US5348942A - Therapeutic uses of bactericidal/permeability increasing protein products - Google Patents

Therapeutic uses of bactericidal/permeability increasing protein products Download PDF

Info

Publication number
US5348942A
US5348942A US08/030,644 US3064493A US5348942A US 5348942 A US5348942 A US 5348942A US 3064493 A US3064493 A US 3064493A US 5348942 A US5348942 A US 5348942A
Authority
US
United States
Prior art keywords
heparin
bpi
rbpi
binding
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/030,644
Inventor
II Roger G. Little
Helene Gazzano-Santoro
James B. Parent
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Xoma Royalty Corp
Original Assignee
Xoma Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xoma Corp filed Critical Xoma Corp
Priority to US08/030,644 priority Critical patent/US5348942A/en
Assigned to XOMA CORPORATION A CORPORATION OF DELAWARE reassignment XOMA CORPORATION A CORPORATION OF DELAWARE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: GAZZANO-SANTORO, HELENE, LITTLE, ROGER G. II, PARENT, JAMES BRIAN
Priority to HK98115457.7A priority patent/HK1014191B/en
Priority to PCT/US1994/002401 priority patent/WO1994020128A1/en
Priority to EP94911490A priority patent/EP0690872B1/en
Priority to AU63605/94A priority patent/AU684503B2/en
Priority to CN94191892A priority patent/CN1105574C/en
Priority to PCT/US1994/002465 priority patent/WO1994020532A1/en
Priority to CNB941918947A priority patent/CN100396695C/en
Priority to ES94911490T priority patent/ES2123134T3/en
Priority to MX9401807A priority patent/MX9401807A/en
Priority to DE69427582T priority patent/DE69427582T2/en
Priority to EP00128250A priority patent/EP1129718A3/en
Priority to NZ263057A priority patent/NZ263057A/en
Priority to ES94910854T priority patent/ES2157981T3/en
Priority to CA002157927A priority patent/CA2157927C/en
Priority to AU63988/94A priority patent/AU694108B2/en
Priority to DK94910854T priority patent/DK0690720T3/en
Priority to JP6520214A priority patent/JPH08509703A/en
Priority to CNA03104316XA priority patent/CN1478543A/en
Priority to HK98115810.9A priority patent/HK1014497B/en
Priority to DE69412243T priority patent/DE69412243T2/en
Priority to CNA2008100960867A priority patent/CN101265299A/en
Priority to PT94910854T priority patent/PT690720E/en
Priority to JP52025194A priority patent/JP4139863B2/en
Priority to EP94910854A priority patent/EP0690720B1/en
Priority to AT94911490T priority patent/ATE169304T1/en
Priority to AT94910854T priority patent/ATE202482T1/en
Priority to CA002158058A priority patent/CA2158058C/en
Priority to NZ263344A priority patent/NZ263344A/en
Priority to DK94911490T priority patent/DK0690872T3/en
Priority to US08/209,762 priority patent/US5733872A/en
Priority to ZA941773A priority patent/ZA941773B/en
Priority to ZA941771A priority patent/ZA941771B/en
Priority to US08/306,473 priority patent/US5652332A/en
Application granted granted Critical
Publication of US5348942A publication Critical patent/US5348942A/en
Priority to US08/415,158 priority patent/US5639727A/en
Priority to US08/435,855 priority patent/US5807818A/en
Priority to US08/466,826 priority patent/US5854214A/en
Priority to US08/466,624 priority patent/US5837678A/en
Priority to US08/473,344 priority patent/US5763567A/en
Priority to US08/485,445 priority patent/US5856438A/en
Priority to US09/093,539 priority patent/US6228834B1/en
Priority to US09/224,480 priority patent/US6153730A/en
Priority to US09/227,659 priority patent/US6156730A/en
Priority to US09/677,664 priority patent/US6664231B1/en
Priority to US09/790,230 priority patent/US6495516B1/en
Priority to US09/942,021 priority patent/US20020090368A1/en
Priority to GR20010401543T priority patent/GR3036686T3/en
Priority to US10/319,786 priority patent/US7045500B2/en
Priority to US10/446,628 priority patent/US20040023884A1/en
Priority to JP2004294373A priority patent/JP2005053921A/en
Priority to JP2005049792A priority patent/JP2005206606A/en
Priority to JP2005049791A priority patent/JP2005187480A/en
Priority to JP2007338237A priority patent/JP2008101026A/en
Anticipated expiration legal-status Critical
Assigned to SILICON VALLEY BANK reassignment SILICON VALLEY BANK SECURITY INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: XOMA TECHNOLOGY LTD.
Assigned to XOMA TECHNOLOGY LTD. reassignment XOMA TECHNOLOGY LTD. RELEASE OF SECURITY INTEREST Assignors: SILICON VALLEY BANK
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4742Bactericidal/Permeability-increasing protein [BPI]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A61K38/1751Bactericidal/permeability-increasing protein [BPI]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/14Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers

