US20230340490A1 - Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (marc1) expression - Google Patents

Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (marc1) expression Download PDF

Info

Publication number
US20230340490A1
US20230340490A1 US18/134,585 US202318134585A US2023340490A1 US 20230340490 A1 US20230340490 A1 US 20230340490A1 US 202318134585 A US202318134585 A US 202318134585A US 2023340490 A1 US2023340490 A1 US 2023340490A1
Authority
US
United States
Prior art keywords
seq
nos
nucleotides
oligonucleotide
marc1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
US18/134,585
Inventor
Henryk Dudek
Wen HAN
Natalie Wayne Pursell
Chengjung Lai
William Geoffrey Haynes
Zhihao Ding
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novo Nordisk AS
Original Assignee
Novo Nordisk AS
Dicerna Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novo Nordisk AS, Dicerna Pharmaceuticals Inc filed Critical Novo Nordisk AS
Priority to US18/134,585 priority Critical patent/US20230340490A1/en
Publication of US20230340490A1 publication Critical patent/US20230340490A1/en
Assigned to NOVO NORDISK A/S reassignment NOVO NORDISK A/S ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DICERNA PHARMACEUTICALS, INC.
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/312—Phosphonates
    • C12N2310/3125—Methylphosphonates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/50—Physical structure
    • C12N2310/53—Physical structure partially self-complementary or closed
    • C12N2310/531—Stem-loop; Hairpin

Definitions

  • the liver plays a critical role in the metabolism of lipids. Abnormalities in normal hepatic lipid metabolism are associated with the development of various liver diseases or disorders such as, non-alcoholic fatty liver disease (NAFLD), its subsequent progression to non-alcoholic steatohepatitis (NASH) and potentially other advanced liver abnormalities.
  • NAFLD non-alcoholic fatty liver disease
  • NASH non-alcoholic steatohepatitis
  • NAFLD is one of the most common liver diseases, with increasing prevalence worldwide (Loomba R., & Sanyal A.J. (2013) NAT REV GASTROENTEROL HEPATOL 10(11):686-90). NAFLD is characterized by a spectrum of clinical and pathological severity ranging from simple steatosis to nonalcoholic fatty liver (NAFL), nonalcoholic steatohepatitis (NASH), fibrosis, cirrhosis, hepatocellular carcinoma (HCC) and liver failure (Bessone F, et al., (2019) CELL MOL LIFE SCI 76(1):99-128).
  • NAFLD is characterized as the presence of fat in the liver in the absence of significant alcohol consumption and other causes of fat in the liver such as medications, starvation, and viral disease (Chalasani, N., et al., (2012) HEPATOLOGY (Baltimore, Md.), 55(6), 2005-23). Additionally, as the disease progresses into NASH, patients also have an increased risk of developing extra-hepatic complications, particularly cardiovascular diseases (CVD), which are among the most common causes of death in this patient population.
  • CVD cardiovascular diseases
  • the current invention is based in part on the discovery of oligonucleotides (e.g., RNAi oligonucleotides) that reduce MARC1 (Mitochondrial Amidoxime Reducing Component 1) expression in the liver.
  • oligonucleotides e.g., RNAi oligonucleotides
  • MARC1 Mitochondrial Amidoxime Reducing Component 1
  • target sequences within MARC1 mRNA were identified and oligonucleotides that bind to these target sequences and inhibit MARC1 mRNA expression were generated.
  • the oligonucleotides inhibited human and non-human primate (NHP) MARC1 expression in the liver.
  • NHS non-human primate
  • the invention provides an RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • the sense strand is 15 to 50 or 18 to 36 nucleotides in length, optionally 36 nucleotides in length; optionally (ii) the antisense strand is 15 to 30 nucleotides in length, optionally 22 nucleotides in length; and optionally (iii) the duplex region is at least 19 nucleotides or at least 20 nucleotides in length.
  • the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein (i) S1 is complementary to S2, optionally wherein S1 and S2 are each 1-10 nucleotides in length and have the same length, optionally wherein S1 and S2 are each 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, further optionally wherein S1 and S2 are 6 nucleotides in length; and (ii) L forms a loop between S1 and S2 of 3-5 nucleotides in length, optionally wherein L is a triloop or a tetraloop, optionally wherein the tetraloop comprises the sequence 5′-GAAA-3′, optionally wherein the stem-loop comprises the sequence 5′-GCAGCCGAAAGGCUGC-3′ (SEQ ID NO: 1681).
  • the antisense strand comprises an overhang sequence of one or more nucleotides in length at the 3′ terminus, optionally wherein the overhang comprises purine nucleotides, optionally wherein the overhang sequence is 2 nucleotides in length, optionally wherein the overhang is selected from AA, GG, AG, and GA, optionally wherein the overhang is GG.
  • At least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands, optionally wherein:
  • each targeting ligand comprises a carbohydrate, amino sugar, cholesterol, polypeptide or lipid;
  • the stem loop comprises one or more targeting ligands conjugated to one or more nucleotides of the stem loop;
  • the one or more targeting ligands is conjugated to one or more nucleotides of the loop, optionally wherein the loop comprises 4 nucleotides numbered 1-4 from 5′ to 3′, wherein nucleotides at positions 2, 3, and 4 each comprise one or more targeting ligands, wherein the targeting ligands are the same or different;
  • each targeting ligand comprises a N-acetylgalactosamine (GalNAc) moiety, optionally wherein the GalNAc moiety is a monovalent GalNAc moiety, a bivalent GalNAc moiety, a trivalent GalNAc moiety or a tetravalent GalNAc moiety; and/or (e) up to 4 nucleotides of L of the stem-loop
  • the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
  • the sense and antisense strands comprise nucleotide sequences selected from the group consisting of:
  • a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of MARC1 wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mGs-mG-mC-mU-mA-mG-mA-fG-fA-fA-fG-mA-mA-mA-mA-mG-mU-mU-mA-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1615), and wherein the antisense strand comprises
  • a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of MARC1 wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mAs-mG-mA-mA-mC-mG-mA-fA-fA-fG-fU-mU-mA-mU-mA-mU-mG-mG-mG-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1632), and wherein the antisense strand comprises
  • a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of MARC1 wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mAs-mA-mG-mU-mU-mG-mA-fC-fU-fA-fA-mA-mC-mU-mU-mG-mA-mA-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1640), and wherein the antisense strand comprises
  • a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of MARC1 wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mUs-mG-mU-mG-mA-mA-mU-fA-fA-fA-fU-mG-mG-mA-mA-mG-mC-mU-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1625), and wherein the antisense strand comprises
  • oligonucleotides described herein are useful for treating a disease, disorder or condition where the MARC1 enzyme plays a causal role.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising the RNAi oligonucleotide described herein and a pharmaceutically acceptable carrier, delivery agent or excipient.
  • the invention provides a kit comprising the RNAi described herein, an optional pharmaceutically acceptable carrier, and a package insert comprising instructions for administration to a subject having a disease, disorder or condition associated with MARC1 expression, optionally for the treatment of NAFLD, NASH, or alcoholic steatohepatitis (ASH).
  • a kit comprising the RNAi described herein, an optional pharmaceutically acceptable carrier, and a package insert comprising instructions for administration to a subject having a disease, disorder or condition associated with MARC1 expression, optionally for the treatment of NAFLD, NASH, or alcoholic steatohepatitis (ASH).
  • the invention provides a use of the RNAi oligonucleotide described herein, in the manufacture of a medicament for the treatment of a disease, disorder or condition associated with MARC1 expression, optionally for the treatment of a disease or condition associated with MARC1 expression in hepatocytes, optionally for the treatment of NAFLD, NASH, or ASH. optionally for use in combination with a second composition or therapeutic agent.
  • FIG. 1 provides a graph depicting the percent (%) of human MARC1 mRNA remaining in Huh7 cells endogenously expressing human MARC1, also referred to as MTARC1, after 24-hours treatment with 1 nM of DsiRNA targeting various regions of the MARC1 gene.
  • 384 DsiRNAs were designed and screened. Two primer pairs were used to measure MARC1 (SEQ ID NOs: 1684-1687), and expression was normalized between samples using the HPRT housekeeping gene (SEQ ID NOs: 1688 and 1689).
  • FIG. 2 provides a graph depicting the percent (%) of human MARC1 mRNA remaining in the liver of mice exogenously expressing human MARC1 (hydrodynamic injection model) after treatment with GalNAc-conjugated MARC1 oligonucleotides.
  • Mice were dosed subcutaneously with 2 mg/kg of the indicated GalNAc-MARC1 oligonucleotides formulated in phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • Three days post-dose mice were hydrodynamically injected (HDI) with a DNA plasmid encoding human MARC1.
  • the level of human MARC1 mRNA was determined from livers collected after 18 hours. Arrows indicate oligonucleotides selected for validation.
  • FIG. 3 provides a graph depicting the percent (%) of human MARC1 mRNA remaining in the liver of mice exogenously expressing human MARC1 (hydrodynamic injection model) after treatment with human GalNAc-conjugated MARC1 oligonucleotides selected for validation based on the results in FIG. 2
  • Mice were dosed subcutaneously with 2 mg/kg of the indicated GalNAc-MARC1 oligonucleotides formulated in PBS.
  • Three days post-dose mice were HDI with a DNA plasmid encoding MARC1. The level of human MARC1 mRNA was determined from livers collected 18 hours later.
  • FIG. 4 provides a graph depicting the dose response of GalNAc-conjugated MARC1 oligonucleotides selected for NHP studies.
  • Three days post-dose mice were HDI with a DNA plasmid encoding MARC1.
  • the level of human MARC1 mRNA was determined from livers collected 18 hours later.
  • FIG. 7 provides a graph depicting NAFLD activity score in samples from mice fed a DIO-NASH diet or Lean Chow diet and treated with 8 weekly doses of the indicated GalNAc-conjugated MARC1 oligonucleotides (3 mg/kg) or GLP-1 ‘22’ (10 nmol/kg) as control relative to mice treated with PBS. The score was calculated based on the NAFLD score at the end of the study.
  • FIG. 8 provides a graph depicting the Steatosis Score in samples from mice fed a DIO-NASH diet or Lean Chow diet and treated with 8 weekly doses of the indicated GalNAc-conjugated MARC1 oligonucleotides (3 mg/kg) or GLP-1 ‘22’ (10 nmol/kg) relative to mice treated with PBS. The score was calculated based on the Steatosis score at the end of the study.
  • FIGS. 9 A and 9 B provide graphs quantifying the steatosis fraction (i.e. the percent (%) of liver steatosis in a given area) ( FIG. 9 A ) and the percent (%) hepatocytes with lipid droplets ( FIG. 9 B ) from mice fed a DIO-NASH diet or Lean Chow diet and treated with 8 weekly doses of the indicated GalNAc-conjugated MARC1 oligonucleotides, (10 nmol/kg) (3 mg/kg), or PBS.
  • ⁇ p ⁇ 0.001(relative to DIO-NASH vehicle treatment).
  • FIG. 11 provides a schematic depicting the dosing and specimen collection schedules for non-human primate (NHP) studies using GalNAc-conjugated MARC1 oligonucleotides.
  • FIG. 12 is a schematic of an exemplary nicked tetraloop oligonucleotide structure.
  • MARC1 Mitochondrial Amidoxime Reducing Component 1, Molybdenum Cofactor Sulfurase C-terminal Domain-Containing Protein 1, Moco Sulfurase C-Terminal Domain Containing Protein 1, MOSC1, MOSC Domain-Containing Protein 1, MTARC1
  • MARC1 mitochondrial Amidoxime Reducing Component 1, Molybdenum Cofactor Sulfurase C-terminal Domain-Containing Protein 1, Moco Sulfurase C-Terminal Domain Containing Protein 1, MOSC1, MOSC Domain-Containing Protein 1, MTARC1
  • MARC1 genetic polymorphisms in MARC1 impact expression and/or functionality of MARC1 across all bodily tissues from birth, with MARC1 being expressed widely and at various levels in different organs.
  • oligonucleotides targeting MARC1 specifically in hepatocytes not only inhibit MARC1 expression in vitro and in vivo, but also provide a therapeutic effect in a mouse model of NASH. Specifically, reduction of MARC1 expression reduced the number of hepatocytes with liver droplets and the steatosis fraction. Additionally, MARC1 inhibition reduced several regulators of hepatic fibrosis in the NASH model.
  • antagonism/inhibition of MARC 1, specifically in hepatocytes may decrease the risk and severity of NAFLD, NASH, and alcoholic steatohepatitis (ASH).
  • This approach may be best managed by a specific and targeted reduction of the MARC1 expression in the liver while other organs, tissues or cells expressing MARC1 are left essentially unaffected.
  • the current invention may provide an improved modality of treatment given its specific targeting of mRNA production in the liver.
  • the current invention provides oligonucleotides (e.g., RNAi oligonucleotides) that reduce MARC1 expression in the liver.
  • the oligonucleotides provided herein are designed to treat diseases associated with MARC1 expression in the liver.
  • the current invention provides methods of treating a disease associated with overall MARC1 expression by reducing MARC1 expression in specific cells (e.g., hepatocytes) or organs (e.g., liver).
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) is targeted to a target sequence comprising a MARC1 mRNA. In some embodiments, an oligonucleotide described herein is targeted to a target sequence within a MARC1 mRNA sequence. In some embodiments, the oligonucleotide described herein corresponds to a target sequence within a MARC1 mRNA sequence.
  • the oligonucleotide, or a portion, fragment, or strand thereof binds or anneals to a target sequence comprising MARC1 mRNA, thereby inhibiting MARC1 expression.
  • the oligonucleotide is targeted to a MARC1 target sequence for the purpose of inhibiting MARC1 expression in vivo.
  • the amount or extent of inhibition of MARC1 expression by an oligonucleotide targeted to a MARC1 target sequence correlates with the potency of the oligonucleotide.
  • the amount or extent of inhibition of MARC1 expression by an oligonucleotide targeted to a MARC1 target sequence correlates with the amount or extent of therapeutic benefit in a subject or patient having a disease, disorder or condition associated with MARC1 expression treated with the oligonucleotide.
  • a sense strand of an oligonucleotide (e.g., an RNAi oligonucleotide) described herein comprises a MARC1 target sequence.
  • a portion or region of the sense strand of an oligonucleotide described herein (e.g., an RNAi oligonucleotide) comprises a MARC1 target sequence.
  • a MARC1 target sequence comprises, or consists of, a sequence of any one of SEQ ID NOs:1-384.
  • a MARC1 target sequence comprises, or consists of, the sequence set forth in SEQ ID NO: 234, 298, 356, or 376.
  • the oligonucleotides herein have regions of complementarity to MARC1 mRNA (e.g., within a target sequence of MARC1 mRNA) for purposes of targeting the MARC1 mRNA in cells and inhibiting and/or reducing MARC1 expression.
  • the oligonucleotides herein comprise a MARC1 targeting sequence (e.g., an antisense strand or a guide strand of a dsRNAi oligonucleotide) having a region of complementarity that binds or anneals to a MARC1 target sequence by complementary (Watson-Crick) base pairing.
  • the targeting sequence or region of complementarity is generally of a suitable length and base content to enable binding or annealing of the oligonucleotide (or a strand thereof) to a MARC1 mRNA for purposes of inhibiting and/or reducing MARC1 expression.
  • the targeting sequence or region of complementarity is at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 nucleotides in length.
  • the targeting sequence or region of complementarity is about 12 to about 30 (e.g., 12 to 30, 12 to 22, 15 to 25, 17 to 21, 18 to 27, 19 to 27, or 15 to 30) nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 18 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 19 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 20 nucleotides in length.
  • the targeting sequence or region of complementarity is 21 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 22 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 23 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 24 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 1-384, and the targeting sequence or region of complementarity is 18 nucleotides in length.
  • an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 1-384, and the targeting sequence or region of complementarity is 19 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152, and the targeting sequence or region of complementarity is 20 nucleotides in length.
  • an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152, and the targeting sequence or region of complementarity is 21 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152, and the targeting sequence or region of complementarity is 22 nucleotides in length.
  • an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152, and the targeting sequence or region of complementarity is 23 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152 and the targeting sequence or region of complementarity is 24 nucleotides in length.
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a targeting sequence or a region of complementarity (e.g., an antisense strand or a guide strand of a double-stranded oligonucleotide) that is fully complementary to a MARC1 target sequence.
  • the targeting sequence or region of complementarity is partially complementary to a MARC1 target sequence.
  • the oligonucleotide comprises a targeting sequence or region of complementarity that is fully complementary to a MARC1 target sequence.
  • the oligonucleotide comprises a targeting sequence or region of complementarity that is partially complementary to a MARC1 target sequence.
  • the oligonucleotide comprises a targeting sequence or region of complementarity that is fully complementary to a sequence of any one of SEQ ID NOs: 1-384. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is fully complementary to the sequence set forth in SEQ ID NOs: 234, 298, 356, or 376. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is partially complementary to a sequence of any one of SEQ ID NOs: 1-384. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is partially complementary to the sequence set forth in SEQ ID NOs: 234, 298, 356, or 376.
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides within a MARC1 mRNA, wherein the contiguous sequence of nucleotides is about 12 to about 30 nucleotides in length (e.g., 12 to 30, 12 to 28, 12 to 26, 12 to 24, 12 to 20, 12 to 18, 12 to 16, 14 to 22, 16 to 20, 18 to 20, or 18 to 19 nucleotides in length).
  • the oligonucleotide comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides within a MARC1 mRNA, wherein the contiguous sequence of nucleotides is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides within a MARC1 mRNA, wherein the contiguous sequence of nucleotides is 19 nucleotides in length.
  • the oligonucleotide comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides within a MARC1 mRNA, wherein the contiguous sequence of nucleotides is 20 nucleotides in length.
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, optionally wherein the contiguous sequence of nucleotides is 19 nucleotides in length.
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 234, 298, 356, or 376, wherein the contiguous sequence of nucleotides is 19 nucleotides in length.
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 769-1152, wherein the contiguous sequence of nucleotides is 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1002, 1066, 1124, and 1144, wherein the contiguous sequence of nucleotides is 20 nucleotides in length.
  • a targeting sequence or region of complementarity of an oligonucleotide herein is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384 and spans the entire length of an antisense strand.
  • a targeting sequence or region of complementarity of the oligonucleotide is complementary to a contiguous sequence of nucleotides of SEQ ID NOs: 1-384 and spans a portion of the entire length of an antisense strand.
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a region of complementarity (e.g., on an antisense strand of a dsRNA) that is at least partially (e.g., fully) complementary to a contiguous stretch of nucleotides spanning nucleotides 1-19 or 1-20 of a sequence as set forth in any one of SEQ ID NOs: 769-1152.
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a targeting sequence or region of complementarity having one or more base pair (bp) mismatches with the corresponding MARC1 target sequence.
  • the targeting sequence or region of complementarity may have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding MARC1 target sequence provided that the ability of the targeting sequence or region of complementarity to bind or anneal to the MARC1 mRNA under appropriate hybridization conditions and/or the ability of the oligonucleotide to inhibit MARC1 expression is maintained.
  • the targeting sequence or region of complementarity may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding MARC1 target sequence provided that the ability of the targeting sequence or region of complementarity to bind or anneal to the MARC1 mRNA under appropriate hybridization conditions and/or the ability of the oligonucleotide to inhibit MARC1 expression is maintained.
  • the oligonucleotide comprises a targeting sequence or region of complementarity having 1 mismatch with the corresponding target sequence.
  • the oligonucleotide comprises a targeting sequence or region of complementarity having 2 mismatches with the corresponding target sequence.
  • the oligonucleotide comprises a targeting sequence or region of complementarity having 3 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity having 4 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity having 5 mismatches with the corresponding target sequence.
  • the oligonucleotide comprises a targeting sequence or region of complementarity having more than one mismatch (e.g., 2, 3, 4, 5, or more mismatches) with the corresponding target sequence, wherein at least 2 (e.g., all) of the mismatches are positioned consecutively (e.g., 2, 3, 4, 5, or more mismatches in a row), or wherein the mismatches are interspersed throughout the targeting sequence or region of complementarity.
  • mismatch e.g., 2, 3, 4, 5, or more mismatches
  • the oligonucleotide comprises a targeting sequence or region of complementarity having more than one mismatch (e.g., 2, 3, 4, 5, or more mismatches) with the corresponding target sequence, wherein at least 2 (e.g., all) of the mismatches are positioned consecutively (e.g., 2, 3, 4, 5, or more mismatches in a row), or wherein at least one or more non-mismatched base pair is located between the mismatches, or a combination thereof.
  • mismatch e.g., 2, 3, 4, 5, or more mismatches
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, wherein the targeting sequence or region of complementarity may have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding MARC1 target sequence.
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, wherein the targeting sequence or region of complementarity may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding MARC1 target sequence.
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 234, 298, 356, or 376, wherein the targeting sequence or region of complementarity may have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding MARC1 target sequence.
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 234, 298, 356, or 376, wherein the targeting sequence or region of complementarity may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding MARC1 target sequence.
  • oligonucleotide types and/or structures are useful for targeting MARC1 in the methods herein including, but not limited to, RNAi oligonucleotides, antisense oligonucleotides (ASOs), miRNAs, etc. Any of the oligonucleotide types described herein or elsewhere are contemplated for use as a framework to incorporate a MARC1 targeting sequence herein for the purposes of inhibiting MARC1 expression.
  • the oligonucleotides herein inhibit MARC1 expression by engaging with RNA interference (RNAi) pathways upstream or downstream of Dicer involvement.
  • RNAi RNA interference
  • RNAi oligonucleotides have been developed with each strand having sizes of about 19-25 nucleotides with at least one 3′-overhang of 1 to 5 nucleotides (see, e.g., U.S. Pat. 8,372,968). Longer oligonucleotides also have been developed that are processed by Dicer to generate active RNAi products (see, e.g., U.S. Pat. 8,883,996).
  • extended dsRNAs where at least one end of at least one strand is extended beyond a duplex targeting region, including structures where one of the strands includes a thermodynamically stabilizing tetraloop structure (see, e.g., US Pats. 8,513,207 and 8,927,705, as well as Intl. Patent Application Publication No. WO 2010/033225).
  • Such structures may include single-stranded (ss) extensions (on one or both sides of the molecule) as well as double-stranded (ds) extensions.
  • the oligonucleotides herein engage with the RNAi pathway downstream of the involvement of Dicer (e.g., Dicer cleavage).
  • the oligonucleotides described herein are Dicer substrates.
  • double-stranded nucleic acids of 19-23 nucleotides in length capable of reducing MARC1 expression are produced.
  • the oligonucleotide has an overhang (e.g., of 1, 2, or 3 nucleotides in length) in the 3′ end of the antisense strand.
  • the oligonucleotide (e.g., siRNA) comprises a 21-nucleotide guide strand that is antisense to a target RNA and a complementary passenger strand, in which both strands anneal to form a 19-bp duplex and 2 nucleotide overhangs at either or both 3′ ends.
  • oligonucleotide designs also are available including oligonucleotides having a guide strand of 23 nucleotides and a passenger strand of 21 nucleotides, where there is a blunt end on the right side of the molecule (3′ end of passenger strand/5′ end of guide strand) and a two nucleotide 3′-guide strand overhang on the left side of the molecule (5′ end of the passenger strand/3′ end of the guide strand). In such molecules, there is a 21 bp duplex region. See, e.g., US Pats. 9,012,138; 9,012,621; and 9,193,753.
  • the oligonucleotides herein comprise sense and antisense strands that are both in the range of about 17 to 36 (e.g., 17 to 36, 20 to 25, or 21-23) nucleotides in length.
  • the oligonucleotides described herein comprise an antisense strand of 19-30 nucleotides in length and a sense strand of 19-50 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • an oligonucleotide herein comprises a sense and antisense strand that are both in the range of about 19-22 nucleotides in length. In some embodiments, the sense and antisense strands are of equal length. In some embodiments, an oligonucleotide comprises sense and antisense strands, such that there is a 3′-overhang on either the sense strand or the antisense strand, or both the sense and antisense strand.
  • a 3′-overhang on the sense, antisense, or both sense and antisense strands is 1 or 2 nucleotides in length.
  • the oligonucleotide has a guide strand of 22 nucleotides and a passenger strand of 20 nucleotides, where there is a blunt end on the right side of the molecule (3′ end of passenger strand/5′ end of guide strand) and a 2 nucleotide 3′-guide strand overhang on the left side of the molecule (5′ end of the passenger strand/3′ end of the guide strand).
  • oligonucleotide designs for use with the compositions and methods herein include: 16-mer siRNAs (see, e.g., NUCLEIC ACIDS IN CHEMISTRY AND BIOLOGY, Blackburn (ed.), ROYAL SOCIETY OF CHEMISTRY, 2006), shRNAs (e.g., having 19 bp or shorter stems; see, e.g., Moore et al. (2010) METHODS MOL. BIOL.
  • siRNAs e.g., of 19 bps in length; see, e.g., Kraynack & Baker (2006) RNA 12:163-176
  • asymmetrical siRNAs aiRNA; see, e.g., Sun et al. (2008) NAT. BIOTECHNOL. 26:1379-82
  • asymmetric shorter-duplex siRNA see, e.g., Chang et al. (2009) MOL. THER. 17:725-32
  • fork siRNAs see, e.g., Hohjoh (2004) FEBS LETT. 557:193-98
  • ss siRNAs Elsner (2012) NAT. BIOTECHNOL.
  • dumbbell-shaped circular siRNAs see, e.g., Abe et al. (2007) J. AM. CHEM. SOC. 129:15108-09
  • small internally segmented interfering RNA siRNA; see, e.g., Bramsen et al. (2007) NUCLEIC ACIDS RES. 35:5886-97.
  • siRNA small internally segmented interfering RNA
  • Further non-limiting examples of an oligonucleotide structures that may be used in some embodiments to reduce or inhibit the expression of MARC1 are microRNA (miRNA), short hairpin RNA (shRNA) and short siRNA (see, e.g., Hamilton et al. (2002) EMBO J. 21:4671-79; see also, US Patent Application Publication No. 2009/0099115).
  • an oligonucleotide for reducing or inhibiting MARC1 expression herein is single-stranded (ss).
  • ss single-stranded
  • Such structures may include but are not limited to single-stranded RNAi molecules.
  • RNAi molecules Recent efforts have demonstrated the activity of ss RNAi molecules (see, e.g., Matsui et al. (2016) MOL. THER. 24:946-55).
  • oligonucleotides herein are antisense oligonucleotides (ASOs).
  • An antisense oligonucleotide is a single-stranded oligonucleotide that has a nucleobase sequence which, when written in the 5′ to 3′ direction, comprises the reverse complement of a targeted segment of a particular nucleic acid and is suitably modified (e.g., as a gapmer) to induce RNaseH-mediated cleavage of its target RNA in cells or (e.g., as a mixmer) so as to inhibit translation of the target mRNA in cells.
  • ASOs for use herein may be modified in any suitable manner known in the art including, for example, as shown in U.S. Pat. No.
  • 9,567,587 including, e.g., length, sugar moieties of the nucleobase (pyrimidine, purine), and alterations of the heterocyclic portion of the nucleobase.
  • ASOs have been used for decades to reduce expression of specific target genes (see, e.g., Bennett et al. (2017) ANNU. REV. PHARMACOL. 57:81-105).
  • the antisense oligonucleotide shares a region of complementarity with MARC1 mRNA. In some embodiments, the antisense oligonucleotide targets various areas of the human MARC1 gene identified as NM_001251935.1. In some embodiments, the antisense oligonucleotide is 15-50 nucleotides in length. In some embodiments, the antisense oligonucleotide is 15-25 nucleotides in length. In some embodiments, the antisense oligonucleotide is 22 nucleotides in length. In some embodiments, the antisense oligonucleotide is complementary to any one of SEQ ID NOs: 1-384.
  • the antisense oligonucleotide is at least 15 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide is at least 19 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide is at least 20 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide differs by 1, 2, or 3 nucleotides from the target sequence.
  • the current invention provides double-stranded (ds) RNAi oligonucleotides for targeting MARC1 mRNA and inhibiting MARC1 expression (e.g., via the RNAi pathway) comprising a sense strand (also referred to herein as a passenger strand) and an antisense strand (also referred to herein as a guide strand).
  • ds double-stranded
  • the sense strand and antisense strand are separate strands and are not covalently linked.
  • the sense strand and antisense strand are covalently linked.
  • the sense strand and antisense strand form a duplex region, wherein the sense strand and antisense strand, or a portion thereof, binds with one another in a complementary fashion (e.g., by Watson-Crick base pairing).
  • the sense strand has a first region (R1) and a second region (R2), wherein R2 comprises a first subregion (S1), a tetraloop or triloop (L), and a second subregion (S2), wherein L is located between S1 and S2, and wherein S1 and S2 form a second duplex (D2).
  • D2 may have various length. In some embodiments, D2 is about 1-6 bp in length. In some embodiments, D2 is 2-6, 3-6, 4-6, 5-6, 1-5, 2-5, 3-5, or 4-5 bp in length. In some embodiments, D2 is 1, 2, 3, 4, 5, or 6 bp in length. In some embodiments, D2 is 6 bp in length.
  • R1 of the sense strand and the antisense strand form a first duplex (D1).
  • D1 is at least about 15 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides in length.
  • D1 is in the range of about 12 to 30 nucleotides in length (e.g., 12 to 30, 12 to 27, 15 to 22, 18 to 22, 18 to 25, 18 to 27, 18 to 30, or 21 to 30 nucleotides in length).
  • D1 is at least 12 nucleotides in length (e.g., at least 12, at least 15, at least 20, at least 25, or at least 30 nucleotides in length).
  • D1 is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, D1 is 20 nucleotides in length. In some embodiments, D1 comprising sense strand and antisense strand does not span the entire length of the sense strand and/or antisense strand. In some embodiments, D1 comprising the sense strand and antisense strand spans the entire length of either the sense strand or antisense strand or both. In certain embodiments, D1 comprising the sense strand and antisense strand spans the entire length of both the sense strand and the antisense strand.
  • an oligonucleotide provided herein comprises a sense strand having a sequence of any one of SEQ ID NOs: 769-1152 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1153-1536. In some embodiments, an oligonucleotide provided herein comprises a sense strand having a sequence of any one of SEQ ID NOs: 1-384 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 385-768.
  • an oligonucleotide provided herein comprises a sense strand having a sequence of any one of SEQ ID NOs: 1537-1570 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1573-1606 as is arranged in Tables 4 and 6.
  • an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand comprising nucleotide sequences selected from:
  • an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand comprising nucleotide sequences selected from:
  • the sense strand comprises the sequence of SEQ ID NO: 1543 and the antisense strand comprises the sequence of SEQ ID NO: 1579.
  • the sense strand comprises the sequence of SEQ ID NO: 1560 and the antisense strand comprises the sequence of SEQ ID NO: 1596.
  • the sense strand comprises the sequence of SEQ ID NO: 1568 and the antisense strand comprises the sequence of SEQ ID NO: 1604.
  • the sense strand comprises the sequence of SEQ ID NO: 1553 and the antisense strand comprises the sequence of SEQ ID NO: 1589.
  • sequences presented in the Sequence Listing may be referred to in describing the structure of an oligonucleotide (e.g., a dsRNAi oligonucleotide) or other nucleic acid.
  • the actual oligonucleotide or other nucleic acid may have one or more alternative nucleotides (e.g., an RNA counterpart of a DNA nucleotide or a DNA counterpart of an RNA nucleotide) and/or one or more modified nucleotides and/or one or more modified internucleotide linkages and/or one or more other modification when compared with the specified sequence while retaining essentially same or similar complementary properties as the specified sequence.
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a 25-nucleotide sense strand and a 27-nucleotide antisense strand that when acted upon by a Dicer enzyme results in an antisense strand that is incorporated into the mature RISC.
  • the 25-nucleotide sense strand comprises a sequence selected from SEQ ID NOs: 769-1152.
  • the 27-nucleotide antisense strand comprises a sequence selected from SEQ ID NOs: 1153-1536.
  • the sense strand of the oligonucleotide is longer than 27 nucleotides (e.g., 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides). In some embodiments, the sense strand of the oligonucleotide is longer than 25 nucleotides (e.g., 26, 27, 28, 29 or 30 nucleotides).
  • the sense strand of the oligonucleotide comprises a nucleotide sequence selected from SEQ ID NOs: 1537-1570, wherein the nucleotide sequence is longer than 27 nucleotides (e.g., 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides).
  • the sense strand of the oligonucleotide comprises a nucleotide sequence selected from SEQ ID NOs: 1537-1570, wherein the nucleotide sequence is longer than 25 nucleotides (e.g., 26, 27, 28, 29, or 30 nucleotides).
  • oligonucleotides herein have one 5′ end that is thermodynamically less stable when compared to the other 5′ end.
  • an asymmetric oligonucleotide is provided that includes a blunt end at the 3′ end of a sense strand and a 3′-overhang at the 3′ end of an antisense strand.
  • the 3′-overhang on the antisense strand is about 1-8 nucleotides in length (e.g., 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length).
  • the oligonucleotide has an overhang comprising two (2) nucleotides on the 3′ end of the antisense (guide) strand.
  • an overhang is a 3′-overhang comprising a length of between 1 and 6 nucleotides, optionally 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 6, 3 to 5, 3 to 4, 4 to 6, 4 to 5, 5 to 6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides.
  • the overhang is a 5′-overhang comprising a length of between 1 and 6 nucleotides, optionally 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 6, 3 to 5, 3 to 4, 4 to 6, 4 to 5, 5 to 6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides.
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, and a 5′-overhang comprising a length of between 1 and 6 nucleotides.
  • the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1537-1570, wherein the oligonucleotide comprises a 5′-overhang comprising a length of between 1 and 6 nucleotides.
  • the oligonucleotide comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1573-1606, wherein the oligonucleotide comprises a 5′-overhang comprising a length of between 1 and 6 nucleotides.
  • the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1537-1570 and antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1573-1606, wherein the oligonucleotide comprises a 5′-overhang comprising a length of between 1 and 6 nucleotides.
  • two (2) terminal nucleotides on the 3′ end of an antisense strand are modified.
  • the two (2) terminal nucleotides on the 3′ end of the antisense strand are complementary with the target mRNA (e.g., MARC1 mRNA).
  • the two (2) terminal nucleotides on the 3′ end of the antisense strand are not complementary with the target mRNA.
  • the two (2) terminal nucleotides on the 3′ end of the antisense strand of an oligonucleotide herein are unpaired.
  • the two (2) terminal nucleotides on the 3′ end of the antisense strand of an oligonucleotide herein comprise an unpaired GG. In some embodiments, the two (2) terminal nucleotides on the 3′ end of an antisense strand of an oligonucleotide herein are not complementary to the target mRNA. In some embodiments, two (2) terminal nucleotides on each 3′ end of an oligonucleotide are GG. In some embodiments, one or both of the two (2) terminal GG nucleotides on each 3′ end of an oligonucleotide herein is not complementary with the target mRNA.
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, wherein the two (2) terminal nucleotides on the 3′ end of the antisense strand of the oligonucleotide herein comprises an unpaired GG.
  • the oligonucleotide comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 385-768, wherein the two (2) terminal nucleotides on the 3′ end of the antisense strand of the oligonucleotide comprises an unpaired GG.
  • the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1537-1570 and antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1573-1606, wherein the two (2) terminal nucleotides on the 3′ end of the antisense strand of the oligonucleotide comprises an unpaired GG.
  • a sense and antisense strand comprising an oligonucleotide herein (e.g., an RNAi oligonucleotide). If there is more than one mismatch between a sense and antisense strand, they may be positioned consecutively (e.g., 2, 3 or more in a row), or interspersed throughout the region of complementarity.
  • the 3′ end of the sense strand comprises one or more mismatches. In some embodiments, two (2) mismatches are incorporated at the 3′ end of the sense strand.
  • base mismatches, or destabilization of segments at the 3′ end of the sense strand of an oligonucleotide herein improves or increases the potency of the oligonucleotide.
  • the sense and antisense strands of an oligonucleotide herein comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand comprising nucleotide sequences selected from:
  • an antisense strand of an oligonucleotide herein is referred to as a “guide strand”.
  • a guide strand an antisense strand that engages with RNA-induced silencing complex (RISC) and binds to an Argonaute protein such as Ago2, or engages with or binds to one or more similar factors, and directs silencing of a target gene, as the antisense strand is referred to as a guide strand.
  • RISC RNA-induced silencing complex
  • Ago2 Argonaute protein
  • a sense strand comprising a region of complementary to a guide strand is referred to herein as a “passenger strand.”
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises an antisense strand of up to about 50 nucleotides in length (e.g., up to 50, up to 40, up to 35, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides in length).
  • an oligonucleotide comprises an antisense strand of at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 22, at least 25, at least 27, at least 30, at least 35, or at least 38 nucleotides in length).
  • an oligonucleotide comprises an antisense strand in a range of about 12 to about 40 (e.g., 12 to 40, 12 to 36, 12 to 32, 12 to 28, 15 to 40, 15 to 36, 15 to 32, 15 to 28, 17 to 22, 17 to 25, 19 to 27, 19 to 30, 20 to 40, 22 to 40, 25 to 40, or 32 to 40) nucleotides in length.
  • an oligonucleotide comprises antisense strand of 15 to 30 nucleotides in length.
  • an antisense strand of any one of the oligonucleotides disclosed herein is of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.
  • an oligonucleotide comprises an antisense strand of 22 nucleotides in length.
  • an oligonucleotide disclosed herein for targeting MARC1 comprises an antisense strand comprising or consisting of a sequence as set forth in any one of SEQ ID NOs: 1153-1536.
  • an oligonucleotide herein comprises an antisense strand comprising at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1153-1536.
  • an oligonucleotide disclosed herein for targeting MARC1 comprises an antisense strand comprising or consisting of a sequence as set forth in any one of SEQ ID NOs: 1573-1606.
  • an oligonucleotide herein comprises an antisense strand comprising at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1573-1606.
  • an oligonucleotide disclosed herein for targeting MARC1 comprises an antisense strand comprising or consisting of a sequence as set forth in any one of SEQ ID NOs: 1579, 1596, 1604, and 1589.
  • an oligonucleotide herein comprises an antisense strand comprising at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1579, 1596, 1604, and 1589.
  • an oligonucleotide herein comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 385-768. In some embodiments, an oligonucleotide herein comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 618, 682, 740, and 760.
  • an oligonucleotide disclosed herein for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 1-384.
  • an oligonucleotide disclosed herein for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 769-1152.
  • an oligonucleotide herein has a sense strand comprised of at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 769-1152.
  • an oligonucleotide herein has a sense strand comprised of at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1-384.
  • an oligonucleotide disclosed herein for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 1537-1570.
  • an oligonucleotide herein has a sense strand comprised of least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1537-1570.
  • an oligonucleotide disclosed herein for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 1543, 1560, 1568, and 1553.
  • an oligonucleotide herein has a sense strand that comprise at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1543, 1560, 1568, or 1553.
  • an oligonucleotide disclosed herein for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 234, 298, 356, and 376.
  • an oligonucleotide herein has a sense strand that comprise at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 234, 298, 356, and 376.
  • an oligonucleotide provided herein comprises a sense strand (or passenger strand) of up to about 50 nucleotides in length (e.g., up to 50, up to 40, up to 36, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides in length).
  • an oligonucleotide herein comprises a sense strand of at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, at least 27, at least 30, at least 36 or at least 38 nucleotides in length).
  • an oligonucleotide herein comprises a sense strand in a range of about 12 to about 50 (e.g., 12 to 50, 12 to 40, 12 to 36, 12 to 32, 12 to 28, 15 to 40, 15 to 36, 15 to 32, 15 to 28, 17 to 21, 17 to 25, 19 to 27, 19 to 30, 20 to 40, 22 to 40, 25 to 40, or 32 to 40) nucleotides in length.
  • an oligonucleotide herein comprises a sense strand of 15 to 50 nucleotides in length.
  • an oligonucleotide herein comprises a sense strand of 18 to 36 nucleotides in length.
  • an oligonucleotide herein comprises a sense strand of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, an oligonucleotide herein comprises a sense strand of 36 nucleotides in length.
  • an oligonucleotide provided herein comprises a sense strand comprising a stem-loop structure at the 3′ end of the sense strand.
  • the stem-loop is formed by intrastrand base pairing.
  • a sense strand comprises a stem-loop structure at its 5′ end.
  • the stem of the stem-loop comprises a duplex of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleotides in length.
  • the stem of the stem-loop comprises a duplex of 2 nucleotides in length.
  • the stem of the stem-loop comprises a duplex of 3 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 4 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 5 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 6 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 7 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 8 nucleotides in length.
  • the stem of the stem-loop comprises a duplex of 9 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 10 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 11 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 12 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 13 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 14 nucleotides in length.
  • a stem-loop provides the oligonucleotide protection against degradation (e.g., enzymatic degradation), facilitates or improves targeting and/or delivery to a target cell, tissue, or organ (e.g., the liver), or both.
  • the loop of a stem-loop is comprised of nucleotides comprising one or more modifications that facilitate, improve, or increase targeting to a target mRNA (e.g., a MARC1 mRNA), inhibition of target gene expression (e.g., MARC1 expression), and/or delivery, uptake, and/or penetrance into a target cell, tissue, or organ (e.g., the liver), or a combination thereof.
  • the stem-loop itself or modification(s) to the stem-loop do not affect or do not substantially affect the inherent gene expression inhibition activity of the oligonucleotide, but facilitates, improves, or increases stability (e.g., provides protection against degradation) and/or delivery, uptake, and/or penetrance of the oligonucleotide to a target cell, tissue, or organ (e.g., the liver).
  • an oligonucleotide herein comprises a sense strand comprising (e.g., at its 3′ end) a stem-loop set forth as: S1-L-S2, in which S1 is complementary to S2, and in which L forms a single-stranded loop of linked nucleotides between S1 and S2 of up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length).
  • the loop (L) is 3 nucleotides in length.
  • the loop (L) is 4 nucleotides in length.
  • the loop (L) is 5 nucleotides in length.
  • the loop (L) is 6 nucleotides in length. In some embodiments, the loop (L) is 7 nucleotides in length. In some embodiments, the loop (L) is 8 nucleotides in length. In some embodiments, the loop (L) is 9 nucleotides in length. In some embodiments, the loop (L) is 10 nucleotides in length.
  • the tetraloop comprises the sequence 5′-GAAA-3′.
  • the stem loop comprises the sequence 5′-GCAGCCGAAAGGCUGC-3′ (SEQ ID NO: 1681).
  • an oligonucleotide provided herein comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, and the oligonucleotide comprises a sense strand comprising (e.g., at its 3′ end) a stem-loop set forth as: S1-L-S2, in which S1 is complementary to S2, and in which L forms a single-stranded loop between S1 and S2 of up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length).
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, and the oligonucleotide comprises a sense strand comprising (e.g., at its 3′ end) a stem-loop set forth as: S1-L-S2, in which S1 is complementary to S2, and in which L forms a single-stranded loop between S1 and S2 of 4 nucleotides in length.
  • a loop (L) of a stem-loop having the structure S1-L-S2 as described herein is a triloop.
  • the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384 and a triloop.
  • the triloop comprises ribonucleotides, deoxyribonucleotides, modified nucleotides, ligands (e.g., delivery ligands), and combinations thereof.
  • a loop (L) of a stem-loop having the structure S1-L-S2 as described above is a tetraloop as describe in U.S. Pat. 10,131,912, incorporated herein by reference.
  • an oligonucleotide herein comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384 and a tetraloop.
  • the tetraloop comprises ribonucleotides, deoxyribonucleotides, modified nucleotides, ligands (e.g., delivery ligands), and combinations thereof.
  • a duplex formed between a sense and antisense strand is at least 12 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is in the range of 12-30 nucleotides in length (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30, or 21 to 30 nucleotides in length). In some embodiments, a duplex formed between a sense and antisense strand is 12, 13, 14, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
  • a duplex formed between a sense and antisense strand is 12 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 13 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 14 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 15 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 16 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 17 nucleotides in length.
  • a duplex formed between a sense and antisense strand is 18 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 19 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 20 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 21 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 22 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 23 nucleotides in length.
  • a duplex formed between a sense and antisense strand is 24 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 25 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 26 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 27 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 28 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 29 nucleotides in length.
  • a duplex formed between a sense and antisense strand is 30 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand does not span the entire length of the sense strand and/or antisense strand. In some embodiments, a duplex between a sense and antisense strand spans the entire length of either the sense or antisense strands. In some embodiments, a duplex between a sense and antisense strand spans the entire length of both the sense strand and the antisense strand. In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • a duplex between a sense and antisense strand spans the entire length of both the sense strand and the antisense strand.
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide disclosed herein comprises a sense strand and an antisense strand, wherein the termini of either or both strands comprise a blunt end.
  • an oligonucleotide herein comprises sense and antisense strands that are separate strands which form an asymmetric duplex region having an overhang at the 3′ terminus of the antisense strand.
  • an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the termini of either or both strands comprise an overhang comprising one or more nucleotides.
  • an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the 3′ termini of the sense strand and the 5′ termini of the antisense strand comprise a blunt end. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the 5′ termini of the sense strand and the 3′ termini of the antisense strand comprise a blunt end.
  • an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the 3′ terminus of either or both strands comprise a 3′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the sense strand comprises a 3′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 3′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein both the sense strand and the antisense strand comprises a 3′-overhang comprising one or more nucleotides.
  • the 3′-overhang is about one (1) to twenty (20) nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleotides in length). In some embodiments, the 3′-overhang is about one (1) to nineteen (19), one (1) to eighteen (18), one (1) to seventeen (17), one (1) to sixteen (16), one (1) to fifteen (15), one (1) to fourteen (14), one (1) to thirteen (13), one (1) to twelve (12), one (1) to eleven (11), one (1) to ten (10), one (1) to nine (9), one (1) to eight (8), one (1) to seven (7), one (1) to six (6), one (1) to five (5), one (1) to four (4), one (1) to three (3), or about one (1) to two (2) nucleotides in length.
  • the 3′-overhang is (1) nucleotide in length. In some embodiments, the 3′-overhang is two (2) nucleotides in length. In some embodiments, the 3′-overhang is three (3) nucleotides in length. In some embodiments, the 3′-overhang is four (4) nucleotides in length. In some embodiments, the 3′-overhang is five (5) nucleotides in length. In some embodiments, the 3′-overhang is six (6) nucleotides in length. In some embodiments, the 3′-overhang is seven (7) nucleotides in length. In some embodiments, the 3′-overhang is eight (8) nucleotides in length.
  • the 3′-overhang is nine (9) nucleotides in length. In some embodiments, the 3′-overhang is ten (10) nucleotides in length. In some embodiments, the 3′-overhang is eleven (11) nucleotides in length. In some embodiments, the 3′-overhang is twelve (12) nucleotides in length. In some embodiments, the 3′-overhang is thirteen (13) nucleotides in length. In some embodiments, the 3′-overhang is fourteen (14) nucleotides in length. In some embodiments, the 3′-overhang is fifteen (15) nucleotides in length. In some embodiments, the 3′-overhang is sixteen (16) nucleotides in length.
  • the 3′-overhang is seventeen (17) nucleotides in length. In some embodiments, the 3′-overhang is eighteen (18) nucleotides in length. In some embodiments, the 3′-overhang is nineteen (19) nucleotides in length. In some embodiments, the 3′-overhang is twenty (20) nucleotides in length.
  • an oligonucleotide disclosed herein comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 3′-overhang, wherein the sense and antisense strands of the oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide disclosed herein comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 3′-overhang, wherein the sense and antisense strands of the oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the 5′ terminus of either or both strands comprise a 5′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the sense strand comprises a 5′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 5′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein both the sense strand and the antisense strand comprises a 5′-overhang comprising one or more nucleotides.
