US5437978A - Detection for Staphylococcus spp. - Google Patents

Detection for Staphylococcus spp. Download PDF

Info

Publication number
US5437978A
US5437978A US07/924,458 US92445892A US5437978A US 5437978 A US5437978 A US 5437978A US 92445892 A US92445892 A US 92445892A US 5437978 A US5437978 A US 5437978A
Authority
US
United States
Prior art keywords
sequence
labeled
solid support
labeled sequence
site
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US07/924,458
Inventor
Kimiko Ubukata
Satoru Nakagami
Akio Yamane
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wakunaga Pharmaceutical Co Ltd
Original Assignee
Wakunaga Pharmaceutical Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wakunaga Pharmaceutical Co Ltd filed Critical Wakunaga Pharmaceutical Co Ltd
Assigned to WAKUNAGA SEIYAKU KABUSHIKI KAISHA reassignment WAKUNAGA SEIYAKU KABUSHIKI KAISHA ASSIGNMENT OF ASSIGNORS INTEREST. Assignors: NAKAGAMI, SATORU, UBUKATA, KIMIKO, YAMANE, AKIO
Application granted granted Critical
Publication of US5437978A publication Critical patent/US5437978A/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention relates to a primer for detecting methicillin-resistant and/or toxic shock syndrome toxin 1 producing Staphylococcus spp., a method for detecting these bacteria using the primer, and a kit for detecting them.
  • Staphylococcus spp. including Staphylococcus aureus as a typical bacterium, which have strong pathogenicity, are well known as causative bacteria to various infections. Since these Staphylococcus spp. are generally sensitive to ⁇ -lactam series drugs, the infections can be prevented and treated with these drugs. However, a methicillin-resistant Staphylococcus sp. (abbreviated as MRS hereinafter) is so extensively resistant to the ⁇ -lactam series drugs that it is difficult to treat infections caused by these methicillin-resistant bacteria. This provides serious problems that the methicillin-resistant bacteria cause opportunistic infections, postoperative infections and the like in the clinical practice.
  • MRS methicillin-resistant Staphylococcus sp.
  • ⁇ -lactam series drugs Since the ⁇ -lactam series drugs have high safety and wide antibacterial spectra, some of the ⁇ -lactam series drugs are widely used as primary choices of drugs against various infections. The mechanism of these drugs is that binding of the ⁇ -lactam series drugs to cell wall-synthesizing enzymes (penicillin-binding proteins: PBPs) which are essential for growth of bacteria results in inhibition of the growth of the bacteria.
  • PBP-2' penicillin-binding proteins
  • PBP-2' additional low-affinity penicillin-binding protein
  • Lett., 30, 119-122(1981) which is active at ⁇ -lactam concentrations that saturate normal complement of PBPs, so that these bacteria are resistant to ⁇ -lactam series drugs.
  • TPS toxic shock syndrome toxin-1
  • TSST-1 gene was isolated [Schliever et al., J. Biol. Chem., 261: 15783-15786 (1986)]. Although the detection of Staphylococcus aureus producing TSST-1 is tried by detecting its gene, this detection method is not practical because of the same reasons as those of the above-mentioned method for detecting MRS.
  • FIG. 1 is a diagram of the procedure for detecting MRSA in Example 7.
  • FIG. 2 is a diagram of the procedure for detecting MRSA-producing and TSST-1-producing bacteria at the same time in Example 9.
  • the mecA gene a structural gene for PBP-2', was isolated from a methicillin-resistant Staphylococcus aureus [Matsuhashi et al., FEBS Letters 221:167-171 (1987)], and similar genes were isolated from other Staphylococcus spp. which were resistant to ⁇ -lactam series drugs [Antimicrob Agent Chemother., 32:1494-1499 (1988)]. This suggests that the methicillin-resistant staphylococcus spp. can be found by detecting the mecA gene.
  • mecA gene seems to be amplified, if primers are designed so as to think much of possibly important regions of the mecA gene sequence. Since PBP-2' coded by the mecA gene, however, has homology to proteins of other pathogenic bacteria and enterobacteria, it is difficult to detect their mecA genes specifically.
  • mecA gene comprised a highly homologous region to a part of penicillinase gene and that to a part of the gene for penicillin binding proteins of Escherichia coli [Matsuhashi M. et al. FEBS LETTERS, 221, 167-171 (1987)].
  • an effective primer set which represent the following base sequences (1) and (2) or their mutation sequences, and which do not react with DNAs of other bacteria (e.g., Pseudomonas aeruginosa, Bacillus subtillis and Escherichia coli), yeasts (e.g., Candida albicans, Saccharomyces cerevisiae) and human, but specifically react with DNA of MRS.
  • bacteria e.g., Pseudomonas aeruginosa, Bacillus subtillis and Escherichia coli
  • yeasts e.g., Candida albicans, Saccharomyces cerevisiae
  • human but specifically react with DNA of MRS.
  • MRS or TPS can be detected by the polymerase chain reaction using these primers, their labeled sequences or solid support binding-site labeled sequences easily, rapidly and with a high sensitivity.
  • the present invention relates to a primer for detecting MRS which comprises the nucleotide fragment of the abovementioned base sequence (1) or base sequence (2) or its mutation sequence, its labeled sequence or its solid support binding site labeled sequence abbreviated as primer (1) and primer (2), respectively, hereinafter]; a primer for detecting TPS which comprises the nucleotide fragments of the above-mentioned base sequence (3) or base sequence (4) or its mutation sequence, its labeled sequence or its solid support binding site labeled sequence [abbreviated as primer (3) and primer (4), respectively, hereinafter]; and a method and kit for detecting MRS and/or TPS using these primers.
  • the primers (1) to (4) of the present invention can be prepared by synthesizing chemically, for example, using a DNA synthesizer, or by excising, for example, the gene of MRS or TPS with some enzymes.
  • MRS used here include Staphylococcus aureus (ATCC No. 33591) and the like.
  • TPS include the bacteria described by Schlievert et al. [J. Biol. Chem. 261:15783-15786 (1986)] and the like.
  • any functional primers for detecting the abovementioned Staphylococcus spp. may be used as primers according to the present invention.
  • these primers include ones in which part of nucleotides are deleted from the nucleotide sequences of the original primers having the above-mentioned nucleotide sequences (1) to (4), ones which are replaced or added by other nucleotides, and more particularly nucleotide sequences which are the corresponding regions of the genes of the mutated strains of the above-mentioned Staphylococcus spp. and the like.
  • the mutation sequences of primers according to the present invention are not particularly limited so long as the gene amplification is not adversely affected, and it is preferred that the variation of the constituent nucleotides is within 20%.
  • the labeled sequences of the primers according to the present invention are ones in which the above-mentioned primers are combined with detectable labels.
  • non-radioactive or radioactive substances are available as these labels, non-radioactive substances being preferably used.
  • the non-radioactive substances include fluorescent substances [e.g., fluorescein and its derivatives (fluorescein isothiocyanate and the like), rhodamine and its derivatives (tetramethylrhodamine isothiocyanate, texasred and the like)], chemiluminescent substances (e.g., acridine and the like), delayed fluorescence-emitting substances (DTTA, by Pharmacia) which can be measured directly.
  • fluorescent substances e.g., fluorescein and its derivatives (fluorescein isothiocyanate and the like), rhodamine and its derivatives (tetramethylrhodamine isothiocyanate, texasred and the like
  • the solid support binding site of the primers according to the present invention include the primers to which the sites capable of binding to solid support are introduced.
  • the above-mentioned nonradioactive labels also can be used as sites capable of binding to the solid support.
  • the preferred examples include biotin, fluorescent substances such as fluorescein; haptens such as a compound having 2'4-dinitrophenol or digoxygenin. These sites can be introduced into primers according to the present invention in advance singly or, if necessary, in various combination with one another. In order to selectively bind the site to the solid support, the substance for the site should be different from that for the label.
  • the solid support should be inactive against solvents and any reagents to be used, can be separated from the reagents by certain methods, and is able to selectively bind the above-mentioned sites.
  • solid support in which streptavidin, antibodies and the like capable of trapping the above-mentioned sites are introduced to solid support such as a microtiter plate, a polystyrene ball, an agarose bead and, a polyacryl bead.
  • the microtiter plate which is excellent in handling and mechanical access is preferably used.
  • a solid support having streptavidin can be used in order to trap products caused by the polymerase chain reaction with a primer in which biotin is introduced.
  • solid support having the corresponding antibodies can be used.
  • the method for detecting MRS and/or TPS comprises (a) adding detection primers comprising a combination of primer (1) with primer (2) and/or a combination of primer (3) with primer (4) to a sample containing Staphylococcus spp. so as to cause a polymerase chain reaction: then (b) detecting products caused by the polymerase chain reaction with the detection primers and methicillin-resistant genes and/or toxin-producing genes of Staphylococcus spp. in the sample.
  • the detection method according to the present invention utilizes the polymerase chain reaction with a set or sets of primers, i.e., a combination of primer (1) with primer (2) and/or a combination of primer (3) with primer (4).
  • set of primers include the following (A) to (D):
  • At least one primer of a set of primers being a labeled sequence
  • the combination of (D) is particularly preferred in view of easiness and rapidness in the detection procedure.
  • the label of primer (1) or primer (2) and that of primer (3) or primer (4) should not be the same, provided that the solid support binding site of primer (1) or primer (2) and that of primer (3) or primer (4) is the same.
  • the label derived from MRS and the label derived from TPS should be distinguished. Therefore, when the methicillin-resistant gene and toxin-producing gene are detected at the same time using the combination of (D), the following embodiments, (i) to (iii), of the primers are preferred.
  • the solid support-binding site of primer (1) or primer (2) is identical to that of primer (3) or primer (4), and the label of primer (1) or primer (2) is different from that of primer (3) or primer (4).
  • the solid support binding site of primer (1) or primer (2) is different from that of primer (3) or primer (4), and the label of primer (1) or primer (2) is identical to that of primer (3) or primer (4).
  • the solid support binding site of primer (1) or primer (2) is different from that of primer (3) or primer (4), and the label of primer (1) or primer (2) is different from that of primer (3) or primer (4).
  • the present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enabled the patients with infections caused by these bacteria to carry out suitable treatment at an earlier stage.
  • samples to be detected for the presence of the desired MRS and/or TPS include cultured medium, bacterial colony, and sputum, urine, pus, blood or various tissue slices obtained from patients.
  • these samples may be subjected to treatments of lysing cells such as treatments with enzymes, heat surfactants, ultrasonication or combination thereof.
  • the treatment of lysing cells is performed in order to obtain a sufficient amount of DNA derived from Staphylococcus spp. Its practical procedure may be referred to general literatures, for example, "PCR PROTOCOLS" [Academic Press Inc., p. 14 and p. 352 (1989)].
  • a polymerase chain reaction according to the elongation reaction of primers may be carried out by adding the primers of the present invention to the samples.