Definitions

  • the present invention relates to therapeutic uses of bactericidal/permeability increasing (BPI) protein products for the treatment of conditions not directly associated with gram negative bacterial infection including neutralization of the anti-coagulant properties of heparin, inhibition of angiogenesis, tumor and endothelial cell proliferation and treatment of chronic inflammatory disease states such as arthritis.
  • BPI bactericidal/permeability increasing
  • Heparin is a heterogenous group of straight-chain anionic mucopolysaccharides, called glycosaminoglycans having anticoagulant properties. Although others may be present, the main sugars occurring in heparin are: (1) ⁇ -L-iduronic acid 2-sulfate, (2) 2-deoxy-2-sulfamino- ⁇ -D-glucose 6-sulfate, (3) ⁇ -D-glucoronic acid, (4) 2-acetamido-2-deoxy- ⁇ -D-glucose, and (5) ⁇ -L-iduronic acid. These sugars are present in decreasing amounts, usually in the order (2)>(1)>(4)>(3)>(5), and are joined by glycosidic linkages, forming polymers of varying sizes.
  • Heparin is strongly acidic because of its content of covalently linked sulfate and carboxylic acid groups. Heparin is found within mast cell granules and is released upon degranulation. A cell associated form of heparin is termed heparan sulfate. Heparan sulfate is a broad term used to describe a variety of sulfated proteoglycans (HSPG's) found with a near-ubiquitous distribution on mammalian cell surface membranes and in the extracellular matrix. HSPG contains a variable percentage of pentameric heparin-like sequences that function in a similar fashion as soluble heparin.
  • HSPG's sulfated proteoglycans
  • the HSPG's serve as a repository for antithrombin III (ATIII) and for heparin-binding growth factors such as fibroblast growth factors (FGF) 1-5, IL-8, GM-CSF and IL-3.
  • ATIII antithrombin III
  • FGF fibroblast growth factors
  • FGF fibroblast growth factors
  • Heparin is commonly administered in doses of up to 400 U/kg during surgical procedures such as cardiopulmonary bypass, cardiac catherization and hemodialysis procedures in order to prevent blood coagulation during such procedures.
  • the anticoagulant effect of heparin in blood is a result of the interaction of heparin with ATIII.
  • the heparin/ATIII complex is a potent inhibitor of many of the clotting factors of the coagulation cascade. Specific inhibition has been demonstrated for activated Factors IXa, Xa, XIa, XIIa and thrombin.
  • the heparin/ATIII complex has the highest affinity for Factor Xa and thrombin which are common to both the intrinsic and extrinsic clotting pathways involved as the last two steps of the clotting cascade that results in the conversion of fibrinogen to fibrin.
  • protamine is used to neutralize heparin.
  • Protamines are simple proteins of low molecular weight which are commonly isolated from salmon sperm. They are rich in arginine amino acid residues and strongly basic. Administered alone, protamines (usually in the form of protamine sulfate) have anti-coagulant effects. When administered in the presence of heparin, a stable complex is formed and the anticoagulant activity of both drugs is lost. Significant hypotensive and anaphylactoid effects of protamine have limited its clinical utility.
  • PF4 platelet factor 4
  • major basic protein see U.S. Pat. No. 5,086,164.
  • Major basic protein demonstrates heparin binding activity but is also highly toxic.
  • Angiogenesis is closely associated with endothelial cell proliferation and constitutes the development of new capillary blood vessels. As such, it is an important process in mammalian development and growth, and in menstruation processes.
  • angiogenic growth factors such as fibroblast growth factors 1 -5, induces proliferation of endothelial cells via a heparin-dependent receptor binding mechanism.
  • heparin-binding growth factors can be released due to vascular trauma (wound healing), immune stimuli (autoimmune disease), inflammatory mediators (prostglandins) and from tumor cells.
  • Angiogenesis is also associated with a number of pathological conditions in which it would be desirable to inhibit such new blood vessel development.
  • angiogenesis is critical to the growth, proliferation, and metastasis of various tumors.
  • Other pathological conditions associated with angiogenesis include diabetic retinopathy, retrolental fibroplasia, neovascular glaucoma, psoriasis, angiofibromas, immune and non-immune inflammation including rheumnatoid arthritis capillary proliferation within atherosclerotic plaques, hemangiomas, endometriosis and Kaposi's Sarcoma.
  • angiogenesis inhibitors Several substances are known to function as angiogenesis inhibitors and have been reported to inhibit tumor angiogenesis, to prevent the onset of arthritis and to inhibit established arthritis in collagen-induced arthritis models, Peacock et al., J. Exp. Med., 175, 1135-1138 (1992).
  • protamine is known to inhibit tumor angiogenesis and subsequent tumor growth.
  • protamine's anti-angiogenic activity is attributed to is ability to bind heparin.
  • PF4 is also known to exhibit anti-angiogenic activity.
  • PF4 has been shown to have at least two functional properties. Heparin binding has been studied most extensively, however, PF4 was originally described to have collagenase inhibitory properties. Collagenase inhibitors were the first inhibitors of angiogenesis to be discovered in 1973. See Folkman, supra. The mutations in the heparin binding region of PF4 were not examined for their effect on collagenase inhibitory activity. Interestingly, thrombospondin is also an inhibitor of angiogenesis and binds to heparin with a serine/tryptophan motif instead of a basic amino acid motif. Thus, there is no obvious prerequisite for heparin binding or for angiogenesis inhibition.
  • Chronic inflammation is usually supported by angiogenesis.
  • Arthritis is a chronic syndrome characterized by the inflammation of the peripheral joints accompanied by synovial thickening and the influx of immune factors and cells such as polymorphonuclear leukocytes (PMN).
  • PMN polymorphonuclear leukocytes
  • the inflammation is immune driven while in reactive arthritis, inflammation is associated with infection of the synovial tissue with pyogenic bacteria or other infectious agents.
  • Folkman et al., supra also note that many types of arthritis progress from a stage dominated by an inflammatory infiltrate in the joint to a later stage in which a neovascular pannus invades the joint and begins to destroy cartilage.
  • angiogenesis in arthritis is a causative component of the disease, and not an epiphenomenon, there is evidence that angiogenesis is necessary for the maintenance of synovitis in rheumatoid arthritis.
  • nonsteroidal anti-inflammatory drugs NSAIDs
  • corticosteroids corticosteroids and other therapies have provided improvements in relief for treatment of arthritis, there remains a need in the art for more effective therapies for arthritis and other inflammatory diseases.
  • Inflammation and angiogenesis are now understood to be separable but not mutually exclusive processes.
  • Specific angiogenic proteins have been discovered that stimulate angiogenesis without inflammation and angiostatic steroids can inhibit angiogenesis without decreasing acute inflammation. See Folkman, supra.
  • endotoxin has been identified as the most potent exogenous stimulator of angiogenesis through its stimulation of macrophage cytokines and growth factors.
  • Bactericidal/permeability-increasing protein is a protein isolated from the granules of mammalian PMNs, which are blood cells essential in the defense against invading microorganisms.
  • Human BPI protein that has been isolated from polymorphonuclear neutrophils by acid extraction combined with either ion exchange chromatography [Elsbach, J. Biol. Chem., 254: 11000 (1979)] or E. coli affinity chromatography [Weiss, et al., Blood, 69: 652 (1987)] is referred to herein as natural BPI and has potent bactericidal activity against a broad spectrum of gram-negative bacteria.
  • the molecular weight of human BPI is approximately 55,000 daltons (55 kD).
  • the amino acid sequence of the entire human BPI protein, as well as the DNA encoding the protein, have been elucidated in FIG. 1 of Gray et al., J. Biol. Chem., 264: 9505 (1989), incorporated herein by reference.
  • BPI bactericidal effect of BPI has been shown to be highly specific to sensitive gram-negative species, while non-toxic for other microorganisms and for eukaryotic cells.
  • the precise mechanism by which BPI kills bacteria is as yet unknown, but it is known that BPI must first attach to the surface of susceptible gram-negative bacteria.
  • This initial binding of BPI to the bacteria involves electrostatic interactions between the basic BPI protein and the negatively charged sites on lipopolysaccharides (LPS).
  • LPS lipopolysaccharides
  • LPS lipopolysaccharides
  • endotoxin because of the potent inflammatory response that it stimulates. LPS induces the release of mediators by host inflammatory cells which may ultimately result in irreversible endotoxic shock.
  • BPI binds to Lipid A, the most toxic and most biologically active component of LPS.
  • BPI binding is thought to disrupt LPS structure, leading to activation of bacterial enzymes that degrade phospholipids and peptidoglycans, altering tile permeability of the cell's outer membrane, and ultimately causing cell death by an as yet unknown mechanism.
  • BPI is also capable of neutralizing the endotoxic properties of LPS to which it binds. Because of its gram negative bactericidal properties and its ability to neutralize LPS, BPI can be utilized for tile treatment of mammals suffering from diseases caused by Gram-negative bacteria, such as bacteremia or sepsis.
  • a proteolytic fragment corresponding to the N-terminal portion of human BPI holoprotein possesses the antibacterial efficacy of the naturally-derived 55 kD human holoprotein.
  • the C-terminal region of the isolated human BPI protein displays only slightly detectable anti-bacterial activity.
  • rBPI 23 A BPI N-terminal fragment, comprising approximately the first 199 amino acid residues of the human BPI holoprotein and referred to as "rBPI 23 ", has been produced by recombinant means as a 23 kD protein. Gazzano-Santoro et al., Infect. Immun. 60: 4754-4761 (1992).
  • compositions comprising a BPI protein and an anionic compound which compositions are said to exhibit (1) no bactericidal activity and (2) endotoxin neutralizing activity.
  • Anionic compounds are preferably a protein such as serum albumin but can also be a proteoglycan such as heparin.
  • Weiss et al., J. Clin. Invest., 55: 33-42 (1975) discloses that heparin sulfate and LPS bind to block expression of the permeabiilty increasing activity of BPI. Neither reference discloses neutralization of heparin by combination with BPI, however.
  • methods for neutralizing the anti-coagulant activity of heparin comprising administering an effective amount of a BPI protein product in vivo to a subject or in vitro to a fluid sample containing heparin.
  • a BPI protein product is administered to subjects in order to inhibit endothelial cell proliferation including but not limited to endothelial cell proliferation associated with anglogenesis.
  • the invention provides methods of inhibiting angiogenesis associated with a variety of clinical conditions. Specifically provided by the invention are methods of treating cancer by inhibiting angiogenesis associated with malignant tumor proliferation; Kaposi's sarcoma lesions and the like. Cancers susceptible to treatment by administration of BPI protein products include melanoma, sarcomas, and carcinomas including but not limited to breast, colon, lung, and prostate carcinomas.
  • BPI protein products can be administered for inhibition of angiogenesis
  • conditions for which BPI protein products can be administered for inhibition of angiogenesis include ocular retinopathy, retrolental fibroplasia, psoriasis, angiofibromas, endometriosis, hemangiomas and the like.
  • methods of contraception comprising administration of an effective amount of a BPI protein product to the uterine lining so as to prevent implantation of a fertilized ovum.
  • the invention also provides methods of treating chronic inflammatory disease states such as arthritis, psoriasis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, lupus erythematosus, autoimmune uveitis, Lyme disease, and asthma comprising administering an effective amount of a BPI protein product to a subject suffering from the inflammatory disease state.
  • chronic inflammatory disease states such as arthritis, psoriasis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, lupus erythematosus, autoimmune uveitis, Lyme disease, and asthma
  • chronic inflammatory disease states such as arthritis, psoriasis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, lupus erythematosus, autoimmune uveitis, Lyme disease, and asthma comprising administering an effective amount of a BPI protein product to a subject suffering from the inflammatory disease state.
  • the invention also provides methods of preparation of medicaments for neutralization of the anti-coagulant properties of heparin, inhibition of tumor and endothelial cell proliferation, inhibition of angiogenesis and treatment of chronic inflammatory disease states.
  • Such medicaments can be prepared for oral administration or by injection or other parenteral methods and preferably include conventional pharmaceutically acceptable carriers and adjuvants as would be known to those of skill in the art.
  • the medicaments are preferably in the form of a unit dose in solid, semi-solid and liquid dosage forms such as tablets, pills, powders, liquid solutions or suspensions, and injectable and infusible solutions. Effective dosage ranges from about 100 ⁇ g/kg to about 10 mg/kg of body weight are contemplated.
  • BPI protein product includes naturally and recombinantly produced bactericidal/permeability-increasing protein, natural synthetic, and recombinant biologically active polypeptide fragments of bactericidal/permeability increasing protein, and biologically active polypeptide analogs, including hybrid fusion proteins, of either bactericidal/permeability increasing protein or biologically active fragments thereof.
  • FIG. 1 depicts a graph of a heparin binding assay for rBPI 23 and rBPI 50 ;
  • FIG. 2 depicts a graph showing the effect of heparin on rBPI binding to E. coli J5 Lipid A compared to various LPS and teichoic acid samples;
  • FIG. 3 depicts a graph showing the effect of rBPI 23 on ATIII/heparin inhibition of thrombin:
  • FIG. 4 depicts a graph showing the effect of rBPI 23 on ATIII/heparin inhibition of Factor Xa;
  • FIG. 5 depicts a graph showing the effect of rBPI 23 on heparin-mediated lengthening of thrombin time in human plasma
  • FIG. 6 depicts a graph showing the effect of rBPI 23 and thaumatin control protein on arthritic scores in a collagen-induced arthritis model with mild arthritis:
  • FIG. 7 depicts a graph showing the effect of rBPI 23 and protamine on arthritic scores in a collagen-induced arthritis model with severe arthritis
  • FIG. 8 depicts a graph showing survival of mice treated with BPI or a buffer in a mouse melanoma metastasis model
  • FIG. 9 depicts a graph showing the effect of rBPI 23 on Type II murine capillary endothelial cell proliferation:
  • FIG. 10 illustrates BPI binding to epithelial cells
  • FIG. 11 depicts a graph of a heparin binding assay for synthetic BPI peptides
  • FIG. 12 depicts a graph of a Limulus Amoebocyte Lysate (LAL) inhibition assay for synthetic BPI peptides.
  • LAL Limulus Amoebocyte Lysate
  • FIG. 13 depicts a graph of a radial diffusion bactericidal assay for synthetic BPI peptides.
  • the present invention relates to the administration of bactericidal/permeability-increasing protein (BPI) protein products for the treatment of a variety of therapeutic conditions not directly associated with bacterial infection.
  • BPI bactericidal/permeability-increasing protein
  • BPI is known as a potent cytotoxin for gram negative bacteria and is further known for neutralizing the adverse effects of lipopolysaccharide associated with the cell walls of grain negative bacteria
  • a variety of therapeutic effects for BPI protein products not directly associated with the gram negative bacterial infection have been discovered.
  • the invention provides methods for treating conditions not directly associated with gram negative infections including neutralization of the anti-coagulant activity of heparin, inhibition of tumor and endothelial cell proliferation including cell proliferation associated with angiogenesis and treatment of chronic inflammatory disease states such as arthritis.
  • the BPI protein products including biologically active fragments of BPI holoprotein which are to be administered according to the methods of this invention may be generated and/or isolated by any means known in the art.
  • Co-owned, copending U.S. patent application Ser. No. 07/885,501 hereby incorporated by reference, discloses novel methods for the purification of recombinant BPI protein products expressed in and secreted from genetically transformed mammalian host cells in culture and discloses how one may produce large quantities of recombinant BPI products suitable for incorporation into stable, homogeneous pharmaceutical preparations.
  • Biologically active fragments of BPI include biologically active molecules that contains the same amino acid sequence as a BPI holoprotein, except that tile molecule lacks amino-terminal amino acids, internal amino acids, and/or carboxy-terminal amino acids of the holoprotein.
  • such fragments include those described herein and the previously mentioned natural 25 kD fragment and a recombinant 23 kD, 199 amino acid residue amino-terminal fragment of the human BPI holoprotein referred to as rBPI 23 . See, Gazzano-Santoro et al., Infect. Immun. 60: 4754-4761 (1992).
  • an expression vector was used as a source of DNA encoding a recombinant expression product (rBPI 23 ) having the 31-residue signal sequence and tile first 199 amino acids of the N-terminus of the mature human BPI, as set out in SEQ ID NOs: 1 and 2 taken from Gray et al., supra, except that valine at position 151 is specified by GTG rather than GTC and residue 185 is glutamic acid (specified by GAG) rather than lysine (specified by AAG).
  • Recombinant holoprotein referred to herein as rBPI 50 has also been produced having the sequence set out in SEQ ID NOs: 1 and 2 taken from Gray et al., supra, with the exceptions noted for rBPI 23 .
  • Biologically active analogs of BPI include but are not limited to recombinant hybrid fusion proteins comprising BPI holoprotein or biologically active fragment thereof, and at least a portion of at least one other polypeptide.
  • Such proteins are described by Theofan et al. in co-owned, copending U.S. patent application Ser. No. 07/885,911, which is incorporated herein by reference in its entirety and include hybrid fusion proteins comprising, at the amino terminal end, a BPI protein or a biologically active fragment thereof and, at the carboxy terminal end, at least one constant domain of an immunoglobulin heavy chain or allelic variant thereof.
  • Biologically active analogs of BPI also include but are not limited to BPI protein products wherein one or more amino acid residue has been replaced by a different amino acid.
  • BPI protein products wherein one or more amino acid residue has been replaced by a different amino acid.
  • co-owned, copending U.S. patent application Ser. No. 08/013,801 filed Feb. 2, 1993, which is incorporated herein by reference, discloses polypeptide analogs of BPI and BPI fragments wherein a cysteine residue at position 132 or at position 135 is replaced by a different amino acid
  • BPI protein products is preferably accomplished with a pharmaceutical composition comprising a BPI protein product and a pharmaceutically acceptable diluent, adjuvant, or carrier.
  • the BPI protein product composition may be administered without or in conjunction with known antibiotics, surfactants, or other chemotherapeutic agents.
  • a preferred pharmaceutical composition containing BPI protein products comprises BPI at a concentration of 1 mg/ml in citrate buffered saline (0.02 M citrate, 0.15 M NaCl, pH 5.0) comprising 0.1% by weight of poloxamer 188 (Pluronic F-68, BASF Wyandotte, Parsippany, NJ) and 0.002% by weight of polysorbate 80 (Tween 80, ICI Americas Inc., Wilmington, DE).
  • poloxamer 188 Pluronic F-68, BASF Wyandotte, Parsippany, NJ
  • polysorbate 80 Teween 80, ICI Americas Inc., Wilmington, DE.
  • Effective doses of BPI and BPI protein products for partial or complete neutralization of the anti-coagulant activity of heparin and other effects described herein may be readily determined by those of skill in the art according to conventional parameters including the size of the subject, the quantity of heparin administered to the subject and the time since administration of the heparin.
  • Example 1 addresses assay systems for quantification of heparin binding by BPI protein products;
  • Example 2 describes the relative capacity of heparin to block binding of bacterial LPS to BPI protein products: Examples 3 and 4, respectively, present results of tests for the capacity of BPI protein products to inhibit thrombin or Factor Xa inactivation by antithrombin III/heparin complexes; and
  • Example 5 relates to the effect of BPI protein products on heparin-mediated lengthening of thrombin time.
  • Examples 6-8 relate to administration of BPI protein products of in collagen and bacterial induced arthritis animal model systems exemplifying treatment of chronic inflammatory disease states.
  • Examples 9-10 illustrate testing of BPI protein products for angiostatic effects in a mouse malignant melanoma metastasis model system.
  • Example 11 addresses effects of BPI protein products on endothelial cell proliferation and possible binding mechanisms involved.
  • Examples 12-14 illustrate heparin-binding, LPS-binding and bactericidal activities for BPI protein product synthetic peptides.
  • rBPI 23 and holoprotein designated rBPI 50 were added to wells of a 96-well microtiter plate having an Imobilon-P (Millipore, Bedford, Mass.) membrane disposed at bottom of the wells. Five ⁇ g of protein was added to each well.
  • the wells were dried and subsequently blocked with a 0.1% bovine serum albumin (BSA) in phosphate buffered saline, pH 7.4 (blocking buffer.) Dilutions of 3 H-heparin (DuPont, NEN, Wilmington, Del.) were made in the blocking buffer and incubated in the rBPI 23 containing wells for one hour at 4° C. The unbound heparin is aspirated and the wells were washed three times with blocking buffer, dried and removed for quantitation in a liquid scintillation counter. Typical assay results are graphically presented in FIG. 1. While BSA in the blocking buffer does have a low affinity and capacity to bind heparin, this was considered physiologically irrelevant and the background was routinely subtracted from the test compound signal.
  • BSA bovine serum albumin
  • binding constants with 3 H-heparin as the ligand were determined using nonlinear function minimization with Grafit software (Erithicus Softward Ltd., Staines, UK) for rBPI 23 , rBPI 50 , protamine and thaumatin with the results shown in Table 1 below.
  • Varying concentrations of putative inhibitors were plated onto the wells in a volume of 25 ⁇ L PBS, followed by 200,000 cpm of radio-iodinated rBPI 23 in 25 ⁇ L of PBS containing 0.1% Tween-20.
  • the test solutions included Ra LPS from Salmonella minnesota R60 at 200 ⁇ g/mL; Smooth LPS from E. coli 0113 (RIBI Immunochem, Hamilton, Mont., #R318) at 200 ⁇ g/mL; Lipoteichoic acid from Streptococcus faecalis, (Sigma, St.
  • a chromostrate assay was used to determine the effect of rBPI 23 on thrombin inactivation by ATIII/heparin complexes.
  • a Chromostrate anti-thrombin assay kit (Organon Teknika Corp., Durham, N.C.) was used to examine the inhibition of purified thrombin by preformed ATIII/heparin complexes in plasma.
  • the assay was performed in 96 well microtiter plates with a final volume per well of 200 ⁇ g/mL.
  • the order of addition of assay components was as follows: diluted heparinized reference plasma (50 ⁇ L); thrombin 1nKat/mL (50 ⁇ L ); 50 ⁇ L rBPI 23 or thaumatin (a control protein) at concentrations ranging from 1.0 ⁇ g/mL to 100 ⁇ g/mL; and thrombin chromogenic substrate 1 ⁇ mole/mL (50 ⁇ L).
  • the reaction was allowed to proceed for 5 minutes and the color reaction was quantitated on a microplate reader.
  • a chromostrate assay was used to determine the effect of rBPI 23 on Factor Xa neutralization by ATIII/heparin complexes. Specifically, the assay was conducted using a chromostrate heparin anti-Factor Xa assay kit (Organon Teknika Corp.) and was performed under fixed concentrations of Factor Xa and ATIII. Heparin concentration was varied so that a heparin standard curve was generated for determination of unknown heparin concentrations in clinical samples. The assay measured functional Factor Xa activity by the release of a chromogenic compound from a synthetic substrate. ATIII/heparin complexes neutralize Factor Xa activity, thus the amount of chromogen released was inversely related to the amount and anti-Factor Xa activity of heparin in the assay sample.
  • the assay was performed in 96 well microtiter plates with a final volume per well of 200 ⁇ L. Assay components were added to the microtiter wells as follows: 50 ⁇ L of purified Factor Xa (.14nKat/mL), 25 ⁇ L purified bovine ATIII (0.5 U/mL), 25 ⁇ L heparin (from 0.0 to 0.6 U/mL), 50 ⁇ L rBPI 23 or the control thaumatin at various concentrations (from 3.125 ⁇ g/mL to 100 ⁇ g/mL) and 50 ⁇ L substrate (3 ⁇ moles/mL). The reaction was allowed to proceed for 5 minutes and then the color reaction was quantitated on a microplate reader. The assay results shown in FIG.
  • thrombin time i.e., the time required for clotting of a mixture of thrombin and plasma.
  • Thrombin time is lengthened by the presence of endogenous or exogenous inhibitors of thrombin formation, such as therapeutically administered heparin.
  • Agents which neutralize the anticoagulant effects of heparin will reduce the thrombin time measured by the test.
  • Human citrated plasma 200 ⁇ L was incubated for 1 minute at 37° C.
  • rBPI 23 inhibits the heparin-mediated lengthening of thrombin time. In the absence of heparin, rBPI 23 had no effect on the assay even at concentrations as high as 56 ⁇ g/mL.
  • Examples 1 through 5 show that rBPI 23 binds to heparin in direct binding assays and effectively neutralizes heparin inhibition of coagulation proteases. Based on these characteristics, BPI protein products are projected to be useful in the clinical neutralization of heparin anti-coagulant effects in dosages generally corresponding functionally to those recommended for protamine sulfate, but are not expected to possess the severe hypotensive and anaphylactoid effects of that material.
  • a further aspect of the present invention relates to the discovery of the utility of BPI to treat and prevent the effects of chronic inflammatory disease states such as arthritis, including rheumatoid and reactive arthritis, psoriasis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, lupus erythematosus, autoimmune uveitis, Lyme disease, and asthma.
  • Exemplary methods are provided for treating subjects suffering from arthritis comprising administering an effective amount of a BPI protein product in order to prevent or treat arthritis.
  • the BPI protein product may be administered topically, or by injection such as intraarticularly, intravenously, intramuscularly or subcutaneously or by other parenteral and non-parenteral methods.
  • mice The effect of administration of BPI protein products was studied in a collagen-induced arthritis model. Specifically, arthritis was induced in mice by intradermal immunization of bovine Type II collagen at the base of the tail according to the method of Stuart et al., J. Clin. Invest., 69: 673-683 (1982). Generally, mice begin to develop arthritic symptoms at Day 21 after collagen immunization. The arthritic scores of the treated mice were then evaluated in a blinded fashion over a period of 120 days for mice treated on each of days 21-25 with doses of either rBPI 23 , thaumatin control protein, or buffer which were injected intravenously via the tail vein.
  • bovine Type II collagen (Southern Biotechnology Associates, Inc., Birmingham Ala.) was administered via intradermal injection (0.1 mg/mouse) at the base of the tail on day 0 to groups of ten male mice (Mouse/DBA/1J), each weighing approximately 20-25 g grams.
  • rBPI 23 was dissolved in 0.5 M NaCl, 20 mM sodium acetate, pH 6.0 and diluted with PBS buffer (1 mg/ml) for administration at 0.125 mg/mouse.
  • Thaumatin protein in PBS (0.121 mg/mouse), and PBS buffer alone (0.1 ml) were administered as controls.
  • the collagen-induced arthritis model of Example 6 was used to evaluate the performance of a BPI protein product in comparison with protamine sulfate, and both thaumatin protein and buffer as controls.
  • rBPI 23 was dissolved in 0.5 M NaCl, 20 mM sodium acetate, pH 6.0 and diluted with PBS buffer (1 mg/ml) and was administered at 0.125 mg/mouse.
  • the other test materials were administered at the following dosages: protamine sulfate (Sigma Chemical Co) (0.13 mg/mouse), thaumatin (0.121 mg/mouse), and PBS buffer (0.1 ml).
  • protamine sulfate Sigma Chemical Co
  • thaumatin (0.121 mg/mouse
  • PBS buffer 0.1 ml
  • FIG. 7 discloses the results of arthritic scores for the various treatment and control protocols evaluated at days 28-80.
  • the stars (*) in FIG. 7 represent a statistically significant difference between rBPI 23 and buffer at p ⁇ 0.01 while the pluses (+) represent a statistically significant difference between rBPI 23 and buffer at p ⁇ 0.05.
  • BPI protein products are administered to treat reactive arthritis in a Yersinia enterocolitica reactive arthritis model according to the method of Yong et al., Microbial Pathogenesis, 4: 305-310 (1988). Specifically, BPI protein products are administered to DBA/2J mice which have previously been injected intravenously with Yersinia enterocolitica WA at a dosage calculated to induce a non-septic arthritis in the mice.
  • the invention also provides methods for inhibiting endothelial cell proliferation and angiogenesis by administration of BPI protein products. Examples are specifically provided which address treatment of tumors in a mouse melanoma model system.
  • a BPI protein product, protamine, and both thaumatin protein and buffer controls were tested for efficacy in a mouse malignant melanoma metastasis model.
  • four groups of nine C57BL/6J mice were inoculated with 10 5 B16.F10 malignant melanoma cells via intravenous injection into the tail vein on day 0.
  • Either rBPI 23 (0.13 mg/mouse), protamine sulfate (0.13 mg/mouse), thaumatin (0.13 mg/mouse) or PBS buffer (0.1 ml/mouse) were intravenously administered into the tail vein of the mice on days 1, 3, 6, 8, 10, 13, 15, 17, and 19.
  • the animals were sacrificed via cervical dislocation on Day 20 for observation of lung tissues.
  • the lobes of each lung were perfused and inflated by injecting 3 ml water into the lung via the trachea.
  • Superficial tumor nodules were then counted with the aid of a dissecting microscope and the number of tumors found per group analyzed for statistically significant differences. While the data was not statistically significant, animals treated with BPI 23 had the lowest tumor load, followed by those treated with protamine, the thaumatin protein control and the buffer control. The lack of statistical significance (tumor number did not adequately reflect tumor size) indicated that a more specific assay methodology would be needed to determine the tumor load.
  • a BPI protein product, protamine, and both thaumatin protein and buffer controls were again tested for efficacy in the mouse malignant melanoma metastasis model of Example 9.
  • six groups of C57BL/6J mice were inoculated with 10 5 B16.
  • F10 malignant melanoma cells via intravenous injection into the tail vein on day 0.
  • Either rBPI 23 (0.125 mg/mouse), protamine sulfate (0.125 mg/mouse), thaumatin (0.125 mg/mouse) or PBS buffer as set out in Table 2 below were intravenously administered into the tail vein of the mice on days 1, 2, 5, 7, 9, 12, 14, 16, and 19.
  • Groups E and F comprising animals treated with either buffer or rBPI 23 respectively were not sacrificed but were observed once daily for mortality.
  • FIG. 8 shows the survival data for the two groups of animals. Although all ten of the animals had died by day 43, the BPI treated mice generally survived significantly longer than the untreated mice indicating that BPI had an anti-angiogenic effect and slowed metastasis of the melanoma tumors.
  • BPI protein products may be used to inhibit Kaposi's Sarcoma in a model system such as that of Miles et al., VII International Conference on AIDS, Florence, Italy, Paper 41(8), 1991.
  • Murine cerebral capillary endothelial cells as described in Bauer, Microvascular Research 37: 148-161 (1989) were passaged in Medium 199 containing Earle's salts, L-glutamine and 2.2 g/l of sodium bicarbonate (Gibco, Grand Island, N.Y., #400-100EB), plus 10% heat inactivated fetal calf serum (Irvine Scientific, Irvine, Calif.) and 1% penicillin/streptomycin (Gibco, #600-5140AG). Harvesting of the confluent cells was performed by trypsinization with trypsin-EDTA (Gibco #610-5300PG) for 3 minutes.
  • the trypsinization was stopped by adding 10 ml of the passage medium to the flask.
  • Proliferation assays were performed on freshly harvested EC in standard flat bottom 96 well microtiter plates. A final volume of 200 ⁇ l/well was maintained for each well of the assay. A total of 4 ⁇ 10 4 EC were added to each well with varying concentrations of rBPI 23 , thaumatin control protein or buffer control. After 48 hours of culture in a 5% CO 2 incubator, 1 ⁇ Ci of [methyl- 3 H] thymidine in 10 ⁇ l of Medium 199 was added to each well. After a 24 hour pulse, the EC cells were harvested by trypsinization onto glass microfiber filters and incorporated [ 3 H]thymidine was quantitated with a gas proportional solid phase beta counter.
  • Concentration dependent inhibition of EC cell proliferation by rBPI 23 is shown in FIG. 9. No effect was observed when similar concentrations of thaumatin or equal volumes of the buffer were added to the wells. The first inhibition of proliferation is observed at 12.4 ⁇ g/ml rBPI 23 and the effect appears to be maximal at 50 ⁇ g/ml.
  • the growth of the EC cells is known to be dependent on FGF-2 (bFGF) in the calf serum and FGF-2 requires cell surface heparan for receptor activation (Yayon et al., Cell 64: 841-848, 1991). Without intending to be bound by a theory of the invention, it is believed that rBPI 23 bound to cell surface heparan on the EC cells interferes with the activation of the cells by FGF-2.
  • 15-mer amino acid synthetic peptides based on the 23 kD amino terminal fragment of BPI were prepared and evaluated for heparin-binding activity, activity in a Limulus Amoebocyte Lysate Inhibition (LAL) assay and bactericidal activity.
  • LAL Limulus Amoebocyte Lysate Inhibition
  • 47 synthetic peptides each comprising 15 amino acids and overlapping the adjacent peptides by 11 amino acids were prepared, in duplicate, based on the sequence of rBPI 23 described above.
  • the synthetic BPI protein product peptides described above were subjected to a heparin binding assay according to the methods described in Example 1.
  • the results, as shown in FIG. 11, indicate the existence of three separate functional domains with heparin binding activity; the first extending from about amino acids 21-55; the second extending from about amino acids 65-107; and the third extending from about amino acids 137-171.
  • Material from blank control pins had no heparin binding effects.
  • the synthetic BPI protein product peptides described above were Limulus Amoebocyte Lysate (LAL) inhibition assay to determine LPS binding properties.
  • LAL Limulus Amoebocyte Lysate
  • the synthetic BPI peptides were mixed in Eppendorf tubes with a fixed concentration of E. coli 0113 LPS (4 ng/ml final) and incubated at 37° C. for 3 hours with occasional shaking. Addition controls comprising 0.05 ⁇ g/mL were also tested. Following incubation, 360 ⁇ l D-PBS was added per tube to obtain an LPS concentration of 200 pg/mL for the LAL assay. Each sample was then transferred into Immulon II strips (Dynatech, Chantilly, Va.) in volumes of 50 ⁇ l per well.
  • Limulus amoebocyte Lysate (Quantitative chromogenic LAL kit, Whitaker Bioproducts, Inc., Walkersville, Md.) was added at 50 ⁇ l per well and the wells were incubated at room temperature for 25 minutes. Chromogenic substrate was then added at a volume of 100 ⁇ l per well and was well mixed. After incubation for 20 to 30 minutes at room temperature, the reaction was stopped with addition of 100 ⁇ l of 25% acetic acid. Optical density at 405 nm was then measured in a multiplate reader (Vmax, Molecular Dynamics, Menlo Park, Calif.) with the results shown in FIG. 12 in terms of percent inhibition of LPS. The data in FIG.
  • the synthetic BPI protein product peptides were tested for bactericidal effects against the rough mutant E. coli J5 bacteria in a radial diffusion assay. Specifically, an overnight culture of E. Coli J5 was diluted 1: 50 into fresh tryptic soy broth and incubated for 3 hours at 37° C. to attain log phase. Bacteria were then pelleted at 3,000 rpm for 5 minutes in a Sorvall RT6000B. 5mL of 10 mM sodium phosphate buffer (ph 7.4) was added and the preparation was re-centrifuged. The supernatant was decanted and 5 mL of fresh buffer was added, the bacteria were resuspended and their concentration was determined by measurement of absorbance at 590 nm.
  • tile tube The entire contents of tile tube were poured into a perfectly level square petri dish and distributed evenly by rocking the dish side to side.
  • the agarose hardened in less than 30 seconds and had a uniform thickness of about 1 mm.
  • a series of wells were then punched into the hardened agarose using a sterile 3 mm punch attached to a vacuum apparatus. The punch was sterilized with 100% alcohol and allowed to air dry.
  • the results of this bactericidal assay along with the heparin binding and LAL assays indicate that there exist small synthetic BPI peptides with one or more of bactericidal, heparin binding and LPS neutralizing effects and that there exist three distinct separate functional domains within the 23 kD amino terminal fragment.
  • the most active domain characterized by activity in all three assays, resides between amino acids 73-99.
  • One specific peptide 86-99 demonstrated activity in all three assays.
  • a second domain resides between amino acid residues 25-44 and the third domain is composed of residues 117-128 and 143-163.
  • the third domain is separated by a CSSCSS amino acid sequence that presumably is involved in a disulfide bond which brings these two minor regions in close 3-dimensional proximity within the native rBPI 23 molecule to create a third LPS/heparin binding domain.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Ophthalmology & Optometry (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Diabetes (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Hematology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention provides therapeutic methods for treatment of conditions including the neutralization of the anti-coagulant activity of heparin, inhibition of angiogenesis, tumor and endothelial cell proliferation, and treatment of chronic inflammatory diseases by administration of bactericidal/permeability-increasing (BPI) protein products.

