US5354664A - DNA encoding a human thrombomodulin having a modified glycosaminoglycan (GAG) binding site - Google Patents
DNA encoding a human thrombomodulin having a modified glycosaminoglycan (GAG) binding site Download PDFInfo
- Publication number
- US5354664A US5354664A US08/110,011 US11001193A US5354664A US 5354664 A US5354664 A US 5354664A US 11001193 A US11001193 A US 11001193A US 5354664 A US5354664 A US 5354664A
- Authority
- US
- United States
- Prior art keywords
- thrombin
- sequence
- seq
- dna
- gag
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/745—Blood coagulation or fibrinolysis factors
- C07K14/7455—Thrombomodulin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention relates to a novel thrombin-binding substance, a DNA fragment encoding the amino acid sequence of said thrombin-binding substance, a recombinant vector comprising said DNA fragment, a transformed cell harboring said recombinant vector, an anticoagulant composition comprising said thrombin-binding substance which has platelet aggregation inhibitory activity, and a process for the preparation of said thrombin-binding substance.
- thrombin activates Protein C which is said to act on the fibrinolytic and anticoagulant systems and that there is a certain substance in extracts of rabbit lung tissues which functions as a coenzyme for the activation mechanism.
- thrombomodulin N. L. Esmon et at, J. Biological Chemistry, 257, (2), 859-864 (1982)].
- the present inventors previously discovered two types of thrombin-binding substances in human urine. They are different from the above-mentioned substances; having smaller molecular weights, i.e., about 39,000 and 31,000 under nonreducing conditions.
- the present inventors filed a patent application on these substances (Japanese Patent Laid-open (kokai) No. 146898/1988).
- the present inventors separated two types of thrombin-binding substances (A) and (B) from human urine and a culture broth of cells derived from human tissues, and established a process for producing large amounts of these thrombin-binding substances in a stable manner.
- the present inventors previously filed patent applications on the thrombin-binding substances and the process (European Patent Publication No. 455,681).
- the present inventors obtained a human urine derived thrombin-binding substance using a recombinant DNA technique (r-UTM) and filed a patent application on this process (Japanese Patent Application No. 54446/1990).
- the thrombin binding substance of the present invention is distinguished over the known (r-UTM) binding substance by the addition of the amino acid sequence X 1 X 2 Y 1 SerGlySerGlyY 2 (SEQ ID NO: 17) at the carboxyl end of the r-UTM protein.
- Thrombomodulin from rabbit lungs is known to increase the activity of antithrombin III [K. T. Preissner et al, J. Biological Chemistry, 265, 4915-4922 (1990)]. Such an activity, however, is not possessed by thrombomodulin from bovine [H. V. Jakubowski et al, J. Biological Chemistry, 261, 3876 (1986)], and thrombomodulin from human placenta inhibits the activity of antithrombin III [K. Hirahara et al, Thrombo. Res., 57, 117-126 (1990)].
- thrombomodulins produced by genetic manipulation techniques are known in the art. One is known to increase the activity of antithrombin III and another is known to possess no such capability [K. Nawa et al, Biochem. Biophys. Res., 171, 729-737 (1990)]. These thrombomodulins, however, are known to inhibit the thrombin coagulation in platelet which plays an important role in the blood coagulation system, but not to inhibit an ADP coagulation effect [N. L. Esmon, J. Biological Chemistry, 256, 12238-12242 (1983)].
- a transformant prepared by transforming a host cell with a recombinant vector into which a DNA fragment obtained by combining a specific DNA fragment at the 3'-end of a DNA fragment encoding a thrombin-binding substance derived from human urine is combined can produce a thrombin-binding substance derived from human urine capable of increasing an antithrombin III activity and inhibiting platelet aggregation.
- an object of the present invention is to provide a novel thrombin-binding substance having the following amino acid sequence (hereinafter referred to as "Sequence A") [SEQ ID NO: 18], a DNA fragment having the nucleotide sequence encoding Sequence A, a recombinant vector comprising said DNA fragment and a replicable vector, and a transformed cell harboring said recombinant vector.
- Sequence A amino acid sequence
- a recombinant vector comprising said DNA fragment and a replicable vector
- a transformed cell harboring said recombinant vector ##STR1## wherein X1 and X2 represent acidic amino acids and Y1 and Y2 represent any arbitrary amino acids.
- Another object of the present invention is to provide an anticoagulant composition comprising said thrombin-binding substance and exhibiting platelet aggregation inhibitory activity.
- Still another object of the present invention is to provide a process for the preparation of said thrombin-binding substance.
- FIG. 1 is a scheme illustrating the structure of expression vector, pCDM-GAG-UTM1 and pCDM-GAG-UTM2, of the present invention.
- FIG. 2 is a scheme which illustrates the structure of expression vector pBPV-GAG-UTM1 of the present invention.
- the thrombin-binding substance of the present invention can be prepared, for example, according to the following process.
- a template DNA is first prepared by cutting a human placenta genome DNA with a suitable restriction endonuclease.
- the template DNA is screened using, as a probe, a DNA primer synthesized referring to a nucleotide sequence of a known human thrombomodulin gene [Shirai, T et al, J. Biochem, 103, 281-285 (1988)].
- the DNA thus produced is fragmented with a suitable restriction endonuclease, and DNA fragments thus obtained are ligated with a cloning vector to transform the microorganism.
- a plasmid DNA is extracted from the transformant and treated with a restriction endonuclease to produce a DNA fragment containing 1404 bases encoding the thrombin-binding substance derived from human urine.
- An oligonucteotide having a nucleotide sequence encoding an amino acid sequence, X 1 X 2 Y 1 SerGlySerGlyY 2 , (SEQ ID NO: 1) is inserted into the DNA fragment, thus obtaining a DNA fragment which contains the DNA fragment of the present invention.
- Typical examples of DNA fragments of the present invention are those having a nucleotide sequence of SEQ ID No. 3 and SEQ ID No. 4. The DNA fragments of the present invention, however, are not limited to them.
- Any DNA fragments capable of encoding an amino acid sequence constituting the thrombin-binding substance which is the target of the present invention i.e., the Sequence A, preferably SEQ ID No. 1 and SEQ ID No. 2, are included in the present invention.
- the construction of the recombinant vector containing the DNA fragment of the present invention may be carried out by connecting the DNA fragment of the present invention with a replicable expression vector.
- procaryotes typically E. coli
- yeasts typically insect viruses, vertebrate viruses, etc.
- the recombinant expression vector be constructed from the following nucleotide sequences (1) to (7) in this order toward the downstream direction of the transcription.
- a nucleotide sequence acting as a promoter (1) A nucleotide sequence acting as a promoter.
- a plasmid DNA is preferably used as a vector, for instance, a plasmid which can multiply itself, e.g., in E. coli as a host microorganism, and can express the inserted gene by transforming mammalian cells.
- a plasmid DNA comprises nucleotide sequences required for the plasmid to multiply itself in E. coli, such as a nucleotide sequence acting as a replicator of ColEI plasmid series, a nucleotide sequence acting as a promoter in mammalian cells, a gene functioning as a selection marker of the transformed E. coli, and a gene functioning as a selection marker of the transformed mammalian cells.
- a replicator nucleotide sequence such as SV40 ori, polyoma ori, or HSV ori which functions in mammalian cells.
- promoters are promoters, e.g., cytomegalovirus, SV40, polyoma virus, bovine papilloma virus, adenovirus, etc; retrovirus LTR, e.g., MMTV; a promoter of metallothionein gene, and the like.
- E. coli selection markers are ampicillin resistant genes, kanamycin resistant genes, tetracycline resistant genes, chioramphenicol resistant genes, and the like.
- mammalian cell selection markers are neomycin resistant genes, hygromycin B resistant genes, thymidine kinase genes, dihydrofolate reductase genes, xanthine-guanine phosphoribosyl transferase genes, and the like. These genes can be used either singly or in combination of two or more.
- Incorporation of the DNA fragment of the present invention into the above vectors can be carried out by cutting a DNA containing the DNA fragment with a suitable restriction endonuclease, optionally, adding a suitable linker, and combining it with the vector which is cut by a suitable restriction endonuclease.
- Restriction endonucleases which can be used here are, for example, Eco RI, Sph I, Pst I, Hind III, Bam HI, Xho I, Xba I, Ban III, Sma I, Nco I, and the like.
- Nucleotide modification enzymes such as exonuclease III, Ba131, SI nuclease, exonuclease VII, mungbean nuclease, DNA polymerase, and the like can also be used.
- a linker Eco RI linker, Sma I linker, Nco I linker, Bam HI linker, Xho I linker, Hind III linker, Pst I linker, Sph I linker, Xbal I linker, or the like may be used.
- Transformed cells which can efficiently produce the recombinant vector and/or thrombin-binding substance of the present invention can be obtained by introducing the expression recombinant vector obtained by the above method into host cells by means of the competent cell method, the protoplast method, the calcium phosphate coprecipitation method, the electroporation method, the DEAE dextran method, the lipofectin method, or the like.
- Unicellular organisms, such as bacteria and yeasts, cultured insect cells, cultured vertebrate cells, and the like are preferably used as host cells for obtaining the transformant.
- coli K12 strain e.g., HB101, C600K, JM101, JM103, JM105, JM109, MV1034, MV1184, MC1061/P3, and the like, are preferably used as E. coli host cells.
- mammalian cells are COS cells, CHO cells, L cells, C127 cells, NIH3T3 cells, HeLa cells, and the like.
- the thrombin-binding substance can be obtained by cultivating the transformant thus obtained, extracting and separating it from the cultivated cells or the culture broth.
- Various natural or artificial media can be used for the cultivation of the transformed cells.
- the media preferably contain carbon sources such as sugars, alcohols, and salts of organic acids; nitrogen sources such as protein mixtures, amino acids, and ammonium salts; and inorganic salts.
- vitamins and antibiotics corresponding to the selection marker genes may preferably be included. If the vector is of the type of which the expression can be controlled, it is necessary to add a procedure for inducing the expression in the course of the cultivation. After the cultivation, the culture broth is centrifuged to separate culture liquid from the cells.
- the cells are destroyed by means of freeze-thaw, ultrasonic treatment, French press, enzyme treatment, homogenizing, or the like, and the thrombin-binding substance is dissolved by using EDTA, surfactants, urea, guanidine hydrochloride, or the like.
- a purified thrombin-binding substance can be obtained by submitting the culture liquid or the cell extract containing the thrombin-binding substance thus prepared to column chromatography. Ion-exchange chromatography, affinity chromatography, e.g., that using the monoclonal antibody described in Japanese Patent Laid-open (kokai) No. 45398/1989, gel filtration chromatography, or the like can be used either independently or in combination.
- thrombin-binding substances thus obtained those having the amino acid sequence of SEQ ID No. 1 or SEQ ID No. 2 possess the following characteristic.
- amino acid sequence is considered to be those shown in SEQ ID Nos. 1 and 2.
- pH 3-4 determined by the isoelectric electrophoresis method using ampholite.
- Two or more sugars are considered to be attached to the thrombin-binding substances from the molecular weight. Based on the amino acid sequence, one of the sugars is considered to be an acidic polysaccharide attached to Ser (474).
- Injection preparations are typical examples of the composition comprising the thrombin-binding substance of the present invention as an anticoagulant agent.
- a preferable form of such injection preparations is a freeze-dried powder which can be dissolved into distilled water or physiological saline each time it is administered.
- Intravenous injection is a preferable manner by which the preparation is administered.
- a dose depends on the symptoms of the patient, the body weight, and the like, a preferable dose is 10 ⁇ g/kg to 10 mg/kg.
- the thrombin-binding substance of the present invention induces no abnormality with the dose of the above range. It is a quite safe substance.
- Primer #1 having the sequence of SEQ ID No. 5 and primer #2 having the sequence of SEQ ID No. 6 were synthesized by using a DNA synthesizer (ABI Model 381A) referring to the nucleotide sequence of human thrombomodulin gene [Shirai, T et al, J. Biochem, 103, 281-285 (1988)].
- a template DNA was prepared by digesting a human placenta genome DNA (a product of Clonetech Co.) with Bam HI. The gene amplification was carried out in the reaction solution of the following formulation using Quick Thermo System (Model QTS-10M: trademark, manufactured by Japan Genetic Co.) by the repetition of 30 cycles of incubation; one cycle consisted of incubation at 94° C. for 2 minutes, at 50° C. for 3 minutes, and at 72° C. for 4 minutes. After the reaction, a portion of the reaction product was sampled to confirm amplification of the target DNA band by agarose gel electrophoresis.