  • the elongation reaction of a primer can be carried out by introducing four kinds of nucleoside triphosphates (deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and thymidine triphosphate: a mixture thereof may be referred to as dNTP) as substrates to the primer.
  • nucleoside triphosphates deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and thymidine triphosphate: a mixture thereof may be referred to as dNTP
  • E. coli's DNA polymerase I Klenow fragments excised by E. coli's DNA polymerase I, T4 DNA polymerase and the like are used. If heat-resistant enzymes such as Taq polymerase which cause the elongation reaction at a higher temperature are particularly used, specificity of primers' recognition of a target sequence can be enhanced (referred to U.S. Pat. No. 4889818).
  • the desired genes of Staphylococcus spp. can be effectively amplified by repeating the elongation reaction using each of two kinds of the primers of the present invention [a combination of primer (1) with primer (2) or a combination of primer (3) with primer (4)].
  • Detection of a combined substance of the desired gene produced by a primer elongation reaction with a detection primer leads to detection of MRS and/or TPS.
  • the preferred detection method depends on kinds or forms of the above-mentioned primer elongation product, i.e., the synthesized nucleotide chain.
  • the product caused by the polymerase chain reaction forms a double stranded DNA, therefore, the synthesized nucleotide chain can be detected by electrophoresis following ethidivm bromide staining [Saiki, R. K. et al., Science, 230:1350-1354 (1985)], dot hybridization with labeled probes [Saiki, R. K. et al., Nature, 324:163-166 (1986)] or the like.
  • the nucleotides can-also be detected by the reverse dot hybridization [Saiki, R. K. et al., Proc. Natl. Acad. Sci. USA, 86, 6230-6234 (1989)] in which the labeled and synthesized nucleotide chain is hybridized with the probe immobilized to the solid support, a column method with solid adsorbent (refer to WO89/06285) or the like.
  • Nucleic acids can be very easily detected by the method described in WO89/06285. That is, there is a method in which products caused by the polymerase chain reaction are contacted with solid supports using the above-mentioned combination of primers (D), and then impurities are washed with an appropriate solvent to remove. Also by this method the desired products with labels which are caused by the polymerase chain reaction are immobilized to the solid support to detect specifically, since the synthesized nucleotide which is elongated by the primer having the solid support binding site forms a double stranded DNA with another synthesized nucleotide which is elongated by the primer having the label.
  • the detection of labels may be performed by general methods depending on the labels to be used. For example, in cases where radioisotopes are used as labels, the radioisotopes themselves may be measured. In cases where biotin or a hapten is used as a label, biotin or a hapten can be detected using an avidin (or streptavidin)-enzyme conjugate or an antibody-enzyme conjugate, respectively. The enzyme of the resultant complex (for example, between incorporated biotin and streptavidin-enzyme conjugate) can thus serve as signal reporting moiety. Furthermore, in cases where fluorescent substances are used as labels, emitted fluorescence itself may be measured using a fluorometer.
  • the detection procedure of the labels should be performed independently.
  • the kit for detecting MRS and/or TPS comprises (A) reagents for lysing cells; (B) reagents for causing the polymerase chain reaction which contain the primers consisting of a combination of primer (1) with primer (2) and/or a combination of primer (3) with primer (4); and (C) a solid support for immobilizing products caused by the polymerase chain reaction with the primers for methicillin-resistant genes and/or toxin-producing genes of Staphylococcus spp. Further, the kit of the present invention comprises, if necessary, (D) reagents for indirectly detecting labels, wash liquids and oils. These components will be illustrated below.
  • These reagents contain enzymes for lysing cell walls of Staphylococcus spp., enzymes for hydrolyzing proteins of the bacteria. Any enzymes for lysing cell walls are available which can hydrolyze peptidoglycans of Staphylococcus spp., and so, for example, lysostaphin, acromopeptidase and the like can be used. On the other hand, any enzymes for hydrolyzing proteins are available which can cleave peptide bonds of proteins, and so, for example, trypsin, pepsin or proteinase K and the like can be used. If necessary, surfactants such as Triton X 100, Nonidet P-40, Tween 20 and SDS are optionally added to these enzymes.
  • Triton X 100, Nonidet P-40, Tween 20 and SDS are optionally added to these enzymes.
  • reagents contain the above-mentioned primers for the specified polymerase chain reaction, four different nucleotide triphosphates for synthesizing (amplifying) nucleotide acid chains and an enzyme for nucleic elongation.
  • Optional DNA polymerases can be used as an enzyme for nucleotide acid elongation, and so the use of a heat-stable DNA polymerase can preferably cause a rapid and specific polymerase chain reaction. Examples of these polymerases include Taq DNA polymerase, Tth DNA polymerase and Vent DNA polymerase and the like.
  • these solid supports can specifically bind to the solid support binding sites which are introduced to the primers of the present invention.
  • Microtiter well which is treated so as to bind specifically to the site, is preferably used.
  • wash liquids are not particularly limited if these remove unreacted primers, reagents and the like, as well as do not affect the detection reaction.
  • buffers can be used.
  • oils an oil which prevents evaporation of water in the reaction solution and can separate water, and has smaller specific gravity than water.
  • examples of the oils include silicone oil, mineral oil and the like.
  • reagents for detecting labels are those containing reagents indirectly detecting these labels.
  • these reagents are (a) those of enzyme conjugated-antibodies specific to the hapten, (b) the substrates of the enzymes and the like.
  • Examples of these reagents include: 2-nitrophenyl- ⁇ -D-galactopyranoside, 4-methylumbelliferyl- ⁇ -D-galactopyranoside and the like as substrates in case where the enzyme is ⁇ -D-galactosidase; 3-(4-hydroxyphenyl) propionic acid, 3,3',5,5'-tetramethylbenzidine, 1,2-phenylenediamine and the like as substrates in case where the enzyme is peroxydase; 4-methylumbelliferyl phosphate, NADP, 4-nitrophenyl phosphate and the like as substrates in case where the enzyme is alkaline phosphatase; glucose, NAD and the like as substrates in case where the enzyme is glucose-6-phosphate dehydrogenase; ethanol, NAD and the like as substrates in case where the enzyme is alcohol dehydrogenase.
  • the primers to which labels or solid support binding sites were introduced, or primers to which labels or solid support binding sites were not introduced were chemically synthesized by the following method.
  • these primers were chemically synthesized by the phosphoamidite method of Caruthers et al. [Tetrahedron Lett. 22:1859 (1981)] using an Applied Biosystems Model 381A DNA synthesizer in an amount scale of 0.2 ⁇ mole.
  • an oligonucleotide (5'GAAATGACTGAACGTCCGAT) whose 5'lends had an amino group introduced was synthesized using an Applied Biosystems Model 381A DNA synthesizer.
  • Protective mononucleotide phosphoamidites were subsequently added to 0.2 ⁇ mole of a solid support and Aminolink II (tradename, Applied Byosystems) was added in the final step. Then these substances were liberated from the solid support by treatment with concentrated ammonia and protective groups were removed.
  • oligonucleotide (5'GCGATCAATGTTACCGTAGT) whose 5'-ends had a dinitrophenyl group (DNP) introduced was derived from that whose 5'-ends had an amino group introduced, and used as a starting material as in case of the biotinylated oligonucleotide.
  • DNP dinitrophenyl group
  • a 1M NaHCO 3 solution (20 ⁇ l) was added to a solution of an aminated oligonucleotide solution (2 O.D.: 180 ⁇ l), to which an ethanol solution of dinitrofluorobenzene (5% (v/v), 100 ul) was added, and then the solution was heated for 2 hours at 37° C. After completion of the reaction, the solution was applied to gel filtration to remove reagents and purified (yield: 1.2 O.D.).
  • oligonucleotide (5'CACTTTGATATGTGGATCCG) whose 5'-ends had a fluorescein group introduced was derived from that whose 5'-ends had an amino group introduced, and used as a starting material as in case of the biotinated oligonucleotide.
  • Anti-DNP antibody and Anti-FITC antibody were prepared by standard method. In brief, each hapten was conjugated with keyhole limpet's hemocyanin (KLH), and then rabbits were immunized with these conjugates. These antisera obtained from these rabbits were purified by salting out with ammonium sulfate and by affinity chromatography. The purified antibodies were digested to Fab's, which were labeled with N-( ⁇ -maleimide caproic acid) succinimide (EMCS) as a crosslinking agent by alkaline phosphatase.
  • KLH keyhole limpet's hemocyanin
  • EMCS N-( ⁇ -maleimide caproic acid) succinimide
  • Phosphate buffered saline (PBS) supplemented with glutaraldehyde up to 2% was added to aminated wells of a microtiter plate (Sepaplate 8F Amino type, Sumitomo Bakelite Co., Ltd.) (100 ⁇ l/well), which was reacted at 37° C. for 4 hours. After completion of the reaction, the wells were washed with water 2 times, to which streptavidin solution in carbonate buffer (10 ug/ml, 10 mM NaHCO 3 -Na 2 CO 3 , pH 9.5) was added (100 ul/well), and then the plate was reacted at 37° C. for 4 hours.
  • PBS Phosphate buffered saline
  • the DNA sample (100 ng, but 1 ug for human DNA) was added to 100 ul of a reaction mixture containing 2 kinds of primers (biotin-GAAATGACTGAACGTCCGAT and DNP-GCGATCAATGTTACCGTAGT, 100 ng each), dATP, dGTP, dCTP and TTP (200 ⁇ M each), 100 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl 2 , and 0.01% gelatin. Heated at 94° C. for 5 min., the mixture was kept at 50° C. for 5 min.
  • TSST-1 gene-specific primers biotin-AGTATGGGCCAAAGTTCGAT and DNP-CACTTTGATATGTGGATCCG
  • DNAs obtained from P. aeruqinosa, B. subtilis, E. coli, TSST-1-producing S. aureus and human were used as samples.
  • TSST-1-producing S. aureus a band corresponding to the expected amplified nucleotide chain of 159 base pairs was able to be identified.
  • bands corresponding to the expected amplified nucleotide chains were not able to be identified.
  • the mecA gene-specific primers (biotin-GAAATGACTGAACGTCCGAT) and DNP-GCGATCAATGTTACCGTAGT) and TSST-1-gene-specific primers (biotin-AGTATGGGCCAAAGTTCGAT and DNP-CACTTTGATATGTGGATCCG) were used at each amount of 100 ng, and these primers were subjected to the polymerase chain reaction as under the conditions in Example 4.
  • DNA samples were prepared from P. aeruqinosa, B. subtilis, E. coli, S. aureus, methicillin-resistant S. aureus, TSST-1-producing S. aureus and human.
  • the four strains whose characters had been elucidated by the culturing method were tested for methicillin-resistance using the kit of the present invention.
  • Each clinically isolated strain was prepared so as to reach a density of 10 5 cells per reaction, and subjected to the detection procedure according to the method shown in FIG. 1. The results are shown in Table 1.
  • Example 7 The same four strains which had been clinically isolated as in Example 7 were tested for TSST-1-production using the kit of the present invention. 10 5 cells of each strain were subjected to the detection procedure according to the method shown in FIG. 1 as in Example 7. The results are shown in Table 2.
  • Example 7 The same four strains which had been clinically isolated as in Example 7 were tested for methicillin-resistance or TSST-1-production using the kit of the present invention. 10 5 cells of each strain were subjected to the detection procedure according to the method shown in FIG. 1. The results are shown in Table 3.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Polysaccharides And Polysaccharide Derivatives (AREA)