Description

BACKGROUND OF THE INVENTION
The present invention relates to therapeutic uses of bactericidal/permeability increasing (BPI) protein products for the treatment of conditions not directly associated with gram negative bacterial infection including neutralization of the anti-coagulant properties of heparin, inhibition of angiogenesis, tumor and endothelial cell proliferation and treatment of chronic inflammatory disease states such as arthritis.
HEPARIN BINDING
Heparin is a heterogenous group of straight-chain anionic mucopolysaccharides, called glycosaminoglycans having anticoagulant properties. Although others may be present, the main sugars occurring in heparin are: (1) α-L-iduronic acid 2-sulfate, (2) 2-deoxy-2-sulfamino-α-D-glucose 6-sulfate, (3)β-D-glucoronic acid, (4) 2-acetamido-2-deoxy-α-D-glucose, and (5) α-L-iduronic acid. These sugars are present in decreasing amounts, usually in the order (2)>(1)>(4)>(3)>(5), and are joined by glycosidic linkages, forming polymers of varying sizes. Heparin is strongly acidic because of its content of covalently linked sulfate and carboxylic acid groups. Heparin is found within mast cell granules and is released upon degranulation. A cell associated form of heparin is termed heparan sulfate. Heparan sulfate is a broad term used to describe a variety of sulfated proteoglycans (HSPG's) found with a near-ubiquitous distribution on mammalian cell surface membranes and in the extracellular matrix. HSPG contains a variable percentage of pentameric heparin-like sequences that function in a similar fashion as soluble heparin. The HSPG's serve as a repository for antithrombin III (ATIII) and for heparin-binding growth factors such as fibroblast growth factors (FGF) 1-5, IL-8, GM-CSF and IL-3. Folkman et. al., Inflammation: Basic Principles and Clinical Correlates, 2d Ed. Chapter 40, pp 821--839 (1992). In fact, cells made genetically deficient in HSPG's require exogenous heparin for growth.
Heparin is commonly administered in doses of up to 400 U/kg during surgical procedures such as cardiopulmonary bypass, cardiac catherization and hemodialysis procedures in order to prevent blood coagulation during such procedures. The anticoagulant effect of heparin in blood is a result of the interaction of heparin with ATIII. The heparin/ATIII complex is a potent inhibitor of many of the clotting factors of the coagulation cascade. Specific inhibition has been demonstrated for activated Factors IXa, Xa, XIa, XIIa and thrombin. The heparin/ATIII complex has the highest affinity for Factor Xa and thrombin which are common to both the intrinsic and extrinsic clotting pathways involved as the last two steps of the clotting cascade that results in the conversion of fibrinogen to fibrin.
When heparin is administered for anticoagulant effects during surgery, it is an important aspect of post-surgical therapy that the effects of heparin are promptly neutralized so that normal coagulation function can be restored. Currently protamine is used to neutralize heparin. Protamines are simple proteins of low molecular weight which are commonly isolated from salmon sperm. They are rich in arginine amino acid residues and strongly basic. Administered alone, protamines (usually in the form of protamine sulfate) have anti-coagulant effects. When administered in the presence of heparin, a stable complex is formed and the anticoagulant activity of both drugs is lost. Significant hypotensive and anaphylactoid effects of protamine have limited its clinical utility.
Other reported compounds which have heparin binding activity include platelet factor 4 (PF4) and major basic protein, see U.S. Pat. No. 5,086,164. Major basic protein demonstrates heparin binding activity but is also highly toxic.
Angiogenesis
Angiogenesis is closely associated with endothelial cell proliferation and constitutes the development of new capillary blood vessels. As such, it is an important process in mammalian development and growth, and in menstruation processes. The release of angiogenic growth factors, such as fibroblast growth factors 1 -5, induces proliferation of endothelial cells via a heparin-dependent receptor binding mechanism. See Yayon et al., Cell, 64: 841-848 (1991). These heparin-binding growth factors can be released due to vascular trauma (wound healing), immune stimuli (autoimmune disease), inflammatory mediators (prostglandins) and from tumor cells.
Angiogenesis is also associated with a number of pathological conditions in which it would be desirable to inhibit such new blood vessel development. As one example, angiogenesis is critical to the growth, proliferation, and metastasis of various tumors. Other pathological conditions associated with angiogenesis include diabetic retinopathy, retrolental fibroplasia, neovascular glaucoma, psoriasis, angiofibromas, immune and non-immune inflammation including rheumnatoid arthritis capillary proliferation within atherosclerotic plaques, hemangiomas, endometriosis and Kaposi's Sarcoma.
Folkman et al., supra, discloses that psoriatic lesions in the skin are dominated by epithelial proliferation, neovascularization, and an infiltrate of inflammatory cells. It is unclear, however, whether angiogenesis is a step in the pathogenesis of psoriasis or a secondary phenomenon.
Several substances are known to function as angiogenesis inhibitors and have been reported to inhibit tumor angiogenesis, to prevent the onset of arthritis and to inhibit established arthritis in collagen-induced arthritis models, Peacock et al., J. Exp. Med., 175, 1135-1138 (1992). As one example, protamine is known to inhibit tumor angiogenesis and subsequent tumor growth. According to Taylor et al., Nature, 297: 307-312 (1982) protamine's anti-angiogenic activity is attributed to is ability to bind heparin. PF4 is also known to exhibit anti-angiogenic activity. Of interest to the present application is U.S. Pat. No. 5,112,946 which discloses modified PF4 and analogs thereof which have anti-angiogenic activity but lack the ability to bind heparin. PF4 has been shown to have at least two functional properties. Heparin binding has been studied most extensively, however, PF4 was originally described to have collagenase inhibitory properties. Collagenase inhibitors were the first inhibitors of angiogenesis to be discovered in 1973. See Folkman, supra. The mutations in the heparin binding region of PF4 were not examined for their effect on collagenase inhibitory activity. Interestingly, thrombospondin is also an inhibitor of angiogenesis and binds to heparin with a serine/tryptophan motif instead of a basic amino acid motif. Thus, there is no obvious prerequisite for heparin binding or for angiogenesis inhibition.
Published PCT patent application WO 92/01003 discloses the use of glycosaminoglycan (heparin) derivatives and their use as inhibitors of tumor invasiveness. Heparin derivatives are disclosed which are described as being substantially devoid of anticoagulation activity and which impede the formation of tumor metastases in a host.
Chronic Inflammation
Chronic inflammation is usually supported by angiogenesis. Arthritis is a chronic syndrome characterized by the inflammation of the peripheral joints accompanied by synovial thickening and the influx of immune factors and cells such as polymorphonuclear leukocytes (PMN). In rheumatoid arthritis, the inflammation is immune driven while in reactive arthritis, inflammation is associated with infection of the synovial tissue with pyogenic bacteria or other infectious agents. Folkman et al., supra, also note that many types of arthritis progress from a stage dominated by an inflammatory infiltrate in the joint to a later stage in which a neovascular pannus invades the joint and begins to destroy cartilage. While it is unclear whether angiogenesis in arthritis is a causative component of the disease, and not an epiphenomenon, there is evidence that angiogenesis is necessary for the maintenance of synovitis in rheumatoid arthritis. While nonsteroidal anti-inflammatory drugs (NSAIDs), corticosteroids and other therapies have provided improvements in relief for treatment of arthritis, there remains a need in the art for more effective therapies for arthritis and other inflammatory diseases.
Inflammation and angiogenesis are now understood to be separable but not mutually exclusive processes. Specific angiogenic proteins have been discovered that stimulate angiogenesis without inflammation and angiostatic steroids can inhibit angiogenesis without decreasing acute inflammation. See Folkman, supra. Interestingly, endotoxin has been identified as the most potent exogenous stimulator of angiogenesis through its stimulation of macrophage cytokines and growth factors.
Bacteicidal/Permeability-Increasing Protein
Bactericidal/permeability-increasing protein (BPI) is a protein isolated from the granules of mammalian PMNs, which are blood cells essential in the defense against invading microorganisms. Human BPI protein that has been isolated from polymorphonuclear neutrophils by acid extraction combined with either ion exchange chromatography [Elsbach, J. Biol. Chem., 254: 11000 (1979)] or E. coli affinity chromatography [Weiss, et al., Blood, 69: 652 (1987)] is referred to herein as natural BPI and has potent bactericidal activity against a broad spectrum of gram-negative bacteria. The molecular weight of human BPI is approximately 55,000 daltons (55 kD). The amino acid sequence of the entire human BPI protein, as well as the DNA encoding the protein, have been elucidated in FIG. 1 of Gray et al., J. Biol. Chem., 264: 9505 (1989), incorporated herein by reference.
The bactericidal effect of BPI has been shown to be highly specific to sensitive gram-negative species, while non-toxic for other microorganisms and for eukaryotic cells. The precise mechanism by which BPI kills bacteria is as yet unknown, but it is known that BPI must first attach to the surface of susceptible gram-negative bacteria. This initial binding of BPI to the bacteria involves electrostatic interactions between the basic BPI protein and the negatively charged sites on lipopolysaccharides (LPS). LPS has been referred to as "endotoxin" because of the potent inflammatory response that it stimulates. LPS induces the release of mediators by host inflammatory cells which may ultimately result in irreversible endotoxic shock. BPI binds to Lipid A, the most toxic and most biologically active component of LPS.
In susceptible bacteria, BPI binding is thought to disrupt LPS structure, leading to activation of bacterial enzymes that degrade phospholipids and peptidoglycans, altering tile permeability of the cell's outer membrane, and ultimately causing cell death by an as yet unknown mechanism. BPI is also capable of neutralizing the endotoxic properties of LPS to which it binds. Because of its gram negative bactericidal properties and its ability to neutralize LPS, BPI can be utilized for tile treatment of mammals suffering from diseases caused by Gram-negative bacteria, such as bacteremia or sepsis.
A proteolytic fragment corresponding to the N-terminal portion of human BPI holoprotein possesses the antibacterial efficacy of the naturally-derived 55 kD human holoprotein. In contrast to the N-terminal portion, the C-terminal region of the isolated human BPI protein displays only slightly detectable anti-bacterial activity. Ooi, et al., J. Exp. Med., 174: 649 (1991). A BPI N-terminal fragment, comprising approximately the first 199 amino acid residues of the human BPI holoprotein and referred to as "rBPI23 ", has been produced by recombinant means as a 23 kD protein. Gazzano-Santoro et al., Infect. Immun. 60: 4754-4761 (1992).
Of interest to the present application are the disclosures in PCT International Application PCT/US91/05758 having publication No. WO 92/03535 relating to compositions comprising a BPI protein and an anionic compound which compositions are said to exhibit (1) no bactericidal activity and (2) endotoxin neutralizing activity. Anionic compounds are preferably a protein such as serum albumin but can also be a proteoglycan such as heparin. In addition, Weiss et al., J. Clin. Invest., 55: 33-42 (1975) discloses that heparin sulfate and LPS bind to block expression of the permeabiilty increasing activity of BPI. Neither reference discloses neutralization of heparin by combination with BPI, however.
There continues to exist a need in the art for new products and methods for use in neutralization of heparin, inhibition of tumor and angiogenesis, endothelial cell proliferation and treatment of chronic inflammation.
SUMMARY OF THE INVENTION
According to one aspect of the invention, methods are provided for neutralizing the anti-coagulant activity of heparin comprising administering an effective amount of a BPI protein product in vivo to a subject or in vitro to a fluid sample containing heparin.
According to another aspect of the invention, a BPI protein product is administered to subjects in order to inhibit endothelial cell proliferation including but not limited to endothelial cell proliferation associated with anglogenesis. The invention provides methods of inhibiting angiogenesis associated with a variety of clinical conditions. Specifically provided by the invention are methods of treating cancer by inhibiting angiogenesis associated with malignant tumor proliferation; Kaposi's sarcoma lesions and the like. Cancers susceptible to treatment by administration of BPI protein products include melanoma, sarcomas, and carcinomas including but not limited to breast, colon, lung, and prostate carcinomas. Other conditions for which BPI protein products can be administered for inhibition of angiogenesis include ocular retinopathy, retrolental fibroplasia, psoriasis, angiofibromas, endometriosis, hemangiomas and the like. Also contemplated by the invention are methods of contraception comprising administration of an effective amount of a BPI protein product to the uterine lining so as to prevent implantation of a fertilized ovum.
The invention also provides methods of treating chronic inflammatory disease states such as arthritis, psoriasis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, lupus erythematosus, autoimmune uveitis, Lyme disease, and asthma comprising administering an effective amount of a BPI protein product to a subject suffering from the inflammatory disease state.
The invention also provides methods of preparation of medicaments for neutralization of the anti-coagulant properties of heparin, inhibition of tumor and endothelial cell proliferation, inhibition of angiogenesis and treatment of chronic inflammatory disease states.
Such medicaments can be prepared for oral administration or by injection or other parenteral methods and preferably include conventional pharmaceutically acceptable carriers and adjuvants as would be known to those of skill in the art. The medicaments are preferably in the form of a unit dose in solid, semi-solid and liquid dosage forms such as tablets, pills, powders, liquid solutions or suspensions, and injectable and infusible solutions. Effective dosage ranges from about 100 μg/kg to about 10 mg/kg of body weight are contemplated.
As used herein, "BPI protein product" includes naturally and recombinantly produced bactericidal/permeability-increasing protein, natural synthetic, and recombinant biologically active polypeptide fragments of bactericidal/permeability increasing protein, and biologically active polypeptide analogs, including hybrid fusion proteins, of either bactericidal/permeability increasing protein or biologically active fragments thereof.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 depicts a graph of a heparin binding assay for rBPI23 and rBPI50 ;
FIG. 2 depicts a graph showing the effect of heparin on rBPI binding to E. coli J5 Lipid A compared to various LPS and teichoic acid samples;
FIG. 3 depicts a graph showing the effect of rBPI23 on ATIII/heparin inhibition of thrombin:
FIG. 4 depicts a graph showing the effect of rBPI23 on ATIII/heparin inhibition of Factor Xa;
FIG. 5 depicts a graph showing the effect of rBPI23 on heparin-mediated lengthening of thrombin time in human plasma;
FIG. 6 depicts a graph showing the effect of rBPI23 and thaumatin control protein on arthritic scores in a collagen-induced arthritis model with mild arthritis:
FIG. 7 depicts a graph showing the effect of rBPI23 and protamine on arthritic scores in a collagen-induced arthritis model with severe arthritis;
FIG. 8 depicts a graph showing survival of mice treated with BPI or a buffer in a mouse melanoma metastasis model;
FIG. 9 depicts a graph showing the effect of rBPI23 on Type II murine capillary endothelial cell proliferation:
FIG. 10 illustrates BPI binding to epithelial cells;
FIG. 11 depicts a graph of a heparin binding assay for synthetic BPI peptides;
FIG. 12 depicts a graph of a Limulus Amoebocyte Lysate (LAL) inhibition assay for synthetic BPI peptides; and
FIG. 13 depicts a graph of a radial diffusion bactericidal assay for synthetic BPI peptides.
DETAILED DESCRIPTION
The present invention relates to the administration of bactericidal/permeability-increasing protein (BPI) protein products for the treatment of a variety of therapeutic conditions not directly associated with bacterial infection.
While BPI is known as a potent cytotoxin for gram negative bacteria and is further known for neutralizing the adverse effects of lipopolysaccharide associated with the cell walls of grain negative bacteria, a variety of therapeutic effects for BPI protein products not directly associated with the gram negative bacterial infection have been discovered. Specifically, the invention provides methods for treating conditions not directly associated with gram negative infections including neutralization of the anti-coagulant activity of heparin, inhibition of tumor and endothelial cell proliferation including cell proliferation associated with angiogenesis and treatment of chronic inflammatory disease states such as arthritis.
The BPI protein products including biologically active fragments of BPI holoprotein which are to be administered according to the methods of this invention may be generated and/or isolated by any means known in the art. Co-owned, copending U.S. patent application Ser. No. 07/885,501, hereby incorporated by reference, discloses novel methods for the purification of recombinant BPI protein products expressed in and secreted from genetically transformed mammalian host cells in culture and discloses how one may produce large quantities of recombinant BPI products suitable for incorporation into stable, homogeneous pharmaceutical preparations.
Biologically active fragments of BPI include biologically active molecules that contains the same amino acid sequence as a BPI holoprotein, except that tile molecule lacks amino-terminal amino acids, internal amino acids, and/or carboxy-terminal amino acids of the holoprotein. By way of nonlimiting examples, such fragments include those described herein and the previously mentioned natural 25 kD fragment and a recombinant 23 kD, 199 amino acid residue amino-terminal fragment of the human BPI holoprotein referred to as rBPI23. See, Gazzano-Santoro et al., Infect. Immun. 60: 4754-4761 (1992). In that publication, an expression vector was used as a source of DNA encoding a recombinant expression product (rBPI23) having the 31-residue signal sequence and tile first 199 amino acids of the N-terminus of the mature human BPI, as set out in SEQ ID NOs: 1 and 2 taken from Gray et al., supra, except that valine at position 151 is specified by GTG rather than GTC and residue 185 is glutamic acid (specified by GAG) rather than lysine (specified by AAG). Recombinant holoprotein referred to herein as rBPI50 has also been produced having the sequence set out in SEQ ID NOs: 1 and 2 taken from Gray et al., supra, with the exceptions noted for rBPI23.
Biologically active analogs of BPI include but are not limited to recombinant hybrid fusion proteins comprising BPI holoprotein or biologically active fragment thereof, and at least a portion of at least one other polypeptide. Such proteins are described by Theofan et al. in co-owned, copending U.S. patent application Ser. No. 07/885,911, which is incorporated herein by reference in its entirety and include hybrid fusion proteins comprising, at the amino terminal end, a BPI protein or a biologically active fragment thereof and, at the carboxy terminal end, at least one constant domain of an immunoglobulin heavy chain or allelic variant thereof.
Biologically active analogs of BPI also include but are not limited to BPI protein products wherein one or more amino acid residue has been replaced by a different amino acid. For example, co-owned, copending U.S. patent application Ser. No. 08/013,801, filed Feb. 2, 1993, which is incorporated herein by reference, discloses polypeptide analogs of BPI and BPI fragments wherein a cysteine residue at position 132 or at position 135 is replaced by a different amino acid
The administration of BPI protein products is preferably accomplished with a pharmaceutical composition comprising a BPI protein product and a pharmaceutically acceptable diluent, adjuvant, or carrier. The BPI protein product composition may be administered without or in conjunction with known antibiotics, surfactants, or other chemotherapeutic agents. A preferred pharmaceutical composition containing BPI protein products comprises BPI at a concentration of 1 mg/ml in citrate buffered saline (0.02 M citrate, 0.15 M NaCl, pH 5.0) comprising 0.1% by weight of poloxamer 188 (Pluronic F-68, BASF Wyandotte, Parsippany, NJ) and 0.002% by weight of polysorbate 80 (Tween 80, ICI Americas Inc., Wilmington, DE). Such preferred combinations are described in co-owned, copending, U.S. patent application Ser. No. 08/012, 360, filed Feb. 2, 1993, the disclosure of which is incorporated herein by reference.