- DNA was collected from the reaction solution by ethanol precipitation, digested with Xho I and Kpn I and subjected to the agarose gel electrophoresis to obtain 1.57 kb Xho I-Kpn I fragments.
- the vector for the cloning pUC118 [Vieira, J. and Messing, J., Methods Enzymol., 153, 3-11 (1987)] was digested with Hind II, connected with Xho I linker, and further digested with Xho I and Kpn I to obtain vector fragments by the agarose gel electrophoresis.
- the vector fragments and the 1.57 kb Xho I-Kpn I fragments were ligated and E. coli MV1034 [Vieira, J. and Messing, J., Methods Enzymol., 153, 3-11 (1987)] was transformed with the ligated DNA.
- Plasmid DNA was extracted from the transformant thus obtained and digested with restriction endonuclease. In this manner, 6 clones holding a plasmid to which the 1.57 kb Xho i-Kpn I fragment derived from human thrombomodulin gene was inserted were selected.
- nucleotide sequences of the inserted fragments in clones revealed 1 to 3 mutated sites in each fragment. Then, 0.31 kb Xho I-Sma I fragment from clone 2, 0.65 kb Sma I-Mlu I fragment from clone 1, and 0.62 kb Mlu I-Kpn I fragment from clone 4, all without mutated sites, were recombined with the above-mentioned vector fragment to obtain plasmid pUCTM/XHO-KPN containing an inserted fragment of the human thrombomodulin gene with the correct sequence.
- the pUCTM/XHO-KPN was digested with Xho I and Kpn I to prepare a 1.57 kb Xho I-Kpn I fragment derived from a human thrombomodulin gene.
- This 1.57 kb fragment was ligated with a mammalian cell expression vector CDM8 (a product of Invitrogen Co.) which had been digested with Xho I and dephosphorylated together with linkers $1, $2, $3, and $4.
- the 1.57 kb fragment was also ligated with Xho I digested and dephosphorylated CDM8 with linkers $1, $2, $5, and $6.
- E. coli MC1061/P3 Seed, B. and Aruffo, A., Proc.
- Plasmid DNAs were extracted from the transformants thus prepared and digested with restriction endonucleases to confirm the direction and the site of the insertion. 1.68 kb fragments containing the DNA fragment of the present invention were cut out by Xho I from 8 clones which showed the correct direction of insertion and the correct restriction endonuclease map. The nucleotide sequences of all clones were found to have the sequence of SEQ ID No. 13 or 14, confirming that the expression vectors were correctly constructed.
- the expression vector of the present invention thus obtained were named pCDM-GAG-UTM1 and pCDM-GAG-UTM2 (FIG. 1), and the transformant harboring the vectors were named E. coli MC1061/P3 (pCDM-GAG-UTM1) and E. coli MC1061/P3 (pCDM-GAG-UTM2).
- COS7 cells were transfected with pCDM-GAG-UTM1 or pCDM-GAG-UTM2 by the DEAE-Dextran method [Seed, B. and Aruffo, A., Proc. Natl. Acad. Sci., USA, 84, 3365-3369 (1987)]. 5 ⁇ 10 5 cells were inoculated into a 60 mm culture dish and, on the next day, the culture medium was aspirated and replaced by 2 ml of Dulbecco's-modified minimum essential medium (DMEM) containing 10% Nu-serum (Collaborative Research).
- DMEM Dulbecco's-modified minimum essential medium
- the culture medium obtained by the above procedure was passed through a 1 ml Sepharose 4B (2 mg IgG/ml resin) column with which monoclonal antibody A-73 (Japanese Patent Laid-open (kokai) No. 45398/1989; 2 mg IgG/ml resin) was combined.
- the column was washed with (1) 2 ml of 0.02M Tris-HCl buffer (pH 7.4) containing 0.1M NaCl, (2) 20 ml of 0.02M Tris-HCl buffer (pH 7.4) containing 1M NaCl and0.05% Tween 20, and (3) 5 ml of 0.02M Tris-HCl buffer (pH 7.4) containing 1M NaCl, followed by elution with 5 ml of 0.02M Tris-HCl buffer (pH 7.4) containing 2M sodium thiocyanate, 5 mM EDTA, and 1M NaCl.
- the eluate was dialyzed against 50 mM acetate buffer containing 0.1M NaCl (pH 4.5) and applied on a column of Mono-Q sepharose.
- the column was washed with the same buffer and eluted with linear gradient of 0.1 to 2 M NaCl in 50 mM acetate buffer (pH 4.5) to obtain purified thrombin-binding substances (r-GAG-UTM1 and r-GAG-UTM2).
- CHO.K1 cells were transfected with pCDM-GAG-UTM1 by the calcium phosphate method [Gorman, C., "DNA Cloning” IRL Press, England, vol. 2, 143-190 (1985)]. 5 ⁇ 10 5 CHO.K1 cells were inoculated into a 10 cm petri dish and, on the next day, the culture medium (Ham F12 medium containing 10% FCS, hereinafter referred to as Medium) was exchanged. Four (4) hours thereafter, a coprecipitate of DNA and calcium phosphate was added. The coprecipitate used here was prepared according to the following manner.
- r-GAG-UTM1 The secreted thrombin-binding substance (r-GAG-UTM1) was quantitatively analyzed to select high producing clones. The cloning was further carried out on the selected clone by the limiting dilution method.
- the transformed cells thus obtained was named CHO-GUTM 1-8 and deposited with Fermentation Research Institute, Agency of Industrial Science and Technology (FERM P-3260).
- the transformed cell CHO-GUTM 1-8 was cultured in UC202 medium (a product of Nissui Pharmaceutical Co.) containing 1% FCS in a 225 cm 2 flask to become confluent, following which the medium was replaced by 50 ml of UC202 medium without containing FCS. After 1 week, the culture supernatant was collected and the same amount of the fresh medium not containing FCS was added. After cultivation for a further 1 week, the culture supernatant was collected and confirmed to contain 3-4 ⁇ g/ml thrombin-binding substance therein secreted.
- UC202 medium a product of Nissui Pharmaceutical Co.
- the purified thrombin-binding substance was obtained according to the same procedure of the later part of Example 3.
- pCDM-GAG-UTM1 was digested with Xho I to prepare a 1.7 kb fragment of soluble human modified thrombomodulin cDNA containing a site where glycosaminoglycan is bound to.
- a mammalian cell expression vector pBPV (a product of Pharmacia Co.) was digested with Xho I and dephosphorylated, and ligated with the cDNA fragment by the use of T4 DNA ligase for transforming E. Coli HB101 (product of TAKARA SHUZO K.K.). DNAs were extracted from the transformants thus prepared and digested with endonucleases to confirm the direction and the site of the insertion.
- the expression vector of the present invention thus constructed was named pBPV-GAG-UTM1 (FIG. 2), and the transformant harboring the vector was named E. coli HB 101 (pBPV-GAG-UTM1).
- mice C127 cells were transfected with pBPV-GAG-U1 by the calcium phosphate method. 8 ⁇ 10 5 C127 cells were inoculated into a 10 petri dish and, on the next day, the culture medium (Dulbecco's Modified Eagle Minimal Medium (DMEM medium) containing 10% FCS) was exchanged. Four hours thereafter, a coprecipitate of DNA and calcium phosphate was added. The coprecipitate employed was prepared according to the following manner.
- DMEM medium Dulbecco's Modified Eagle Minimal Medium
- Plasmid containing 20 ⁇ g of pBPV-GAG-UTM1 and 100 ng of neomycin resistant gene was dissolved into 450 ⁇ l of 1 mM Tris-HCl buffer (pH 8-0)-0.1 mM EDTA and mixed with 50 ⁇ l of 2.5M calcium chloride. The mixture was added dropwise to 500 ⁇ l of a solution: 50 mMHEPES (pH 7.12)-280 mM NaCl-1.5 mM sodium hydrogen phosphate, and after allowing to stand over 30 minutes at room temperature, the solution was added to the cell culture medium for cultivation for 24 hours.
- 50 mMHEPES pH 7.12
- the medium was replaced by a fresh DME medium and cultivated for a further 24 hours, and then the medium was replaced by a DME medium added with 5% FCS and containing 400 ⁇ g/ml G418. After 10 days, colonies produced were transferred to a 24-well plate and continuously cultivated up to the confluent. The supernatant was collected from the culture broth. The secreted thrombin-binding substance was quantitatively analyzed to select high producing clones. Cloning was further carried out on the selected clone by the limiting dilution method.
- the selected transformed C127 cells were cultured in 5% FCS-added DMEM medium in a 1750 cm 2 roller bottle to become confluent, following which the medium was replaced by 500 ml of 1% FCS-added DMEM medium. After 1 week, the culture supernatant was collected and confirmed to contain 2 ⁇ g/ml thrombin-binding substance therein secreted.
- r-GAG-UTM1 a purified thrombin-binding substance
- SDS-PAGE was performed according to the Laemmli's method (Nature, 227, 680-685) on the purified thrombin-binding substances.
- the protein was transferred onto a PVDF membrane according to the Matsudaira's method [J. Biol. Chem., 262 (21), 10035-10038].
- the PVDF membrane was then incubated in 0.05M Tris-HCl buffer (TBS) containing 0.1% bovine serum albumin and 0.1M NaCl at room temperature for 2 hours.
- TBS Tris-HCl buffer
- r-UTM and r-GAG-UTM1 and 2 which are the thrombin-binding substances of the present invention, 0.1 ⁇ g/ml each, were treated with 5 ⁇ l of chondroitinase (10 mU, a product of Seikagaku Kogyo K.K.) at 37° C. for 40 minutes.
- the immunoblotting was carried out in the same manner as in Example 5 to confirm the presence of chondroitin sulfate type glycosaminoglycan covalent bonds in the thrombin-binding substances of the present invention.
- r-UTM and r-GAG-UTM1 and 2 of the thrombin-binding substance of the present invention 2.5 ⁇ g/ml each, were mixed with human fibrinogen (2.5 mg/ml) and human antithrombin III (0 or 250 ⁇ g/ml), and dissolved in 5 mM solution of CaCl 2 .
- Bovine thrombin 0.5 U/ml was added to the solutions to measure the clotting time. The results are shown in Table 1.
- Table I demonstrates that the thrombin-binding substances of the present invention delay blood coagulation by combining with thrombin. A remarkable promotion of the anti-coagulant activity of the thrombin-binding substances by the presence of antithrombin III are also shown.
- r-UTM (9-90 nM), r-GAG-UTM1, or r-GAG-UTM2 (thrombin-binding substance of the present invention (9-90 nM), dissolved in a solution of bovine fibrinogen (1 mg/ml) in 20 mM Tris-HCl buffer (pH 7.4) containing 0.15M NaCl, was mixed with bovine thrombin (18 nM) to measure the time required for the coagulation. 50% inhibitory concentrations (IC 50 ) were determined from the calibration curve prepared by using bovine thrombin of various concentrations. The results are shown in Table 2.
- r-UTM exhibited no aggregation inhibitory activity within the tested concentration range (10 -6 -10 -8 M).
- a catheter was inserted into the right femoral vein of Wistar rats (male) under anesthesia, and through the catheter were rapidly administered 1 mg/ml/kg of the tested compounds, r-GAG-UTM1 and r-UTM.
- Blood samples 0.1 ml each, taken before the administration and 1, 3, 6, 10, 20, 30, 60, and 120 minutes after the administration were mixed with heparin and served as plasma samples for the determination of the blood concentration.
- the measurement of the blood concentration was performed according to the sandwich ELISA method using an anti-human thrombin-binding monoclonal antibody. Both tested compounds were found to be analyzable with the one-compartment model. The results are shown in the following Table.
- thrombin-binding substances of the present invention promote antithrombin III activity and inhibit platelet aggregation, and by themselves possess antithrombin activity. Thus, they are useful as an effective component of anticoagulant agents. Furthermore, the thrombin-binding substance of the present invention can be produced inexpensively in a large scale.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Toxicology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Thrombin-binding substances capable of promoting anti-thrombin III activity and inhibiting platelet aggregation, and by themselves possessing anti-thrombin activity are disclosed. The thrombin-binding substances are useful as an effective component of anticoagulant agents, and can be produced inexpensively on a large scale.
Description
This is a division of application Ser. No. 08/014,723, filed on Feb. 8, 1993, now U.S. Pat. No. 5,273,962, which is a continuation-in-part of 07/796,336 filed Nov. 22, 1991, now abandoned.
1. Field of the Invention
The present invention relates to a novel thrombin-binding substance, a DNA fragment encoding the amino acid sequence of said thrombin-binding substance, a recombinant vector comprising said DNA fragment, a transformed cell harboring said recombinant vector, an anticoagulant composition comprising said thrombin-binding substance which has platelet aggregation inhibitory activity, and a process for the preparation of said thrombin-binding substance.