Abstract

The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4):
5'GAAATGACTGAACGTCCGAT                                     (1)
5'GCGATCAATGTTACCGTAGT                                     (2)
5'AGTATGGGCCAAAGTTCGAT                                     (3)
5'CACTTTGATATGTGGATCCG                                     (4)
a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.

Description

BACKGROUND OF THE INVENTION
i) Field of the Invention
The present invention relates to a primer for detecting methicillin-resistant and/or toxic shock syndrome toxin 1 producing Staphylococcus spp., a method for detecting these bacteria using the primer, and a kit for detecting them.
ii) Description of the Background Art
Staphylococcus spp. including Staphylococcus aureus as a typical bacterium, which have strong pathogenicity, are well known as causative bacteria to various infections. Since these Staphylococcus spp. are generally sensitive to β-lactam series drugs, the infections can be prevented and treated with these drugs. However, a methicillin-resistant Staphylococcus sp. (abbreviated as MRS hereinafter) is so extensively resistant to the β-lactam series drugs that it is difficult to treat infections caused by these methicillin-resistant bacteria. This provides serious problems that the methicillin-resistant bacteria cause opportunistic infections, postoperative infections and the like in the clinical practice.
Since the β-lactam series drugs have high safety and wide antibacterial spectra, some of the β-lactam series drugs are widely used as primary choices of drugs against various infections. The mechanism of these drugs is that binding of the β-lactam series drugs to cell wall-synthesizing enzymes (penicillin-binding proteins: PBPs) which are essential for growth of bacteria results in inhibition of the growth of the bacteria. However, the methicillin-resistant bacteria have changed to produce an additional low-affinity penicillin-binding protein, PBP-2'[Hayes, at al., FEMS Microbial. Lett., 30, 119-122(1981)], which is active at β-lactam concentrations that saturate normal complement of PBPs, so that these bacteria are resistant to β-lactam series drugs.
It is very important to determine whether infectious bacteria are resistant to methicillin in order to set up a therapeutic procedure against the bacteria, and recently susceptibility tests by culturing bacteria have been widely used as methods for detecting MRS. The culturing method, however, requires 2 days to determine the susceptibility. Since some drugs are needed to be administered to patients prior to the determination, incorrect therapy may lead patients to die because effective drugs for MRS are limited. Thus, methods for rapidly detecting MRS should be developed without delay. Moreover, Expression of methicillin resistance in susceptibility tests is subjected to environmental conditions such as temperature [Canawati, H. N. et al. Antimicrob. Agents Chemother. 21, 173-175(1982)], PH [Sabth, L. D. et al. Antimicrob. Agents Chemother, 2, 350-355)] and salt concentration [Chambers, H. F. et al. Antimicrob. Agents Chemother. 31, 1982-1988(1987)]. Conditional expression of PBP-2' may cause ambiguities in susceptibility tests [Barry, A. L. et al. J Clin. Microbiol. 25, 1897-1901(1987)].
Under the present circumstances, researchers have tried to detect MRS by genetic techniques. One of them is an approach that detects the gene for PBP-2' (mecA gene) characterizing MRS [Tomasz et al., Antimicrob. Agents Chemother., 35; 632-639 (1991)]. However, it is difficult to apply the method, which uses the dot hybridization with isotope-labeled DNA probes, in clinical institutes such as hospitals in view of handling. On the other hand, there is another approach [Higashiyama et al., 65th Nippon Kansenshogakkai Kouen Shouroku, p. 13 (1991)] using a polymerase chain reaction [PCR; Mullis et al., Science, 230: 1350-1354 (1985)], which is a highly sensitive and relative rapid method for detecting various genes, though complicated handling and difficult treatment of multiple samples makes the approach unpractical.
Among MRS, strains producing toxic shock syndrome toxin-1 (abbreviated as TSST-1 hereinafter) have been isolated at high frequencies, TSST-1 producing Staphylococcus spp. is abbreviated as TPS hereinafter, and it is said that the mortality of the patients carrying these strains is high. There is a general method for detecting the toxin-producing Staphylococcus spp., which directly detects the toxic protein by the immunological method [See et al., J. Clin. Microbiol. 27:2050-2053 (1989)], and whose sensitivity depends on the amount of toxic proteins produced, being insufficiently used at clinical institutes. The method, which is based on culturing, is also insufficient in view of rapidness. Subsequently, TSST-1 gene was isolated [Schliever et al., J. Biol. Chem., 261: 15783-15786 (1986)]. Although the detection of Staphylococcus aureus producing TSST-1 is tried by detecting its gene, this detection method is not practical because of the same reasons as those of the above-mentioned method for detecting MRS.
SUMMARY OF THE INVENTION
Accordingly, it is an object of the present invention to provide a primer for detecting MRS and/or TPS.
It is another object of the present invention to provide a method for detecting MRS and/or TPS.
It is a further object of the present invention to provide a kit for detecting these bacteria.
The above and other objects, features and advantages of the present invention will become apparent from the following description.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a diagram of the procedure for detecting MRSA in Example 7.
FIG. 2 is a diagram of the procedure for detecting MRSA-producing and TSST-1-producing bacteria at the same time in Example 9.
DETAILED DESCRIPTION OF THE INVENTION AND PREFERRED EMBODIMENTS
The present inventors have studies to overcome the above-mentioned various problems. As a result, the mecA gene, a structural gene for PBP-2', was isolated from a methicillin-resistant Staphylococcus aureus [Matsuhashi et al., FEBS Letters 221:167-171 (1987)], and similar genes were isolated from other Staphylococcus spp. which were resistant to ε-lactam series drugs [Antimicrob Agent Chemother., 32:1494-1499 (1988)]. This suggests that the methicillin-resistant staphylococcus spp. can be found by detecting the mecA gene. There are various methods for detecting the gene, and the combinational use of the polymerase chain reaction with them preferably makes highly sensitive detection of the gene successful. In order to achieve these objects, mecA gene seems to be amplified, if primers are designed so as to think much of possibly important regions of the mecA gene sequence. Since PBP-2' coded by the mecA gene, however, has homology to proteins of other pathogenic bacteria and enterobacteria, it is difficult to detect their mecA genes specifically.
The present inventors presumed that the mecA gene comprised a highly homologous region to a part of penicillinase gene and that to a part of the gene for penicillin binding proteins of Escherichia coli [Matsuhashi M. et al. FEBS LETTERS, 221, 167-171 (1987)]. As a result of intensive researches to examine various primer sets for gene amplification in view of the boundary region of the mecA gene, the present inventors have found an effective primer set which represent the following base sequences (1) and (2) or their mutation sequences, and which do not react with DNAs of other bacteria (e.g., Pseudomonas aeruginosa, Bacillus subtillis and Escherichia coli), yeasts (e.g., Candida albicans, Saccharomyces cerevisiae) and human, but specifically react with DNA of MRS.
5'GAAATGACTGAACGTCCGAT                                     (1)
5'GCGATCAATGTTACCGTAGT                                     (2)
In addition to the above mentioned sequences, a base sequence of the gene coding for the toxic protein of TSST-1 has already been reported [Schlievert et al., J. Biol. Chem., 261:15783-15786 (1986)]. As a result of intensive research to examine different nucleotide fragments which specifically amplify the TSST-1 gene by comparing the base sequence with base sequences of genes of other toxins (SEA, SEB, SEC1, SEC2, SEC3, SED and SEE) which are produced by Staphylococcus aureus, the present inventors have found nucleotide fragments which represent the following base sequence (3) and (4) or their mutation sequences.
5'AGTATGGGCCAAAGTTCGAT                                     (3)
5'CACTTTGATATGTGGATCCG                                     (4)
Further, the present inventors have found that MRS or TPS can be detected by the polymerase chain reaction using these primers, their labeled sequences or solid support binding-site labeled sequences easily, rapidly and with a high sensitivity.
It is known that more than two genes can be simultaneously amplified (multiple amplification) by the polymerase chain reaction [Chamberlain et al., Nucleic Acids Res. 16:11141-11156 (1988)], though frequencies of nonspecific reactions such as amplification reactions of unexpected gene and amplification reactions of primers one another are very high. The present inventors have found that the use of the primer sets of the present invention does not cause gene products owing to the nonspecific amplification reaction, but can amplify the genes for MRS and TPS simultaneously and specifically, as well as can detect these genes at the same time.
Accomplished on the basis of these findings, the present invention relates to a primer for detecting MRS which comprises the nucleotide fragment of the abovementioned base sequence (1) or base sequence (2) or its mutation sequence, its labeled sequence or its solid support binding site labeled sequence abbreviated as primer (1) and primer (2), respectively, hereinafter]; a primer for detecting TPS which comprises the nucleotide fragments of the above-mentioned base sequence (3) or base sequence (4) or its mutation sequence, its labeled sequence or its solid support binding site labeled sequence [abbreviated as primer (3) and primer (4), respectively, hereinafter]; and a method and kit for detecting MRS and/or TPS using these primers.
The primers (1) to (4) of the present invention can be prepared by synthesizing chemically, for example, using a DNA synthesizer, or by excising, for example, the gene of MRS or TPS with some enzymes. Examples of MRS used here include Staphylococcus aureus (ATCC No. 33591) and the like. Examples of TPS include the bacteria described by Schlievert et al. [J. Biol. Chem. 261:15783-15786 (1986)] and the like.
Any functional primers for detecting the abovementioned Staphylococcus spp. may be used as primers according to the present invention. Examples of these primers include ones in which part of nucleotides are deleted from the nucleotide sequences of the original primers having the above-mentioned nucleotide sequences (1) to (4), ones which are replaced or added by other nucleotides, and more particularly nucleotide sequences which are the corresponding regions of the genes of the mutated strains of the above-mentioned Staphylococcus spp. and the like. It is preferred that there are no mutations, if any, little in the vicinity of the 3'-ends of the primers which seem to greatly affect efficacies of the elongation reaction of the primers, whereas it is allowed that there are mutations in the vicinity of the 5' ends of the primers.
The mutation sequences of primers according to the present invention are not particularly limited so long as the gene amplification is not adversely affected, and it is preferred that the variation of the constituent nucleotides is within 20%.
The labeled sequences of the primers according to the present invention are ones in which the above-mentioned primers are combined with detectable labels. In the present labeling, either non-radioactive or radioactive substances are available as these labels, non-radioactive substances being preferably used. Examples of the non-radioactive substances include fluorescent substances [e.g., fluorescein and its derivatives (fluorescein isothiocyanate and the like), rhodamine and its derivatives (tetramethylrhodamine isothiocyanate, texasred and the like)], chemiluminescent substances (e.g., acridine and the like), delayed fluorescence-emitting substances (DTTA, by Pharmacia) which can be measured directly.
When substances which bind the above-mentioned labels specifically are utilized for detecting these labels, these labels are detected indirectly. Biotin or some haptens are available as these labels. In cases where biotin is used, avidin or streptavidin which specifically binds to biotin can utilized. In cases where haptens are used, antibodies which specifically bind these haptens can be utilized. A compound having a 2,4-dinitrophenol, digoxygenin, biotin and fluorescent substances can be used as haptens. Any of these labels can be introduced into primers singly or, if necessary, in various combination with one another according to the publicly known methods (refer to U.S. Pat. No. 4,789,737).
Moreover, the solid support binding site of the primers according to the present invention include the primers to which the sites capable of binding to solid support are introduced. For example, the above-mentioned nonradioactive labels also can be used as sites capable of binding to the solid support. The preferred examples include biotin, fluorescent substances such as fluorescein; haptens such as a compound having 2'4-dinitrophenol or digoxygenin. These sites can be introduced into primers according to the present invention in advance singly or, if necessary, in various combination with one another. In order to selectively bind the site to the solid support, the substance for the site should be different from that for the label. The solid support should be inactive against solvents and any reagents to be used, can be separated from the reagents by certain methods, and is able to selectively bind the above-mentioned sites. There are solid support in which streptavidin, antibodies and the like capable of trapping the above-mentioned sites are introduced to solid support such as a microtiter plate, a polystyrene ball, an agarose bead and, a polyacryl bead. The microtiter plate which is excellent in handling and mechanical access is preferably used.