Effective doses of BPI and BPI protein products for partial or complete neutralization of the anti-coagulant activity of heparin and other effects described herein may be readily determined by those of skill in the art according to conventional parameters including the size of the subject, the quantity of heparin administered to the subject and the time since administration of the heparin.
Other aspects and advantages of the present invention will be understood upon consideration of the following illustrative examples. Example 1 addresses assay systems for quantification of heparin binding by BPI protein products; Example 2 describes the relative capacity of heparin to block binding of bacterial LPS to BPI protein products: Examples 3 and 4, respectively, present results of tests for the capacity of BPI protein products to inhibit thrombin or Factor Xa inactivation by antithrombin III/heparin complexes; and Example 5 relates to the effect of BPI protein products on heparin-mediated lengthening of thrombin time. Examples 6-8 relate to administration of BPI protein products of in collagen and bacterial induced arthritis animal model systems exemplifying treatment of chronic inflammatory disease states. Examples 9-10 illustrate testing of BPI protein products for angiostatic effects in a mouse malignant melanoma metastasis model system. Example 11 addresses effects of BPI protein products on endothelial cell proliferation and possible binding mechanisms involved. Examples 12-14 illustrate heparin-binding, LPS-binding and bactericidal activities for BPI protein product synthetic peptides.
EXAMPLE 1
Heparin binding assays were conducted using membrane bound natural and recombinant BPI molecules and radiolabelled heparin. Briefly, rBPI23 and holoprotein designated rBPI50 were added to wells of a 96-well microtiter plate having an Imobilon-P (Millipore, Bedford, Mass.) membrane disposed at bottom of the wells. Five μg of protein was added to each well. The wells were dried and subsequently blocked with a 0.1% bovine serum albumin (BSA) in phosphate buffered saline, pH 7.4 (blocking buffer.) Dilutions of 3 H-heparin (DuPont, NEN, Wilmington, Del.) were made in the blocking buffer and incubated in the rBPI23 containing wells for one hour at 4° C. The unbound heparin is aspirated and the wells were washed three times with blocking buffer, dried and removed for quantitation in a liquid scintillation counter. Typical assay results are graphically presented in FIG. 1. While BSA in the blocking buffer does have a low affinity and capacity to bind heparin, this was considered physiologically irrelevant and the background was routinely subtracted from the test compound signal.
Similar assays compared heparin binding by rBPI23 , rBPI50, and natural holoprotein (BPI55) with thaumatin or with wash buffer (1% BSA) as controls. In these assays, relatively little heparin binding by the natural and rBPI50 holoproteins was observed. The lesser extent of binding by rBPI50 and nBPI55 may have been the result of carbohydrate contamination of the protein preparations.
In addition, binding constants with 3 H-heparin as the ligand were determined using nonlinear function minimization with Grafit software (Erithicus Softward Ltd., Staines, UK) for rBPI23, rBPI50, protamine and thaumatin with the results shown in Table 1 below.
              TABLE 1                                                     
______________________________________                                    
Binding Constants with .sup.3 H-heparin as the Ligand                     
                                     HEPARIN                              
HEPARIN          CO-                 COLUMN                               
BINDING          OPERA-              NaCl                                 
PROTEIN K.sub.d  TIVITY    CAPACITY  ELUTION                              
______________________________________                                    
rBPI.sub.23                                                               
         79 nM   1.93      2.63 μg                                     
                                     0.84 M                               
rBPI.sub.50                                                               
        173 nM   1.18      1.30 μg                                     
                                     0.81 M                               
Protamine                                                                 
         8.1 nM  1.02      2.66 μg                                     
                                     1.33 M                               
Thaumatin        no binding          0.15 M                               
______________________________________                                    
EXAMPLE 2
The ability of heparin and of soluble Lipid A, LPS, and Teichoic acids to compete with immobilized E. coli J5 Lipid A for binding to soluble rBPI23 were assessed. Specifically, Immulon 2 (Dynatech, Chintilly, Va.) microtiter wells were coated with E. coli J5 Lipid A at a concentration of 0.5 μg/mL in methanol (50 μL volume ). The wells were then blocked for 4 hours at 37° C. with PBS containing 0.1% BSA. Control wells were treated with 50μL of plain methanol and then blocked as above. The blocked wells were aspirated and washed twice with PBS/0.05% Tween-20. Varying concentrations of putative inhibitors were plated onto the wells in a volume of 25μL PBS, followed by 200,000 cpm of radio-iodinated rBPI23 in 25μL of PBS containing 0.1% Tween-20. The test solutions included Ra LPS from Salmonella minnesota R60 at 200μg/mL; Smooth LPS from E. coli 0113 (RIBI Immunochem, Hamilton, Mont., #R318) at 200μg/mL; Lipoteichoic acid from Streptococcus faecalis, (Sigma, St. Louis, Mo., #L-4015) at 400 μg/mL; Lipoteichoic acid from Staphylococcus Aureus, (Sigma #L-2525) at 400 μg/mL; and heparin sodium USP injection (Lypho-Med, Rosemont, Ill., #915501 ) at 400 μg/mL. Binding was allowed to proceed overnight at 4° C. with gentle shaking, after which the wells were aspirated, washed three times with PBS/0.05% Tween-20, and counted. The results as set out in FIG. 2 show a high affinity of rBPI23 for heparin and also that heparin block a greater proportion of BPI binding to Lipid A at concentrations of up to 0.1μg/mL than any of the LPS or teichoic acid inhibitors.
EXAMPLE 3
A chromostrate assay was used to determine the effect of rBPI23 on thrombin inactivation by ATIII/heparin complexes. Specifically, a Chromostrate anti-thrombin assay kit (Organon Teknika Corp., Durham, N.C.) was used to examine the inhibition of purified thrombin by preformed ATIII/heparin complexes in plasma.
The assay was performed in 96 well microtiter plates with a final volume per well of 200 μg/mL. The order of addition of assay components was as follows: diluted heparinized reference plasma (50 μL); thrombin 1nKat/mL (50 μL ); 50 μL rBPI23 or thaumatin (a control protein) at concentrations ranging from 1.0 μg/mL to 100 μg/mL; and thrombin chromogenic substrate 1 μmole/mL (50 μL). The reaction was allowed to proceed for 5 minutes and the color reaction was quantitated on a microplate reader. The assay results shown in FIG. 3 indicate that rBPI23 can effectively neutralize ATIII/heparin complexes in heparinized human plasma in a dose dependent manner. As the plasma was titrated the amount of thrombin activity increased. This was caused by a decrease in the amount of inhibitory ATIII/heparin complexes in the added plasma. The control protein, thaumatin, was essentially equivalent in effect to the buffer control at all protein concentrations.
EXAMPLE 4
A chromostrate assay was used to determine the effect of rBPI23 on Factor Xa neutralization by ATIII/heparin complexes. Specifically, the assay was conducted using a chromostrate heparin anti-Factor Xa assay kit (Organon Teknika Corp.) and was performed under fixed concentrations of Factor Xa and ATIII. Heparin concentration was varied so that a heparin standard curve was generated for determination of unknown heparin concentrations in clinical samples. The assay measured functional Factor Xa activity by the release of a chromogenic compound from a synthetic substrate. ATIII/heparin complexes neutralize Factor Xa activity, thus the amount of chromogen released was inversely related to the amount and anti-Factor Xa activity of heparin in the assay sample.
The assay was performed in 96 well microtiter plates with a final volume per well of 200 μL. Assay components were added to the microtiter wells as follows: 50 μL of purified Factor Xa (.14nKat/mL), 25 μL purified bovine ATIII (0.5 U/mL), 25 μL heparin (from 0.0 to 0.6 U/mL), 50 μL rBPI23 or the control thaumatin at various concentrations (from 3.125 μg/mL to 100 μg/mL) and 50 μL substrate (3 μmoles/mL). The reaction was allowed to proceed for 5 minutes and then the color reaction was quantitated on a microplate reader. The assay results shown in FIG. 4 indicates that rBPI23 can effectively neutralize heparin in the ATIII/heparin inhibition of Factor Xa. As the concentration of heparin is increased, the amount of rBPI23 necessary for heparin neutralization also increased. The control protein, thaumatin, was essentially equivalent in effect to the buffer control at all protein concentrations.
EXAMPLE 5
The effect of rBPI23 was determined on heparin-mediated lengthening of thrombin time, i.e., the time required for clotting of a mixture of thrombin and plasma. Thrombin time is lengthened by the presence of endogenous or exogenous inhibitors of thrombin formation, such as therapeutically administered heparin. Agents which neutralize the anticoagulant effects of heparin will reduce the thrombin time measured by the test. Human citrated plasma (200 μL) was incubated for 1 minute at 37° C. with either 15 μL of diluent (0.15 M NaCl, 0.1 M Tris, pH 7.4) or 15 μL of the diluent also containing 25 μg/mL heparin (187 units/mg). Various concentrations of rBPI23 )from 0.0 to 56 μg/mL) in a volume of 15 μL were added, followed immediately by 100 μL of thrombin reagent (Sigma Chemical Co., No. 845-4). Clotting time (thrombin time) was measured using a BBL Fibrometer (Becton Dickenson Microbiology Systems, Cockeysville, Md.). The results shown in FIG. 5 establish that rBPI23 inhibits the heparin-mediated lengthening of thrombin time. In the absence of heparin, rBPI23 had no effect on the assay even at concentrations as high as 56 μg/mL.
The results of Examples 1 through 5 show that rBPI23 binds to heparin in direct binding assays and effectively neutralizes heparin inhibition of coagulation proteases. Based on these characteristics, BPI protein products are projected to be useful in the clinical neutralization of heparin anti-coagulant effects in dosages generally corresponding functionally to those recommended for protamine sulfate, but are not expected to possess the severe hypotensive and anaphylactoid effects of that material.
A further aspect of the present invention relates to the discovery of the utility of BPI to treat and prevent the effects of chronic inflammatory disease states such as arthritis, including rheumatoid and reactive arthritis, psoriasis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, lupus erythematosus, autoimmune uveitis, Lyme disease, and asthma. Exemplary methods are provided for treating subjects suffering from arthritis comprising administering an effective amount of a BPI protein product in order to prevent or treat arthritis. The BPI protein product may be administered topically, or by injection such as intraarticularly, intravenously, intramuscularly or subcutaneously or by other parenteral and non-parenteral methods.
EXAMPLE 6
The effect of administration of BPI protein products was studied in a collagen-induced arthritis model. Specifically, arthritis was induced in mice by intradermal immunization of bovine Type II collagen at the base of the tail according to the method of Stuart et al., J. Clin. Invest., 69: 673-683 (1982). Generally, mice begin to develop arthritic symptoms at Day 21 after collagen immunization. The arthritic scores of the treated mice were then evaluated in a blinded fashion over a period of 120 days for mice treated on each of days 21-25 with doses of either rBPI23, thaumatin control protein, or buffer which were injected intravenously via the tail vein.
Specifically, bovine Type II collagen (Southern Biotechnology Associates, Inc., Birmingham Ala.) was administered via intradermal injection (0.1 mg/mouse) at the base of the tail on day 0 to groups of ten male mice (Mouse/DBA/1J), each weighing approximately 20-25 g grams. rBPI23 was dissolved in 0.5 M NaCl, 20 mM sodium acetate, pH 6.0 and diluted with PBS buffer (1 mg/ml) for administration at 0.125 mg/mouse. Thaumatin protein in PBS (0.121 mg/mouse), and PBS buffer alone (0.1 ml) were administered as controls.
The results shown in FIG. 6 show that the BPI has a statistically significant effect in reducing the arthritic score of treated mice compared with the PBS buffer and thaumatin protein controls.
EXAMPLE 7
The collagen-induced arthritis model of Example 6 was used to evaluate the performance of a BPI protein product in comparison with protamine sulfate, and both thaumatin protein and buffer as controls. Specifically, rBPI23 was dissolved in 0.5 M NaCl, 20 mM sodium acetate, pH 6.0 and diluted with PBS buffer (1 mg/ml) and was administered at 0.125 mg/mouse. The other test materials were administered at the following dosages: protamine sulfate (Sigma Chemical Co) (0.13 mg/mouse), thaumatin (0.121 mg/mouse), and PBS buffer (0.1 ml). Each of four groups of ten mice received test or control materials through intravenous injection via the tail vein on each of days 28 through 32. FIG. 7 discloses the results of arthritic scores for the various treatment and control protocols evaluated at days 28-80. The stars (*) in FIG. 7 represent a statistically significant difference between rBPI23 and buffer at p<0.01 while the pluses (+) represent a statistically significant difference between rBPI23 and buffer at p < 0.05.These results show that the rBPI23 significantly reduced arthritic score for mice treated in the model system.
EXAMPLE 8
In this example BPI protein products are administered to treat reactive arthritis in a Yersinia enterocolitica reactive arthritis model according to the method of Yong et al., Microbial Pathogenesis, 4: 305-310 (1988). Specifically, BPI protein products are administered to DBA/2J mice which have previously been injected intravenously with Yersinia enterocolitica WA at a dosage calculated to induce a non-septic arthritis in the mice.
The invention also provides methods for inhibiting endothelial cell proliferation and angiogenesis by administration of BPI protein products. Examples are specifically provided which address treatment of tumors in a mouse melanoma model system.
EXAMPLE 9
According to this example, a BPI protein product, protamine, and both thaumatin protein and buffer controls were tested for efficacy in a mouse malignant melanoma metastasis model. Specifically, four groups of nine C57BL/6J mice were inoculated with 105 B16.F10 malignant melanoma cells via intravenous injection into the tail vein on day 0. Either rBPI23 (0.13 mg/mouse), protamine sulfate (0.13 mg/mouse), thaumatin (0.13 mg/mouse) or PBS buffer (0.1 ml/mouse) were intravenously administered into the tail vein of the mice on days 1, 3, 6, 8, 10, 13, 15, 17, and 19. The animals were sacrificed via cervical dislocation on Day 20 for observation of lung tissues. The lobes of each lung were perfused and inflated by injecting 3 ml water into the lung via the trachea. Superficial tumor nodules were then counted with the aid of a dissecting microscope and the number of tumors found per group analyzed for statistically significant differences. While the data was not statistically significant, animals treated with BPI23 had the lowest tumor load, followed by those treated with protamine, the thaumatin protein control and the buffer control. The lack of statistical significance (tumor number did not adequately reflect tumor size) indicated that a more specific assay methodology would be needed to determine the tumor load.
EXAMPLE 10
A BPI protein product, protamine, and both thaumatin protein and buffer controls were again tested for efficacy in the mouse malignant melanoma metastasis model of Example 9. Specifically, six groups of C57BL/6J mice were inoculated with 105 B16. F10 malignant melanoma cells via intravenous injection into the tail vein on day 0. Either rBPI23 (0.125 mg/mouse), protamine sulfate (0.125 mg/mouse), thaumatin (0.125 mg/mouse) or PBS buffer as set out in Table 2 below were intravenously administered into the tail vein of the mice on days 1, 2, 5, 7, 9, 12, 14, 16, and 19. All animals in groups A-D were sacrificed by cervical dislocation on day 20 for observation of lung tissues. The lungs were removed and placed into a beaker of cold water. The lobes of each lung were then perfused and inflated by injecting 3 ml of water into the lung via the trachea. Superficial tumor nodules are then analyzed for melanin content.
              TABLE 2                                                     
______________________________________                                    
Group     Control/Test Article                                            
                         No. of Animals                                   
______________________________________                                    
A         Buffer         10                                               
B         Protamine      10                                               
C         Thaumatin      10                                               
D         rBPI.sub.23    10                                               
E         Buffer          5                                               
F         rBPI.sub.23     5                                               
______________________________________                                    
Groups E and F comprising animals treated with either buffer or rBPI23 respectively were not sacrificed but were observed once daily for mortality. FIG. 8 shows the survival data for the two groups of animals. Although all ten of the animals had died by day 43, the BPI treated mice generally survived significantly longer than the untreated mice indicating that BPI had an anti-angiogenic effect and slowed metastasis of the melanoma tumors.
According to an additional aspect of the invention, BPI protein products may be used to inhibit Kaposi's Sarcoma in a model system such as that of Miles et al., VII International Conference on AIDS, Florence, Italy, Paper 41(8), 1991.
EXAMPLE 11
Murine cerebral capillary endothelial cells (EC) as described in Bauer, Microvascular Research 37: 148-161 (1989) were passaged in Medium 199 containing Earle's salts, L-glutamine and 2.2 g/l of sodium bicarbonate (Gibco, Grand Island, N.Y., #400-100EB), plus 10% heat inactivated fetal calf serum (Irvine Scientific, Irvine, Calif.) and 1% penicillin/streptomycin (Gibco, #600-5140AG). Harvesting of the confluent cells was performed by trypsinization with trypsin-EDTA (Gibco #610-5300PG) for 3 minutes. The trypsinization was stopped by adding 10 ml of the passage medium to the flask. Proliferation assays were performed on freshly harvested EC in standard flat bottom 96 well microtiter plates. A final volume of 200 μl/well was maintained for each well of the assay. A total of 4×104 EC were added to each well with varying concentrations of rBPI23, thaumatin control protein or buffer control. After 48 hours of culture in a 5% CO2 incubator, 1 μCi of [methyl-3 H] thymidine in 10 μl of Medium 199 was added to each well. After a 24 hour pulse, the EC cells were harvested by trypsinization onto glass microfiber filters and incorporated [3 H]thymidine was quantitated with a gas proportional solid phase beta counter.
Concentration dependent inhibition of EC cell proliferation by rBPI23 is shown in FIG. 9. No effect was observed when similar concentrations of thaumatin or equal volumes of the buffer were added to the wells. The first inhibition of proliferation is observed at 12.4 μg/ml rBPI23 and the effect appears to be maximal at 50 μg/ml. The growth of the EC cells is known to be dependent on FGF-2 (bFGF) in the calf serum and FGF-2 requires cell surface heparan for receptor activation (Yayon et al., Cell 64: 841-848, 1991). Without intending to be bound by a theory of the invention, it is believed that rBPI23 bound to cell surface heparan on the EC cells interferes with the activation of the cells by FGF-2.
Direct binding studies of rBPI23 on the EC cells were performed by harvesting the 10x passaged cells from a confluent flask and resuspending the trypsinized cells in 12.5 ml of culture medium. 0.5 ml of the suspension was added to each well of a standard 24 well tissue culture plate and incubated overnight. The plate was washed with 0.1% bovine serum albumin in phosphate buffered saline containing calcium and magnesium. (Gibco.) After washing, 0.5 ml of the BSA/PBS was added per well. Preliminary experiments indicated that 50 ng/ml of 125 I-labeled rBPI23 added to the wells produced approximately 30,000 specific cpm after a 3 hour, 4° C. incubation with 3x washing in PBS and lysis with 1 M NaOH from gamma counting of the lysate.