2. Description of the Background Art
A great deal of work has been done regarding the role that thrombin plays as a proteolytic enzyme in the blood coagulation control mechanism, and the mechanism of blood coagulation has been elucidated for the most part.
A publication reports that thrombin activates Protein C which is said to act on the fibrinolytic and anticoagulant systems and that there is a certain substance in extracts of rabbit lung tissues which functions as a coenzyme for the activation mechanism. Such a substance was named thrombomodulin [N. L. Esmon et at, J. Biological Chemistry, 257, (2), 859-864 (1982)].
N. Aoki, et al reported that a human thrombomodulin separated from human placenta with a molecular weight of about 71,000 under nonreducing conditions had characteristics similar to the thrombomodulin reported by Esmon et al [Thromb. Res., 37, 353-364 (1985)].
I. Maruyama et al compared the activities of human thrombomodulin separated from human placenta having a molecular weight of about 75,000 with the activities of the above-mentioned rabbit thrombomodulin. They reported that the two thrombomodulins were equivalent in activity [J. Clin. Invest., 75, 987-991 (1985)].
H. Ishii et al reported that human plasma and human urine contained substances having the same activities as thrombomodulin and that the molecular weights of such substances in plasma were 63,000 and 54,000 [J. Clin. Invest., 76, 2178-2181 (1985)].
The present inventors previously discovered two types of thrombin-binding substances in human urine. They are different from the above-mentioned substances; having smaller molecular weights, i.e., about 39,000 and 31,000 under nonreducing conditions. The present inventors filed a patent application on these substances (Japanese Patent Laid-open (kokai) No. 146898/1988).
Furthermore, the present inventors separated two types of thrombin-binding substances (A) and (B) from human urine and a culture broth of cells derived from human tissues, and established a process for producing large amounts of these thrombin-binding substances in a stable manner. The present inventors previously filed patent applications on the thrombin-binding substances and the process (European Patent Publication No. 455,681).
The present inventors obtained a human urine derived thrombin-binding substance using a recombinant DNA technique (r-UTM) and filed a patent application on this process (Japanese Patent Application No. 54446/1990).
The thrombin binding substance of the present invention is distinguished over the known (r-UTM) binding substance by the addition of the amino acid sequence X1 X2 Y1 SerGlySerGlyY2 (SEQ ID NO: 17) at the carboxyl end of the r-UTM protein.
Thrombomodulin from rabbit lungs is known to increase the activity of antithrombin III [K. T. Preissner et al, J. Biological Chemistry, 265, 4915-4922 (1990)]. Such an activity, however, is not possessed by thrombomodulin from bovine [H. V. Jakubowski et al, J. Biological Chemistry, 261, 3876 (1986)], and thrombomodulin from human placenta inhibits the activity of antithrombin III [K. Hirahara et al, Thrombo. Res., 57, 117-126 (1990)].
Also, two soluble thrombomodulins produced by genetic manipulation techniques are known in the art. One is known to increase the activity of antithrombin III and another is known to possess no such capability [K. Nawa et al, Biochem. Biophys. Res., 171, 729-737 (1990)]. These thrombomodulins, however, are known to inhibit the thrombin coagulation in platelet which plays an important role in the blood coagulation system, but not to inhibit an ADP coagulation effect [N. L. Esmon, J. Biological Chemistry, 256, 12238-12242 (1983)].
Promoting the antithrombin III activity and the platelet aggregation inhibitory activity in human thrombomodulins and other thrombin-binding substances has therefore been desired.
In view of this situation, the present inventors have undertaken extensive studies and found that a transformant prepared by transforming a host cell with a recombinant vector into which a DNA fragment obtained by combining a specific DNA fragment at the 3'-end of a DNA fragment encoding a thrombin-binding substance derived from human urine is combined can produce a thrombin-binding substance derived from human urine capable of increasing an antithrombin III activity and inhibiting platelet aggregation.
Accordingly, an object of the present invention is to provide a novel thrombin-binding substance having the following amino acid sequence (hereinafter referred to as "Sequence A") [SEQ ID NO: 18], a DNA fragment having the nucleotide sequence encoding Sequence A, a recombinant vector comprising said DNA fragment and a replicable vector, and a transformed cell harboring said recombinant vector. ##STR1## wherein X1 and X2 represent acidic amino acids and Y1 and Y2 represent any arbitrary amino acids.
Another object of the present invention is to provide an anticoagulant composition comprising said thrombin-binding substance and exhibiting platelet aggregation inhibitory activity.
Still another object of the present invention is to provide a process for the preparation of said thrombin-binding substance.
Other objects, features and advantages of the invention will hereinafter become more readily apparent from the following description.
A more complete appreciation of the invention and many of the attendant advantages thereof will be readily obtained as the same becomes better understood by reference to the following detailed description when considered in connection with the accompanying drawings, wherein:
FIG. 1 is a scheme illustrating the structure of expression vector, pCDM-GAG-UTM1 and pCDM-GAG-UTM2, of the present invention; and
FIG. 2 is a scheme which illustrates the structure of expression vector pBPV-GAG-UTM1 of the present invention.
The thrombin-binding substance of the present invention can be prepared, for example, according to the following process. A template DNA is first prepared by cutting a human placenta genome DNA with a suitable restriction endonuclease. The template DNA is screened using, as a probe, a DNA primer synthesized referring to a nucleotide sequence of a known human thrombomodulin gene [Shirai, T et al, J. Biochem, 103, 281-285 (1988)]. The DNA thus produced is fragmented with a suitable restriction endonuclease, and DNA fragments thus obtained are ligated with a cloning vector to transform the microorganism. A plasmid DNA is extracted from the transformant and treated with a restriction endonuclease to produce a DNA fragment containing 1404 bases encoding the thrombin-binding substance derived from human urine. An oligonucteotide having a nucleotide sequence encoding an amino acid sequence, X1 X2 Y1 SerGlySerGlyY2, (SEQ ID NO: 1) is inserted into the DNA fragment, thus obtaining a DNA fragment which contains the DNA fragment of the present invention. Typical examples of DNA fragments of the present invention are those having a nucleotide sequence of SEQ ID No. 3 and SEQ ID No. 4. The DNA fragments of the present invention, however, are not limited to them. Any DNA fragments capable of encoding an amino acid sequence constituting the thrombin-binding substance which is the target of the present invention, i.e., the Sequence A, preferably SEQ ID No. 1 and SEQ ID No. 2, are included in the present invention.
The construction of the recombinant vector containing the DNA fragment of the present invention may be carried out by connecting the DNA fragment of the present invention with a replicable expression vector.
As the expression vector, those from any sources, e.g., procaryotes (typically E. coli), yeasts, insect viruses, vertebrate viruses, etc., can be used, so long as they are replicable.
In order to ensure efficient production of the thrombin-binding substance, it is desirable that the recombinant expression vector be constructed from the following nucleotide sequences (1) to (7) in this order toward the downstream direction of the transcription.
(1) A nucleotide sequence acting as a promoter.
(2) A nucleotide sequence functioning as a ribosome binding site.
(3) A nucleotide sequence acting as a initiation codon.
(4) A nucleotide sequence encoding a signal peptide.
(5) A nucleotide sequence encoding the amino acid sequence of Sequence (A).
(6) A nucleotide sequence acting as a termination codon.
(7) A nucleotide sequence acting as a poly A addition signal.
A plasmid DNA is preferably used as a vector, for instance, a plasmid which can multiply itself, e.g., in E. coli as a host microorganism, and can express the inserted gene by transforming mammalian cells. Such a plasmid DNA comprises nucleotide sequences required for the plasmid to multiply itself in E. coli, such as a nucleotide sequence acting as a replicator of ColEI plasmid series, a nucleotide sequence acting as a promoter in mammalian cells, a gene functioning as a selection marker of the transformed E. coli, and a gene functioning as a selection marker of the transformed mammalian cells. In a preferable embodiment, it further include a replicator nucleotide sequence such as SV40 ori, polyoma ori, or HSV ori which functions in mammalian cells. Given as preferable examples of promoters are promoters, e.g., cytomegalovirus, SV40, polyoma virus, bovine papilloma virus, adenovirus, etc; retrovirus LTR, e.g., MMTV; a promoter of metallothionein gene, and the like. Examples of E. coli selection markers are ampicillin resistant genes, kanamycin resistant genes, tetracycline resistant genes, chioramphenicol resistant genes, and the like. Given as examples of mammalian cell selection markers are neomycin resistant genes, hygromycin B resistant genes, thymidine kinase genes, dihydrofolate reductase genes, xanthine-guanine phosphoribosyl transferase genes, and the like. These genes can be used either singly or in combination of two or more.
Incorporation of the DNA fragment of the present invention into the above vectors can be carried out by cutting a DNA containing the DNA fragment with a suitable restriction endonuclease, optionally, adding a suitable linker, and combining it with the vector which is cut by a suitable restriction endonuclease. Restriction endonucleases which can be used here are, for example, Eco RI, Sph I, Pst I, Hind III, Bam HI, Xho I, Xba I, Ban III, Sma I, Nco I, and the like. Nucleotide modification enzymes such as exonuclease III, Ba131, SI nuclease, exonuclease VII, mungbean nuclease, DNA polymerase, and the like can also be used. As a linker, Eco RI linker, Sma I linker, Nco I linker, Bam HI linker, Xho I linker, Hind III linker, Pst I linker, Sph I linker, Xbal I linker, or the like may be used.
Transformed cells which can efficiently produce the recombinant vector and/or thrombin-binding substance of the present invention can be obtained by introducing the expression recombinant vector obtained by the above method into host cells by means of the competent cell method, the protoplast method, the calcium phosphate coprecipitation method, the electroporation method, the DEAE dextran method, the lipofectin method, or the like. Unicellular organisms, such as bacteria and yeasts, cultured insect cells, cultured vertebrate cells, and the like are preferably used as host cells for obtaining the transformant. Various mutants of E. coli K12 strain, e.g., HB101, C600K, JM101, JM103, JM105, JM109, MV1034, MV1184, MC1061/P3, and the like, are preferably used as E. coli host cells. Preferable examples given of mammalian cells are COS cells, CHO cells, L cells, C127 cells, NIH3T3 cells, HeLa cells, and the like.
The thrombin-binding substance can be obtained by cultivating the transformant thus obtained, extracting and separating it from the cultivated cells or the culture broth. Various natural or artificial media can be used for the cultivation of the transformed cells. The media preferably contain carbon sources such as sugars, alcohols, and salts of organic acids; nitrogen sources such as protein mixtures, amino acids, and ammonium salts; and inorganic salts. In addition, vitamins and antibiotics corresponding to the selection marker genes may preferably be included. If the vector is of the type of which the expression can be controlled, it is necessary to add a procedure for inducing the expression in the course of the cultivation. After the cultivation, the culture broth is centrifuged to separate culture liquid from the cells. In the case where the thrombin-binding substance accumulates in the cultured cells, the cells are destroyed by means of freeze-thaw, ultrasonic treatment, French press, enzyme treatment, homogenizing, or the like, and the thrombin-binding substance is dissolved by using EDTA, surfactants, urea, guanidine hydrochloride, or the like.
A purified thrombin-binding substance can be obtained by submitting the culture liquid or the cell extract containing the thrombin-binding substance thus prepared to column chromatography. Ion-exchange chromatography, affinity chromatography, e.g., that using the monoclonal antibody described in Japanese Patent Laid-open (kokai) No. 45398/1989, gel filtration chromatography, or the like can be used either independently or in combination. Among the thrombin-binding substances thus obtained those having the amino acid sequence of SEQ ID No. 1 or SEQ ID No. 2 possess the following characteristic.
(1) Amino acid sequence:
Based on the nucleotide sequence of the DNA fragments, the amino acid sequence is considered to be those shown in SEQ ID Nos. 1 and 2.
(2) Molecular weight:
55,000-100,000 determined by the SDS-polyacrylamide gel electrophoresis under under nonreduced conditions.
(3) Isoelectric point:
pH 3-4 determined by the isoelectric electrophoresis method using ampholite.
(4) Sugar analysis:
Two or more sugars are considered to be attached to the thrombin-binding substances from the molecular weight. Based on the amino acid sequence, one of the sugars is considered to be an acidic polysaccharide attached to Ser (474).
(5) Actions:
Possesses antithrombin activity.
Increases the activity of the antithrombin III.
Possesses platelet aggregation inhibitory activity.