For example, a solid support having streptavidin can be used in order to trap products caused by the polymerase chain reaction with a primer in which biotin is introduced. Moreover, in order to trap products caused by the polymerase chain reaction with a primer in which fluorescein or a 2,4-dinitrophenol is introduced, solid support having the corresponding antibodies can be used.
The method for detecting MRS and/or TPS according to the present invention comprises (a) adding detection primers comprising a combination of primer (1) with primer (2) and/or a combination of primer (3) with primer (4) to a sample containing Staphylococcus spp. so as to cause a polymerase chain reaction: then (b) detecting products caused by the polymerase chain reaction with the detection primers and methicillin-resistant genes and/or toxin-producing genes of Staphylococcus spp. in the sample.
The detection method according to the present invention utilizes the polymerase chain reaction with a set or sets of primers, i.e., a combination of primer (1) with primer (2) and/or a combination of primer (3) with primer (4). Examples of such set of primers include the following (A) to (D):
(A) A set of primers having no modifications;
(B) At least one primer of a set of primers being a labeled sequence;
(C) At least one primer of a set of primers having a solid support binding site; and
(D) One of a set of primers having a solid support binding site and the other being a labeled sequence.
Among them, the combination of (D) is particularly preferred in view of easiness and rapidness in the detection procedure. When the methicillin-resistant gene and toxin-producing gene are detected at the same time using the combination of (D), the label of primer (1) or primer (2) and that of primer (3) or primer (4) should not be the same, provided that the solid support binding site of primer (1) or primer (2) and that of primer (3) or primer (4) is the same. In other words, the label derived from MRS and the label derived from TPS should be distinguished. Therefore, when the methicillin-resistant gene and toxin-producing gene are detected at the same time using the combination of (D), the following embodiments, (i) to (iii), of the primers are preferred.
(i) The solid support-binding site of primer (1) or primer (2) is identical to that of primer (3) or primer (4), and the label of primer (1) or primer (2) is different from that of primer (3) or primer (4).
(ii) The solid support binding site of primer (1) or primer (2) is different from that of primer (3) or primer (4), and the label of primer (1) or primer (2) is identical to that of primer (3) or primer (4).
(iii) The solid support binding site of primer (1) or primer (2) is different from that of primer (3) or primer (4), and the label of primer (1) or primer (2) is different from that of primer (3) or primer (4).
The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enabled the patients with infections caused by these bacteria to carry out suitable treatment at an earlier stage.
The detection method according to the present invention will now be described in further detail.
(1) Samples
There are first provided samples to be detected for the presence of the desired MRS and/or TPS. Examples of the samples include cultured medium, bacterial colony, and sputum, urine, pus, blood or various tissue slices obtained from patients.
After a part of a sample is directly collected in case of the colony, or other samples are condensed as precipitates, if necessary, by centrifugation and the like, these samples may be subjected to treatments of lysing cells such as treatments with enzymes, heat surfactants, ultrasonication or combination thereof. The treatment of lysing cells is performed in order to obtain a sufficient amount of DNA derived from Staphylococcus spp. Its practical procedure may be referred to general literatures, for example, "PCR PROTOCOLS" [Academic Press Inc., p. 14 and p. 352 (1989)].
(2) Polymerase chain reaction
If Staphylococcus spp. are present in the abovementioned samples, a polymerase chain reaction according to the elongation reaction of primers may be carried out by adding the primers of the present invention to the samples.
The elongation reaction of a primer can be carried out by introducing four kinds of nucleoside triphosphates (deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and thymidine triphosphate: a mixture thereof may be referred to as dNTP) as substrates to the primer.
In the elongation reaction, E. coli's DNA polymerase I, Klenow fragments excised by E. coli's DNA polymerase I, T4 DNA polymerase and the like are used. If heat-resistant enzymes such as Taq polymerase which cause the elongation reaction at a higher temperature are particularly used, specificity of primers' recognition of a target sequence can be enhanced (referred to U.S. Pat. No. 4889818).
The desired genes of Staphylococcus spp. can be effectively amplified by repeating the elongation reaction using each of two kinds of the primers of the present invention [a combination of primer (1) with primer (2) or a combination of primer (3) with primer (4)].
Further detailed procedure of the polymerase chain reaction should be referred to PCR Technology, Stockton press (1989).
(3) Detection
Detection of a combined substance of the desired gene produced by a primer elongation reaction with a detection primer leads to detection of MRS and/or TPS. The preferred detection method depends on kinds or forms of the above-mentioned primer elongation product, i.e., the synthesized nucleotide chain.
Generally, the product caused by the polymerase chain reaction forms a double stranded DNA, therefore, the synthesized nucleotide chain can be detected by electrophoresis following ethidivm bromide staining [Saiki, R. K. et al., Science, 230:1350-1354 (1985)], dot hybridization with labeled probes [Saiki, R. K. et al., Nature, 324:163-166 (1986)] or the like.
When a label substance is introduced to a synthesized nucleotide chain, the nucleotides can-also be detected by the reverse dot hybridization [Saiki, R. K. et al., Proc. Natl. Acad. Sci. USA, 86, 6230-6234 (1989)] in which the labeled and synthesized nucleotide chain is hybridized with the probe immobilized to the solid support, a column method with solid adsorbent (refer to WO89/06285) or the like.
Nucleic acids can be very easily detected by the method described in WO89/06285. That is, there is a method in which products caused by the polymerase chain reaction are contacted with solid supports using the above-mentioned combination of primers (D), and then impurities are washed with an appropriate solvent to remove. Also by this method the desired products with labels which are caused by the polymerase chain reaction are immobilized to the solid support to detect specifically, since the synthesized nucleotide which is elongated by the primer having the solid support binding site forms a double stranded DNA with another synthesized nucleotide which is elongated by the primer having the label.
In fact, the detection of labels may be performed by general methods depending on the labels to be used. For example, in cases where radioisotopes are used as labels, the radioisotopes themselves may be measured. In cases where biotin or a hapten is used as a label, biotin or a hapten can be detected using an avidin (or streptavidin)-enzyme conjugate or an antibody-enzyme conjugate, respectively. The enzyme of the resultant complex (for example, between incorporated biotin and streptavidin-enzyme conjugate) can thus serve as signal reporting moiety. Furthermore, in cases where fluorescent substances are used as labels, emitted fluorescence itself may be measured using a fluorometer.
Moreover, in cases where a label of primer (1) or primer (2) and a label of primer (3) or primer (4) are different from each other for detecting the methicillin-resistant gene and the toxin-producing gene at the same time, the detection procedure of the labels should be performed independently.
The kit for detecting MRS and/or TPS according to the present invention comprises (A) reagents for lysing cells; (B) reagents for causing the polymerase chain reaction which contain the primers consisting of a combination of primer (1) with primer (2) and/or a combination of primer (3) with primer (4); and (C) a solid support for immobilizing products caused by the polymerase chain reaction with the primers for methicillin-resistant genes and/or toxin-producing genes of Staphylococcus spp. Further, the kit of the present invention comprises, if necessary, (D) reagents for indirectly detecting labels, wash liquids and oils. These components will be illustrated below.
(A) Reagents for lysing cells
These reagents contain enzymes for lysing cell walls of Staphylococcus spp., enzymes for hydrolyzing proteins of the bacteria. Any enzymes for lysing cell walls are available which can hydrolyze peptidoglycans of Staphylococcus spp., and so, for example, lysostaphin, acromopeptidase and the like can be used. On the other hand, any enzymes for hydrolyzing proteins are available which can cleave peptide bonds of proteins, and so, for example, trypsin, pepsin or proteinase K and the like can be used. If necessary, surfactants such as Triton X 100, Nonidet P-40, Tween 20 and SDS are optionally added to these enzymes.
(B) Reagents for causing the polymerase chain reaction
These reagents contain the above-mentioned primers for the specified polymerase chain reaction, four different nucleotide triphosphates for synthesizing (amplifying) nucleotide acid chains and an enzyme for nucleic elongation. Optional DNA polymerases can be used as an enzyme for nucleotide acid elongation, and so the use of a heat-stable DNA polymerase can preferably cause a rapid and specific polymerase chain reaction. Examples of these polymerases include Taq DNA polymerase, Tth DNA polymerase and Vent DNA polymerase and the like.
(C) Solid support for immobilizing products caused by a polymerase chain reaction
As described above in detail, these solid supports can specifically bind to the solid support binding sites which are introduced to the primers of the present invention. Microtiter well which is treated so as to bind specifically to the site, is preferably used.
(D) Other reagents
Any wash liquids are not particularly limited if these remove unreacted primers, reagents and the like, as well as do not affect the detection reaction. In general, buffers can be used.
Among oils, an oil can be used which prevents evaporation of water in the reaction solution and can separate water, and has smaller specific gravity than water. Examples of the oils include silicone oil, mineral oil and the like.
In cases where labels not capable of directly detecting are introduced to primers, reagents for detecting labels are those containing reagents indirectly detecting these labels. For example, in cases where a label is a hapten, these reagents are (a) those of enzyme conjugated-antibodies specific to the hapten, (b) the substrates of the enzymes and the like. Examples of these reagents include: 2-nitrophenyl-β-D-galactopyranoside, 4-methylumbelliferyl-ε-D-galactopyranoside and the like as substrates in case where the enzyme is ε-D-galactosidase; 3-(4-hydroxyphenyl) propionic acid, 3,3',5,5'-tetramethylbenzidine, 1,2-phenylenediamine and the like as substrates in case where the enzyme is peroxydase; 4-methylumbelliferyl phosphate, NADP, 4-nitrophenyl phosphate and the like as substrates in case where the enzyme is alkaline phosphatase; glucose, NAD and the like as substrates in case where the enzyme is glucose-6-phosphate dehydrogenase; ethanol, NAD and the like as substrates in case where the enzyme is alcohol dehydrogenase.
EXAMPLES
The present invention is illustrated with reference to the following examples, but the invention is not intended to be limited only to the Examples.
Example 1
Preparation of primers
In accordance with the present invention, the primers to which labels or solid support binding sites were introduced, or primers to which labels or solid support binding sites were not introduced were chemically synthesized by the following method.
First, in cases where the primers to which labels or solid support binding sites were not introduced, these primers were chemically synthesized by the phosphoamidite method of Caruthers et al. [Tetrahedron Lett. 22:1859 (1981)] using an Applied Biosystems Model 381A DNA synthesizer in an amount scale of 0.2 μmole.
On the other hand, in cases where the primers to which labels or solid support binding sites were introduced, oligonucleotides whose 5'-ends had amino groups introduced were synthesized, and then labels or solid support binding sites were introduced to them with appropriate reagents. The following examples explain these syntheses in detail.
First, an oligonucleotide (5'GAAATGACTGAACGTCCGAT) whose 5'lends had an amino group introduced was synthesized using an Applied Biosystems Model 381A DNA synthesizer. Protective mononucleotide phosphoamidites were subsequently added to 0.2 μmole of a solid support and Aminolink II (tradename, Applied Byosystems) was added in the final step. Then these substances were liberated from the solid support by treatment with concentrated ammonia and protective groups were removed.
After deprotection, the liberated mixture was applied to gel filtration with Sephadex G-50, and then fractions of the peak eluted first were collected to condense. The sample was then purified by reverse-phase HPLC (column: μ-Bondapak C18; eluent: 5-20% acetonitrile/50 mM triethylammonium acetic acid, pH 7.0).
Then a 1M NaHCO3 solution (10 μl), H2 O (30 μl) and a solution of biotin-N-hydroxysuccinimide ester (BRL Co., Ltd) in DMF (20 μg/μl, 50 μl) were added to a solution of aminated oligonucleotide (1 O.D.: 10 μl, which were mixed and allowed to stand at room temperature. After 4 hours, the mixture was applied to gel filtration column (Sephadex G-50), was eluted with 50 mM TEAB buffer (a solution of triethylammonium bicarbonate, pH 7.5), and then fractions of the peak eluted first were collected to dry into solid (yield: 0.6 O.D.).