The specific binding of 50 ng/ml 125 I-labeled, "hot" rBPI23 to the EC cells could be competed by addition of 20 μg/ml heparin (Sigma, Grade I). Similar competition was observed for unlabeled ("cold") rBPI23 added to the binding culture. The combination of unlabeled rBPI23 with heparin (concurrently added or pre-mixed prior to addition) could not reduce the binding below the heparin only competition (FIG. 10). These data indicate that rBPI23 binds to endothelial cells via heparin-like molecule and that this binding appears to interfere with EC cell proliferation to a heparin binding growth factor (FGF-2).
In order to assess biological properties of peptide fragment BPI protein products, 15-mer amino acid synthetic peptides based on the 23 kD amino terminal fragment of BPI were prepared and evaluated for heparin-binding activity, activity in a Limulus Amoebocyte Lysate Inhibition (LAL) assay and bactericidal activity. Specifically, 47 synthetic peptides each comprising 15 amino acids and overlapping the adjacent peptides by 11 amino acids were prepared, in duplicate, based on the sequence of rBPI23 described above.
Peptides were simultaneously synthesized according to the methods of Maeji et al., Immunol. Methods, 134: 23-33 (1990) and Gammon et al., J. Exp. Med., 173: 609-617 (1991 ), utilizing the solid-phase technology of Cambridge Research Biochemicals Ltd. under license of Coselco Mimotopes Pty Ltd. Briefly, the sequence of rBPI23 (1-199) was divided into 47 different 15-mer peptides that progressed along the linear sequence of rBPI23 by initiating a subsequent peptide every fifth amino acid. This peptide synthesis technology allows for the simultaneous small scale synthesis of multiple peptides on separate pins in a 96-well plate format. Thus, 94 individual pins were utilized for this synthesis and tile remaining to pins (B,B) were subjected to the same steps as the other pins without tile addition of activated FMOC-amino acids. Final cleavage of the 15-mer peptides from the solid-phase pin support employed an aqueous basic buffer (sodium carbonate, pH 8.3). The unique linkage to the pin undergoes a quantitative diketopiperazine cyclization under these conditions resulting in a cleaved peptide with a cyclo(lysylprolyl) moiety on the carboxyl-terminus of each peptide. The amino-termini were not acetylated so that the free amino group could potentially contribute to anion binding reactions. An average of about 15 μg of each 15-mer peptide is recovered per well.
EXAMPLE 12
The synthetic BPI protein product peptides described above were subjected to a heparin binding assay according to the methods described in Example 1. The results, as shown in FIG. 11, indicate the existence of three separate functional domains with heparin binding activity; the first extending from about amino acids 21-55; the second extending from about amino acids 65-107; and the third extending from about amino acids 137-171. Material from blank control pins had no heparin binding effects.
EXAMPLE 12
The synthetic BPI protein product peptides described above were Limulus Amoebocyte Lysate (LAL) inhibition assay to determine LPS binding properties. Specifically, the synthetic BPI peptides were mixed in Eppendorf tubes with a fixed concentration of E. coli 0113 LPS (4 ng/ml final) and incubated at 37° C. for 3 hours with occasional shaking. Addition controls comprising 0.05 μg/mL were also tested. Following incubation, 360 μl D-PBS was added per tube to obtain an LPS concentration of 200 pg/mL for the LAL assay. Each sample was then transferred into Immulon II strips (Dynatech, Chantilly, Va.) in volumes of 50 μl per well.
Limulus amoebocyte Lysate (Quantitative chromogenic LAL kit, Whitaker Bioproducts, Inc., Walkersville, Md.) was added at 50 μl per well and the wells were incubated at room temperature for 25 minutes. Chromogenic substrate was then added at a volume of 100 μl per well and was well mixed. After incubation for 20 to 30 minutes at room temperature, the reaction was stopped with addition of 100 μl of 25% acetic acid. Optical density at 405 nm was then measured in a multiplate reader (Vmax, Molecular Dynamics, Menlo Park, Calif.) with the results shown in FIG. 12 in terms of percent inhibition of LPS. The data in FIG. 12 indicate at least three major domains with significant LAL inhibition; the first extending from amino acids 17-55; the second extending from about amino acids 73-99 and the third extending from about amino acids 137-163. Other individual peptides also exhibit LAL inhibition. In contrast, material from blank control pins did not exhibit LPS neutralizing effects as measured by the LAL assay.
EXAMPLE 14
The synthetic BPI protein product peptides were tested for bactericidal effects against the rough mutant E. coli J5 bacteria in a radial diffusion assay. Specifically, an overnight culture of E. Coli J5 was diluted 1: 50 into fresh tryptic soy broth and incubated for 3 hours at 37° C. to attain log phase. Bacteria were then pelleted at 3,000 rpm for 5 minutes in a Sorvall RT6000B. 5mL of 10 mM sodium phosphate buffer (ph 7.4) was added and the preparation was re-centrifuged. The supernatant was decanted and 5 mL of fresh buffer was added, the bacteria were resuspended and their concentration was determined by measurement of absorbance at 590 nm. Absorbance of 1.25×109 CFU/mL suspension equals 1.00. The bacteria were diluted to 4×106 CFU/mL in 10 mL of molten underlayer agarose (approximately 45° C.) and inverted repeatedly to mix with 15 mL polypropylene tubes used for this purpose.
The entire contents of tile tube were poured into a perfectly level square petri dish and distributed evenly by rocking the dish side to side. The agarose hardened in less than 30 seconds and had a uniform thickness of about 1 mm. A series of wells were then punched into the hardened agarose using a sterile 3 mm punch attached to a vacuum apparatus. The punch was sterilized with 100% alcohol and allowed to air dry.
10 μL of the synthetic BPI peptides were carefully pipetted into each well. As controls, pH 8.3 buffer was added to a separate well (as positive controls, 5 μg/mL and 1 μg/mL concentration of rBPI23 was also added. In addition, products from tile blank pins B and B were tested as controls. The plate was allowed to incubate at 37° C. for 3 hours and 10 mL of molten overlayer agarose (at approximately 45° C.) was then added into the level petri dish, allowed to harden and incubated overnight at 37° C. A clear zone was seen against the lawn of bacteria in those wells having bactericidal activity. In order to visually enhance this zone, a dilute Coomassie solution (0.002% Coomassie Brilliant Blue, 27% methanol, 15% formaldehyde (37% stock solution) and H2 O) was poured over the agar and allowed to stain for 24 hours. The bacterial zones were measured with a Mitutoyo micrometer.
The results of the assay are shown in FIG. 13 where the only synthetic BPI peptide seen to have bactericidal activity was a fragment corresponding to amino acids 85-99. The positive rBPI23 controls also had bactericidal effects while the buffer and blank pin controls did not.
The results of this bactericidal assay along with the heparin binding and LAL assays indicate that there exist small synthetic BPI peptides with one or more of bactericidal, heparin binding and LPS neutralizing effects and that there exist three distinct separate functional domains within the 23 kD amino terminal fragment. The most active domain, characterized by activity in all three assays, resides between amino acids 73-99. One specific peptide 86-99 demonstrated activity in all three assays. A second domain resides between amino acid residues 25-44 and the third domain is composed of residues 117-128 and 143-163. The third domain is separated by a CSSCSS amino acid sequence that presumably is involved in a disulfide bond which brings these two minor regions in close 3-dimensional proximity within the native rBPI23 molecule to create a third LPS/heparin binding domain.
Numerous modifications and variations in the practice of the invention are expected to occur to those skilled in the art upon consideration of the presently preferred embodiments thereof. Consequently, the only limitations which should be placed upon the scope of the invention are those which appear in the appended claims.
__________________________________________________________________________
SEQUENCE LISTING                                                          
(1) GENERAL INFORMATION:                                                  
(iii) NUMBER OF SEQUENCES: 2                                              
(2) INFORMATION FOR SEQ ID NO:1:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 1813 base pairs                                               
(B) TYPE: nucleic acid                                                    
(C) STRANDEDNESS: single                                                  
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: cDNA                                                  
(ix) FEATURE:                                                             
(A) NAME/KEY: CDS                                                         
(B) LOCATION: 31..1491                                                    
(ix) FEATURE:                                                             
(A) NAME/KEY: matpeptide                                                  
(B) LOCATION: 124..1491                                                   
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
CAGGCCTTGAGGTTTTGGCAGCTCTGGAGGATGAGAGAGAACATGGCCAGGGGC54                  
MetArg GluAsnMetAlaArgGly                                                 
31-30-25                                                                  
CCTTGCAACGCGCCGAGATGGGTGTCCCTGATGGTGCTCGTCGCCATA102                       
ProCysAsnAlaProArgTrpValSerLe uMetValLeuValAlaIle                         
20-15- 10                                                                 
GGCACCGCCGTGACAGCGGCCGTCAACCCTGGCGTCGTGGTCAGGATC150                       
GlyThrAlaValThrAlaAlaValAsnPro GlyValValValArgIle                         
515                                                                       
TCCCAGAAGGGCCTGGACTACGCCAGCCAGCAGGGGACGGCCGCTCTG198                       
SerGlnLysGlyLeuAspTyrAlaSerGlnGlnGlyThr AlaAlaLeu                         
10152025                                                                  
CAGAAGGAGCTGAAGAGGATCAAGATTCCTGACTACTCAGACAGCTTT246                       
GlnLysGluLeuLysArgIleLysIleProAspTy rSerAspSerPhe                         
303540                                                                    
AAGATCAAGCATCTTGGGAAGGGGCATTATAGCTTCTACAGCATGGAC294                       
LysIleLysHisLeuGlyLysGlyHisTyrSerP heTyrSerMetAsp                         
455055                                                                    
ATCCGTGAATTCCAGCTTCCCAGTTCCCAGATAAGCATGGTGCCCAAT342                       
IleArgGluPheGlnLeuProSerSerGlnIleSer MetValProAsn                         
606570                                                                    
GTGGGCCTTAAGTTCTCCATCAGCAACGCCAATATCAAGATCAGCGGG390                       
ValGlyLeuLysPheSerIleSerAsnAlaAsnIleLysIle SerGly                         
758085                                                                    
AAATGGAAGGCACAAAAGAGATTCTTAAAAATGAGCGGCAATTTTGAC438                       
LysTrpLysAlaGlnLysArgPheLeuLysMetSerGlyAsnPheAsp                          
 9095100105                                                               
CTGAGCATAGAAGGCATGTCCATTTCGGCTGATCTGAAGCTGGGCAGT486                       
LeuSerIleGluGlyMetSerIleSerAlaAspLeuLysLeuGlyS er                         
110115120                                                                 
AACCCCACGTCAGGCAAGCCCACCATCACCTGCTCCAGCTGCAGCAGC534                       
AsnProThrSerGlyLysProThrIleThrCysSerSerCysSer Ser                         
125130135                                                                 
CACATCAACAGTGTCCACGTGCACATCTCAAAGAGCAAAGTCGGGTGG582                       
HisIleAsnSerValHisValHisIleSerLysSerLysValGlyTrp                          
140145150                                                                 
CTGATCCAACTCTTCCACAAAAAAATTGAGTCTGCGCTTCGAAACAAG630                       
LeuIleGlnLeuPheHisLysLysIleGluSerAlaLeuArgAsnLys                          
1 55160165                                                                
ATGAACAGCCAGGTCTGCGAGAAAGTGACCAATTCTGTATCCTCCAAG678                       
MetAsnSerGlnValCysGluLysValThrAsnSerValSerSerLys                          
170 175180185                                                             
CTGCAACCTTATTTCCAGACTCTGCCAGTAATGACCAAAATAGATTCT726                       
LeuGlnProTyrPheGlnThrLeuProValMetThrLysIleAspSer                          
 190195200                                                                
GTGGCTGGAATCAACTATGGTCTGGTGGCACCTCCAGCAACCACGGCT774                       
ValAlaGlyIleAsnTyrGlyLeuValAlaProProAlaThrThrAla                          
 205210215                                                                
GAGACCCTGGATGTACAGATGAAGGGGGAGTTTTACAGTGAGAACCAC822                       
GluThrLeuAspValGlnMetLysGlyGluPheTyrSerGluAsnHis                          
220 225230                                                                
CACAATCCACCTCCCTTTGCTCCACCAGTGATGGAGTTTCCCGCTGCC870                       
HisAsnProProProPheAlaProProValMetGluPheProAlaAla                          
235 240245                                                                
CATGACCGCATGGTATACCTGGGCCTCTCAGACTACTTCTTCAACACA918                       
HisAspArgMetValTyrLeuGlyLeuSerAspTyrPhePheAsnThr                          
250255 260265                                                             
GCCGGGCTTGTATACCAAGAGGCTGGGGTCTTGAAGATGACCCTTAGA966                       
AlaGlyLeuValTyrGlnGluAlaGlyValLeuLysMetThrLeuArg                          
270 275280                                                                
GATGACATGATTCCAAAGGAGTCCAAATTTCGACTGACAACCAAGTTC1014                      
AspAspMetIleProLysGluSerLysPheArgLeuThrThrLysPhe                          
285 290295                                                                
TTTGGAACCTTCCTACCTGAGGTGGCCAAGAAGTTTCCCAACATGAAG1062                      
PheGlyThrPheLeuProGluValAlaLysLysPheProAsnMetLys                          
300 305310                                                                
ATACAGATCCATGTCTCAGCCTCCACCCCGCCACACCTGTCTGTGCAG1110                      
IleGlnIleHisValSerAlaSerThrProProHisLeuSerValGln                          
315320 325                                                                
CCCACCGGCCTTACCTTCTACCCTGCCGTGGATGTCCAGGCCTTTGCC1158                      
ProThrGlyLeuThrPheTyrProAlaValAspValGlnAlaPheAla                          
330335340 345                                                             
GTCCTCCCCAACTCCTCCCTGGCTTCCCTCTTCCTGATTGGCATGCAC1206                      
ValLeuProAsnSerSerLeuAlaSerLeuPheLeuIleGlyMetHis                          
350355 360                                                                
ACAACTGGTTCCATGGAGGTCAGCGCCGAGTCCAACAGGCTTGTTGGA1254                      
ThrThrGlySerMetGluValSerAlaGluSerAsnArgLeuValGly                          
365370 375                                                                
GAGCTCAAGCTGGATAGGCTGCTCCTGGAACTGAAGCACTCAAATATT1302                      
GluLeuLysLeuAspArgLeuLeuLeuGluLeuLysHisSerAsnIle                          
380385 390                                                                
GGCCCCTTCCCGGTTGAATTGCTGCAGGATATCATGAACTACATTGTA1350                      
GlyProPheProValGluLeuLeuGlnAspIleMetAsnTyrIleVal                          
395400405                                                                 
 CCCATTCTTGTGCTGCCCAGGGTTAACGAGAAACTACAGAAAGGCTTC1398                     
ProIleLeuValLeuProArgValAsnGluLysLeuGlnLysGlyPhe                          
4104154204 25                                                             
CCTCTCCCGACGCCGGCCAGAGTCCAGCTCTACAACGTAGTGCTTCAG1446                      
ProLeuProThrProAlaArgValGlnLeuTyrAsnValValLeuGln                          
430435 440                                                                
CCTCACCAGAACTTCCTGCTGTTCGGTGCAGACGTTGTCTATAAA1491                         
ProHisGlnAsnPheLeuLeuPheGlyAlaAspValValTyrLys                             
445450455                                                                 
T GAAGGCACCAGGGGTGCCGGGGGCTGTCAGCCGCACCTGTTCCTGATGGGCTGTGGGGC1551         
ACCGGCTGCCTTTCCCCAGGGAATCCTCTCCAGATCTTAACCAAGAGCCCCTTGCAAACT1611          
TCTTCGACTCAGATTCAGAAATGATCTAAACACGAGGAAACATTATT CATTGGAAAAGTG1671         
CATGGTGTGTATTTTAGGGATTATGAGCTTCTTTCAAGGGCTAAGGCTGCAGAGATATTT1731          
CCTCCAGGAATCGTGTTTCAATTGTAACCAAGAAATTTCCATTTGTGCTTCATGAAAAAA1791          
AACTTCTGGTTTTTTTCATGTG 1813                                               
(2) INFORMATION FOR SEQ ID NO:2:                                          
(i) SEQUENCE CHARACTERISTICS:                                             
(A) LENGTH: 487 amino acids                                               
(B) TYPE: amino acid                                                      
(D) TOPOLOGY: linear                                                      
(ii) MOLECULE TYPE: protein                                               
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
MetArgGluAsnMetAlaArgGlyProCysAs nAlaProArgTrpVal                         
31-30-25-20                                                               
SerLeuMetValLeuValAlaIleGlyThrAlaValThrAlaAlaVal                          
15-10-5 1                                                                 
AsnProGlyValValValArgIleSerGlnLysGlyLeuAspTyrAla                          
51015                                                                     
SerGlnGlnGlyThrAlaAlaLeuGlnLysGluLeuLysArgIleLys                          
 202530                                                                   
IleProAspTyrSerAspSerPheLysIleLysHisLeuGlyLysGly                          
354045                                                                    
HisTyrSerPheTyrSerMetAspIleArg GluPheGlnLeuProSer                         
50556065                                                                  
SerGlnIleSerMetValProAsnValGlyLeuLysPheSerIleSer                          
7075 80                                                                   
AsnAlaAsnIleLysIleSerGlyLysTrpLysAlaGlnLysArgPhe                          
859095                                                                    
LeuLysMetSerGlyAsnPheAspLeuSerIleGluGlyMetSe rIle                         
100105110                                                                 
SerAlaAspLeuLysLeuGlySerAsnProThrSerGlyLysProThr                          
115120125                                                                 
IleThrCysSerSerCys SerSerHisIleAsnSerValHisValHis                         
130135140145                                                              
IleSerLysSerLysValGlyTrpLeuIleGlnLeuPheHisLysLys                          
150 155160                                                                
IleGluSerAlaLeuArgAsnLysMetAsnSerGlnValCysGluLys                          
165170175                                                                 
ValThrAsnSerValSerSerLysLeuGlnPro TyrPheGlnThrLeu                         
180185190                                                                 
ProValMetThrLysIleAspSerValAlaGlyIleAsnTyrGlyLeu                          
195200205                                                                 
ValAlaP roProAlaThrThrAlaGluThrLeuAspValGlnMetLys                         
210215220225                                                              
GlyGluPheTyrSerGluAsnHisHisAsnProProProPheAlaPro                          
 230235240                                                                
ProValMetGluPheProAlaAlaHisAspArgMetValTyrLeuGly                          
245250255                                                                 
LeuSerAspTyrPhePheAsn ThrAlaGlyLeuValTyrGlnGluAla                         
260265270                                                                 
GlyValLeuLysMetThrLeuArgAspAspMetIleProLysGluSer                          
275280 285                                                                
LysPheArgLeuThrThrLysPhePheGlyThrPheLeuProGluVal                          
290295300305                                                              
AlaLysLysPheProAsnMetLysIleGlnIleHisValSerAlaSer                          
310315320                                                                 
ThrProProHisLeuSerValGlnProThrGlyLeuThrPheTyrPro                          
325330335                                                                 
AlaValAspV alGlnAlaPheAlaValLeuProAsnSerSerLeuAla                         
340345350                                                                 
SerLeuPheLeuIleGlyMetHisThrThrGlySerMetGluValSer                          
355360 365                                                                
AlaGluSerAsnArgLeuValGlyGluLeuLysLeuAspArgLeuLeu                          
370375380385                                                              
LeuGluLeuLysHisSerAsnIleGlyProPhePro ValGluLeuLeu                         
390395400                                                                 
GlnAspIleMetAsnTyrIleValProIleLeuValLeuProArgVal                          
405410415                                                                 
AsnGluLysLeuGlnLysGlyPheProLeuProThrProAlaArgVal                          
420425430                                                                 
GlnLeuTyrAsnValValLeuGlnProHisGlnAsnPheLeuLeuPhe                          
435 440445                                                                
GlyAlaAspValValTyrLys                                                     
450455                                                                    

