods (Maniatis supra). Two clones, pDL4.1 and pDL11.3, were obtained having identical inserts oriented in opposite direction in the vector. Restriction analysis and comparative DNA transfer blotting were performed as described herein supra and showed no evidence of deletion or rearrangement.
6. RNA transfer blots were performed to confirm that the cloned DNA was transcribed. RNA was isolated from saponin purified P. falciparum parasites suspended in 100 mM NaCl, 10 mM tris pH 8.0, 2 mM MgCl2, 10 mM vanadyl-ribonucleoside comlexes and 1% NaDodSO4. Sequential extraction was carried out with hot phenol and chloroform according to the method of Hyde et al. (Mol. Biochem. Parasitol., 4:283-290). RNA transfer and hybridization with nick-translated pDL4.1 were performed according to the protocols described by Mehdy et al. (Cell 32:763-771).
7. The complete nucleotide sequence of each insert from pDL4.1 and pDL11.3 was determined by the dideoxynucleotide method of Sanger et al, supra, and both were found to be identical. FIGS. 1, 2 and 3 show the map and sequence obtained for the region of the PfHRP-II gene extending from the 3' splice junction of the intron to and through the stop codon.
8. The nucleotide sequence of the RNA transcript extending from the initiating codon to the intron splice junction was obtained by primer extension analysis according to the protocol of Belfort et al. (Cell 41:375-382). Oligonucleotide primers (synthesized as recommended by the manufacturer, Applied Biosystems DNA synthesizer, Foster City, Calif.) were used which were complementary to nucleotides 64-83 and 114-135 of the PfHRP-II genomic sequence (FIG. 2). Reactions were carried out using 0.5 pmol of 5' labelled synthetic oligonucleotide and 10 μg of P. falciparum RNA.
9. To confirm the reading frame and deduced amino acid sequence of PfHRP-II as correct, antisera were generated against a synthetic oligopeptide containing repeats from the deduced sequence and used to immunoprecipitate biosynthetically labelled PfHRP-II. The synthetic oligopeptide AHH(AHHAAD)2 [SEQ. ID. NO. :5] was synthesized by the solid-phase method of Merrifield and Marglin (Ann. Rev. Biochem. 39:841-866) and cleaved from the solid support with liquid HF (Tam et al., J. Am. Chem. Soc. 105:6442-6455). The oligopeptide was desalted using a Biogel P-2 column and coupled to Keyhole Limpet hemocyanin (KLH). Rabbits were immunized with biweekly injections of a 1:1 mixture of the synthetic oligopeptide, AHH(AHHAAD)2, [SEQ. ID. NO. :5] and KLH in Freund's complete adjuvant and antisera were obtained during the 7th week following the first injection. The antiserum thus obtained and McAb87 reacted with specificity with the protein (PfHRP-II) obtained from infected erythrocyte, thus demonstrating the identical nature of the synthetic and the naturally occurring PfHRP-II epitope (FIG. 4). The observed specificity of reaction between the antigen (PfHRP-II) and the antibodies indicates neutralizing efficacy of the antibodies against PfHRP-II.
10. Studies of biosynthetically labelled cultures were performed on the 7G8 clone of P. falciparum maintained in vitro by the methods of Trager and Jensen (Science, 193:673-675). Labelled amino acids L-[2,5-3 H]-histidine, L-[2,3-3 H]-alanine, L-[4,5-3 H]-isoleucine and the labelled sugar D-[6-3 H]-galactose were obtained from Amersham Corporation (Arlington Heights, Ill.) and used for biosynthetic labelling according to the procedures of Leech et al. (J. Cell. Biol. 98:1256-1264). Cultures were harvested after 24 hours of labelling and immunoprecipitated by standard methods (Kessler, J. Immunol. 115:1617-1624) using McAb87 and the antisera described in step 9, supra.
A deposit of the recombinant DNA clone (pDL4.1) prepared in accordance with the present invention has been made at the American Type Culture Collection, Rockville, Md. under accession number 40248. It is noted that the deposit made at the ATCC shall be viably maintained for the life of the patent if issued or for at least 30 years from the date of the deposit and made available without restriction to the public upon issuance of the patent, of course, consistent with the provisions of the law.
B. Properties of the PfHRP-II Gene and Expressed Protein
1. The PfHRP-II gene has an interrupted structure, with an intron separating a short (69 bp) exon encoding a hydrophobic leader from a 927 bp exon encoding numerous tandem repeats of very high histidine, alanine and aspartate content (FIGS. 2 and 3).
2. The gene is transcribed to produce an RNA transcript of approximately 2.1 kb.
3. The nucleotide sequence encodes a protein of approximate molecular weight 35,138, a value much lower than the Mr of 60,000-80,000 obtained by SDS-PAGE. Without being bound to any theory, possible explanations for this difference include post-translational events (e.g. dimerization) and anomalous migration during SDS-PAGE.
4. The deduced sequence contains about 34% histidine, 37% alanine and 10% aspartate.
5. PfHRP-II migrates as a multiplet of bands generally spanning 5,000-10,000 Mr which is indicative of post-translational processing.
6. The protein is exported from the parasite into the body fluid. PfHRP-II passes through the host erythrocyte in concentrated "packets" and is released from the infected erythrocyte into the body fluid in vivo or into the culture supernatant in vitro. The mature protein recovered from culture supernatant corresponds to the slowest moving band of the multiplet reactive with McAb87.
7. The mature protein is glycosylated and incorporates radiolabelled galactose.
8. The protein exhibits strong binding to the divalent cations Zn++ and Cu++ (Table 1). Binding of Zn++ to PfHRP-II can be reversed by imidazole, the side group of histidine. Other cations forming chelation complexes with histidine (such as Cd, Hg, Co, Ni) would likewise bind with PfHRP-II.