Injection preparations are typical examples of the composition comprising the thrombin-binding substance of the present invention as an anticoagulant agent. A preferable form of such injection preparations is a freeze-dried powder which can be dissolved into distilled water or physiological saline each time it is administered. Intravenous injection is a preferable manner by which the preparation is administered.
Although a dose depends on the symptoms of the patient, the body weight, and the like, a preferable dose is 10 μg/kg to 10 mg/kg. The thrombin-binding substance of the present invention induces no abnormality with the dose of the above range. It is a quite safe substance.
Other features of the invention will become apparent in the course of the following description of the exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.
______________________________________
<Reaction Solution>
______________________________________
Distilled water 71 μl
Buffer solution* 10 μl
dNTP mixed solution (2.5 mM)
8 μl
Primer #1 (20 μM) 5 μl
Primer #2 (20 μM) 5 μl
Template DNA (1 μg/μl)
1 μl
AmpliTaq (5 units/μl) 0.5 μl
______________________________________
*Buffer solution:
0.1M potassium chloride
0.1M TrisHCl buffer (pH 8.3)
0.1% gelatin
15 mM magnesium chloride
DNA was collected from the reaction solution by ethanol precipitation, digested with Xho I and Kpn I and subjected to the agarose gel electrophoresis to obtain 1.57 kb Xho I-Kpn I fragments. Separately, the vector for the cloning pUC118 [Vieira, J. and Messing, J., Methods Enzymol., 153, 3-11 (1987)] was digested with Hind II, connected with Xho I linker, and further digested with Xho I and Kpn I to obtain vector fragments by the agarose gel electrophoresis. The vector fragments and the 1.57 kb Xho I-Kpn I fragments were ligated and E. coli MV1034 [Vieira, J. and Messing, J., Methods Enzymol., 153, 3-11 (1987)] was transformed with the ligated DNA.
Plasmid DNA was extracted from the transformant thus obtained and digested with restriction endonuclease. In this manner, 6 clones holding a plasmid to which the 1.57 kb Xho i-Kpn I fragment derived from human thrombomodulin gene was inserted were selected.
The determination of nucleotide sequences of the inserted fragments in clones thus obtained revealed 1 to 3 mutated sites in each fragment. Then, 0.31 kb Xho I-Sma I fragment from clone 2, 0.65 kb Sma I-Mlu I fragment from clone 1, and 0.62 kb Mlu I-Kpn I fragment from clone 4, all without mutated sites, were recombined with the above-mentioned vector fragment to obtain plasmid pUCTM/XHO-KPN containing an inserted fragment of the human thrombomodulin gene with the correct sequence.
In order to combine a glycosaminoglycan addition site to Asp at C-terminal of the amino acid sequence of the thrombin-binding substance derived from human urine, linkers $1 to $6 with the nucleotide sequences of SEQ ID Nos. 7 to 12, respectively, were synthesized and each 5'-end was phosphorylated.
The pUCTM/XHO-KPN was digested with Xho I and Kpn I to prepare a 1.57 kb Xho I-Kpn I fragment derived from a human thrombomodulin gene. This 1.57 kb fragment was ligated with a mammalian cell expression vector CDM8 (a product of Invitrogen Co.) which had been digested with Xho I and dephosphorylated together with linkers $1, $2, $3, and $4. The 1.57 kb fragment was also ligated with Xho I digested and dephosphorylated CDM8 with linkers $1, $2, $5, and $6. E. coli MC1061/P3 [Seed, B. and Aruffo, A., Proc. Natl. Acad. Sci., USA, 84, 3365-3369 (1987)] was transformed with the ligated DNAs. Plasmid DNAs were extracted from the transformants thus prepared and digested with restriction endonucleases to confirm the direction and the site of the insertion. 1.68 kb fragments containing the DNA fragment of the present invention were cut out by Xho I from 8 clones which showed the correct direction of insertion and the correct restriction endonuclease map. The nucleotide sequences of all clones were found to have the sequence of SEQ ID No. 13 or 14, confirming that the expression vectors were correctly constructed.
The expression vector of the present invention thus obtained were named pCDM-GAG-UTM1 and pCDM-GAG-UTM2 (FIG. 1), and the transformant harboring the vectors were named E. coli MC1061/P3 (pCDM-GAG-UTM1) and E. coli MC1061/P3 (pCDM-GAG-UTM2).
COS7 cells were transfected with pCDM-GAG-UTM1 or pCDM-GAG-UTM2 by the DEAE-Dextran method [Seed, B. and Aruffo, A., Proc. Natl. Acad. Sci., USA, 84, 3365-3369 (1987)]. 5×105 cells were inoculated into a 60 mm culture dish and, on the next day, the culture medium was aspirated and replaced by 2 ml of Dulbecco's-modified minimum essential medium (DMEM) containing 10% Nu-serum (Collaborative Research). 10 μg (1 μg/μl) of pCDM-GAG-UTM1 or pCDM-GAG-UTM2 were added to 100 μl of a 10 mg/ml DEAE-Dextran solution (average molecular weight: 5×105, a product of Pharmacia) in PBS, and the resulting solution was added to cell culture liquid together with 10 μl of 20 mM chloroquine. After cultivating for 4 hours at 37° C., the culture medium was aspirated and 2 ml of 10% DMSO (dissolved in PBS) was added. The mixture was allowed to stand at room temperature for 2 minutes. After removal of the DMSO solution by aspiration, 3 ml of DMEM containing 10% FCS was added and the mixture was cultivated at 37° C. for 24 hours. The culture medium was replaced by DMEM containing no FCS, followed by continued cultivation for a further 48 hours. After the cultivation, the supernatant was collected.
The culture medium obtained by the above procedure was passed through a 1 ml Sepharose 4B (2 mg IgG/ml resin) column with which monoclonal antibody A-73 (Japanese Patent Laid-open (kokai) No. 45398/1989; 2 mg IgG/ml resin) was combined. The column was washed with (1) 2 ml of 0.02M Tris-HCl buffer (pH 7.4) containing 0.1M NaCl, (2) 20 ml of 0.02M Tris-HCl buffer (pH 7.4) containing 1M NaCl and0.05% Tween 20, and (3) 5 ml of 0.02M Tris-HCl buffer (pH 7.4) containing 1M NaCl, followed by elution with 5 ml of 0.02M Tris-HCl buffer (pH 7.4) containing 2M sodium thiocyanate, 5 mM EDTA, and 1M NaCl. The eluate was dialyzed against 50 mM acetate buffer containing 0.1M NaCl (pH 4.5) and applied on a column of Mono-Q sepharose. The column was washed with the same buffer and eluted with linear gradient of 0.1 to 2 M NaCl in 50 mM acetate buffer (pH 4.5) to obtain purified thrombin-binding substances (r-GAG-UTM1 and r-GAG-UTM2).
CHO.K1 cells were transfected with pCDM-GAG-UTM1 by the calcium phosphate method [Gorman, C., "DNA Cloning" IRL Press, England, vol. 2, 143-190 (1985)]. 5×105 CHO.K1 cells were inoculated into a 10 cm petri dish and, on the next day, the culture medium (Ham F12 medium containing 10% FCS, hereinafter referred to as Medium) was exchanged. Four (4) hours thereafter, a coprecipitate of DNA and calcium phosphate was added. The coprecipitate used here was prepared according to the following manner. 20 μg of pCDM-GAG-UTM1 and 100 ng of neomycin resistant gene dissolved into 450 μl of 1 mM Tris-HCl buffer <pH 8.0)-0.1 EDTA and mixed with 50 μl of 2.5M calcium chloride. The mixture was added dropwise to 500 μl of solution: 50 mM HEPES (pH 7.12)-280 mM NaCl-1.5 mM sodium hydrogen phosphate, and after allowing to stand still, the solution was added to the cell culture medium for cultivation for 24 hours. The medium was replaced by a fresh one and cultivated for a further 24 hours, following which the medium was replaced by a selective medium containing 400 μg/ml G418. After 2 weeks, colonies produced were transferred to a 24-well plate and continuously cultivated until confluent. The supernatant was collected from the culture broth. The secreted thrombin-binding substance (r-GAG-UTM1) was quantitatively analyzed to select high producing clones. The cloning was further carried out on the selected clone by the limiting dilution method. The transformed cells thus obtained was named CHO-GUTM 1-8 and deposited with Fermentation Research Institute, Agency of Industrial Science and Technology (FERM P-3260).
The transformed cell CHO-GUTM 1-8 was cultured in UC202 medium (a product of Nissui Pharmaceutical Co.) containing 1% FCS in a 225 cm2 flask to become confluent, following which the medium was replaced by 50 ml of UC202 medium without containing FCS. After 1 week, the culture supernatant was collected and the same amount of the fresh medium not containing FCS was added. After cultivation for a further 1 week, the culture supernatant was collected and confirmed to contain 3-4 μg/ml thrombin-binding substance therein secreted.
The purified thrombin-binding substance was obtained according to the same procedure of the later part of Example 3.
pCDM-GAG-UTM1 was digested with Xho I to prepare a 1.7 kb fragment of soluble human modified thrombomodulin cDNA containing a site where glycosaminoglycan is bound to. Separately, a mammalian cell expression vector pBPV (a product of Pharmacia Co.) was digested with Xho I and dephosphorylated, and ligated with the cDNA fragment by the use of T4 DNA ligase for transforming E. Coli HB101 (product of TAKARA SHUZO K.K.). DNAs were extracted from the transformants thus prepared and digested with endonucleases to confirm the direction and the site of the insertion. Clones indicating the right direction and the site were selected. The expression vector of the present invention thus constructed was named pBPV-GAG-UTM1 (FIG. 2), and the transformant harboring the vector was named E. coli HB 101 (pBPV-GAG-UTM1).
In a similar manner as described in Example 4, mouse C127 cells were transfected with pBPV-GAG-U1 by the calcium phosphate method. 8×105 C127 cells were inoculated into a 10 petri dish and, on the next day, the culture medium (Dulbecco's Modified Eagle Minimal Medium (DMEM medium) containing 10% FCS) was exchanged. Four hours thereafter, a coprecipitate of DNA and calcium phosphate was added. The coprecipitate employed was prepared according to the following manner. Plasmid containing 20 μg of pBPV-GAG-UTM1 and 100 ng of neomycin resistant gene was dissolved into 450 μl of 1 mM Tris-HCl buffer (pH 8-0)-0.1 mM EDTA and mixed with 50μl of 2.5M calcium chloride. The mixture was added dropwise to 500 μl of a solution: 50 mMHEPES (pH 7.12)-280 mM NaCl-1.5 mM sodium hydrogen phosphate, and after allowing to stand over 30 minutes at room temperature, the solution was added to the cell culture medium for cultivation for 24 hours. The medium was replaced by a fresh DME medium and cultivated for a further 24 hours, and then the medium was replaced by a DME medium added with 5% FCS and containing 400 μg/ml G418. After 10 days, colonies produced were transferred to a 24-well plate and continuously cultivated up to the confluent. The supernatant was collected from the culture broth. The secreted thrombin-binding substance was quantitatively analyzed to select high producing clones. Cloning was further carried out on the selected clone by the limiting dilution method.
The selected transformed C127 cells were cultured in 5% FCS-added DMEM medium in a 1750 cm2 roller bottle to become confluent, following which the medium was replaced by 500 ml of 1% FCS-added DMEM medium. After 1 week, the culture supernatant was collected and confirmed to contain 2 μg/ml thrombin-binding substance therein secreted.
About 800 μg of a purified thrombin-binding substance (r-GAG-UTM1) was obtained according to the procedure of the latter part of Example 3.
SDS-PAGE was performed according to the Laemmli's method (Nature, 227, 680-685) on the purified thrombin-binding substances. The protein was transferred onto a PVDF membrane according to the Matsudaira's method [J. Biol. Chem., 262 (21), 10035-10038]. The PVDF membrane was then incubated in 0.05M Tris-HCl buffer (TBS) containing 0.1% bovine serum albumin and 0.1M NaCl at room temperature for 2 hours. After discharging the solution, the residue was washed thoroughly with a TBS-0.05% Tween 20, reacted with horseradish peroxidase conjugated monoclonai antibody A-60 in TBS-0.05% Tween 20 solution at room temperature for 1 hour. The solution was discharged, and the residue was washed thoroughly with a 0.05% Tween 20-TBS and put into 50 ml of an acetic acid buffer (pH 5.0) containing 5 mg of 3-amino-9-ethylcarbazole and 25 μl of 30% hydrogen peroxide to develop the color reaction to confirm a broad band which is characteristic to glycosaminoglycan adducts.
r-UTM and r-GAG-UTM1 and 2 which are the thrombin-binding substances of the present invention, 0.1 μg/ml each, were treated with 5 μl of chondroitinase (10 mU, a product of Seikagaku Kogyo K.K.) at 37° C. for 40 minutes. The immunoblotting was carried out in the same manner as in Example 5 to confirm the presence of chondroitin sulfate type glycosaminoglycan covalent bonds in the thrombin-binding substances of the present invention.
r-UTM and r-GAG-UTM1 and 2 of the thrombin-binding substance of the present invention, 2.5 μg/ml each, were mixed with human fibrinogen (2.5 mg/ml) and human antithrombin III (0 or 250 μg/ml), and dissolved in 5 mM solution of CaCl2. Bovine thrombin (0.5 U/ml) was added to the solutions to measure the clotting time. The results are shown in Table 1.