  • the 5′-overhang is about one (1) to twenty (20) nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleotides in length). In some embodiments, the 5′-overhang is about one (1) to nineteen (19), one (1) to eighteen (18), one (1) to seventeen (17), one (1) to sixteen (16), one (1) to fifteen (15), one (1) to fourteen (14), one (1) to thirteen (13), one (1) to twelve (12), one (1) to eleven (11), one (1) to ten (10), one (1) to nine (9), one (1) to eight (8), one (1) to seven (7), one (1) to six (6), one (1) to five (5), one (1) to four (4), one (1) to three (3), or about one (1) to two (2) nucleotides in length.
  • the 5′-overhang is (1) nucleotide in length. In some embodiments, the 5′-overhang is two (2) nucleotides in length. In some embodiments, the 5′-overhang is three (3) nucleotides in length. In some embodiments, the 5′-overhang is four (4) nucleotides in length. In some embodiments, the 5′-overhang is five (5) nucleotides in length. In some embodiments, the 5′-overhang is six (6) nucleotides in length. In some embodiments, the 5′-overhang is seven (7) nucleotides in length. In some embodiments, the 5′-overhang is eight (8) nucleotides in length.
  • the 5′-overhang is nine (9) nucleotides in length. In some embodiments, the 5′-overhang is ten (10) nucleotides in length. In some embodiments, the 5′-overhang is eleven (11) nucleotides in length. In some embodiments, the 5′-overhang is twelve (12) nucleotides in length. In some embodiments, the 5′-overhang is thirteen (13) nucleotides in length. In some embodiments, the 5′-overhang is fourteen (14) nucleotides in length. In some embodiments, the 5′-overhang is fifteen (15) nucleotides in length. In some embodiments, the 5′-overhang is sixteen (16) nucleotides in length.
  • the 5′-overhang is seventeen (17) nucleotides in length. In some embodiments, the 5′-overhang is eighteen (18) nucleotides in length. In some embodiments, the 5′-overhang is nineteen (19) nucleotides in length. In some embodiments, the 5′-overhang is twenty (20) nucleotides in length.
  • an oligonucleotide disclosed herein comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 5′-overhang, wherein the sense and antisense strands of the oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide disclosed herein comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 5′-overhang, wherein the sense and antisense strands of the oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • one or more (e.g., 2, 3, 4, 5, or more) nucleotides comprising the 3′ terminus or 5′ terminus of a sense and/or antisense strand are modified.
  • one or two terminal nucleotides of the 3′ terminus of the antisense strand are modified.
  • the last nucleotide at the 3′ terminus of an antisense strand is modified, such that it comprises 2′ modification, or it comprises, a 2′-O-methoxyethyl.
  • the last one or two terminal nucleotides at the 3′ terminus of an antisense strand are complementary with the target.
  • the last one or two nucleotides at the 3′ terminus of the antisense strand are not complementary with the target.
  • an oligonucleotide disclosed herein comprises a sense strand and an antisense strand, wherein the 3′ terminus of the sense strand comprises a step-loop described herein and the 3′ terminus of the antisense strand comprises a 3′-overhang described herein.
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand that form a nicked tetraloop structure described herein, wherein the 3′ terminus of the sense strand comprises a stem-loop, wherein the loop is a tetraloop described herein, and wherein the 3′ terminus of the antisense strand comprises a 3′-overhang described herein.
  • the 3′-overhang is two (2) nucleotides in length.
  • the two (2) nucleotides comprising the 3′-overhang both comprise guanine (G) nucleobases.
  • an oligonucleotide described herein comprises the nicked tetraloop structure shown in FIG. 12 .
  • an oligonucleotide described herein comprises a modification.
  • Oligonucleotides e.g., RNAi oligonucleotides
  • the modification is a modified sugar. In some embodiments, the modification is a 5′-terminal phosphate group. In some embodiments, the modification is a modified internucleotide linkage. In some embodiments, the modification is a modified base. In some embodiments, an oligonucleotide described herein can comprise any one of the modifications described herein or any combination thereof. For example, in some embodiments, an oligonucleotide described herein comprises at least one modified sugar, a 5′-terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base. In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide described herein comprises at least one modified sugar, a 5′-terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base.
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • oligonucleotide e.g., an RNAi oligonucleotide
  • oligonucleotides may be delivered in vivo by conjugating them to or encompassing them in a lipid nanoparticle (LNP) or similar carrier.
  • LNP lipid nanoparticle
  • an oligonucleotide is not protected by an LNP or similar carrier, it may be advantageous for at least some of the nucleotides to be modified. Accordingly, in some embodiments, all or substantially all the nucleotides of an oligonucleotide are modified.
  • an oligonucleotide as disclosed herein has a number and type of modified nucleotides sufficient to cause the desired characteristics (e.g., protection from enzymatic degradation, capacity to target a desired cell after in vivo administration, and/or thermodynamic stability).
  • an oligonucleotide described herein comprises a modified sugar.
  • a modified sugar also referred herein to a sugar analog
  • a modified sugar includes a modified deoxyribose or ribose moiety in which, for example, one or more modifications occur at the 2′, 3′, 4′, and/or 5′ carbon position of the sugar.
  • a modified sugar may also include non-natural alternative carbon structures such as those present in locked nucleic acids (“LNA”; see, e.g., Koshkin et al.
  • LNA locked nucleic acids
  • a nucleotide modification in a sugar comprises a 2′-modification.
  • a 2′-modification may be 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-fluoro (2′-F), 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), or 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • a modification in a sugar comprises a modification of the sugar ring, which may comprise modification of one or more carbons of the sugar ring.
  • a modification of a sugar of a nucleotide may comprise a 2′-oxygen of a sugar is linked to a 1′-carbon or 4′-carbon of the sugar, or a 2′-oxygen is linked to the 1′-carbon or 4′-carbon via an ethylene or methylene bridge.
  • a modified nucleotide has an acyclic sugar that lacks a 2′-carbon to 3′-carbon bond.
  • a modified nucleotide has a thiol group, e.g., in the 4′ position of the sugar.
  • an oligonucleotide (e.g., an RNAi oligonucleotide) described herein comprises at least about 1 modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, or more).
  • the sense strand of the oligonucleotide comprises at least about 1 modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, or more).
  • the antisense strand of the oligonucleotide comprises at least about 1 modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, or more).
  • nucleotides of the sense strand of the oligonucleotide are modified. In some embodiments, all the nucleotides of the antisense strand of the oligonucleotide are modified. In some embodiments, all the nucleotides of the oligonucleotide (i.e., both the sense strand and the antisense strand) are modified. In some embodiments, the modified nucleotide comprises a 2′-modification (e.g., a 2′-F or 2′-OMe, 2′-MOE, and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid).
  • a 2′-modification e.g., a 2′-F or 2′-OMe, 2′-MOE, and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid.
  • an oligonucleotide herein comprises a sense strand having a modification pattern as set forth in the Examples and Sequence Listing and an antisense strand having a modification pattern as set forth in the Examples and Sequence Listing.
  • an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) comprises an antisense strand having nucleotides that are modified with 2′-F.
  • an oligonucleotide herein comprises an antisense strand comprising nucleotides that are modified with 2′-F and 2′-OMe.
  • an oligonucleotide disclosed herein comprises a sense strand having nucleotides that are modified with 2′-F.
  • an oligonucleotide disclosed herein comprises a sense strand comprises nucleotides that are modified with 2′-F and 2′-OMe.
  • an oligonucleotide described herein comprises a sense strand with about 10-15%, 10%, 11%, 12%, 13%, 14%, or 15% of the nucleotides of the sense strand comprising a 2′-fluoro modification. In some embodiments, about 11% of the nucleotides of the sense strand comprise a 2-fluoro modification. In some embodiments, an oligonucleotide described herein comprises an antisense strand with about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the antisense strand comprising a 2′-fluoro modification.
  • about 32% of the nucleotides of the antisense strand comprise a 2′-fluoro modification.
  • the oligonucleotide has about 15-25%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25% of its nucleotides comprising a 2′-fluoro modification.
  • about 19% of the nucleotides in the dsRNAi oligonucleotide comprise a 2′-fluoro modification.
  • one or more of positions 8, 9, 10, or 11 of the sense strand is modified with a 2′-F group. In some embodiments, one or more of positions 3, 8, 9, 10, 12, 13, and 17 of the sense strand is modified with a 2′-F group. In some embodiments, one or more of positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand is modified with a 2′-F group. In some embodiments, one or more of positions 2, 3, 4, 5, 7, 8, 10, 14, 16, and 19 is modified with a 2′-F group. In some embodiments, the sugar moiety at each of nucleotides at positions 1-7 and 12-20 in the sense strand is modified with a 2′-OMe.
  • the sugar moiety at each of nucleotides at positions 1-7, 12-27, and 31-36 in the sense strand is modified with a 2′-OMe. In some embodiments, the sugar moiety at each of nucleotides at positions 6, 9, 11-13, 15, 17, 18, and 20-22 in the sense strand is modified with a 2′-OMe.
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 5, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 1, 2, 5, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 4, 5, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 1, 2, 3, 5, 7, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 4, 5, 7, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 1, 2, 3, 5, 10, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 4, 5, 10, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 5, 7, 10, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 4, 5, 7, 8, 10, 14, 16, and, 19 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, or position 22 modified with 2′-F.
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, or position 22 modified with 2′-OMe.
  • an oligonucleotide provided herein comprises an antisense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, or position 22 modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 8-11 modified with 2′-F. In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 3, 8, 9, 10, 12, 13 and 17 modified with 2′-F. In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 1-7 and 12-17, or 12-20 modified with 2′OMe. In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 1-7, 12-27, and 31-36 modified with 2′OMe.
  • an oligonucleotide provided herein comprises a sense strand having the sugar moiety of each of the nucleotides at positions 1-7 and 12-17, or 12-20 of the sense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-FANA).
  • an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 1-2, 4-7, 11, 14-16, and 18-20 modified with 2′OMe.
  • an oligonucleotide provided herein comprises a sense strand having the sugar moiety of each of the nucleotides at positions 1-2, 4-7, 11, 14-16, and 18-20 of the sense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′
  • an oligonucleotide provided herein comprises a sense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14,position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, position 24, position 25, position 26, position 27, position 28, position 29, position 30, position 31, position 32, position 33, position 34, position 35, or position 36 modified with 2′-F.
  • an oligonucleotide provided herein comprises a sense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, position 24, position 25, position 26, position 27, position 28, position 29, position 30, position 31, position 32, position 33, position 34, position 35, or position 36 modified with 2′-OMe.
  • an oligonucleotide provided herein comprises a sense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, position 24, position 25, position 26, position 27, position 28, position 29, position 30, position 31, position 32, position 33, position 34, position 35, or position 36 modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid (2′-
  • an oligonucleotide described herein comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 5′-terminal phosphate.
  • 5′-terminal phosphate groups of an RNAi oligonucleotide enhance the interaction with Ago2.
  • oligonucleotides comprising a 5′-phosphate group may be susceptible to degradation via phosphatases or other enzymes, which can limit their performance and/or bioavailability in vivo.
  • an oligonucleotide herein includes analogs of 5′-phosphates that are resistant to such degradation.
  • the phosphate analog is oxymethyl phosphonate, vinylphosphonate or malonylphosphonate, or a combination thereof.
  • the 5′ terminus of an oligonucleotide strand is attached to chemical moiety that mimics the electrostatic and steric properties of a natural 5′-phosphate group (“phosphate mimic”).
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide herein e.g., an RNAi oligonucleotide
  • has a phosphate analog at a 4′-carbon position of the sugar referred to as a “4′-phosphate analog”.
  • an oligonucleotide herein comprises a 4′-phosphate analog at a 5′-terminal nucleotide.
  • a phosphate analog is an oxymethyl phosphonate, in which the oxygen atom of the oxymethyl group is bound to the sugar moiety (e.g., at its 4′-carbon) or analog thereof.
  • a 4′-phosphate analog is a thiomethyl phosphonate or an aminomethyl phosphonate, in which the sulfur atom of the thiomethyl group or the nitrogen atom of the amino methyl group is bound to the 4′-carbon of the sugar moiety or analog thereof.
  • a 4′-phosphate analog is an oxymethyl phosphonate.
  • an oxymethyl phosphonate is represented by the formula —O—CH 2 —PO(OH) 2 , —O—CH 2 —PO(OR) 2 , or —O—CH 2 —PO(OH)(R), in which R is independently selected from —H, —CH 3 , an alkyl group, —CH 2 CH 2 CN, —CH 2 OCOC(CH 3 ) 3 , —CH 2 OCH 2 CH 2 Si(CH 3 ) 3 or a protecting group.
  • the alkyl group is CH 2 CH 3 . More typically, R is independently selected from —H, —CH 3 or —CH 2 CH 3 .
  • R is —CH 3 .
  • the 4′-phosphate analog is 5′-methoxyphosphonate-4′-oxy.
  • an oligonucleotide provided herein comprises an antisense strand comprising a 4′-phosphate analog at the 5′-terminal nucleotide, wherein 5′-terminal nucleotide comprises the following structure:
  • an oligonucleotide provided herein comprises a modified internucleotide linkage.
  • phosphate modifications or substitutions result in an oligonucleotide that comprises at least about 1 (e.g., at least 1, at least 2, at least 3, or at least 5) modified internucleotide linkage.
  • any one of the oligonucleotides disclosed herein comprises about 1 to about 10 (e.g., 1 to 10, 2 to 8, 4 to 6, 3 to 10, 5 to 10, 1 to 5, 1 to 3, or 1 to 2) modified internucleotide linkages.
  • any one of the oligonucleotides disclosed herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified internucleotide linkages.
  • a modified internucleotide linkage may be a phosphorodithioate linkage, a phosphorothioate linkage, a phosphotriester linkage, a thionoalkylphosphonate linkage, a thionalkylphosphotriester linkage, a phosphoramidite linkage, a phosphonate linkage or a boranophosphate linkage.
  • at least one modified internucleotide linkage of any one of the oligonucleotides as disclosed herein is a phosphorothioate linkage.
  • an oligonucleotide provided herein (e.g., a RNAi oligonucleotide) has a phosphorothioate linkage between one or more of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.
  • the oligonucleotide described herein has a phosphorothioate linkage between each of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • the oligonucleotide described herein has a phosphorothioate linkage between each of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide provided herein comprises one or more modified nucleobases.
  • modified nucleobases also referred to herein as base analogs
  • a modified nucleobase is a nitrogenous base.
  • a modified nucleobase does not contain nitrogen atom. See, e.g., U.S. Pat. Application Publication No. 2008/0274462.
  • a modified nucleotide comprises a universal base.
  • a modified nucleotide does not contain a nucleobase (abasic).
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • a modified nucleotide comprises a universal base. In some embodiments, a modified nucleotide does not contain a nucleobase (abasic). In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • a universal base is a heterocyclic moiety located at the 1′ position of a nucleotide sugar moiety in a modified nucleotide, or the equivalent position in a nucleotide sugar moiety substitution, that, when present in a duplex, can be positioned opposite more than one type of base without substantially altering structure of the duplex.
  • a single-stranded nucleic acid containing a universal base forms a duplex with the target nucleic acid that has a lower T m than a duplex formed with the complementary nucleic acid.
  • the single-stranded nucleic acid containing the universal base forms a duplex with the target nucleic acid that has a higher T m than a duplex formed with the nucleic acid comprising the mismatched base.
  • Non-limiting examples of universal-binding nucleotides include, but are not limited to, inosine, 1- ⁇ -D-ribofuranosyl-5-nitroindole and/or 1- ⁇ -D-ribofuranosyl-3-nitropyrrole (see, U.S. Pat. Application Publication No. 2007/0254362; Van Aerschot et al. (1995) NUCLEIC ACIDS RES. 23:4363-4370; Loakes et al. (1995) NUCLEIC ACIDS RES. 23:2361-66; and Loakes & Brown (1994) NUCLEIC ACIDS RES. 22:4039-43).
  • an oligonucleotide provided herein e.g., an RNAi oligonucleotide
  • Such a strategy may help to avoid undesirable effects to the organism treated and/or to avoid undue loss of the oligonucleotide to cells, tissues, organs, or anatomical regions or compartments that would not benefit from the oligonucleotide or its effects (e.g., inhibition or reduction of MARC1 expression).
  • oligonucleotides disclosed herein are modified to facilitate targeting and/or delivery to particular cells or cell types, tissues, organs, or anatomical regions or compartments (e.g., to facilitate delivery of the oligonucleotide to the liver).
  • an oligonucleotide comprises at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6, or more nucleotides) conjugated to one or more targeting ligand(s).
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • an oligonucleotide comprises at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6, or more nucleotides) conjugated to one or more targeting ligand(s).
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • the targeting ligand comprises a carbohydrate, amino sugar, cholesterol, peptide, polypeptide, protein, or part of a protein (e.g., an antibody or antibody fragment), or lipid.
  • the targeting ligand is a carbohydrate comprising at least one GalNAc moiety.
  • nucleotides of an oligonucleotide provided herein are each conjugated to a separate targeting ligand (e.g., a GalNAc moiety).
  • a separate targeting ligand e.g., a GalNAc moiety.
  • 2 to 4 nucleotides of an oligonucleotide are each conjugated to a separate targeting ligand.
  • targeting ligands are conjugated to 2 to 4 nucleotides at either ends of the sense or antisense strand (e.g., targeting ligands are conjugated to a 2 to 4 nucleotide overhang or extension on the 5′ or 3′ terminus of the sense or antisense strand) such that the targeting ligands resemble bristles of a toothbrush, and the oligonucleotide resembles a toothbrush.
  • an oligonucleotide may comprise a stem-loop at either the 5′ or 3′ terminus of the sense strand and 1, 2, 3, or 4 nucleotides of the loop of the stem may be individually conjugated to a targeting ligand.
  • an oligonucleotide provided by the current invention comprises a stem-loop at the 3′ terminus of the sense strand, wherein the loop of the stem-loop comprises a triloop or a tetraloop, and wherein the 3 or 4 nucleotides comprising the triloop or tetraloop, respectively, are individually conjugated to a targeting ligand.
  • an oligonucleotide provided by the current invention comprises a stem-loop at the 3′ terminus of the sense strand, wherein the loop of the stem-loop comprises a tetraloop, and wherein 3 nucleotides of the tetraloop are individually conjugated to a targeting ligand.
  • GalNAc is a high affinity carbohydrate ligand for the asialoglycoprotein receptor (ASGPR), which is primarily expressed on the surface of hepatocyte cells and has a major role in binding, internalizing and subsequent clearing circulating glycoproteins that contain terminal galactose or GalNAc residues (asialoglycoproteins).
  • Conjugation (either indirect or direct) of GalNAc moieties to oligonucleotides of the instant disclosure can be used to target these oligonucleotides to the ASGPR expressed on cells.
  • an oligonucleotide of the instant disclosure e.g., an RNAi oligonucleotide
  • the GalNAc moiety target the oligonucleotide to the liver.
  • an oligonucleotide of the instant disclosure is conjugated directly or indirectly to a monovalent GalNAc moiety.
  • the oligonucleotide is conjugated directly or indirectly to more than one monovalent GalNAc (i.e., is conjugated to 2, 3 or 4 monovalent GalNAc moieties and is typically conjugated to 3 or 4 monovalent GalNAc moieties).
  • an oligonucleotide is conjugated to one or more bivalent GalNAc, trivalent GalNAc or tetravalent GalNAc moieties.
  • a bivalent, trivalent or tetravalent GalNAc moiety is conjugated to an oligonucleotide via a branched linker.
  • a monovalent GalNAc moiety is conjugated to a first nucleotide and a bivalent, trivalent, or tetravalent GalNAc moiety is conjugated to a second nucleotide via a branched linker.
  • one (1) or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of an oligonucleotide described herein are each conjugated to a GalNAc moiety.
  • two (2) to four (4) nucleotides of a tetraloop are each conjugated to a separate GalNAc moiety.
  • one (1) to three (3) nucleotides of a triloop are each conjugated to a separate GalNAc moiety.
  • targeting ligands are conjugated to two (2) to four (4) nucleotides at either ends of the sense or antisense strand (e.g., ligands are conjugated to a two (2) to four (4) nucleotide overhang or extension on the 5′ or 3′ terminus of the sense or antisense strand) such that the GalNAc moieties resemble bristles of a toothbrush and the oligonucleotide resembles a toothbrush.
  • GalNAc moieties are conjugated to a nucleotide of the sense strand.
  • three (3) or four (4) GalNAc moieties can be conjugated to nucleotides in the tetraloop of the sense strand where each GalNAc moiety is conjugated to one (1) nucleotide.
  • an oligonucleotide described herein comprises a tetraloop, wherein the tetraloop (L) is any combination of adenine (A) and guanine (G) nucleotides.
  • an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a monovalent GalNAc moiety attached to a guanine (G) nucleotide referred to as [ademG-GalNAc] or 2′-aminodiethoxymethanol-Guanine-GalNAc, as depicted below:
  • an oligonucleotide herein comprises a monovalent GalNAc moiety attached to an adenine nucleotide, referred to as [ademA-GalNAc] or 2′-aminodiethoxymethanol-Adenine-GalNAc, as depicted below:
  • a targeting ligand is conjugated to a nucleotide comprising an oligonucleotide herein (e.g., an RNAi oligonucleotide) using a click linker.
  • an acetal-based linker is used to conjugate a targeting ligand to a nucleotide of any one of the oligonucleotides described herein. Acetal-based linkers are disclosed, for example, in Intl. Patent Application Publication No. WO2016/100401.
  • the linker is a labile linker.
  • the linker is stable.
  • An example is shown below for a loop comprising from 5′ to 3′ the nucleotides GAAA, in which GalNAc moieties are attached to nucleotides of the loop using an acetal linker.
  • Such a loop may be present, for example, at positions 27-30 of the any one of the sense strands.
  • a targeting ligand is conjugated to a nucleotide using a click linker.
  • an acetal-based linker is used to conjugate a targeting ligand to a nucleotide of any one of the oligonucleotides described herein. Acetal-based linkers are disclosed, for example, in Intl. Patent Application Publication No. WO 2016/100401.
  • the linker is a labile linker.
  • the linker is a stable linker.
  • a duplex extension (e.g., of up to 3, 4, 5, or 6 bp in length) is provided between a targeting ligand (e.g., a GalNAc moiety) and the oligonucleotide.
  • a targeting ligand e.g., a GalNAc moiety
  • the oligonucleotides herein do not have a GalNAc conjugated thereto.
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
  • the MARC1-targeting dsRNAi oligonucleotide for reducing MARC1 expression provided by the current invention comprise a sense strand and an antisense strand, wherein all nucleotides comprising the sense strand and antisense strand are modified, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length.
  • the 5′-terminal nucleotide of the antisense strand comprises 5′-methoxyphosphonate-4′-oxy-2′-O-methyluridine [MePhosphonate-40-mU], as described herein.
  • the 5′-terminal nucleotide of the antisense strand comprises a phosphorothioate linkage.
  • the antisense strand and the sense strand comprise one or more 2′-fluoro (2′ -F) and 2′-O-methyl (2′-OMe) modified nucleotides and at least one phosphorothioate linkage.
  • the antisense strand comprises four (4) phosphorothioate linkages and the sense strand comprises one (1) phosphorothioate linkage. In some embodiments, the antisense strand comprises five (5) phosphorothioate linkages and the sense strand comprises one (1) phosphorothioate linkage.
  • an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand having a sequence of any one of SEQ ID NOs: 769-1152 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1153-1536.
  • an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand having a sequence of any one of SEQ ID NOs: 1537-1570 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1573-1606.
  • an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand having a sequence of any one of SEQ ID NOs: 1609-1642 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1645-1678.
  • an oligonucleotide provided herein (e.g., and RNAi oligonucleotide) for reducing MARC1 expression comprises:
  • the MARC1-targeting dsRNAi oligonucleotides for reducing MARC1 expression comprise:
  • a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1543 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1579.
  • a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1560 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1596.
  • a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1568 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1604.
  • a MARC1 -targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1553 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1589.
  • a MARC1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 618; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 682; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 740; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 760; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 618; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 682; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 740; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 760; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 618; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 234, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 682; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 298, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 740; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 356, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 760; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 376, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 618; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 234, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strand
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 682; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 298, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strand
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 740; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 356, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strand
  • a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 760; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 376, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate
  • the current invention provides an oligonucleotide (e.g., an RNAi oligonucleotide) for reducing MARC1 expression, wherein the oligonucleotide comprises a sense strand and an antisense strand according to:
  • the current invention provides an oligonucleotide (e.g., an RNAi oligonucleotide) for reducing MARC1 expression, wherein the oligonucleotide comprises a sense strand and an antisense strand comprising nucleotide sequences selected from the group consisting of:
  • a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1615 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1651.
  • a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1632 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1668.
  • a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1640 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1676.
  • a MARC1 -targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1625 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1661.
  • oligonucleotides e.g., RNAi oligonucleotides
  • compositions comprising oligonucleotides reduce the expression of MARC1.
  • compositions can be suitably formulated such that when administered to a subject, either into the immediate environment of a target cell or systemically, a sufficient portion of the oligonucleotides enter the cell to reduce MARC1 expression.
  • suitable oligonucleotide formulations can be used to deliver oligonucleotides for the reduction of MARC1 as disclosed herein.
  • an oligonucleotide is formulated in buffer solutions such as PBS solutions, liposomes, micellar structures, and capsids. Any of the oligonucleotides described herein may be provided not only as nucleic acids, but also in the form of a pharmaceutically acceptable salt.
  • Formulations of oligonucleotides with cationic lipids can be used to facilitate transfection of the oligonucleotides into cells.
  • cationic lipids such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g., polylysine)
  • Suitable lipids include Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6 (Roche) all of which can be used according to the manufacturer’s instructions.
  • a formulation comprises a lipid nanoparticle.
  • an excipient comprises a liposome, a lipid, a lipid complex, a microsphere, a microparticle, a nanosphere or a nanoparticle, or may be otherwise formulated for administration to the cells, tissues, organs, or body of a subject in need thereof (see, e.g., Remington: THE SCIENCE AND PRACTICE OF PHARMACY, 22nd edition, Pharmaceutical Press, 2013).
  • the formulations herein comprise an excipient.
  • an excipient confers to a composition improved stability, improved absorption, improved solubility and/or therapeutic enhancement of the active ingredient.
  • an excipient is a buffering agent (e.g., sodium citrate, sodium phosphate, a tris base, or sodium hydroxide) or a vehicle (e.g., a buffered solution, petrolatum, dimethyl sulfoxide, or mineral oil).
  • a buffering agent e.g., sodium citrate, sodium phosphate, a tris base, or sodium hydroxide
  • a vehicle e.g., a buffered solution, petrolatum, dimethyl sulfoxide, or mineral oil.
  • an oligonucleotide is lyophilized for extending its shelf-life and then made into a solution before use (e.g., administration to a subject).
  • an excipient in a composition comprising any one of the oligonucleotides described herein may be a lyoprotectant (e.g., mannitol, lactose, polyethylene glycol or polyvinylpyrrolidone) or a collapse temperature modifier (e.g., dextran, FicollTM or gelatin).
  • a lyoprotectant e.g., mannitol, lactose, polyethylene glycol or polyvinylpyrrolidone
  • a collapse temperature modifier e.g., dextran, FicollTM or gelatin.
  • a pharmaceutical composition is formulated to be compatible with its intended route of administration.
  • routes of administration include parenteral (e.g., intravenous, intramuscular, intraperitoneal, intradermal, subcutaneous), oral (e.g., inhalation), transdermal (e.g., topical), transmucosal and rectal administration.
  • compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or PBS.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition.
  • Sterile injectable solutions can be prepared by incorporating the oligonucleotides in a required amount in a selected solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • a composition may contain at least about 0.1% of the therapeutic agent (e.g., a RNAi oligonucleotide for reducing MARC1 expression) or more, although the percentage of the active ingredient(s) may be between about 1% to about 80% or more of the weight or volume of the total composition.
  • the therapeutic agent e.g., a RNAi oligonucleotide for reducing MARC1 expression
  • the percentage of the active ingredient(s) may be between about 1% to about 80% or more of the weight or volume of the total composition.
  • Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
  • the current invention provides methods for contacting or delivering to a cell or population of cells an effective amount of oligonucleotides provided herein (e.g., RNAi oligonucleotides) to reduce MARC1 expression.
  • a reduction of MARC1 expression is determined by measuring a reduction in the amount or level of MARC1 mRNA, MARC1 protein, or MARC1 activity in a cell. The methods include those described herein and known to one of ordinary skill in the art.
  • a cell is any cell that expresses MARC1 mRNA (e.g., hepatocytes).
  • the cell is a primary cell obtained from a subject.
  • the primary cell has undergone a limited number of passages such that the cell substantially maintains its natural phenotypic properties.
  • a cell to which the oligonucleotide is delivered is ex vivo or in vitro (i.e., can be delivered to a cell in culture or to an organism in which the cell resides).
  • the oligonucleotides herein are delivered to a cell or population of cells using a nucleic acid delivery method known in the art including, but not limited to, injection of a solution containing the oligonucleotides, bombardment by particles covered by the oligonucleotides, exposing the cell or population of cells to a solution containing the oligonucleotides, or electroporation of cell membranes in the presence of the oligonucleotides.
  • Other methods known in the art for delivering oligonucleotides to cells may be used, such as lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection such as calcium phosphate, and others.
  • reduction of MARC1 expression is determined by an assay or technique that evaluates one or more molecules, properties, or characteristics of a cell or population of cells associated with MARC1 expression, or by an assay or technique that evaluates molecules that are directly indicative of MARC1 expression in a cell or population of cells (e.g., MARC1 mRNA or MARC1 protein).
  • the extent to which an oligonucleotide provided herein reduces MARC1 expression is evaluated by comparing MARC1 expression in a cell or population of cells contacted with the oligonucleotide to an appropriate control (e.g., an appropriate cell or population of cells not contacted with the oligonucleotide or contacted with a control oligonucleotide).
  • an appropriate control e.g., an appropriate cell or population of cells not contacted with the oligonucleotide or contacted with a control oligonucleotide.
  • a control amount or level of MARC1 expression in a control cell or population of cells is predetermined, such that the control amount or level need not be measured in every instance the assay or technique is performed.
  • the predetermined level or value can take a variety of forms. In some embodiments, a predetermined level or value can be single cut-off value, such as a median or mean.
  • contacting or delivering an oligonucleotide described herein results in a reduction in MARC1 expression in a cell or population of cells not contacted with the oligonucleotide or contacted with a control oligonucleotide.
  • the reduction in MARC1 expression is about 1% or lower, about 5% or lower, about 10% or lower, about 15% or lower, about 20% or lower, about 25% or lower, about 30% or lower, about 35% or lower, about 40% or lower, about 45% or lower, about 50% or lower, about 55% or lower, about 60% or lower, about 70% or lower, about 80% or lower, or about 90% or lower relative to a control amount or level of MARC1 expression.
  • the control amount or level of MARC1 expression is an amount or level of MARC1 mRNA and/or MARC 1 protein in a cell or population of cells that has not been contacted with an oligonucleotide herein.
  • the effect of delivery of an oligonucleotide herein to a cell or population of cells according to a method herein is assessed after any finite period or amount of time (e.g., minutes, hours, days, weeks, months).
  • MARC1 expression is determined in a cell or population of cells at least about 4 hours, about 8 hours, about 12 hours, about 18 hours, about 24 hours; or at least about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, about 56 days, about 63 days, about 70 days, about 77 days, or about 84 days or more after contacting or delivering the oligonucleotide to the cell or population of cells.
  • MARC1 expression is determined in a cell or population of cells at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, or about 6 months or more after contacting or delivering the oligonucleotide to the cell or population of cells.
  • an oligonucleotide provided herein e.g., an RNAi oligonucleotide
  • a transgene that is engineered to express in a cell the oligonucleotide or strands comprising the oligonucleotide (e.g., its sense and antisense strands).
  • an oligonucleotide herein is delivered using a transgene engineered to express any oligonucleotide disclosed herein.
  • Transgenes may be delivered using viral vectors (e.g., adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, or herpes simplex virus) or non-viral vectors (e.g., plasmids or synthetic mRNAs).
  • viral vectors e.g., adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, or herpes simplex virus
  • non-viral vectors e.g., plasmids or synthetic mRNAs.
  • transgenes can be injected directly to a subject.
  • the current invention provides oligonucleotides (e.g., RNAi oligonucleotides) for use as a medicament, in particular for use in a method for the treatment of diseases, disorders, and conditions associated with expression of MARC1.
  • oligonucleotides for use, or adaptable for use, to treat a subject (e.g., a human having a disease, disorder or condition associated with MARC1 expression) that would benefit from reducing MARC1 expression.
  • the current invention provides oligonucleotides for use, or adapted for use, to treat a subject having a disease, disorder or condition associated with expression of MARC1.
  • the current invention also provides oligonucleotides for use, or adaptable for use, in the manufacture of a medicament or pharmaceutical composition for treating a disease, disorder or condition associated with MARC1 expression.
  • the oligonucleotides for use, or adaptable for use target MARC1 mRNA and reduce MARC1 expression (e.g., via the RNAi pathway).
  • the oligonucleotides for use, or adaptable for use, target MARC1 mRNA and reduce the amount or level of MARC1 mRNA, MARC1 protein and/or MARC1 activity are examples of MARC1 mRNA, or adaptable for use, to reduce a disease, disorder or condition associated with expression of MARC1 expression.
  • a subject having a disease, disorder, or condition associated with MARC1 expression or is predisposed to the same is selected for treatment with an oligonucleotide provided herein (e.g., an RNAi oligonucleotide).
  • the method comprises selecting an individual having a marker (e.g., a biomarker) for a disease, disorder, or condition associated with MARC1 expression or predisposed to the same, such as, but not limited to, MARC1 mRNA, MARC1 protein, or a combination thereof.
  • some embodiments of the methods provided by the current invention include steps such as measuring or obtaining a baseline value for a marker of MARC1 expression (e.g., MARC1 mRNA), and then comparing such obtained value to one or more other baseline values or values obtained after the subject is administered the oligonucleotide to assess the effectiveness of treatment.
  • a marker of MARC1 expression e.g., MARC1 mRNA
  • the current invention also provides methods of treating a subject having, suspected of having, or at risk of developing a disease, disorder or condition associated with MARC1 expression with an oligonucleotide provided herein.
  • the current invention provides methods of treating or attenuating the onset or progression of a disease, disorder or condition associated with MARC1 expression using the oligonucleotides herein.
  • the current invention provides methods to achieve one or more therapeutic benefits in a subject having a disease, disorder, or condition associated with MARC1 expression using the oligonucleotides provided herein.
  • the subject is treated by administering a therapeutically effective amount of any one or more of the oligonucleotides provided herein.
  • treatment comprises reducing MARC1 expression.
  • the subject is treated therapeutically.
  • the subject is treated prophylactically.
  • one or more oligonucleotides herein e.g., RNAi oligonucleotides
  • a pharmaceutical composition comprising one or more oligonucleotides
  • an amount or level of MARC1 mRNA is reduced in the subject.
  • an amount or level of MARC 1 protein is reduced in the subject.
  • an amount or level of MARC1 activity is reduced in the subject.
  • an oligonucleotide provided herein e.g., an RNAi oligonucleotide
  • a pharmaceutical composition comprising the oligonucleotide is administered to a subject having a disease, disorder or condition associated with MARC1 such that MARC1 expression is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to MARC1 expression prior to administration of one or more oligonucleotides or pharmaceutical composition.
  • MARC1 expression is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to MARC1 expression in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or oligonucleotides or pharmaceutical composition or receiving a control oligonucleotide or oligonucleotides, pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • an oligonucleotide or oligonucleotides herein e.g., RNAi oligonucleotides
  • a pharmaceutical composition comprising the oligonucleotide or oligonucleotides
  • a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of MARC1 mRNA is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of MARC1 mRNA prior to administration of the oligonucleotide or pharmaceutical composition.
  • an amount or level of MARC1 mRNA is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of MARC1 mRNA in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or oligonucleotides or pharmaceutical composition or receiving a control oligonucleotide or oligonucleotides, pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • an oligonucleotide or oligonucleotides herein, or a pharmaceutical composition comprising the oligonucleotide or oligonucleotides is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of MARC1 protein is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of MARC1 protein prior to administration of the oligonucleotide or pharmaceutical composition.
  • an amount or level of MARC1 protein is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of MARC1 protein in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or oligonucleotides or pharmaceutical composition or receiving a control oligonucleotide, oligonucleotides or pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • an oligonucleotide or oligonucleotides e.g., RNAi oligonucleotides
  • a pharmaceutical composition comprising the oligonucleotide or oligonucleotides
  • a subject having a disease, disorder or condition associated with MARC1 such that an amount or level of MARC1 gene activity/expression is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of MARC1 activity prior to administration of the oligonucleotide or pharmaceutical composition.
  • an amount or level of MARC1 activity is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of MARC1 activity in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • Suitable methods for determining MARC1 expression, the amount or level of MARC1 mRNA, MARC1 protein, MARC1 activity, or a biomarker related to or affected by modulation of MARC1 expression e.g., a plasma biomarker
  • a biomarker related to or affected by modulation of MARC1 expression e.g., a plasma biomarker
  • the Examples set forth herein illustrate methods for determining MARC1 expression.
  • MARC1 expression, the amount or level of MARC1 mRNA, MARC1 protein, MARC1 activity, or a biomarker related to or affected by modulation of MARC1 expression, or any combination thereof is reduced in a cell (e.g., a hepatocyte), a population or a group of cells (e.g., an organoid), an organ (e.g., liver), blood or a fraction thereof (e.g., plasma), a tissue (e.g., liver tissue), a sample (e.g., a liver biopsy sample), or any other appropriate biological material obtained or isolated from the subject.
  • a cell e.g., a hepatocyte
  • a population or a group of cells e.g., an organoid
  • an organ e.g., liver
  • blood or a fraction thereof e.g., plasma
  • tissue e.g., liver tissue
  • sample e.g., a liver biopsy sample
  • MARC1 expression, the amount or level of MARC1 mRNA, MARC1 protein, MARC1 activity, or a biomarker related to or affected by modulation of MARC1 expression, or any combination thereof is reduced in more than one type of cell (e.g., a hepatocyte and one or more other type(s) of cell), more than one groups of cells, more than one organ (e.g., liver and one or more other organ(s)), more than one fraction of blood (e.g., plasma and one or more other blood fraction(s)), more than one type of tissue (e.g., liver tissue and one or more other type(s) of tissue), or more than one type of sample (e.g., a liver biopsy sample and one or more other type(s) of biopsy sample).
  • a hepatocyte and one or more other type(s) of cell e.g., a hepatocyte and one or more other type(s) of cell
  • more than one groups of cells e.g., more than one organ (e
  • the oligonucleotides provided herein specifically target mRNA of target genes (e.g., MARC1 mRNA) of cells and tissue(s), or organs(s) (e.g., in the liver).
  • target genes e.g., MARC1 mRNA
  • the target gene may be one which is required for initiation or maintenance of the disease or which has been identified as being associated with a higher risk of contracting the disease.
  • the oligonucleotide can be brought into contact with the cells, tissue(s), or organ(s) (e.g., liver) exhibiting or responsible for mediating the disease.
  • an oligonucleotide substantially identical to all or part of a wild-type (i.e., native) or mutated gene associated with a disorder or condition associated with MARC1 expression may be brought into contact with or introduced into a cell or tissue type of interest such as a hepatocyte or other liver cell.
  • a wild-type i.e., native
  • mutated gene associated with a disorder or condition associated with MARC1 expression may be brought into contact with or introduced into a cell or tissue type of interest such as a hepatocyte or other liver cell.
  • Examples of a disease, disorder or condition associated with MARC1 expression include, but are not limited to non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis (ASH), or metabolic syndrome.
  • NAFLD non-alcoholic fatty liver disease
  • NASH non-alcoholic steatohepatitis
  • ASH alcoholic steatohepatitis
  • metabolic syndrome e.g., MARC1 expression of MARC1 expression
  • the disease is NAFLD.
  • the disease is NASH.
  • the disease is ASH.
  • an amount or level of liver steatosis is reduced in a subject. In some embodiments, an amount or level of liver fibrosis is reduced in a subject. In some embodiments, an amount or level of cholesterol is reduced in a subject. In some embodiments, an amount or level of triglyceride is reduced in a subject. In some embodiments, an amount or level of alanine aminotransferase is reduced in a subject. In some embodiments, an amount or level of aspartate aminotransferase is reduced in a subject.
  • any combination of the following is reduced or altered in the subject: MARC1 expression, an amount or level of MARC1 mRNA, an amount or level of MARC 1 protein, an amount or level of MARC1 activity, an amount or level of TG, an amount or level of cholesterol and/or the ratio of total cholesterol to HDL cholesterol, an amount or level of liver steatosis, an amount or level of liver fibrosis, an amount of level of alanine aminotransferase, and an amount of level of aspartate aminotransferase.
  • an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of liver fibrosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of liver fibrosis prior to administration of the oligonucleotide or pharmaceutical composition.
  • an amount or level of liver fibrosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of liver fibrosis in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of liver steatosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of liver steatosis prior to administration of the oligonucleotide or pharmaceutical composition.
  • an amount or level of liver steatosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of liver steatosis in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of alanine aminotransferase is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of alanine aminotransferase prior to administration of the oligonucleotide or pharmaceutical composition.
  • an amount or level of alanine aminotransferase is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of alanine aminotransferase in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of aspartate aminotransferase is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of aspartate aminotransferase prior to administration of the oligonucleotide or pharmaceutical composition.
  • an amount or level of aspartate aminotransferase is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of aspartate aminotransferase in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of triglyceride is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of triglyceride prior to administration of the oligonucleotide or pharmaceutical composition.
  • an amount or level of triglyceride is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of triglyceride in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of cholesterol (e.g., total cholesterol, LDL cholesterol, and/or HDL cholesterol) is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of cholesterol prior to administration of the oligonucleotide or pharmaceutical composition.
  • a disease, disorder or condition associated with MARC1 expression such that an amount or level of cholesterol (e.g., total cholesterol, LDL cholesterol, and/or HDL cholesterol) is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 7
  • an amount or level of cholesterol is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of cholesterol in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • a subject e.g., a reference or control subject
  • the target gene may be a target gene from any mammal, such as a human target. Any target gene may be silenced according to the method described herein.
  • Methods described herein typically involve administering to a subject an effective amount of an oligonucleotide herein (e.g., a RNAi oligonucleotide), that is, an amount that produces or generates a desirable therapeutic result.
  • a therapeutically acceptable amount may be an amount that therapeutically treats a disease or disorder.
  • the appropriate dosage for any one subject will depend on certain factors, including the subject’s size, body surface area, age, the composition to be administered, the active ingredient(s) in the composition, time and route of administration, general health, and other drugs being administered concurrently.
  • a subject is administered any one of the compositions herein (e.g., a composition comprising an RNAi oligonucleotide described herein) either enterally (e.g., orally, by gastric feeding tube, by duodenal feeding tube, via gastrostomy or rectally), parenterally (e.g., subcutaneous injection, intravenous injection or infusion, intra-arterial injection or infusion, intraosseous infusion, intramuscular injection, intracerebral injection, intracerebroventricular injection, intrathecal), topically (e.g., epicutaneous, inhalational, via eye drops, or through a mucous membrane), or by direct injection into a target organ (e.g., the liver of a subject).
  • oligonucleotides herein are administered intravenously or subcutaneously.
  • an oligonucleotide herein e.g., an RNAi oligonucleotide
  • a pharmaceutical composition comprising the oligonucleotide is administered alone or in combination.
  • the oligonucleotides herein are administered in combination concurrently, sequentially (in any order), or intermittently.
  • two oligonucleotides may be co-administered concurrently.
  • one oligonucleotide may be administered and followed any amount of time later (e.g., one hour, one day, one week or one month) by the administration of a second oligonucleotide.
  • the subject to be treated is a human or non-human primate or other mammalian subject.
  • Other exemplary subjects include domesticated animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and animals such as mice, rats, guinea pigs, and hamsters.
  • the current invention provides a kit comprising an oligonucleotide herein (e.g., an RNAi oligonucleotide), and instructions for use.
  • the kit comprises an oligonucleotide herein, and a package insert containing instructions for use of the kit and/or any component thereof.
  • the kit comprises, in a suitable container, an oligonucleotide herein, one or more controls, and various buffers, reagents, enzymes and other standard ingredients well known in the art.
  • the container comprises at least one vial, well, test tube, flask, bottle, syringe, or other container means, into which the oligonucleotide is placed, and in some instances, suitably aliquoted.
  • the kit contains additional containers into which this component is placed.
  • the kits can also include a means for containing the oligonucleotide and any other reagent in close confinement for commercial sale.
  • Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.
  • Containers and/or kits can include labeling with instructions for use and/or warnings.
  • a kit comprises an oligonucleotide herein (e.g., an RNAi oligonucleotide), and a pharmaceutically acceptable carrier, or a pharmaceutical composition comprising the oligonucleotide and instructions for treating or delaying progression of a disease, disorder or condition associated with MARC1 expression in a subject in need thereof.
  • an oligonucleotide herein e.g., an RNAi oligonucleotide
  • a pharmaceutically acceptable carrier e.g., a pharmaceutically acceptable carrier
  • a pharmaceutical composition comprising the oligonucleotide and instructions for treating or delaying progression of a disease, disorder or condition associated with MARC1 expression in a subject in need thereof.
  • antisense oligonucleotide encompasses a nucleic acid-based molecule which has a sequence complementary to all or part of the target mRNA, in particular seed sequence thereby capable of forming a duplex with a mRNA.
  • antisense oligonucleotide may be referred to as “complementary nucleic acid-based inhibitor”.
  • administer refers to providing a substance (e.g., an oligonucleotide) to a subject in a manner that is pharmacologically useful (e.g., to treat a disease, disorder, or condition in the subject).
  • a substance e.g., an oligonucleotide
  • Attenuate refers to reducing or effectively halting.
  • one or more of the treatments herein may reduce or effectively halt the onset or progression of NAFLD or NASH in a subject.
  • This attenuation may be exemplified by, for example, a decrease in one or more aspects (e.g., symptoms, tissue characteristics, and cellular, inflammatory, or immunological activity, etc.) of NAFLD, NASH, or ASH, no detectable progression (worsening) of one or more aspects of fatty liver disease, or no detectable aspects of NAFLD, NASH, or ASH) in a subject when they might otherwise be expected.
  • aspects e.g., symptoms, tissue characteristics, and cellular, inflammatory, or immunological activity, etc.
  • complementary refers to a structural relationship between two nucleotides (e.g., on two opposing nucleic acids or on opposing regions of a single nucleic acid strand) that permits the two nucleotides to form base pairs with one another.
  • a purine nucleotide of one nucleic acid that is complementary to a pyrimidine nucleotide of an opposing nucleic acid may base pair together by forming hydrogen bonds with one another.
  • complementary nucleotides can base pair in the Watson-Crick manner or in any other manner that allows for the formation of stable duplexes.
  • two nucleic acids may have regions of multiple nucleotides that are complementary with each other to form regions of complementarity, as described herein.
  • deoxyribonucleotide refers to a nucleotide having a hydrogen in place of a hydroxyl at the 2′ position of its pentose sugar when compared with a ribonucleotide.
  • a modified deoxyribonucleotide is a deoxyribonucleotide having one or more modifications or substitutions of atoms other than at the 2′ position, including modifications or substitutions in or of the sugar, phosphate group or base.
  • double-stranded oligonucleotide or “ds oligonucleotide” refers to an oligonucleotide that is substantially in a duplex form.
  • the complementary base-pairing of duplex region(s) of a double-stranded oligonucleotide is formed between antiparallel sequences of nucleotides of covalently separate nucleic acid strands.
  • complementary base-pairing of duplex region(s) of a double-stranded oligonucleotide is formed between antiparallel sequences of nucleotides of nucleic acid strands that are covalently linked.