Claims (2)

What is claimed is:
1. A method for neutralizing the anti-coagulant effect of heparin comprising administering to a subject suffering from heparin-mediated lengthening of clotting time an effective amount of a heparin binding bactericidal/permeability-increasing (BPI) protein product.
2. The method of claims claim 1 wherein the BPI protein product is a 23-25kD amino-terminal fragment of bactericidal/permeability-increasing protein.
US08/030,644 1993-03-12 1993-03-12 Therapeutic uses of bactericidal/permeability increasing protein products Expired - Lifetime US5348942A (en)

Priority Applications (53)

Application Number Priority Date Filing Date Title
US08/030,644 US5348942A (en) 1993-03-12 1993-03-12 Therapeutic uses of bactericidal/permeability increasing protein products
HK98115457.7A HK1014191B (en) 1993-03-12 1994-03-11 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
PCT/US1994/002401 WO1994020128A1 (en) 1993-03-12 1994-03-11 Therapeutic uses of bactericidal/permeability increasing protein products
EP94911490A EP0690872B1 (en) 1993-03-12 1994-03-11 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
AU63605/94A AU684503B2 (en) 1993-03-12 1994-03-11 Therapeutic uses of bactericidal/permeability increasing protein products
CN94191892A CN1105574C (en) 1993-03-12 1994-03-11 Therapeutic use of bactericidal/permeability enhancing protein products
PCT/US1994/002465 WO1994020532A1 (en) 1993-03-12 1994-03-11 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
CNB941918947A CN100396695C (en) 1993-03-12 1994-03-11 Bioactive peptides from functional domains of bactericidal permeability-increasing proteins and uses thereof
ES94911490T ES2123134T3 (en) 1993-03-12 1994-03-11 BIOLOGICALLY ACTIVE PEPTIDES OF FUNCTIONAL DOMAINS OF PERMEABILITY-INCREASING BACTERICIDE PROTEIN AND USES THEREOF.
MX9401807A MX9401807A (en) 1993-03-12 1994-03-11 THERAPEUTIC USES OF PROTEIN PRODUCTS THAT INCREASE PERMEABILITY / BACTERICIDES.
DE69427582T DE69427582T2 (en) 1993-03-12 1994-03-11 THERAPEUTIC USE OF ANTIBACTERIAL / PLEASURING PROTEIN PRODUCTS
EP00128250A EP1129718A3 (en) 1993-03-12 1994-03-11 Therapeutic uses of bactericidal/permeability increasing protein products
NZ263057A NZ263057A (en) 1993-03-12 1994-03-11 Use of bactericidal permeability increasing proteins or derivative for treating chronic inflammatory diseases, neutralising heparin, inhibiting angiogenesis, tumour and epithelial cell proliferation
ES94910854T ES2157981T3 (en) 1993-03-12 1994-03-11 THERAPEUTIC USES OF BACTERICIDIC / PERMEABILITY PROTEIN PRODUCTS.
CA002157927A CA2157927C (en) 1993-03-12 1994-03-11 Therapeutic uses of bactericidal/permeability increasing protein produc ts
AU63988/94A AU694108B2 (en) 1993-03-12 1994-03-11 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
DK94910854T DK0690720T3 (en) 1993-03-12 1994-03-11 Therapeutic applications of bactericidal / permeability enhancing protein products
JP6520214A JPH08509703A (en) 1993-03-12 1994-03-11 Sterilization / Therapeutic use of increased permeability protein products
CNA03104316XA CN1478543A (en) 1993-03-12 1994-03-11 Therapeutic use of bactericidal/permeability enhancing protein products
HK98115810.9A HK1014497B (en) 1993-03-12 1994-03-11 Therapeutic uses of bacterici-dal/permeability increasing protein products
DE69412243T DE69412243T2 (en) 1993-03-12 1994-03-11 BIOLOGICALLY ACTIVE PEPTIDES FROM FUNCTIONAL DOMAINS OF BACTERICIDES / PROTEIN INCREASING PERMEABILITY AND THEIR USE
CNA2008100960867A CN101265299A (en) 1993-03-12 1994-03-11 Biologically active peptides derived from functional domains of bactericidal permeability-enhancing proteins and uses thereof
PT94910854T PT690720E (en) 1993-03-12 1994-03-11 THERAPEUTIC USES OF PERMEABILITY INDUCTIVE BACTERICIDE PROTEIN PRODUCTS
JP52025194A JP4139863B2 (en) 1993-03-12 1994-03-11 Biologically active peptides derived from functional domains of proteins with improved bactericidal / permeability and uses thereof
EP94910854A EP0690720B1 (en) 1993-03-12 1994-03-11 Therapeutic uses of bactericidal/permeability increasing protein products
AT94911490T ATE169304T1 (en) 1993-03-12 1994-03-11 BIOLOGICALLY ACTIVE PEPTIDES FROM FUNCTIONAL DOMAIN OF THE BACTERICIDE/PERMEABILITY-INCREASE PROTEINS AND THEIR USE
AT94910854T ATE202482T1 (en) 1993-03-12 1994-03-11 THERAPEUTIC USES OF ANTIBACTERIAL/PERMEABILITY-INCREASE PROTEIN PRODUCTS
CA002158058A CA2158058C (en) 1993-03-12 1994-03-11 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
NZ263344A NZ263344A (en) 1993-03-12 1994-03-11 Human bactericidal/permeability increasing (bpi) protein functional domain peptides and their use
DK94911490T DK0690872T3 (en) 1993-03-12 1994-03-11 Biologically active peptides from bacterial / permeability enhancing protein functional domains and uses thereof
US08/209,762 US5733872A (en) 1993-03-12 1994-03-11 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
ZA941773A ZA941773B (en) 1993-03-12 1994-03-14 Therapeutic uses of bactericidal/permeability increasing protein products
ZA941771A ZA941771B (en) 1993-03-12 1994-03-14 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US08/306,473 US5652332A (en) 1993-03-12 1994-09-15 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US08/415,158 US5639727A (en) 1993-03-12 1995-03-31 Therapeutic uses of bactericidal/permeability increasing protein products
US08/435,855 US5807818A (en) 1993-03-12 1995-05-05 Therapeutic uses of bactericidal/permeability increasing protein (BPI) protein products
US08/466,826 US5854214A (en) 1993-03-12 1995-06-06 Therapeutic uses of bactericidal/permeability increasing protein products
US08/466,624 US5837678A (en) 1993-03-12 1995-06-06 Therapeutic uses of bactericidal/permeability increasing protein products
US08/473,344 US5763567A (en) 1993-03-12 1995-06-07 Biologically active peptides from funcional domains of bactericidal/permeability-increasing protein and uses thereof
US08/485,445 US5856438A (en) 1993-03-12 1995-06-07 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US09/093,539 US6228834B1 (en) 1993-03-12 1998-06-08 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US09/224,480 US6153730A (en) 1993-03-12 1998-12-31 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US09/227,659 US6156730A (en) 1993-03-12 1999-01-08 Anti-fungal peptides
US09/677,664 US6664231B1 (en) 1993-03-12 2000-10-02 Anti-fungal peptides
US09/790,230 US6495516B1 (en) 1993-03-12 2001-02-21 Method for killing gram-negative bacteria with biologically active peptides from functional domains of bacterial/permeability-increasing protein
US09/942,021 US20020090368A1 (en) 1993-03-12 2001-08-27 Therapeutic uses of bactericidal/permeability increasing (BPI) protein products
GR20010401543T GR3036686T3 (en) 1993-03-12 2001-09-20 Therapeutic uses of bactericidal/permeability increasing protein products
US10/319,786 US7045500B2 (en) 1993-03-12 2002-12-13 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US10/446,628 US20040023884A1 (en) 1993-03-12 2003-05-27 Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
JP2004294373A JP2005053921A (en) 1993-03-12 2004-10-06 Biologically active peptides derived from functional domains of proteins with improved bactericidal / permeability and uses thereof
JP2005049792A JP2005206606A (en) 1993-03-12 2005-02-24 Therapeutic use of bactericidal / permeability increased protein products
JP2005049791A JP2005187480A (en) 1993-03-12 2005-02-24 Therapeutic use of bactericidal / permeability increased protein products
JP2007338237A JP2008101026A (en) 1993-03-12 2007-12-27 Biologically active peptides derived from functional domains of proteins with improved bactericidal / permeability and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US08/030,644 US5348942A (en) 1993-03-12 1993-03-12 Therapeutic uses of bactericidal/permeability increasing protein products