9. PfHRP-II binds strongly to heparin-Sepharose (Pharmacia) and cannot be eluted by a gradient of NaCl up to 2M NaCl, whereas other proteins which bind to heparin-Sepharose are eluted by≦1.5M NaCl, indicating the polycationic nature of multiple imidazole groups of PfHRP-II.
10. Using McAb87 and/or rabbit antisera, experiments with serum from patients infected with malaria demonstrated the presence of circulating PfHRP-II in infected blood and the presence of antibodies to PfHRP-II in previously infected patients (Data not shown).
11. PfHRP-II has a histidine content that is similar to that of a Mr 30,000 fragment obtained from a histidine-rich glycoprotein (HRG) that has been isolated from normal human serum (Morgan, Biochim. Biophys. Acta. 533:319). HRG interacts with divalent metal ions, heparin, thrombospondin, and autorosette-forming thymocytes. Levels of HRG are decreased in immunosuppressed states indicating that HRG may be linked to immune function. The properties common to PfHRP-II and HRG indicate similarity of the functional role in vivo and that PfHRP-II may alter the physiologic role of HRG.
              TABLE 1                                                     
______________________________________                                    
                    Position of elution                                   
                    with linear gradient of                               
                    0-750 mM imidazole                                    
                Binding to                                                
                          Peak width                                      
                                    Peak max                              
Protein         column    (mM imidazole)                                  
______________________________________                                    
Elution of proteins from Zn.sup.2+ -chelated sepharose 6B by imidazole    
Bovine serum albumin                                                      
                -         --        --                                    
Human hemoglobin                                                          
                +         10-40      25                                   
Human transferrin                                                         
                +          25-100    75                                   
Human α2-macroglobulin                                              
                +          75-130   100                                   
Human serum histidine-rich                                                
                +         100-180   140                                   
glycoprotein                                                              
PfHRP-II        +         260-400   325                                   
Elution of PfHRP2 from Cu.sup.2+ -chelated sepharose 6B by imidazole      
PfHRP-II        +         ND        >450                                  
______________________________________                                    
In summary, the amino acid composition and the biochemical and biological properties of the PfHRP-II and its encoding gene clearly distinguish the recombinant clone from any other recombinant heretofore known.
Of course, the malarial antigen of the present invention prepared from the recombinant PfHRP-II clone or synthesized from the known amino acid sequence (FIG. 2) allows the preparation of a pharmaceutical composition comprising immunogenic amount of PfHRP-II to immunize against malaria in a host to whom said pharmaceutical composition is administered in a pharmaceutically acceptable vehicle or carrier such as physiological saline, nontoxic buffers, fillers or adjuvants and the like. Moreover, a kit comprising containers containing antigen and/or antibodies having specificity against PfHRP-II in suitable preservative medium such as physiological saline, nontoxic buffers and the like, and preferably lyophilized or cryopreserved, can be utilized by standard immunological assays, well known in the art, to detect or diagnose even low level or early malarial infection which otherwise cannot be detected by conventional methods such as thin and thick blood smears and the like. The kit may also include such standard items as microtiter plates, micropipettes, agglutination reading means and the like which are normally found in such kits. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 5                                              
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1150 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: double                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: DNA (genomic)                                         
(vi) ORIGINAL SOURCE:                                                     
 (A) ORGANISM: Plasmodium falciparum                                      
(ix) FEATURE:                                                             
(A) NAME/KEY: exon                                                        
(B) LOCATION: 42..968                                                     
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 42..968                                                     
(D) OTHER INFORMATION: /product="Plasmodium falciparum                    
Histidine Rich Protein"                                                   
(ix) FEATURE:                                                             
(A) NAME/KEY: intron                                                      
 (B) LOCATION: 1..41                                                      
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