  • complementary base-pairing of duplex region(s) of a double-stranded oligonucleotide is formed from single nucleic acid strand that is folded (e.g., via a hairpin) to provide complementary antiparallel sequences of nucleotides that base pair together.
  • a double-stranded oligonucleotide comprises two covalently separate nucleic acid strands that are fully duplexed with one another.
  • a double-stranded oligonucleotide comprises two covalently separate nucleic acid strands that are partially duplexed (e.g., having overhangs at one or both ends).
  • a double-stranded oligonucleotide comprises antiparallel sequence of nucleotides that are partially complementary, and thus, may have one or more mismatches, which may include internal mismatches or end mismatches.
  • duplex in reference to nucleic acids (e.g., oligonucleotides), refers to a structure formed through complementary base pairing of two antiparallel sequences of nucleotides.
  • excipient refers to a non-therapeutic agent that may be included in a composition, for example, to provide or contribute to a desired consistency or stabilizing effect.
  • hepatocyte refers to cells of the parenchymal tissues of the liver. These cells make up about 70%-85% of the liver’s mass and manufacture serum albumin, FBN and the prothrombin group of clotting factors (except for Factors 3 and 4). Markers for hepatocyte lineage cells include, but are not limited to, transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor 1a (Hnfla) and hepatocyte nuclear factor 4a (Hnf4a).
  • Ttr transthyretin
  • Glul glutamine synthetase
  • Hnfla hepatocyte nuclear factor 1a
  • Hnf4a hepatocyte nuclear factor 4a
  • Markers for mature hepatocytes may include, but are not limited to, cytochrome P450 (Cyp3a11), fumarylacetoacetate hydrolase (Fah), glucose 6-phosphate (G6p), albumin (Alb) and OC2-2F8. See, e.g., Huch et al. (2013) NATURE 494:247-50.
  • hepatotoxic agent refers to a chemical compound, virus or other substance that is itself toxic to the liver or can be processed to form a metabolite that is toxic to the liver.
  • Hepatotoxic agents may include, but are not limited to, carbon tetrachloride (CCl 4 ), acetaminophen (paracetamol), vinyl chloride, arsenic, chloroform, nonsteroidal antiinflammatory drugs (such as aspirin and phenylbutazone).
  • MARC1 Mitochondrial Amidoxime Reducing Component 1.
  • MARC1 is a protein which catalyzes the reduction of molecules.
  • MARC1 may also refer to the gene which encodes the protein.
  • labile linker refers to a linker that can be cleaved (e.g., by acidic pH).
  • a “stable linker” refers to a linker that cannot be cleaved.
  • liver inflammation refers to a physical condition in which the liver becomes swollen, dysfunctional and/or painful, especially as a result of injury or infection, as may be caused by exposure to a hepatotoxic agent. Symptoms may include jaundice (yellowing of the skin or eyes), fatigue, weakness, nausea, vomiting, appetite reduction and weight loss. Liver inflammation, if left untreated, may progress to fibrosis, cirrhosis, liver failure or liver cancer.
  • liver fibrosis “Liver Fibrosis” or “fibrosis of the liver” refers to an excessive accumulation in the liver of extracellular matrix proteins, which could include collagens (I, III, and IV), FBN, undulin, elastin, laminin, hyaluronan and proteoglycans resulting from inflammation and liver cell death. Liver fibrosis, if left untreated, may progress to cirrhosis, liver failure or liver cancer.
  • loop refers to an unpaired region of a nucleic acid (e.g., oligonucleotide) that is flanked by two antiparallel regions of the nucleic acid that are sufficiently complementary to one another, such that under appropriate hybridization conditions (e.g., in a phosphate buffer, in a cell), the two antiparallel regions, which flank the unpaired region, hybridize to form a duplex (referred to as a “stem”).
  • a nucleic acid e.g., oligonucleotide
  • modified internucleotide linkage refers to an internucleotide linkage having one or more chemical modifications when compared with a reference internucleotide linkage comprising a phosphodiester bond.
  • a modified nucleotide is a non-naturally occurring linkage.
  • a modified internucleotide linkage confers one or more desirable properties to a nucleic acid in which the modified internucleotide linkage is present.
  • a modified internucleotide linkage may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, reduced immunogenicity, etc.
  • modified nucleotide refers to a nucleotide having one or more chemical modifications when compared with a corresponding reference nucleotide selected from: adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide and thymidine deoxyribonucleotide.
  • a modified nucleotide is a non-naturally occurring nucleotide.
  • a modified nucleotide has one or more chemical modification in its sugar, nucleobase and/or phosphate group. In some embodiments, a modified nucleotide has one or more chemical moieties conjugated to a corresponding reference nucleotide. Typically, a modified nucleotide confers one or more desirable properties to a nucleic acid in which the modified nucleotide is present. For example, a modified nucleotide may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, reduced immunogenicity, etc.
  • RNAi oligonucleotide that is characterized by separate sense (passenger) and antisense (guide) strands, in which the sense strand has a region of complementarity with the antisense strand, and in which at least one of the strands, generally the sense strand, has a tetraloop configured to stabilize an adjacent stem region formed within the at least one strand.
  • oligonucleotide refers to a short nucleic acid (e.g., less than about 100 nucleotides in length).
  • An oligonucleotide may be single-stranded (ss) or ds.
  • An oligonucleotide may or may not have duplex regions.
  • an oligonucleotide may be, but is not limited to, a small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), dicer substrate interfering RNA (DsiRNA), antisense oligonucleotide, short siRNA or ss siRNA.
  • a double-stranded (dsRNA) is an RNAi oligonucleotide.
  • overhang refers to terminal non-base pairing nucleotide(s) resulting from one strand or region extending beyond the terminus of a complementary strand with which the one strand or region forms a duplex.
  • an overhang comprises one or more unpaired nucleotides extending from a duplex region at the 5′ terminus or 3′ terminus of an oligonucleotide.
  • the overhang is a 3′- or 5′-overhang on the antisense strand or sense strand of an oligonucleotide.
  • phosphate analog refers to a chemical moiety that mimics the electrostatic and/or steric properties of a phosphate group. In some embodiments, the phosphate analog mimics the electrostatic and/or steric properties of a phosphate group in biologic systems. In some embodiments, a phosphate analog is positioned at the 5′-terminal nucleotide of an oligonucleotide in place of a 5′-phosphate, which is often susceptible to enzymatic removal. In some embodiments, a 5′-phosphate analog contains a phosphatase-resistant linkage.
  • phosphate analogs include, but are not limited to, 5′-phosphonates, such as 5′-methylene phosphonate (5′-MP) and 5′-(E)-vinylphosphonate (5′-VP).
  • an oligonucleotide has a phosphate analog at a 4′-carbon position of the sugar (referred to as a “4′-phosphate analog”) at a 5′-terminal nucleotide.
  • An example of a 4′-phosphate analog is oxymethyl phosphonate, in which the oxygen atom of the oxymethyl group is bound to the sugar moiety (e.g., at its 4′-carbon) or analog thereof. See, e.g., U.S. Pat. Publication No.
  • reduced expression of a gene refers to a decrease in the amount or level of RNA transcript (e.g., MARC1 mRNA) or protein encoded by the gene and/or a decrease in the amount or level of activity of the gene in a cell, a population of cells, a sample, or a subject, when compared to an appropriate reference (e.g., a reference cell, population of cells, sample or subject).
  • an appropriate reference e.g., a reference cell, population of cells, sample or subject.
  • the act of contacting a cell with an oligonucleotide herein may result in a decrease in the amount or level of MARC1 mRNA, protein and/or activity (e.g., via degradation of MARC1 mRNA by the RNAi pathway) when compared to a cell that is not treated with the oligonucleotide.
  • reducing expression refers to an act that results in reduced expression of a gene (e.g., MARC1).
  • “reduction of MARC1 expression” refers to a decrease in the amount or level of MARC1 mRNA, MARC1 protein and/or MARC1 activity in a cell, a population of cells, a sample or a subject when compared to an appropriate reference (e.g., a reference cell, population of cells, sample, or subject).
  • region of complementarity refers to a sequence of nucleotides of a nucleic acid (e.g., an oligonucleotide) that is sufficiently complementary to an antiparallel sequence of nucleotides to permit hybridization between the two sequences of nucleotides under appropriate hybridization conditions (e.g., in a phosphate buffer, in a cell, etc.).
  • an oligonucleotide herein comprises a targeting sequence having a region of complementary to a mRNA target sequence.
  • ribonucleotide refers to a nucleotide having a ribose as its pentose sugar, which contains a hydroxyl group at its 2′ position.
  • a modified ribonucleotide is a ribonucleotide having one or more modifications or substitutions of atoms other than at the 2′ position, including modifications or substitutions in or of the ribose, phosphate group or base.
  • RNAi oligonucleotide refers to either (a) a double-stranded oligonucleotide having a sense strand (passenger) and antisense strand (guide), in which the antisense strand or part of the antisense strand is used by the Argonaute 2 (Ago2) endonuclease in the cleavage of a target mRNA (e.g., MARC1 mRNA) or (b) a single-stranded oligonucleotide having a single antisense strand, where that antisense strand (or part of that antisense strand) is used by the Ago2 endonuclease in the cleavage of a target mRNA (e.g., MARC1 mRNA).
  • a target mRNA e.g., MARC1 mRNA
  • strand refers to a single, contiguous sequence of nucleotides linked together through internucleotide linkages (e.g., phosphodiester linkages or phosphorothioate linkages). In some embodiments, a strand has two free ends (e.g., a 5′ end and a 3′ end).
  • subject means any mammal, including mice, rabbits, and humans. In one embodiment, the subject is a human or NHP. Moreover, “individual” or “patient” may be used interchangeably with “subject.”
  • “synthetic” refers to a nucleic acid or other molecule that is artificially synthesized (e.g., using a machine (e.g., a solid-state nucleic acid synthesizer)) or that is otherwise not derived from a natural source (e.g., a cell or organism) that normally produces the molecule.
  • targeting ligand refers to a molecule (e.g., a carbohydrate, amino sugar, cholesterol, polypeptide, or lipid) that selectively binds to a cognate molecule (e.g., a receptor) of a tissue or cell of interest and that is conjugatable to another substance for purposes of targeting the other substance to the tissue or cell of interest.
  • a targeting ligand may be conjugated to an oligonucleotide for purposes of targeting the oligonucleotide to a specific tissue or cell of interest.
  • a targeting ligand selectively binds to a cell surface receptor.
  • a targeting ligand when conjugated to an oligonucleotide facilitates delivery of the oligonucleotide into a particular cell through selective binding to a receptor expressed on the surface of the cell and endosomal internalization by the cell of the complex comprising the oligonucleotide, targeting ligand and receptor.
  • a targeting ligand is conjugated to an oligonucleotide via a linker that is cleaved following or during cellular internalization such that the oligonucleotide is released from the targeting ligand in the cell.
  • the targeting ligand comprises at least one GalNAc moiety and targets the liver and human liver cells (e.g., human hepatocytes).
  • tetraloop refers to a loop that increases stability of an adjacent duplex formed by hybridization of flanking sequences of nucleotides.
  • the increase in stability is detectable as an increase in melting temperature (T m ) of an adjacent stem duplex that is higher than the T m of the adjacent stem duplex expected, on average, from a set of loops of comparable length consisting of randomly selected sequences of nucleotides.
  • T m melting temperature
  • a tetraloop can confer a T m of at least about 50° C., at least about 55° C., at least about 56° C., at least about 58° C., at least about 60° C., at least about 65° C., or at least about 75° C.
  • a tetraloop can confer a Tm of at least about 50° C., at least about 55° C., at least about 56° C., at least about 58° C., at least about 60° C., at least about 65° C., or at least about 75° C. in 10 mM NaH 2 PO 4 to a hairpin comprising a duplex of at least 2 base pairs (bp) in length.
  • a tetraloop may stabilize a bp in an adjacent stem duplex by stacking interactions.
  • a tetraloop comprises or consists of 3 to 6 nucleotides and is typically 4 to 5 nucleotides.
  • a tetraloop comprises or consists of 3, 4, 5, or 6 nucleotides, which may or may not be modified (e.g., which may or may not be conjugated to a targeting moiety).
  • a tetraloop consists of 4 nucleotides. Any nucleotide may be used in the tetraloop and standard IUPAC-IUB symbols for such nucleotides may be used as described in Cornish-Bowden (1985) NUCLEIC ACIDS RES. 13:3021-30.
  • the letter “N” may be used to mean that any base may be in that position
  • the letter “R” may be used to show that A (adenine) or G (guanine) may be in that position
  • “B” may be used to show that C (cytosine), G (guanine), or T (thymine) may be in that position.
  • tetraloops include the UNCG family of tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g., GAAA), and the CUUG tetraloop (Woese et al. (1990) PROC. NATL. ACAD. SCI. USA 87:8467-71; Antao et al. (1991) NUCLEIC ACIDS RES. 19:5901-05).
  • UUCG UUCG
  • GNRA GNRA
  • GAAA GNRA family of tetraloops
  • CUUG tetraloop Wiese et al. (1990) PROC. NATL. ACAD. SCI. USA 87:8467-71
  • DNA tetraloops include the d(GNNA) family of tetraloops (e.g., d(GTTA), the d(GNRA)) family of tetraloops, the d(GNAB) family of tetraloops, the d(CNNG) family of tetraloops, and the d(TNCG) family of tetraloops (e.g., d(TTCG)).
  • d(GNNA) family of tetraloops e.g., d(GTTA), the d(GNRA) family of tetraloops, the d(GNAB) family of tetraloops, the d(CNNG) family of tetraloops, and the d(TNCG) family of tetraloops (e.g., d(TTCG)
  • d(GNNA) d(GTTA)
  • d(GNRA) d(GNAB) family of tetraloops
  • treat or “treating” refers to the act of providing care to a subject in need thereof, for example, by administering a therapeutic agent (e.g., an oligonucleotide herein) to the subject, for purposes of improving the health and/or well-being of the subject with respect to an existing condition (e.g., a disease, disorder) or to prevent or decrease the likelihood of the occurrence of a condition.
  • a therapeutic agent e.g., an oligonucleotide herein
  • treatment involves reducing the frequency or severity of at least one sign, symptom or contributing factor of a condition (e.g., disease, disorder) experienced by a subject.
  • dsRNA double-stranded RNAi
  • dsRNAi oligonucleotides were chemically synthesized using methods described herein.
  • dsRNAi oligonucleotides were synthesized using solid phase oligonucleotide synthesis methods as described for 19-23mer siRNAs (see, e.g., Scaringe et al. (1990) Nucleic Acids Res. 18:5433-5441 and Usman et al. (1987) J. Am. Chem. Soc. 109:7845-7845; see also, US Pats.
  • dsRNAi oligonucleotides having a 19mer core sequence were formatted into constructs having a 25mer sense strand and a 27mer antisense strand to allow for processing by the RNAi machinery.
  • the 19mer core sequence is complementary to a region in the MARC1 mRNA.
  • RNA oligonucleotides were synthesized and HPLC purified according to standard methods (Integrated DNA Technologies; Coralville, IA). For example, RNA oligonucleotides were synthesized using solid phase phosphoramidite chemistry, deprotected and desalted on NAP-5 columns (Amersham Pharmacia Biotech; Piscataway, NJ) using standard techniques (Damha & Olgivie (1993) Methods Mol. Biol. 20:81-114; Wincott et al. (1995) Nucleic Acids Res. 23:2677-2684).
  • the oligomers were purified using ion-exchange high performance liquid chromatography (IE-HPLC) on an Amersham Source 15Q column (1.0 cm ⁇ 25 cm; Amersham Pharmacia Biotech) using a 15 min. step-linear gradient. The gradient varied from 90:10 Buffers A:B to 52:48 Buffers A:B, where Buffer A is 100 mM Tris pH 8.5 and Buffer B is 100 mM Tris pH 8.5, 1 M NaCl. Samples were monitored at 260 nm and peaks corresponding to the full-length oligonucleotide species were collected, pooled, desalted on NAP-5 columns, and lyophilized. Single strand RNA oligomers were stored lyophilized or in nuclease-free water at -80° C.
  • IE-HPLC ion-exchange high performance liquid chromatography
  • each oligomer was determined by capillary electrophoresis (CE) on a Beckman PACE 5000 (Beckman Coulter, Inc.; Fullerton, CA).
  • the CE capillaries have a 100 ⁇ m inner diameter and contain ssDNA 100R Gel (Beckman-Coulter).
  • ssDNA 100R Gel (Beckman-Coulter).
  • about 0.6 nmole of oligonucleotide was injected into a capillary, run in an electric field of 444 V/cm and was detected by UV absorbance at 260 nm.
  • Denaturing Tris-Borate-7 M-urea running buffer was purchased from Beckman-Coulter. Oligoribonucleotides were obtained that were at least 90% pure as assessed by CE for use in experiments described below.
  • RNA oligomers Single strand RNA oligomers were resuspended (e.g., at 100 ⁇ M concentration) in duplex buffer consisting of 100 mM potassium acetate, 30 mM HEPES, pH 7.5. Complementary sense and antisense strands were mixed in equal molar amounts to yield a final solution of, for example, 50 ⁇ M duplex. Samples were heated to 100° C. for 5 min. in RNA buffer (Integrated DNA Technologies (IDT)) and were allowed to cool to room temperature before use. The dsRNA oligonucleotides were stored at -20° C.
  • RNA buffer Integrated DNA Technologies (IDT)
  • MARC1 is an enzyme involved in catalyzing N-oxygenated molecules.
  • a computer-based algorithm was used to computationally identify MARC1 mRNA target sequences suitable for assaying inhibition of MARC1 expression by the RNAi pathway.
  • the algorithm provided RNAi oligonucleotide guide (antisense) strand sequences each having a region of complementarity to a suitable MARC1 target sequence of human MARC1 mRNA (e.g., SEQ ID NO: 1692; Table 1). Some of the guide strand sequences identified by the algorithm were also complementary to the corresponding MARC1 target sequence of monkey MARC1 mRNA (SEQ ID NO: 1693 Table 1).
  • MARC1 RNAi oligonucleotides comprising a region of complementarity to homologous MARC1 mRNA target sequences with nucleotide sequence similarity are predicted to have the ability to target homologous MARC1 mRNAs.
  • each of the modified DsiRNA in Table 2 was measured using in vitro cell-based assays. Briefly, human hepatocyte (Huh7) cells expressing endogenous human MARC1 gene were transfected with each of the DsiRNAs listed in Table 2 at 1 nM in separate wells of a multi-well cell-culture plate. Cells were maintained for 24 hours following transfection with the modified DsiRNA, and then the amount of remaining MARC1 mRNA from the transfected cells was determined using TAQMAN®-based qPCR assays.
  • Each primer pair was assayed for % remaining RNA as shown in Table 2 and FIG. 1 .
  • DsiRNAs resulting in less than or equal to 10% MARC1 mRNA remaining in DsiRNA-transfected cells when compared to mock-transfected cells were considered DsiRNA “hits”.
  • the Huh7 cell-based assay evaluating the ability of the DsiRNAs listed in Table 2 to inhibit MARC1 expression identified several candidate DsiRNAs.
  • Example 2 validated the ability of MARC1-targeting oligonucleotides to knock-down target mRNA.
  • an HDI mouse model was used.
  • RNAi oligonucleotides comprising a nicked tetraloop GalNAc-conjugated structure (referred to herein as “GalNAc-conjugated MARC1 oligonucleotides” or “GalNAc-MARC1 oligonucleotides”) having a 36-mer passenger strand and a 22-mer guide strand (Table 4).
  • nucleotide sequences comprising the passenger strand and guide strand have a distinct pattern of modified nucleotides and phosphorothioate linkages (sense strand SEQ ID Nos: 1609-1642; antisense SEQ ID Nos: 1645-1678).
  • sense strand SEQ ID Nos: 1609-1642; antisense SEQ ID Nos: 1645-1678 Three of the nucleotides comprising the tetraloop were each conjugated to a GalNAc moiety (CAS#14131-60-3). The modification pattern of each strand is illustrated below:
  • Modification key Symbol Modification/linkage Key 1 mX 2′-O-methyl modified nucleotide fX 2′-fluoro modified nucleotide -S- phosphorothioate linkage – phosphodiester linkage [MePhosphonate-4O-mX] 5′-methoxyphosphonate-4′-oxy modified nucleotide ademA-GalNAc GalNAc attached to an adenine nucleotide Key 2 [mXs] 2′-O-methyl modified nucleotide with a phosphorothioate linkage to the neighboring nucleotide [fXs] 2′-fluoro modified nucleotide with a phosphorothioate linkage to the neighboring nucleotide [mX] 2′-O-methyl modified nucleotide with phosphodiester linkages to neighboring nucleotides [fX] 2′-fluoro modified nucleotide with phosphodiester linkages to neighboring
  • CMV ubiquitous cytomegalovirus
  • RNA derived from these HDI mice were subjected to qRT-PCR analysis to determine MARC1 mRNA levels as described in Example 2. mRNA levels were measured for human mRNA. The values were normalized for transfection efficiency using the NeoR gene included on the DNA plasmid.
  • results in FIG. 2 demonstrate that GalNAc-conjugated MARC1 oligonucleotides designed to target human MARC1 mRNA inhibited human MARC1 mRNA expression in HDI mice, as determined by a reduction in the amount of human MARC1 mRNA expression in liver samples from HDI mice treated with GalNAc-conjugated MARC1 oligonucleotides relative to control HDI mice treated with only PBS.
  • a subset of the GalNAc-conjugated MARC1 oligonucleotides tested in FIG. 2 were further validated in repeat assays as shown in FIG. 3 using oligonucleotides selected from Table 4.
  • the assays verified knock-down efficiency of each GalNAc-conjugated MARC1 oligonucleotide, and four oligonucleotides were selected for further analysis.
  • mice were fed Lean Chow (11% fat, 24% protein, and 65% carbohydrate; Altromin 1324, Brogaarden, Denmark), or a NASH diet consisting of 40% fat, 22% fructose and 2% cholesterol (D09100310, Research Diets) for 36 weeks (DIO-NASH).
  • Prior to treatment with oligonucleotides and the GLP-1 receptor agonist mice were randomized into chow control, PBS control, GLP-1 ‘22’, MARC1-1113 (SEQ ID NOs: 1643 and 1679), and MARC1-1575 (SEQ ID NOs: 1644 and 1680) treatment groups by their fibrosis state as determined by Collal, i.e., collagen, levels (data not shown).
  • GLP-1 receptor agonist (GLP-1 ‘22’) is a long acting GLP-1 receptor agonist and used as a benchmark in these studies. Injections were given on days 0, 7, 14, 21, 28, 35, 42, and 49 after initiation of the study (i.e. week 36 on DIO-NASH or Lean Chow diet).
  • the DIO-NASH vehicle control, MARC1-1113, and MARC1-1575 mice increased their relative body weight at similar pace throughout the duration of the study (Table 5A). As expected, the Lean-Chow showed a slower rate of body weight gain, while GLP-1 ‘22’ controls showed a reduction in relative body weight to the start of the study.
  • Table 5A provides the body weight of mice throughout treatment with GalNAc-conjugated MARC1 oligonucleotides targeting mouse MARC1 or a long acting GLP-1 receptor against (GLP-1 ‘22’) used as positive control for disease regression in a diet induced obesity (DIO) - NASH model. Weights are relative to starting weight. Mice were fed a DIO-NASH (AMLN diet) or Lean-Chow diet.
  • DIO-NASH AMLN diet
  • Lean-Chow diet Lean-Chow diet.
  • ALT plasma alanine aminotransferase
  • AST aspartate aminotransferase
  • TG triglyceride
  • TC total cholesterol
  • liver weight was lower in both Lean Chow mice and DIO-NASH mice treated with GLP-1 ‘22’ at termination of the study compared to the NASH vehicle group.
  • TG levels were reduced in both MARC1-1113 and MARC1-1575 treated mice compared to DIO-NASH vehicle control ( FIGS. 5 and 6 ).
  • NAFLD activity was measured.
  • the NAFLD activity score is used to measure changes in disease features concurrent with treatment for NAFLD and is measured by staining liver samples and using clinical criteria outlined in Kleiner et al.
  • MARC1-1113 oligonucleotide demonstrated an improved NAFLD score in the DIO-NASH model ( FIG. 7 ).
  • treatment with the MARC1-1113 oligonucleotide reduced steatosis (calculated as a percentage of hepatocytes with lipid droplets) in the animals ( FIG. 8 ), but no reduction was observed for hepatocellular ballooning or lobular inflammation (data not shown) as determined by histopathological analysis as described in Kleiner et al. Reduced steatosis fraction (i.e.
  • FIGS. 9 A and 9 B measured area fraction of steatosis in a histology sample) and hepatocytes with liver droplets is observed in MARC1-1113 treated mice, as determined by quantification of histopathological analysis using methods described in Kleiner et al. ( FIGS. 9 A and 9 B ). Inflammation and fibrosis do not appear to be changed with treatment as there was no observed difference in the number of inflammatory cells, inflammatory foci, CD45, CDllb, fibrosis, periportal fibrosis, sinusoidal fibrosis, or Colla among treatment groups (data not shown).
  • the stellate cell activation marker ⁇ -SMA an early indicator of hepatic fibrosis was reduced by MARC1-1113 treatment demonstrating that although a reduction in overall fibrosis was not observed, treatment with MARC1-1113 reduced fibrosis development ( FIG. 10 ).
  • qPCR was performed on a panel of genes related to MARC1 expression, steatosis, cholesterol metabolism, fibrosis, phosphatidylcholine, and potential biomarkers (Table 5B). Reduced expression was observed for several steatosis relevant genes: Fasn, AcacA, AcacB, and ApoB, following MARC1-1113 treatment.
  • MARC1-1113 treatment a reduction in several early regulators of fibrosis and potential biomarker genes were also reduced following MARC1-1113 treatment including: Collal, Tgfb, Timpl, Mmp9, Mmp2, and Fabpl.
  • the DIO-NASH study demonstrates the therapeutic effect of hepatic MARC1 inhibition using GalNAc-conjugated MARC1 oligonucleotides.
  • GalNAc-conjugated MARC1 oligonucleotides identified in the HDI mouse studies were assayed for targeting efficiency in NHP.
  • GalNAc-conjugated MARC1 oligonucleotides listed in Table 6 were evaluated in non-na ⁇ ve cynomolgus monkeys ( Macaca fascicularis ). In this study, the monkeys were grouped so that their mean body weights (about 2.5 kg) were comparable between the control and experimental groups. Each cohort contained all male subjects.
  • the GalNAc-conjugated MARC1 oligonucleotides were administered subcutaneously at a dose of either 1 mg/kg or 4 mg/kg on study days 0, 28, 54, and 86.
  • RNA derived from the liver biopsy samples was subjected to qRT-PCR analysis to measure MARC1 mRNA in oligonucleotide-treated monkeys relative to those treated with a comparable volume of PBS. To normalize the data, the measurements were made relative to the reference gene, PPIB.
  • Table 7 provides the percent (%) of NHP MARC1 mRNA remaining after treatment with GalNAc-conjugated MARC1 oligonucleotides. NHP were treated with four doses of the indicated oligonucleotides at 1 mg/kg or 4 mg/kg according to the dosing scheme shown in FIG. 11 . The percent (%) of mRNA remaining in liver was determined in livers collected on the indicated days (0, 28, 56, and 112). No difference was observed in weight among treatment groups.
  • DGAT1, DGAT2, MTTP, APOB, CHKA, CHKB, PCYT1A, CEPT1, PEMT, PCYT2, ETNK, FMO3, ACC2, FASN, and FABP was measured on days 27, 55, and 111 and showed no changes between PBS and GalNAc-conjugated MARC1 oligonucleotide treated NHPs (data not shown).
  • Circulating lipids were measured on days 14, 29, 57, and 113 and there was no difference observed in TG, Cholesterol, LDLc, HDLc, or ApoB100 between PBS and GalNAc-conjugated MARC1 oligonucleotide treated NHPs (data not shown).
  • liver enzymes including alanine aminotransferase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), or gamma-glutamyl transferase (GGT) (data not shown).
  • ALT alanine aminotransferase
  • AST aspartate transaminase
  • ALP alkaline phosphatase
  • GTT gamma-glutamyl transferase
  • PHH expressing endogenous human MARC1 gene were cultured for 27 days using long-term maintenance media (Xiang et al, Science 364, 399-402, 2019). A total of 7 PHH donors were used across 25 individual experiments.
  • PHH were transfected with 30 nM Dharmacon ON-TARGET plus Human MARC1 siRNA (L-019358-02-0010) or non-targeting siRNA (D-001810-10-20).
  • L-019358-02-0010 Human MARC1 siRNA
  • D-001810-10-20 non-targeting siRNA
  • cells were treated with 0 or 800 ⁇ M of a BSA conjugated Free Fatty Acids (FFA) mixture comprised of Oleic Acid, Linoleic Acid, Alpha Linoleic Acid and Palmitic Acid.
  • FFA BSA conjugated Free Fatty Acids
  • MARC1 TaqManTM Gene Expression Assays #4331182, Hs00224227_m1
  • TBP housekeeping gene
  • Nile Red to quantify lipid accumulation (Diaz et al, Micron 39, 819-824, 2008). The Nile Red ratio was calculated as the neutral lipid fluorescence (540-15 nm/600-20 nm) divided by the phospholipid fluorescence (540-15 nm/640-20 nm).
  • % of lipid accumulation ((Nile Red Ratio x - Nile Red Ratio non-targeting 0 ⁇ M FFA )/(Nile Red Ratio non-targeting 800 ⁇ M FFA - Nile Red Ratio non-targeting 0 ⁇ M FFA )) x 100.
  • lipid accumulation and MARC1 RNA shown % remaining in 7 PHH donors across 25 independent experiments following transfection with MARC1 siRNA and treatment with either 0 or 800 ⁇ M FFA.
  • Non-targeting control values at 0 ⁇ M were set to 0% and at 800 ⁇ M were set to 100%.
  • MARC1 siRNA significantly (p ⁇ 0.01) reduced lipid accumulation by 27% and 35% at 0 and 800 ⁇ M FFA, respectively, compared to non-targeting siRNA (Table 8). It was concluded that the knockdown of MARC1 significantly lowered both basal and FFA-induced lipid accumulation in cultured PHH.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand of 15 to 50 nucleotides in length and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand of 15 to 50 nucleotides in length and an antisense strand of 15 to 30 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand of 15 to 50 nucleotides in length and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand of 18 to 36 nucleotides in length and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand of 18 to 36 nucleotides in length and an antisense strand of 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand of 18 to 36 nucleotides in length and an antisense strand of 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand of 36 nucleotides in length and an antisense strand of 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand of 36 nucleotides in length and an antisense strand of 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region of at least 19 nucleotides in length, optionally 20 nucleotides in length, wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising:
  • RNAi oligonucleotide of embodiment 16 wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length.
  • RNAi oligonucleotide of embodiment 19, wherein the tetraloop comprises the sequence 5′-GAAA-3′.
  • RNAi oligonucleotide of any one of embodiments 18 to 23, wherein the stem-loop comprises the sequence 5′-GCAGCCGAAAGGCUGC-3′ (SEQ ID NO: 1681).
  • RNAi oligonucleotide of any one of embodiments 1-24 comprising a nicked tetraloop structure.
  • RNAi oligonucleotide of any one of embodiments 1-24 comprising a nick between the 3′ terminus of the sense strand and the 5′ terminus of the antisense strand.
  • RNAi oligonucleotide of any one of embodiments 16-28, wherein the overhang comprises purine nucleotides.
  • RNAi oligonucleotide of embodiment 30, wherein the 3′-overhang is selected from AA, GG, AG, and GA.
  • RNAi oligonucleotide of embodiment 31, wherein the overhang is GG or AA.
  • RNAi oligonucleotide of embodiment 31, wherein the overhang is GG.
  • RNAi oligonucleotide of any one of the preceding embodiments wherein the oligonucleotide comprises at least one modified nucleotide.
  • RNAi oligonucleotide of embodiment 34 wherein the modified nucleotide comprises a 2′-modification.
  • RNAi oligonucleotide of embodiment 35 wherein the 2′-modification is a modification selected from 2′-aminoethyl, 2′-fluoro, 2′-O-methyl, 2′-O-methoxyethyl, and 2′-deoxy-2′-fluoro- ⁇ -d-arabinonucleic acid.
  • RNAi oligonucleotide of any one of embodiments 34-37, wherein about 10-15%, 10%, 11%, 12%, 13%, 14%, or 15% of the nucleotides of the sense strand comprise a 2′ -fluoro modification.
  • RNAi oligonucleotide of any one of embodiments 34-38 wherein about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the antisense strand comprise a 2′-fluoro modification.
  • RNAi oligonucleotide of any one of embodiments 34-39 wherein about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the oligonucleotide comprise a 2′-fluoro modification
  • RNAi oligonucleotide of any one of the preceding embodiments wherein the oligonucleotide comprises at least one modified internucleotide linkage.
  • RNAi oligonucleotide of embodiment 44 wherein the at least one modified internucleotide linkage is a phosphorothioate linkage.
  • RNAi oligonucleotide of embodiment 45 wherein the antisense strand comprises a phosphorothioate linkage (i) between positions 1 and 2, and between positions 2 and 3; or (ii) between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4, wherein positions are numbered 1-4 from 5′ to 3′.
  • RNAi oligonucleotide of embodiment 45 or 64 wherein the antisense strand is 22 nucleotides in length, and wherein the antisense strand comprises a phosphorothioate linkage between positions 20 and 21 and between positions 21 and 22, wherein positions are numbered 1-22 from 5′ to 3′.
  • RNAi oligonucleotide of embodiment 48 wherein the phosphorylated nucleotide is uridine.
  • RNAi oligonucleotide of any one of the preceding embodiments, wherein the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog.
  • RNAi oligonucleotide of embodiment 50 wherein the phosphate analog is oxymethylphosphonate, vinylphosphonate, or malonylphosphonate, optionally wherein the phosphate analog is a 4′-phosphate analog comprising 5′-methoxyphosphonate-4′-oxy.
  • RNAi oligonucleotide of any one of the preceding embodiments wherein at least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands.
  • each targeting ligand comprises a carbohydrate, amino sugar, cholesterol, polypeptide, or lipid.
  • RNAi oligonucleotide of embodiment 54 wherein the one or more targeting ligands is conjugated to one or more nucleotides of the loop.
  • RNAi oligonucleotide of embodiment 55 wherein the loop comprises 4 nucleotides numbered 1-4 from 5′ to 3′, wherein nucleotides at positions 2, 3, and 4 each comprise one or more targeting ligands, wherein the targeting ligands are the same or different.
  • GalNAc N-acetylgalactosamine
  • RNAi oligonucleotide of embodiment 57 wherein the GalNAc moiety is a monovalent GalNAc moiety, a bivalent GalNAc moiety, a trivalent GalNAc moiety or a tetravalent GalNAc moiety.
  • RNAi oligonucleotide of any one of embodiments 1-59 wherein the region of complementarity is fully complementary to the MARC1 mRNA target sequence at nucleotide positions 2-8 of the antisense strand, wherein nucleotide positions are numbered 5′ to 3′.
  • RNAi oligonucleotide of any one of embodiments 1 to 61, wherein the sense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1537-1570.
  • RNAi oligonucleotide of any one of embodiments 1 to 62, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1573-1606.
  • RNAi oligonucleotide of embodiment 69, wherein the antisense strand comprises a nucleotide sequence selected from SEQ ID NOs: 1579, 1596, 1604, and 1589.
  • RNAi oligonucleotide of embodiment 72, wherein the sense strand comprises a nucleotide sequence selected from SEQ ID NOs: 1543, 1560, 1568, and 1553.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein all nucleotides comprising the sense strand and antisense strand are modified, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein all nucleotides comprising the sense strand and antisense strand are modified, wherein the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein all nucleotides comprising the sense strand and antisense strand are modified, wherein the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • RNAi oligonucleotide for reducing MARC1 expression comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein all nucleotides comprising the sense strand and the antisense strand are modified, wherein the antisense strand and the sense strand comprise one or more 2′-fluoro and 2′-O-methyl modified nucleotides and at least one phosphorothioate linkage, wherein the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the
  • RNAi oligonucleotide of any one of embodiments 1-78, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1645-1678.
  • RNAi oligonucleotide for inhibiting expression of MARC1 wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mGs-mG-mC-mU-mA-mG-mA-fG-fA-fA-fG-mA-mA-mA-mG-mU-mU-mA-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1615), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhosphon
  • RNAi oligonucleotide for inhibiting expression of MARC1 wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mAs-mG-mA-mA-mC-mG-mA-fA-fA-fG-fU-mU-mA-mU-mA-mU-mG-mG-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1632), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhos
  • RNAi oligonucleotide for inhibiting expression of MARC1 wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mAs-mA-mG-mU-mU-mG-mA-fC-fU-fA-fA-mA-mC-mU-mU-mG-mA-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1640), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhos
  • dsRNAi double stranded RNAi oligonucleotide
  • said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript
  • the sense strand comprises the sequence and all of the modifications of 5′-mUs-mG-mU-mG-mA-mA-mU-fA-fA-fA-fU-mG-mG-mA-mA-mG-mC-mU-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1625), and wherein the antisense strand comprises the sequence and all
  • a method for treating a subject having a disease, disorder or condition associated with MARC1 expression comprising administering to the subject a therapeutically effective amount of the RNAi oligonucleotide of any one of the preceding embodiments, or pharmaceutical composition thereof, thereby treating the subject.
  • a pharmaceutical composition comprising the RNAi oligonucleotide of any one of embodiments 1 to 90, and a pharmaceutically acceptable carrier, delivery agent or excipient.
  • a method of delivering an oligonucleotide to a subject comprising administering pharmaceutical composition of embodiment 92 to the subject.
  • a method for reducing MARC1 expression in a cell, a population of cells or a subject comprising the step of:
  • reducing MARC1 expression comprises reducing an amount or level of MARC1 mRNA, an amount or level of MARC 1 protein, or both.
  • RNAi oligonucleotide or pharmaceutical composition
  • a method for treating a subject having a disease, disorder or condition associated with MARC1 expression comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • a method for treating a subject having a disease, disorder or condition associated with MARC1 expression comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand selected from a row set forth in Table 4 or Table 6, or pharmaceutical composition thereof, thereby treating the subject.
  • a method for treating a subject having a disease, disorder or condition associated with MARC1 expression comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
  • a method for treating a subject having a disease, disorder or condition associated with MARC1 expression comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
  • RNAi oligonucleotide of any one of embodiments 1 to 90, or the pharmaceutical composition of embodiment 92 in the manufacture of a medicament for the treatment of a disease, disorder or condition associated with MARC1 expression, optionally for the treatment of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), or alcoholic steatohepatitis (ASH).
  • NAFLD non-alcoholic fatty liver disease
  • NASH non-alcoholic steatohepatitis
  • ASH alcoholic steatohepatitis
  • NAFLD non-alcoholic fatty liver disease
  • NASH non-alcoholic steatohepatitis
  • ASH alcoholic steatohepatitis
  • NAFLD non-alcoholic fatty liver disease
  • NASH non-alcoholic steatohepatitis
  • ASH alcoholic steatohepatitis
  • kits comprising the RNAi oligonucleotide of any one of embodiments 1 to 90, an optional pharmaceutically acceptable carrier, and a package insert comprising instructions for administration to a subject having a disease, disorder or condition associated with MARC1 expression.
  • embodiment 114 the RNAi oligonucleotide or pharmaceutical composition for use, or adaptable for use, of embodiment 115, or the kit of embodiment 116, wherein the disease, disorder or condition associated with MARC1 expression is non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), or alcoholic steatohepatitis (ASH).
  • NAFLD non-alcoholic fatty liver disease
  • NASH non-alcoholic steatohepatitis
  • ASH alcoholic steatohepatitis

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Saccharide Compounds (AREA)

Abstract

Oligonucleotides are provided herein that inhibit MARC1 expression. Also provided are compositions including the same and uses thereof, particularly uses relating to treating diseases, disorders and/or conditions associated with MARC1 expression.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a divisional of U.S. Application 17/826,211, filed May 27, 2022, which claims priority to European Patent Application 21183860.2, filed Jul. 6, 2021, and claims priority to U.S. Application 63/194,395, filed May 28, 2021; the contents of which are incorporated herein by reference.
    • SEQUENCE LISTING
  • The instant application contains a Sequence Listing which has been submitted in XML format via the USPTO patent electronic filing system and is hereby incorporated by reference in its entirety. Said XML file, created on Apr. 11, 2023, is named 210009US03.xml and is 3,449 kilobytes in size.
    • BACKGROUND OF INVENTION
  • The liver plays a critical role in the metabolism of lipids. Abnormalities in normal hepatic lipid metabolism are associated with the development of various liver diseases or disorders such as, non-alcoholic fatty liver disease (NAFLD), its subsequent progression to non-alcoholic steatohepatitis (NASH) and potentially other advanced liver abnormalities.
  • NAFLD is one of the most common liver diseases, with increasing prevalence worldwide (Loomba R., & Sanyal A.J. (2013) NAT REV GASTROENTEROL HEPATOL 10(11):686-90). NAFLD is characterized by a spectrum of clinical and pathological severity ranging from simple steatosis to nonalcoholic fatty liver (NAFL), nonalcoholic steatohepatitis (NASH), fibrosis, cirrhosis, hepatocellular carcinoma (HCC) and liver failure (Bessone F, et al., (2019) CELL MOL LIFE SCI 76(1):99-128). NAFLD is characterized as the presence of fat in the liver in the absence of significant alcohol consumption and other causes of fat in the liver such as medications, starvation, and viral disease (Chalasani, N., et al., (2012) HEPATOLOGY (Baltimore, Md.), 55(6), 2005-23). Additionally, as the disease progresses into NASH, patients also have an increased risk of developing extra-hepatic complications, particularly cardiovascular diseases (CVD), which are among the most common causes of death in this patient population. The abnormalities in hepatic lipid metabolism that lead to NAFLD also drive the progression of atherogenic dyslipidemia, where elevated plasma triglycerides (TG), cholesterol and lipoprotein particles infiltrate the arterial wall and subsequently develop atherosclerotic plaques (Loomba R & Sanyal AJ (2013) NAT REV GASTROENTEROL HEPATOL 10(11):686-90). Thus, there remains an unmet need for the development and use of therapeutics for treatment of NAFLD.
    • SUMMARY OF DISCLOSURE
  • The current invention is based in part on the discovery of oligonucleotides (e.g., RNAi oligonucleotides) that reduce MARC1 (Mitochondrial Amidoxime Reducing Component 1) expression in the liver. Specifically, target sequences within MARC1 mRNA were identified and oligonucleotides that bind to these target sequences and inhibit MARC1 mRNA expression were generated. As demonstrated herein, the oligonucleotides inhibited human and non-human primate (NHP) MARC1 expression in the liver.
  • In an aspect, the invention provides an RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • In some embodiments of the RNAi oligonucleotide, (i) the sense strand is 15 to 50 or 18 to 36 nucleotides in length, optionally 36 nucleotides in length; optionally (ii) the antisense strand is 15 to 30 nucleotides in length, optionally 22 nucleotides in length; and optionally (iii) the duplex region is at least 19 nucleotides or at least 20 nucleotides in length.
  • In some embodiments of the RNAi oligonucleotide, the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein (i) S1 is complementary to S2, optionally wherein S1 and S2 are each 1-10 nucleotides in length and have the same length, optionally wherein S1 and S2 are each 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, further optionally wherein S1 and S2 are 6 nucleotides in length; and (ii) L forms a loop between S1 and S2 of 3-5 nucleotides in length, optionally wherein L is a triloop or a tetraloop, optionally wherein the tetraloop comprises the sequence 5′-GAAA-3′, optionally wherein the stem-loop comprises the sequence 5′-GCAGCCGAAAGGCUGC-3′ (SEQ ID NO: 1681).
  • In some embodiments of the RNAi oligonucleotide, the antisense strand comprises an overhang sequence of one or more nucleotides in length at the 3′ terminus, optionally wherein the overhang comprises purine nucleotides, optionally wherein the overhang sequence is 2 nucleotides in length, optionally wherein the overhang is selected from AA, GG, AG, and GA, optionally wherein the overhang is GG.
  • In some embodiments of the RNAi oligonucleotide, at least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands, optionally wherein:
  • (a) each targeting ligand comprises a carbohydrate, amino sugar, cholesterol, polypeptide or lipid; (b) the stem loop comprises one or more targeting ligands conjugated to one or more nucleotides of the stem loop; (c) the one or more targeting ligands is conjugated to one or more nucleotides of the loop, optionally wherein the loop comprises 4 nucleotides numbered 1-4 from 5′ to 3′, wherein nucleotides at positions 2, 3, and 4 each comprise one or more targeting ligands, wherein the targeting ligands are the same or different; (d) each targeting ligand comprises a N-acetylgalactosamine (GalNAc) moiety, optionally wherein the GalNAc moiety is a monovalent GalNAc moiety, a bivalent GalNAc moiety, a trivalent GalNAc moiety or a tetravalent GalNAc moiety; and/or (e) up to 4 nucleotides of L of the stem-loop are each conjugated to a monovalent GalNAc moiety. In some embodiments of the RNAi oligonucleotide, the targeting ligand comprises at least one GalNAc moiety and targets human liver cells (e.g., human hepatocytes).
  • In some embodiments of the RNAi oligonucleotide, the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively.
  • In some embodiments of the RNAi oligonucleotide, the sense and antisense strands comprise nucleotide sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1609 and 1645, respectively;
    • (b) SEQ ID NOs: 1610 and 1646, respectively;
    • (c) SEQ ID NOs: 1611 and 1647, respectively;
    • (d) SEQ ID NOs: 1612 and 1648, respectively;
    • (e) SEQ ID NOs: 1613 and 1649, respectively;
    • (f) SEQ ID NOs: 1614 and 1650, respectively;
    • (g) SEQ ID NOs: 1615 and 1651, respectively;
    • (h) SEQ ID NOs: 1616 and 1652, respectively;
    • (i) SEQ ID NOs: 1617 and 1653, respectively;
    • (j) SEQ ID NOs: 1618 and 1654, respectively;
    • (k) SEQ ID NOs: 1619 and 1655, respectively;
    • (l) SEQ ID NOs: 1620 and 1656, respectively;
    • (m) SEQ ID NOs: 1621 and 1657, respectively;
    • (n) SEQ ID NOs: 1622 and 1658, respectively;
    • (o) SEQ ID NOs: 1623 and 1659, respectively;
    • (p) SEQ ID NOs: 1624 and 1660, respectively;
    • (q) SEQ ID NOs: 1625 and 1661, respectively;
    • (r) SEQ ID NOs: 1626 and 1662, respectively;
    • (s) SEQ ID NOs: 1627 and 1663, respectively;
    • (t) SEQ ID NOs: 1628 and 1664, respectively;
    • (u) SEQ ID NOs: 1628 and 1665, respectively;
    • (v) SEQ ID NOs: 1630 and 1666, respectively;
    • (w) SEQ ID NOs: 1631 and 1667, respectively;
    • (x) SEQ ID NOs: 1632 and 1668, respectively;
    • (y) SEQ ID NOs: 1633 and 1669, respectively;
    • (z) SEQ ID NOs: 1634 and 1670, respectively;
    • (aa) SEQ ID NOs: 1635 and 1671, respectively;
    • (bb) SEQ ID NOs: 1636 and 1672, respectively;
    • (cc) SEQ ID NOs: 1637 and 1673, respectively;
    • (dd) SEQ ID NOs: 1638 and 1674, respectively;
    • (ee) SEQ ID NOs: 1639 and 1675, respectively;
    • (ff) SEQ ID NOs: 1640 and 1676, respectively;
    • (gg) SEQ ID NOs: 1641 and 1677, respectively; and,
    • (hh) SEQ ID NOs: 1642 and 1678, respectively.