If aminated oligonucleotide as a starting material was crude, or biotinylation reaction did not proceed quantitatively, samples obtained after gel filtration were purified further by reverse-phase HPLC (column: μ-Bondapak C18; eluent: 5-20% acetonitrile/50 mM triethylammonium acetic acid, pH 7.0). In this case, since the desired biotinylated oligonucleotide elutes later than starting material and the other impurities, it can be easily purified.
An oligonucleotide (5'GCGATCAATGTTACCGTAGT) whose 5'-ends had a dinitrophenyl group (DNP) introduced was derived from that whose 5'-ends had an amino group introduced, and used as a starting material as in case of the biotinylated oligonucleotide.
A 1M NaHCO3 solution (20 μl) was added to a solution of an aminated oligonucleotide solution (2 O.D.: 180 μl), to which an ethanol solution of dinitrofluorobenzene (5% (v/v), 100 ul) was added, and then the solution was heated for 2 hours at 37° C. After completion of the reaction, the solution was applied to gel filtration to remove reagents and purified (yield: 1.2 O.D.).
An oligonucleotide (5'CACTTTGATATGTGGATCCG) whose 5'-ends had a fluorescein group introduced was derived from that whose 5'-ends had an amino group introduced, and used as a starting material as in case of the biotinated oligonucleotide.
A 1M Na2 CO3 solution (108 μl) and water (120 μl) was added to a solution of an aminated oligonucleotide solution (2 O.D.: 40 μl), to which an solution of fluorescein isothiocyanate (4 mg/12 ul) in DMF was added, and then the solution was mixed to react at room temperature over night. After completion of the reaction, the solution was applied to gel filtration to remove reagents and purified by HPLC (yield: 0.85 O.D.).
Example 2
Labeling of antibody
Anti-DNP antibody and Anti-FITC antibody were prepared by standard method. In brief, each hapten was conjugated with keyhole limpet's hemocyanin (KLH), and then rabbits were immunized with these conjugates. These antisera obtained from these rabbits were purified by salting out with ammonium sulfate and by affinity chromatography. The purified antibodies were digested to Fab's, which were labeled with N-(ε-maleimide caproic acid) succinimide (EMCS) as a crosslinking agent by alkaline phosphatase.
Example 3
Preparation of streptavidin-immobilized wells of a microtiter plate
Phosphate buffered saline (PBS) supplemented with glutaraldehyde up to 2% was added to aminated wells of a microtiter plate (Sepaplate 8F Amino type, Sumitomo Bakelite Co., Ltd.) (100 μl/well), which was reacted at 37° C. for 4 hours. After completion of the reaction, the wells were washed with water 2 times, to which streptavidin solution in carbonate buffer (10 ug/ml, 10 mM NaHCO3 -Na2 CO3, pH 9.5) was added (100 ul/well), and then the plate was reacted at 37° C. for 4 hours.
After completion of the reaction, the wells were washed with PBS, to which 1% BSA, 0.05% NaN3 and PBS-, and then the plate was kept at 4° C.
Example 4
mecA gene-specific amplification reaction
When DNAs from P. aeruginosa, B. subtilis, E. coli, S. aureus, methicillin-resistant S. aureus and human, which were prepared according to a conventional manner were provided as samples, and their genes were amplified by the PCR method. The DNA sample (100 ng, but 1 ug for human DNA) was added to 100 ul of a reaction mixture containing 2 kinds of primers (biotin-GAAATGACTGAACGTCCGAT and DNP-GCGATCAATGTTACCGTAGT, 100 ng each), dATP, dGTP, dCTP and TTP (200 μM each), 100 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, and 0.01% gelatin. Heated at 94° C. for 5 min., the mixture was kept at 50° C. for 5 min. Then 2.5 units of heat-resistant DNA polymerase (Cettus Co., Ltd.) were added to the mixture, which was reacted at 72° C. for 60 sec., at 94° C. for 30 sec. and at 50° C. for 30 sec. as 1 cycle for 30 cycles.
After completion of the reaction, 5 μl of the resulting mixture was subjected to agarose gel electrophoresis, and then amplified nucleotide chains were detected by ethidium bromide-staining. As a result, when the DNA of methicillin-resistant Staphylococcus aureus was used as a sample, a band corresponding to the expected amplified nucleotide chain of 150 base pairs was able to be identified. On the other hand, when DNAs obtained from P. aeruginosa, B. subtilis, E. Coli, S. aureus and human were used as samples, bands corresponding to the expected amplified nucleotide chains were not able to be identified.
Example 5
TSST-1 gene-specific amplification reaction
The cross-reactivities of the TSST-1 gene-specific primers (biotin-AGTATGGGCCAAAGTTCGAT and DNP-CACTTTGATATGTGGATCCG) with other bacterial strains were tested as in Example 4. DNAs obtained from P. aeruqinosa, B. subtilis, E. coli, TSST-1-producing S. aureus and human were used as samples. When the TSST-1-producing S. aureus was used, a band corresponding to the expected amplified nucleotide chain of 159 base pairs was able to be identified. When the other DNAs were used, bands corresponding to the expected amplified nucleotide chains were not able to be identified.
Example 6
mecA gene- and TSST-1 gene-specific amplification reaction at the same time
The mecA gene-specific primers (biotin-GAAATGACTGAACGTCCGAT) and DNP-GCGATCAATGTTACCGTAGT) and TSST-1-gene-specific primers (biotin-AGTATGGGCCAAAGTTCGAT and DNP-CACTTTGATATGTGGATCCG) were used at each amount of 100 ng, and these primers were subjected to the polymerase chain reaction as under the conditions in Example 4. DNA samples were prepared from P. aeruqinosa, B. subtilis, E. coli, S. aureus, methicillin-resistant S. aureus, TSST-1-producing S. aureus and human. As a result of the reaction, when the DNA of methicillin-resistant Staphylococcus aureus was used as a sample, only a band corresonding to 150 base pairs was able to be identified and when the DNA of TSST-1 producing S. aureus was used as a sample, only a band corresponding to 159 base pairs was able to be identified. On the other hand, when the DNA of methicillin-resistant and TSST-1-producing Staphylococcus aureus were used, only two bands corresponding to 150 base pairs and 159 base pairs were able to be identified. No bands were identified when DNAs except the above-mentioned ones were used.
Example 7
Detection of MRSA in clinically isolated strains using the kit for detecting MRS
The four strains whose characters had been elucidated by the culturing method were tested for methicillin-resistance using the kit of the present invention. Each clinically isolated strain was prepared so as to reach a density of 105 cells per reaction, and subjected to the detection procedure according to the method shown in FIG. 1. The results are shown in Table 1.
              TABLE 1                                                     
______________________________________                                    
             MRSA  TSST-1   Measurements                                  
______________________________________                                    
Clinically isolated strain 1                                              
               -       +        0.02                                      
Clinically isolated strain 2                                              
               -       -        0.02                                      
Clinically isolated strain 3                                              
               +       +        0.34                                      
Clinically isolated strain 4                                              
               +       -        0.70                                      
______________________________________                                    
Example 8
Detection of TSST-1-producing Staphylococcus aureus in clinically isolated strains using the kit for detecting TSST-1-producing Staphylococcus aureus
The same four strains which had been clinically isolated as in Example 7 were tested for TSST-1-production using the kit of the present invention. 105 cells of each strain were subjected to the detection procedure according to the method shown in FIG. 1 as in Example 7. The results are shown in Table 2.
              TABLE 2                                                     
______________________________________                                    
             MRSA  TSST-1   Measurements                                  
______________________________________                                    
Clinically isolated strain 1                                              
               -       +        0.23                                      
Clinically isolated strain 2                                              
               -       -        0.01                                      
Clinically isolated strain 3                                              
               +       +        0.30                                      
Clinically isolated strain 4                                              
               +       -        0.02                                      
______________________________________                                    
Example 9
Analysis of clinically isolated strains using the kit for detecting methicillin-resistant and TSST-1-producing Staphylococcus aureus at the same time
The same four strains which had been clinically isolated as in Example 7 were tested for methicillin-resistance or TSST-1-production using the kit of the present invention. 105 cells of each strain were subjected to the detection procedure according to the method shown in FIG. 1. The results are shown in Table 3.
              TABLE 3                                                     
______________________________________                                    
                      Measurements                                        
             MRSA  TSST-1   MRSA    TSST-1                                
______________________________________                                    
Clinically isolated strain 1                                              
               -       +        0.00  0.36                                
Clinically isolated strain 2                                              
               -       -        0.00  0.00                                
Clinically isolated strain 3                                              
               +       +        0.30  0.33                                
Clinically isolated strain 4                                              
               +       -        0.74  0.00                                
______________________________________                                    
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 4                                              
(2) INFORMATION FOR SEQ ID NO: 1 :                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20                                                            
(B) TYPE: Nucleic acid                                                    
(C) STRANDEDNESS: Single                                                  
(D) TOPOLOGY: Linear                                                      
(ii) MOLECULE TYPE: Other nucleic acid (Synthetic nucleic acid)           
(iii) HYPOTHETICAL: No                                                    
(i v) ANTI-SENSE: No                                                      
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: methicillin resistant Staphylococcus aureus                 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:                                  
GAAATGACTGAACGTCCGAT20                                                    
(2) INFORMATION FOR SEQ ID NO: 2 :                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20                                                            
(B) TYPE: Nucleic acid                                                    
(C) STRANDEDNESS: Single                                                  
(D) TOPOLOGY: Linear                                                      
( ii) MOLECULE TYPE: Other nucleic acid (Synthetic nucleic acid)          
(iii) HYPOTHETICAL: No                                                    
(iv) ANTI-SENSE: Yes                                                      
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: methicillin resistant Staphylococcus aureus                 
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2 :                                 
GCGATCAATGTTACCGTAGT20                                                    
(2) INFORMATION FOR SEQ ID NO: 3 :                                        
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20                                                            
(B) TYPE: Nucleic acid                                                    
 (C) STRANDEDNESS: Single                                                 
(D) TOPOLOGY: Linear                                                      
(ii) MOLECULE TYPE: Other nucleic acid (Synthetic nucleic acid)           
(iii) HYPOTHETICAL: No                                                    
(iv) ANTI-SENSE: No                                                       
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: toxic shock syndrome toxin 1 producing                      
Staphylococcus aureus                                                     
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3 :                                 
AGTATGGGCCAAAGTTCGAT20                                                    
( 2) INFORMATION FOR SEQ ID NO: 4 :                                       
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 20                                                            
(B) TYPE: Nucleic acid                                                    
(C) STRANDEDNESS: Single                                                  
(D) TOPOLOGY: Linear                                                      
(ii) MOLECULE TYPE: Other nucleic acid (Synthetic nucleic acid)           
(iii) HYPOTHETICAL: No                                                    
(iv) ANTI-SENSE: Yes                                                      
(vi) ORIGINAL SOURCE:                                                     
(A) ORGANISM: toxic shock syndrome toxin 1 producing                      
Staphylococcus aureus                                                     
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4 :                                 
CACTTTGATATGTGGATCCG20                                                    