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US9320293A Continuation-In-Part 1993-03-12 1993-07-15
US08/415,158 Continuation-In-Part US5639727A (en) 1993-03-12 1995-03-31 Therapeutic uses of bactericidal/permeability increasing protein products

Publications (1)

Publication Number Publication Date
US5348942A true US5348942A (en) 1994-09-20

Family

ID=21855214

Family Applications (3)

Application Number Title Priority Date Filing Date
US08/030,644 Expired - Lifetime US5348942A (en) 1993-03-12 1993-03-12 Therapeutic uses of bactericidal/permeability increasing protein products
US08/466,624 Expired - Fee Related US5837678A (en) 1993-03-12 1995-06-06 Therapeutic uses of bactericidal/permeability increasing protein products
US08/466,826 Expired - Fee Related US5854214A (en) 1993-03-12 1995-06-06 Therapeutic uses of bactericidal/permeability increasing protein products

Family Applications After (2)

Application Number Title Priority Date Filing Date
US08/466,624 Expired - Fee Related US5837678A (en) 1993-03-12 1995-06-06 Therapeutic uses of bactericidal/permeability increasing protein products
US08/466,826 Expired - Fee Related US5854214A (en) 1993-03-12 1995-06-06 Therapeutic uses of bactericidal/permeability increasing protein products

Country Status (3)

Country Link
US (3) US5348942A (en)
CN (1) CN101265299A (en)
ZA (2) ZA941771B (en)

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5420019A (en) * 1993-02-02 1995-05-30 Xoma Corporation Stable bactericidal/permeability-increasing protein muteins
US5447913A (en) * 1994-03-11 1995-09-05 Xoma Corporation Therapeutic uses of bactericidal/permeability-increasing protein dimer products
US5494896A (en) * 1995-03-31 1996-02-27 Xoma Corporation Method of treating conditions associated with burn injuries
US5523288A (en) * 1993-09-22 1996-06-04 Xoma Corporation Method of treating gram-negative bacterial infection by administration of bactericidal/permeability-increasing (BPI) protein product and antibiotic
US5532216A (en) * 1994-06-24 1996-07-02 Incyte Pharmaceuticals, Inc. Neutralization of non-lipopolysaccharide compounds by bactericidal/permeability-increasing protein
WO1996034873A1 (en) * 1995-05-01 1996-11-07 Incyte Pharmaceuticals, Inc. Recombinant endotoxin-neutralizing proteins
US5578572A (en) * 1994-01-14 1996-11-26 Xoma Corporation Anti-gram-positive bacterial methods and materials
US5627153A (en) * 1994-01-14 1997-05-06 Xoma Corporation Anti-fungal methods and materials
WO1997017989A1 (en) * 1995-11-14 1997-05-22 Xoma Corporation Bactericidal/permeability increasing protein (bpi) for treating conditions associated with corneal transplantation
WO1997017990A1 (en) * 1995-11-14 1997-05-22 Xoma Corporation Bactericidal permeability increasing protein (bpi) for treating conditions associated with corneal injury
US5643875A (en) * 1994-01-24 1997-07-01 Friedmann; Nadav Human therapeutic uses of bactericidal/permeability increasing (BPI) protein products
US5646114A (en) * 1994-07-11 1997-07-08 Xoma Corporation Anti-protozoan methods
US5652332A (en) * 1993-03-12 1997-07-29 Xoma Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
WO1997042967A1 (en) * 1996-05-10 1997-11-20 Xoma Corporation Antithrombotic materials and methods
US5696090A (en) * 1993-02-02 1997-12-09 Xoma Corporation Pharmaceutical composition
US5731415A (en) * 1993-06-17 1998-03-24 Xoma Corporation Lipopolysaccharide binding protein derivatives
US5756464A (en) * 1996-05-23 1998-05-26 Xoma Corporation Therapeutic uses of BPI protein products in humans with hemmorhage due to trauma
US5766897A (en) * 1990-06-21 1998-06-16 Incyte Pharmaceuticals, Inc. Cysteine-pegylated proteins
US5770561A (en) * 1993-07-14 1998-06-23 Xoma Corporation Method for potentiating BPI protein product bactericidal activity by administration of LBP protein products
US5786324A (en) * 1994-03-24 1998-07-28 Regents Of The University Of Minnesota Synthetic peptides with bactericidal activity and endotoxin neutralizing activity for gram negative bacteria and methods for their use
US5821064A (en) * 1993-09-22 1998-10-13 Xoma Corporation Method of screening for an active inflammatory state by determining the concentration of extracellular BPI
US5830860A (en) * 1994-03-24 1998-11-03 Regents Of The University Of Minnesota Peptides with bactericidal activity and endotoxin neutralizing activity for gram negative bacteria and methods for their use
US5854214A (en) * 1993-03-12 1998-12-29 Xoma Corporation Therapeutic uses of bactericidal/permeability increasing protein products
US5858974A (en) * 1995-07-20 1999-01-12 Xoma Corporation Anti-fungal peptides
US5888977A (en) * 1996-05-10 1999-03-30 Giroir; Brett P. Therapeutic uses of BPI protein products for human meningococcemia
US5888973A (en) * 1996-08-09 1999-03-30 Xoma Corporation Anti-chlamydial uses of BPI protein products
US5932544A (en) * 1994-05-31 1999-08-03 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) compositions
US5968759A (en) * 1995-10-18 1999-10-19 Centeon Pharma Gmbh Method for the quantification of activated coagulation factor VII (FVIIa)
US6013631A (en) * 1998-06-19 2000-01-11 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) deletion analogs
US6051553A (en) * 1993-07-14 2000-04-18 Xoma Corporation Method for potentiating BPI protein product bactericidal activity by administration of LBP protein products
US6093573A (en) * 1997-06-20 2000-07-25 Xoma Three-dimensional structure of bactericidal/permeability-increasing protein (BPI)
US6214789B1 (en) 1993-03-12 2001-04-10 Xoma Corporation Treatment of mycobacterial diseases by administration of bactericidal/permeability-increasing protein products
US6242219B1 (en) 1999-03-18 2001-06-05 Xoma (Us) Llc Methods for recombinant peptide production
US6271203B1 (en) * 1994-07-07 2001-08-07 Xoma Corporation Anti-protozoan methods and materials
US6440690B1 (en) 1995-06-29 2002-08-27 Amram Mor Peptides for the activation of the immune system in humans and animals
US6482800B1 (en) * 1998-08-13 2002-11-19 The University Of Southern California Methods to stimulate angiogenesis
US6482796B2 (en) 1996-11-01 2002-11-19 Xoma Corporation Therapeutic uses of N-terminal BPI protein products in ANCA-positive patients
US6486125B1 (en) 1996-05-24 2002-11-26 Regents Of The University Of Minnesota Synthesis of soluble β-sheet forming peptides
US6573056B2 (en) * 1995-10-18 2003-06-03 Aventis Behring Gmbh Process for purifying factor VII and activated factor VII
US6759203B1 (en) 1993-09-22 2004-07-06 Xoma Corporation Method for quantifying BPI in body fluids
US20050153889A1 (en) * 2000-12-01 2005-07-14 King George L. Modulation of pericyte proliferation
US7056514B2 (en) 2002-02-20 2006-06-06 Regents Of The University Of Minnesota Partial peptide mimetics and methods
EP1741440A1 (en) 2005-07-08 2007-01-10 Mellitus S.L. Use of BPI protein for the treatment of disorders of the metabolism and cardiovascular disorders
EP2311962A1 (en) 2002-03-29 2011-04-20 XOMA Technology Ltd. Multigenic vectors plasmids and methods for increasing expression of recombinant polypeptides
US20110091918A1 (en) * 2009-09-12 2011-04-21 Gerlinde Christ Heterogeneous coagulation test

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5198541A (en) * 1987-08-11 1993-03-30 New York University Dna encoding bactericidal/permeability-increasing proteins
EP1252181B1 (en) * 2000-01-20 2006-01-18 Regents Of The University Of Minnesota Peptides with antibacterial activity
CN104497126B (en) * 2015-01-06 2017-05-24 中南大学湘雅二医院 Novel antibacterial active peptide based on human autocrine
CN104745595B (en) * 2015-03-27 2017-06-27 宁波大学 Apostichopus japonicus BPI gene, encoded protein and cloning method thereof, and method for constructing recombinant Apostichopus japonicus BPI genetic engineering bacteria
CN115894623B (en) * 2022-12-20 2025-05-13 中国科学院昆明动物研究所 Polypeptide NR6 with double-regulation function of DBH and DDC enzyme activities and application thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992001003A1 (en) * 1990-07-10 1992-01-23 Board Of Regents, The University Of Texas System Glycosaminoglycan derivatives and their use as inhibitors of tumor invasiveness or metastatic profusion-ii
US5086164A (en) * 1989-01-10 1992-02-04 Repligen Corporation Novel methods and compositions for treatment of angiogenic diseases
WO1992002240A2 (en) * 1990-07-27 1992-02-20 Repligen Corporation Novel methods and compositions for treatment of angiogenic diseases
US5112946A (en) * 1989-07-06 1992-05-12 Repligen Corporation Modified pf4 compositions and methods of use
US5171739A (en) * 1989-02-14 1992-12-15 Incyte Pharmaceuticals, Inc. Treatment of endotoxin-associated shock and preventation thereof using a BPI protein
WO1993013794A1 (en) * 1992-01-16 1993-07-22 Repligen Corporation Novel methods and compositions for treatment of angiogenic diseases

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5089274A (en) * 1989-02-14 1992-02-18 Incyte Pharmaceuticals, Inc. Use of bactericidal/permeability increasing protein or biologically active analogs thereof to treat endotoxin-related disorders
EP0563222B1 (en) * 1990-12-03 1998-02-25 New York University Biologically active bactericidal/permeability-increasing protein fragments
US5348942A (en) * 1993-03-12 1994-09-20 Xoma Corporation Therapeutic uses of bactericidal/permeability increasing protein products

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5086164A (en) * 1989-01-10 1992-02-04 Repligen Corporation Novel methods and compositions for treatment of angiogenic diseases
US5171739A (en) * 1989-02-14 1992-12-15 Incyte Pharmaceuticals, Inc. Treatment of endotoxin-associated shock and preventation thereof using a BPI protein
US5112946A (en) * 1989-07-06 1992-05-12 Repligen Corporation Modified pf4 compositions and methods of use
WO1992001003A1 (en) * 1990-07-10 1992-01-23 Board Of Regents, The University Of Texas System Glycosaminoglycan derivatives and their use as inhibitors of tumor invasiveness or metastatic profusion-ii
WO1992002240A2 (en) * 1990-07-27 1992-02-20 Repligen Corporation Novel methods and compositions for treatment of angiogenic diseases
WO1993013794A1 (en) * 1992-01-16 1993-07-22 Repligen Corporation Novel methods and compositions for treatment of angiogenic diseases

Non-Patent Citations (44)

* Cited by examiner, † Cited by third party
Title
Charles, et al., J. Biol. Chem., "The Three-dimensional Structure of Bovine Platelet Factor 4 at 3.0-Å Resolution," 264(4): 2092-2099 (Feb. 5, 1989).
Charles, et al., J. Biol. Chem., The Three dimensional Structure of Bovine Platelet Factor 4 at 3.0 Resolution, 264(4): 2092 2099 (Feb. 5, 1989). *
Cook, et al., Circulation, "Platelet Factor 4 Efficiently Reverses Heparin Anticoagulation in the Rat Without Adverse Effects of Heparin-Protamine Complexes," 85(3): 1102-1109 (Mar. 1992).
Cook, et al., Circulation, Platelet Factor 4 Efficiently Reverses Heparin Anticoagulation in the Rat Without Adverse Effects of Heparin Protamine Complexes, 85(3): 1102 1109 (Mar. 1992). *
Elsbach, et al., J. Biol. Chem., "Separation and Purification of a Potent Bactericidal/Permeability-increasing Protein and a Closely Associated Pospholipase A2 from Rabbit Polymorphonuclear Leukocytes," 254(21): 11000-11009 (Nov. 10, 1979).
Elsbach, et al., J. Biol. Chem., Separation and Purification of a Potent Bactericidal/Permeability increasing Protein and a Closely Associated Pospholipase A 2 from Rabbit Polymorphonuclear Leukocytes, 254(21): 11000 11009 (Nov. 10, 1979). *
Folkman, et al., Inflammation: Basic Principles and Clinical Correlates, "Angiogenesis and Inflammation," 2nd Ed. Chapter 40, pp. 821-839 (1992).
Folkman, et al., Inflammation: Basic Principles and Clinical Correlates, Angiogenesis and Inflammation, 2nd Ed. Chapter 40, pp. 821 839 (1992). *
Gammon, et al., J. Exp. Med, "T Cell Determinant Structure: Cores and Determinant Envelopes in Three Mouse Major Histocompatibility Complex Haplotypes," 173: 609-617 (Mar. 1991).
Gammon, et al., J. Exp. Med, T Cell Determinant Structure: Cores and Determinant Envelopes in Three Mouse Major Histocompatibility Complex Haplotypes, 173: 609 617 (Mar. 1991). *
Garcia, et al., BioWorld Today, Repligen IND for Platelet Factor p. 5 (Jan. 11, 1983). *
Gazzano Santoro, et al., Infect. Immunol., High Affinity Binding of the Bactericidal/Permeability Increasing Protein and a Recombinant Amino Terminal Fragment to the Lipid A Region of Lipopolysaccharide, 60(11):4754 4761 (Nov., 1992). *
Gazzano-Santoro, et al., Infect. Immunol., "High-Affinity Binding of the Bactericidal/Permeability Increasing Protein and a Recombinant Amino-Terminal Fragment to the Lipid A Region of Lipopolysaccharide," 60(11):4754-4761 (Nov., 1992).
Gray, et al., J. Biol. Chem., "Cloning of the cDNA of a Human Neutrophil Bactericidal Protein," 264(16): 9505-9509 (Jun. 5, 1989).
Gray, et al., J. Biol. Chem., Cloning of the cDNA of a Human Neutrophil Bactericidal Protein, 264(16): 9505 9509 (Jun. 5, 1989). *
Heyderman, et al., Thrombosis Res., "Reduction of the Anticoagulant Activity of Glycosaminoglycans on the Surface of the Vascular Endothelium by Endotoxin and Neutrophils: Evaluation by an Amidolytic Assay," 67:677-685 (Apr. 28, 1992).
Heyderman, et al., Thrombosis Res., Reduction of the Anticoagulant Activity of Glycosaminoglycans on the Surface of the Vascular Endothelium by Endotoxin and Neutrophils: Evaluation by an Amidolytic Assay, 67:677 685 (Apr. 28, 1992). *
Hiti Harper, et al., Science,. Platelet Factor 4: An Inhibitor of Collagenase, 199:991 992 (Mar. 3, 1978). *
Hiti-Harper, et al., Science,. "Platelet Factor 4: An Inhibitor of Collagenase," 199:991-992 (Mar. 3, 1978).
Maeji, et al., J. Immunological Methods, "Multi-pin peptide strategy for T cell determinant analysis," 134:23-33 (1990).
Maeji, et al., J. Immunological Methods, Multi pin peptide strategy for T cell determinant analysis, 134:23 33 (1990). *
Maione , et al., Cancer Res., "Inhibition of Tumor Growth in Mice by an Analogue of Platelet Factor 4 That Lacks Affinity for Heparin and Retains Potent Angiostatic Activity," 51:2077-2083 (Apr. 15, 1991).
Maione , et al., Cancer Res., Inhibition of Tumor Growth in Mice by an Analogue of Platelet Factor 4 That Lacks Affinity for Heparin and Retains Potent Angiostatic Activity, 51:2077 2083 (Apr. 15, 1991). *
Maione, et al., CAS BioTech Updates Antibody Conjugates, p. 1, 1334, 117:226303x Issue Jun. 26, 1992). *
Maione, et al., CAS BioTech Updates-Antibody Conjugates, p. 1, 1334, 117:226303x Issue Jun. 26, 1992).
Mannion et al. Mar. 1990. J. Clin Invest. 85:853 860. *
Mannion et al. Mar. 1990. J. Clin Invest. 85:853-860.
Miles, et al., VII International Conference on Aids, Florence, Italy, "Recombinant Platelet Factor 4 (rPF4) and a Non-heparin Binding Derivative Inhibit Aids-Kaposi Sarcoma Derived Cell Lines," Paper 41(8), W.A. 1066, p. 108 (Jun. 16-21, 1991).
Miles, et al., VII International Conference on Aids, Florence, Italy, Recombinant Platelet Factor 4 (rPF4) and a Non heparin Binding Derivative Inhibit Aids Kaposi Sarcoma Derived Cell Lines, Paper 41(8), W.A. 1066, p. 108 (Jun. 16 21, 1991). *
Peacock, et al., J. Exp. Med. , Angiogenesis Inhibition Suppresses Collagen Arthritis, 175: 1135 1138 (Apr., 1992). *
Peacock, et al., J. Exp. Med., "Angiogenesis Inhibition Suppresses Collagen Arthritis," 175: 1135-1138 (Apr., 1992).
Repligen Corporation, Research in Review, Spring 1992. *
Stuart, et al., J. Clin. Invest., "Nature and Specificity of the Immune Response to Collagen in Type II Collagen-induced Arthritis in Mice" 69: 673-683 (Mar., 1982).
Stuart, et al., J. Clin. Invest., Nature and Specificity of the Immune Response to Collagen in Type II Collagen induced Arthritis in Mice 69: 673 683 (Mar., 1982). *
Taylor, et al., Nature, "Protamine is an inhibitor of angiogenesis," 297: 307-312 (May 27, 1982).
Taylor, et al., Nature, Protamine is an inhibitor of angiogenesis, 297: 307 312 (May 27, 1982). *
Weiss et al. 1978. J. Biol. Chem. 253(8): 2664 2672. *
Weiss et al. 1978. J. Biol. Chem. 253(8): 2664-2672.
Weiss, et al., Blood, "Cellular and Subcellular Localization of the Bactericidal/Permeability-Increasing Protein of Neutrophils," 69(2): 652-659 (Feb., 1987).
Weiss, et al., Blood, Cellular and Subcellular Localization of the Bactericidal/Permeability Increasing Protein of Neutrophils, 69(2): 652 659 (Feb., 1987). *
Yayon, et al., Cell, "Cell Surface, Heparin-like Molecules Are Required for Binding of Basis Fibroblast Growth Factor to Its High Affinity Receptor," 64: 641-648 (Feb. 22, 1991).
Yayon, et al., Cell, Cell Surface, Heparin like Molecules Are Required for Binding of Basis Fibroblast Growth Factor to Its High Affinity Receptor, 64: 641 648 (Feb. 22, 1991). *
Yong, et al., Microbial Pathogenesis, "An experimental mouse model of Yersinia-induced reactive arthritis," 4: 305-310 (1988).
Yong, et al., Microbial Pathogenesis, An experimental mouse model of Yersinia induced reactive arthritis, 4: 305 310 (1988). *