TAAATTTTTTCATTTTTAAATGCTTTTTTATTTTTATATAGAATAATTCCGCA53                   
AsnAsnSerAla                                                              
 1                                                                        
TTTAATAATAACTTGTGTAGCAAAAATGCAAAAGGACTTAATTTAAAT101                       
PheAsnAsnAsnLeuCysSerLysAsnAlaLysGlyLeuAsnLeuAsn                          
510 1520                                                                  
AAGAGATTATTACACGAAACTCAAGCACATGTAGATGATGCCCATCAT149                       
LysArgLeuLeuHisGluThrGlnAlaHisValAspAspAlaHisHis                          
25 3035                                                                   
GCTCATCATGTAGCCGATGCCCATCATGCTCATCATGCTCACCATGCA197                       
AlaHisHisValAlaAspAlaHisHisAlaHisHisAlaHisHisAla                          
40 4550                                                                   
GCCGATGCCCATCACGCTCATCATGCAGCCGATGCTCATCATGCTCAC245                       
AlaAspAlaHisHisAlaHisHisAlaAlaAspAlaHisHisAlaHis                          
55 6065                                                                   
CATGCAGCCGATGCCCATCACGCTCATCATGCAGCCGATGCCCATCAT293                       
HisAlaAlaAspAlaHisHisAlaHisHisAlaAlaAspAlaHisHis                          
7075 80                                                                   
GCTCACCATGCAGCTGATGCTCATCACGCTCATCATGCAGCCGATGCC341                       
AlaHisHisAlaAlaAspAlaHisHisAlaHisHisAlaAlaAspAla                          
8590 95100                                                                
CATCATGCTCATCATGCAGCCGATGCCCATCATGCTCACCATGCAGCT389                       
HisHisAlaHisHisAlaAlaAspAlaHisHisAlaHisHisAlaAla                          
105 110115                                                                
GATGCTCATCACGCTCATCATGCAGCCGATGCCCATCATGCTCATCAT437                       
AspAlaHisHisAlaHisHisAlaAlaAspAlaHisHisAlaHisHis                          
120 125130                                                                
GCAGCCTATGCCCATCATGCTCATCATGCATCCGATGCTCATCATGCA485                       
AlaAlaTyrAlaHisHisAlaHisHisAlaSerAspAlaHisHisAla                          
135 140145                                                                
GCTGATGCTCACCATGCAGCTTATGCCCATCACGCTCATCATGCAGCT533                       
AlaAspAlaHisHisAlaAlaTyrAlaHisHisAlaHisHisAlaAla                          
150155 160                                                                
GATGCTCATCATGCAGCTGATGCTCACCATGCAGCTTATGCCCATCAC581                       
AspAlaHisHisAlaAlaAspAlaHisHisAlaAlaTyrAlaHisHis                          
165170 175180                                                             
GCTCATCATGCAGCTGATGCTCATCATGCAGCCGATGCTCACCATGCA629                       
AlaHisHisAlaAlaAspAlaHisHisAlaAlaAspAlaHisHisAla                          
185 190195                                                                
ACCGATGCTCATCACGCTCACCATGCAGCCGATGCTCACCATGCAACC677                       
ThrAspAlaHisHisAlaHisHisAlaAlaAspAlaHisHisAlaThr                          
200 205210                                                                
GATGCTCATCATGCAGCCGATGCTCACCATGCAGCCGATGCTCATCAT725                       
AspAlaHisHisAlaAlaAspAlaHisHisAlaAlaAspAlaHisHis                          
215 220225                                                                
GCAACCGATGCTCATCATGCAGCCGATGCTCACCATGCAACCGATGCT773                       
AlaThrAspAlaHisHisAlaAlaAspAlaHisHisAlaThrAspAla                          
230235 240                                                                
CATCATGCAGCCGATGCTCACCATGCAGCCGATGCTCACCATGCAACC821                       
HisHisAlaAlaAspAlaHisHisAlaAlaAspAlaHisHisAlaThr                          
245250 255260                                                             
GATTCTCATCACGCTCACCATGCAGCCGATGCTCATCATGCAGCCGCA869                       
AspSerHisHisAlaHisHisAlaAlaAspAlaHisHisAlaAlaAla                          
265 270275                                                                
CACCATGCAACTGATGCTCACCATGCAGCCGCACACCATGCAACCGAT917                       
HisHisAlaThrAspAlaHisHisAlaAlaAlaHisHisAlaThrAsp                          
280 285290                                                                
GCTCACCATGCAGCCGCACACCACGAAGCCGCCACACATTGCCTACGC965                       
AlaHisHisAlaAlaAlaHisHisGluAlaAlaThrHisCysLeuArg                          
295 300305                                                                
CATTAAATTTATTTAATAATAGATTAAAAATATTATAAAAATAAAAACATAAA1018                 
His                                                                       
CACAGAAATTACAAAAAAAATACATATGAATTTTTTTTTTGTAATCTTCCTTATAAATAT1078          
AGAATAATGAATC ATATAAAACATATCATTATTCATTTATTTACATTTAAAATTATTGTT1138         
TCAGTATCTTTA1150                                                          
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 309 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
AsnAsnSerAlaPheAsnAsnAsnLeuCysSerLysAsnAlaLysGly                          
151015                                                                    
LeuAsnLeuAsnL ysArgLeuLeuHisGluThrGlnAlaHisValAsp                         
202530                                                                    
AspAlaHisHisAlaHisHisValAlaAspAlaHisHisAlaHisHis                          
35 4045                                                                   
AlaHisHisAlaAlaAspAlaHisHisAlaHisHisAlaAlaAspAla                          
505560                                                                    
HisHisAlaHisHisAlaAlaAspAlaHisHisAlaHisHi sAlaAla                         
65707580                                                                  
AspAlaHisHisAlaHisHisAlaAlaAspAlaHisHisAlaHisHis                          