TABLE 1
______________________________________
Control r-UTM r-GAG-UTM1
r-GAG-UTM2
(sec.) (sec.) (sec.) (sec.)
______________________________________
ATIII (-)
43.3 61.8 77.2 80.1
ATIII (+)
49.5 80.8 >400 >400
______________________________________
Table I demonstrates that the thrombin-binding substances of the present invention delay blood coagulation by combining with thrombin. A remarkable promotion of the anti-coagulant activity of the thrombin-binding substances by the presence of antithrombin III are also shown.
r-UTM (9-90 nM), r-GAG-UTM1, or r-GAG-UTM2 (thrombin-binding substance of the present invention (9-90 nM), dissolved in a solution of bovine fibrinogen (1 mg/ml) in 20 mM Tris-HCl buffer (pH 7.4) containing 0.15M NaCl, was mixed with bovine thrombin (18 nM) to measure the time required for the coagulation. 50% inhibitory concentrations (IC50) were determined from the calibration curve prepared by using bovine thrombin of various concentrations. The results are shown in Table 2.
TABLE 2
______________________________________
IC.sub.50 (nM)
______________________________________
r-UTM 80
r-GAG-UTM1 16
r-GAG-UTM2 15
______________________________________
Substances of the present invention (17 nM) or r-UTM (17 nM), dissolved in a solution of bovine fibrinogen (1 mg/ml) in 20 mM Tris-HCl buffer (pH 7.4) containing 0.15M NaCl, was mixed with bovine thrombin (18 nM) to measure the time required for the coagulation. The results are shown in Table 3.
TABLE 3
______________________________________
Coagulation time (sec)
______________________________________
Control 28.1
r-UTM 29.6
r-GAG-UTM1 300.0
r-GAG-UTM2 295.3
______________________________________
To 8 μl of a solution of a substance of the present invention (10-6 -10-8 M) and platelet rich plasma (PRP) (200 μl ), prepared from blood taken from rabbit ear vein, was added 2 μM adenosine diphosphate (ADP) to measure the platelet aggregation. 50% inhibitory concentration, i.e., the concentration of the compounds of the present invention to inhibit ADP aggregation, determined based on the calibration curve which was prepared by using ADP at various concentrations, were 2×10-7 M for r-GAG-UTM1 and 2.1×10-7 M for r-GAG-UTM2. r-UTM exhibited no aggregation inhibitory activity within the tested concentration range (10-6 -10-8 M).
A catheter was inserted into the right femoral vein of Wistar rats (male) under anesthesia, and through the catheter were rapidly administered 1 mg/ml/kg of the tested compounds, r-GAG-UTM1 and r-UTM. Blood samples, 0.1 ml each, taken before the administration and 1, 3, 6, 10, 20, 30, 60, and 120 minutes after the administration were mixed with heparin and served as plasma samples for the determination of the blood concentration. The measurement of the blood concentration was performed according to the sandwich ELISA method using an anti-human thrombin-binding monoclonal antibody. Both tested compounds were found to be analyzable with the one-compartment model. The results are shown in the following Table.
TABLE 4
______________________________________
r-GAG-UTM1 (n = 3)
r-UTM (n = 5)
______________________________________
T.sub.1/2 (min)
75.2 ± 10.8 45.4 ± 2.6
AUC (min · μg/ml)
1380 ± 61 872 ± 64
______________________________________
As illustrated above thrombin-binding substances of the present invention promote antithrombin III activity and inhibit platelet aggregation, and by themselves possess antithrombin activity. Thus, they are useful as an effective component of anticoagulant agents. Furthermore, the thrombin-binding substance of the present invention can be produced inexpensively in a large scale.
Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 18 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 476 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: AlaProAlaGluPro GlnProGlyGlySerGlnCysValGluHisAsp 151015 CysPheAlaLeuTyrProGlyProAlaThrPheLeuAsnAlaSerGln 20 2530 IleCysAspGlyLeuArgGlyHisLeuMetThrValArgSerSerVal 354045 AlaAlaAspValIleSer LeuLeuLeuAsnGlyAspGlyGlyValGly 505560 ArgArgArgLeuTrpIleGlyLeuGlnLeuProProGlyCysGlyAsp 6570 7580 ProLysArgLeuGlyProLeuArgGlyPheGlnTrpValThrGlyAsp 859095 AsnAsnThrSerTyrSer ArgTrpAlaArgLeuAspLeuAsnGlyAla 100105110 ProLeuCysGlyProLeuCysValAlaValSerAlaAlaGluAlaThr 115 120125 ValProSerGluProIleTrpGluGluGlnGlnCysGluValLysAla 130135140 AspGlyPheLeuCysGluPheHisPheP roAlaThrCysArgProLeu 145150155160 AlaValGluProGlyAlaAlaAlaAlaAlaValSerIleThrTyrGly 165 170175 ThrProPheAlaAlaArgGlyAlaAspPheGlnAlaLeuProValGly 180185190 SerSerAlaAlaValAlaPr oLeuGlyLeuGlnLeuMetCysThrAla 195200205 ProProGlyAlaValGlnGlyHisTrpAlaArgGluAlaProGlyAla 210215 220 TrpAspCysSerValGluAsnGlyGlyCysGluHisAlaCysAsnAla 225230235240 IleProGlyAlaProArgCysGln CysProAlaGlyAlaAlaLeuGln 245250255 AlaAspGlyArgSerCysThrAlaSerAlaThrGlnSerCysAsnAsp 260 265270 LeuCysGluHisPheCysValProAsnProAspGlnProGlySerTyr 275280285 SerCysMetCysGluThrGlyTyr ArgLeuAlaAlaAspGlnHisArg 290295300 CysGluAspValAspAspCysIleLeuGluProSerProCysProGln 305310 315320 ArgCysValAsnThrGlnGlyGlyPheGluCysHisCysTyrProAsn 325330335 TyrAspLeuValAspGlyGluC ysValGluProValAspProCysPhe 340345350 ArgAlaAsnCysGluTyrGlnCysGlnProLeuAsnGlnThrSerTyr 355 360365 LeuCysValCysAlaGluGlyPheAlaProIleProHisGluProHis 370375380 ArgCysGlnMetPheCysAsnGlnThrAlaCy sProAlaAspCysAsp 385390395400 ProAsnThrGlnAlaSerCysGluCysProGluGlyTyrIleLeuAsp 405 410415 AspGlyPheIleCysThrAspIleAspGluCysGluAsnGlyGlyPhe 420425430 CysSerGlyValCysHisAsnLeu ProGlyThrPheGluCysIleCys 435440445 GlyProAspSerAlaLeuValArgHisIleGlyThrAspCysAspSer 450455 460 GlyLysValAspGluAspTyrSerGlySerGlyGlu 465470475 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 476 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: AlaProAlaGluProGlnProGlyGlySerGlnCysValGluHisAsp 151015 CysPheAlaLeuTyrProGly ProAlaThrPheLeuAsnAlaSerGln 202530 IleCysAspGlyLeuArgGlyHisLeuMetThrValArgSerSerVal 35 4045 AlaAlaAspValIleSerLeuLeuLeuAsnGlyAspGlyGlyValGly 505560 ArgArgArgLeuTrpIleGlyLeuGlnLeuPro ProGlyCysGlyAsp 65707580 ProLysArgLeuGlyProLeuArgGlyPheGlnTrpValThrGlyAsp 85 9095 AsnAsnThrSerTyrSerArgTrpAlaArgLeuAspLeuAsnGlyAla 100105110 ProLeuCysGlyProLeuCysValAl aValSerAlaAlaGluAlaThr 115120125 ValProSerGluProIleTrpGluGluGlnGlnCysGluValLysAla 130135 140 AspGlyPheLeuCysGluPheHisPheProAlaThrCysArgProLeu 145150155160 AlaValGluProGlyAlaAlaAlaAlaAla ValSerIleThrTyrGly 165170175 ThrProPheAlaAlaArgGlyAlaAspPheGlnAlaLeuProValGly 180 185190 SerSerAlaAlaValAlaProLeuGlyLeuGlnLeuMetCysThrAla 195200205 ProProGlyAlaValGlnGlyHisTrpAla ArgGluAlaProGlyAla 210215220 TrpAspCysSerValGluAsnGlyGlyCysGluHisAlaCysAsnAla 225230235 240 IleProGlyAlaProArgCysGlnCysProAlaGlyAlaAlaLeuGln 245250255 AlaAspGlyArgSerCysThrAlaSerA laThrGlnSerCysAsnAsp 260265270 LeuCysGluHisPheCysValProAsnProAspGlnProGlySerTyr 275280 285 SerCysMetCysGluThrGlyTyrArgLeuAlaAlaAspGlnHisArg 290295300 CysGluAspValAspAspCysIleLeuGluProSerPr oCysProGln 305310315320 ArgCysValAsnThrGlnGlyGlyPheGluCysHisCysTyrProAsn 325330 335 TyrAspLeuValAspGlyGluCysValGluProValAspProCysPhe 340345350 ArgAlaAsnCysGluTyrGlnCysGlnPro LeuAsnGlnThrSerTyr 355360365 LeuCysValCysAlaGluGlyPheAlaProIleProHisGluProHis 370375 380 ArgCysGlnMetPheCysAsnGlnThrAlaCysProAlaAspCysAsp 385390395400 ProAsnThrGlnAlaSerCysGluCysProGlu GlyTyrIleLeuAsp 405410415 AspGlyPheIleCysThrAspIleAspGluCysGluAsnGlyGlyPhe 420425 430 CysSerGlyValCysHisAsnLeuProGlyThrPheGluCysIleCys 435440445 GlyProAspSerAlaLeuValArgHisIleGlyT hrAspCysAspSer 450455460 GlyLysValAspAspGluAlaSerGlySerGlyAsp 465470475 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1428 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GCACCCGCAGAGCCGCAGCCGGGTGGCAGCCAGTGCGTCGAGCACGACTGCTTCGCGCTC60 TACCCGGGCCCCGCGA CCTTCCTCAATGCCAGTCAGATCTGCGACGGACTGCGGGGCCAC120 CTAATGACAGTGCGCTCCTCGGTGGCTGCCGATGTCATTTCCTTGCTACTGAACGGCGAC180 GGCGGCGTTGGCCGCCGGCGCCTCTGGATCGGCCTGCAGCTGCCACCCGGCTGCGGCGAC 240 CCCAAGCGCCTCGGGCCCCTGCGCGGCTTCCAGTGGGTTACGGGAGACAACAACACCAGC300 TATAGCAGGTGGGCACGGCTCGACCTCAATGGGGCTCCCCTCTGCGGCCCGTTGTGCGTC360 GCTGTCTCCGCTGCTGAGGCCACTGTGCCCAGCGAGCCG ATCTGGGAGGAGCAGCAGTGC420 GAAGTGAAGGCCGATGGCTTCCTCTGCGAGTTCCACTTCCCAGCCACCTGCAGGCCACTG480 GCTGTGGAGCCCGGCGCCGCGGCTGCCGCCGTCTCGATCACCTACGGCACCCCGTTCGCG540 GCCCGCGGAGCGGACT TCCAGGCGCTGCCGGTGGGCAGCTCCGCCGCGGTGGCTCCCCTC600 GGCTTACAGCTAATGTGCACCGCGCCGCCCGGAGCGGTCCAGGGGCACTGGGCCAGGGAG660 GCGCCGGGCGCTTGGGACTGCAGCGTGGAGAACGGCGGCTGCGAGCACGCGTGCAATGCG 720 ATCCCTGGGGCTCCCCGCTGCCAGTGCCCAGCCGGCGCCGCCCTGCAGGCAGACGGGCGC780 