Cited By (100)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6265187B1 (en) 1989-02-14 2001-07-24 Incyte Pharmaceuticals, Inc. Recombinant endotoxin-neutralizing proteins
US5766897A (en) * 1990-06-21 1998-06-16 Incyte Pharmaceuticals, Inc. Cysteine-pegylated proteins
US5674834A (en) * 1993-02-02 1997-10-07 Xoma Corporation Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US6255284B1 (en) 1993-02-02 2001-07-03 Xoma Corporation Pharmaceutical composition
US6433140B1 (en) 1993-02-02 2002-08-13 Xoma Corporation Stable bactericidal permeability-increasing protein products and pharmaceutical compositions containing the same
US5420019A (en) * 1993-02-02 1995-05-30 Xoma Corporation Stable bactericidal/permeability-increasing protein muteins
US6066620A (en) * 1993-02-02 2000-05-23 Xoma Corporation Pharmaceutical compositions of bactericidal/permeability increasing protein (BPI)
US5955427A (en) * 1993-02-02 1999-09-21 Xoma Corporation Pharmaceutical composition
US5827816A (en) * 1993-02-02 1998-10-27 Xoma Corporation Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US6828418B2 (en) 1993-02-02 2004-12-07 Xoma Corporation Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US5696090A (en) * 1993-02-02 1997-12-09 Xoma Corporation Pharmaceutical composition
US20060009383A1 (en) * 1993-02-02 2006-01-12 Georgia Theofan Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US5856438A (en) * 1993-03-12 1999-01-05 Xoma Corporation Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US5652332A (en) * 1993-03-12 1997-07-29 Xoma Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6620785B2 (en) 1993-03-12 2003-09-16 Xoma Corporation Treatment of Mycobacterial diseases by administration of bactericidal/permeability-increasing protein products
US20050118112A1 (en) * 1993-03-12 2005-06-02 Xoma Corporation Treatment of Mycobacterial diseases by administration of bacterial/permeability-increasing protein products
US5854214A (en) * 1993-03-12 1998-12-29 Xoma Corporation Therapeutic uses of bactericidal/permeability increasing protein products
US6214789B1 (en) 1993-03-12 2001-04-10 Xoma Corporation Treatment of mycobacterial diseases by administration of bactericidal/permeability-increasing protein products
US20030180303A1 (en) * 1993-06-17 2003-09-25 Xoma Technology Ltd. Lipopolysaccharide binding protein derivatives
US5731415A (en) * 1993-06-17 1998-03-24 Xoma Corporation Lipopolysaccharide binding protein derivatives
US6376462B1 (en) 1993-06-17 2002-04-23 Xoma Corporation Lipopolysaccharide binding protein derivatives
US6051553A (en) * 1993-07-14 2000-04-18 Xoma Corporation Method for potentiating BPI protein product bactericidal activity by administration of LBP protein products
US5770561A (en) * 1993-07-14 1998-06-23 Xoma Corporation Method for potentiating BPI protein product bactericidal activity by administration of LBP protein products
US6140306A (en) * 1993-09-22 2000-10-31 Xoma Corporation Method of treating gram-negative bacterial infection by administration of bactericidal/permeability-increasing (BPI) protein product and antibiotic
US6759203B1 (en) 1993-09-22 2004-07-06 Xoma Corporation Method for quantifying BPI in body fluids
US5821064A (en) * 1993-09-22 1998-10-13 Xoma Corporation Method of screening for an active inflammatory state by determining the concentration of extracellular BPI
US5523288A (en) * 1993-09-22 1996-06-04 Xoma Corporation Method of treating gram-negative bacterial infection by administration of bactericidal/permeability-increasing (BPI) protein product and antibiotic
US5627153A (en) * 1994-01-14 1997-05-06 Xoma Corporation Anti-fungal methods and materials
US5578572A (en) * 1994-01-14 1996-11-26 Xoma Corporation Anti-gram-positive bacterial methods and materials
US5783561A (en) * 1994-01-14 1998-07-21 Xoma Corporation Anti-gram-positive bacterial methods and materials
US6054431A (en) * 1994-01-14 2000-04-25 Xoma Corporation Anti-gram-positive bacterial methods and materials
US5753620A (en) * 1994-01-24 1998-05-19 Xoma Corporation Human therapeutic uses of BPI protein products
US5990086A (en) * 1994-01-24 1999-11-23 Xoma Corporation Therapeutic uses of BPI protein products for human meningococcemia
US5643875A (en) * 1994-01-24 1997-07-01 Friedmann; Nadav Human therapeutic uses of bactericidal/permeability increasing (BPI) protein products
US6586400B2 (en) 1994-01-24 2003-07-01 Xoma Corporation Human therapeutic uses of BPI protein products
US5952302A (en) * 1994-01-24 1999-09-14 Xoma Corporation Human therapeutic uses of BPI protein products
US6191112B1 (en) 1994-01-24 2001-02-20 Xoma Corporation Human therapeutic uses of BPI protein products
US5856302A (en) * 1994-03-11 1999-01-05 Xoma Corporation Therapeutic uses of bactericidal/permeability-increasing protein dimer products
US6277821B1 (en) 1994-03-11 2001-08-21 Xoma Corporation Therapeutic uses of bactericidal/permeability-increasing protein dimer products
US5447913A (en) * 1994-03-11 1995-09-05 Xoma Corporation Therapeutic uses of bactericidal/permeability-increasing protein dimer products
US5786324A (en) * 1994-03-24 1998-07-28 Regents Of The University Of Minnesota Synthetic peptides with bactericidal activity and endotoxin neutralizing activity for gram negative bacteria and methods for their use
US5830860A (en) * 1994-03-24 1998-11-03 Regents Of The University Of Minnesota Peptides with bactericidal activity and endotoxin neutralizing activity for gram negative bacteria and methods for their use
US6057293A (en) * 1994-05-31 2000-05-02 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) compositions
US6268345B1 (en) 1994-05-31 2001-07-31 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) compositions
US5932544A (en) * 1994-05-31 1999-08-03 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) compositions
US5532216A (en) * 1994-06-24 1996-07-02 Incyte Pharmaceuticals, Inc. Neutralization of non-lipopolysaccharide compounds by bactericidal/permeability-increasing protein
US6271203B1 (en) * 1994-07-07 2001-08-07 Xoma Corporation Anti-protozoan methods and materials
US5646114A (en) * 1994-07-11 1997-07-08 Xoma Corporation Anti-protozoan methods
US6013629A (en) * 1994-07-11 2000-01-11 Xoma Corporation Anti-protozoan methods and materials
US6440936B2 (en) * 1994-07-11 2002-08-27 Xoma Corporation Anti-protozoan methods and materials
US5494896A (en) * 1995-03-31 1996-02-27 Xoma Corporation Method of treating conditions associated with burn injuries
WO1996034873A1 (en) * 1995-05-01 1996-11-07 Incyte Pharmaceuticals, Inc. Recombinant endotoxin-neutralizing proteins
US6440690B1 (en) 1995-06-29 2002-08-27 Amram Mor Peptides for the activation of the immune system in humans and animals
US5858974A (en) * 1995-07-20 1999-01-12 Xoma Corporation Anti-fungal peptides
US5968759A (en) * 1995-10-18 1999-10-19 Centeon Pharma Gmbh Method for the quantification of activated coagulation factor VII (FVIIa)
US6573056B2 (en) * 1995-10-18 2003-06-03 Aventis Behring Gmbh Process for purifying factor VII and activated factor VII
WO1997017989A1 (en) * 1995-11-14 1997-05-22 Xoma Corporation Bactericidal/permeability increasing protein (bpi) for treating conditions associated with corneal transplantation
WO1997017990A1 (en) * 1995-11-14 1997-05-22 Xoma Corporation Bactericidal permeability increasing protein (bpi) for treating conditions associated with corneal injury
US5686414A (en) * 1995-11-14 1997-11-11 Xoma Corporation Methods of treating conditions associated with corneal transplantation
US6107280A (en) * 1996-05-10 2000-08-22 Xoma Corporation Antithrombotic materials and methods
US5888977A (en) * 1996-05-10 1999-03-30 Giroir; Brett P. Therapeutic uses of BPI protein products for human meningococcemia
US6596691B2 (en) 1996-05-10 2003-07-22 Xoma Corporation Therapeutic uses of BPI protein products for human meningococcemia
US6242418B1 (en) 1996-05-10 2001-06-05 Xoma Corporation Therapeutic uses of BPI protein products for human meningococcemia
US5935930A (en) * 1996-05-10 1999-08-10 Xoma Corporation Antithrombotic materials and methods
WO1997042967A1 (en) * 1996-05-10 1997-11-20 Xoma Corporation Antithrombotic materials and methods
US5741779A (en) * 1996-05-10 1998-04-21 Xoma Corporation Antithrombotic materials and methods
US6599881B1 (en) 1996-05-10 2003-07-29 Xoma Corporation Antithrombotic materials and methods
US5756464A (en) * 1996-05-23 1998-05-26 Xoma Corporation Therapeutic uses of BPI protein products in humans with hemmorhage due to trauma
US5945399A (en) * 1996-05-23 1999-08-31 Xoma Corporation Therapeutic uses of BPI protein products in humans with hemorrhage due to trauma
US6486125B1 (en) 1996-05-24 2002-11-26 Regents Of The University Of Minnesota Synthesis of soluble β-sheet forming peptides
US7030087B2 (en) 1996-05-24 2006-04-18 Regents Of The University Of Minnesota Synthetic approach to designed chemical structures
US20060183191A1 (en) * 1996-05-24 2006-08-17 Regents Of The University Of Minnesota Synthetic approach to designed chemical structures
US20080261880A1 (en) * 1996-05-24 2008-10-23 Regents Of The University Of Minnesota Synthetic approach to designed chemical structures
US20030153502A1 (en) * 1996-05-24 2003-08-14 Regents Of The University Of Minnesota Synthetic approach to designed chemical structures
US6583116B1 (en) 1996-08-09 2003-06-24 Xoma Corporation Anti-chlamydial methods and materials
US5888973A (en) * 1996-08-09 1999-03-30 Xoma Corporation Anti-chlamydial uses of BPI protein products
US6162788A (en) * 1996-08-09 2000-12-19 Xoma Corporation Uses of BPI protein products
US20040002452A1 (en) * 1996-11-01 2004-01-01 Xoma Technology Ltd. Therapeutic uses of N-terminal BPI protein products in ANCA-positive patients
US6482796B2 (en) 1996-11-01 2002-11-19 Xoma Corporation Therapeutic uses of N-terminal BPI protein products in ANCA-positive patients
US6093573A (en) * 1997-06-20 2000-07-25 Xoma Three-dimensional structure of bactericidal/permeability-increasing protein (BPI)
US6013631A (en) * 1998-06-19 2000-01-11 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) deletion analogs
US6599880B1 (en) 1998-06-19 2003-07-29 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) deletion analogs
US6087126A (en) * 1998-06-19 2000-07-11 Xoma Corporation Bactericidal/permeability-increasing protein (BPI) deletion analogs
US6482800B1 (en) * 1998-08-13 2002-11-19 The University Of Southern California Methods to stimulate angiogenesis
US20090246831A1 (en) * 1999-03-18 2009-10-01 Xoma Technology Ltd. Methods for Recombinant Peptide Production
US7749731B2 (en) 1999-03-18 2010-07-06 Xoma Technology Ltd. Methods for recombinant peptide production
US6500648B1 (en) 1999-03-18 2002-12-31 Xoma Technology, Ltd. Methods for recombinant peptide production
US6242219B1 (en) 1999-03-18 2001-06-05 Xoma (Us) Llc Methods for recombinant peptide production
US7291451B2 (en) 2000-12-01 2007-11-06 Xoma Technology Ltd. Modulation of pericyte proliferation
US20080119410A1 (en) * 2000-12-01 2008-05-22 Xoma Technology Ltd. Modulation of Pericyte Proliferation
US20050153889A1 (en) * 2000-12-01 2005-07-14 King George L. Modulation of pericyte proliferation
US7339023B2 (en) 2002-02-20 2008-03-04 Regents Of The University Of Minnesota Partial peptide mimetics and methods
US7056514B2 (en) 2002-02-20 2006-06-06 Regents Of The University Of Minnesota Partial peptide mimetics and methods
EP2311962A1 (en) 2002-03-29 2011-04-20 XOMA Technology Ltd. Multigenic vectors plasmids and methods for increasing expression of recombinant polypeptides
EP1741440A1 (en) 2005-07-08 2007-01-10 Mellitus S.L. Use of BPI protein for the treatment of disorders of the metabolism and cardiovascular disorders
US20090215684A1 (en) * 2005-07-08 2009-08-27 Bridge Bioresearch Limited Use of BPI Protein for Treatment of Diseases
US20110091918A1 (en) * 2009-09-12 2011-04-21 Gerlinde Christ Heterogeneous coagulation test
EP2413143A3 (en) * 2009-12-09 2012-05-09 Siemens Healthcare Diagnostics Products GmbH Heterogeneous coagulation test
US8501429B2 (en) 2009-12-09 2013-08-06 Siemens Healthcare Diagnostics Products Gmbh Method for quantitatively analyzing an anticoagulant in a sample
US8809007B2 (en) 2009-12-09 2014-08-19 Siemens Healthcare Diagnostics Products Gmbh Method for determining the activity of a proteolytic coagulation factor in a sample

Also Published As

Publication number Publication date
ZA941773B (en) 1994-10-26
ZA941771B (en) 1996-02-16
CN101265299A (en) 2008-09-17
US5854214A (en) 1998-12-29
US5837678A (en) 1998-11-17

Similar Documents

Publication Publication Date Title
US5348942A (en) Therapeutic uses of bactericidal/permeability increasing protein products
US5807818A (en) Therapeutic uses of bactericidal/permeability increasing protein (BPI) protein products
US6228834B1 (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6153730A (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6515104B1 (en) Therapeutic peptide-based constructs derived from domain II of bactericidal/permeability-increasing protein
US6964948B2 (en) Therapeutic peptide-based constructs derived from Domain II of bactericidal/permeability-increasing protein
US20040023884A1 (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
US6423825B1 (en) Therapeutic derivative compounds derived from domain II of bactericidal/permeability-increasing protein
CN100396695C (en) Bioactive peptides from functional domains of bactericidal permeability-increasing proteins and uses thereof
HK1014497B (en) Therapeutic uses of bacterici-dal/permeability increasing protein products
US6306824B1 (en) Uses of lipopolysaccharide binding protein
JP4707911B2 (en) Therapeutic peptide-based constructs
EP0754194B1 (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
HK1014191B (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof
HK1014191A1 (en) Biologically active peptides from functional domains of bactericidal/permeability-increasing protein and uses thereof

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: APPLICATION UNDERGOING PREEXAM PROCESSING

AS Assignment

Owner name: XOMA CORPORATION A CORPORATION OF DELAWARE, CALIF

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:LITTLE, ROGER G. II;GAZZANO-SANTORO, HELENE;PARENT, JAMES BRIAN;REEL/FRAME:006604/0872

Effective date: 19930505

CC Certificate of correction
FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

FPAY Fee payment

Year of fee payment: 4

FPAY Fee payment

Year of fee payment: 8

REMI Maintenance fee reminder mailed
FPAY Fee payment

Year of fee payment: 12

SULP Surcharge for late payment

Year of fee payment: 11

AS Assignment

Owner name: SILICON VALLEY BANK, CALIFORNIA

Free format text: SECURITY INTEREST;ASSIGNOR:XOMA TECHNOLOGY LTD.;REEL/FRAME:046115/0459

Effective date: 20180507