8590 95                                                                   
AlaAlaAspAlaHisHisAlaHisHisAlaAlaAspAlaHisHisAla                          
100105110                                                                 
HisHisAlaAlaAspAlaHisHisAlaHisHisAlaAlaAspAlaHis                          
 115120125                                                                
HisAlaHisHisAlaAlaTyrAlaHisHisAlaHisHisAlaSerAsp                          
130135140                                                                 
AlaHisHisAlaAlaAspAlaH isHisAlaAlaTyrAlaHisHisAla                         
145150155160                                                              
HisHisAlaAlaAspAlaHisHisAlaAlaAspAlaHisHisAlaAla                          
165 170175                                                                
TyrAlaHisHisAlaHisHisAlaAlaAspAlaHisHisAlaAlaAsp                          
180185190                                                                 
AlaHisHisAlaThrAspAlaHisHisAlaHi sHisAlaAlaAspAla                         
195200205                                                                 
HisHisAlaThrAspAlaHisHisAlaAlaAspAlaHisHisAlaAla                          
210215220                                                                 
Asp AlaHisHisAlaThrAspAlaHisHisAlaAlaAspAlaHisHis                         
225230235240                                                              
AlaThrAspAlaHisHisAlaAlaAspAlaHisHisAlaAlaAspAla                          
 245250255                                                                
HisHisAlaThrAspSerHisHisAlaHisHisAlaAlaAspAlaHis                          
260265270                                                                 
HisAlaAlaAlaH isHisAlaThrAspAlaHisHisAlaAlaAlaHis                         
275280285                                                                 
HisAlaThrAspAlaHisHisAlaAlaAlaHisHisGluAlaAlaThr                          
290295 300                                                                
HisCysLeuArgHis                                                           
305                                                                       
(2) INFORMATION FOR SEQ ID NO:3:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 135 base pairs                                                
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: mRNA                                                  
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: Plasmodium falciparum                                       
 (ix) FEATURE:                                                            
(A) NAME/KEY: exon                                                        
(B) LOCATION: 19..135                                                     
(D) OTHER INFORMATION: /product="Pf Histidine Rich                        
Protein .sub.-- .sub.-- .sub.-- Amino Terminus"                           
(ix) FEATURE:                                                             
(A) NAME/KEY: 5'UTR                                                       
(B) LOCATION: 1..18                                                       
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 19..135                                                     
 (D) OTHER INFORMATION: /product="Plasmodium falciparum                   
Histidine Rich Protein"                                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
UAAAAUUAUUUAAUAAAAAUGGUUUCCUUCUCAAAAAAUAAAGUAUUAUCC51                     
MetValSerPheSerLysAsnLysValLeuSe r                                        
1510                                                                      
GCUGCCGUUUUUGCCUCCGUACUUUUGUUAGAUAACAAUAAUUCCGCA99                        
AlaAlaValPheAlaSerValLeuLeuLeuAspAsnAsnAsnSe rAla                         
152025                                                                    
UUUAAUAAUAACUUGUGUAGCAAAAAUGCAAAAGGA135                                   
PheAsnAsnAsnLeuCysSerLysAsnAlaLysGly                                      
 3035                                                                     
(2) INFORMATION FOR SEQ ID NO:4:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 39 amino acids                                                
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
MetValSerPheSerLysAsnLysValLeuSerAlaAlaValP heAla                         
151015                                                                    
SerValLeuLeuLeuAspAsnAsnAsnSerAlaPheAsnAsnAsnLeu                          
202530                                                                    
Cys SerLysAsnAlaLysGly                                                    
35                                                                        
(2) INFORMATION FOR SEQ ID NO:5:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 15 amino acids                                                
(B) TYPE: amino acid                                                      
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: peptide                                               
(v) FRAGMENT TYPE: internal                                               
(ix) FEATURE:                                                             
(A) NAME/KEY: Peptide                                                     
(B) LOCATION: 1..15                                                       
(D) OTHER INFORMATION: /label=peptide                                     
/note="synthetic peptide used to produce                                  
anti-PfHRP- II antiserum"                                                 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
AlaHisHisAlaHisHisAlaAlaAspAlaHisHisAlaAlaAsp                             
15 1015                                                                   