  • In an embodiment a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of MARC1 is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mGs-mG-mC-mU-mA-mG-mA-fG-fA-fA-fG-mA-mA-mA-mG-mU-mU-mA-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1615), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhosphonate-40-mUs-fUs-fUs-fA-fA-mC-fU-mU-mU-fC-mU-mU-mC-fU-mC-mU-mA-mG-mC-mCs-mGs-mG-3′ (SEQ ID NO: 1651), wherein mC, mA, mG, and mU = 2′-OMe ribonucleosides; fA, fC, fG, and fU= 2′F ribonucleosides; s = phosphorothioate, and wherein ademA-GalNAc =
  • Figure US20230340490A1-20231026-C00001
  • In an embodiment a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of MARC1 is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mAs-mG-mA-mA-mC-mG-mA-fA-fA-fG-fU-mU-mA-mU-mA-mU-mG-mG-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1632), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhosphonate-4O-mUs-fUs-fCs-fC-fA-mU-fA-mU-mA-fA-mC-mU-mU-fU-mC-mG-mU-mU-mC-mUs-mGs-mG-3′ (SEQ ID NO: 1668), wherein mC, mA, mG, and mU = 2′-OMe ribonucleosides; fA, fC, fG, and fU = 2′F ribonucleosides; s = phosphorothioate, and wherein ademA-GalNAc =
  • Figure US20230340490A1-20231026-C00002
  • In an embodiment a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of MARC1 is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mAs-mA-mG-mU-mU-mG-mA-fC-fU-fA-fA-mA-mC-mU-mU-mG-mA-mA-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1640), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhosphonate-4O-mUs-fUs-fUs-fU-fC-mA-fA-mG-mU-fU-mU-mA-mG-fU-mC-mA-mA-mC-mU-mUs-mGs-mG-3′ (SEQ ID NO: 1676), wherein mC, mA, mG, and mU = 2′-OMe ribonucleosides; fA, fC, fG, and fU = 2′F ribonucleosides; s = phosphorothioate, and wherein ademA-GalNAc =
  • Figure US20230340490A1-20231026-C00003
  • In an embodiment a double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of MARC1 is provided, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mUs-mG-mU-mG-mA-mA-mU-fA-fA-fA-fU-mG-mG-mA-mA-mG-mC-mU-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1625), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhosphonate-4O-mUs-fUs-fAs-fG-fC-mU-fU-mC-mC-fA-mU-mU-mU-fA-mU-mU-mC-mA-mC-mAs-mGs-mG-3′ (SEQ ID NO: 1661), wherein mC, mA, mG, and mU = 2′-OMe ribonucleosides; fA, fC, fG, and fU = 2′F ribonucleosides; s = phosphorothioate, and wherein ademA-GalNAc =
  • Figure US20230340490A1-20231026-C00004
  • Without being bound by theory, the oligonucleotides described herein are useful for treating a disease, disorder or condition where the MARC1 enzyme plays a causal role.
  • In an aspect, the invention provides a pharmaceutical composition comprising the RNAi oligonucleotide described herein and a pharmaceutically acceptable carrier, delivery agent or excipient.
  • In an aspect, the invention provides a kit comprising the RNAi described herein, an optional pharmaceutically acceptable carrier, and a package insert comprising instructions for administration to a subject having a disease, disorder or condition associated with MARC1 expression, optionally for the treatment of NAFLD, NASH, or alcoholic steatohepatitis (ASH).
  • In an aspect, the invention provides a use of the RNAi oligonucleotide described herein, in the manufacture of a medicament for the treatment of a disease, disorder or condition associated with MARC1 expression, optionally for the treatment of a disease or condition associated with MARC1 expression in hepatocytes, optionally for the treatment of NAFLD, NASH, or ASH. optionally for use in combination with a second composition or therapeutic agent.
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 provides a graph depicting the percent (%) of human MARC1 mRNA remaining in Huh7 cells endogenously expressing human MARC1, also referred to as MTARC1, after 24-hours treatment with 1 nM of DsiRNA targeting various regions of the MARC1 gene. 384 DsiRNAs were designed and screened. Two primer pairs were used to measure MARC1 (SEQ ID NOs: 1684-1687), and expression was normalized between samples using the HPRT housekeeping gene (SEQ ID NOs: 1688 and 1689).
  • FIG. 2 provides a graph depicting the percent (%) of human MARC1 mRNA remaining in the liver of mice exogenously expressing human MARC1 (hydrodynamic injection model) after treatment with GalNAc-conjugated MARC1 oligonucleotides. Mice were dosed subcutaneously with 2 mg/kg of the indicated GalNAc-MARC1 oligonucleotides formulated in phosphate buffered saline (PBS). Three days post-dose mice were hydrodynamically injected (HDI) with a DNA plasmid encoding human MARC1. The level of human MARC1 mRNA was determined from livers collected after 18 hours. Arrows indicate oligonucleotides selected for validation.
  • FIG. 3 provides a graph depicting the percent (%) of human MARC1 mRNA remaining in the liver of mice exogenously expressing human MARC1 (hydrodynamic injection model) after treatment with human GalNAc-conjugated MARC1 oligonucleotides selected for validation based on the results in FIG. 2 Mice were dosed subcutaneously with 2 mg/kg of the indicated GalNAc-MARC1 oligonucleotides formulated in PBS. Three days post-dose mice were HDI with a DNA plasmid encoding MARC1. The level of human MARC1 mRNA was determined from livers collected 18 hours later.
  • FIG. 4 provides a graph depicting the dose response of GalNAc-conjugated MARC1 oligonucleotides selected for NHP studies. The percent (%) of human MARC1 mRNA remaining in the liver of mice exogenously expressing human MARC1 (hydrodynamic injection model) after treatment with human GalNAc-conjugated MARC1 oligonucleotides at three doses (0.1 mg/kg, 0.3 mg/kg, and 1 mg/kg) was measured. Three days post-dose mice were HDI with a DNA plasmid encoding MARC1. The level of human MARC1 mRNA was determined from livers collected 18 hours later.
  • FIG. 5 and FIG. 6 provide graphs depicting the level of liver triglycerides (TG) and total cholesterol (TC) in samples collected on day 56 from mice fed a DIO-NASH diet or Lean Chow diet and treated with 8 weekly doses of the indicated GalNAc-conjugated MARC1 oligonucleotides (3 mg/kg) or control GLP-1 peptide (Jesper Lau et la. J. Med. Chem. (2015); 58, 7370-80, compound 22) (GLP-1 ‘22’) (10 nmol/kg) relative to mice treated with PBS. Relative (FIG. 5 ) and total (FIG. 6 ) TG and TC levels were compared to DIO-NASH vehicle control. ***=p<0.001, *=p<0.05.
  • FIG. 7 provides a graph depicting NAFLD activity score in samples from mice fed a DIO-NASH diet or Lean Chow diet and treated with 8 weekly doses of the indicated GalNAc-conjugated MARC1 oligonucleotides (3 mg/kg) or GLP-1 ‘22’ (10 nmol/kg) as control relative to mice treated with PBS. The score was calculated based on the NAFLD score at the end of the study.
  • FIG. 8 provides a graph depicting the Steatosis Score in samples from mice fed a DIO-NASH diet or Lean Chow diet and treated with 8 weekly doses of the indicated GalNAc-conjugated MARC1 oligonucleotides (3 mg/kg) or GLP-1 ‘22’ (10 nmol/kg) relative to mice treated with PBS. The score was calculated based on the Steatosis score at the end of the study.
  • FIGS. 9A and 9B provide graphs quantifying the steatosis fraction (i.e. the percent (%) of liver steatosis in a given area) (FIG. 9A) and the percent (%) hepatocytes with lipid droplets (FIG. 9B) from mice fed a DIO-NASH diet or Lean Chow diet and treated with 8 weekly doses of the indicated GalNAc-conjugated MARC1 oligonucleotides, (10 nmol/kg) (3 mg/kg), or PBS. ∗∗∗=p<0.001(relative to DIO-NASH vehicle treatment).
  • FIG. 10 provides a graph depicting α-SMA levels in liver samples from mice fed a DIO-NASH diet and treated with the indicated GalNAc-conjugated MARC1 oligonucleotides, (10 nmol/kg) PBS, or fed a Lean-Chow diet. ***=p<0.001, *=p<0.05 (relative to DIO-NASH vehicle treatment).
  • FIG. 11 provides a schematic depicting the dosing and specimen collection schedules for non-human primate (NHP) studies using GalNAc-conjugated MARC1 oligonucleotides.
  • FIG. 12 is a schematic of an exemplary nicked tetraloop oligonucleotide structure.
    •  DETAILED DESCRIPTION
  • MARC1 (Mitochondrial Amidoxime Reducing Component 1, Molybdenum Cofactor Sulfurase C-terminal Domain-Containing Protein 1, Moco Sulfurase C-Terminal Domain Containing Protein 1, MOSC1, MOSC Domain-Containing Protein 1, MTARC1) is a protein which catalyzes the reduction of N-oxygenated molecules in various metabolic processes. While the biological function and mechanisms of MARC1 have yet to be elucidated, a common missense variant has been identified in MARC1 that protects subjects against cirrhosis. Carriers of this variant also have lower blood cholesterol levels and reduced liver fat, indicating MARC1 may be an effective therapeutic target for NAFLD, NASH and ASH. It should be understood that the genetic polymorphisms in MARC1 impact expression and/or functionality of MARC1 across all bodily tissues from birth, with MARC1 being expressed widely and at various levels in different organs. As described herein, oligonucleotides targeting MARC1 specifically in hepatocytes not only inhibit MARC1 expression in vitro and in vivo, but also provide a therapeutic effect in a mouse model of NASH. Specifically, reduction of MARC1 expression reduced the number of hepatocytes with liver droplets and the steatosis fraction. Additionally, MARC1 inhibition reduced several regulators of hepatic fibrosis in the NASH model. These various improved disease outcomes demonstrate the therapeutic efficacy of MARC1 inhibition, specifically in hepatocytes.
  • Taken together, and without being bound by theory, antagonism/inhibition of MARC 1, specifically in hepatocytes (e.g., via MARC1-targeted RNAi oligonucleotides), may decrease the risk and severity of NAFLD, NASH, and alcoholic steatohepatitis (ASH). This approach may be best managed by a specific and targeted reduction of the MARC1 expression in the liver while other organs, tissues or cells expressing MARC1 are left essentially unaffected. In this sense the current invention may provide an improved modality of treatment given its specific targeting of mRNA production in the liver.
  • According to some aspects, the current invention provides oligonucleotides (e.g., RNAi oligonucleotides) that reduce MARC1 expression in the liver. In some embodiments, the oligonucleotides provided herein are designed to treat diseases associated with MARC1 expression in the liver. In some respects, the current invention provides methods of treating a disease associated with overall MARC1 expression by reducing MARC1 expression in specific cells (e.g., hepatocytes) or organs (e.g., liver).
    • Oligonucleotide Inhibitors of MARC1 Expression MARC1 Target Sequences
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) is targeted to a target sequence comprising a MARC1 mRNA. In some embodiments, an oligonucleotide described herein is targeted to a target sequence within a MARC1 mRNA sequence. In some embodiments, the oligonucleotide described herein corresponds to a target sequence within a MARC1 mRNA sequence. In some embodiments, the oligonucleotide, or a portion, fragment, or strand thereof (e.g., an antisense strand or a guide strand of a double-stranded (ds) RNAi oligonucleotide) binds or anneals to a target sequence comprising MARC1 mRNA, thereby inhibiting MARC1 expression.
  • In some embodiments, the oligonucleotide is targeted to a MARC1 target sequence for the purpose of inhibiting MARC1 expression in vivo. In some embodiments, the amount or extent of inhibition of MARC1 expression by an oligonucleotide targeted to a MARC1 target sequence correlates with the potency of the oligonucleotide. In some embodiments, the amount or extent of inhibition of MARC1 expression by an oligonucleotide targeted to a MARC1 target sequence correlates with the amount or extent of therapeutic benefit in a subject or patient having a disease, disorder or condition associated with MARC1 expression treated with the oligonucleotide.
  • Through examination of the nucleotide sequence of mRNAs encoding MARC1, including mRNAs of multiple different species (e.g., human, cynomolgus monkey, and mouse; see, e.g., Example 2) and as a result of in vitro and in vivo testing (see, e.g., Examples 2-5), it has been discovered that certain nucleotide sequences of MARC1 mRNA are more amenable than others to oligonucleotide-based inhibition and are thus useful as target sequences for the oligonucleotides herein. In some embodiments, a sense strand of an oligonucleotide (e.g., an RNAi oligonucleotide) described herein comprises a MARC1 target sequence. In some embodiments, a portion or region of the sense strand of an oligonucleotide described herein (e.g., an RNAi oligonucleotide) comprises a MARC1 target sequence. In some embodiments, a MARC1 target sequence comprises, or consists of, a sequence of any one of SEQ ID NOs:1-384. In some embodiments, a MARC1 target sequence comprises, or consists of, the sequence set forth in SEQ ID NO: 234, 298, 356, or 376.
    • MARC1 Targeting Sequences
  • In some embodiments, the oligonucleotides herein (e.g., RNAi oligonucleotides) have regions of complementarity to MARC1 mRNA (e.g., within a target sequence of MARC1 mRNA) for purposes of targeting the MARC1 mRNA in cells and inhibiting and/or reducing MARC1 expression. In some embodiments, the oligonucleotides herein comprise a MARC1 targeting sequence (e.g., an antisense strand or a guide strand of a dsRNAi oligonucleotide) having a region of complementarity that binds or anneals to a MARC1 target sequence by complementary (Watson-Crick) base pairing. The targeting sequence or region of complementarity is generally of a suitable length and base content to enable binding or annealing of the oligonucleotide (or a strand thereof) to a MARC1 mRNA for purposes of inhibiting and/or reducing MARC1 expression. In some embodiments, the targeting sequence or region of complementarity is at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is about 12 to about 30 (e.g., 12 to 30, 12 to 22, 15 to 25, 17 to 21, 18 to 27, 19 to 27, or 15 to 30) nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 18 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 19 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 20 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 21 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 22 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 23 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 24 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 1-384, and the targeting sequence or region of complementarity is 18 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 1-384, and the targeting sequence or region of complementarity is 19 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152, and the targeting sequence or region of complementarity is 20 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152, and the targeting sequence or region of complementarity is 21 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152, and the targeting sequence or region of complementarity is 22 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152, and the targeting sequence or region of complementarity is 23 nucleotides in length. In some embodiments, an oligonucleotide comprises a target sequence or region of complementarity complementary to a sequence of any one of SEQ ID NOs: 769-1152 and the targeting sequence or region of complementarity is 24 nucleotides in length.
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a targeting sequence or a region of complementarity (e.g., an antisense strand or a guide strand of a double-stranded oligonucleotide) that is fully complementary to a MARC1 target sequence. In some embodiments, the targeting sequence or region of complementarity is partially complementary to a MARC1 target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is fully complementary to a MARC1 target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is partially complementary to a MARC1 target sequence.
  • In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is fully complementary to a sequence of any one of SEQ ID NOs: 1-384. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is fully complementary to the sequence set forth in SEQ ID NOs: 234, 298, 356, or 376. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is partially complementary to a sequence of any one of SEQ ID NOs: 1-384. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is partially complementary to the sequence set forth in SEQ ID NOs: 234, 298, 356, or 376.
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides within a MARC1 mRNA, wherein the contiguous sequence of nucleotides is about 12 to about 30 nucleotides in length (e.g., 12 to 30, 12 to 28, 12 to 26, 12 to 24, 12 to 20, 12 to 18, 12 to 16, 14 to 22, 16 to 20, 18 to 20, or 18 to 19 nucleotides in length). In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides within a MARC1 mRNA, wherein the contiguous sequence of nucleotides is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides within a MARC1 mRNA, wherein the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides within a MARC1 mRNA, wherein the contiguous sequence of nucleotides is 20 nucleotides in length.
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, optionally wherein the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 234, 298, 356, or 376, wherein the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 769-1152, wherein the contiguous sequence of nucleotides is 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1002, 1066, 1124, and 1144, wherein the contiguous sequence of nucleotides is 20 nucleotides in length.
  • In some embodiments, a targeting sequence or region of complementarity of an oligonucleotide herein (e.g., an RNAi oligonucleotide) is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384 and spans the entire length of an antisense strand. In some embodiments, a targeting sequence or region of complementarity of the oligonucleotide is complementary to a contiguous sequence of nucleotides of SEQ ID NOs: 1-384 and spans a portion of the entire length of an antisense strand. In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a region of complementarity (e.g., on an antisense strand of a dsRNA) that is at least partially (e.g., fully) complementary to a contiguous stretch of nucleotides spanning nucleotides 1-19 or 1-20 of a sequence as set forth in any one of SEQ ID NOs: 769-1152.
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a targeting sequence or region of complementarity having one or more base pair (bp) mismatches with the corresponding MARC1 target sequence. In some embodiments, the targeting sequence or region of complementarity may have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding MARC1 target sequence provided that the ability of the targeting sequence or region of complementarity to bind or anneal to the MARC1 mRNA under appropriate hybridization conditions and/or the ability of the oligonucleotide to inhibit MARC1 expression is maintained. Alternatively, the targeting sequence or region of complementarity may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding MARC1 target sequence provided that the ability of the targeting sequence or region of complementarity to bind or anneal to the MARC1 mRNA under appropriate hybridization conditions and/or the ability of the oligonucleotide to inhibit MARC1 expression is maintained. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity having 1 mismatch with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity having 2 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity having 3 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity having 4 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity having 5 mismatches with the corresponding target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity having more than one mismatch (e.g., 2, 3, 4, 5, or more mismatches) with the corresponding target sequence, wherein at least 2 (e.g., all) of the mismatches are positioned consecutively (e.g., 2, 3, 4, 5, or more mismatches in a row), or wherein the mismatches are interspersed throughout the targeting sequence or region of complementarity. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity having more than one mismatch (e.g., 2, 3, 4, 5, or more mismatches) with the corresponding target sequence, wherein at least 2 (e.g., all) of the mismatches are positioned consecutively (e.g., 2, 3, 4, 5, or more mismatches in a row), or wherein at least one or more non-mismatched base pair is located between the mismatches, or a combination thereof. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, wherein the targeting sequence or region of complementarity may have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding MARC1 target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, wherein the targeting sequence or region of complementarity may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding MARC1 target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 234, 298, 356, or 376, wherein the targeting sequence or region of complementarity may have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding MARC1 target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 234, 298, 356, or 376, wherein the targeting sequence or region of complementarity may have no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches with the corresponding MARC1 target sequence.
    • Types of Oligonucleotides
  • A variety of oligonucleotide types and/or structures are useful for targeting MARC1 in the methods herein including, but not limited to, RNAi oligonucleotides, antisense oligonucleotides (ASOs), miRNAs, etc. Any of the oligonucleotide types described herein or elsewhere are contemplated for use as a framework to incorporate a MARC1 targeting sequence herein for the purposes of inhibiting MARC1 expression.
  • In some embodiments, the oligonucleotides herein inhibit MARC1 expression by engaging with RNA interference (RNAi) pathways upstream or downstream of Dicer involvement. For example, RNAi oligonucleotides have been developed with each strand having sizes of about 19-25 nucleotides with at least one 3′-overhang of 1 to 5 nucleotides (see, e.g., U.S. Pat. 8,372,968). Longer oligonucleotides also have been developed that are processed by Dicer to generate active RNAi products (see, e.g., U.S. Pat. 8,883,996). Further work produced extended dsRNAs where at least one end of at least one strand is extended beyond a duplex targeting region, including structures where one of the strands includes a thermodynamically stabilizing tetraloop structure (see, e.g., US Pats. 8,513,207 and 8,927,705, as well as Intl. Patent Application Publication No. WO 2010/033225). Such structures may include single-stranded (ss) extensions (on one or both sides of the molecule) as well as double-stranded (ds) extensions.
  • In some embodiments, the oligonucleotides herein engage with the RNAi pathway downstream of the involvement of Dicer (e.g., Dicer cleavage). In some embodiments, the oligonucleotides described herein are Dicer substrates. In some embodiments, upon endogenous Dicer processing, double-stranded nucleic acids of 19-23 nucleotides in length capable of reducing MARC1 expression are produced. In some embodiments, the oligonucleotide has an overhang (e.g., of 1, 2, or 3 nucleotides in length) in the 3′ end of the antisense strand. In some embodiments, the oligonucleotide (e.g., siRNA) comprises a 21-nucleotide guide strand that is antisense to a target RNA and a complementary passenger strand, in which both strands anneal to form a 19-bp duplex and 2 nucleotide overhangs at either or both 3′ ends. Longer oligonucleotide designs also are available including oligonucleotides having a guide strand of 23 nucleotides and a passenger strand of 21 nucleotides, where there is a blunt end on the right side of the molecule (3′ end of passenger strand/5′ end of guide strand) and a two nucleotide 3′-guide strand overhang on the left side of the molecule (5′ end of the passenger strand/3′ end of the guide strand). In such molecules, there is a 21 bp duplex region. See, e.g., US Pats. 9,012,138; 9,012,621; and 9,193,753.
  • In some embodiments, the oligonucleotides herein comprise sense and antisense strands that are both in the range of about 17 to 36 (e.g., 17 to 36, 20 to 25, or 21-23) nucleotides in length. In some embodiments, the oligonucleotides described herein comprise an antisense strand of 19-30 nucleotides in length and a sense strand of 19-50 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand. In some embodiments, an oligonucleotide herein comprises a sense and antisense strand that are both in the range of about 19-22 nucleotides in length. In some embodiments, the sense and antisense strands are of equal length. In some embodiments, an oligonucleotide comprises sense and antisense strands, such that there is a 3′-overhang on either the sense strand or the antisense strand, or both the sense and antisense strand. In some embodiments, for oligonucleotides that have sense and antisense strands that are both in the range of about 21-23 nucleotides in length, a 3′-overhang on the sense, antisense, or both sense and antisense strands is 1 or 2 nucleotides in length. In some embodiments, the oligonucleotide has a guide strand of 22 nucleotides and a passenger strand of 20 nucleotides, where there is a blunt end on the right side of the molecule (3′ end of passenger strand/5′ end of guide strand) and a 2 nucleotide 3′-guide strand overhang on the left side of the molecule (5′ end of the passenger strand/3′ end of the guide strand). In such molecules, there is a 20 bp duplex region.
  • Other oligonucleotide designs for use with the compositions and methods herein include: 16-mer siRNAs (see, e.g., NUCLEIC ACIDS IN CHEMISTRY AND BIOLOGY, Blackburn (ed.), ROYAL SOCIETY OF CHEMISTRY, 2006), shRNAs (e.g., having 19 bp or shorter stems; see, e.g., Moore et al. (2010) METHODS MOL. BIOL. 629:141-158), blunt siRNAs (e.g., of 19 bps in length; see, e.g., Kraynack & Baker (2006) RNA 12:163-176), asymmetrical siRNAs (aiRNA; see, e.g., Sun et al. (2008) NAT. BIOTECHNOL. 26:1379-82), asymmetric shorter-duplex siRNA (see, e.g., Chang et al. (2009) MOL. THER. 17:725-32), fork siRNAs (see, e.g., Hohjoh (2004) FEBS LETT. 557:193-98), ss siRNAs (Elsner (2012) NAT. BIOTECHNOL. 30:1063), dumbbell-shaped circular siRNAs (see, e.g., Abe et al. (2007) J. AM. CHEM. SOC. 129:15108-09), and small internally segmented interfering RNA (siRNA; see, e.g., Bramsen et al. (2007) NUCLEIC ACIDS RES. 35:5886-97). Further non-limiting examples of an oligonucleotide structures that may be used in some embodiments to reduce or inhibit the expression of MARC1 are microRNA (miRNA), short hairpin RNA (shRNA) and short siRNA (see, e.g., Hamilton et al. (2002) EMBO J. 21:4671-79; see also, US Patent Application Publication No. 2009/0099115).
  • Still, in some embodiments, an oligonucleotide for reducing or inhibiting MARC1 expression herein is single-stranded (ss). Such structures may include but are not limited to single-stranded RNAi molecules. Recent efforts have demonstrated the activity of ss RNAi molecules (see, e.g., Matsui et al. (2016) MOL. THER. 24:946-55). However, in some embodiments, oligonucleotides herein are antisense oligonucleotides (ASOs). An antisense oligonucleotide is a single-stranded oligonucleotide that has a nucleobase sequence which, when written in the 5′ to 3′ direction, comprises the reverse complement of a targeted segment of a particular nucleic acid and is suitably modified (e.g., as a gapmer) to induce RNaseH-mediated cleavage of its target RNA in cells or (e.g., as a mixmer) so as to inhibit translation of the target mRNA in cells. ASOs for use herein may be modified in any suitable manner known in the art including, for example, as shown in U.S. Pat. No. 9,567,587 (including, e.g., length, sugar moieties of the nucleobase (pyrimidine, purine), and alterations of the heterocyclic portion of the nucleobase). Further, ASOs have been used for decades to reduce expression of specific target genes (see, e.g., Bennett et al. (2017) ANNU. REV. PHARMACOL. 57:81-105).
  • In some embodiments, the antisense oligonucleotide shares a region of complementarity with MARC1 mRNA. In some embodiments, the antisense oligonucleotide targets various areas of the human MARC1 gene identified as NM_001251935.1. In some embodiments, the antisense oligonucleotide is 15-50 nucleotides in length. In some embodiments, the antisense oligonucleotide is 15-25 nucleotides in length. In some embodiments, the antisense oligonucleotide is 22 nucleotides in length. In some embodiments, the antisense oligonucleotide is complementary to any one of SEQ ID NOs: 1-384. In some embodiments, the antisense oligonucleotide is at least 15 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide is at least 19 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide is at least 20 contiguous nucleotides in length. In some embodiments, the antisense oligonucleotide differs by 1, 2, or 3 nucleotides from the target sequence.
    • Double-Stranded Oligonucleotides
  • In some aspects, the current invention provides double-stranded (ds) RNAi oligonucleotides for targeting MARC1 mRNA and inhibiting MARC1 expression (e.g., via the RNAi pathway) comprising a sense strand (also referred to herein as a passenger strand) and an antisense strand (also referred to herein as a guide strand). In some embodiments, the sense strand and antisense strand are separate strands and are not covalently linked. In some embodiments, the sense strand and antisense strand are covalently linked. In some embodiments, the sense strand and antisense strand form a duplex region, wherein the sense strand and antisense strand, or a portion thereof, binds with one another in a complementary fashion (e.g., by Watson-Crick base pairing).
  • In some embodiments, the sense strand has a first region (R1) and a second region (R2), wherein R2 comprises a first subregion (S1), a tetraloop or triloop (L), and a second subregion (S2), wherein L is located between S1 and S2, and wherein S1 and S2 form a second duplex (D2). D2 may have various length. In some embodiments, D2 is about 1-6 bp in length. In some embodiments, D2 is 2-6, 3-6, 4-6, 5-6, 1-5, 2-5, 3-5, or 4-5 bp in length. In some embodiments, D2 is 1, 2, 3, 4, 5, or 6 bp in length. In some embodiments, D2 is 6 bp in length. In some embodiments, R1 of the sense strand and the antisense strand form a first duplex (D1). In some embodiments, D1 is at least about 15 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides in length. In some embodiments, D1 is in the range of about 12 to 30 nucleotides in length (e.g., 12 to 30, 12 to 27, 15 to 22, 18 to 22, 18 to 25, 18 to 27, 18 to 30, or 21 to 30 nucleotides in length). In some embodiments, D1 is at least 12 nucleotides in length (e.g., at least 12, at least 15, at least 20, at least 25, or at least 30 nucleotides in length). In some embodiments, D1 is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, D1 is 20 nucleotides in length. In some embodiments, D1 comprising sense strand and antisense strand does not span the entire length of the sense strand and/or antisense strand. In some embodiments, D1 comprising the sense strand and antisense strand spans the entire length of either the sense strand or antisense strand or both. In certain embodiments, D1 comprising the sense strand and antisense strand spans the entire length of both the sense strand and the antisense strand.
  • In some embodiments, an oligonucleotide provided herein comprises a sense strand having a sequence of any one of SEQ ID NOs: 769-1152 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1153-1536. In some embodiments, an oligonucleotide provided herein comprises a sense strand having a sequence of any one of SEQ ID NOs: 1-384 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 385-768.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand having a sequence of any one of SEQ ID NOs: 1537-1570 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1573-1606 as is arranged in Tables 4 and 6.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand comprising nucleotide sequences selected from:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand comprising nucleotide sequences selected from:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively.
  • In some embodiments, the sense strand comprises the sequence of SEQ ID NO: 1543 and the antisense strand comprises the sequence of SEQ ID NO: 1579.
  • In some embodiments, the sense strand comprises the sequence of SEQ ID NO: 1560 and the antisense strand comprises the sequence of SEQ ID NO: 1596.
  • In some embodiments, the sense strand comprises the sequence of SEQ ID NO: 1568 and the antisense strand comprises the sequence of SEQ ID NO: 1604.
  • In some embodiments, the sense strand comprises the sequence of SEQ ID NO: 1553 and the antisense strand comprises the sequence of SEQ ID NO: 1589.
  • It should be appreciated that, in some embodiments, sequences presented in the Sequence Listing may be referred to in describing the structure of an oligonucleotide (e.g., a dsRNAi oligonucleotide) or other nucleic acid. In such embodiments, the actual oligonucleotide or other nucleic acid may have one or more alternative nucleotides (e.g., an RNA counterpart of a DNA nucleotide or a DNA counterpart of an RNA nucleotide) and/or one or more modified nucleotides and/or one or more modified internucleotide linkages and/or one or more other modification when compared with the specified sequence while retaining essentially same or similar complementary properties as the specified sequence.
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a 25-nucleotide sense strand and a 27-nucleotide antisense strand that when acted upon by a Dicer enzyme results in an antisense strand that is incorporated into the mature RISC. In some embodiments, the 25-nucleotide sense strand comprises a sequence selected from SEQ ID NOs: 769-1152. In some embodiments, the 27-nucleotide antisense strand comprises a sequence selected from SEQ ID NOs: 1153-1536. In some embodiments, the sense strand of the oligonucleotide is longer than 27 nucleotides (e.g., 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides). In some embodiments, the sense strand of the oligonucleotide is longer than 25 nucleotides (e.g., 26, 27, 28, 29 or 30 nucleotides). In some embodiments, the sense strand of the oligonucleotide comprises a nucleotide sequence selected from SEQ ID NOs: 1537-1570, wherein the nucleotide sequence is longer than 27 nucleotides (e.g., 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides). In some embodiments, the sense strand of the oligonucleotide comprises a nucleotide sequence selected from SEQ ID NOs: 1537-1570, wherein the nucleotide sequence is longer than 25 nucleotides (e.g., 26, 27, 28, 29, or 30 nucleotides).
  • In some embodiments, oligonucleotides herein (e.g., RNAi oligonucleotides) have one 5′ end that is thermodynamically less stable when compared to the other 5′ end. In some embodiments, an asymmetric oligonucleotide is provided that includes a blunt end at the 3′ end of a sense strand and a 3′-overhang at the 3′ end of an antisense strand. In some embodiments, the 3′-overhang on the antisense strand is about 1-8 nucleotides in length (e.g., 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length). In some embodiments, the oligonucleotide has an overhang comprising two (2) nucleotides on the 3′ end of the antisense (guide) strand. However, other overhangs are possible. In some embodiments, an overhang is a 3′-overhang comprising a length of between 1 and 6 nucleotides, optionally 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 6, 3 to 5, 3 to 4, 4 to 6, 4 to 5, 5 to 6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides. However, in some embodiments, the overhang is a 5′-overhang comprising a length of between 1 and 6 nucleotides, optionally 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 6, 3 to 5, 3 to 4, 4 to 6, 4 to 5, 5 to 6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, and a 5′-overhang comprising a length of between 1 and 6 nucleotides. In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1537-1570, wherein the oligonucleotide comprises a 5′-overhang comprising a length of between 1 and 6 nucleotides. In some embodiments, the oligonucleotide comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1573-1606, wherein the oligonucleotide comprises a 5′-overhang comprising a length of between 1 and 6 nucleotides. In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1537-1570 and antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1573-1606, wherein the oligonucleotide comprises a 5′-overhang comprising a length of between 1 and 6 nucleotides.
  • In some embodiments, two (2) terminal nucleotides on the 3′ end of an antisense strand are modified. In some embodiments, the two (2) terminal nucleotides on the 3′ end of the antisense strand are complementary with the target mRNA (e.g., MARC1 mRNA). In some embodiments, the two (2) terminal nucleotides on the 3′ end of the antisense strand are not complementary with the target mRNA. In some embodiments, the two (2) terminal nucleotides on the 3′ end of the antisense strand of an oligonucleotide herein are unpaired. In some embodiments, the two (2) terminal nucleotides on the 3′ end of the antisense strand of an oligonucleotide herein comprise an unpaired GG. In some embodiments, the two (2) terminal nucleotides on the 3′ end of an antisense strand of an oligonucleotide herein are not complementary to the target mRNA. In some embodiments, two (2) terminal nucleotides on each 3′ end of an oligonucleotide are GG. In some embodiments, one or both of the two (2) terminal GG nucleotides on each 3′ end of an oligonucleotide herein is not complementary with the target mRNA. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, wherein the two (2) terminal nucleotides on the 3′ end of the antisense strand of the oligonucleotide herein comprises an unpaired GG. In some embodiments, the oligonucleotide comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 385-768, wherein the two (2) terminal nucleotides on the 3′ end of the antisense strand of the oligonucleotide comprises an unpaired GG. In some embodiments, the oligonucleotide comprises a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1537-1570 and antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 1573-1606, wherein the two (2) terminal nucleotides on the 3′ end of the antisense strand of the oligonucleotide comprises an unpaired GG.
  • In some embodiments, there is one or more (e.g., 1, 2, 3, 4, or 5) mismatch(s) between a sense and antisense strand comprising an oligonucleotide herein (e.g., an RNAi oligonucleotide). If there is more than one mismatch between a sense and antisense strand, they may be positioned consecutively (e.g., 2, 3 or more in a row), or interspersed throughout the region of complementarity. In some embodiments, the 3′ end of the sense strand comprises one or more mismatches. In some embodiments, two (2) mismatches are incorporated at the 3′ end of the sense strand. In some embodiments, base mismatches, or destabilization of segments at the 3′ end of the sense strand of an oligonucleotide herein improves or increases the potency of the oligonucleotide. In some embodiments, the sense and antisense strands of an oligonucleotide herein comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    wherein there is one or more (e.g., 1, 2, 3, 4, or 5) mismatch(s) between the sense and antisense strands.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand comprising nucleotide sequences selected from:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    wherein there is one or more (e.g., 1, 2, 3, 4, or 5) mismatch(s) between the sense and antisense strands. Antisense Strands
  • In some embodiments, an antisense strand of an oligonucleotide herein (e.g., an RNAi oligonucleotide) is referred to as a “guide strand”. For example, an antisense strand that engages with RNA-induced silencing complex (RISC) and binds to an Argonaute protein such as Ago2, or engages with or binds to one or more similar factors, and directs silencing of a target gene, as the antisense strand is referred to as a guide strand. In some embodiments, a sense strand comprising a region of complementary to a guide strand is referred to herein as a “passenger strand.”
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises an antisense strand of up to about 50 nucleotides in length (e.g., up to 50, up to 40, up to 35, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides in length). In some embodiments, an oligonucleotide comprises an antisense strand of at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 22, at least 25, at least 27, at least 30, at least 35, or at least 38 nucleotides in length). In some embodiments, an oligonucleotide comprises an antisense strand in a range of about 12 to about 40 (e.g., 12 to 40, 12 to 36, 12 to 32, 12 to 28, 15 to 40, 15 to 36, 15 to 32, 15 to 28, 17 to 22, 17 to 25, 19 to 27, 19 to 30, 20 to 40, 22 to 40, 25 to 40, or 32 to 40) nucleotides in length. In some embodiments, an oligonucleotide comprises antisense strand of 15 to 30 nucleotides in length. In some embodiments, an antisense strand of any one of the oligonucleotides disclosed herein is of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length. In some embodiments, an oligonucleotide comprises an antisense strand of 22 nucleotides in length.
  • In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) for targeting MARC1 comprises an antisense strand comprising or consisting of a sequence as set forth in any one of SEQ ID NOs: 1153-1536. In some embodiments, an oligonucleotide herein comprises an antisense strand comprising at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1153-1536. In some embodiments, an oligonucleotide disclosed herein for targeting MARC1 comprises an antisense strand comprising or consisting of a sequence as set forth in any one of SEQ ID NOs: 1573-1606. In some embodiments, an oligonucleotide herein comprises an antisense strand comprising at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1573-1606. In some embodiments, an oligonucleotide disclosed herein for targeting MARC1 comprises an antisense strand comprising or consisting of a sequence as set forth in any one of SEQ ID NOs: 1579, 1596, 1604, and 1589. In some embodiments, an oligonucleotide herein comprises an antisense strand comprising at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1579, 1596, 1604, and 1589.
  • In some embodiments, an oligonucleotide herein comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 385-768. In some embodiments, an oligonucleotide herein comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 618, 682, 740, and 760.
    • Sense Strands
  • In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 1-384. In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 769-1152. In some embodiments, an oligonucleotide herein has a sense strand comprised of at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 769-1152. In some embodiments, an oligonucleotide herein has a sense strand comprised of at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1-384. In some embodiments, an oligonucleotide disclosed herein for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 1537-1570. In some embodiments, an oligonucleotide herein has a sense strand comprised of least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1537-1570. In some embodiments, an oligonucleotide disclosed herein for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 1543, 1560, 1568, and 1553. In some embodiments, an oligonucleotide herein has a sense strand that comprise at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 1543, 1560, 1568, or 1553. In some embodiments, an oligonucleotide disclosed herein for targeting MARC1 mRNA and inhibiting MARC1 expression comprises a sense strand sequence as set forth in any one of SEQ ID NOs: 234, 298, 356, and 376. In some embodiments, an oligonucleotide herein has a sense strand that comprise at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19) contiguous nucleotides of a sequence as set forth in any one of SEQ ID NOs: 234, 298, 356, and 376.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand (or passenger strand) of up to about 50 nucleotides in length (e.g., up to 50, up to 40, up to 36, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides in length). In some embodiments, an oligonucleotide herein comprises a sense strand of at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, at least 27, at least 30, at least 36 or at least 38 nucleotides in length). In some embodiments, an oligonucleotide herein comprises a sense strand in a range of about 12 to about 50 (e.g., 12 to 50, 12 to 40, 12 to 36, 12 to 32, 12 to 28, 15 to 40, 15 to 36, 15 to 32, 15 to 28, 17 to 21, 17 to 25, 19 to 27, 19 to 30, 20 to 40, 22 to 40, 25 to 40, or 32 to 40) nucleotides in length. In some embodiments, an oligonucleotide herein comprises a sense strand of 15 to 50 nucleotides in length. In some embodiments, an oligonucleotide herein comprises a sense strand of 18 to 36 nucleotides in length. In some embodiments, an oligonucleotide herein comprises a sense strand of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, an oligonucleotide herein comprises a sense strand of 36 nucleotides in length.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand comprising a stem-loop structure at the 3′ end of the sense strand. In some embodiments, the stem-loop is formed by intrastrand base pairing. In some embodiments, a sense strand comprises a stem-loop structure at its 5′ end. In some embodiments, the stem of the stem-loop comprises a duplex of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 2 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 3 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 4 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 5 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 6 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 7 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 8 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 9 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 10 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 11 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 12 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 13 nucleotides in length. In some embodiments, the stem of the stem-loop comprises a duplex of 14 nucleotides in length.
  • In some embodiments, a stem-loop provides the oligonucleotide protection against degradation (e.g., enzymatic degradation), facilitates or improves targeting and/or delivery to a target cell, tissue, or organ (e.g., the liver), or both. For example, in some embodiments, the loop of a stem-loop is comprised of nucleotides comprising one or more modifications that facilitate, improve, or increase targeting to a target mRNA (e.g., a MARC1 mRNA), inhibition of target gene expression (e.g., MARC1 expression), and/or delivery, uptake, and/or penetrance into a target cell, tissue, or organ (e.g., the liver), or a combination thereof. In some embodiments, the stem-loop itself or modification(s) to the stem-loop do not affect or do not substantially affect the inherent gene expression inhibition activity of the oligonucleotide, but facilitates, improves, or increases stability (e.g., provides protection against degradation) and/or delivery, uptake, and/or penetrance of the oligonucleotide to a target cell, tissue, or organ (e.g., the liver). In certain embodiments, an oligonucleotide herein comprises a sense strand comprising (e.g., at its 3′ end) a stem-loop set forth as: S1-L-S2, in which S1 is complementary to S2, and in which L forms a single-stranded loop of linked nucleotides between S1 and S2 of up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length). In some embodiments, the loop (L) is 3 nucleotides in length. In some embodiments, the loop (L) is 4 nucleotides in length. In some embodiments, the loop (L) is 5 nucleotides in length. In some embodiments, the loop (L) is 6 nucleotides in length. In some embodiments, the loop (L) is 7 nucleotides in length. In some embodiments, the loop (L) is 8 nucleotides in length. In some embodiments, the loop (L) is 9 nucleotides in length. In some embodiments, the loop (L) is 10 nucleotides in length.
  • In some embodiments, the tetraloop comprises the sequence 5′-GAAA-3′. In some embodiments, the stem loop comprises the sequence 5′-GCAGCCGAAAGGCUGC-3′ (SEQ ID NO: 1681).
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, and the oligonucleotide comprises a sense strand comprising (e.g., at its 3′ end) a stem-loop set forth as: S1-L-S2, in which S1 is complementary to S2, and in which L forms a single-stranded loop between S1 and S2 of up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length). In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384, and the oligonucleotide comprises a sense strand comprising (e.g., at its 3′ end) a stem-loop set forth as: S1-L-S2, in which S1 is complementary to S2, and in which L forms a single-stranded loop between S1 and S2 of 4 nucleotides in length.
  • In some embodiments, a loop (L) of a stem-loop having the structure S1-L-S2 as described herein is a triloop. In some embodiments, the oligonucleotide comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384 and a triloop. In some embodiments, the triloop comprises ribonucleotides, deoxyribonucleotides, modified nucleotides, ligands (e.g., delivery ligands), and combinations thereof.
  • In some embodiments, a loop (L) of a stem-loop having the structure S1-L-S2 as described above is a tetraloop as describe in U.S. Pat. 10,131,912, incorporated herein by reference. In some embodiments, an oligonucleotide herein comprises a targeting sequence or a region of complementary that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 1-384 and a tetraloop. In some embodiments, the tetraloop comprises ribonucleotides, deoxyribonucleotides, modified nucleotides, ligands (e.g., delivery ligands), and combinations thereof.
    • Duplex Length
  • In some embodiments, a duplex formed between a sense and antisense strand is at least 12 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is in the range of 12-30 nucleotides in length (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30, or 21 to 30 nucleotides in length). In some embodiments, a duplex formed between a sense and antisense strand is 12, 13, 14, 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 12 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 13 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 14 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 15 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 16 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 17 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 18 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 19 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 20 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 21 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 22 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 23 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 24 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 25 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 26 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 27 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 28 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 29 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand is 30 nucleotides in length. In some embodiments, a duplex formed between a sense and antisense strand does not span the entire length of the sense strand and/or antisense strand. In some embodiments, a duplex between a sense and antisense strand spans the entire length of either the sense or antisense strands. In some embodiments, a duplex between a sense and antisense strand spans the entire length of both the sense strand and the antisense strand. In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    wherein a duplex formed between a sense and antisense strand is in the range of 12-30 nucleotides in length (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30, or 21 to 30 nucleotides in length)
  • In some embodiments, a duplex between a sense and antisense strand spans the entire length of both the sense strand and the antisense strand. In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    wherein a duplex formed between a sense and antisense strand is in the range of 12-30 nucleotides in length (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30, or 21 to 30 nucleotides in length) Oligonucleotide Termini
  • In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand, wherein the termini of either or both strands comprise a blunt end. In some embodiments, an oligonucleotide herein comprises sense and antisense strands that are separate strands which form an asymmetric duplex region having an overhang at the 3′ terminus of the antisense strand. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the termini of either or both strands comprise an overhang comprising one or more nucleotides. In some embodiments, the one or more nucleotides comprising the overhang are unpaired nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the 3′ termini of the sense strand and the 5′ termini of the antisense strand comprise a blunt end. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the 5′ termini of the sense strand and the 3′ termini of the antisense strand comprise a blunt end.
  • In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the 3′ terminus of either or both strands comprise a 3′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the sense strand comprises a 3′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 3′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein both the sense strand and the antisense strand comprises a 3′-overhang comprising one or more nucleotides.
  • In some embodiments, the 3′-overhang is about one (1) to twenty (20) nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleotides in length). In some embodiments, the 3′-overhang is about one (1) to nineteen (19), one (1) to eighteen (18), one (1) to seventeen (17), one (1) to sixteen (16), one (1) to fifteen (15), one (1) to fourteen (14), one (1) to thirteen (13), one (1) to twelve (12), one (1) to eleven (11), one (1) to ten (10), one (1) to nine (9), one (1) to eight (8), one (1) to seven (7), one (1) to six (6), one (1) to five (5), one (1) to four (4), one (1) to three (3), or about one (1) to two (2) nucleotides in length. In some embodiments, the 3′-overhang is (1) nucleotide in length. In some embodiments, the 3′-overhang is two (2) nucleotides in length. In some embodiments, the 3′-overhang is three (3) nucleotides in length. In some embodiments, the 3′-overhang is four (4) nucleotides in length. In some embodiments, the 3′-overhang is five (5) nucleotides in length. In some embodiments, the 3′-overhang is six (6) nucleotides in length. In some embodiments, the 3′-overhang is seven (7) nucleotides in length. In some embodiments, the 3′-overhang is eight (8) nucleotides in length. In some embodiments, the 3′-overhang is nine (9) nucleotides in length. In some embodiments, the 3′-overhang is ten (10) nucleotides in length. In some embodiments, the 3′-overhang is eleven (11) nucleotides in length. In some embodiments, the 3′-overhang is twelve (12) nucleotides in length. In some embodiments, the 3′-overhang is thirteen (13) nucleotides in length. In some embodiments, the 3′-overhang is fourteen (14) nucleotides in length. In some embodiments, the 3′-overhang is fifteen (15) nucleotides in length. In some embodiments, the 3′-overhang is sixteen (16) nucleotides in length. In some embodiments, the 3′-overhang is seventeen (17) nucleotides in length. In some embodiments, the 3′-overhang is eighteen (18) nucleotides in length. In some embodiments, the 3′-overhang is nineteen (19) nucleotides in length. In some embodiments, the 3′-overhang is twenty (20) nucleotides in length.
  • In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 3′-overhang, wherein the sense and antisense strands of the oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    and wherein the antisense strand comprises a 3′-overhang about one (1) to twenty (20) nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleotides in length), optionally wherein the 3′-overhang is two (2) nucleotides in length.
  • In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 3′-overhang, wherein the sense and antisense strands of the oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    and wherein the antisense strand comprises a 3′-overhang about one (1) to twenty (20) nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleotides in length), optionally wherein the 3′-overhang is two (2) nucleotides in length.
  • In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the 5′ terminus of either or both strands comprise a 5′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the sense strand comprises a 5′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 5′-overhang comprising one or more nucleotides. In some embodiments, an oligonucleotide herein comprises a sense strand and an antisense strand, wherein both the sense strand and the antisense strand comprises a 5′-overhang comprising one or more nucleotides.