Claims (20)

What is claimed is:
1. A kit for detecting in a sample Staphylococcus spp. carrying the mec A gene and encoding the tsst-1 gene which comprises
(a) a reagent for causing a polymerase chain reaction which contains a detection primer composition consisting essentially of
(i) a nucleotide fragment of sequence (1)
5'GAAATGACTGAACGTCCGAT                                     (1),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof;
(ii) a nucleotide fragment of sequence (2):
5'GCGATCAATGTTACCGTAGT                                     (2),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof;
(iii) a nucleotide fragment of sequence (3):
5'AGTATGGGCCAAAGTTCGAT                                     (3),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof; and
(iv) a nucleotide fragment of sequence (4):
5'CACTTTGATATGTGGATCCG                                     (4),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof; and
(b) a solid support for immobilizing products caused by a polymerase chain reaction with the primer composition.
2. The kit according to claim 1 further comprising a reagent for lysing the cells in the sample.
3. The kit according to claim 1 further comprising nucleoside triphosphates selected from the group consisting of deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate, thymidine triphosphate, and mixtures thereof.
4. The kit according to claim 1 wherein the Staphylococcus spp. is Staphylococcus aureus.
5. The kit according to claim 1 wherein the labeled sequence is labeled with biotin or a hapten.
6. A method for the simultaneous and specific detection of Staphylococcus spp. carrying the mec A gene and encoding the tsst-1 gene in a cell-containing sample, which method comprises a polymerase chain reaction resulting from
(a) adding to the sample a primer composition consisting essentially of:
(i) a nucleotide fragment of sequence (1):
5'GAAATGACTGAACGTCCGAT                                     (1),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof;
(ii) a nucleotide fragment of sequence (2):
5'GCGATCAATGTTACCGTAGT                                     (2),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof;
(iii) a nucleotide fragment of sequence (3):
5'AGTATGGGCCAAAGTTCGAT                                     (3),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof; and
(iv) a nucleotide fragment of sequence (4):
5'CACTTTGATATGTGGATCCG                                     (4),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof;
(b) adding nucleoside triphosphates to the sample to cause an elongation reaction of the primer composition; and
(c) repeating the elongation reaction of step (b) to amplify the genes; followed by detection of the genes.
7. A method according to claim 6 wherein the Staphylococcus spp. is Staphylococcus aureus.
8. A method according to claim 7 wherein cells in the sample are lysed in advance.
9. A method according to claim 7 wherein the nucleoside triphosphates are selected from the group consisting of deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate, thymidine triphosphate, and mixtures thereof.
10. A method according to claim 7 wherein nucleotide fragments of sequences (1) and (2) are combined and have a solid support binding site, and the nucleotide fragments of sequences (3) and (4) are combined and are labeled.
11. A method according to claim 7 wherein nucleotide fragment of sequences (1) and (2) are combined and are labeled, and the nucleotide fragments of sequences (3) and (4) are combined and have a solid support binding site.
12. A method for detecting methicillin-resistant and toxic shock syndrome toxin-1 producing Staphylococcus spp. in a cell-containing sample by a polymerase chain reaction wherein the method comprises
(a) adding to the sample a detection primer composition consisting essentially of
(i) a nucleotide fragment of sequence (1):
5'GAAATGACTGAACGTCCGAT                                     (1),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof;
(ii) a nucleotide fragment of sequence (2):
5'GCGATCAATGTTACCGTAGT                                     (2),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof;
(iii) a nucleotide fragment of sequence (3):
5'AGTATGGGCCAAAGTTCGAT                                     (3),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof; and
(iv) a nucleotide fragment of sequence (4):
5'CACTTTGATATGTGGATCCG                                     (4),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof; then
(b) detecting products caused by the polymerase chain reaction with the detection primer composition and methicillin-resistant genes and toxin-producing genes of Staphylococcus spp. in the sample.
13. The method according to claim 12 wherein the methicillin-resistant and toxic shock syndrome toxin-1 producing Staphylococcus spp. is Staphylococcus aureus.
14. The method according to claim 12 wherein cells in the sample are lysed in advance.
15. A primer composition for the simultaneous and specific detection of Staphylococcus spp. in a sample carrying the mec A gene and encoding the tsst- 1 gene in a cell-containing sample, consisting essentially of
(i) a nucleotide fragment of sequence (1):
5'GAAATGACTGAACGTCCGAT                                     (1)
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof;
(ii) a nucleotide fragment of sequence (2):
5'GCGATCAATGTTACCGTAGT                                     (2),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof;
(iii) a nucleotide fragment of sequence (3):
5'AGTATGGGCCAAAGTTCGAT                                     (3),
a labeled sequence thereof or a solid support binding-site labeled sequence thereof; and
(iv) a nucleotide fragment of sequence (4):
5'CACTTTGATATGTGGATCCG                                     (4),
a labeled sequence thereof or a solid support binding-site labeled sequence thereof.
16. The primer composition according to claim 15 wherein the labeled sequence is labeled with biotin or a hapten.
17. A primer for specifically detecting methicillin-resistant Staphylococcus spp. consisting of a nucleotide fragment of sequence (1):
5'GAAATGACTGAACGTCCGAT                                     (1),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof, which sequence specifically reacts with DNA of the methicillin-resistant strain of Staphylococcus spp.
18. A primer for specifically detecting methicillin-resistant Staphylococcus spp. consisting of a nucleotide fragment of sequence (2):
5'GCGATCAATGTTACCGTAGT                                     (2),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof, which sequence specifically reacts with DNA of the methicillin-resistant strain of Staphylococcus spp.
19. A primer for specifically detecting toxic shock syndrome toxin-1 producing strains of Staphylococcus spp. consisting of a nucleotide fragment of sequence (3):
5'AGTATGGGCCAAAGTTCGAT                                     (3),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof, which sequence specifically amplifies DNA of toxic shock syndrome producing toxin-1 strains of Staphylococcus spp.
20. A primer for specifically detecting toxic shock syndrome toxin-1 producing strains of Staphylococcus spp. consisting of a nucleotide fragment of sequence (4):
5'CACTTTGATATGTGGATCCG                                     (4),
a labeled sequence thereof, or a solid support binding-site labeled sequence thereof, which sequence specifically amplifies DNA of toxic shock syndrome producing toxin-1 strains of Staphylococcus spp.
US07/924,458 1991-08-05 1992-08-04 Detection for Staphylococcus spp. Expired - Fee Related US5437978A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP3-195398 1991-08-05
JP3195398A JPH0549477A (en) 1991-08-05 1991-08-05 Detection of bacteria of the genus staphylococcus