Claims (11)

We claim:
1. An isolated DNA molecule having a nucleotide sequence that encodes the amino acid sequence of SEQ. I.D. NO. 2.
2. An isolated DNA molecule according to claim 1, having the nucleotide sequence of SEQ. I.D. NO. 1.
3. An isolated DNA molecule comprising nucleotide sequences encoding a polypeptide consisting of amino acid residues 1 through 23 of SEQ. I.D. NO. 4 and amino acid residues 1 through 309 of SEQ. I.D. NO. 2, wherein the amino acid residues of SEQ. I.D. NO. 4 are attached to the amino terminus of the amino acid residues of SEQ. I.D. NO. 2.
4. An isolated recombinant λ phage comprising a DNA molecule according to claim 3.
5. An isolated recombinant λ phage having all of the identifying characteristics of the λ phage clone deposited as ATCC 40248.
6. An isolated recombinant λ phage of claim 5, which is the λ phage deposited as ATCC 40248.
7. An Escherichia coli cell containing a plasmid which comprises a DNA molecule according to claim 1.
8. An Escherichia coli cell containing a plasmid which comprises a DNA molecule according to claim 2.
9. An Escherichia coli cell containing a vector comprising a DNA molecule according to claim 3.
10. An Escherichia coli cell containing a λ phage according to claim 4.
11. An Escherichia coli cell containing a λ phage according to claim 5.
US08/161,406 1986-08-13 1993-12-06 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum Expired - Lifetime US5476785A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/161,406 US5476785A (en) 1986-08-13 1993-12-06 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US89594286A 1986-08-13 1986-08-13
US27924588A 1988-12-01 1988-12-01
US07/518,299 US5130416A (en) 1986-08-13 1990-05-03 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from plasmodium falciparum
US07/791,392 US5296382A (en) 1986-08-13 1991-11-14 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum
US08/161,406 US5476785A (en) 1986-08-13 1993-12-06 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US07/791,392 Division US5296382A (en) 1986-08-13 1991-11-14 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum

Publications (1)

Publication Number Publication Date
US5476785A true US5476785A (en) 1995-12-19

Family

ID=26959545

Family Applications (3)

Application Number Title Priority Date Filing Date
US07/518,299 Expired - Lifetime US5130416A (en) 1986-08-13 1990-05-03 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from plasmodium falciparum
US07/791,392 Expired - Lifetime US5296382A (en) 1986-08-13 1991-11-14 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum
US08/161,406 Expired - Lifetime US5476785A (en) 1986-08-13 1993-12-06 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US07/518,299 Expired - Lifetime US5130416A (en) 1986-08-13 1990-05-03 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from plasmodium falciparum
US07/791,392 Expired - Lifetime US5296382A (en) 1986-08-13 1991-11-14 Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum

Country Status (1)

Country Link
US (3) US5130416A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100331753A1 (en) * 2008-02-02 2010-12-30 Alberto Gandini A Blood Purification Method and Apparatus for the Treatment of Malaria
US11085034B2 (en) * 2016-12-06 2021-08-10 Korea University Research And Business Foundation Enzyme complex comprising heme polymerase and heme ligase, and method for producing hemozoin using same

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5130416A (en) * 1986-08-13 1992-07-14 The United States Of America As Represented By The Department Of Health And Human Services Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from plasmodium falciparum
DE3737238A1 (en) * 1987-11-03 1989-05-18 Behringwerke Ag RECOMBINANT HISTIDINE-PROTEIN (37 KD ANTIGEN) OF PLASMODIUM FALCIPARUM, ITS PRODUCTION AND USE
DE4041836A1 (en) * 1990-12-24 1992-06-25 Behringwerke Ag PROTECTIVE PLASMODIUM FALCIPARUM HYBRID PROTEINS COMPRISING PARTIAL SEQUENCES OF MALARIA ANTIGENE HRPII AND SERP, THEIR PREPARATION AND USE
AU670108B2 (en) * 1992-09-11 1996-07-04 Becton Dickinson & Company Improved antibodies to plasmodium falciparum
US5532133A (en) * 1993-06-02 1996-07-02 New York University Plasmodium vivax blood stage antigens, PvESP-1, antibodies, and diagnostic assays
DE19507166C1 (en) * 1995-03-01 1996-04-18 Deutsches Krebsforsch Antibodies specific for fusion polypeptide(s) contg. a histidine component
KR101035111B1 (en) * 2004-06-30 2011-05-19 주식회사 엘지생명과학 Methods of immunological measurement of malaria plasmodium falciparum and measuring means used therein
EP1853914B1 (en) * 2005-01-25 2015-04-22 The Johns Hopkins University Plasmodium diagnostic assay