TCCTGCACCGCATCCGCGACGCAGTCCTGCAACGACCTCTGCGAGCACTTCTGCGTTCCC840 AACCCCGACCAGCCGGGCTCCTACTCGTGCATGTGCGAG ACCGGCTACCGGCTGGCGGCC900 GACCAACACCGGTGCGAGGACGTGGATGACTGCATACTGGAGCCCAGTCCGTGTCCGCAG960 CGCTGTGTCAACACACAGGGTGGCTTCGAGTGCCACTGCTACCCTAACTACGACCTGGTG1020 GACGGCGAGTGTGTGG AGCCCGTGGACCCGTGCTTCAGAGCCAACTGCGAGTACCAGTGC1080 CAGCCCCTGAACCAAACTAGCTACCTCTGCGTCTGCGCCGAGGGCTTCGCGCCCATTCCC1140 CACGAGCCGCACAGGTGCCAGATGTTTTGCAACCAGACTGCCTGTCCAGCCGACTGCGAC 1200 CCCAACACCCAGGCTAGCTGTGAGTGCCCTGAAGGCTACATCCTGGACGACGGTTTCATC1260 TGCACGGACATCGACGAGTGCGAAAACGGCGGCTTCTGCTCCGGGGTGTGCCACAACCTC1320 CCCGGTACCTTCGAGTGCATCTGCGGGCCCGACTCGGCC CTTGTCCGCCACATTGGCACC1380 GACTGTGACTCCGGCAAGGTGGACGAGGACTATAGCGGCTCTGGCGAG1428 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1428 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: GCACCCGCAGAGCCGCAGCCGGGTGGCAGCCAGTGCGTCGAGCACGACTGCTTCGCGCTC60 TACCCGGGCCCCGCGACCTTCCTCAATGCCAGTCAGATCTGCGACGGACTGCGGGGCCAC120 CTAATGACAGTGC GCTCCTCGGTGGCTGCCGATGTCATTTCCTTGCTACTGAACGGCGAC180 GGCGGCGTTGGCCGCCGGCGCCTCTGGATCGGCCTGCAGCTGCCACCCGGCTGCGGCGAC240 CCCAAGCGCCTCGGGCCCCTGCGCGGCTTCCAGTGGGTTACGGGAGACAACAACACCAG C300 TATAGCAGGTGGGCACGGCTCGACCTCAATGGGGCTCCCCTCTGCGGCCCGTTGTGCGTC360 GCTGTCTCCGCTGCTGAGGCCACTGTGCCCAGCGAGCCGATCTGGGAGGAGCAGCAGTGC420 GAAGTGAAGGCCGATGGCTTCCTCTGCGAGTTCCAC TTCCCAGCCACCTGCAGGCCACTG480 GCTGTGGAGCCCGGCGCCGCGGCTGCCGCCGTCTCGATCACCTACGGCACCCCGTTCGCG540 GCCCGCGGAGCGGACTTCCAGGCGCTGCCGGTGGGCAGCTCCGCCGCGGTGGCTCCCCTC600 GGCTTACAGCTAA TGTGCACCGCGCCGCCCGGAGCGGTCCAGGGGCACTGGGCCAGGGAG660 GCGCCGGGCGCTTGGGACTGCAGCGTGGAGAACGGCGGCTGCGAGCACGCGTGCAATGCG720 ATCCCTGGGGCTCCCCGCTGCCAGTGCCCAGCCGGCGCCGCCCTGCAGGCAGACGGGCG C780 TCCTGCACCGCATCCGCGACGCAGTCCTGCAACGACCTCTGCGAGCACTTCTGCGTTCCC840 AACCCCGACCAGCCGGGCTCCTACTCGTGCATGTGCGAGACCGGCTACCGGCTGGCGGCC900 GACCAACACCGGTGCGAGGACGTGGATGACTGCATA CTGGAGCCCAGTCCGTGTCCGCAG960 CGCTGTGTCAACACACAGGGTGGCTTCGAGTGCCACTGCTACCCTAACTACGACCTGGTG1020 GACGGCGAGTGTGTGGAGCCCGTGGACCCGTGCTTCAGAGCCAACTGCGAGTACCAGTGC1080 CAGCCCCTGAACC AAACTAGCTACCTCTGCGTCTGCGCCGAGGGCTTCGCGCCCATTCCC1140 CACGAGCCGCACAGGTGCCAGATGTTTTGCAACCAGACTGCCTGTCCAGCCGACTGCGAC1200 CCCAACACCCAGGCTAGCTGTGAGTGCCCTGAAGGCTACATCCTGGACGACGGTTTCAT C1260 TGCACGGACATCGACGAGTGCGAAAACGGCGGCTTCTGCTCCGGGGTGTGCCACAACCTC1320 CCCGGTACCTTCGAGTGCATCTGCGGGCCCGACTCGGCCCTTGTCCGCCACATTGGCACC1380 GACTGTGACTCCGGCAAGGTCGACGACGAGGCCAGC GGCTCTGGCGAC1428 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid; (A) DESCRIPTION: DNA (synthetic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: AGGGCCGGGCACTTATAA ACT21 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid; (A) DESCRIPTION: DNA (synthetic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CCCAGTGGTCCAGTGACGTCA21 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid; (A) DESCRIPTION: DNA (synthetic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CTTCGAGTGCATCTGCGGGCCCGACTCGGCCCTTGTCCG39 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 49 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid; (A) DESCRIPTION: DNA (synthetic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: ATGTGGCGGACAAGGGCCGAGTCGGGCCCGCAGATGCACTCGAAGGTAC49 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 65 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid; (A) DESCRIPTION: DNA (synthetic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: CCACATTGGCACCGACTGTGACTCCGGCAAGGTGGACGAGGACTATAGCGGCTCTGGCGA60 GTGAC 65 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 63 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid; (A) DESCRIPTION: DNA (synthetic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: TCGAGTCACTCGCCAGAGCCGCTATAGTCCTCGTCCACCT TGCCGGAGTCACAGTCGGTG60 CCA63 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 65 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid; (A) DESCRIPTION: DNA (synthetic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: CCACATTGGCACCGACTGTGACTCCGGCAAGGTCGACGACGAGGCCAGCGGCTCTGGCGA60 CTGAC65 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 63 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: Other nucleic acid; (A) DESCRIPTION: DNA (synthetic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: TCGAGTCAGTCGCCAGAGCCGCTGGCCTCGTCGTCGACCTTGCCGGAGTC ACAGTCGGTG60 CCA63 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1680 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA (ix) FEATURE: (A) NAME/KEY: sigpeptide (B) LOCATION: 190..243 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 190..1671 (ix) FEATURE: (A) NAME/KEY: matpeptide (B) LOCATION: 244..1671 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: CTCGAGCCCTGGCCGATCCGCATGTCAGAGGCTGC CTCGCAGGGGCTGCGCGCAGCGGCA60 AGAAGTGTCTGGGCTGGGACGGACAGGAGAGGCTGTCGCCATCGGCGTCCTGTGCCCCTC120 TGCTCCGGCACGGCCCTGTCGCAGTGCCCGCGCTTTCCCCGGCGCCTGCACGCGGCGCGC180 CTGGGTAACATG CTTGGGGTCCTGGTCCTTGGCGCGCTGGCCCTGGCC228 MetLeuGlyValLeuValLeuGlyAlaLeuAlaLeuAla 18-15-10 GGCCTGGGGTTCCCCGCACCC GCAGAGCCGCAGCCGGGTGGCAGCCAG276 GlyLeuGlyPheProAlaProAlaGluProGlnProGlyGlySerGln 51510 TGCGTCGAGCACGACTGCTT CGCGCTCTACCCGGGCCCCGCGACCTTC324 CysValGluHisAspCysPheAlaLeuTyrProGlyProAlaThrPhe 152025 CTCAATGCCAGTCAGATCTGCG ACGGACTGCGGGGCCACCTAATGACA372 LeuAsnAlaSerGlnIleCysAspGlyLeuArgGlyHisLeuMetThr 303540 GTGCGCTCCTCGGTGGCTGCCGATGTC ATTTCCTTGCTACTGAACGGC420 ValArgSerSerValAlaAlaAspValIleSerLeuLeuLeuAsnGly 455055 GACGGCGGCGTTGGCCGCCGGCGCCTCTGGATCGGC CTGCAGCTGCCA468 AspGlyGlyValGlyArgArgArgLeuTrpIleGlyLeuGlnLeuPro 60657075 CCCGGCTGCGGCGACCCCAAGCGCCTCGGGCC CCTGCGCGGCTTCCAG516 ProGlyCysGlyAspProLysArgLeuGlyProLeuArgGlyPheGln 808590 TGGGTTACGGGAGACAACAACACCAGCTATA GCAGGTGGGCACGGCTC564 TrpValThrGlyAspAsnAsnThrSerTyrSerArgTrpAlaArgLeu 95100105 GACCTCAATGGGGCTCCCCTCTGCGGCCCGTTG TGCGTCGCTGTCTCC612 AspLeuAsnGlyAlaProLeuCysGlyProLeuCysValAlaValSer 110115120 GCTGCTGAGGCCACTGTGCCCAGCGAGCCGATCTGGGAG GAGCAGCAG660 AlaAlaGluAlaThrValProSerGluProIleTrpGluGluGlnGln 125130135 TGCGAAGTGAAGGCCGATGGCTTCCTCTGCGAGTTCCACTTCCCAGC C708 CysGluValLysAlaAspGlyPheLeuCysGluPheHisPheProAla 140145150155 ACCTGCAGGCCACTGGCTGTGGAGCCCGGCGCCGCGGCTGCCG CCGTC756 ThrCysArgProLeuAlaValGluProGlyAlaAlaAlaAlaAlaVal 160165170 TCGATCACCTACGGCACCCCGTTCGCGGCCCGCGGAGCGGAC TTCCAG804 SerIleThrTyrGlyThrProPheAlaAlaArgGlyAlaAspPheGln 175180185 GCGCTGCCGGTGGGCAGCTCCGCCGCGGTGGCTCCCCTCGGCTTA CAG852 AlaLeuProValGlySerSerAlaAlaValAlaProLeuGlyLeuGln 190195200 CTAATGTGCACCGCGCCGCCCGGAGCGGTCCAGGGGCACTGGGCCAGG 900 LeuMetCysThrAlaProProGlyAlaValGlnGlyHisTrpAlaArg 205210215 GAGGCGCCGGGCGCTTGGGACTGCAGCGTGGAGAACGGCGGCTGCGAG948 Glu AlaProGlyAlaTrpAspCysSerValGluAsnGlyGlyCysGlu 220225230235 CACGCGTGCAATGCGATCCCTGGGGCTCCCCGCTGCCAGTGCCCAGCC996 HisAlaCysAsnAlaIleProGlyAlaProArgCysGlnCysProAla 240245250 GGCGCCGCCCTGCAGGCAGACGGGCGCTCCTGCACCGCATCCGCGACG104 4 GlyAlaAlaLeuGlnAlaAspGlyArgSerCysThrAlaSerAlaThr 255260265 CAGTCCTGCAACGACCTCTGCGAGCACTTCTGCGTTCCCAACCCCGAC1092 GlnSerCysAsnAspLeuCysGluHisPheCysValProAsnProAsp 270275280 CAGCCGGGCTCCTACTCGTGCATGTGCGAGACCGGCTACCGGCTGGCG1140 GlnPro GlySerTyrSerCysMetCysGluThrGlyTyrArgLeuAla 285290295 GCCGACCAACACCGGTGCGAGGACGTGGATGACTGCATACTGGAGCCC1188 AlaAspGlnHisAr gCysGluAspValAspAspCysIleLeuGluPro 300305310315 AGTCCGTGTCCGCAGCGCTGTGTCAACACACAGGGTGGCTTCGAGTGC1236 SerProCysP roGlnArgCysValAsnThrGlnGlyGlyPheGluCys 320325330 CACTGCTACCCTAACTACGACCTGGTGGACGGCGAGTGTGTGGAGCCC1284 HisCysTyr ProAsnTyrAspLeuValAspGlyGluCysValGluPro 335340345 GTGGACCCGTGCTTCAGAGCCAACTGCGAGTACCAGTGCCAGCCCCTG1332 ValAspProCys PheArgAlaAsnCysGluTyrGlnCysGlnProLeu 350355360 AACCAAACTAGCTACCTCTGCGTCTGCGCCGAGGGCTTCGCGCCCATT1380 AsnGlnThrSerTyrLe uCysValCysAlaGluGlyPheAlaProIle 365370375 CCCCACGAGCCGCACAGGTGCCAGATGTTTTGCAACCAGACTGCCTGT1428 ProHisGluProHisArgCysGlnM etPheCysAsnGlnThrAlaCys 380385390395 CCAGCCGACTGCGACCCCAACACCCAGGCTAGCTGTGAGTGCCCTGAA1476 ProAlaAspCysAspProAsn ThrGlnAlaSerCysGluCysProGlu 400405410 GGCTACATCCTGGACGACGGTTTCATCTGCACGGACATCGACGAGTGC1524 GlyTyrIleLeuAspAspGly PheIleCysThrAspIleAspGluCys 415420425 GAAAACGGCGGCTTCTGCTCCGGGGTGTGCCACAACCTCCCCGGTACC1572 GluAsnGlyGlyPheCysSerGl yValCysHisAsnLeuProGlyThr 430435440 TTCGAGTGCATCTGCGGGCCCGACTCGGCCCTTGTCCGCCACATTGGC1620 PheGluCysIleCysGlyProAspSerA laLeuValArgHisIleGly 445450455 ACCGACTGTGACTCCGGCAAGGTGGACGAGGACTATAGCGGCTCTGGC1668 ThrAspCysAspSerGlyLysValAspGluAspTyr SerGlySerGly 460465470475 GAGTGACTCGAG1680 Glu (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 494 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: MetLeuGlyValLeuValLeuGlyAlaLeuAlaLeuAlaGlyLeuGly 18-15-10-5 PheP roAlaProAlaGluProGlnProGlyGlySerGlnCysValGlu 