Publications (1)

Publication Number Publication Date
US5437978A true US5437978A (en) 1995-08-01

Family

ID=16340471

Family Applications (1)

Application Number Title Priority Date Filing Date
US07/924,458 Expired - Fee Related US5437978A (en) 1991-08-05 1992-08-04 Detection for Staphylococcus spp.

Country Status (5)

Country Link
US (1) US5437978A (en)
EP (1) EP0526876B1 (en)
JP (1) JPH0549477A (en)
AT (1) ATE154645T1 (en)
DE (1) DE69220431T2 (en)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5683875A (en) * 1995-05-04 1997-11-04 Hewlett-Packard Company Method for detecting a target nucleic acid analyte in a sample
US5976794A (en) * 1994-04-15 1999-11-02 The Trustees Of Columbia University In The City Of New York Method for molecular staging of prostate cancer
US5994067A (en) * 1995-11-14 1999-11-30 The United States Of America As Represented By The Secretary Of The Army Method and kit for rapid detection of toxins and bacteria
US5994066A (en) * 1995-09-11 1999-11-30 Infectio Diagnostic, Inc. Species-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US6001564A (en) * 1994-09-12 1999-12-14 Infectio Diagnostic, Inc. Species specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US6075119A (en) * 1997-04-07 2000-06-13 The Rockefeller University Peptides useful for reducing symptoms of toxic shock syndrome
WO2001023604A2 (en) 1999-09-28 2001-04-05 Infectio Diagnostic (I.D.I.) Inc. Highly conserved genes and their use to generate probes and primers for detection of microorganisms
US20030049636A1 (en) * 1999-05-03 2003-03-13 Bergeron Michel G. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
US20030180733A1 (en) * 1994-09-12 2003-09-25 Bergeron Michel G. Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US20040063139A1 (en) * 2001-11-21 2004-04-01 Kimberly-Clark Worldwide, Inc. Detection and identification of enteric bacteria
US20050019893A1 (en) * 2001-06-04 2005-01-27 Ann Huletsky Sequences for detection and identification of methicillin-resistant staphyloccocus
US20070082340A1 (en) * 2005-10-11 2007-04-12 Ann Huletsky Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA)
US20090035780A1 (en) * 2007-07-31 2009-02-05 Mccarthy Larry Detection of methicillin-resistant and methicillin-sensitive staphylococcus aureus in biological samples
US20090081663A1 (en) * 2007-04-19 2009-03-26 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US20100216155A1 (en) * 2003-05-13 2010-08-26 Gen-Probe Incorporated Method and Kit for Identifying Antibiotic-Resistant Microorganisms
US20100267012A1 (en) * 1997-11-04 2010-10-21 Bergeron Michel G Highly conserved genes and their use to generate probes and primers for detection of microorganisms
US20110256541A1 (en) * 2007-03-23 2011-10-20 Ecker David J Compositions for use in identification of bacteria
US8518646B2 (en) 2006-12-19 2013-08-27 Geneohm Sciences, Inc. Detection of Staphylococcus aureus and identification of methicillin-resistant Staphylococcus aureus
US10167520B2 (en) 2011-12-06 2019-01-01 Scot E. Dowd Universal or broad range assays and multi-tag sample specific diagnostic process using non-optical sequencing
US10267792B2 (en) 2016-09-09 2019-04-23 International Business Machines Corporation Device for detecting toxic shock syndrome toxins and method of making the same
US11834720B2 (en) 2005-10-11 2023-12-05 Geneohm Sciences, Inc. Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA) of MREJ types xi to xx

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0630973A3 (en) * 1993-05-14 1995-04-26 Eastman Kodak Co Diagnostic compositions, elements, methods & test kits for amplification & detection of two or more DNA's using primers having matched melting temperatures.
DE4338119A1 (en) * 1993-11-08 1995-05-11 Bayer Ag Specific gene probes and methods for the quantitative detection of methicillin-resistant staphylococci
DE69433201T2 (en) * 1994-02-28 2004-07-29 Shimadzu Corp. Oligonucleotides and methods for the detection of bacteria
US5702895A (en) * 1995-01-19 1997-12-30 Wakunaga Seiyaku Kabushiki Kaisha Method and kit for detecting methicillin-resistant Staphylococcus aureus
EP1360324A2 (en) 2000-08-31 2003-11-12 Mayo Foundation For Medical Education And Research Detection of varicella-zoster virus
ATE465272T1 (en) 2001-01-31 2010-05-15 Mayo Foundation DETECTION OF HERPEX SIMPLEX VIRUS
US7691571B2 (en) 2001-01-31 2010-04-06 Mayo Foundation For Medical Education And Research Detection of bordetella
US7074598B2 (en) 2002-09-25 2006-07-11 Mayo Foundation For Medical Education And Research Detection of vancomycin-resistant enterococcus spp.
US7365176B2 (en) 2002-09-26 2008-04-29 Mayo Foundation For Medical Education And Research Detection of Epstein-Barr virus
US7074599B2 (en) * 2002-09-27 2006-07-11 Mayo Foundation For Medical Education And Research Detection of mecA-containing Staphylococcus spp.
US7427475B2 (en) 2003-11-18 2008-09-23 Mayo Foundation For Medical Education And Research Detection of group B streptococcus

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4965188A (en) * 1986-08-22 1990-10-23 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Blomster Hautamaa et al., The nucleotide and partial . . . , JBC, 261:33, pp. 15783 15786, 1986. *
Blomster-Hautamaa et al., "The nucleotide and partial . . . ", JBC, 261:33, pp. 15783-15786, 1986.
Song et al., "Evolution of an inducible . . . ", FEBS Lett., 221:1, pp. 167-171, 1987.
Song et al., Evolution of an inducible . . . , FEBS Lett., 221:1, pp. 167 171, 1987. *