  • In some embodiments, the 5′-overhang is about one (1) to twenty (20) nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleotides in length). In some embodiments, the 5′-overhang is about one (1) to nineteen (19), one (1) to eighteen (18), one (1) to seventeen (17), one (1) to sixteen (16), one (1) to fifteen (15), one (1) to fourteen (14), one (1) to thirteen (13), one (1) to twelve (12), one (1) to eleven (11), one (1) to ten (10), one (1) to nine (9), one (1) to eight (8), one (1) to seven (7), one (1) to six (6), one (1) to five (5), one (1) to four (4), one (1) to three (3), or about one (1) to two (2) nucleotides in length. In some embodiments, the 5′-overhang is (1) nucleotide in length. In some embodiments, the 5′-overhang is two (2) nucleotides in length. In some embodiments, the 5′-overhang is three (3) nucleotides in length. In some embodiments, the 5′-overhang is four (4) nucleotides in length. In some embodiments, the 5′-overhang is five (5) nucleotides in length. In some embodiments, the 5′-overhang is six (6) nucleotides in length. In some embodiments, the 5′-overhang is seven (7) nucleotides in length. In some embodiments, the 5′-overhang is eight (8) nucleotides in length. In some embodiments, the 5′-overhang is nine (9) nucleotides in length. In some embodiments, the 5′-overhang is ten (10) nucleotides in length. In some embodiments, the 5′-overhang is eleven (11) nucleotides in length. In some embodiments, the 5′-overhang is twelve (12) nucleotides in length. In some embodiments, the 5′-overhang is thirteen (13) nucleotides in length. In some embodiments, the 5′-overhang is fourteen (14) nucleotides in length. In some embodiments, the 5′-overhang is fifteen (15) nucleotides in length. In some embodiments, the 5′-overhang is sixteen (16) nucleotides in length. In some embodiments, the 5′-overhang is seventeen (17) nucleotides in length. In some embodiments, the 5′-overhang is eighteen (18) nucleotides in length. In some embodiments, the 5′-overhang is nineteen (19) nucleotides in length. In some embodiments, the 5′-overhang is twenty (20) nucleotides in length.
  • In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 5′-overhang, wherein the sense and antisense strands of the oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    and wherein the antisense strand comprises a 5′-overhang about one (1) to twenty (20) nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleotides in length), optionally wherein the 5′-overhang is two (2) nucleotides in length.
  • In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 5′-overhang, wherein the sense and antisense strands of the oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    and wherein the antisense strand comprises a 5′-overhang about one (1) to twenty (20) nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or about 20 nucleotides in length), optionally wherein the 5′-overhang is two (2) nucleotides in length.
  • In some embodiments, one or more (e.g., 2, 3, 4, 5, or more) nucleotides comprising the 3′ terminus or 5′ terminus of a sense and/or antisense strand are modified. For example, in some embodiments, one or two terminal nucleotides of the 3′ terminus of the antisense strand are modified. In some embodiments, the last nucleotide at the 3′ terminus of an antisense strand is modified, such that it comprises 2′ modification, or it comprises, a 2′-O-methoxyethyl. In some embodiments, the last one or two terminal nucleotides at the 3′ terminus of an antisense strand are complementary with the target. In some embodiments, the last one or two nucleotides at the 3′ terminus of the antisense strand are not complementary with the target.
  • In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand, wherein the 3′ terminus of the sense strand comprises a step-loop described herein and the 3′ terminus of the antisense strand comprises a 3′-overhang described herein. In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand that form a nicked tetraloop structure described herein, wherein the 3′ terminus of the sense strand comprises a stem-loop, wherein the loop is a tetraloop described herein, and wherein the 3′ terminus of the antisense strand comprises a 3′-overhang described herein. In some embodiments, the 3′-overhang is two (2) nucleotides in length. In some embodiments, the two (2) nucleotides comprising the 3′-overhang both comprise guanine (G) nucleobases. Typically, one or both of the nucleotides comprising the 3′-overhang of the antisense strand are not complementary with the target mRNA. An exemplary nicked tetraloop structure is provided in FIG. 12 . In some embodiments, an oligonucleotide described herein comprises the nicked tetraloop structure shown in FIG. 12 .
    • Oligonucleotide Modifications
  • In some embodiments, an oligonucleotide described herein (e.g., an RNAi oligonucleotide) comprises a modification. Oligonucleotides (e.g., RNAi oligonucleotides) may be modified in various ways to improve or control specificity, stability, delivery, bioavailability, resistance from nuclease degradation, immunogenicity, base-pairing properties, RNA distribution and cellular uptake and other features relevant to therapeutic or research use.
  • In some embodiments, the modification is a modified sugar. In some embodiments, the modification is a 5′-terminal phosphate group. In some embodiments, the modification is a modified internucleotide linkage. In some embodiments, the modification is a modified base. In some embodiments, an oligonucleotide described herein can comprise any one of the modifications described herein or any combination thereof. For example, in some embodiments, an oligonucleotide described herein comprises at least one modified sugar, a 5′-terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base. In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    wherein the oligonucleotide comprises at least one modified sugar, a 5′-terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base.
  • In some embodiments, an oligonucleotide described herein comprises at least one modified sugar, a 5′-terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base. In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    wherein the oligonucleotide comprises at least one modified sugar, a 5′-terminal phosphate group, at least one modified internucleotide linkage, and at least one modified base.
  • The number of modifications on an oligonucleotide (e.g., an RNAi oligonucleotide) and the position of those nucleotide modifications may influence the properties of an oligonucleotide. For example, oligonucleotides may be delivered in vivo by conjugating them to or encompassing them in a lipid nanoparticle (LNP) or similar carrier. However, when an oligonucleotide is not protected by an LNP or similar carrier, it may be advantageous for at least some of the nucleotides to be modified. Accordingly, in some embodiments, all or substantially all the nucleotides of an oligonucleotide are modified. In some embodiments, more than half of the nucleotides are modified. In some embodiments, less than half of the nucleotides are modified. In some embodiments, the sugar moiety of all nucleotides comprising the oligonucleotide is modified at the 2′ position. The modifications may be reversible or irreversible. In some embodiments, an oligonucleotide as disclosed herein has a number and type of modified nucleotides sufficient to cause the desired characteristics (e.g., protection from enzymatic degradation, capacity to target a desired cell after in vivo administration, and/or thermodynamic stability).
    • Sugar Modifications
  • In some embodiments, an oligonucleotide described herein (e.g., an RNAi oligonucleotide) comprises a modified sugar. In some embodiments, a modified sugar (also referred herein to a sugar analog) includes a modified deoxyribose or ribose moiety in which, for example, one or more modifications occur at the 2′, 3′, 4′, and/or 5′ carbon position of the sugar. In some embodiments, a modified sugar may also include non-natural alternative carbon structures such as those present in locked nucleic acids (“LNA”; see, e.g., Koshkin et al. (1998) TETRAHEDON 54:3607-30), unlocked nucleic acids (“UNA”; see, e.g., Snead et al. (2013) MOL. THER-NUCL. ACIDS 2:e103) and bridged nucleic acids (“BNA”; see, e.g., Imanishi & Obika (2002) CHEM COMMUN. (CAMB) 21:1653-59).
  • In some embodiments, a nucleotide modification in a sugar comprises a 2′-modification. In some embodiments, a 2′-modification may be 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-fluoro (2′-F), 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), or 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA). In some embodiments, the modification is 2′-F, 2′-OMe, or 2′-MOE. In some embodiments, a modification in a sugar comprises a modification of the sugar ring, which may comprise modification of one or more carbons of the sugar ring. For example, a modification of a sugar of a nucleotide may comprise a 2′-oxygen of a sugar is linked to a 1′-carbon or 4′-carbon of the sugar, or a 2′-oxygen is linked to the 1′-carbon or 4′-carbon via an ethylene or methylene bridge. In some embodiments, a modified nucleotide has an acyclic sugar that lacks a 2′-carbon to 3′-carbon bond. In some embodiments, a modified nucleotide has a thiol group, e.g., in the 4′ position of the sugar.
  • In some embodiments, an oligonucleotide (e.g., an RNAi oligonucleotide) described herein comprises at least about 1 modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, or more). In some embodiments, the sense strand of the oligonucleotide comprises at least about 1 modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, or more). In some embodiments, the antisense strand of the oligonucleotide comprises at least about 1 modified nucleotide (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, or more).
  • In some embodiments, all the nucleotides of the sense strand of the oligonucleotide are modified. In some embodiments, all the nucleotides of the antisense strand of the oligonucleotide are modified. In some embodiments, all the nucleotides of the oligonucleotide (i.e., both the sense strand and the antisense strand) are modified. In some embodiments, the modified nucleotide comprises a 2′-modification (e.g., a 2′-F or 2′-OMe, 2′-MOE, and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid).
  • In some embodiments, the current invention provides oligonucleotides having different modification patterns. In some embodiments, an oligonucleotide herein comprises a sense strand having a modification pattern as set forth in the Examples and Sequence Listing and an antisense strand having a modification pattern as set forth in the Examples and Sequence Listing.
  • In some embodiments, an oligonucleotide disclosed herein (e.g., an RNAi oligonucleotide) comprises an antisense strand having nucleotides that are modified with 2′-F. In some embodiments, an oligonucleotide herein comprises an antisense strand comprising nucleotides that are modified with 2′-F and 2′-OMe. In some embodiments, an oligonucleotide disclosed herein comprises a sense strand having nucleotides that are modified with 2′-F. In some embodiments, an oligonucleotide disclosed herein comprises a sense strand comprises nucleotides that are modified with 2′-F and 2′-OMe.
  • In some embodiments, an oligonucleotide described herein comprises a sense strand with about 10-15%, 10%, 11%, 12%, 13%, 14%, or 15% of the nucleotides of the sense strand comprising a 2′-fluoro modification. In some embodiments, about 11% of the nucleotides of the sense strand comprise a 2-fluoro modification. In some embodiments, an oligonucleotide described herein comprises an antisense strand with about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the antisense strand comprising a 2′-fluoro modification. In some embodiments, about 32% of the nucleotides of the antisense strand comprise a 2′-fluoro modification. In some embodiments, the oligonucleotide has about 15-25%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25% of its nucleotides comprising a 2′-fluoro modification. In some embodiments, about 19% of the nucleotides in the dsRNAi oligonucleotide comprise a 2′-fluoro modification.
  • In some embodiments, one or more of positions 8, 9, 10, or 11 of the sense strand is modified with a 2′-F group. In some embodiments, one or more of positions 3, 8, 9, 10, 12, 13, and 17 of the sense strand is modified with a 2′-F group. In some embodiments, one or more of positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand is modified with a 2′-F group. In some embodiments, one or more of positions 2, 3, 4, 5, 7, 8, 10, 14, 16, and 19 is modified with a 2′-F group. In some embodiments, the sugar moiety at each of nucleotides at positions 1-7 and 12-20 in the sense strand is modified with a 2′-OMe. In some embodiments, the sugar moiety at each of nucleotides at positions 1-7, 12-27, and 31-36 in the sense strand is modified with a 2′-OMe. In some embodiments, the sugar moiety at each of nucleotides at positions 6, 9, 11-13, 15, 17, 18, and 20-22 in the sense strand is modified with a 2′-OMe.
  • In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    wherein one or more of positions 8, 9, 10 or 11 of the sense strand is modified with a 2′-F group.
  • In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    wherein one or more of positions 8, 9, 10, or 11 of the sense strand is modified with a 2′-F group.
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 5, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 1, 2, 5, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 4, 5, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 1, 2, 3, 5, 7, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 4, 5, 7, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 1, 2, 3, 5, 10, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 4, 5, 10, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 5, 7, 10, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 4, 5, 7, 10, and 14 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety of each of the nucleotides at positions 2, 3, 4, 5, 7, 8, 10, 14, 16, and, 19 of the antisense strand modified with 2′-F and the sugar moiety of each of the remaining nucleotides of the antisense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, or position 22 modified with 2′-F.
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, or position 22 modified with 2′-OMe.
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, or position 22 modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 8-11 modified with 2′-F. In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 3, 8, 9, 10, 12, 13 and 17 modified with 2′-F. In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 1-7 and 12-17, or 12-20 modified with 2′OMe. In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 1-7, 12-27, and 31-36 modified with 2′OMe. In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety of each of the nucleotides at positions 1-7 and 12-17, or 12-20 of the sense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA). In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at positions 1-2, 4-7, 11, 14-16, and 18-20 modified with 2′OMe. In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety of each of the nucleotides at positions 1-2, 4-7, 11, 14-16, and 18-20 of the sense strand modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
  • In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14,position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, position 24, position 25, position 26, position 27, position 28, position 29, position 30, position 31, position 32, position 33, position 34, position 35, or position 36 modified with 2′-F.
  • In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, position 24, position 25, position 26, position 27, position 28, position 29, position 30, position 31, position 32, position 33, position 34, position 35, or position 36 modified with 2′-OMe.
  • In some embodiments, an oligonucleotide provided herein comprises a sense strand having the sugar moiety at position 1, position 2, position 3, position 4, position 5, position 6, position 7, position 8, position 9, position 10, position 11, position 12, position 13, position 14, position 15, position 16, position 17, position 18, position 19, position 20, position 21, position 22, position 23, position 24, position 25, position 26, position 27, position 28, position 29, position 30, position 31, position 32, position 33, position 34, position 35, or position 36 modified with a modification selected from the group consisting of 2′-O-propargyl, 2′-O-propylamin, 2′-amino, 2′-ethyl, 2′-aminoethyl (EA), 2′-O-methyl (2′-OMe), 2′-O-methoxyethyl (2′-MOE), 2′-O-[2-(methylamino)-2-oxoethyl] (2′-O-NMA), and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid (2′-FANA).
    • 5′-Terminal Phosphate
  • In some embodiments, an oligonucleotide described herein (e.g., an RNAi oligonucleotide) comprises a sense strand and an antisense strand, wherein the antisense strand comprises a 5′-terminal phosphate. In some embodiments, 5′-terminal phosphate groups of an RNAi oligonucleotide enhance the interaction with Ago2. However, oligonucleotides comprising a 5′-phosphate group may be susceptible to degradation via phosphatases or other enzymes, which can limit their performance and/or bioavailability in vivo. In some embodiments, an oligonucleotide herein includes analogs of 5′-phosphates that are resistant to such degradation. In some embodiments, the phosphate analog is oxymethyl phosphonate, vinylphosphonate or malonylphosphonate, or a combination thereof. In certain embodiments, the 5′ terminus of an oligonucleotide strand is attached to chemical moiety that mimics the electrostatic and steric properties of a natural 5′-phosphate group (“phosphate mimic”). In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    wherein the oligonucleotide comprises a 5′-terminal phosphate, optionally a 5′-terminal phosphate analog.
  • In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    wherein the oligonucleotide comprises a 5′-terminal phosphate, optionally a 5′-terminal phosphate analog.
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) has a phosphate analog at a 4′-carbon position of the sugar (referred to as a “4′-phosphate analog”). See, e.g., Intl. Patent Application Publication No. WO 2018/045317. In some embodiments, an oligonucleotide herein comprises a 4′-phosphate analog at a 5′-terminal nucleotide. In some embodiments, a phosphate analog is an oxymethyl phosphonate, in which the oxygen atom of the oxymethyl group is bound to the sugar moiety (e.g., at its 4′-carbon) or analog thereof. In other embodiments, a 4′-phosphate analog is a thiomethyl phosphonate or an aminomethyl phosphonate, in which the sulfur atom of the thiomethyl group or the nitrogen atom of the amino methyl group is bound to the 4′-carbon of the sugar moiety or analog thereof. In certain embodiments, a 4′-phosphate analog is an oxymethyl phosphonate. In some embodiments, an oxymethyl phosphonate is represented by the formula —O—CH2—PO(OH)2, —O—CH2—PO(OR)2, or —O—CH2—PO(OH)(R), in which R is independently selected from —H, —CH3, an alkyl group, —CH2CH2CN, —CH2OCOC(CH3)3, —CH2OCH2CH2Si(CH3)3 or a protecting group. In certain embodiments, the alkyl group is CH2CH3. More typically, R is independently selected from —H, —CH3 or —CH2CH3. In some embodiment, R is —CH3. In some embodiments, the 4′-phosphate analog is 5′-methoxyphosphonate-4′-oxy.
  • In some embodiments, an oligonucleotide provided herein comprises an antisense strand comprising a 4′-phosphate analog at the 5′-terminal nucleotide, wherein 5′-terminal nucleotide comprises the following structure:
  • Figure US20230340490A1-20231026-C00005
  • 5′-methoxyphosphonate-4′-oxy-2′-O-methyluridine phosphorothioate [MePhosphonate-40-mUs].
    • Modified Internucleotide Linkage
  • In some embodiments, an oligonucleotide provided herein (e.g., a RNAi oligonucleotide) comprises a modified internucleotide linkage. In some embodiments, phosphate modifications or substitutions result in an oligonucleotide that comprises at least about 1 (e.g., at least 1, at least 2, at least 3, or at least 5) modified internucleotide linkage. In some embodiments, any one of the oligonucleotides disclosed herein comprises about 1 to about 10 (e.g., 1 to 10, 2 to 8, 4 to 6, 3 to 10, 5 to 10, 1 to 5, 1 to 3, or 1 to 2) modified internucleotide linkages. In some embodiments, any one of the oligonucleotides disclosed herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified internucleotide linkages.
  • A modified internucleotide linkage may be a phosphorodithioate linkage, a phosphorothioate linkage, a phosphotriester linkage, a thionoalkylphosphonate linkage, a thionalkylphosphotriester linkage, a phosphoramidite linkage, a phosphonate linkage or a boranophosphate linkage. In some embodiments, at least one modified internucleotide linkage of any one of the oligonucleotides as disclosed herein is a phosphorothioate linkage.
  • In some embodiments, an oligonucleotide provided herein (e.g., a RNAi oligonucleotide) has a phosphorothioate linkage between one or more of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In some embodiments, the oligonucleotide described herein has a phosphorothioate linkage between each of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (1) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    wherein the oligonucleotide comprises a modified internucleotide linkage.
  • In some embodiments, the oligonucleotide described herein has a phosphorothioate linkage between each of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    wherein the oligonucleotide comprises a modified internucleotide linkage. Base Modifications
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotides) comprises one or more modified nucleobases. In some embodiments, modified nucleobases (also referred to herein as base analogs) are linked at the 1′ position of a nucleotide sugar moiety. In certain embodiments, a modified nucleobase is a nitrogenous base. In some embodiments, a modified nucleobase does not contain nitrogen atom. See, e.g., U.S. Pat. Application Publication No. 2008/0274462. In some embodiments, a modified nucleotide comprises a universal base. In some embodiments, a modified nucleotide does not contain a nucleobase (abasic). In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    wherein the oligonucleotide comprises one or more modified nucleobases.
  • In some embodiments, a modified nucleotide comprises a universal base. In some embodiments, a modified nucleotide does not contain a nucleobase (abasic). In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    wherein the oligonucleotide comprises one or more modified nucleobases.
  • In some embodiments, a universal base is a heterocyclic moiety located at the 1′ position of a nucleotide sugar moiety in a modified nucleotide, or the equivalent position in a nucleotide sugar moiety substitution, that, when present in a duplex, can be positioned opposite more than one type of base without substantially altering structure of the duplex. In some embodiments, compared to a reference single-stranded nucleic acid (e.g., oligonucleotide) that is fully complementary to a target nucleic acid (e.g., a MARC1 mRNA), a single-stranded nucleic acid containing a universal base forms a duplex with the target nucleic acid that has a lower Tm than a duplex formed with the complementary nucleic acid. In some embodiments, when compared to a reference single-stranded nucleic acid in which the universal base has been replaced with a base to generate a single mismatch, the single-stranded nucleic acid containing the universal base forms a duplex with the target nucleic acid that has a higher Tm than a duplex formed with the nucleic acid comprising the mismatched base.
  • Non-limiting examples of universal-binding nucleotides include, but are not limited to, inosine, 1-β-D-ribofuranosyl-5-nitroindole and/or 1-β-D-ribofuranosyl-3-nitropyrrole (see, U.S. Pat. Application Publication No. 2007/0254362; Van Aerschot et al. (1995) NUCLEIC ACIDS RES. 23:4363-4370; Loakes et al. (1995) NUCLEIC ACIDS RES. 23:2361-66; and Loakes & Brown (1994) NUCLEIC ACIDS RES. 22:4039-43).
    • Targeting Ligands
  • In some embodiments, it is desirable to target an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) to one or more cells or cell type, tissues, organs, or anatomical regions or compartments. Such a strategy may help to avoid undesirable effects to the organism treated and/or to avoid undue loss of the oligonucleotide to cells, tissues, organs, or anatomical regions or compartments that would not benefit from the oligonucleotide or its effects (e.g., inhibition or reduction of MARC1 expression). Accordingly, in some embodiments, oligonucleotides disclosed herein (e.g., RNAi oligonucleotides) are modified to facilitate targeting and/or delivery to particular cells or cell types, tissues, organs, or anatomical regions or compartments (e.g., to facilitate delivery of the oligonucleotide to the liver). In some embodiments, an oligonucleotide comprises at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6, or more nucleotides) conjugated to one or more targeting ligand(s). In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    wherein the oligonucleotide comprises a targeting ligand conjugated to at least one nucleotide.
  • In some embodiments, an oligonucleotide comprises at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6, or more nucleotides) conjugated to one or more targeting ligand(s). In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    wherein the oligonucleotide comprises a targeting ligand conjugated to at least one nucleotide.
  • In some embodiments, the targeting ligand comprises a carbohydrate, amino sugar, cholesterol, peptide, polypeptide, protein, or part of a protein (e.g., an antibody or antibody fragment), or lipid. In certain embodiments, the targeting ligand is a carbohydrate comprising at least one GalNAc moiety.
  • In some embodiments, 1 or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) are each conjugated to a separate targeting ligand (e.g., a GalNAc moiety). In some embodiments, 2 to 4 nucleotides of an oligonucleotide are each conjugated to a separate targeting ligand. In some embodiments, targeting ligands are conjugated to 2 to 4 nucleotides at either ends of the sense or antisense strand (e.g., targeting ligands are conjugated to a 2 to 4 nucleotide overhang or extension on the 5′ or 3′ terminus of the sense or antisense strand) such that the targeting ligands resemble bristles of a toothbrush, and the oligonucleotide resembles a toothbrush. For example, an oligonucleotide may comprise a stem-loop at either the 5′ or 3′ terminus of the sense strand and 1, 2, 3, or 4 nucleotides of the loop of the stem may be individually conjugated to a targeting ligand. In some embodiments, an oligonucleotide provided by the current invention (e.g., a RNAi oligonucleotide) comprises a stem-loop at the 3′ terminus of the sense strand, wherein the loop of the stem-loop comprises a triloop or a tetraloop, and wherein the 3 or 4 nucleotides comprising the triloop or tetraloop, respectively, are individually conjugated to a targeting ligand. In some embodiments, an oligonucleotide provided by the current invention (e.g., a RNAi oligonucleotide) comprises a stem-loop at the 3′ terminus of the sense strand, wherein the loop of the stem-loop comprises a tetraloop, and wherein 3 nucleotides of the tetraloop are individually conjugated to a targeting ligand.
  • GalNAc is a high affinity carbohydrate ligand for the asialoglycoprotein receptor (ASGPR), which is primarily expressed on the surface of hepatocyte cells and has a major role in binding, internalizing and subsequent clearing circulating glycoproteins that contain terminal galactose or GalNAc residues (asialoglycoproteins). Conjugation (either indirect or direct) of GalNAc moieties to oligonucleotides of the instant disclosure can be used to target these oligonucleotides to the ASGPR expressed on cells. In some embodiments, an oligonucleotide of the instant disclosure (e.g., an RNAi oligonucleotide) is conjugated to at least one or more GalNAc moieties, wherein the GalNAc moieties target the oligonucleotide to an ASGPR expressed on human liver cells (e.g., human hepatocytes). In some embodiments, the GalNAc moiety target the oligonucleotide to the liver.
  • In some embodiments, an oligonucleotide of the instant disclosure (e.g., an RNAi oligonucleotide) is conjugated directly or indirectly to a monovalent GalNAc moiety. In some embodiments, the oligonucleotide is conjugated directly or indirectly to more than one monovalent GalNAc (i.e., is conjugated to 2, 3 or 4 monovalent GalNAc moieties and is typically conjugated to 3 or 4 monovalent GalNAc moieties). In some embodiments, an oligonucleotide is conjugated to one or more bivalent GalNAc, trivalent GalNAc or tetravalent GalNAc moieties. In some embodiments, a bivalent, trivalent or tetravalent GalNAc moiety is conjugated to an oligonucleotide via a branched linker. In some embodiments, a monovalent GalNAc moiety is conjugated to a first nucleotide and a bivalent, trivalent, or tetravalent GalNAc moiety is conjugated to a second nucleotide via a branched linker.
  • In some embodiments, one (1) or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of an oligonucleotide described herein (e.g., an RNAi oligonucleotide) are each conjugated to a GalNAc moiety. In some embodiments, two (2) to four (4) nucleotides of a tetraloop are each conjugated to a separate GalNAc moiety. In some embodiments, one (1) to three (3) nucleotides of a triloop are each conjugated to a separate GalNAc moiety. In some embodiments, targeting ligands are conjugated to two (2) to four (4) nucleotides at either ends of the sense or antisense strand (e.g., ligands are conjugated to a two (2) to four (4) nucleotide overhang or extension on the 5′ or 3′ terminus of the sense or antisense strand) such that the GalNAc moieties resemble bristles of a toothbrush and the oligonucleotide resembles a toothbrush. In some embodiments, GalNAc moieties are conjugated to a nucleotide of the sense strand. For example, three (3) or four (4) GalNAc moieties can be conjugated to nucleotides in the tetraloop of the sense strand where each GalNAc moiety is conjugated to one (1) nucleotide.
  • In some embodiments, an oligonucleotide described herein (e.g., an RNAi oligonucleotide) comprises a tetraloop, wherein the tetraloop (L) is any combination of adenine (A) and guanine (G) nucleotides. In some embodiments, the tetraloop (L) comprises a monovalent GalNAc moiety attached to any one or more guanine (G) nucleotides of the tetraloop via any linker described herein, as depicted below (X = heteroatom):
  • Figure US20230340490A1-20231026-C00006
  • In some embodiments, the tetraloop (L) has a monovalent GalNAc attached to any one or more adenine nucleotides of the tetraloop via any linker described herein, as depicted below (X = heteroatom):
  • Figure US20230340490A1-20231026-C00007
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide) comprises a monovalent GalNAc moiety attached to a guanine (G) nucleotide referred to as [ademG-GalNAc] or 2′-aminodiethoxymethanol-Guanine-GalNAc, as depicted below:
  • Figure US20230340490A1-20231026-C00008
  • In some embodiments, an oligonucleotide herein comprises a monovalent GalNAc moiety attached to an adenine nucleotide, referred to as [ademA-GalNAc] or 2′-aminodiethoxymethanol-Adenine-GalNAc, as depicted below:
  • Figure US20230340490A1-20231026-C00009
  • An example of such conjugation is shown below for a loop comprising from 5′ to 3′ the nucleotide sequence GAAA (L = linker, X = heteroatom). Such a loop may be present, for example, at positions 27-30 of a sense strand provided herein. In the chemical formula,
  • Figure US20230340490A1-20231026-C00010
  • is used to describe an attachment point to the oligonucleotide strand.
  • Figure US20230340490A1-20231026-C00011
  • Appropriate methods or chemistry (e.g., click chemistry) can be used to link a targeting ligand to a nucleotide. In some embodiments, a targeting ligand is conjugated to a nucleotide comprising an oligonucleotide herein (e.g., an RNAi oligonucleotide) using a click linker. In some embodiments, an acetal-based linker is used to conjugate a targeting ligand to a nucleotide of any one of the oligonucleotides described herein. Acetal-based linkers are disclosed, for example, in Intl. Patent Application Publication No. WO2016/100401. In some embodiments, the linker is a labile linker. However, in other embodiments, the linker is stable. An example is shown below for a loop comprising from 5′ to 3′ the nucleotides GAAA, in which GalNAc moieties are attached to nucleotides of the loop using an acetal linker. Such a loop may be present, for example, at positions 27-30 of the any one of the sense strands. In the chemical formula,
  • Figure US20230340490A1-20231026-C00012
  • is an attachment point to the oligonucleotide strand.
  • Figure US20230340490A1-20231026-C00013
  • Figure US20230340490A1-20231026-C00014
  • As mentioned, various appropriate methods or chemistry synthetic techniques (e.g., click chemistry) can be used to link a targeting ligand to a nucleotide. In some embodiments, a targeting ligand is conjugated to a nucleotide using a click linker. In some embodiments, an acetal-based linker is used to conjugate a targeting ligand to a nucleotide of any one of the oligonucleotides described herein. Acetal-based linkers are disclosed, for example, in Intl. Patent Application Publication No. WO 2016/100401. In some embodiments, the linker is a labile linker. However, in other embodiments, the linker is a stable linker.
  • In some embodiments, a duplex extension (e.g., of up to 3, 4, 5, or 6 bp in length) is provided between a targeting ligand (e.g., a GalNAc moiety) and the oligonucleotide. In some embodiments, the oligonucleotides herein (e.g., RNAi oligonucleotides) do not have a GalNAc conjugated thereto.
  • In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively,
    wherein the oligonucleotide comprises at least one GalNAc moiety conjugated to a nucleotide.
  • In some embodiments, the sense and antisense strands of an oligonucleotide comprise nucleotides sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1543 and 1579, respectively;
    • (b) SEQ ID NOs: 1560 and 1596, respectively;
    • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
    • (d) SEQ ID NOs: 1553 and 1589, respectively,
    wherein the oligonucleotide comprises at least one GalNAc moiety conjugated to a nucleotide. Exemplary Oligonucleotides for Reducing MARC1 Expression
  • In some embodiments, the MARC1-targeting dsRNAi oligonucleotide for reducing MARC1 expression provided by the current invention comprise a sense strand and an antisense strand, wherein all nucleotides comprising the sense strand and antisense strand are modified, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length. In some embodiments, the 5′-terminal nucleotide of the antisense strand comprises 5′-methoxyphosphonate-4′-oxy-2′-O-methyluridine [MePhosphonate-40-mU], as described herein. In some embodiments, the 5′-terminal nucleotide of the antisense strand comprises a phosphorothioate linkage. In some embodiments, the antisense strand and the sense strand comprise one or more 2′-fluoro (2′ -F) and 2′-O-methyl (2′-OMe) modified nucleotides and at least one phosphorothioate linkage. In some embodiments, the antisense strand comprises four (4) phosphorothioate linkages and the sense strand comprises one (1) phosphorothioate linkage. In some embodiments, the antisense strand comprises five (5) phosphorothioate linkages and the sense strand comprises one (1) phosphorothioate linkage.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand having a sequence of any one of SEQ ID NOs: 769-1152 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1153-1536.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand having a sequence of any one of SEQ ID NOs: 1537-1570 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1573-1606.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) comprises a sense strand having a sequence of any one of SEQ ID NOs: 1609-1642 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 1645-1678.
  • In some embodiments, an oligonucleotide provided herein (e.g., and RNAi oligonucleotide) for reducing MARC1 expression comprises:
    • a sense strand comprising a 2′-F modified nucleotide at positions 8-11, a 2′-OMe modified nucleotide at positions 1-7, 12-27, and 31-36, a GalNAc-conjugated nucleotide at position 28, 29, and 30; and a phosphorothioate linkage between positions 1 and 2;
    • an antisense strand comprising a 2′-F modified nucleotide at positions 2, 3, 4, 5, 7, 10 and 14, a 2′-OMe at positions 1, 6, 8, 9, 11-13, and 15-22, a phosphorothioate linkage between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 20 and 21, and positions 21 and 22, and a 5′-terminal nucleotide at position 1 comprising a 4′-phosphate analog, optionally wherein the 5′-terminal nucleotide comprises 5′-methoxyphosphonate-4′-oxy-2′-O-methyluridine [MePhosphonate-4O-mU]; wherein positions 1-20 of the antisense strand form a duplex region with positions 1-20 of the sense strand, wherein positions 21-36 of the sense strand form a stem-loop, wherein positions 27-30 form the loop of the stem-loop, optionally wherein positions 27-30 comprise a tetraloop, wherein positions 21 and 22 of the antisense strand comprise an overhang, and wherein the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
      • (a) SEQ ID NOs: 1537 and 1573, respectively;
      • (b) SEQ ID NOs: 1538 and 1574, respectively;
      • (c) SEQ ID NOs: 1539 and 1575, respectively;
      • (d) SEQ ID NOs: 1540 and 1576, respectively;
      • (e) SEQ ID NOs: 1541 and 1577, respectively;
      • (f) SEQ ID NOs: 1542 and 1578, respectively;
      • (g) SEQ ID NOs: 1543 and 1579, respectively;
      • (h) SEQ ID NOs: 1544 and 1580, respectively;
      • (i) SEQ ID NOs: 1545 and 1581, respectively;
      • (j) SEQ ID NOs: 1546 and 1582, respectively;
      • (k) SEQ ID NOs: 1547 and 1583, respectively;
      • (l) SEQ ID NOs: 1548 and 1584, respectively;
      • (m) SEQ ID NOs: 1549 and 1585, respectively;
      • (n) SEQ ID NOs: 1550 and 1586, respectively;
      • (o) SEQ ID NOs: 1551 and 1587, respectively;
      • (p) SEQ ID NOs: 1552 and 1588, respectively;
      • (q) SEQ ID NOs: 1553 and 1589, respectively;
      • (r) SEQ ID NOs: 1554 and 1590, respectively;
      • (s) SEQ ID NOs: 1555 and 1591, respectively;
      • (t) SEQ ID NOs: 1556 and 1592, respectively;
      • (u) SEQ ID NOs: 1557 and 1593, respectively;
      • (v) SEQ ID NOs: 1558 and 1594, respectively;
      • (w) SEQ ID NOs: 1559 and 1595, respectively;
      • (x) SEQ ID NOs: 1560 and 1596, respectively;
      • (y) SEQ ID NOs: 1561 and 1597, respectively;
      • (z) SEQ ID NOs: 1562 and 1598, respectively;
      • (aa) SEQ ID NOs: 1563 and 1599, respectively;
      • (bb) SEQ ID NOs: 1564 and 1600, respectively;
      • (cc) SEQ ID NOs: 1565 and 1601, respectively;
      • (dd) SEQ ID NOs: 1566 and 1602, respectively;
      • (ee) SEQ ID NOs: 1567 and 1603, respectively;
      • (ff) SEQ ID NOs: 1568 and 1604, respectively;
      • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
      • (hh) SEQ ID NOs: 1570 and 1606, respectively,
  • In some embodiments, the MARC1-targeting dsRNAi oligonucleotides for reducing MARC1 expression comprise:
    • a sense strand comprising a 2′-F modified nucleotide at positions 8-11, a 2′-OMe modified nucleotide at positions 1-7, 12-27, and 31-36, a GalNAc-conjugated nucleotide at position 28, 29 and 30; and a phosphorothioate linkage between positions 1 and 2;
    • an antisense strand comprising a 2′-F modified nucleotide at positions 2, 3, 4, 5, 7, 10, and 14, a 2′-OMe at positions 1, 6, 8, 9, 11-13, and 15-22, a phosphorothioate linkage between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 20 and 21, and positions 21 and 22, and a 5′-terminal nucleotide at position 1 comprising a 4′-phosphate analog, optionally wherein the 5′-terminal nucleotide comprises 5′-methoxyphosphonate-4′-oxy-2′-O-methyluridine [MePhosphonate-4O-mU]; wherein positions 1-20 of the antisense strand form a duplex region with positions 1-20 of the sense strand, wherein positions 21-36 of the sense strand form a stem-loop, wherein positions 27-30 form the loop of the stem-loop, optionally wherein positions 27-30 comprise a tetraloop, wherein positions 21 and 22 of the antisense strand comprise an overhang, and wherein the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
      • (a) SEQ ID NOs: 1543 and 1579, respectively;
      • (b) SEQ ID NOs: 1560 and 1596, respectively;
      • (c) SEQ ID NOs: 1568 and 1604, respectively; and,
      • (d) SEQ ID NOs: 1553 and 1589, respectively.
  • In some embodiments, a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1543 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1579. In some embodiments, a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1560 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1596. In some embodiments, a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1568 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1604. In some embodiments, a MARC1 -targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1553 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1589.
  • In some embodiments, a MARC1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 618; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 682; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 740; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 760; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 618; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 682; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 740; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 760; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 618; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 234, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 682; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 298, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 740; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 356, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 760; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 376, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 618; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 234, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 682; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 298, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 740; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 356, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, a MARC 1-targeting dsRNAi oligonucleotide for reducing MARC1 expression comprises (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is set forth in SEQ ID NO: 760; and (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand and a stem-loop at the 3′ terminus, wherein the region of complementarity to the antisense strand is set forth in SEQ ID NO: 376, wherein the stem-loop is set forth as S1-L-S2, wherein S1 is complementary to S2 and wherein L forms a loop between S1 and S2 of 3 to 5 nucleotides in length, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • In some embodiments, the current invention provides an oligonucleotide (e.g., an RNAi oligonucleotide) for reducing MARC1 expression, wherein the oligonucleotide comprises a sense strand and an antisense strand according to:
    • Sense Strand: 5′-mX-S-mX-mX-mX-mX-mX-mX-fX-fX-fX-fX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-mX-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mX-mX-mX-mX-mX-mX-3′; hybridized to:
    • Antisense Strand: 5′-[MePhosphonate-4O-mX]-S-fX-S-fX-S-fX-fX-mX-fX-mX-mX-fX-mX-mX-mX-fX-mX-mX-mX-mX-mX-mX-S-mX-S-mX-3′;
    • wherein mX = 2′-O-methyl modified nucleotide, fX = 2′-fluoro modified nucleotide, -S- = phosphorothioate linkage, - = phosphodiester linkage, [MePhosphonate-4O-mX] = 5′-methoxyphosphonate-4-oxy modified nucleotide, and ademA-GalNAc = GalNAc attached to an adenine nucleotide.
  • In some embodiments, the current invention provides an oligonucleotide (e.g., an RNAi oligonucleotide) for reducing MARC1 expression, wherein the oligonucleotide comprises a sense strand and an antisense strand comprising nucleotide sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1609 and 1645, respectively;
    • (b) SEQ ID NOs: 1610 and 1646, respectively;
    • (c) SEQ ID NOs: 1611 and 1647, respectively;
    • (d) SEQ ID NOs: 1612 and 1648, respectively;
    • (e) SEQ ID NOs: 1613 and 1649, respectively;
    • (f) SEQ ID NOs: 1614 and 1650, respectively;
    • (g) SEQ ID NOs: 1615 and 1651, respectively;
    • (h) SEQ ID NOs: 1616 and 1652, respectively;
    • (i) SEQ ID NOs: 1617 and 1653, respectively;
    • (j) SEQ ID NOs: 1618 and 1654, respectively;
    • (k) SEQ ID NOs: 1619 and 1655, respectively;
    • (l) SEQ ID NOs: 1620 and 1656, respectively;
    • (m) SEQ ID NOs: 1621 and 1657, respectively;
    • (n) SEQ ID NOs: 1622 and 1658, respectively;
    • (o) SEQ ID NOs: 1623 and 1659, respectively;
    • (p) SEQ ID NOs: 1624 and 1660, respectively;
    • (q) SEQ ID NOs: 1625 and 1661, respectively;
    • (r) SEQ ID NOs: 1626 and 1662, respectively;
    • (s) SEQ ID NOs: 1627 and 1663, respectively;
    • (t) SEQ ID NOs: 1628 and 1664, respectively;
    • (u) SEQ ID NOs: 1628 and 1665, respectively;
    • (v) SEQ ID NOs: 1630 and 1666, respectively;
    • (w) SEQ ID NOs: 1631 and 1667, respectively;
    • (x) SEQ ID NOs: 1632 and 1668, respectively;
    • (y) SEQ ID NOs: 1633 and 1669, respectively;
    • (z) SEQ ID NOs: 1634 and 1670, respectively;
    • (aa) SEQ ID NOs: 1635 and 1671, respectively;
    • (bb) SEQ ID NOs: 1636 and 1672, respectively;
    • (cc) SEQ ID NOs: 1637 and 1673, respectively;
    • (dd) SEQ ID NOs: 1638 and 1674, respectively;
    • (ee) SEQ ID NOs: 1639 and 1675, respectively;
    • (ff) SEQ ID NOs: 1640 and 1676, respectively;
    • (gg) SEQ ID NOs: 1641 and 1677, respectively; and,
    • (hh) SEQ ID NOs: 1642 and 1678, respectively,
  • In some embodiments, a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1615 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1651. In some embodiments, a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1632 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1668. In some embodiments, a MARC1-targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1640 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1676. In some embodiments, a MARC1 -targeting oligonucleotide for reducing MARC1 expression provided by the current invention comprises a sense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1625 and an antisense strand comprising the nucleotide sequence as set forth in SEQ ID NO: 1661.
    • Formulations
  • Various formulations (e.g., pharmaceutical formulations) have been developed for oligonucleotide use. For example, oligonucleotides (e.g., RNAi oligonucleotides) can be delivered to a subject or a cellular environment using a formulation that minimizes degradation, facilitates delivery and/or uptake, or provides another beneficial property to the oligonucleotides in the formulation. In some embodiments, provided herein are compositions comprising oligonucleotides (e.g., RNAi oligonucleotides) reduce the expression of MARC1. Such compositions can be suitably formulated such that when administered to a subject, either into the immediate environment of a target cell or systemically, a sufficient portion of the oligonucleotides enter the cell to reduce MARC1 expression. Any variety of suitable oligonucleotide formulations can be used to deliver oligonucleotides for the reduction of MARC1 as disclosed herein. In some embodiments, an oligonucleotide is formulated in buffer solutions such as PBS solutions, liposomes, micellar structures, and capsids. Any of the oligonucleotides described herein may be provided not only as nucleic acids, but also in the form of a pharmaceutically acceptable salt.
  • Formulations of oligonucleotides with cationic lipids can be used to facilitate transfection of the oligonucleotides into cells. For example, cationic lipids, such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g., polylysine), can be used. Suitable lipids include Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6 (Roche) all of which can be used according to the manufacturer’s instructions.
  • Accordingly, in some embodiments, a formulation comprises a lipid nanoparticle. In some embodiments, an excipient comprises a liposome, a lipid, a lipid complex, a microsphere, a microparticle, a nanosphere or a nanoparticle, or may be otherwise formulated for administration to the cells, tissues, organs, or body of a subject in need thereof (see, e.g., Remington: THE SCIENCE AND PRACTICE OF PHARMACY, 22nd edition, Pharmaceutical Press, 2013).
  • In some embodiments, the formulations herein comprise an excipient. In some embodiments, an excipient confers to a composition improved stability, improved absorption, improved solubility and/or therapeutic enhancement of the active ingredient. In some embodiments, an excipient is a buffering agent (e.g., sodium citrate, sodium phosphate, a tris base, or sodium hydroxide) or a vehicle (e.g., a buffered solution, petrolatum, dimethyl sulfoxide, or mineral oil). In some embodiments, an oligonucleotide is lyophilized for extending its shelf-life and then made into a solution before use (e.g., administration to a subject). Accordingly, an excipient in a composition comprising any one of the oligonucleotides described herein may be a lyoprotectant (e.g., mannitol, lactose, polyethylene glycol or polyvinylpyrrolidone) or a collapse temperature modifier (e.g., dextran, Ficoll™ or gelatin).
  • In some embodiments, a pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intramuscular, intraperitoneal, intradermal, subcutaneous), oral (e.g., inhalation), transdermal (e.g., topical), transmucosal and rectal administration.
  • Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or PBS. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Sterile injectable solutions can be prepared by incorporating the oligonucleotides in a required amount in a selected solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • In some embodiments, a composition may contain at least about 0.1% of the therapeutic agent (e.g., a RNAi oligonucleotide for reducing MARC1 expression) or more, although the percentage of the active ingredient(s) may be between about 1% to about 80% or more of the weight or volume of the total composition. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
    • Methods of Use Reducing MARC1 Expression
  • In some embodiments, the current invention provides methods for contacting or delivering to a cell or population of cells an effective amount of oligonucleotides provided herein (e.g., RNAi oligonucleotides) to reduce MARC1 expression. In some embodiments, a reduction of MARC1 expression is determined by measuring a reduction in the amount or level of MARC1 mRNA, MARC1 protein, or MARC1 activity in a cell. The methods include those described herein and known to one of ordinary skill in the art.
  • Methods provided herein are useful in any appropriate cell type. In some embodiments, a cell is any cell that expresses MARC1 mRNA (e.g., hepatocytes). In some embodiments, the cell is a primary cell obtained from a subject. In some embodiments, the primary cell has undergone a limited number of passages such that the cell substantially maintains its natural phenotypic properties. In some embodiments, a cell to which the oligonucleotide is delivered is ex vivo or in vitro (i.e., can be delivered to a cell in culture or to an organism in which the cell resides).
  • In some embodiments, the oligonucleotides herein (e.g., RNAi oligonucleotides) are delivered to a cell or population of cells using a nucleic acid delivery method known in the art including, but not limited to, injection of a solution containing the oligonucleotides, bombardment by particles covered by the oligonucleotides, exposing the cell or population of cells to a solution containing the oligonucleotides, or electroporation of cell membranes in the presence of the oligonucleotides. Other methods known in the art for delivering oligonucleotides to cells may be used, such as lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection such as calcium phosphate, and others.
  • In some embodiments, reduction of MARC1 expression is determined by an assay or technique that evaluates one or more molecules, properties, or characteristics of a cell or population of cells associated with MARC1 expression, or by an assay or technique that evaluates molecules that are directly indicative of MARC1 expression in a cell or population of cells (e.g., MARC1 mRNA or MARC1 protein). In some embodiments, the extent to which an oligonucleotide provided herein reduces MARC1 expression is evaluated by comparing MARC1 expression in a cell or population of cells contacted with the oligonucleotide to an appropriate control (e.g., an appropriate cell or population of cells not contacted with the oligonucleotide or contacted with a control oligonucleotide). In some embodiments, a control amount or level of MARC1 expression in a control cell or population of cells is predetermined, such that the control amount or level need not be measured in every instance the assay or technique is performed. The predetermined level or value can take a variety of forms. In some embodiments, a predetermined level or value can be single cut-off value, such as a median or mean.
  • In some embodiments, contacting or delivering an oligonucleotide described herein (e.g., an RNAi oligonucleotide) to a cell or a population of cells results in a reduction in MARC1 expression in a cell or population of cells not contacted with the oligonucleotide or contacted with a control oligonucleotide. In some embodiments, the reduction in MARC1 expression is about 1% or lower, about 5% or lower, about 10% or lower, about 15% or lower, about 20% or lower, about 25% or lower, about 30% or lower, about 35% or lower, about 40% or lower, about 45% or lower, about 50% or lower, about 55% or lower, about 60% or lower, about 70% or lower, about 80% or lower, or about 90% or lower relative to a control amount or level of MARC1 expression. In some embodiments, the control amount or level of MARC1 expression is an amount or level of MARC1 mRNA and/or MARC 1 protein in a cell or population of cells that has not been contacted with an oligonucleotide herein. In some embodiments, the effect of delivery of an oligonucleotide herein to a cell or population of cells according to a method herein is assessed after any finite period or amount of time (e.g., minutes, hours, days, weeks, months). For example, in some embodiments, MARC1 expression is determined in a cell or population of cells at least about 4 hours, about 8 hours, about 12 hours, about 18 hours, about 24 hours; or at least about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, about 56 days, about 63 days, about 70 days, about 77 days, or about 84 days or more after contacting or delivering the oligonucleotide to the cell or population of cells. In some embodiments, MARC1 expression is determined in a cell or population of cells at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, or about 6 months or more after contacting or delivering the oligonucleotide to the cell or population of cells.
  • In some embodiments, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide) is delivered in the form of a transgene that is engineered to express in a cell the oligonucleotide or strands comprising the oligonucleotide (e.g., its sense and antisense strands). In some embodiments, an oligonucleotide herein is delivered using a transgene engineered to express any oligonucleotide disclosed herein. Transgenes may be delivered using viral vectors (e.g., adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, or herpes simplex virus) or non-viral vectors (e.g., plasmids or synthetic mRNAs). In some embodiments, transgenes can be injected directly to a subject.