1510 HisAspCysPheAlaLeuTyrProGlyProAlaThrPheLeuAsnAla 1520 2530 SerGlnIleCysAspGlyLeuArgGlyHisLeuMetThrValArgSer 354045 SerValAlaAlaAspValIleSer LeuLeuLeuAsnGlyAspGlyGly 505560 ValGlyArgArgArgLeuTrpIleGlyLeuGlnLeuProProGlyCys 6570 75 GlyAspProLysArgLeuGlyProLeuArgGlyPheGlnTrpValThr 808590 GlyAspAsnAsnThrSerTyrSerArgTrpAlaArgLeuAspLeuAsn 95 100105110 GlyAlaProLeuCysGlyProLeuCysValAlaValSerAlaAlaGlu 115120125 AlaThrValProS erGluProIleTrpGluGluGlnGlnCysGluVal 130135140 LysAlaAspGlyPheLeuCysGluPheHisPheProAlaThrCysArg 1451 50155 ProLeuAlaValGluProGlyAlaAlaAlaAlaAlaValSerIleThr 160165170 TyrGlyThrProPheAlaAlaArgGlyAlaAspPheGlnAlaLeu Pro 175180185190 ValGlySerSerAlaAlaValAlaProLeuGlyLeuGlnLeuMetCys 195200205 Th rAlaProProGlyAlaValGlnGlyHisTrpAlaArgGluAlaPro 210215220 GlyAlaTrpAspCysSerValGluAsnGlyGlyCysGluHisAlaCys 225 230235 AsnAlaIleProGlyAlaProArgCysGlnCysProAlaGlyAlaAla 240245250 LeuGlnAlaAspGlyArgSerCysThrAlaSerA laThrGlnSerCys 255260265270 AsnAspLeuCysGluHisPheCysValProAsnProAspGlnProGly 275280 285 SerTyrSerCysMetCysGluThrGlyTyrArgLeuAlaAlaAspGln 290295300 HisArgCysGluAspValAspAspCysIleLeuGluProSerProCys 305310315 ProGlnArgCysValAsnThrGlnGlyGlyPheGluCysHisCysTyr 320325330 ProAsnTyrAspLeuValAspGl yGluCysValGluProValAspPro 335340345350 CysPheArgAlaAsnCysGluTyrGlnCysGlnProLeuAsnGlnThr 355 360365 SerTyrLeuCysValCysAlaGluGlyPheAlaProIleProHisGlu 370375380 ProHisArgCysGlnMetPheCysAsnGlnThrAlaC ysProAlaAsp 385390395 CysAspProAsnThrGlnAlaSerCysGluCysProGluGlyTyrIle 400405410 LeuAspAspGly PheIleCysThrAspIleAspGluCysGluAsnGly 415420425430 GlyPheCysSerGlyValCysHisAsnLeuProGlyThrPheGluCys 435 440445 IleCysGlyProAspSerAlaLeuValArgHisIleGlyThrAspCys 450455460 AspSerGlyLysValAspGluAspTy rSerGlySerGlyGlu 465470475 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1680 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA to mRNA (ix) FEATURE: (A) NAME/KEY: sigpeptide (B) LOCATION: 190..243 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 190..1671 (ix) FEATURE: (A) NAME/KEY: matpeptide (B) LOCATION: 244..1671 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: CTCGAGCCCTGGCCGATCCGCATGTCAGAGGCTGCCTCGCAGGGGCTGCGCG CAGCGGCA60 AGAAGTGTCTGGGCTGGGACGGACAGGAGAGGCTGTCGCCATCGGCGTCCTGTGCCCCTC120 TGCTCCGGCACGGCCCTGTCGCAGTGCCCGCGCTTTCCCCGGCGCCTGCACGCGGCGCGC180 CTGGGTAACATGCTTGGGGTCCTGGT CCTTGGCGCGCTGGCCCTGGCC228 MetLeuGlyValLeuValLeuGlyAlaLeuAlaLeuAla 18-15-10 GGCCTGGGGTTCCCCGCACCCGCAGAGCCGCAGCC GGGTGGCAGCCAG276 GlyLeuGlyPheProAlaProAlaGluProGlnProGlyGlySerGln 51510 TGCGTCGAGCACGACTGCTTCGCGCTCTACCCGG GCCCCGCGACCTTC324 CysValGluHisAspCysPheAlaLeuTyrProGlyProAlaThrPhe 152025 CTCAATGCCAGTCAGATCTGCGACGGACTGCGGGGC CACCTAATGACA372 LeuAsnAlaSerGlnIleCysAspGlyLeuArgGlyHisLeuMetThr 303540 GTGCGCTCCTCGGTGGCTGCCGATGTCATTTCCTTGCTACTG AACGGC420 ValArgSerSerValAlaAlaAspValIleSerLeuLeuLeuAsnGly 455055 GACGGCGGCGTTGGCCGCCGGCGCCTCTGGATCGGCCTGCAGCTGCCA 468 AspGlyGlyValGlyArgArgArgLeuTrpIleGlyLeuGlnLeuPro 60657075 CCCGGCTGCGGCGACCCCAAGCGCCTCGGGCCCCTGCGCGGCTTCC AG516 ProGlyCysGlyAspProLysArgLeuGlyProLeuArgGlyPheGln 808590 TGGGTTACGGGAGACAACAACACCAGCTATAGCAGGTGGGCACGG CTC564 TrpValThrGlyAspAsnAsnThrSerTyrSerArgTrpAlaArgLeu 95100105 GACCTCAATGGGGCTCCCCTCTGCGGCCCGTTGTGCGTCGCTGTCTCC 612 AspLeuAsnGlyAlaProLeuCysGlyProLeuCysValAlaValSer 110115120 GCTGCTGAGGCCACTGTGCCCAGCGAGCCGATCTGGGAGGAGCAGCAG6 60 AlaAlaGluAlaThrValProSerGluProIleTrpGluGluGlnGln 125130135 TGCGAAGTGAAGGCCGATGGCTTCCTCTGCGAGTTCCACTTCCCAGCC708 CysGlu ValLysAlaAspGlyPheLeuCysGluPheHisPheProAla 140145150155 ACCTGCAGGCCACTGGCTGTGGAGCCCGGCGCCGCGGCTGCCGCCGTC756 Th rCysArgProLeuAlaValGluProGlyAlaAlaAlaAlaAlaVal 160165170 TCGATCACCTACGGCACCCCGTTCGCGGCCCGCGGAGCGGACTTCCAG804 S erIleThrTyrGlyThrProPheAlaAlaArgGlyAlaAspPheGln 175180185 GCGCTGCCGGTGGGCAGCTCCGCCGCGGTGGCTCCCCTCGGCTTACAG852 Ala LeuProValGlySerSerAlaAlaValAlaProLeuGlyLeuGln 190195200 CTAATGTGCACCGCGCCGCCCGGAGCGGTCCAGGGGCACTGGGCCAGG900 LeuMetCys ThrAlaProProGlyAlaValGlnGlyHisTrpAlaArg 205210215 GAGGCGCCGGGCGCTTGGGACTGCAGCGTGGAGAACGGCGGCTGCGAG948 GluAlaProGlyAlaTr pAspCysSerValGluAsnGlyGlyCysGlu 220225230235 CACGCGTGCAATGCGATCCCTGGGGCTCCCCGCTGCCAGTGCCCAGCC996 HisAlaCysAsnA laIleProGlyAlaProArgCysGlnCysProAla 240245250 GGCGCCGCCCTGCAGGCAGACGGGCGCTCCTGCACCGCATCCGCGACG1044 GlyAlaAlaLeu GlnAlaAspGlyArgSerCysThrAlaSerAlaThr 255260265 CAGTCCTGCAACGACCTCTGCGAGCACTTCTGCGTTCCCAACCCCGAC1092 GlnSerCysAsnAsp LeuCysGluHisPheCysValProAsnProAsp 270275280 CAGCCGGGCTCCTACTCGTGCATGTGCGAGACCGGCTACCGGCTGGCG1140 GlnProGlySerTyrSerCy sMetCysGluThrGlyTyrArgLeuAla 285290295 GCCGACCAACACCGGTGCGAGGACGTGGATGACTGCATACTGGAGCCC1188 AlaAspGlnHisArgCysGluAspValA spAspCysIleLeuGluPro 300305310315 AGTCCGTGTCCGCAGCGCTGTGTCAACACACAGGGTGGCTTCGAGTGC1236 SerProCysProGlnArgCysVal AsnThrGlnGlyGlyPheGluCys 320325330 CACTGCTACCCTAACTACGACCTGGTGGACGGCGAGTGTGTGGAGCCC1284 HisCysTyrProAsnTyrAspLeu ValAspGlyGluCysValGluPro 335340345 GTGGACCCGTGCTTCAGAGCCAACTGCGAGTACCAGTGCCAGCCCCTG1332 ValAspProCysPheArgAlaAsnCy sGluTyrGlnCysGlnProLeu 350355360 AACCAAACTAGCTACCTCTGCGTCTGCGCCGAGGGCTTCGCGCCCATT1380 AsnGlnThrSerTyrLeuCysValCysAlaG luGlyPheAlaProIle 365370375 CCCCACGAGCCGCACAGGTGCCAGATGTTTTGCAACCAGACTGCCTGT1428 ProHisGluProHisArgCysGlnMetPheCysAsnGln ThrAlaCys 380385390395 CCAGCCGACTGCGACCCCAACACCCAGGCTAGCTGTGAGTGCCCTGAA1476 ProAlaAspCysAspProAsnThrGlnAlaSerCys GluCysProGlu 400405410 GGCTACATCCTGGACGACGGTTTCATCTGCACGGACATCGACGAGTGC1524 GlyTyrIleLeuAspAspGlyPheIleCysThrAs pIleAspGluCys 415420425 GAAAACGGCGGCTTCTGCTCCGGGGTGTGCCACAACCTCCCCGGTACC1572 GluAsnGlyGlyPheCysSerGlyValCysHisAsnL euProGlyThr 430435440 TTCGAGTGCATCTGCGGGCCCGACTCGGCCCTTGTCCGCCACATTGGC1620 PheGluCysIleCysGlyProAspSerAlaLeuValArgHis IleGly 445450455 ACCGACTGTGACTCCGGCAAGGTCGACGACGAGGCCAGCGGCTCTGGC1668 ThrAspCysAspSerGlyLysValAspAspGluAlaSerGlySerGly 46 0465470475 GACTGACTCGAG1680 Asp (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 494 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: MetLeuGlyValLeuValLeuGlyAlaLeuAlaLeuAlaGlyLeuGly 18-15-10-5 PheProAlaProAlaGlu ProGlnProGlyGlySerGlnCysValGlu 1510 HisAspCysPheAlaLeuTyrProGlyProAlaThrPheLeuAsnAla 152025 30 SerGlnIleCysAspGlyLeuArgGlyHisLeuMetThrValArgSer 354045 SerValAlaAlaAspValIleSerLeuLeuLeuAsnGly AspGlyGly 505560 ValGlyArgArgArgLeuTrpIleGlyLeuGlnLeuProProGlyCys 657075 GlyAspP roLysArgLeuGlyProLeuArgGlyPheGlnTrpValThr 808590 GlyAspAsnAsnThrSerTyrSerArgTrpAlaArgLeuAspLeuAsn 95100 105110 GlyAlaProLeuCysGlyProLeuCysValAlaValSerAlaAlaGlu 115120125 AlaThrValProSerGluProIleTrp GluGluGlnGlnCysGluVal 130135140 LysAlaAspGlyPheLeuCysGluPheHisPheProAlaThrCysArg 145150 155 ProLeuAlaValGluProGlyAlaAlaAlaAlaAlaValSerIleThr 160165170 TyrGlyThrProPheAlaAlaArgGlyAlaAspPheGlnAlaLeuPro 175 180185190 ValGlySerSerAlaAlaValAlaProLeuGlyLeuGlnLeuMetCys 195200205 ThrAlaProProGlyA laValGlnGlyHisTrpAlaArgGluAlaPro 210215220 GlyAlaTrpAspCysSerValGluAsnGlyGlyCysGluHisAlaCys 225230 235 AsnAlaIleProGlyAlaProArgCysGlnCysProAlaGlyAlaAla 240245250 LeuGlnAlaAspGlyArgSerCysThrAlaSerAlaThrGlnSerCys 255260265270 AsnAspLeuCysGluHisPheCysValProAsnProAspGlnProGly 275280285 SerTy rSerCysMetCysGluThrGlyTyrArgLeuAlaAlaAspGln 290295300 HisArgCysGluAspValAspAspCysIleLeuGluProSerProCys 305 310315 ProGlnArgCysValAsnThrGlnGlyGlyPheGluCysHisCysTyr 320325330 ProAsnTyrAspLeuValAspGlyGluCysValGluP roValAspPro 335340345350 CysPheArgAlaAsnCysGluTyrGlnCysGlnProLeuAsnGlnThr 355360 365 SerTyrLeuCysValCysAlaGluGlyPheAlaProIleProHisGlu 370375380 ProHisArgCysGlnMetPheCysAsnGlnThrAlaCysProAlaAsp 385390395 CysAspProAsnThrGlnAlaSerCysGluCysProGluGlyTyrIle 400405410 LeuAspAspGlyPheIleCysThrAs pIleAspGluCysGluAsnGly 415420425430 GlyPheCysSerGlyValCysHisAsnLeuProGlyThrPheGluCys 43544 0445 IleCysGlyProAspSerAlaLeuValArgHisIleGlyThrAspCys 450455460 AspSerGlyLysValAspAspGluAlaSerGlySerGlyA sp 465470475 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 1 (D) OTHER INFORMATION: /note="acidic amino acid" (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 2 (D) OTHER INFORMATION: /note="acidic amino acid" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: XaaXaaXaaSerGlySerGlyXaa 15 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 476 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 469 (D) OTHER INFORMATION: /note="acidic amino acid" (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 470 (D) OTHER INFORMATION: /note="acidic amino acid" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: AlaProAlaGluProGlnProGlyGlySerGlnCysValGluHisAsp 151015 CysPheAlaLeuTyrProGlyProAlaThrPhe LeuAsnAlaSerGln 