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5976794A (en) * 1994-04-15 1999-11-02 The Trustees Of Columbia University In The City Of New York Method for molecular staging of prostate cancer
US20050042606A9 (en) * 1994-09-12 2005-02-24 Bergeron Michel G. Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US6001564A (en) * 1994-09-12 1999-12-14 Infectio Diagnostic, Inc. Species specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US7943346B2 (en) 1994-09-12 2011-05-17 Geneohm Sciences Canada Inc. Probes and primers for detection of bacterial pathogens and antibiotic resistance genes
US20090053703A1 (en) * 1994-09-12 2009-02-26 Bergeron Michel G Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US20030180733A1 (en) * 1994-09-12 2003-09-25 Bergeron Michel G. Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US20070009947A1 (en) * 1994-09-12 2007-01-11 Bergeron Michel G Specific and universal probes and amplification primers to rapidly detect and identify common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US5683875A (en) * 1995-05-04 1997-11-04 Hewlett-Packard Company Method for detecting a target nucleic acid analyte in a sample
US5994066A (en) * 1995-09-11 1999-11-30 Infectio Diagnostic, Inc. Species-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial pathogens and associated antibiotic resistance genes from clinical specimens for routine diagnosis in microbiology laboratories
US5994067A (en) * 1995-11-14 1999-11-30 The United States Of America As Represented By The Secretary Of The Army Method and kit for rapid detection of toxins and bacteria
US8426137B2 (en) 1996-11-04 2013-04-23 Genohm Sciences Canada, Inc. Methods and probes for detecting a vancomycin resistance gene
EP2339033A1 (en) 1996-11-04 2011-06-29 Geneohm Sciences Canada, Inc. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
EP2128268A1 (en) 1996-11-04 2009-12-02 Geneohm Sciences Canada Inc. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
EP2336364A1 (en) 1996-11-04 2011-06-22 Geneohm Sciences Canada Inc. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
EP2345746A1 (en) 1996-11-04 2011-07-20 Geneohm Sciences Canada Inc. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
EP2336365A1 (en) 1996-11-04 2011-06-22 Geneohm Sciences Canada Inc. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
EP2336366A1 (en) 1996-11-04 2011-06-22 Geneohm Sciences Canada Inc. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
EP2339034A1 (en) 1996-11-04 2011-06-29 Geneohm Sciences Canada Inc. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
US7115268B1 (en) 1997-04-07 2006-10-03 The Rockefeller University Peptides useful for reducing symptoms of toxic shock syndrome and septic shock
US6075119A (en) * 1997-04-07 2000-06-13 The Rockefeller University Peptides useful for reducing symptoms of toxic shock syndrome
US8034588B2 (en) 1997-11-04 2011-10-11 Geneohm Sciences Canada Inc. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
US8067207B2 (en) 1997-11-04 2011-11-29 Geneohm Sciences Canada Inc. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
US20060263810A1 (en) * 1997-11-04 2006-11-23 Bergeron Michel G Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
US20100267012A1 (en) * 1997-11-04 2010-10-21 Bergeron Michel G Highly conserved genes and their use to generate probes and primers for detection of microorganisms
US20040185478A1 (en) * 1997-11-04 2004-09-23 Bergeron Michel G. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
US20030049636A1 (en) * 1999-05-03 2003-03-13 Bergeron Michel G. Species-specific, genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes from clinical specimens for diagnosis in microbiology laboratories
EP2322667A2 (en) 1999-09-28 2011-05-18 Geneohm Sciences Canada, Inc. Highly conserved gene and its use to generate species-specific, genus-specific, family-specific, group-specific and universal nucleic acid probes for microorganisms.
US8114601B2 (en) 1999-09-28 2012-02-14 Geneohm Sciences Canada Inc. Highly conserved genes and their use to generate probes and primers for detection of microorganisms
US10047404B2 (en) 1999-09-28 2018-08-14 Geneohm Sciences Canada, Inc. Highly conserved tuf genes and their use to generate probes and primers for detection of coagulase-negative Staphylococcus
EP2660335A2 (en) 1999-09-28 2013-11-06 Geneohm Sciences Canada, Inc. Highly conserved genes and their use to generate species-specific, genus-specific, family-specific, group-specific and universal nucleic acid probes and amplification primers to rapidly detect and identify algal, archaeal, bacterial, fungal and parasitical microorgamisms from clinical specimens for diagnosis
WO2001023604A2 (en) 1999-09-28 2001-04-05 Infectio Diagnostic (I.D.I.) Inc. Highly conserved genes and their use to generate probes and primers for detection of microorganisms
US8182996B2 (en) 1999-09-28 2012-05-22 Geneohm Sciences Canada Inc. Compositions and methods for detecting Klebsiella pneumoniae
EP2322668A2 (en) 1999-09-28 2011-05-18 Geneohm Sciences Canada Inc. Highly conserved gene and its use to generate species-specific, genus-specific, family-specific, group-specific and universal nucleic acid probes for microorganisms.
EP2322666A2 (en) 1999-09-28 2011-05-18 Geneohm Sciences Canada, Inc. Highly conserved gene and its use to generate species-specific, genus-specific, family-specific, group-specific and universal nucleic acid probes for microorganisms.
US20090068641A1 (en) * 1999-09-28 2009-03-12 Bergeron Michel G Highly conserved genes and their use to generate probes and primers for detection of microorganisms
US7449289B2 (en) 2001-06-04 2008-11-11 Geneohm Sciences Canada, Inc. Methods for detection and identification of methicillin-resistant Staphylococcus aureus
US10801074B2 (en) 2001-06-04 2020-10-13 Geneohm Sciences Canada, Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US10577664B2 (en) 2001-06-04 2020-03-03 Geneohm Sciences Canada, Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US20060252078A1 (en) * 2001-06-04 2006-11-09 Ann Huletsky Sequences for detection and identification of methicillin-resistant Staphylococcus aureus
US9777335B2 (en) 2001-06-04 2017-10-03 Geneohm Sciences Canada Inc. Method for the detection and identification of methicillin-resistant Staphylococcus aureus
US20050019893A1 (en) * 2001-06-04 2005-01-27 Ann Huletsky Sequences for detection and identification of methicillin-resistant staphyloccocus
US20040063139A1 (en) * 2001-11-21 2004-04-01 Kimberly-Clark Worldwide, Inc. Detection and identification of enteric bacteria
US7179603B2 (en) 2001-11-21 2007-02-20 Kimberly-Clark Worldwide, Inc. Detection and identification of enteric bacteria
US20100216155A1 (en) * 2003-05-13 2010-08-26 Gen-Probe Incorporated Method and Kit for Identifying Antibiotic-Resistant Microorganisms
US7786289B2 (en) 2003-05-13 2010-08-31 Gen-Probe Incorporated Method and kit for identifying antibiotic-resistant microorganisms
US9109261B2 (en) 2003-05-13 2015-08-18 Gen-Probe Incorporated Method and kit for identifying antibiotic-resistant microorganisms
US11834720B2 (en) 2005-10-11 2023-12-05 Geneohm Sciences, Inc. Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA) of MREJ types xi to xx
US20070082340A1 (en) * 2005-10-11 2007-04-12 Ann Huletsky Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA)
US7838221B2 (en) 2005-10-11 2010-11-23 Geneohm Sciences, Inc. Sequences for detection and identification of methicillin-resistant Staphylococcus aureus (MRSA)
US8518646B2 (en) 2006-12-19 2013-08-27 Geneohm Sciences, Inc. Detection of Staphylococcus aureus and identification of methicillin-resistant Staphylococcus aureus
US20110256541A1 (en) * 2007-03-23 2011-10-20 Ecker David J Compositions for use in identification of bacteria
US8557524B2 (en) 2007-04-19 2013-10-15 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US8557974B2 (en) 2007-04-19 2013-10-15 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US9074260B2 (en) 2007-04-19 2015-07-07 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US8512954B2 (en) 2007-04-19 2013-08-20 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US8017337B2 (en) 2007-04-19 2011-09-13 Molecular Detection, Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US8362228B2 (en) 2007-04-19 2013-01-29 Molecular Detection, Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US20090081663A1 (en) * 2007-04-19 2009-03-26 Molecular Detection Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US20110151466A1 (en) * 2007-04-19 2011-06-23 Molecular Detection, Inc. Methods, compositions and kits for detection and analysis of antibiotic-resistant bacteria
US7888075B2 (en) 2007-07-31 2011-02-15 Quest Diagnostics Investments Incorporated Detection of methicillin-resistant and methicillin-sensitive Staphylococcus aureus in biological samples
US20090035780A1 (en) * 2007-07-31 2009-02-05 Mccarthy Larry Detection of methicillin-resistant and methicillin-sensitive staphylococcus aureus in biological samples
US10167520B2 (en) 2011-12-06 2019-01-01 Scot E. Dowd Universal or broad range assays and multi-tag sample specific diagnostic process using non-optical sequencing
US10267792B2 (en) 2016-09-09 2019-04-23 International Business Machines Corporation Device for detecting toxic shock syndrome toxins and method of making the same

Also Published As

Publication number Publication date
ATE154645T1 (en) 1997-07-15
DE69220431D1 (en) 1997-07-24
EP0526876A1 (en) 1993-02-10
JPH0549477A (en) 1993-03-02
EP0526876B1 (en) 1997-06-18
DE69220431T2 (en) 1997-10-16

Similar Documents

Publication Publication Date Title
EP0526876B1 (en) Detection for staphylococcus spp.
US6015666A (en) Rapid DNA test for detecting quinolone-resistant Staphylococcus aureus pathogens in clinical material
US8288524B2 (en) Molecular diagnosis of bacteremia
JPH10504973A (en) Specific and universal probes and amplification primers for rapid detection and identification of common bacterial pathogens and antibiotic resistance genes from clinical specimens for routine diagnostics in microbiological laboratories
US20100255474A1 (en) Method for Detecting Bacteria and Fungi
JPH11503921A (en) Universal target for species identification
JP2001518800A (en) Hybridization assays destroy excess probe
WO1995013395A1 (en) Specific gene probes and methods for quantitative detection of methicillin-resistant staphylococci
JP2686428B2 (en) Species-specific detection of Mycobacterium kansasii
JP2547517B2 (en) Probes for Mycobacterium avium, Mycobacterium intracellulare and Mycobacterium paratuberculosis
US6355435B1 (en) Methods for detecting and enumerating Campylobacter jejuni in environmental samples and for identifying antibiotic-resistant strains
US6218125B1 (en) Assay for Chlamydia trachomatis by amplification and detection of Chlamydia trachomatis cryptic plasmid
US5518884A (en) Nucleic acid sequences specific for mycbacterium kansasii
US6013435A (en) Drug resistance screening method using multiplex amplification
JP3048340B2 (en) Materials and methods for species-specific detection of M. kansasii nucleic acids
JP3200134B2 (en) Malaria parasite detection
US5814490A (en) Amplification and detection of chlamydia trachomatis nucleic acids
US5723296A (en) Amplification and detection of mycobacterial DNA K nucleic acids
US20050058985A1 (en) Method and kit for identifying vancomycin-resistant enterococcus
JP2001510688A (en) Nucleic acid molecules, kits and uses
JP3652387B2 (en) Penicillin-resistant pneumococcal gene fragment and its use
JPH0588A (en) New nucleic acid fragment and detection of mycoplasma using the same
JP2004534536A (en) Gram-positive bacteria detection method
JP2001520520A (en) DNA probes, methods and kits for identifying antibiotic resistant strains of bacteria
JP2004201636A (en) Method for detecting pathogenic fungus gene and oligonucleotide for identification of strain of fungus

Legal Events

Date Code Title Description
AS Assignment

Owner name: WAKUNAGA SEIYAKU KABUSHIKI KAISHA, JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST.;ASSIGNORS:UBUKATA, KIMIKO;NAKAGAMI, SATORU;YAMANE, AKIO;REEL/FRAME:006290/0365

Effective date: 19921001

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

FPAY Fee payment

Year of fee payment: 4

REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20030801