    • Treatment Methods
  • The current invention provides oligonucleotides (e.g., RNAi oligonucleotides) for use as a medicament, in particular for use in a method for the treatment of diseases, disorders, and conditions associated with expression of MARC1.The current invention also provides oligonucleotides for use, or adaptable for use, to treat a subject (e.g., a human having a disease, disorder or condition associated with MARC1 expression) that would benefit from reducing MARC1 expression. In some respects, the current invention provides oligonucleotides for use, or adapted for use, to treat a subject having a disease, disorder or condition associated with expression of MARC1.The current invention also provides oligonucleotides for use, or adaptable for use, in the manufacture of a medicament or pharmaceutical composition for treating a disease, disorder or condition associated with MARC1 expression. In some embodiments, the oligonucleotides for use, or adaptable for use, target MARC1 mRNA and reduce MARC1 expression (e.g., via the RNAi pathway). In some embodiments, the oligonucleotides for use, or adaptable for use, target MARC1 mRNA and reduce the amount or level of MARC1 mRNA, MARC1 protein and/or MARC1 activity.
  • In addition, in some embodiments of the methods herein, a subject having a disease, disorder, or condition associated with MARC1 expression or is predisposed to the same is selected for treatment with an oligonucleotide provided herein (e.g., an RNAi oligonucleotide). In some embodiments, the method comprises selecting an individual having a marker (e.g., a biomarker) for a disease, disorder, or condition associated with MARC1 expression or predisposed to the same, such as, but not limited to, MARC1 mRNA, MARC1 protein, or a combination thereof. Likewise, and as detailed below, some embodiments of the methods provided by the current invention include steps such as measuring or obtaining a baseline value for a marker of MARC1 expression (e.g., MARC1 mRNA), and then comparing such obtained value to one or more other baseline values or values obtained after the subject is administered the oligonucleotide to assess the effectiveness of treatment.
  • The current invention also provides methods of treating a subject having, suspected of having, or at risk of developing a disease, disorder or condition associated with MARC1 expression with an oligonucleotide provided herein. In some aspects, the current invention provides methods of treating or attenuating the onset or progression of a disease, disorder or condition associated with MARC1 expression using the oligonucleotides herein. In other aspects, the current invention provides methods to achieve one or more therapeutic benefits in a subject having a disease, disorder, or condition associated with MARC1 expression using the oligonucleotides provided herein. In some embodiments of the methods herein, the subject is treated by administering a therapeutically effective amount of any one or more of the oligonucleotides provided herein. In some embodiments, treatment comprises reducing MARC1 expression. In some embodiments, the subject is treated therapeutically. In some embodiments, the subject is treated prophylactically.
  • In some embodiments of the methods herein, one or more oligonucleotides herein (e.g., RNAi oligonucleotides), or a pharmaceutical composition comprising one or more oligonucleotides, is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that MARC1 expression is reduced in the subject, thereby treating the subject. In some embodiments, an amount or level of MARC1 mRNA is reduced in the subject. In some embodiments, an amount or level of MARC 1 protein is reduced in the subject. In some embodiments, an amount or level of MARC1 activity is reduced in the subject.
  • In some embodiments of the methods herein, an oligonucleotide provided herein (e.g., an RNAi oligonucleotide), or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with MARC1 such that MARC1 expression is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to MARC1 expression prior to administration of one or more oligonucleotides or pharmaceutical composition. In some embodiments, MARC1 expression is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to MARC1 expression in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or oligonucleotides or pharmaceutical composition or receiving a control oligonucleotide or oligonucleotides, pharmaceutical composition or treatment.
  • In some embodiments of the methods herein, an oligonucleotide or oligonucleotides herein (e.g., RNAi oligonucleotides), or a pharmaceutical composition comprising the oligonucleotide or oligonucleotides, is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of MARC1 mRNA is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of MARC1 mRNA prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, an amount or level of MARC1 mRNA is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of MARC1 mRNA in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or oligonucleotides or pharmaceutical composition or receiving a control oligonucleotide or oligonucleotides, pharmaceutical composition or treatment.
  • In some embodiments of the methods herein, an oligonucleotide or oligonucleotides herein, or a pharmaceutical composition comprising the oligonucleotide or oligonucleotides, is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of MARC1 protein is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of MARC1 protein prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, an amount or level of MARC1 protein is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of MARC1 protein in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or oligonucleotides or pharmaceutical composition or receiving a control oligonucleotide, oligonucleotides or pharmaceutical composition or treatment.
  • In some embodiments of the methods herein, an oligonucleotide or oligonucleotides (e.g., RNAi oligonucleotides) herein, or a pharmaceutical composition comprising the oligonucleotide or oligonucleotides, is administered to a subject having a disease, disorder or condition associated with MARC1 such that an amount or level of MARC1 gene activity/expression is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of MARC1 activity prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, an amount or level of MARC1 activity is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of MARC1 activity in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • Suitable methods for determining MARC1 expression, the amount or level of MARC1 mRNA, MARC1 protein, MARC1 activity, or a biomarker related to or affected by modulation of MARC1 expression (e.g., a plasma biomarker), in the subject, or in a sample from the subject, are known in the art. Further, the Examples set forth herein illustrate methods for determining MARC1 expression.
  • In some embodiments, MARC1 expression, the amount or level of MARC1 mRNA, MARC1 protein, MARC1 activity, or a biomarker related to or affected by modulation of MARC1 expression, or any combination thereof, is reduced in a cell (e.g., a hepatocyte), a population or a group of cells (e.g., an organoid), an organ (e.g., liver), blood or a fraction thereof (e.g., plasma), a tissue (e.g., liver tissue), a sample (e.g., a liver biopsy sample), or any other appropriate biological material obtained or isolated from the subject. In some embodiments, MARC1 expression, the amount or level of MARC1 mRNA, MARC1 protein, MARC1 activity, or a biomarker related to or affected by modulation of MARC1 expression, or any combination thereof, is reduced in more than one type of cell (e.g., a hepatocyte and one or more other type(s) of cell), more than one groups of cells, more than one organ (e.g., liver and one or more other organ(s)), more than one fraction of blood (e.g., plasma and one or more other blood fraction(s)), more than one type of tissue (e.g., liver tissue and one or more other type(s) of tissue), or more than one type of sample (e.g., a liver biopsy sample and one or more other type(s) of biopsy sample).
  • Because of their high specificity, the oligonucleotides provided herein (e.g., dsRNAi oligonucleotides) specifically target mRNA of target genes (e.g., MARC1 mRNA) of cells and tissue(s), or organs(s) (e.g., in the liver). In preventing disease, the target gene may be one which is required for initiation or maintenance of the disease or which has been identified as being associated with a higher risk of contracting the disease. In treating disease, the oligonucleotide can be brought into contact with the cells, tissue(s), or organ(s) (e.g., liver) exhibiting or responsible for mediating the disease. For example, an oligonucleotide (e.g., an RNAi oligonucleotide) substantially identical to all or part of a wild-type (i.e., native) or mutated gene associated with a disorder or condition associated with MARC1 expression may be brought into contact with or introduced into a cell or tissue type of interest such as a hepatocyte or other liver cell.
  • Examples of a disease, disorder or condition associated with MARC1 expression include, but are not limited to non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic steatohepatitis (ASH), or metabolic syndrome. In some embodiments, the disease is NAFLD. In some embodiments, the disease is NASH. In some embodiments, the disease is ASH.
  • In some embodiments, an amount or level of liver steatosis is reduced in a subject. In some embodiments, an amount or level of liver fibrosis is reduced in a subject. In some embodiments, an amount or level of cholesterol is reduced in a subject. In some embodiments, an amount or level of triglyceride is reduced in a subject. In some embodiments, an amount or level of alanine aminotransferase is reduced in a subject. In some embodiments, an amount or level of aspartate aminotransferase is reduced in a subject. In some embodiments, any combination of the following is reduced or altered in the subject: MARC1 expression, an amount or level of MARC1 mRNA, an amount or level of MARC 1 protein, an amount or level of MARC1 activity, an amount or level of TG, an amount or level of cholesterol and/or the ratio of total cholesterol to HDL cholesterol, an amount or level of liver steatosis, an amount or level of liver fibrosis, an amount of level of alanine aminotransferase, and an amount of level of aspartate aminotransferase.
  • In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of liver fibrosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of liver fibrosis prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, an amount or level of liver fibrosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of liver fibrosis in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of liver steatosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of liver steatosis prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, an amount or level of liver steatosis is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of liver steatosis in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of alanine aminotransferase is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of alanine aminotransferase prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, an amount or level of alanine aminotransferase is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of alanine aminotransferase in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of aspartate aminotransferase is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of aspartate aminotransferase prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, an amount or level of aspartate aminotransferase is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of aspartate aminotransferase in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of triglyceride is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of triglyceride prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, an amount or level of triglyceride is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of triglyceride in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder or condition associated with MARC1 expression such that an amount or level of cholesterol (e.g., total cholesterol, LDL cholesterol, and/or HDL cholesterol) is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to the amount or level of cholesterol prior to administration of the oligonucleotide or pharmaceutical composition. In some embodiments, an amount or level of cholesterol is reduced in the subject by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or greater than 99% when compared to an amount or level of cholesterol in a subject (e.g., a reference or control subject) not receiving the oligonucleotide or pharmaceutical composition or receiving a control oligonucleotide, pharmaceutical composition or treatment.
  • In some embodiments, the target gene may be a target gene from any mammal, such as a human target. Any target gene may be silenced according to the method described herein.
  • Methods described herein typically involve administering to a subject an effective amount of an oligonucleotide herein (e.g., a RNAi oligonucleotide), that is, an amount that produces or generates a desirable therapeutic result. A therapeutically acceptable amount may be an amount that therapeutically treats a disease or disorder. The appropriate dosage for any one subject will depend on certain factors, including the subject’s size, body surface area, age, the composition to be administered, the active ingredient(s) in the composition, time and route of administration, general health, and other drugs being administered concurrently.
  • In some embodiments, a subject is administered any one of the compositions herein (e.g., a composition comprising an RNAi oligonucleotide described herein) either enterally (e.g., orally, by gastric feeding tube, by duodenal feeding tube, via gastrostomy or rectally), parenterally (e.g., subcutaneous injection, intravenous injection or infusion, intra-arterial injection or infusion, intraosseous infusion, intramuscular injection, intracerebral injection, intracerebroventricular injection, intrathecal), topically (e.g., epicutaneous, inhalational, via eye drops, or through a mucous membrane), or by direct injection into a target organ (e.g., the liver of a subject). Typically, oligonucleotides herein are administered intravenously or subcutaneously.
  • In some embodiments, an oligonucleotide herein (e.g., an RNAi oligonucleotide), or a pharmaceutical composition comprising the oligonucleotide, is administered alone or in combination. In some embodiments, the oligonucleotides herein are administered in combination concurrently, sequentially (in any order), or intermittently. For example, two oligonucleotides may be co-administered concurrently. Alternatively, one oligonucleotide may be administered and followed any amount of time later (e.g., one hour, one day, one week or one month) by the administration of a second oligonucleotide.
  • In some embodiments, the subject to be treated is a human or non-human primate or other mammalian subject. Other exemplary subjects include domesticated animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and animals such as mice, rats, guinea pigs, and hamsters.
    • Kits
  • In some embodiments, the current invention provides a kit comprising an oligonucleotide herein (e.g., an RNAi oligonucleotide), and instructions for use. In some embodiments, the kit comprises an oligonucleotide herein, and a package insert containing instructions for use of the kit and/or any component thereof. In some embodiments, the kit comprises, in a suitable container, an oligonucleotide herein, one or more controls, and various buffers, reagents, enzymes and other standard ingredients well known in the art. In some embodiments, the container comprises at least one vial, well, test tube, flask, bottle, syringe, or other container means, into which the oligonucleotide is placed, and in some instances, suitably aliquoted. In some embodiments where an additional component is provided, the kit contains additional containers into which this component is placed. The kits can also include a means for containing the oligonucleotide and any other reagent in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained. Containers and/or kits can include labeling with instructions for use and/or warnings.
  • In some embodiments, a kit comprises an oligonucleotide herein (e.g., an RNAi oligonucleotide), and a pharmaceutically acceptable carrier, or a pharmaceutical composition comprising the oligonucleotide and instructions for treating or delaying progression of a disease, disorder or condition associated with MARC1 expression in a subject in need thereof.
    • Definitions
  • As used herein, the term “antisense oligonucleotide” encompasses a nucleic acid-based molecule which has a sequence complementary to all or part of the target mRNA, in particular seed sequence thereby capable of forming a duplex with a mRNA. Thus, the term “antisense oligonucleotide”, as used herein, may be referred to as “complementary nucleic acid-based inhibitor”.
  • As used herein, “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • As used herein, “administer,” “administering,” “administration” and the like refers to providing a substance (e.g., an oligonucleotide) to a subject in a manner that is pharmacologically useful (e.g., to treat a disease, disorder, or condition in the subject).
  • As used herein, “attenuate,” “attenuating,” “attenuation” and the like refers to reducing or effectively halting. As a non-limiting example, one or more of the treatments herein may reduce or effectively halt the onset or progression of NAFLD or NASH in a subject. This attenuation may be exemplified by, for example, a decrease in one or more aspects (e.g., symptoms, tissue characteristics, and cellular, inflammatory, or immunological activity, etc.) of NAFLD, NASH, or ASH, no detectable progression (worsening) of one or more aspects of fatty liver disease, or no detectable aspects of NAFLD, NASH, or ASH) in a subject when they might otherwise be expected.
  • As used herein, “complementary” refers to a structural relationship between two nucleotides (e.g., on two opposing nucleic acids or on opposing regions of a single nucleic acid strand) that permits the two nucleotides to form base pairs with one another. For example, a purine nucleotide of one nucleic acid that is complementary to a pyrimidine nucleotide of an opposing nucleic acid may base pair together by forming hydrogen bonds with one another. In some embodiments, complementary nucleotides can base pair in the Watson-Crick manner or in any other manner that allows for the formation of stable duplexes. In some embodiments, two nucleic acids may have regions of multiple nucleotides that are complementary with each other to form regions of complementarity, as described herein.
  • As used herein, “deoxyribonucleotide” refers to a nucleotide having a hydrogen in place of a hydroxyl at the 2′ position of its pentose sugar when compared with a ribonucleotide. A modified deoxyribonucleotide is a deoxyribonucleotide having one or more modifications or substitutions of atoms other than at the 2′ position, including modifications or substitutions in or of the sugar, phosphate group or base.
  • As used herein, “double-stranded oligonucleotide” or “ds oligonucleotide” refers to an oligonucleotide that is substantially in a duplex form. In some embodiments, the complementary base-pairing of duplex region(s) of a double-stranded oligonucleotide is formed between antiparallel sequences of nucleotides of covalently separate nucleic acid strands. In some embodiments, complementary base-pairing of duplex region(s) of a double-stranded oligonucleotide is formed between antiparallel sequences of nucleotides of nucleic acid strands that are covalently linked. In some embodiments, complementary base-pairing of duplex region(s) of a double-stranded oligonucleotide is formed from single nucleic acid strand that is folded (e.g., via a hairpin) to provide complementary antiparallel sequences of nucleotides that base pair together. In some embodiments, a double-stranded oligonucleotide comprises two covalently separate nucleic acid strands that are fully duplexed with one another. However, in some embodiments, a double-stranded oligonucleotide comprises two covalently separate nucleic acid strands that are partially duplexed (e.g., having overhangs at one or both ends). In some embodiments, a double-stranded oligonucleotide comprises antiparallel sequence of nucleotides that are partially complementary, and thus, may have one or more mismatches, which may include internal mismatches or end mismatches.
  • As used herein, “duplex” in reference to nucleic acids (e.g., oligonucleotides), refers to a structure formed through complementary base pairing of two antiparallel sequences of nucleotides.
  • As used herein, “excipient” refers to a non-therapeutic agent that may be included in a composition, for example, to provide or contribute to a desired consistency or stabilizing effect.
  • As used herein, “hepatocyte” or “hepatocytes” refers to cells of the parenchymal tissues of the liver. These cells make up about 70%-85% of the liver’s mass and manufacture serum albumin, FBN and the prothrombin group of clotting factors (except for Factors 3 and 4). Markers for hepatocyte lineage cells include, but are not limited to, transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor 1a (Hnfla) and hepatocyte nuclear factor 4a (Hnf4a). Markers for mature hepatocytes may include, but are not limited to, cytochrome P450 (Cyp3a11), fumarylacetoacetate hydrolase (Fah), glucose 6-phosphate (G6p), albumin (Alb) and OC2-2F8. See, e.g., Huch et al. (2013) NATURE 494:247-50.
  • As used herein, a “hepatotoxic agent” refers to a chemical compound, virus or other substance that is itself toxic to the liver or can be processed to form a metabolite that is toxic to the liver. Hepatotoxic agents may include, but are not limited to, carbon tetrachloride (CCl4), acetaminophen (paracetamol), vinyl chloride, arsenic, chloroform, nonsteroidal antiinflammatory drugs (such as aspirin and phenylbutazone).
  • As used herein, the term “MARC1” refers to Mitochondrial Amidoxime Reducing Component 1. MARC1 is a protein which catalyzes the reduction of molecules. “MARC1” may also refer to the gene which encodes the protein.
  • As used herein, “labile linker” refers to a linker that can be cleaved (e.g., by acidic pH). A “stable linker” refers to a linker that cannot be cleaved.
  • As used herein, “liver inflammation” or “hepatitis” refers to a physical condition in which the liver becomes swollen, dysfunctional and/or painful, especially as a result of injury or infection, as may be caused by exposure to a hepatotoxic agent. Symptoms may include jaundice (yellowing of the skin or eyes), fatigue, weakness, nausea, vomiting, appetite reduction and weight loss. Liver inflammation, if left untreated, may progress to fibrosis, cirrhosis, liver failure or liver cancer.
  • As used herein, “liver fibrosis” “Liver Fibrosis” or “fibrosis of the liver” refers to an excessive accumulation in the liver of extracellular matrix proteins, which could include collagens (I, III, and IV), FBN, undulin, elastin, laminin, hyaluronan and proteoglycans resulting from inflammation and liver cell death. Liver fibrosis, if left untreated, may progress to cirrhosis, liver failure or liver cancer.
  • As used herein, “loop” refers to an unpaired region of a nucleic acid (e.g., oligonucleotide) that is flanked by two antiparallel regions of the nucleic acid that are sufficiently complementary to one another, such that under appropriate hybridization conditions (e.g., in a phosphate buffer, in a cell), the two antiparallel regions, which flank the unpaired region, hybridize to form a duplex (referred to as a “stem”).
  • As used herein, “modified internucleotide linkage” refers to an internucleotide linkage having one or more chemical modifications when compared with a reference internucleotide linkage comprising a phosphodiester bond. In some embodiments, a modified nucleotide is a non-naturally occurring linkage. Typically, a modified internucleotide linkage confers one or more desirable properties to a nucleic acid in which the modified internucleotide linkage is present. For example, a modified internucleotide linkage may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, reduced immunogenicity, etc.
  • As used herein, “modified nucleotide” refers to a nucleotide having one or more chemical modifications when compared with a corresponding reference nucleotide selected from: adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide and thymidine deoxyribonucleotide. In some embodiments, a modified nucleotide is a non-naturally occurring nucleotide. In some embodiments, a modified nucleotide has one or more chemical modification in its sugar, nucleobase and/or phosphate group. In some embodiments, a modified nucleotide has one or more chemical moieties conjugated to a corresponding reference nucleotide. Typically, a modified nucleotide confers one or more desirable properties to a nucleic acid in which the modified nucleotide is present. For example, a modified nucleotide may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, bioactivity, reduced immunogenicity, etc.
  • As used herein, “nicked tetraloop structure” refers to a structure of a RNAi oligonucleotide that is characterized by separate sense (passenger) and antisense (guide) strands, in which the sense strand has a region of complementarity with the antisense strand, and in which at least one of the strands, generally the sense strand, has a tetraloop configured to stabilize an adjacent stem region formed within the at least one strand.
  • As used herein, “oligonucleotide” refers to a short nucleic acid (e.g., less than about 100 nucleotides in length). An oligonucleotide may be single-stranded (ss) or ds. An oligonucleotide may or may not have duplex regions. As a set of non-limiting examples, an oligonucleotide may be, but is not limited to, a small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), dicer substrate interfering RNA (DsiRNA), antisense oligonucleotide, short siRNA or ss siRNA. In some embodiments, a double-stranded (dsRNA) is an RNAi oligonucleotide.
  • As used herein, “overhang” refers to terminal non-base pairing nucleotide(s) resulting from one strand or region extending beyond the terminus of a complementary strand with which the one strand or region forms a duplex. In some embodiments, an overhang comprises one or more unpaired nucleotides extending from a duplex region at the 5′ terminus or 3′ terminus of an oligonucleotide. In certain embodiments, the overhang is a 3′- or 5′-overhang on the antisense strand or sense strand of an oligonucleotide.
  • As used herein, “phosphate analog” refers to a chemical moiety that mimics the electrostatic and/or steric properties of a phosphate group. In some embodiments, the phosphate analog mimics the electrostatic and/or steric properties of a phosphate group in biologic systems. In some embodiments, a phosphate analog is positioned at the 5′-terminal nucleotide of an oligonucleotide in place of a 5′-phosphate, which is often susceptible to enzymatic removal. In some embodiments, a 5′-phosphate analog contains a phosphatase-resistant linkage. Examples of phosphate analogs include, but are not limited to, 5′-phosphonates, such as 5′-methylene phosphonate (5′-MP) and 5′-(E)-vinylphosphonate (5′-VP). In some embodiments, an oligonucleotide has a phosphate analog at a 4′-carbon position of the sugar (referred to as a “4′-phosphate analog”) at a 5′-terminal nucleotide. An example of a 4′-phosphate analog is oxymethyl phosphonate, in which the oxygen atom of the oxymethyl group is bound to the sugar moiety (e.g., at its 4′-carbon) or analog thereof. See, e.g., U.S. Pat. Publication No. 2019-0177729. Other modifications have been developed for the 5′ end of oligonucleotides (see, e.g., Intl. Patent Application No. WO 2011/133871; U.S. Pat. No. 8,927,513; and Prakash et al. (2015) NUCLEIC ACIDS RES. 43:2993-3011).
  • As used herein, “reduced expression” of a gene (e.g., MARC1) refers to a decrease in the amount or level of RNA transcript (e.g., MARC1 mRNA) or protein encoded by the gene and/or a decrease in the amount or level of activity of the gene in a cell, a population of cells, a sample, or a subject, when compared to an appropriate reference (e.g., a reference cell, population of cells, sample or subject). For example, the act of contacting a cell with an oligonucleotide herein (e.g., an oligonucleotide comprising an antisense strand having a nucleotide sequence that is complementary to a nucleotide sequence comprising MARC1 mRNA) may result in a decrease in the amount or level of MARC1 mRNA, protein and/or activity (e.g., via degradation of MARC1 mRNA by the RNAi pathway) when compared to a cell that is not treated with the oligonucleotide. Similarly, and as used herein, “reducing expression” refers to an act that results in reduced expression of a gene (e.g., MARC1). As used herein, “reduction of MARC1 expression” refers to a decrease in the amount or level of MARC1 mRNA, MARC1 protein and/or MARC1 activity in a cell, a population of cells, a sample or a subject when compared to an appropriate reference (e.g., a reference cell, population of cells, sample, or subject).
  • As used herein, “region of complementarity” refers to a sequence of nucleotides of a nucleic acid (e.g., an oligonucleotide) that is sufficiently complementary to an antiparallel sequence of nucleotides to permit hybridization between the two sequences of nucleotides under appropriate hybridization conditions (e.g., in a phosphate buffer, in a cell, etc.). In some embodiments, an oligonucleotide herein comprises a targeting sequence having a region of complementary to a mRNA target sequence.
  • As used herein, “ribonucleotide” refers to a nucleotide having a ribose as its pentose sugar, which contains a hydroxyl group at its 2′ position. A modified ribonucleotide is a ribonucleotide having one or more modifications or substitutions of atoms other than at the 2′ position, including modifications or substitutions in or of the ribose, phosphate group or base.
  • As used herein, “RNAi oligonucleotide” refers to either (a) a double-stranded oligonucleotide having a sense strand (passenger) and antisense strand (guide), in which the antisense strand or part of the antisense strand is used by the Argonaute 2 (Ago2) endonuclease in the cleavage of a target mRNA (e.g., MARC1 mRNA) or (b) a single-stranded oligonucleotide having a single antisense strand, where that antisense strand (or part of that antisense strand) is used by the Ago2 endonuclease in the cleavage of a target mRNA (e.g., MARC1 mRNA).
  • As used herein, “strand” refers to a single, contiguous sequence of nucleotides linked together through internucleotide linkages (e.g., phosphodiester linkages or phosphorothioate linkages). In some embodiments, a strand has two free ends (e.g., a 5′ end and a 3′ end).
  • As used herein, “subject” means any mammal, including mice, rabbits, and humans. In one embodiment, the subject is a human or NHP. Moreover, “individual” or “patient” may be used interchangeably with “subject.”
  • As used herein, “synthetic” refers to a nucleic acid or other molecule that is artificially synthesized (e.g., using a machine (e.g., a solid-state nucleic acid synthesizer)) or that is otherwise not derived from a natural source (e.g., a cell or organism) that normally produces the molecule.
  • As used herein, “targeting ligand” refers to a molecule (e.g., a carbohydrate, amino sugar, cholesterol, polypeptide, or lipid) that selectively binds to a cognate molecule (e.g., a receptor) of a tissue or cell of interest and that is conjugatable to another substance for purposes of targeting the other substance to the tissue or cell of interest. For example, in some embodiments, a targeting ligand may be conjugated to an oligonucleotide for purposes of targeting the oligonucleotide to a specific tissue or cell of interest. In some embodiments, a targeting ligand selectively binds to a cell surface receptor. Accordingly, in some embodiments, a targeting ligand when conjugated to an oligonucleotide facilitates delivery of the oligonucleotide into a particular cell through selective binding to a receptor expressed on the surface of the cell and endosomal internalization by the cell of the complex comprising the oligonucleotide, targeting ligand and receptor. In some embodiments, a targeting ligand is conjugated to an oligonucleotide via a linker that is cleaved following or during cellular internalization such that the oligonucleotide is released from the targeting ligand in the cell. In some embodiments, the targeting ligand comprises at least one GalNAc moiety and targets the liver and human liver cells (e.g., human hepatocytes).
  • As used herein, “tetraloop” refers to a loop that increases stability of an adjacent duplex formed by hybridization of flanking sequences of nucleotides. The increase in stability is detectable as an increase in melting temperature (Tm) of an adjacent stem duplex that is higher than the Tm of the adjacent stem duplex expected, on average, from a set of loops of comparable length consisting of randomly selected sequences of nucleotides. For example, a tetraloop can confer a Tm of at least about 50° C., at least about 55° C., at least about 56° C., at least about 58° C., at least about 60° C., at least about 65° C., or at least about 75° C. in 10 mM Na2HPO4 to a hairpin comprising a duplex of at least 2 base pairs (bp) in length. In some embodiments, a tetraloop can confer a Tm of at least about 50° C., at least about 55° C., at least about 56° C., at least about 58° C., at least about 60° C., at least about 65° C., or at least about 75° C. in 10 mM NaH2PO4 to a hairpin comprising a duplex of at least 2 base pairs (bp) in length. In some embodiments, a tetraloop may stabilize a bp in an adjacent stem duplex by stacking interactions. In addition, interactions among the nucleotides in a tetraloop include, but are not limited to, non-Watson-Crick base pairing, stacking interactions, hydrogen bonding and contact interactions (Cheong et al. (1990) NATURE 346:680-82; Heus & Pardi (1991) SCIENCE 253:191-94). In some embodiments, a tetraloop comprises or consists of 3 to 6 nucleotides and is typically 4 to 5 nucleotides. In certain embodiments, a tetraloop comprises or consists of 3, 4, 5, or 6 nucleotides, which may or may not be modified (e.g., which may or may not be conjugated to a targeting moiety). In one embodiment, a tetraloop consists of 4 nucleotides. Any nucleotide may be used in the tetraloop and standard IUPAC-IUB symbols for such nucleotides may be used as described in Cornish-Bowden (1985) NUCLEIC ACIDS RES. 13:3021-30. For example, the letter “N” may be used to mean that any base may be in that position, the letter “R” may be used to show that A (adenine) or G (guanine) may be in that position, and “B” may be used to show that C (cytosine), G (guanine), or T (thymine) may be in that position. Examples of tetraloops include the UNCG family of tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g., GAAA), and the CUUG tetraloop (Woese et al. (1990) PROC. NATL. ACAD. SCI. USA 87:8467-71; Antao et al. (1991) NUCLEIC ACIDS RES. 19:5901-05). Examples of DNA tetraloops include the d(GNNA) family of tetraloops (e.g., d(GTTA), the d(GNRA)) family of tetraloops, the d(GNAB) family of tetraloops, the d(CNNG) family of tetraloops, and the d(TNCG) family of tetraloops (e.g., d(TTCG)). See, e.g., Nakano et al. (2002) BIOCHEM. 41:14281-92; Shinji et al. (2000) NIPPON KAGAKKAI KOEN YOKOSHU 78:731. In some embodiments, the tetraloop is contained within a nicked tetraloop structure.
  • As used herein, “treat” or “treating” refers to the act of providing care to a subject in need thereof, for example, by administering a therapeutic agent (e.g., an oligonucleotide herein) to the subject, for purposes of improving the health and/or well-being of the subject with respect to an existing condition (e.g., a disease, disorder) or to prevent or decrease the likelihood of the occurrence of a condition. In some embodiments, treatment involves reducing the frequency or severity of at least one sign, symptom or contributing factor of a condition (e.g., disease, disorder) experienced by a subject.
    • EXAMPLES
  • While the current invention has been described with reference to the specific embodiments set forth in the following Examples, it should be understood by those skilled in the art that various changes may be made, and equivalents may be substituted without departing from the true spirit and scope of the current invention. Further, the following Examples are offered by way of illustration and are not intended to limit the scope of the current invention in any manner. In addition, modifications may be made to adapt to a situation, material, composition of matter, process, process step or steps, to the objective, spirit, and scope of the current invention. All such modifications are intended to be within the scope of the current invention. Standard techniques well known in the art or the techniques specifically described below were utilized.
    • Example 1: Preparation of Double-Stranded RNAi Oligonucleotides Oligonucleotide Synthesis and Purification
  • The double-stranded RNAi (dsRNA) oligonucleotides described in the foregoing Examples were chemically synthesized using methods described herein. Generally, dsRNAi oligonucleotides were synthesized using solid phase oligonucleotide synthesis methods as described for 19-23mer siRNAs (see, e.g., Scaringe et al. (1990) Nucleic Acids Res. 18:5433-5441 and Usman et al. (1987) J. Am. Chem. Soc. 109:7845-7845; see also, US Pats. 5,804,683; 5,831,071; 5,998,203; 6,008,400; 6,111,086; 6,117,657; 6,353,098; 6,362,323; 6,437,117; and 6,469,158) in addition to using known phosphoramidite synthesis (see, e.g. Hughes and Ellington (2017) Cold Spring Harb Perspect Biol. 9(1):a023812; Beaucage S.L., Caruthers M.H. Studies on Nucleotide Chemistry V: Deoxynucleoside Phosphoramidites-A New Class of Key Intermediates for Deoxypolynucleotide Synthesis. Tetrahedron Lett. (1981);22:1859-1862. doi: 10.1016/S0040-4039(01)90461-7). dsRNAi oligonucleotides having a 19mer core sequence were formatted into constructs having a 25mer sense strand and a 27mer antisense strand to allow for processing by the RNAi machinery. The 19mer core sequence is complementary to a region in the MARC1 mRNA.
  • Individual RNA strands were synthesized and HPLC purified according to standard methods (Integrated DNA Technologies; Coralville, IA). For example, RNA oligonucleotides were synthesized using solid phase phosphoramidite chemistry, deprotected and desalted on NAP-5 columns (Amersham Pharmacia Biotech; Piscataway, NJ) using standard techniques (Damha & Olgivie (1993) Methods Mol. Biol. 20:81-114; Wincott et al. (1995) Nucleic Acids Res. 23:2677-2684). The oligomers were purified using ion-exchange high performance liquid chromatography (IE-HPLC) on an Amersham Source 15Q column (1.0 cm×25 cm; Amersham Pharmacia Biotech) using a 15 min. step-linear gradient. The gradient varied from 90:10 Buffers A:B to 52:48 Buffers A:B, where Buffer A is 100 mM Tris pH 8.5 and Buffer B is 100 mM Tris pH 8.5, 1 M NaCl. Samples were monitored at 260 nm and peaks corresponding to the full-length oligonucleotide species were collected, pooled, desalted on NAP-5 columns, and lyophilized. Single strand RNA oligomers were stored lyophilized or in nuclease-free water at -80° C.
  • The purity of each oligomer was determined by capillary electrophoresis (CE) on a Beckman PACE 5000 (Beckman Coulter, Inc.; Fullerton, CA). The CE capillaries have a 100 µm inner diameter and contain ssDNA 100R Gel (Beckman-Coulter). Typically, about 0.6 nmole of oligonucleotide was injected into a capillary, run in an electric field of 444 V/cm and was detected by UV absorbance at 260 nm. Denaturing Tris-Borate-7 M-urea running buffer was purchased from Beckman-Coulter. Oligoribonucleotides were obtained that were at least 90% pure as assessed by CE for use in experiments described below. Compound identity was verified by matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectroscopy on a Voyager DE™ Biospectometry WorkStation (Applied Biosystems; Foster City, CA) following the manufacturer’s recommended protocol. Relative molecular masses of all oligomers were obtained, often within 0.2% of expected molecular mass.
    • Preparation of Duplexes
  • Single strand RNA oligomers were resuspended (e.g., at 100 µM concentration) in duplex buffer consisting of 100 mM potassium acetate, 30 mM HEPES, pH 7.5. Complementary sense and antisense strands were mixed in equal molar amounts to yield a final solution of, for example, 50 µM duplex. Samples were heated to 100° C. for 5 min. in RNA buffer (Integrated DNA Technologies (IDT)) and were allowed to cool to room temperature before use. The dsRNA oligonucleotides were stored at -20° C.
    • Example 2: Generation of MARC1-Targeting Double-Stranded RNAi Oligonucleotides Identification of MARC1 mRNA Target Sequences
  • MARC1 is an enzyme involved in catalyzing N-oxygenated molecules. To generate RNAi oligonucleotide inhibitors of MARC1 expression, a computer-based algorithm was used to computationally identify MARC1 mRNA target sequences suitable for assaying inhibition of MARC1 expression by the RNAi pathway. The algorithm provided RNAi oligonucleotide guide (antisense) strand sequences each having a region of complementarity to a suitable MARC1 target sequence of human MARC1 mRNA (e.g., SEQ ID NO: 1692; Table 1). Some of the guide strand sequences identified by the algorithm were also complementary to the corresponding MARC1 target sequence of monkey MARC1 mRNA (SEQ ID NO: 1693 Table 1). MARC1 RNAi oligonucleotides comprising a region of complementarity to homologous MARC1 mRNA target sequences with nucleotide sequence similarity are predicted to have the ability to target homologous MARC1 mRNAs.
  • TABLE 1
    Sequences of Human and Monkey MARC1 mRNA
    Species Ref Seq # SEQ ID NO
    Human (Hs) NM_022746.4 1692
    Cynomolgus monkey (Mf) XM_005540898.2 1693
  • RNAi oligonucleotides (formatted as DsiRNA oligonucleotides) were generated as described in Example 1 for evaluation in vitro. Each DsiRNA was generated with the same modification pattern, and each with a unique guide strand having a region of complementarity to a MARC1 target sequence identified by SEQ ID NOs: 1-384. Modifications for the sense and anti-sense DsiRNA included the following (X = any nucleotide; m = 2′-O-methyl modified nucleotide; r = ribosyl modified nucleotide):
    • Sense Strand: rXmXrXmXrXrXrXrXrXrXrXrXrXmXrXmXrXrXrXrXrXrXrXXX
    • Anti-sense Strand: mXmXmXmXrXrXrXrXrXrXmXrXmXrXrXrXrXrXrXrXrXrXmXrXmXmXmX
    In Vitro Cell-Based Assays
  • The ability of each of the modified DsiRNA in Table 2 to reduce MARC1 mRNA was measured using in vitro cell-based assays. Briefly, human hepatocyte (Huh7) cells expressing endogenous human MARC1 gene were transfected with each of the DsiRNAs listed in Table 2 at 1 nM in separate wells of a multi-well cell-culture plate. Cells were maintained for 24 hours following transfection with the modified DsiRNA, and then the amount of remaining MARC1 mRNA from the transfected cells was determined using TAQMAN®-based qPCR assays. Two qPCR assays, a 3′ assay (Forward- (SEQ ID NO: 1684), Reverse- (SEQ ID NO: 1685), Probe- /56-FAM/AAAGG TGC T/Zen/CAGGAGGATGGTTGT/3IABkFQ (SEQ ID NO: 1694)) and a 5′ assay (Forward- (SEQ ID NO: 1686), Reverse- (SEQ ID NO: 1687 ), Probe- /56-FAM/TCAAAACGC/ZEN/CCACCACAAATGCA/3IABkFQ (SEQ ID NO: 1695)) were used to determine MARC1 mRNA levels as measured using PCR probes conjugated to 6-carboxy-fluorescein (FAM) and normalized to the HPRT housekeeping gene (Forward- (SEQ ID NO: 1688), Reverse- (SEQ ID NO: 1689); Probe- 5HEX /ATGGTCAAG/ZEN/ GTCGCAAGCTTGCTGGT/31ABkFQ/ -3′(SEQ ID NO: 1696). Each primer pair was assayed for % remaining RNA as shown in Table 2 and FIG. 1 . DsiRNAs resulting in less than or equal to 10% MARC1 mRNA remaining in DsiRNA-transfected cells when compared to mock-transfected cells were considered DsiRNA “hits”. The Huh7 cell-based assay evaluating the ability of the DsiRNAs listed in Table 2 to inhibit MARC1 expression identified several candidate DsiRNAs.
  • Taken together, these results show that DsiRNAs designed to target human MARC1 mRNA inhibit MARC1 expression in cells, as determined by a reduced amount of MARC1 mRNA in DsiRNA-transfected cells relative to control cells. These results demonstrate that the nucleotide sequences comprising the DsiRNA are useful for generating RNAi oligonucleotides to inhibit MARC1 expression. Further, these results demonstrate that multiple MARC1 mRNA target sequences are suitable for the RNAi-mediated inhibition of MARC1 expression.