202530 IleCysAspGlyLeuArgGlyHisLeuMetThrValArgSerSerVal 3540 45 AlaAlaAspValIleSerLeuLeuLeuAsnGlyAspGlyGlyValGly 505560 ArgArgArgLeuTrpIleGlyLeuGlnLeuProProGlyCysGly Asp 65707580 ProLysArgLeuGlyProLeuArgGlyPheGlnTrpValThrGlyAsp 8590 95 AsnAsnThrSerTyrSerArgTrpAlaArgLeuAspLeuAsnGlyAla 100105110 ProLeuCysGlyProLeuCysValAlaValSerAlaAla GluAlaThr 115120125 ValProSerGluProIleTrpGluGluGlnGlnCysGluValLysAla 130135140 AspGlyPheLeuCysGluPheHisPheProAlaThrCysArgProLeu 145150155160 AlaValGluProGlyAlaAlaAlaAlaAlaValSerIleThr TyrGly 165170175 ThrProPheAlaAlaArgGlyAlaAspPheGlnAlaLeuProValGly 180185 190 SerSerAlaAlaValAlaProLeuGlyLeuGlnLeuMetCysThrAla 195200205 ProProGlyAlaValGlnGlyHisTrpAlaArgGluAlaProG lyAla 210215220 TrpAspCysSerValGluAsnGlyGlyCysGluHisAlaCysAsnAla 22523023524 0 IleProGlyAlaProArgCysGlnCysProAlaGlyAlaAlaLeuGln 245250255 AlaAspGlyArgSerCysThrAlaSerAlaThrGlnSerCy sAsnAsp 260265270 LeuCysGluHisPheCysValProAsnProAspGlnProGlySerTyr 275280285 SerCysMetCysGluThrGlyTyrArgLeuAlaAlaAspGlnHisArg 290295300 CysGluAspValAspAspCysIleLeuGluProSerProCysProGln 305310315320 ArgCysValAsnThrGlnGlyGlyPheGluCysHisCysTyrProAsn 325330 335 TyrAspLeuValAspGlyGluCysValGluProValAspProCysPhe 340345350 ArgAlaAsnCysGluTyrGlnCysGlnProLeuAsnGlnThr SerTyr 355360365 LeuCysValCysAlaGluGlyPheAlaProIleProHisGluProHis 370375380 Ar gCysGlnMetPheCysAsnGlnThrAlaCysProAlaAspCysAsp 385390395400 ProAsnThrGlnAlaSerCysGluCysProGluGlyTyrIleLeuA sp 405410415 AspGlyPheIleCysThrAspIleAspGluCysGluAsnGlyGlyPhe 42042543 0 CysSerGlyValCysHisAsnLeuProGlyThrPheGluCysIleCys 435440445 GlyProAspSerAlaLeuValArgHisIleGlyThrAspCysAspSe r 450455460 GlyLysValAspXaaXaaXaaSerGlySerGlyXaa 465470475
Claims (9)
1. A DNA molecule, the sequence of which encodes the amino acid sequence of SEQ ID NO: 18, wherein Xaa469 and Xaa470 are acidic amino acids and Xaa471 and Xaa472 are arbitrary amino acids.
2. The DNA molecule of claim 1, wherein the encoded polypeptide has Glu469, Asp470, Tyr471, and Glu472.
3. The DNA molecule of claim 1, wherein the encoded polypeptide has Asp469, Glu470, Ala471, and Asp472.
4. A DNA molecule having the nucleotide sequence of SEQ ID NO: 3.
5. A replicable recombinant vector comprising the DNA sequence of claim 1.
6. A vector comprising, in order (5'→3'):
a promoter sequence;
a ribosome binding sequence;
an initiation codon;
a sequence encoding a signal peptide;
a sequence encoding a mature translation product according to claim 1;
7. A DNA molecule having the nucleotide sequence of SEQ ID NO: 4.
a termination codon; and
a polyA addition signal.
8. A cultured cell transformed with the vector of claim 5.
9. A process for making a modified thrombomodulin polypeptide comprising the steps of:
cultivating the cell of claim 8 under conditions which permit the expression of the heterologous DNA, and
collecting the polypeptides produced by said cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/110,011 US5354664A (en) | 1990-11-30 | 1993-08-23 | DNA encoding a human thrombomodulin having a modified glycosaminoglycan (GAG) binding site |
Applications Claiming Priority (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2-335720 | 1990-11-30 | ||
| JP33572090 | 1990-11-30 | ||
| JP3027191 | 1991-02-25 | ||
| JP3-30271 | 1991-02-25 | ||
| US79633691A | 1991-11-22 | 1991-11-22 | |
| US08/014,723 US5273962A (en) | 1990-11-30 | 1993-02-08 | Human urinary thrombomodulin with a modified glycosaminoglycan (GAG) binding site |
| US08/110,011 US5354664A (en) | 1990-11-30 | 1993-08-23 | DNA encoding a human thrombomodulin having a modified glycosaminoglycan (GAG) binding site |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/014,723 Division US5273962A (en) | 1990-11-30 | 1993-02-08 | Human urinary thrombomodulin with a modified glycosaminoglycan (GAG) binding site |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US5354664A true US5354664A (en) | 1994-10-11 |
Family
ID=27459210
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/014,723 Expired - Lifetime US5273962A (en) | 1990-11-30 | 1993-02-08 | Human urinary thrombomodulin with a modified glycosaminoglycan (GAG) binding site |
| US08/110,011 Expired - Fee Related US5354664A (en) | 1990-11-30 | 1993-08-23 | DNA encoding a human thrombomodulin having a modified glycosaminoglycan (GAG) binding site |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/014,723 Expired - Lifetime US5273962A (en) | 1990-11-30 | 1993-02-08 | Human urinary thrombomodulin with a modified glycosaminoglycan (GAG) binding site |
Country Status (1)
| Country | Link |
|---|---|
| US (2) | US5273962A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030207343A1 (en) * | 1997-11-07 | 2003-11-06 | Dade Behring Marburg Gmbh | Method for determining the anticoagulatory potential of a sample |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0489180A4 (en) * | 1990-06-27 | 1993-03-31 | Mochida Pharmaceutical Co., Ltd. | Anticoagulant polypeptides |
| CA2399734A1 (en) * | 2000-02-08 | 2001-08-16 | Ssp Co., Ltd. | Method of detecting ligand or ligand-like low-molecular weight compound |
-
1993
- 1993-02-08 US US08/014,723 patent/US5273962A/en not_active Expired - Lifetime
- 1993-08-23 US US08/110,011 patent/US5354664A/en not_active Expired - Fee Related
Non-Patent Citations (8)
| Title |
|---|
| Bourdon, M. A., et al. (1986) J. Biol. Chem. 261(27): 12534 37. * |
| Bourdon, M. A., et al. (1986) J. Biol. Chem. 261(27): 12534-37. |
| Jackman, R. W., et al. (1987) Proc. Natl. Acad. Sci. USA 84: 6425 6429. * |
| Jackman, R. W., et al. (1987) Proc. Natl. Acad. Sci. USA 84: 6425-6429. |
| Nawa, K., et al. (1990) id. 171(2): 729 37. * |
| Nawa, K., et al. (1990) id. 171(2): 729-37. |
| Parkinson, J. F., et al. (1990) Biochem. Biophys. Res. Comm. 169(1): 177 83. * |
| Parkinson, J. F., et al. (1990) Biochem. Biophys. Res. Comm. 169(1): 177-83. |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030207343A1 (en) * | 1997-11-07 | 2003-11-06 | Dade Behring Marburg Gmbh | Method for determining the anticoagulatory potential of a sample |
Also Published As
| Publication number | Publication date |
|---|---|
| US5273962A (en) | 1993-12-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP3122127B2 (en) | Anticoagulant protein | |
| Kaufman et al. | Effect of von Willebrand factor coexpression on the synthesis and secretion of factor VIII in Chinese hamster ovary cells | |
| US5516659A (en) | Truncated thrombomodulin, recombinant production thereof, and therapeutic agent | |
| US5726147A (en) | Human mutant tissue factor compositions useful as tissue factor antagonists | |
| US5726152A (en) | Vascular endothelial cell growth factor II | |
| EP0255206B1 (en) | Peptides that inhibit von Willebrand factor binding | |
| US5238919A (en) | Peptides that inhibit von Willebrand Factor binding to the platelet SPIB receptor | |
| JP3805358B2 (en) | Von Willebrand factor therapeutic domain | |
| US5185431A (en) | Recombinant natural killer cell activator | |
| JP2002509691A (en) | Production and use of recombinant protein multimers with altered biological activity | |
| JPH05506646A (en) | Cloning and production of human von Willebrand factor and methods for its use | |
| AU646633B2 (en) | Soluble analogs of thrombomodulin | |
| JP2872255B2 (en) | High yield production method of factor VIII | |
| US5354664A (en) | DNA encoding a human thrombomodulin having a modified glycosaminoglycan (GAG) binding site | |
| EP0445681A2 (en) | Preparation of a thrombin-binding substance | |
| EP0488317B1 (en) | Thrombin-binding substance and process for preparing the same | |
| JP3534434B2 (en) | Signal peptide for expression of thrombomodulins | |
| JP2553425B2 (en) | Thrombin-binding substance and method for producing the same | |
| AU651330B2 (en) | Novel proteins with oncostatin M activity and process for their preparation | |
| WO1992006999A1 (en) | Therapeutic fragments of von willebrand factor | |
| DE4328336A1 (en) | Thrombin inhibitor from the saliva of protostomes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| CC | Certificate of correction | ||
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| FPAY | Fee payment |
Year of fee payment: 8 |
|
| REMI | Maintenance fee reminder mailed | ||
| LAPS | Lapse for failure to pay maintenance fees | ||
| STCH | Information on status: patent discontinuation |
Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
|
| FP | Lapsed due to failure to pay maintenance fee |
Effective date: 20061011 |