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4196265A (en) * 1977-06-15 1980-04-01 The Wistar Institute Method of producing antibodies
US4707445A (en) * 1984-07-31 1987-11-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Intact gene and method of excising and cloning same
US5001225A (en) * 1986-12-08 1991-03-19 Georgetown University Monoclonal antibodies to a pan-malarial antigen
US5130416A (en) * 1986-08-13 1992-07-14 The United States Of America As Represented By The Department Of Health And Human Services Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from plasmodium falciparum

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4196265A (en) * 1977-06-15 1980-04-01 The Wistar Institute Method of producing antibodies
US4707445A (en) * 1984-07-31 1987-11-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Intact gene and method of excising and cloning same
US5130416A (en) * 1986-08-13 1992-07-14 The United States Of America As Represented By The Department Of Health And Human Services Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from plasmodium falciparum
US5296382A (en) * 1986-08-13 1994-03-22 The United States Of America As Represented By The Department Of Health And Human Services Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum
US5001225A (en) * 1986-12-08 1991-03-19 Georgetown University Monoclonal antibodies to a pan-malarial antigen

Non-Patent Citations (16)

* Cited by examiner, † Cited by third party
Title
Aley, S. B., et al., J. Exp. Med. 160:1585 1590 (1984), Knob positive and knob negative Plasmodium falciparum differ in expression of a strain specific malarial ant the surface of infected erythrocytes . *
Aley, S. B., et al., J. Exp. Med. 160:1585-1590 (1984), "Knob-positive and knob-negative Plasmodium falciparum differ in expression of a strain-specific malarial ant the surface of infected erythrocytes".
Bellou, et al., Science 228:996 999 (1985), Immunogenicity of synthetic peptide form circumsporozoite protein . *
Bellou, et al., Science 228:996-999 (1985), "Immunogenicity of synthetic peptide form circumsporozoite protein".
Dame, J. B., et al., Science 225:593 599 (1984), Structure of the gene encoding the immunodominant surface antigen on the sporozoite of the human malaria parasite Plasmodium falciparum . *
Dame, J. B., et al., Science 225:593-599 (1984), "Structure of the gene encoding the immunodominant surface antigen on the sporozoite of the human malaria parasite Plasmodium falciparum".
Leech, J. R., et al., J. Cell Biology 98:1256 1264 (Apr., 1984), Plasmodium falciparum malaria: association of knobs on the surface of infected erythrocytes with a histidine rich protein and the erythrocyte skeleton . *
Leech, J. R., et al., J. Cell Biology 98:1256-1264 (Apr., 1984), "Plasmodium falciparum malaria: association of knobs on the surface of infected erythrocytes with a histidine-rich protein and the erythrocyte skeleton".
McCutchan, T. F. et al., Science 225:625 628 (1984), Mung bean nuclease cleaves Plasmodium genomic DNA at sites before and after genes . *
McCutchan, T. F. et al., Science 225:625-628 (1984), "Mung bean nuclease cleaves Plasmodium genomic DNA at sites before and after genes".
Proc.Natl.Acad.Sci. USA, vol. 83, pp. 6065 6069 Aug. 1986. *
Proc.Natl.Acad.Sci. USA, vol. 83, pp. 6065-6069 Aug. 1986.
Stahl, H. D., et al., Nucleic Acids Res. 13:7837 7846 (1985), Sequence of a cDNA encoding a small polymorphic histidine and alanine rich protein from Plasmodium falciparum . *
Stahl, H. D., et al., Nucleic Acids Res. 13:7837-7846 (1985), "Sequence of a cDNA encoding a small polymorphic histidine- and alanine-rich protein from Plasmodium falciparum".
Wellems, T. E., et al., Molecular strategies of parasitic invasion (1987, Alan R. Liss, Inc., pp. 47 58, Histidine rich proteins in Plasmodium falciparum :an update and perspective. *
Wellems, T. E., et al., Molecular strategies of parasitic invasion (1987, Alan R. Liss, Inc., pp. 47-58, "Histidine-rich proteins in Plasmodium falciparum:an update and perspective."