  • TABLE 2
    Analysis of MARC1 mRNA in Huh7 cells
    MARC1-5′ Assay MARC1-3′ Assay
    SED ID NO (Sense Strand) SED ID NO (Anti-sense Strand) DsiRNA name % remaining SEM % remaining SEM
    769 1153 MARC1-231 25.8 2.4 35.7 2.8
    770 1154 MARC1-233 40.3 3.3 39.9 4.9
    771 1155 MARC1-234 17.7 2.8 19.6 2.5
    772 1156 MARC1-235 25.0 3.7 25.4 3.0
    773 1157 MARC1-236 23.8 6.4 34.8 6.9
    774 1158 MARC1-237 35.1 5.8 40.1 6.0
    775 1159 MARC1-238 30.6 4.2 39.1 4.7
    776 1160 MARC1-239 21.6 3.4 33.0 5.5
    777 1161 MARC1-240 9.2 1.1 16.5 1.6
    778 1162 MARC1-241 29.0 3.3 36.5 2.6
    779 1163 MARC1-242 60.8 2.4 68.1 3.7
    780 1164 MARC1-243 27.9 3.6 37.4 4.6
    781 1165 MARC1-244 35.4 3.4 43.5 3.8
    782 1166 MARC1-245 72.0 5.2 89.6 6.7
    783 1167 MARC1-247 21.0 2.3 29.5 2.5
    784 1168 MARC1-248 22.0 2.9 32.3 5.4
    785 1169 MARC1-249 16.6 1.5 22.3 1.6
    786 1170 MARC1-253 29.3 3.5 30.1 3.0
    787 1171 MARC1-255 28.6 1.4 32.8 1.6
    788 1172 MARC1-318 64.7 3.6 71.7 5.6
    789 1173 MARC1-319 84.5 5.0 91.8 5.8
    790 1174 MARC1-320 42.4 3.0 59.7 5.5
    791 1175 MARC1-321 29.6 2.2 42.0 3.2
    792 1176 MARC1-323 16.2 1.2 26.0 2.3
    793 1177 MARC1-324 3.7 0.5 6.3 0.9
    794 1178 MARC1-325 24.6 7.4 29.9 8.8
    795 1179 MARC1-326 10.7 2.1 14.1 2.9
    796 1180 MARC1-327 10.8 0.6 16.0 2.0
    797 1181 MARC1-328 11.9 0.9 13.3 0.9
    798 1182 MARC1-329 13.4 0.9 16.2 1.8
    799 1183 MARC1-330 10.3 1.1 13.6 1.3
    800 1184 MARC1-331 11.5 1.1 12.3 1.2
    801 1185 MARC1-332 29.2 1.9 34.4 4.7
    802 1186 MARC1-334 52.6 4.1 64.5 5.8
    803 1187 MARC1-335 21.5 1.5 26.2 2.4
    804 1188 MARC1-337 31.2 3.6 32.9 4.4
    805 1189 MARC1-338 35.4 2.5 36.8 2.5
    806 1190 MARC1-339 35.1 5.1 41.7 5.6
    807 1191 MARC1-340 33.2 2.7 36.1 3.4
    808 1192 MARC1-341 17.8 1.2 20.4 1.9
    809 1193 MARC1-342 11.4 4.4 22.1 7.6
    810 1194 MARC1-343 30.6 2.1 34.5 3.2
    811 1195 MARC1-345 43.3 2.9 38.8 2.8
    812 1196 MARC1-346 19.1 2.5 22.9 3.4
    813 1197 MARC1-347 91.0 7.7 83.7 8.8
    814 1198 MARC1-348 35.8 3.2 37.9 3.7
    815 1199 MARC1-349 29.9 1.7 29.9 2.9
    816 1200 MARC1-350 40.5 6.7 30.4 6.3
    817 1201 MARC1-351 20.2 2.2 29.7 3.3
    818 1202 MARC1-352 35.5 3.8 44.5 4.1
    819 1203 MARC1-353 43.8 6.8 42.7 7.4
    820 1204 MARC1-354 54.9 6.1 58.6 6.2
    821 1205 MARC1-356 76.2 9.1 59.2 5.3
    822 1206 MARC1-357 26.0 4.0 28.5 3.6
    823 1207 MARC1-358 50.5 7.7 40.2 6.0
    824 1208 MARC1-359 68.7 7.5 53.4 6.2
    825 1209 MARC1-360 22.5 1.4 34.6 2.5
    826 1210 MARC1-361 63.0 7.1 72.8 6.5
    827 1211 MARC1-362 61.4 5.9 63.8 5.8
    828 1212 MARC1-365 70.5 4.1 66.5 4.2
    829 1213 MARC1-376 90.8 6.8 70.2 7.2
    830 1214 MARC1-379 95.1 7.6 82.4 7.8
    831 1215 MARC1-384 44.8 5.2 36.5 3.6
    832 1216 MARC1-385 62.4 5.2 46.9 5.1
    833 1217 MARC1-388 29.0 3.1 32.2 3.2
    834 1218 MARC1-390 43.1 1.7 48.7 2.6
    835 1219 MARC1-391 29.9 3.7 33.2 3.7
    836 1220 MARC1-393 36.6 1.4 35.8 1.8
    837 1221 MARC1-395 68.6 4.1 68.0 4.3
    838 1222 MARC1-405 19.2 2.1 24.1 2.8
    839 1223 MARC1-409 29.7 3.0 33.9 3.6
    840 1224 MARC1-411 50.4 3.7 46.1 3.8
    841 1225 MARC1-412 31.4 2.2 35.9 2.6
    842 1226 MARC1-413 16.1 1.8 21.8 3.1
    843 1227 MARC1-414 28.1 3.5 25.8 2.9
    844 1228 MARC1-415 19.8 4.5 30.4 6.5
    845 1229 MARC1-416 16.9 2.2 20.4 1.8
    846 1230 MARC1-417 34.4 3.6 36.6 3.3
    847 1231 MARC1-418 46.9 5.0 45.2 4.8
    848 1232 MARC1-419 24.8 3.3 27.0 3.1
    849 1233 MARC1-420 68.4 6.5 77.6 9.1
    850 1234 MARC1-421 14.6 1.0 25.2 2.2
    851 1235 MARC1-422 25.9 1.5 27.7 1.4
    852 1236 MARC1-423 15.5 1.0 18.3 1.6
    853 1237 MARC1-424 32.2 3.1 31.1 5.0
    854 1238 MARC1-425 42.7 3.7 41.5 4.4
    855 1239 MARC1-426 33.6 2.5 38.2 3.7
    856 1240 MARC1-427 20.1 1.3 28.6 2.4
    857 1241 MARC1-428 46.5 8.1 69.6 11.3
    858 1242 MARC1-429 17.4 1.8 33.6 3.5
    859 1243 MARC1-430 29.1 3.2 42.1 5.0
    860 1244 MARC1-431 23.1 2.7 40.8 3.5
    861 1245 MARC1-433 12.5 0.7 20.2 1.7
    862 1246 MARC1-434 16.0 1.3 24.7 1.8
    863 1247 MARC1-435 18.7 2.0 26.8 2.5
    864 1248 MARC1-436 42.1 3.7 62.6 5.9
    865 1249 MARC1-437 20.1 2.2 42.8 9.0
    866 1250 MARC1-438 35.8 3.4 36.0 3.6
    867 1251 MARC1-439 21.0 2.6 26.4 3.0
    868 1252 MARC1-440 38.0 11.5 104.7 29.2
    869 1253 MARC1-441 18.7 1.7 23.7 2.0
    870 1254 MARC1-445 30.1 3.4 36.6 3.4
    871 1255 MARC1-446 14.2 2.8 25.0 3.9
    872 1256 MARC1-447 25.4 6.7 35.9 8.2
    873 1257 MARC1-448 26.9 5.3 27.5 4.5
    874 1258 MARC1-449 22.4 3.3 26.9 4.4
    875 1259 MARC1-450 21.1 1.3 22.8 1.7
    876 1260 MARC1-451 30.6 1.5 33.4 1.9
    877 1261 MARC1-452 78.5 9.6 85.6 16.8
    878 1262 MARC1-453 44.4 2.3 49.4 3.2
    879 1263 MARC1-454 29.1 2.7 43.3 3.5
    880 1264 MARC1-456 19.7 2.3 24.6 2.7
    881 1265 MARC1-457 14.6 1.5 25.1 2.3
    882 1266 MARC1-458 18.1 1.2 25.1 3.3
    883 1267 MARC1-459 29.4 1.7 35.1 3.3
    884 1268 MARC1-460 30.5 1.5 34.0 3.2
    885 1269 MARC1-462 33.2 3.3 38.2 3.9
    886 1270 MARC1-468 49.0 4.2 61.9 7.9
    887 1271 MARC1-469 24.5 1.6 28.9 2.9
    888 1272 MARC1-470 32.1 3.3 35.5 4.3
    889 1273 MARC1-471 39.8 1.7 48.7 2.4
    890 1274 MARC1-473 27.1 1.9 32.1 2.6
    891 1275 MARC1-475 78.8 2.8 70.6 2.3
    892 1276 MARC1-476 108.2 7.7 107.7 8.6
    893 1277 MARC1-482 36.1 2.3 39.0 3.2
    894 1278 MARC1-483 28.8 1.7 43.0 2.5
    895 1279 MARC1-484 33.9 3.0 44.0 5.3
    896 1280 MARC1-552 44.8 3.3 70.4 7.3
    897 1281 MARC1-553 17.9 1.0 32.0 1.8
    898 1282 MARC1-554 21.9 2.2 31.8 2.0
    899 1283 MARC1-555 28.6 2.1 40.5 3.6
    900 1284 MARC1-556 18.5 0.8 27.8 1.6
    901 1285 MARC1-557 25.3 2.0 31.6 2.7
    902 1286 MARC1-558 43.5 2.7 66.1 5.3
    903 1287 MARC1-559 41.0 2.6 47.0 3.2
    904 1288 MARC1-560 21.3 1.5 37.7 3.1
    905 1289 MARC1-561 19.8 1.5 26.1 2.1
    906 1290 MARC1-562 78.6 4.6 85.6 8.3
    907 1291 MARC1-563 61.7 3.3 73.4 4.2
    908 1292 MARC1-564 31.4 2.3 37.6 3.3
    909 1293 MARC1-565 56.3 3.7 60.5 4.8
    910 1294 MARC1-566 41.7 5.4 53.1 5.8
    911 1295 MARC1-567 68.1 5.1 76.5 6.7
    912 1296 MARC1-568 46.7 3.5 67.5 5.8
    913 1297 MARC1-589 23.4 2.2 35.4 2.6
    914 1298 MARC1-591 14.9 1.1 21.5 2.9
    915 1299 MARC1-592 21.8 3.2 24.8 4.2
    916 1300 MARC1-593 71.2 7.2 96.1 12.4
    917 1301 MARC1-597 43.2 2.6 53.7 5.2
    918 1302 MARC1-600 24.1 5.7 29.1 5.7
    919 1303 MARC1-612 22.6 2.0 26.3 2.4
    920 1304 MARC1-614 34.2 4.1 48.3 7.2
    921 1305 MARC1-617 59.0 6.1 75.3 8.1
    922 1306 MARC1-618 22.8 1.4 37.6 3.0
    923 1307 MARC1-620 28.9 1.8 39.9 3.2
    924 1308 MARC1-621 32.0 4.6 34.8 4.0
    925 1309 MARC1-622 14.6 1.0 23.4 1.6
    926 1310 MARC1-623 28.6 2.1 36.3 2.8
    927 1311 MARC1-624 30.6 2.6 36.4 3.1
    928 1312 MARC1-625 38.3 4.8 39.0 5.4
    929 1313 MARC1-626 21.1 2.6 25.5 2.9
    930 1314 MARC1-627 14.5 1.3 17.9 1.7
    931 1315 MARC1-628 39.6 3.9 43.3 3.8
    932 1316 MARC1-629 54.1 3.6 52.5 2.9
    933 1317 MARC1-630 25.9 3.4 35.6 4.1
    934 1318 MARC1-631 19.8 1.2 29.5 2.4
    935 1319 MARC1-632 17.7 2.1 22.3 2.1
    936 1320 MARC1-633 16.9 1.0 20.2 1.9
    937 1321 MARC1-634 21.4 1.2 39.9 4.1
    938 1322 MARC1-635 23.2 1.9 26.1 2.9
    939 1323 MARC1-636 45.3 1.6 38.1 1.9
    940 1324 MARC1-637 53.9 6.0 54.5 9.8
    941 1325 MARC1-638 15.2 0.9 21.9 1.6
    942 1326 MARC1-639 17.7 1.3 23.9 2.9
    943 1327 MARC1-640 29.5 3.6 36.9 4.2
    944 1328 MARC1-641 22.8 2.4 45.1 7.5
    945 1329 MARC1-642 19.2 1.9 47.2 5.3
    946 1330 MARC1-643 19.4 1.1 27.6 2.8
    947 1331 MARC1-644 24.2 1.7 30.0 4.5
    948 1332 MARC1-645 37.6 2.3 44.5 3.2
    949 1333 MARC1-646 41.5 2.5 43.1 4.1
    950 1334 MARC1-647 46.5 4.2 49.6 5.2
    951 1335 MARC1-648 19.0 1.6 27.0 3.6
    952 1336 MARC1-649 35.7 5.0 39.8 5.7
    953 1337 MARC1-650 72.2 6.8 84.2 5.8
    954 1338 MARC1-651 71.7 4.7 70.7 6.9
    955 1339 MARC1-652 57.0 2.1 62.3 8.8
    956 1340 MARC1-653 18.2 1.4 20.7 2.4
    957 1341 MARC1-654 17.9 1.0 19.5 1.5
    958 1342 MARC1-655 71.5 7.0 71.2 9.3
    959 1343 MARC1-656 41.9 3.6 44.1 4.4
    960 1344 MARC1-657 18.2 2.8 21.7 3.1
    961 1345 MARC1-658 30.2 2.1 45.9 2.7
    962 1346 MARC1-659 47.1 14.7 51.8 11.1
    963 1347 MARC1-660 17.7 1.7 23.6 2.0
    964 1348 MARC1-661 13.0 1.4 20.4 2.5
    965 1349 MARC1-662 25.5 2.4 30.9 2.6
    966 1350 MARC1-663 34.3 3.5 36.3 3.4
    967 1351 MARC1-664 37.1 4.4 41.9 4.1
    968 1352 MARC1-665 22.5 2.2 37.8 3.6
    969 1353 MARC1-666 17.8 1.9 32.6 4.5
    970 1354 MARC1-667 27.4 5.0 32.6 7.3
    971 1355 MARC1-668 45.6 3.0 58.0 2.8
    972 1356 MARC1-669 33.1 2.4 42.1 2.8
    973 1357 MARC1-670 26.3 2.7 29.7 2.6
    974 1358 MARC1-671 62.9 3.4 66.9 6.9
    975 1359 MARC1-672 60.3 3.5 70.9 5.1
    976 1360 MARC1-673 38.8 4.0 56.7 8.1
    977 1361 MARC1-674 21.4 1.5 37.8 2.9
    978 1362 MARC1-675 47.6 3.7 51.1 4.0
    979 1363 MARC1-676 53.9 4.1 54.2 4.9
    980 1364 MARC1-677 44.5 8.6 69.6 17.2
    981 1365 MARC1-678 38.1 3.8 37.7 4.3
    982 1366 MARC1-679 50.7 3.6 49.1 6.0
    983 1367 MARC1-680 27.5 1.8 29.5 2.0
    984 1368 MARC1-681 24.9 2.1 32.7 2.0
    985 1369 MARC1-682 51.4 2.4 55.4 2.2
    986 1370 MARC1-683 28.0 1.7 26.9 2.5
    987 1371 MARC1-684 23.8 2.1 23.8 3.0
    988 1372 MARC1-685 72.2 13.5 81.3 15.1
    989 1373 MARC1-686 18.8 1.2 20.5 3.4
    990 1374 MARC1-687 18.0 1.8 22.3 3.1
    991 1375 MARC1-691 21.8 2.3 23.6 2.6
    992 1376 MARC1-692 25.7 2.9 25.4 2.7
    993 1377 MARC1-724 49.0 2.8 74.6 10.5
    994 1378 MARC1-726 36.6 3.5 37.6 4.1
    995 1379 MARC1-728 38.9 3.1 40.0 4.2
    996 1380 MARC1-729 31.8 3.4 36.0 4.8
    997 1381 MARC1-730 62.3 3.1 60.0 7.8
    998 1382 MARC1-731 66.0 6.6 66.1 6.8
    999 1383 MARC1-733 33.8 4.4 28.0 3.7
    1000 1384 MARC1-734 17.7 2.0 25.8 3.4
    1001 1385 MARC1-735 9.5 1.4 16.7 2.2
    1002 1386 MARC1-736 12.0 2.1 13.5 1.7
    1003 1387 MARC1-737 17.0 1.0 18.8 1.2
    1004 1388 MARC1-738 25.6 4.5 24.0 4.0
    1005 1389 MARC1-739 19.1 2.2 16.2 1.3
    1006 1390 MARC1-740 31.5 3.5 30.1 3.5
    1007 1391 MARC1-741 36.4 2.7 29.1 2.6
    1008 1392 MARC1-742 32.9 5.4 29.7 4.7
    1009 1393 MARC1-743 45.3 5.5 59.2 5.0
    1010 1394 MARC1-744 25.4 2.6 34.7 2.7
    1011 1395 MARC1-745 23.2 2.7 27.8 4.6
    1012 1396 MARC1-746 121.1 19.5 153.6 26.6
    1013 1397 MARC1-747 29.4 3.2 33.1 3.4
    1014 1398 MARC1-748 26.9 4.1 30.0 4.9
    1015 1399 MARC1-750 33.3 6.4 36.3 6.3
    1016 1400 MARC1-751 35.1 5.3 42.0 8.0
    1017 1401 MARC1-752 22.9 2.6 27.1 5.4
    1018 1402 MARC1-753 41.3 2.5 42.9 2.8
    1019 1403 MARC1-754 84.7 7.7 57.0 5.7
    1020 1404 MARC1-755 22.1 1.5 31.3 6.5
    1021 1405 MARC1-756 46.6 2.1 46.2 2.5
    1022 1406 MARC1-758 36.5 5.4 43.8 5.8
    1023 1407 MARC1-759 57.6 10.7 73.2 15.8
    1024 1408 MARC1-760 33.0 6.1 41.1 10.1
    1025 1409 MARC1-761 16.1 1.8 19.6 2.7
    1026 1410 MARC1-762 16.3 1.0 20.3 1.8
    1027 1411 MARC1-763 22.9 1.5 25.1 2.3
    1028 1412 MARC1-764 43.1 1.7 49.5 3.2
    1029 1413 MARC1-765 57.2 5.0 50.2 4.5
    1030 1414 MARC1-766 30.2 2.1 35.3 3.8
    1031 1415 MARC1-767 84.0 12.8 83.7 19.5
    1032 1416 MARC1-768 20.9 3.5 22.9 4.2
    1033 1417 MARC1-769 21.0 3.8 29.6 3.4
    1034 1418 MARC1-770 24.1 1.3 29.9 1.6
    1035 1419 MARC1-771 40.2 2.9 35.8 2.7
    1036 1420 MARC1-772 80.6 29.6 123.8 45.0
    1037 1421 MARC1-773 37.5 2.6 39.5 4.7
    1038 1422 MARC1-774 19.5 1.4 24.3 2.2
    1039 1423 MARC1-775 18.6 1.5 22.5 2.7
    1040 1424 MARC1-776 32.4 4.4 39.9 5.9
    1041 1425 MARC1-777 28.7 1.9 33.7 2.4
    1042 1426 MARC1-778 18.7 1.5 25.3 2.3
    1043 1427 MARC1-779 24.6 3.0 41.9 7.7
    1044 1428 MARC1-780 22.5 4.3 32.3 7.0
    1045 1429 MARC1-781 25.8 2.3 25.7 2.2
    1046 1430 MARC1-782 19.4 3.9 30.7 7.7
    1047 1431 MARC1-783 23.2 3.9 27.1 4.5
    1048 1432 MARC1-784 19.6 2.9 27.1 4.3
    1049 1433 MARC1-785 15.2 0.9 19.1 1.8
    1050 1434 MARC1-786 41.3 3.9 44.4 6.4
    1051 1435 MARC1-787 25.2 3.3 27.4 3.8
    1052 1436 MARC1-788 12.7 1.2 18.7 1.4
    1053 1437 MARC1-789 15.2 1.6 21.0 2.2
    1054 1438 MARC1-790 20.3 2.3 25.1 3.1
    1055 1439 MARC1-791 29.7 2.4 32.2 2.5
    1056 1440 MARC1-792 36.7 4.8 43.2 5.9
    1057 1441 MARC1-863 11.8 1.8 18.6 1.8
    1058 1442 MARC1-929 37.4 6.8 42.9 8.0
    1059 1443 MARC1-930 54.5 6.6 60.7 10.4
    1060 1444 MARC1-934 55.3 8.2 78.8 12.0
    1061 1445 MARC1-955 37.2 4.9 41.5 5.7
    1062 1446 MARC1-959 17.8 1.8 22.1 1.7
    1063 1447 MARC1-960 25.2 2.5 29.9 5.9
    1064 1448 MARC1-963 32.1 4.3 34.8 6.4
    1065 1449 MARC1-964 20.0 2.3 23.0 2.9
    1066 1450 MARC1-965 15.2 1.2 21.0 1.0
    1067 1451 MARC1-966 19.9 0.9 22.2 1.7
    1068 1452 MARC1-967 18.4 2.7 25.0 7.0
    1069 1453 MARC1-969 19.9 1.4 23.5 1.6
    1070 1454 MARC1-970 28.1 1.6 30.7 3.8
    1071 1455 MARC1-971 24.2 1.6 26.3 2.4
    1072 1456 MARC1-1107 24.2 3.9 24.7 4.7
    1073 1457 MARC1-1113 49.9 4.3 56.3 6.4
    1074 1458 MARC1-1118 18.2 1.6 21.9 2.1
    1075 1459 MARC1-1123 25.7 2.5 28.3 1.2
    1076 1460 MARC1-1126 21.1 7.6 27.2 10.2
    1077 1461 MARC1-1127 29.6 2.4 29.6 2.6
    1078 1462 MARC1-1128 23.9 1.0 27.8 2.0
    1079 1463 MARC1-1129 27.1 4.1 33.3 5.0
    1080 1464 MARC1-1130 34.3 5.3 32.6 4.9
    1081 1465 MARC1-1132 24.3 2.6 19.2 4.1
    1082 1466 MARC1-1133 26.2 3.1 31.0 3.6
    1083 1467 MARC1-1134 21.3 1.6 21.9 1.5
    1084 1468 MARC1-1135 36.3 7.5 36.5 10.8
    1085 1469 MARC1-1139 25.3 2.3 25.3 1.6
    1086 1470 MARC1-1144 49.8 7.4 48.3 9.1
    1087 1471 MARC1-1165 38.9 6.7 35.7 6.2
    1088 1472 MARC1-1167 90.1 7.0 61.4 9.1
    1089 1473 MARC1-1173 32.7 2.4 35.8 6.1
    1090 1474 MARC1-1177 14.9 1.2 20.4 2.1
    1091 1475 MARC1-1179 11.6 0.7 13.4 1.5
    1092 1476 MARC1-1329 24.9 1.8 26.6 2.3
    1093 1477 MARC1-1330 23.4 1.7 23.5 1.8
    1094 1478 MARC1-1332 33.9 5.1 32.9 5.5
    1095 1479 MARC1-1333 48.9 6.1 50.8 6.9
    1096 1480 MARC1-1334 34.7 7.0 31.1 6.8
    1097 1481 MARC1-1335 16.8 1.5 19.2 2.4
    1098 1482 MARC1-1620 18.9 2.7 18.1 3.0
    1099 1483 MARC1-1622 22.1 1.5 21.2 1.5
    1100 1484 MARC1-1660 29.6 6.1 23.2 4.1
    1101 1485 MARC1-1663 39.1 3.9 33.8 5.5
    1102 1486 MARC1-1664 26.5 3.4 23.2 3.3
    1103 1487 MARC1-1812 30.7 2.6 26.3 2.9
    1104 1488 MARC1-1816 41.2 10.1 27.3 7.3
    1105 1489 MARC1-1868 21.0 4.7 27.9 5.8
    1106 1490 MARC1-1869 25.7 3.6 28.5 5.6
    1107 1491 MARC1-1876 20.4 1.9 15.6 1.9
    1108 1492 MARC1-1877 33.1 1.6 20.1 3.9
    1109 1493 MARC1-1878 24.1 1.3 17.3 2.1
    1110 1494 MARC1-1879 27.4 4.3 18.8 3.3
    1111 1495 MARC1-1882 29.8 3.3 17.4 3.2
    1112 1496 MARC1-1883 34.8 6.8 13.0 3.3
    1113 1497 MARC1-1884 22.6 2.0 20.6 4.7
    1114 1498 MARC1-1885 20.2 1.9 13.8 2.0
    1115 1499 MARC1-1886 28.6 3.2 25.6 4.0
    1116 1500 MARC1-1935 25.6 1.8 23.2 1.4
    1117 1501 MARC1-1936 38.8 3.3 17.0 2.8
    1118 1502 MARC1-1937 25.4 3.0 15.9 4.2
    1119 1503 MARC1-1939 60.6 6.1 25.1 4.1
    1120 1504 MARC1-1941 36.9 7.7 27.4 9.8
    1121 1505 MARC1-1953 22.0 2.9 35.2 10.0
    1122 1506 MARC1-1955 20.3 1.6 24.9 2.4
    1123 1507 MARC1-1981 24.8 1.4 24.5 2.3
    1124 1508 MARC1-1983 26.7 2.2 19.2 6.6
    1125 1509 MARC1-1985 41.5 2.2 16.4 2.5
    1126 1510 MARC1-1986 22.6 1.8 15.0 2.8
    1127 1511 MARC1-1988 35.6 4.6 63.9 24.7
    1128 1512 MARC1-1989 39.6 4.4 26.2 4.3
    1129 1513 MARC1-1990 25.8 1.9 18.8 2.2
    1130 1514 MARC1-1995 27.8 1.2 22.9 2.5
    1131 1515 MARC1-1996 36.0 2.3 19.7 2.0
    1132 1516 MARC1-1998 108.0 16.4 51.0 8.5
    1133 1517 MARC1-1999 57.4 4.9 74.3 12.0
    1134 1518 MARC1-2000 34.4 2.3 17.8 3.5
    1135 1519 MARC1-2001 53.6 7.9 17.9 3.0
    1136 1520 MARC1-2002 68.0 17.7 11.3 3.4
    1137 1521 MARC1-2005 27.4 5.7 34.1 12.2
    1138 1522 MARC1-2006 25.2 1.8 23.8 2.6
    1139 1523 MARC1-2010 63.5 7.7 33.0 4.5
    1140 1524 MARC1-2011 21.8 2.0 22.0 4.9
    1141 1525 MARC1-2012 19.1 1.2 9.9 1.0
    1142 1526 MARC1-2013 34.8 5.6 10.7 2.1
    1143 1527 MARC1-2015 93.3 24.0 23.5 6.8
    1144 1528 MARC1-2016 57.0 11.1 12.6 2.9
    1145 1529 MARC1-2017 24.8 1.2 25.3 2.0
    1146 1530 MARC1-2018 34.4 4.1 29.9 5.6
    1147 1531 MARC1-2019 25.5 2.6 22.4 2.5
    1148 1532 MARC1-2020 25.7 2.6 27.9 7.9
    1149 1533 MARC1-2022 18.5 1.5 18.4 2.6
    1150 1534 MARC1-2023 34.1 2.4 14.6 1.2
    1151 1535 MARC1-2025 137.2 22.1 24.1 4.8
    1152 1536 MARC1-2027 158.4 33.6 39.5 9.7
    • Example 3: RNAi Oligonucleotide Inhibition of MARC1 In Vivo
  • The in vitro screening assay in Example 2 validated the ability of MARC1-targeting oligonucleotides to knock-down target mRNA. To confirm the ability of the RNAi oligonucleotides to knockdown MARC1 in vivo, an HDI mouse model was used. A subset of the DsiRNAs identified in Example 2 were used to generate corresponding double-stranded RNAi oligonucleotides comprising a nicked tetraloop GalNAc-conjugated structure (referred to herein as “GalNAc-conjugated MARC1 oligonucleotides” or “GalNAc-MARC1 oligonucleotides”) having a 36-mer passenger strand and a 22-mer guide strand (Table 4). Further, the nucleotide sequences comprising the passenger strand and guide strand have a distinct pattern of modified nucleotides and phosphorothioate linkages (sense strand SEQ ID Nos: 1609-1642; antisense SEQ ID Nos: 1645-1678). Three of the nucleotides comprising the tetraloop were each conjugated to a GalNAc moiety (CAS#14131-60-3). The modification pattern of each strand is illustrated below:
    • Sense Strand: 5′-mX-S-mX-mX-mX-mX-mX-mX-fX-fX-fX-fX[-mX-]16-[ademX-GalNAc]-[ademX-GalNAc]-[ademX-GalNAc]-mX-mX-mX-mX-mX-mX-3′. Hybridized to:
    • Antisense Strand: 5′-[MePhosphonate-4O-mX]-S-fX-S-fX-S-fX-fX-mX-fX-mX-mX-fX-mX-mX-mX-fX-mX-mX-mX-mX-mX-mX-S-mX-S-mX-3′. Or, represented as:
      • Sense Strand: [mXs][mX][mX][mX][mX][mX][mX][fX][fX][fX][fX][mX][mX][mX] [mX][mX][mX][mX][mX][mX][mX][mX][mX][mX][mX][mX][mX][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mX][mX][mX][mX][mX][mX] Hybridized to:
      • Antisense Strand: [MePhosphonate-4O-mXs] [fXs] [fXs] [fX] [fX] [mX] [fX] [mX] [mX] [fX] [mX] [mX] [mX] [fX] [mX] [mX] [mX] [mX] [mX] [mXs] [mXs] [mX]
  • TABLE 3
    Modification key
    Symbol Modification/linkage
    Key
    1
    mX 2′-O-methyl modified nucleotide
    fX
    2′-fluoro modified nucleotide
    -S- phosphorothioate linkage
    – phosphodiester linkage
    [MePhosphonate-4O-mX] 5′-methoxyphosphonate-4′-oxy modified nucleotide
    ademA-GalNAc GalNAc attached to an adenine nucleotide
    Key 2
    [mXs] 2′-O-methyl modified nucleotide with a phosphorothioate linkage to the neighboring nucleotide
    [fXs] 2′-fluoro modified nucleotide with a phosphorothioate linkage to the neighboring nucleotide
    [mX] 2′-O-methyl modified nucleotide with phosphodiester linkages to neighboring nucleotides
    [fX] 2′-fluoro modified nucleotide with phosphodiester linkages to neighboring nucleotides
  • Oligonucleotides in Table 4 were evaluated in mice engineered to transiently express human MARC1 mRNA in hepatocytes of the mouse liver. Briefly, 6-8-week-old female CD-1 mice (n = 4-5) were subcutaneously administered the indicated GalNAc-conjugated MARC1 oligonucleotides at a dose of 2 mg/kg formulated in PBS. A control group of mice (n = 5) were administered only PBS. Three days later (72 hours), the mice were HDI with a DNA plasmid encoding the full human MARC1 gene (SEQ ID NO: 1682) (25 µg) under control of a ubiquitous cytomegalovirus (CMV) promoter sequence. One day after introduction of the DNA plasmid, liver samples from HDI mice were collected. Total RNA derived from these HDI mice were subjected to qRT-PCR analysis to determine MARC1 mRNA levels as described in Example 2. mRNA levels were measured for human mRNA. The values were normalized for transfection efficiency using the NeoR gene included on the DNA plasmid.
  • TABLE 4
    GalNAc-Conjugated MARC1 RNAi Oligonucleotides for HDI screen
    Unmodified Sense Strand (SEQ ID NO) Unmodified Antisense strand (SEQ ID NO) Modified Sense Strand (SEQ ID NO) Modified Antisense strand (SEQ ID NO)
    MARC1-0324 1537 1573 1609 1645
    MARC1-0326 1538 1574 1610 1646
    MARC1-0327 1539 1575 1611 1647
    MARC1-0330 1540 1576 1612 1648
    MARC1-0331 1541 1577 1613 1649
    MARC1-0735 1542 1578 1614 1650
    MARC1-0736 1543 1579 1615 1651
    MARC1-0788 1544 1580 1616 1652
    MARC1-0863 1545 1581 1617 1653
    MARC1-1179 1546 1582 1618 1654
    MARC1-2012 1547 1583 1619 1655
    MARC1-2013 1548 1584 1620 1656
    MARC1-0661 1549 1585 1621 1657
    MARC1-1869 1550 1586 1622 1658
    MARC1-1876 1551 1587 1623 1659
    MARC1-1886 1552 1588 1624 1660
    MARC1-2016 1553 1589 1625 1661
    MARC1-0413 1554 1590 1626 1662
    MARC1-0416 1555 1591 1627 1663
    MARC1-0622 1556 1592 1628 1664
    MARC1-0638 1557 1593 1629 1665
    MARC1-0657 1558 1594 1630 1666
    MARC1-0660 1559 1595 1631 1667
    MARC1-0965 1560 1596 1632 1668
    MARC1-0966 1561 1597 1633 1669
    MARC1-0967 1562 1598 1634 1670
    MARC1-0969 1563 1599 1635 1671
    MARC1-1177 1564 1600 1636 1672
    MARC1-1884 1565 1601 1637 1673
    MARC1-1885 1566 1602 1638 1674
    MARC1-1955 1567 1603 1639 1675
    MARC1-1983 1568 1604 1640 1676
    MARC1-1986 1569 1605 1641 1677
    MARC1-2011 1570 1606 1642 1678
  • The results in FIG. 2 demonstrate that GalNAc-conjugated MARC1 oligonucleotides designed to target human MARC1 mRNA inhibited human MARC1 mRNA expression in HDI mice, as determined by a reduction in the amount of human MARC1 mRNA expression in liver samples from HDI mice treated with GalNAc-conjugated MARC1 oligonucleotides relative to control HDI mice treated with only PBS.
  • A subset of the GalNAc-conjugated MARC1 oligonucleotides tested in FIG. 2 were further validated in repeat assays as shown in FIG. 3 using oligonucleotides selected from Table 4. The assays verified knock-down efficiency of each GalNAc-conjugated MARC1 oligonucleotide, and four oligonucleotides were selected for further analysis.
  • Specifically, dosing studies were carried out using four GalNAc-conjugated MARC1 oligonucleotides (MARC1-0736, MARC1-965, MARC1-1983, and MARC1-2016). Mice were HDI as described above and treated with 0.1 mg/kg, 0.3 mg/kg, or 1 mg/kg of oligonucleotide. Livers were collected after one day, and MARC1 expression was measured to determine a potent dose (FIG. 4 ). All GalNAc-conjugated MARC1 oligonucleotides were able to reduce MARC1 expression at a 1 mg/kg dose. Overall, the HDI studies identified several potential GalNAc-conjugated MARC1 oligonucleotides for inhibiting MARC1 expression in liver.
    • Example 4: RNAi Oligonucleotide Inhibition of MARC1 in DIO-NASH Disease Model
  • To investigate the therapeutic effect of GalNAc-conjugated MARC1 oligonucleotides on liver diseases such as NAFLD and NASH, the diet-induced obese (DIO)-NASH model was used (Kristiansen, M., et al. 2016. WJH. 8(16): 673-684). The model exhibits histopathology and clinical endpoints similar to NASH and is initiated through a diet high in fat, fructose, and cholesterol. Two mice specific surrogate GalNAc-conjugated MARC1 oligonucleotides with different levels of knockdown (Table 5B) were tested in this murine model of NASH. Mice were fed Lean Chow (11% fat, 24% protein, and 65% carbohydrate; Altromin 1324, Brogaarden, Denmark), or a NASH diet consisting of 40% fat, 22% fructose and 2% cholesterol (D09100310, Research Diets) for 36 weeks (DIO-NASH). Prior to treatment with oligonucleotides and the GLP-1 receptor agonist mice were randomized into chow control, PBS control, GLP-1 ‘22’, MARC1-1113 (SEQ ID NOs: 1643 and 1679), and MARC1-1575 (SEQ ID NOs: 1644 and 1680) treatment groups by their fibrosis state as determined by Collal, i.e., collagen, levels (data not shown). Weekly concurrent, subcutaneous dosing was initiated on week 36 and mice were treated with 3 mg/kg of MARC1-1113, 3 mg/kg of MARC1-1575, 10 nmol/kg of GLP-1 ‘22’, or PBS control (“DIO-NASH vehicle”) for 8 weeks. The GLP-1 receptor agonist (GLP-1 ‘22’) is a long acting GLP-1 receptor agonist and used as a benchmark in these studies. Injections were given on days 0, 7, 14, 21, 28, 35, 42, and 49 after initiation of the study (i.e. week 36 on DIO-NASH or Lean Chow diet). The DIO-NASH vehicle control, MARC1-1113, and MARC1-1575 mice increased their relative body weight at similar pace throughout the duration of the study (Table 5A). As expected, the Lean-Chow showed a slower rate of body weight gain, while GLP-1 ‘22’ controls showed a reduction in relative body weight to the start of the study.
  • Table 5A provides the body weight of mice throughout treatment with GalNAc-conjugated MARC1 oligonucleotides targeting mouse MARC1 or a long acting GLP-1 receptor against (GLP-1 ‘22’) used as positive control for disease regression in a diet induced obesity (DIO) - NASH model. Weights are relative to starting weight. Mice were fed a DIO-NASH (AMLN diet) or Lean-Chow diet.
  • Body Weight (%)
    Study Day Lean-Chow DIO-NASH Vehicle MARC1-1113 MARC1-1575 GLP-1 ‘22’
    Mean SEM Mean SEM Mean SEM Mean SEM Mean SEM
    -4 101.02 0.48 99.86 0.56 99.13 0.33 100.18 0.39 99.91 0.50
    -3 100.79 0.53 99.95 0.50 98.73 0.28 100.20 0.37 99.39 0.49
    -2 100.75 0.38 99.74 0.41 98.96 0.37 99.75 0.32 99.16 0.45
    -1 100.52 0.31 99.74 0.25 99.10 0.25 99.74 0.31 99.33 0.33
    0 100.00 0.00 100.00 0.00 100.00 0.00 100.00 0.00 100.00 0.00
    1 99.46 0.50 100.13 0.30 99.28 0.24 99.72 0.33 98.23 0.35
    2 99.66 0.34 100.10 0.30 99.42 0.25 99.72 0.47 96.88 0.39
    3 99.77 0.44 100.81 0.37 99.61 0.28 100.59 0.37 95.46 0.47
    4 100.11 0.41 101.09 0.42 100.34 0.25 101.18 0.47 92.30 0.64
    5 100.38 0.61 100.99 0.40 100.04 0.39 100.80 0.52 89.71 0.69
    6 100.87 0.58 101.24 0.48 99.92 0.49 101.04 0.56 86.62 0.84
    7 101.37 0.55 101.86 0.56 100.52 0.54 101.65 0.56 86.13 1.09
    8 101.31 0.55 101.82 0.55 101.14 0.40 102.28 0.56 84.75 1.50
    9 101.10 0.70 102.34 0.71 101.90 0.51 102.28 0.63 83.78 1.76
    10 101.60 0.73 102.75 0.61 102.57 0.56 103.09 0.63 84.31 1.65
    11 101.63 0.88 102.88 0.68 102.74 0.57 103.45 0.76 84.25 1.54
    12 101.50 0.82 102.71 0.67 102.47 0.51 103.01 0.81 83.92 1.51
    13 101.30 0.79 102.66 0.61 102.45 0.66 101.92 0.60 83.88 1.27
    14 101.38 0.69 103.13 0.68 102.37 0.54 104.19 0.85 83.46 1.35
    15 100.75 0.79 102.89 0.64 102.52 0.72 103.85 0.83 83.39 1.37
    16 101.63 1.18 102.47 0.67 102.34 0.70 103.58 0.86 83.39 1.26
    17 102.92 0.88 103.49 0.65 102.98 0.66 104.44 0.85 82.71 1.31
    18 103.67 1.08 103.61 0.66 102.97 0.76 104.75 0.85 82.51 1.41
    19 103.62 0.94 103.69 0.64 103.10 0.68 104.75 0.88 82.12 1.45
    20 102.89 0.73 103.65 0.63 103.29 0.82 105.00 0.89 81.96 1.20
    21 102.36 0.95 103.73 0.73 103.76 0.86 105.52 0.89 82.52 1.02
    22 101.94 0.96 104.69 0.56 103.86 0.82 105.45 0.79 82.74 1.03
    23 102.50 0.93 104.39 0.58 103.61 0.80 105.32 0.71 83.14 1.02
    24 103.73 1.07 104.71 0.85 104.19 0.73 106.05 0.82 82.30 1.05
    25 102.48 0.75 103.46 0.72 103.92 0.73 106.28 0.69 82.66 1.02
    26 101.93 0.95 103.08 0.79 103.56 0.76 105.30 0.74 82.37 0.98
    27 102.19 0.80 102.52 0.79 102.83 0.62 104.33 0.87 81.69 0.94
    28 101.51 0.74 103.28 0.77 102.98 0.66 104.89 0.90 82.04 0.86
    29 101.95 0.76 103.24 0.75 103.38 0.82 104.34 0.96 82.26 0.94
    30 102.50 0.75 103.89 0.78 104.13 0.81 105.52 0.96 82.09 0.93
    31 102.80 0.65 103.38 0.73 103.80 0.90 105.25 0.84 81.99 0.96
    32 102.83 0.59 104.30 0.84 104.40 0.77 105.67 0.88 82.49 0.89
    33 102.03 0.80 104.44 0.94 104.52 0.71 105.65 0.97 82.35 0.85
    34 102.69 0.89 104.26 0.91 104.13 0.76 105.25 1.02 81.87 0.83
    35 102.08 0.93 104.79 0.92 104.93 0.75 105.20 0.82 82.25 0.87
    36 102.37 0.75 105.56 0.96 106.31 0.73 107.05 0.78 83.11 0.85
    37 102.12 1.02 105.43 0.91 106.24 0.84 106.24 0.91 81.99 0.86
    38 101.59 0.67 105.11 0.96 106.36 0.80 106.94 0.78 82.54 0.92
    39 102.70 0.68 105.38 0.94 106.37 0.81 107.12 0.90 82.73 1.06
    40 101.56 0.87 105.64 1.09 106.83 0.88 107.44 0.79 82.70 1.05
    41 101.72 0.78 105.93 1.17 106.36 0.96 107.19 0.75 82.86 0.89
    42 101.61 1.01 106.56 1.14 106.20 0.95 106.85 0.84 82.14 0.97
    43 101.40 1.05 107.48 1.12 107.12 0.90 108.24 0.87 82.88 0.93
    44 102.44 0.89 107.39 1.11 106.59 0.81 107.73 0.88 82.56 1.01
    45 102.32 0.90 106.94 1.07 106.76 0.86 107.73 1.04 82.44 1.16
    46 101.98 1.22 106.96 1.26 107.00 0.91 107.79 0.99 82.91 1.14
    47 102.43 1.09 107.36 1.33 107.18 0.98 108.15 0.98 82.76 1.12
    48 102.28 0.77 107.51 1.32 107.36 0.88 108.50 1.07 83.12 1.18
    49 103.32 1.02 107.94 1.14 107.82 0.94 108.40 1.09 82.35 1.05
    50 102.74 0.95 108.53 1.14 108.70 0.74 107.63 1.09 82.91 1.09
    51 103.84 1.11 108.51 1.39 108.46 0.92 108.05 0.96 83.41 1.01
    52 103.49 1.27 108.86 1.28 109.03 0.79 108.28 0.88 83.14 1.03
    53 102.83 0.89 109.09 1.30 109.06 0.72 108.15 1.06 83.33 1.10
    54 101.77 1.30 108.67 1.32 108.76 0.77 108.41 1.11 82.31 1.24
    55 102.81 0.95 109.63 1.23 109.77 0.70 109.05 1.19 83.46 1.26
    56 103.33 0.95 109.84 1.31 110.04 0.83 109.29 1.04 83.57 1.23
  • After week 8 of dosing, plasma was collected and analyzed for plasma alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglyceride (TG), and total cholesterol (TC). The model performed as expected, as measured by the GLP-1 ‘22’ control reducing ALT, AST, and TC levels. Treatment of DIO-NASH mice with the GalNAc-conjugated MARC1 oligonucleotides did not change the plasma ALT, AST, TG, or TC levels compared to PBS treated DIO-NASH mice (data not shown). Liver tissue was collected at week 8, weighed and processed for analysis. As expected, liver weight was lower in both Lean Chow mice and DIO-NASH mice treated with GLP-1 ‘22’ at termination of the study compared to the NASH vehicle group. However, there was no observed difference in liver weight in the DIO-NASH mice treated with vehicle control or the GalNAc-conjugated MARC1 oligonucleotides (data not shown). In the liver, TG levels were reduced in both MARC1-1113 and MARC1-1575 treated mice compared to DIO-NASH vehicle control (FIGS. 5 and 6 ). Further, NAFLD activity was measured. The NAFLD activity score is used to measure changes in disease features concurrent with treatment for NAFLD and is measured by staining liver samples and using clinical criteria outlined in Kleiner et al. (Kleiner et al. 2005. Hepatology. 41: 1313-1321) to determine the score. The MARC1-1113 oligonucleotide demonstrated an improved NAFLD score in the DIO-NASH model (FIG. 7 ). Similarly, treatment with the MARC1-1113 oligonucleotide reduced steatosis (calculated as a percentage of hepatocytes with lipid droplets) in the animals (FIG. 8 ), but no reduction was observed for hepatocellular ballooning or lobular inflammation (data not shown) as determined by histopathological analysis as described in Kleiner et al. Reduced steatosis fraction (i.e. measured area fraction of steatosis in a histology sample) and hepatocytes with liver droplets is observed in MARC1-1113 treated mice, as determined by quantification of histopathological analysis using methods described in Kleiner et al. (FIGS. 9A and 9B). Inflammation and fibrosis do not appear to be changed with treatment as there was no observed difference in the number of inflammatory cells, inflammatory foci, CD45, CDllb, fibrosis, periportal fibrosis, sinusoidal fibrosis, or Colla among treatment groups (data not shown). However, the stellate cell activation marker α-SMA, an early indicator of hepatic fibrosis was reduced by MARC1-1113 treatment demonstrating that although a reduction in overall fibrosis was not observed, treatment with MARC1-1113 reduced fibrosis development (FIG. 10 ). Finally, qPCR was performed on a panel of genes related to MARC1 expression, steatosis, cholesterol metabolism, fibrosis, phosphatidylcholine, and potential biomarkers (Table 5B). Reduced expression was observed for several steatosis relevant genes: Fasn, AcacA, AcacB, and ApoB, following MARC1-1113 treatment. Additionally, a reduction in several early regulators of fibrosis and potential biomarker genes were also reduced following MARC1-1113 treatment including: Collal, Tgfb, Timpl, Mmp9, Mmp2, and Fabpl. These findings demonstrate that MARC1 inhibition reduces genes that regulate steatosis and fibrosis development.
  • In conclusion, the DIO-NASH study demonstrates the therapeutic effect of hepatic MARC1 inhibition using GalNAc-conjugated MARC1 oligonucleotides.
  • TABLE 5B
    Summary of Gene Expression in MARC1 treated DIO-NASH Mice
    Mean % mRNA Remaining (Relative to DIO-NASH Vehicle)
    Gene Lean-Chow DIO-NASH Vehicle MARC1-1113 MARC1 -1575 GLP-1 ‘22’
    Target-Related Genes Marc1 140.38 100.00 10.61 30.60 114.18
    Marc2 131.34 100.00 86.09 114.58 117.14
    Nr1h3 108.41 100.00 92.01 118.46 111.44
    Nr1h2 108.56 100.00 94.98 124.83 114.30
    Fmo3 311.16 100.00 119.93 172.15 251.50
    Dgat2 145.27 100.00 92.25 127.87 120.47
    Steatosis-Related Genes Fasn 172.84 100.00 67.93 132.57 173.23
    Cidec 3.45 100.00 92.15 138.33 65.26
    Acc1 (AcacA) 107.88 100.00 92.85 138.20 117.28
    Acc2 (AcacB) 158.79 100.00 59.13 102.16 144.66
    Sdc1 115.80 100.00 99.88 119.66 118.81
    ApoB 88.84 100.00 78.57 97.86 97.60
    Cholesterol Metabolism-Related Genes Abca1 83.94 100.00 99.39 130.12 110.81
    Abcg5 28.58 100.00 90.89 96.52 95.70
    Hmgcr 562.47 100.00 84.95 146.22 157.49
    Phosphatidylcholin e Hypothesis Pemt 160.40 100.00 86.47 115.15 115.73
    Early Regulators of Fibrosis Genes Col1a1 9.02 100.00 57.83 142.74 58.97
    Tgfb1 59.54 100.00 84.72 120.06 85.16
    Timp1 3.02 100.00 49.32 136.88 48.32
    Mmp9 104.95 100.00 68.95 99.70 99.41
    Mmp2 20.57 100.00 81.04 174.74 124.65
    Biomarker Genes p1a2g12 b 120.28 100.00 92.93 124.68 102.55
    Cpm 136.88 100.00 122.37 140.68 125.86
    Fabp1 128.78 100.00 82.50 176.75 216.97
    Smpd1 107.65 100.00 95.05 121.59 115.48
    Cyp7a1 75.08 100.00 126.34 120.64 121.09
    • Example 5 RNAi Oligonucleotide Inhibition of MARC1 Expression and Studies in NHP
  • Effective GalNAc-conjugated MARC1 oligonucleotides identified in the HDI mouse studies were assayed for targeting efficiency in NHP. Specifically, GalNAc-conjugated MARC1 oligonucleotides listed in Table 6 were evaluated in non-naïve cynomolgus monkeys (Macaca fascicularis). In this study, the monkeys were grouped so that their mean body weights (about 2.5 kg) were comparable between the control and experimental groups. Each cohort contained all male subjects. The GalNAc-conjugated MARC1 oligonucleotides were administered subcutaneously at a dose of either 1 mg/kg or 4 mg/kg on study days 0, 28, 54, and 86. As depicted in the study scheme in FIG. 11 , blood samples were collected two weeks prior to dosing (Day -14), on the dosing date (Day 1) and days 15, 29, 57, and 113 after dosing. Ultrasound-guided core needle liver biopsies were collected on Study Days -13, 27, 55, and 111. At each time point, total RNA derived from the liver biopsy samples was subjected to qRT-PCR analysis to measure MARC1 mRNA in oligonucleotide-treated monkeys relative to those treated with a comparable volume of PBS. To normalize the data, the measurements were made relative to the reference gene, PPIB. The following SYBR assays purchased from IDT were used to evaluate MARC1 gene expression: Forward- SEQ ID NO: 1690, Reverse- SEQ ID NO: 1691. The following TaqMan qPCR probe purchased from ThermoFisher Scientific, was used to evaluate PPIB gene expression: Rh02802984_m1. Treating NHPs with the GalNAc-conjugated MARC1 oligonucleotides listed in Table 6 inhibited MARC1 expression in the liver, as determined by a reduced amount of MARC1 mRNA in liver samples from oligonucleotide-treated NHPs relative to NHPs treated with PBS (Table 7).
  • TABLE 6
    Single-dose GalNAc-conjugated-MARC1 Oligonucleotides for NHP Study
    Name Sense strand (SEQ ID NO) Anti-sense strand (SEQ ID NO)
    MARC1-0736 1615 1651
    MARC1-0965 1632 1668
    MARC1-1983 1640 1676
    MARC1-2016 1625 1661
  • Table 7 provides the percent (%) of NHP MARC1 mRNA remaining after treatment with GalNAc-conjugated MARC1 oligonucleotides. NHP were treated with four doses of the indicated oligonucleotides at 1 mg/kg or 4 mg/kg according to the dosing scheme shown in FIG. 11 . The percent (%) of mRNA remaining in liver was determined in livers collected on the indicated days (0, 28, 56, and 112). No difference was observed in weight among treatment groups.
  • TABLE 7
    MARC1 mRNA in liver samples from oligonucleotide-treated NHPs
    Percent (%) MARC1 mRNA (normalized to pre-dose & time matched PBS)
    Study Day
    0 28 56 112
    PBS Mean 100 100.0 100.0 100.0
    SEM 0 17.7 17.2 16.2
    1 mg/kg MARC1-0736 Mean 100 74.6 34.8 48.6
    SEM 0 17.0 6.4 5.9
    4 mg/kg MARC1-0736 Mean 100 38.1 18.3 35.3
    SEM 0 6.9 6.2 8.6
    1 mg/kg MARC1-0965 Mean 100 80.5 32.2 41.1
    SEM 0 15.0 12.1 14.2
    4 mg/kg MARC1-0965 Mean 100 57.7 23.3 39.5
    SEM 0 9.4 4.6 6.7
    1 mg/kg MARC1-1983 Mean 100 81.0 70.6 93.6
    SEM 0 12.6 11.0 8.4
    4 mg/kg MARC1-1983 Mean 100 49.8 34.5 68.8
    SEM 0 6.2 6.3 8.7
    1 mg/kg MARC1-2016 Mean 100 83.9 71.9 120.3
    SEM 0 9.4 17.4 23.5
    4 mg/kg MARC1-2016 Mean 100 62.0 56.1 71.1
    SEM 0 14.7 15.4 16.8
  • Gene expression related to phosphatidylcholine metabolism (DGAT1, DGAT2, MTTP, APOB, CHKA, CHKB, PCYT1A, CEPT1, PEMT, PCYT2, ETNK, FMO3, ACC2, FASN, and FABP) was measured on days 27, 55, and 111 and showed no changes between PBS and GalNAc-conjugated MARC1 oligonucleotide treated NHPs (data not shown). Circulating lipids were measured on days 14, 29, 57, and 113 and there was no difference observed in TG, Cholesterol, LDLc, HDLc, or ApoB100 between PBS and GalNAc-conjugated MARC1 oligonucleotide treated NHPs (data not shown). Similarly, no difference was observed in liver enzymes including alanine aminotransferase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), or gamma-glutamyl transferase (GGT) (data not shown).
  • Taken together, these results show that GalNAc-conjugated MARC1 oligonucleotides designed to target human MARC1 mRNA inhibit MARC1 expression in vivo in the liver (as determined by the reduction in amount of hepatic MARC1 mRNA).
    • Example 6 - Effect of Reducing MARC1 mRNA on Lipid Accumulation in vitro
  • The effect on lipid accumulation through the reduction of MARC1 mRNA was assessed in vitro using primary human hepatocytes (PHH). Briefly, PHH expressing endogenous human MARC1 gene were cultured for 27 days using long-term maintenance media (Xiang et al, Science 364, 399-402, 2019). A total of 7 PHH donors were used across 25 individual experiments.
  • On day 7 PHH were transfected with 30 nM Dharmacon ON-TARGET plus Human MARC1 siRNA (L-019358-02-0010) or non-targeting siRNA (D-001810-10-20). On day 24 cells were treated with 0 or 800 µM of a BSA conjugated Free Fatty Acids (FFA) mixture comprised of Oleic Acid, Linoleic Acid, Alpha Linoleic Acid and Palmitic Acid. On day 27 cells were harvested for mRNA or fixed with 4% formaldehyde.
  • Expression levels of MARC1 (TaqMan™ Gene Expression Assays #4331182, Hs00224227_m1) and a housekeeping gene, TBP (Hs00427620_m1), were determined by qRT-PCR. MARC1 siRNA reduced MARC1 mRNA with an average of 18% and 14% MARC1 mRNA remaining after 0 and 800 µM FFA treatment, respectively, compared to non-targeting siRNA (Table 8).
  • Fixed cells were stained using Nile Red to quantify lipid accumulation (Diaz et al, Micron 39, 819-824, 2008). The Nile Red ratio was calculated as the neutral lipid fluorescence (540-15 nm/600-20 nm) divided by the phospholipid fluorescence (540-15 nm/640-20 nm). To normalize data across experiments non-targeting siRNA values were set to 0% for 0 µM FFA and 100% for 800 µM FFA treatment using the following equation: % of lipid accumulation = ((Nile Red Ratiox - Nile Red Rationon-targeting 0 µM FFA)/(Nile Red Rationon-targeting 800 µM FFA - Nile Red Rationon-targeting 0 µM FFA)) x 100.
  • In Table 8, lipid accumulation and MARC1 RNA shown % remaining in 7 PHH donors across 25 independent experiments following transfection with MARC1 siRNA and treatment with either 0 or 800 µM FFA. Non-targeting control values at 0 µM were set to 0% and at 800 µM were set to 100%. Two-way ANOVA analysis demonstrated significant Fat and siRNA main effects. **p<0.01 compared to non-targeting siRNA within fat treatment by Sidak’s multiple comparison test. n/a = unable to obtain values due to unsuccessful isolation of RNA.