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100331753A1 (en) * 2008-02-02 2010-12-30 Alberto Gandini A Blood Purification Method and Apparatus for the Treatment of Malaria
US8556843B2 (en) 2008-02-02 2013-10-15 AccelDx Blood purification method and apparatus for the treatment of malaria
US11085034B2 (en) * 2016-12-06 2021-08-10 Korea University Research And Business Foundation Enzyme complex comprising heme polymerase and heme ligase, and method for producing hemozoin using same

Also Published As

Publication number Publication date
US5296382A (en) 1994-03-22
US5130416A (en) 1992-07-14

Similar Documents

Publication Publication Date Title
Ardeshir et al. A 75 kd merozoite surface protein of Plasmodium falciparum which is related to the 70 kd heat‐shock proteins.
Fidock et al. Plasmodium falciparum liver stage antigen-1 is well conserved and contains potent B and T cell determinants.
Rock et al. Comparative analysis of the Plasmodium falciparum histidine-rich proteins HRP-I, HRP-II and HRP-III in malaria parasites of diverse origin
Stahl et al. Interspersed blocks of repetitive and charged amino acids in a dominant immunogen of Plasmodium falciparum.
Mattei et al. Cross–reactive antigenic determinants present on different Plasmodium falciparum blood–stage antigens
US5231168A (en) Malaria antigen
US5589343A (en) Antibodies which bind to molecules containing at least one peptide sequence carrying one or several epitopes characteristic of a liver stage antigen produced by P. falciparum in hepatocytes
US5476785A (en) Recombinant DNA clone containing a genomic fragment of PfHRP-II gene from Plasmodium falciparum
IE840190L (en) Protective peptide antigen.
US5677438A (en) Coccidiosis vaccine
Bonnefoy et al. Plasmodium falciparum: characterization of gene R45 encoding a trophozoite antigen containing a central block of six amino acid repeats
CA1340213C (en) Antigens of plasmodium falciparum
US5633139A (en) Toxoplasma gondii P28 gene and methods for its use
JP2726264B2 (en) Assays and antibodies for N-myc proteins
US6100067A (en) Molecules containing at least one peptide sequence carrying one or several epitopes characteristic of a protein produced by P. falciparum at the sporozoite stage and in the hepatocytes
US5061788A (en) Recombinant malarial polypeptides
US5215917A (en) Nucleotide sequence encoding the Toxoplasma gondii P22 gene
US5543323A (en) Plasmodium merozoite rhoptries antigenic polypeptides
US5225534A (en) Recombinant malarial polypeptides
US5646247A (en) Merozoite antigens localized at the apical end of the parasite
US5126264A (en) The RESA and FIRA antigens of plasmodium falciparum
AU645482B2 (en) A malaria antigen
EP0388738B1 (en) Plasmodium merozoite rhoptries antigen and derivatives
Saul et al. A portion of the Pf155/RESA antigen of Plasmodium falciparum is accessible on the surface of infected erythrocytes
EP1226166A1 (en) Immuno-interactive fragments of the alpha c subunit of inhibin

Legal Events

Date Code Title Description
STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12