  • MARC1 siRNA significantly (p<0.01) reduced lipid accumulation by 27% and 35% at 0 and 800 µM FFA, respectively, compared to non-targeting siRNA (Table 8). It was concluded that the knockdown of MARC1 significantly lowered both basal and FFA-induced lipid accumulation in cultured PHH.
  • TABLE 8
    Effects of MARC1 siRNA on lipid accumulation and mRNA in PHH
    MARC1
    0 µM FFA 800 µM FFA
    Donor Experiment % lipid Accumulation % remaining (RNA) % lipid Accumulation % remaining (RNA)
    Donor A 1 -19 8 29 4
    Donor A 2 -3 5 53 5
    Donor B 1 -21 n/a 68 n/a
    Donor C 1 19 17 125 17
    Donor C 2 -140 7 -39 6
    Donor C 3 -65 9 34 8
    Donor C 4 -125 7 36 4
    Donor C 5 -53 11 77 9
    Donor C 6 -24 88 68 17
    Donor D 1 2 6 98 5
    Donor D 2 -16 14 86 14
    Donor E 1 -13 9 41 10
    Donor E 2 -17 28 45 4
    Donor E 3 -72 9 21 8
    Donor E 4 -26 10 56 8
    Donor E 5 -3 8 53 10
    Donor E 6 -36 8 25 7
    Donor F 1 -2 12 107 13
    Donor F 2 -81 33 -25 31
    Donor F 3 10 17 152 15
    Donor F 4 4 28 110 29
    Donor F 5 1 29 121 55
    Donor F 6 -2 27 102 25
    Donor G 1 -11 17 92 16
    Donor G 2 11 23 99 17
    Average -27∗∗ 18 65∗∗ 14
  • SEQUENCE LISTING
    Name Strand Sequence SEQ ID NO
    MTARC1-231 19 mer Sense Strand GCGCAGCUCUGGAUCUACC 1
    MTARC1-233 19 mer Sense Strand GCAGCUCUGGAUCUACCCU 2
    MTARC1-234 19 mer Sense Strand CAGCUCUGGAUCUACCCUG 3
    MTARC1-235 19 mer Sense Strand AGCUCUGGAUCUACCCUGU 4
    MTARC1-236 19 mer Sense Strand GCUCUGGAUCUACCCUGUG 5
    MTARC1-237 19 mer Sense Strand CUCUGGAUCUACCCUGUGA 6
    MTARC1-238 19 mer Sense Strand UCUGGAUCUACCCUGUGAA 7
    MTARC1-239 19 mer Sense Strand CUGGAUCUACCCUGUGAAA 8
    MTARC1-240 19 mer Sense Strand UGGAUCUACCCUGUGAAAU 9
    MTARC1-241 19 mer Sense Strand GGAUCUACCCUGUGAAAUC 10
    MTARC1-242 19 mer Sense Strand GAUCUACCCUGUGAAAUCC 11
    MTARC1-243 19 mer Sense Strand AUCUACCCUGUGAAAUCCU 12
    MTARC1-244 19 mer Sense Strand UCUACCCUGUGAAAUCCUG 13
    MTARC1-245 19 mer Sense Strand CUACCCUGUGAAAUCCUGC 14
    MTARC1-247 19 mer Sense Strand ACCCUGUGAAAUCCUGCAA 15
    MTARC1-248 19 mer Sense Strand CCCUGUGAAAUCCUGCAAG 16
    MTARC1-249 19 mer Sense Strand CCUGUGAAAUCCUGCAAGG 17
    MTARC1-253 19 mer Sense Strand UGAAAUCCUGCAAGGGGGU 18
    MTARC1-255 19 mer Sense Strand AAAUCCUGCAAGGGGGUGC 19
    MTARC1-318 19 mer Sense Strand AACCUGCGGGACAGGUUUU 20
    MTARC1-319 19 mer Sense Strand ACCUGCGGGACAGGUUUUG 21
    MTARC1-320 19 mer Sense Strand CCUGCGGGACAGGUUUUGG 22
    MTARC1-321 19 mer Sense Strand CUGCGGGACAGGUUUUGGC 23
    MTARC1-323 19 mer Sense Strand GCGGGACAGGUUUUGGCUU 24
    MTARC1-324 19 mer Sense Strand CGGGACAGGUUUUGGCUUG 25
    MTARC1-325 19 mer Sense Strand GGGACAGGUUUUGGCUUGU 26
    MTARC1-326 19 mer Sense Strand GGACAGGUUUUGGCUUGUG 27
    MTARC1-327 19 mer Sense Strand GACAGGUUUUGGCUUGUGA 28
    MTARC1-328 19 mer Sense Strand ACAGGUUUUGGCUUGUGAU 29
    MTARC1-329 19 mer Sense Strand CAGGUUUUGGCUUGUGAUC 30
    MTARC1-330 19 mer Sense Strand AGGUUUUGGCUUGUGAUCA 31
    MTARC1-331 19 mer Sense Strand GGUUUUGGCUUGUGAUCAA 32
    MTARC1-332 19 mer Sense Strand GUUUUGGCUUGUGAUCAAC 33
    MTARC1-334 19 mer Sense Strand UUUGGCUUGUGAUCAACCA 34
    MTARC1-335 19 mer Sense Strand UUGGCUUGUGAUCAACCAG 35
    MTARC1-337 19 mer Sense Strand GGCUUGUGAUCAACCAGGA 36
    MTARC1-338 19 mer Sense Strand GCUUGUGAUCAACCAGGAG 37
    MTARC1-339 19 mer Sense Strand CUUGUGAUCAACCAGGAGG 38
    MTARC1-340 19 mer Sense Strand UUGUGAUCAACCAGGAGGG 39
    MTARC1-341 19 mer Sense Strand UGUGAUCAACCAGGAGGGA 40
    MTARC1-342 19 mer Sense Strand GUGAUCAACCAGGAGGGAA 41
    MTARC1-343 19 mer Sense Strand UGAUCAACCAGGAGGGAAA 42
    MTARC1-345 19 mer Sense Strand AUCAACCAGGAGGGAAACA 43
    MTARC1-346 19 mer Sense Strand UCAACCAGGAGGGAAACAU 44
    MTARC1-347 19 mer Sense Strand CAACCAGGAGGGAAACAUG 45
    MTARC1-348 19 mer Sense Strand AACCAGGAGGGAAACAUGG 46
    MTARC1-349 19 mer Sense Strand ACCAGGAGGGAAACAUGGU 47
    MTARC1-350 19 mer Sense Strand CCAGGAGGGAAACAUGGUU 48
    MTARC1-351 19 mer Sense Strand CAGGAGGGAAACAUGGUUA 49
    MTARC1-352 19 mer Sense Strand AGGAGGGAAACAUGGUUAC 50
    MTARC1-353 19 mer Sense Strand GGAGGGAAACAUGGUUACU 51
    MTARC1-354 19 mer Sense Strand GAGGGAAACAUGGUUACUG 52
    MTARC1-356 19 mer Sense Strand GGGAAACAUGGUUACUGCU 53
    MTARC1-357 19 mer Sense Strand GGAAACAUGGUUACUGCUC 54
    MTARC1-358 19 mer Sense Strand GAAACAUGGUUACUGCUCG 55
    MTARC1-359 19 mer Sense Strand AAACAUGGUUACUGCUCGC 56
    MTARC1-360 19 mer Sense Strand AACAUGGUUACUGCUCGCC 57
    MTARC1-361 19 mer Sense Strand ACAUGGUUACUGCUCGCCA 58
    MTARC1-362 19 mer Sense Strand CAUGGUUACUGCUCGCCAG 59
    MTARC1-365 19 mer Sense Strand GGUUACUGCUCGCCAGGAA 60
    MTARC1-376 19 mer Sense Strand GCCAGGAACCUCGCCUGGU 61
    MTARC1-379 19 mer Sense Strand AGGAACCUCGCCUGGUCCU 62
    MTARC1-384 19 mer Sense Strand CCUCGCCUGGUCCUGAUUU 63
    MTARC1-385 19 mer Sense Strand CUCGCCUGGUCCUGAUUUC 64
    MTARC1-388 19 mer Sense Strand GCCUGGUCCUGAUUUCCCU 65
    MTARC1-390 19 mer Sense Strand CUGGUCCUGAUUUCCCUGA 66
    MTARC1-391 19 mer Sense Strand UGGUCCUGAUUUCCCUGAC 67
    MTARC1-393 19 mer Sense Strand GUCCUGAUUUCCCUGACCU 68
    MTARC1-395 19 mer Sense Strand CCUGAUUUCCCUGACCUGC 69
    MTARC1-405 19 mer Sense Strand CUGACCUGCGAUGGUGACA 70
    MTARC1-409 19 mer Sense Strand CCUGCGAUGGUGACACCCU 71
    MTARC1-411 19 mer Sense Strand UGCGAUGGUGACACCCUGA 72
    MTARC1-412 19 mer Sense Strand GCGAUGGUGACACCCUGAC 73
    MTARC1-413 19 mer Sense Strand CGAUGGUGACACCCUGACU 74
    MTARC1-414 19 mer Sense Strand GAUGGUGACACCCUGACUC 75
    MTARC1-415 19 mer Sense Strand AUGGUGACACCCUGACUCU 76
    MTARC1-416 19 mer Sense Strand UGGUGACACCCUGACUCUC 77
    MTARC1-417 19 mer Sense Strand GGUGACACCCUGACUCUCA 78
    MTARC1-418 19 mer Sense Strand GUGACACCCUGACUCUCAG 79
    MTARC1-419 19 mer Sense Strand UGACACCCUGACUCUCAGU 80
    MTARC1-420 19 mer Sense Strand GACACCCUGACUCUCAGUG 81
    MTARC1-421 19 mer Sense Strand ACACCCUGACUCUCAGUGC 82
    MTARC1-422 19 mer Sense Strand CACCCUGACUCUCAGUGCA 83
    MTARC1-423 19 mer Sense Strand ACCCUGACUCUCAGUGCAG 84
    MTARC1-424 19 mer Sense Strand CCCUGACUCUCAGUGCAGC 85
    MTARC1-425 19 mer Sense Strand CCUGACUCUCAGUGCAGCC 86
    MTARC1-426 19 mer Sense Strand CUGACUCUCAGUGCAGCCU 87
    MTARC1-427 19 mer Sense Strand UGACUCUCAGUGCAGCCUA 88
    MTARC1-428 19 mer Sense Strand GACUCUCAGUGCAGCCUAC 89
    MTARC1-429 19 mer Sense Strand ACUCUCAGUGCAGCCUACA 90
    MTARC1-430 19 mer Sense Strand CUCUCAGUGCAGCCUACAC 91
    MTARC1-431 19 mer Sense Strand UCUCAGUGCAGCCUACACA 92
    MTARC1-433 19 mer Sense Strand UCAGUGCAGCCUACACAAA 93
    MTARC1-434 19 mer Sense Strand CAGUGCAGCCUACACAAAG 94
    MTARC1-435 19 mer Sense Strand AGUGCAGCCUACACAAAGG 95
    MTARC1-436 19 mer Sense Strand GUGCAGCCUACACAAAGGA 96
    MTARC1-437 19 mer Sense Strand UGCAGCCUACACAAAGGAC 97
    MTARC1-438 19 mer Sense Strand GCAGCCUACACAAAGGACC 98
    MTARC1-439 19 mer Sense Strand CAGCCUACACAAAGGACCU 99
    MTARC1-440 19 mer Sense Strand AGCCUACACAAAGGACCUA 100
    MTARC1-441 19 mer Sense Strand GCCUACACAAAGGACCUAC 101
    MTARC1-445 19 mer Sense Strand ACACAAAGGACCUACUACU 102
    MTARC1-446 19 mer Sense Strand CACAAAGGACCUACUACUG 103
    MTARC1-447 19 mer Sense Strand ACAAAGGACCUACUACUGC 104
    MTARC1-448 19 mer Sense Strand CAAAGGACCUACUACUGCC 105
    MTARC1-449 19 mer Sense Strand AAAGGACCUACUACUGCCU 106
    MTARC1-450 19 mer Sense Strand AAGGACCUACUACUGCCUA 107
    MTARC1-451 19 mer Sense Strand AGGACCUACUACUGCCUAU 108
    MTARC1-452 19 mer Sense Strand GGACCUACUACUGCCUAUC 109
    MTARC1-453 19 mer Sense Strand GACCUACUACUGCCUAUCA 110
    MTARC1-454 19 mer Sense Strand ACCUACUACUGCCUAUCAA 111
    MTARC1-456 19 mer Sense Strand CUACUACUGCCUAUCAAAA 112
    MTARC1-457 19 mer Sense Strand UACUACUGCCUAUCAAAAC 113
    MTARC1-458 19 mer Sense Strand ACUACUGCCUAUCAAAACG 114
    MTARC1-459 19 mer Sense Strand CUACUGCCUAUCAAAACGC 115
    MTARC1-460 19 mer Sense Strand UACUGCCUAUCAAAACGCC 116
    MTARC1-462 19 mer Sense Strand CUGCCUAUCAAAACGCCCA 117
    MTARC1-468 19 mer Sense Strand AUCAAAACGCCCACCACAA 118
    MTARC1-469 19 mer Sense Strand UCAAAACGCCCACCACAAA 119
    MTARC1-470 19 mer Sense Strand CAAAACGCCCACCACAAAU 120
    MTARC1-471 19 mer Sense Strand AAAACGCCCACCACAAAUG 121
    MTARC1-473 19 mer Sense Strand AACGCCCACCACAAAUGCA 122
    MTARC1-475 19 mer Sense Strand CGCCCACCACAAAUGCAGU 123
    MTARC1-476 19 mer Sense Strand GCCCACCACAAAUGCAGUG 124
    MTARC1-482 19 mer Sense Strand CACAAAUGCAGUGCACAAG 125
    MTARC1-483 19 mer Sense Strand ACAAAUGCAGUGCACAAGU 126
    MTARC1-484 19 mer Sense Strand CAAAUGCAGUGCACAAGUG 127
    MTARC1-552 19 mer Sense Strand GCCCAGUGGAUAACCAGCU 128
    MTARC1-553 19 mer Sense Strand CCCAGUGGAUAACCAGCUU 129
    MTARC1-554 19 mer Sense Strand CCAGUGGAUAACCAGCUUC 130
    MTARC1-555 19 mer Sense Strand CAGUGGAUAACCAGCUUCC 131
    MTARC1-556 19 mer Sense Strand AGUGGAUAACCAGCUUCCU 132
    MTARC1-557 19 mer Sense Strand GUGGAUAACCAGCUUCCUG 133
    MTARC1-558 19 mer Sense Strand UGGAUAACCAGCUUCCUGA 134
    MTARC1-559 19 mer Sense Strand GGAUAACCAGCUUCCUGAA 135
    MTARC1-560 19 mer Sense Strand GAUAACCAGCUUCCUGAAG 136
    MTARC1-561 19 mer Sense Strand AUAACCAGCUUCCUGAAGU 137
    MTARC1-562 19 mer Sense Strand UAACCAGCUUCCUGAAGUC 138
    MTARC1-563 19 mer Sense Strand AACCAGCUUCCUGAAGUCA 139
    MTARC1-564 19 mer Sense Strand ACCAGCUUCCUGAAGUCAC 140
    MTARC1-565 19 mer Sense Strand CCAGCUUCCUGAAGUCACA 141
    MTARC1-566 19 mer Sense Strand CAGCUUCCUGAAGUCACAG 142
    MTARC1-567 19 mer Sense Strand AGCUUCCUGAAGUCACAGC 143
    MTARC1-568 19 mer Sense Strand GCUUCCUGAAGUCACAGCC 144
    MTARC1-589 19 mer Sense Strand ACCGCCUGGUGCACUUCGA 145
    MTARC1-591 19 mer Sense Strand CGCCUGGUGCACUUCGAGC 146
    MTARC1-592 19 mer Sense Strand GCCUGGUGCACUUCGAGCC 147
    MTARC1-593 19 mer Sense Strand CCUGGUGCACUUCGAGCCU 148
    MTARC1-597 19 mer Sense Strand GUGCACUUCGAGCCUCACA 149
    MTARC1-600 19 mer Sense Strand CACUUCGAGCCUCACAUGC 150
    MTARC1-612 19 mer Sense Strand CACAUGCGACCGAGACGUC 151
    MTARC1-614 19 mer Sense Strand CAUGCGACCGAGACGUCCU 152
    MTARC1-617 19 mer Sense Strand GCGACCGAGACGUCCUCAU 153
    MTARC1-618 19 mer Sense Strand CGACCGAGACGUCCUCAUC 154
    MTARC1-620 19 mer Sense Strand ACCGAGACGUCCUCAUCAA 155
    MTARC1-621 19 mer Sense Strand CCGAGACGUCCUCAUCAAA 156
    MTARC1-622 19 mer Sense Strand CGAGACGUCCUCAUCAAAU 157
    MTARC1-623 19 mer Sense Strand GAGACGUCCUCAUCAAAUA 158
    MTARC1-624 19 mer Sense Strand AGACGUCCUCAUCAAAUAG 159
    MTARC1-625 19 mer Sense Strand GACGUCCUCAUCAAAUAGC 160
    MTARC1-626 19 mer Sense Strand ACGUCCUCAUCAAAUAGCA 161
    MTARC1-627 19 mer Sense Strand CGUCCUCAUCAAAUAGCAG 162
    MTARC1-628 19 mer Sense Strand GUCCUCAUCAAAUAGCAGA 163
    MTARC1-629 19 mer Sense Strand UCCUCAUCAAAUAGCAGAC 164
    MTARC1-630 19 mer Sense Strand CCUCAUCAAAUAGCAGACU 165
    MTARC1-631 19 mer Sense Strand CUCAUCAAAUAGCAGACUU 166
    MTARC1-632 19 mer Sense Strand UCAUCAAAUAGCAGACUUG 167
    MTARC1-633 19 mer Sense Strand CAUCAAAUAGCAGACUUGU 168
    MTARC1-634 19 mer Sense Strand AUCAAAUAGCAGACUUGUU 169
    MTARC1-635 19 mer Sense Strand UCAAAUAGCAGACUUGUUC 170
    MTARC1-636 19 mer Sense Strand CAAAUAGCAGACUUGUUCC 171
    MTARC1-637 19 mer Sense Strand AAAUAGCAGACUUGUUCCG 172
    MTARC1-638 19 mer Sense Strand AAUAGCAGACUUGUUCCGA 173
    MTARC1-639 19 mer Sense Strand AUAGCAGACUUGUUCCGAC 174
    MTARC1-640 19 mer Sense Strand UAGCAGACUUGUUCCGACC 175
    MTARC1-641 19 mer Sense Strand AGCAGACUUGUUCCGACCC 176
    MTARC1-642 19 mer Sense Strand GCAGACUUGUUCCGACCCA 177
    MTARC1-643 19 mer Sense Strand CAGACUUGUUCCGACCCAA 178
    MTARC1-644 19 mer Sense Strand AGACUUGUUCCGACCCAAG 179
    MTARC1-645 19 mer Sense Strand GACUUGUUCCGACCCAAGG 180
    MTARC1-646 19 mer Sense Strand ACUUGUUCCGACCCAAGGA 181
    MTARC1-647 19 mer Sense Strand CUUGUUCCGACCCAAGGAC 182
    MTARC1-648 19 mer Sense Strand UUGUUCCGACCCAAGGACC 183
    MTARC1-649 19 mer Sense Strand UGUUCCGACCCAAGGACCA 184
    MTARC1-650 19 mer Sense Strand GUUCCGACCCAAGGACCAG 185
    MTARC1-651 19 mer Sense Strand UUCCGACCCAAGGACCAGA 186
    MTARC1-652 19 mer Sense Strand UCCGACCCAAGGACCAGAU 187
    MTARC1-653 19 mer Sense Strand CCGACCCAAGGACCAGAUU 188
    MTARC1-654 19 mer Sense Strand CGACCCAAGGACCAGAUUG 189
    MTARC1-655 19 mer Sense Strand GACCCAAGGACCAGAUUGC 190
    MTARC1-656 19 mer Sense Strand ACCCAAGGACCAGAUUGCU 191
    MTARC1-657 19 mer Sense Strand CCCAAGGACCAGAUUGCUU 192
    MTARC1-658 19 mer Sense Strand CCAAGGACCAGAUUGCUUA 193
    MTARC1-659 19 mer Sense Strand CAAGGACCAGAUUGCUUAC 194
    MTARC1-660 19 mer Sense Strand AAGGACCAGAUUGCUUACU 195
    MTARC1-661 19 mer Sense Strand AGGACCAGAUUGCUUACUC 196
    MTARC1-662 19 mer Sense Strand GGACCAGAUUGCUUACUCA 197
    MTARC1-663 19 mer Sense Strand GACCAGAUUGCUUACUCAG 198
    MTARC1-664 19 mer Sense Strand ACCAGAUUGCUUACUCAGA 199
    MTARC1-665 19 mer Sense Strand CCAGAUUGCUUACUCAGAC 200
    MTARC1-666 19 mer Sense Strand CAGAUUGCUUACUCAGACA 201
    MTARC1-667 19 mer Sense Strand AGAUUGCUUACUCAGACAC 202
    MTARC1-668 19 mer Sense Strand GAUUGCUUACUCAGACACC 203
    MTARC1-669 19 mer Sense Strand AUUGCUUACUCAGACACCA 204
    MTARC1-670 19 mer Sense Strand UUGCUUACUCAGACACCAG 205
    MTARC1-671 19 mer Sense Strand UGCUUACUCAGACACCAGC 206
    MTARC1-672 19 mer Sense Strand GCUUACUCAGACACCAGCC 207
    MTARC1-673 19 mer Sense Strand CUUACUCAGACACCAGCCC 208
    MTARC1-674 19 mer Sense Strand UUACUCAGACACCAGCCCA 209
    MTARC1-675 19 mer Sense Strand UACUCAGACACCAGCCCAU 210
    MTARC1-676 19 mer Sense Strand ACUCAGACACCAGCCCAUU 211
    MTARC1-677 19 mer Sense Strand CUCAGACACCAGCCCAUUC 212
    MTARC1-678 19 mer Sense Strand UCAGACACCAGCCCAUUCU 213
    MTARC1-679 19 mer Sense Strand CAGACACCAGCCCAUUCUU 214
    MTARC1-680 19 mer Sense Strand AGACACCAGCCCAUUCUUG 215
    MTARC1-681 19 mer Sense Strand GACACCAGCCCAUUCUUGA 216
    MTARC1-682 19 mer Sense Strand ACACCAGCCCAUUCUUGAU 217
    MTARC1-683 19 mer Sense Strand CACCAGCCCAUUCUUGAUC 218
    MTARC1-684 19 mer Sense Strand ACCAGCCCAUUCUUGAUCC 219
    MTARC1-685 19 mer Sense Strand CCAGCCCAUUCUUGAUCCU 220
    MTARC1-686 19 mer Sense Strand CAGCCCAUUCUUGAUCCUU 221
    MTARC1-687 19 mer Sense Strand AGCCCAUUCUUGAUCCUUU 222
    MTARC1-691 19 mer Sense Strand CAUUCUUGAUCCUUUCUGA 223
    MTARC1-692 19 mer Sense Strand AUUCUUGAUCCUUUCUGAG 224
    MTARC1-724 19 mer Sense Strand AUCUCAACUCCAGGCUAGA 225
    MTARC1-726 19 mer Sense Strand CUCAACUCCAGGCUAGAGA 226
    MTARC1-728 19 mer Sense Strand CAACUCCAGGCUAGAGAAG 227
    MTARC1-729 19 mer Sense Strand AACUCCAGGCUAGAGAAGA 228
    MTARC1-730 19 mer Sense Strand ACUCCAGGCUAGAGAAGAA 229
    MTARC1-731 19 mer Sense Strand CUCCAGGCUAGAGAAGAAA 230
    MTARC1-733 19 mer Sense Strand CCAGGCUAGAGAAGAAAGU 231
    MTARC1-734 19 mer Sense Strand CAGGCUAGAGAAGAAAGUU 232
    MTARC1-735 19 mer Sense Strand AGGCUAGAGAAGAAAGUUA 233
    MTARC1-736 19 mer Sense Strand GGCUAGAGAAGAAAGUUAA 234
    MTARC1-737 19 mer Sense Strand GCUAGAGAAGAAAGUUAAA 235
    MTARC1-738 19 mer Sense Strand CUAGAGAAGAAAGUUAAAG 236
    MTARC1-739 19 mer Sense Strand UAGAGAAGAAAGUUAAAGC 237
    MTARC1-740 19 mer Sense Strand AGAGAAGAAAGUUAAAGCA 238
    MTARC1-741 19 mer Sense Strand GAGAAGAAAGUUAAAGCAA 239
    MTARC1-742 19 mer Sense Strand AGAAGAAAGUUAAAGCAAC 240
    MTARC1-743 19 mer Sense Strand GAAGAAAGUUAAAGCAACC 241
    MTARC1-744 19 mer Sense Strand AAGAAAGUUAAAGCAACCA 242
    MTARC1-745 19 mer Sense Strand AGAAAGUUAAAGCAACCAA 243
    MTARC1-746 19 mer Sense Strand GAAAGUUAAAGCAACCAAC 244
    MTARC1-747 19 mer Sense Strand AAAGUUAAAGCAACCAACU 245
    MTARC1-748 19 mer Sense Strand AAGUUAAAGCAACCAACUU 246
    MTARC1-750 19 mer Sense Strand GUUAAAGCAACCAACUUCA 247
    MTARC1-751 19 mer Sense Strand UUAAAGCAACCAACUUCAG 248
    MTARC1-752 19 mer Sense Strand UAAAGCAACCAACUUCAGG 249
    MTARC1-753 19 mer Sense Strand AAAGCAACCAACUUCAGGC 250
    MTARC1-754 19 mer Sense Strand AAGCAACCAACUUCAGGCC 251
    MTARC1-755 19 mer Sense Strand AGCAACCAACUUCAGGCCC 252
    MTARC1-756 19 mer Sense Strand GCAACCAACUUCAGGCCCA 253
    MTARC1-758 19 mer Sense Strand AACCAACUUCAGGCCCAAU 254
    MTARC1-759 19 mer Sense Strand ACCAACUUCAGGCCCAAUA 255
    MTARC1-760 19 mer Sense Strand CCAACUUCAGGCCCAAUAU 256
    MTARC1-761 19 mer Sense Strand CAACUUCAGGCCCAAUAUU 257
    MTARC1-762 19 mer Sense Strand AACUUCAGGCCCAAUAUUG 258
    MTARC1-763 19 mer Sense Strand ACUUCAGGCCCAAUAUUGU 259
    MTARC1-764 19 mer Sense Strand CUUCAGGCCCAAUAUUGUA 260
    MTARC1-765 19 mer Sense Strand UUCAGGCCCAAUAUUGUAA 261
    MTARC1-766 19 mer Sense Strand UCAGGCCCAAUAUUGUAAU 262
    MTARC1-767 19 mer Sense Strand CAGGCCCAAUAUUGUAAUU 263
    MTARC1-768 19 mer Sense Strand AGGCCCAAUAUUGUAAUUU 264
    MTARC1-769 19 mer Sense Strand GGCCCAAUAUUGUAAUUUC 265
    MTARC1-770 19 mer Sense Strand GCCCAAUAUUGUAAUUUCA 266
    MTARC1-771 19 mer Sense Strand CCCAAUAUUGUAAUUUCAG 267
    MTARC1-772 19 mer Sense Strand CCAAUAUUGUAAUUUCAGG 268
    MTARC1-773 19 mer Sense Strand CAAUAUUGUAAUUUCAGGA 269
    MTARC1-774 19 mer Sense Strand AAUAUUGUAAUUUCAGGAU 270
    MTARC1-775 19 mer Sense Strand AUAUUGUAAUUUCAGGAUG 271
    MTARC1-776 19 mer Sense Strand UAUUGUAAUUUCAGGAUGC 272
    MTARC1-777 19 mer Sense Strand AUUGUAAUUUCAGGAUGCG 273
    MTARC1-778 19 mer Sense Strand UUGUAAUUUCAGGAUGCGA 274
    MTARC1-779 19 mer Sense Strand UGUAAUUUCAGGAUGCGAU 275
    MTARC1-780 19 mer Sense Strand GUAAUUUCAGGAUGCGAUG 276
    MTARC1-781 19 mer Sense Strand UAAUUUCAGGAUGCGAUGU 277
    MTARC1-782 19 mer Sense Strand AAUUUCAGGAUGCGAUGUC 278
    MTARC1-783 19 mer Sense Strand AUUUCAGGAUGCGAUGUCU 279
    MTARC1-784 19 mer Sense Strand UUUCAGGAUGCGAUGUCUA 280
    MTARC1-785 19 mer Sense Strand UUCAGGAUGCGAUGUCUAU 281
    MTARC1-786 19 mer Sense Strand UCAGGAUGCGAUGUCUAUG 282
    MTARC1-787 19 mer Sense Strand CAGGAUGCGAUGUCUAUGC 283
    MTARC1-788 19 mer Sense Strand AGGAUGCGAUGUCUAUGCA 284
    MTARC1-789 19 mer Sense Strand GGAUGCGAUGUCUAUGCAG 285
    MTARC1-790 19 mer Sense Strand GAUGCGAUGUCUAUGCAGA 286
    MTARC1-791 19 mer Sense Strand AUGCGAUGUCUAUGCAGAG 287
    MTARC1-792 19 mer Sense Strand UGCGAUGUCUAUGCAGAGG 288
    MTARC1-863 19 mer Sense Strand UUGUUCCAGAUGCAUUUUA 289
    MTARC1-929 19 mer Sense Strand GGAAACACUGAAGAGUUAU 290
    MTARC1-930 19 mer Sense Strand GAAACACUGAAGAGUUAUC 291
    MTARC1-934 19 mer Sense Strand CACUGAAGAGUUAUCGCCA 292
    MTARC1-955 19 mer Sense Strand GUGACCCUUCAGAACGAAA 293
    MTARC1-959 19 mer Sense Strand CCCUUCAGAACGAAAGUUA 294
    MTARC1-960 19 mer Sense Strand CCUUCAGAACGAAAGUUAU 295
    MTARC1-963 19 mer Sense Strand UCAGAACGAAAGUUAUAUG 296
    MTARC1-964 19 mer Sense Strand CAGAACGAAAGUUAUAUGG 297
    MTARC1-965 19 mer Sense Strand AGAACGAAAGUUAUAUGGA 298
    MTARC1-966 19 mer Sense Strand GAACGAAAGUUAUAUGGAA 299
    MTARC1-967 19 mer Sense Strand AACGAAAGUUAUAUGGAAA 300
    MTARC1-969 19 mer Sense Strand CGAAAGUUAUAUGGAAAAU 301
    MTARC1-970 19 mer Sense Strand GAAAGUUAUAUGGAAAAUC 302
    MTARC1-971 19 mer Sense Strand AAAGUUAUAUGGAAAAUCA 303
    MTARC1-1107 19 mer Sense Strand AAAAAUGUUCUCAAAAAUG 304
    MTARC1-1113 19 mer Sense Strand GUUCUCAAAAAUGACAACA 305
    MTARC1-1118 19 mer Sense Strand CAAAAAUGACAACACUUGA 306
    MTARC1-1123 19 mer Sense Strand AUGACAACACUUGAAGCAU 307
    MTARC1-1126 19 mer Sense Strand ACAACACUUGAAGCAUGGU 308
    MTARC1-1127 19 mer Sense Strand CAACACUUGAAGCAUGGUG 309
    MTARC1-1128 19 mer Sense Strand AACACUUGAAGCAUGGUGU 310
    MTARC1-1129 19 mer Sense Strand ACACUUGAAGCAUGGUGUU 311
    MTARC1-1130 19 mer Sense Strand CACUUGAAGCAUGGUGUUU 312
    MTARC1-1132 19 mer Sense Strand CUUGAAGCAUGGUGUUUCA 313
    MTARC1-1133 19 mer Sense Strand UUGAAGCAUGGUGUUUCAG 314
    MTARC1-1134 19 mer Sense Strand UGAAGCAUGGUGUUUCAGA 315
    MTARC1-1135 19 mer Sense Strand GAAGCAUGGUGUUUCAGAA 316
    MTARC1-1139 19 mer Sense Strand CAUGGUGUUUCAGAACUGA 317
    MTARC1-1144 19 mer Sense Strand UGUUUCAGAACUGAGACCU 318
    MTARC1-1165 19 mer Sense Strand ACAUUUUCUUUAAAUUUGU 319
    MTARC1-1167 19 mer Sense Strand AUUUUCUUUAAAUUUGUGA 320
    MTARC1-1173 19 mer Sense Strand UUUAAAUUUGUGAUUUUCA 321
    MTARC1-1177 19 mer Sense Strand AAUUUGUGAUUUUCACAUU 322
    MTARC1-1179 19 mer Sense Strand UUUGUGAUUUUCACAUUUU 323
    MTARC1-1329 19 mer Sense Strand GUUUAACUGAUUAUGGAAU 324
    MTARC1-1330 19 mer Sense Strand UUUAACUGAUUAUGGAAUA 325
    MTARC1-1332 19 mer Sense Strand UAACUGAUUAUGGAAUAGU 326
    MTARC1-1333 19 mer Sense Strand AACUGAUUAUGGAAUAGUU 327
    MTARC1-1334 19 mer Sense Strand ACUGAUUAUGGAAUAGUUC 328
    MTARC1-1335 19 mer Sense Strand CUGAUUAUGGAAUAGUUCU 329
    MTARC1-1620 19 mer Sense Strand CAGAUAUUAAUUUUCCAUA 330
    MTARC1-1622 19 mer Sense Strand GAUAUUAAUUUUCCAUAGA 331
    MTARC1-1660 19 mer Sense Strand CUUCUCAGACAGCAUUGGA 332
    MTARC1-1663 19 mer Sense Strand CUCAGACAGCAUUGGAUUU 333
    MTARC1-1664 19 mer Sense Strand UCAGACAGCAUUGGAUUUC 334
    MTARC1-1812 19 mer Sense Strand AGAAAAGUGAUUCAGUGAU 335
    MTARC1-1816 19 mer Sense Strand AAGUGAUUCAGUGAUUUCA 336
    MTARC1-1868 19 mer Sense Strand GGAAAGCAUAUGUCAGUUG 337
    MTARC1-1869 19 mer Sense Strand GAAAGCAUAUGUCAGUUGU 338
    MTARC1-1876 19 mer Sense Strand UAUGUCAGUUGUUUAAAAC 339
    MTARC1-1877 19 mer Sense Strand AUGUCAGUUGUUUAAAACC 340
    MTARC1-1878 19 mer Sense Strand UGUCAGUUGUUUAAAACCC 341
    MTARC1-1879 19 mer Sense Strand GUCAGUUGUUUAAAACCCA 342
    MTARC1-1882 19 mer Sense Strand AGUUGUUUAAAACCCAAUA 343
    MTARC1-1883 19 mer Sense Strand GUUGUUUAAAACCCAAUAU 344
    MTARC1-1884 19 mer Sense Strand UUGUUUAAAACCCAAUAUC 345
    MTARC1-1885 19 mer Sense Strand UGUUUAAAACCCAAUAUCU 346
    MTARC1-1886 19 mer Sense Strand GUUUAAAACCCAAUAUCUA 347
    MTARC1-1935 19 mer Sense Strand UGAUGAAGUAUAUUUUUUA 348
    MTARC1-1936 19 mer Sense Strand GAUGAAGUAUAUUUUUUAU 349
    MTARC1-1937 19 mer Sense Strand AUGAAGUAUAUUUUUUAUU 350
    MTARC1-1939 19 mer Sense Strand GAAGUAUAUUUUUUAUUGC 351
    MTARC1-1941 19 mer Sense Strand AGUAUAUUUUUUAUUGCCA 352
    MTARC1-1953 19 mer Sense Strand AUUGCCAUUUUGUCCUUUG 353
    MTARC1-1955 19 mer Sense Strand UGCCAUUUUGUCCUUUGAU 354
    MTARC1-1981 19 mer Sense Strand GGAAGUUGACUAAACUUGA 355
    MTARC1-1983 19 mer Sense Strand AAGUUGACUAAACUUGAAA 356
    MTARC1-1985 19 mer Sense Strand GUUGACUAAACUUGAAAAA 357
    MTARC1-1986 19 mer Sense Strand UUGACUAAACUUGAAAAAU 358
    MTARC1-1988 19 mer Sense Strand GACUAAACUUGAAAAAUGU 359
    MTARC1-1989 19 mer Sense Strand ACUAAACUUGAAAAAUGUU 360
    MTARC1-1990 19 mer Sense Strand CUAAACUUGAAAAAUGUUU 361
    MTARC1-1995 19 mer Sense Strand CUUGAAAAAUGUUUUUAAA 362
    MTARC1-1996 19 mer Sense Strand UUGAAAAAUGUUUUUAAAA 363
    MTARC1-1998 19 mer Sense Strand GAAAAAUGUUUUUAAAACU 364
    MTARC1-1999 19 mer Sense Strand AAAAAUGUUUUUAAAACUG 365
    MTARC1-2000 19 mer Sense Strand AAAAUGUUUUUAAAACUGU 366
    MTARC1-2001 19 mer Sense Strand AAAUGUUUUUAAAACUGUG 367
    MTARC1-2002 19 mer Sense Strand AAUGUUUUUAAAACUGUGA 368
    MTARC1-2005 19 mer Sense Strand GUUUUUAAAACUGUGAAUA 369
    MTARC1-2006 19 mer Sense Strand UUUUUAAAACUGUGAAUAA 370
    MTARC1-2010 19 mer Sense Strand UAAAACUGUGAAUAAAUGG 371
    MTARC1-2011 19 mer Sense Strand AAAACUGUGAAUAAAUGGA 372
    MTARC1-2012 19 mer Sense Strand AAACUGUGAAUAAAUGGAA 373
    MTARC1-2013 19 mer Sense Strand AACUGUGAAUAAAUGGAAG 374
    MTARC1-2015 19 mer Sense Strand CUGUGAAUAAAUGGAAGCU 375
    MTARC1-2016 19 mer Sense Strand UGUGAAUAAAUGGAAGCUA 376
    MTARC1-2017 19 mer Sense Strand GUGAAUAAAUGGAAGCUAC 377
    MTARC1-2018 19 mer Sense Strand UGAAUAAAUGGAAGCUACU 378
    MTARC1-2019 19 mer Sense Strand GAAUAAAUGGAAGCUACUU 379
    MTARC1-2020 19 mer Sense Strand AAUAAAUGGAAGCUACUUU 380
    MTARC1-2022 19 mer Sense Strand UAAAUGGAAGCUACUUUGA 381
    MTARC1-2023 19 mer Sense Strand AAAUGGAAGCUACUUUGAC 382
    MTARC1-2025 19 mer Sense Strand AUGGAAGCUACUUUGACUA 383
    MTARC1-2027 19 mer Sense Strand GGAAGCUACUUUGACUAGU 384
    MTARC1-231 19 mer Anti-sense Strand GGUAGAUCCAGAGCUGCGC 385
    MTARC1-233 19 mer Anti-sense Strand AGGGUAGAUCCAGAGCUGC 386
    MTARC1-234 19 mer Anti-sense Strand CAGGGUAGAUCCAGAGCUG 387
    MTARC1-235 19 mer Anti-sense Strand ACAGGGUAGAUCCAGAGCU 388
    MTARC1-236 19 mer Anti-sense Strand CACAGGGUAGAUCCAGAGC 389
    MTARC1-237 19 mer Anti-sense Strand UCACAGGGUAGAUCCAGAG 390
    MTARC1-238 19 mer Anti-sense Strand UUCACAGGGUAGAUCCAGA 391
    MTARC1-239 19 mer Anti-sense Strand UUUCACAGGGUAGAUCCAG 392
    MTARC1-240 19 mer Anti-sense Strand AUUUCACAGGGUAGAUCCA 393
    MTARC1-241 19 mer Anti-sense Strand GAUUUCACAGGGUAGAUCC 394
    MTARC1-242 19 mer Anti-sense Strand GGAUUUCACAGGGUAGAUC 395
    MTARC1-243 19 mer Anti-sense Strand AGGAUUUCACAGGGUAGAU 396
    MTARC1-244 19 mer Anti-sense Strand CAGGAUUUCACAGGGUAGA 397
    MTARC1-245 19 mer Anti-sense Strand GCAGGAUUUCACAGGGUAG 398
    MTARC1-247 19 mer Anti-sense Strand UUGCAGGAUUUCACAGGGU 399
    MTARC1-248 19 mer Anti-sense Strand CUUGCAGGAUUUCACAGGG 400
    MTARC1-249 19 mer Anti-sense Strand CCUUGCAGGAUUUCACAGG 401
    MTARC1-253 19 mer Anti-sense Strand ACCCCCUUGCAGGAUUUCA 402
    MTARC1-255 19 mer Anti-sense Strand GCACCCCCUUGCAGGAUUU 403
    MTARC1-318 19 mer Anti-sense Strand AAAACCUGUCCCGCAGGUU 404
    MTARC1-319 19 mer Anti-sense Strand CAAAACCUGUCCCGCAGGU 405
    MTARC1-320 19 mer Anti-sense Strand CCAAAACCUGUCCCGCAGG 406
    MTARC1-321 19 mer Anti-sense Strand GCCAAAACCUGUCCCGCAG 407
    MTARC1-323 19 mer Anti-sense Strand AAGCCAAAACCUGUCCCGC 408
    MTARC1-324 19 mer Anti-sense Strand CAAGCCAAAACCUGUCCCG 409
    MTARC1-325 19 mer Anti-sense Strand ACAAGCCAAAACCUGUCCC 410
    MTARC1-326 19 mer Anti-sense Strand CACAAGCCAAAACCUGUCC 411
    MTARC1-327 19 mer Anti-sense Strand UCACAAGCCAAAACCUGUC 412
    MTARC1-328 19 mer Anti-sense Strand AUCACAAGCCAAAACCUGU 413
    MTARC1-329 19 mer Anti-sense Strand GAUCACAAGCCAAAACCUG 414
    MTARC1-330 19 mer Anti-sense Strand UGAUCACAAGCCAAAACCU 415
    MTARC1-331 19 mer Anti-sense Strand UUGAUCACAAGCCAAAACC 416
    MTARC1-332 19 mer Anti-sense Strand GUUGAUCACAAGCCAAAAC 417
    MTARC1-334 19 mer Anti-sense Strand UGGUUGAUCACAAGCCAAA 418
    MTARC1-335 19 mer Anti-sense Strand CUGGUUGAUCACAAGCCAA 419
    MTARC1-337 19 mer Anti-sense Strand UCCUGGUUGAUCACAAGCC 420
    MTARC1-338 19 mer Anti-sense Strand CUCCUGGUUGAUCACAAGC 421
    MTARC1-339 19 mer Anti-sense Strand CCUCCUGGUUGAUCACAAG 422
    MTARC1-340 19 mer Anti-sense Strand CCCUCCUGGUUGAUCACAA 423
    MTARC1-341 19 mer Anti-sense Strand UCCCUCCUGGUUGAUCACA 424
    MTARC1-342 19 mer Anti-sense Strand UUCCCUCCUGGUUGAUCAC 425
    MTARC1-343 19 mer Anti-sense Strand UUUCCCUCCUGGUUGAUCA 426
    MTARC1-345 19 mer Anti-sense Strand UGUUUCCCUCCUGGUUGAU 427
    MTARC1-346 19 mer Anti-sense Strand AUGUUUCCCUCCUGGUUGA 428
    MTARC1-347 19 mer Anti-sense Strand CAUGUUUCCCUCCUGGUUG 429
    MTARC1-348 19 mer Anti-sense Strand CCAUGUUUCCCUCCUGGUU 430
    MTARC1-349 19 mer Anti-sense Strand ACCAUGUUUCCCUCCUGGU 431
    MTARC1-350 19 mer Anti-sense Strand AACCAUGUUUCCCUCCUGG 432
    MTARC1-351 19 mer Anti-sense Strand UAACCAUGUUUCCCUCCUG 433
    MTARC1-352 19 mer Anti-sense Strand GUAACCAUGUUUCCCUCCU 434
    MTARC1-353 19 mer Anti-sense Strand AGUAACCAUGUUUCCCUCC 435
    MTARC1-354 19 mer Anti-sense Strand CAGUAACCAUGUUUCCCUC 436
    MTARC1-356 19 mer Anti-sense Strand AGCAGUAACCAUGUUUCCC 437
    MTARC1-357 19 mer Anti-sense Strand GAGCAGUAACCAUGUUUCC 438
    MTARC1-358 19 mer Anti-sense Strand CGAGCAGUAACCAUGUUUC 439
    MTARC1-359 19 mer Anti-sense Strand GCGAGCAGUAACCAUGUUU 440
    MTARC1-360 19 mer Anti-sense Strand GGCGAGCAGUAACCAUGUU 441
    MTARC1-361 19 mer Anti-sense Strand UGGCGAGCAGUAACCAUGU 442
    MTARC1-362 19 mer Anti-sense Strand CUGGCGAGCAGUAACCAUG 443
    MTARC1-365 19 mer Anti-sense Strand UUCCUGGCGAGCAGUAACC 444
    MTARC1-376 19 mer Anti-sense Strand ACCAGGCGAGGUUCCUGGC 445
    MTARC1-379 19 mer Anti-sense Strand AGGACCAGGCGAGGUUCCU 446
    MTARC1-384 19 mer Anti-sense Strand AAAUCAGGACCAGGCGAGG 447
    MTARC1-385 19 mer Anti-sense Strand GAAAUCAGGACCAGGCGAG 448
    MTARC1-388 19 mer Anti-sense Strand AGGGAAAUCAGGACCAGGC 449
    MTARC1-390 19 mer Anti-sense Strand UCAGGGAAAUCAGGACCAG 450
    MTARC1-391 19 mer Anti-sense Strand GUCAGGGAAAUCAGGACCA 451
    MTARC1-393 19 mer Anti-sense Strand AGGUCAGGGAAAUCAGGAC 452
    MTARC1-395 19 mer Anti-sense Strand GCAGGUCAGGGAAAUCAGG 453
    MTARC1-405 19 mer Anti-sense Strand UGUCACCAUCGCAGGUCAG 454
    MTARC1-409 19 mer Anti-sense Strand AGGGUGUCACCAUCGCAGG 455
    MTARC1-411 19 mer Anti-sense Strand UCAGGGUGUCACCAUCGCA 456
    MTARC1-412 19 mer Anti-sense Strand GUCAGGGUGUCACCAUCGC 457
    MTARC1-413 19 mer Anti-sense Strand AGUCAGGGUGUCACCAUCG 458
    MTARC1-414 19 mer Anti-sense Strand GAGUCAGGGUGUCACCAUC 459
    MTARC1-415 19 mer Anti-sense Strand AGAGUCAGGGUGUCACCAU 460
    MTARC1-416 19 mer Anti-sense Strand GAGAGUCAGGGUGUCACCA 461
    MTARC1-417 19 mer Anti-sense Strand UGAGAGUCAGGGUGUCACC 462
    MTARC1-418 19 mer Anti-sense Strand CUGAGAGUCAGGGUGUCAC 463
    MTARC1-419 19 mer Anti-sense Strand ACUGAGAGUCAGGGUGUCA 464
    MTARC1-420 19 mer Anti-sense Strand CACUGAGAGUCAGGGUGUC 465
    MTARC1-421 19 mer Anti-sense Strand GCACUGAGAGUCAGGGUGU 466
    MTARC1-422 19 mer Anti-sense Strand UGCACUGAGAGUCAGGGUG 467
    MTARC1-423 19 mer Anti-sense Strand CUGCACUGAGAGUCAGGGU 468
    MTARC1-424 19 mer Anti-sense Strand GCUGCACUGAGAGUCAGGG 469
    MTARC1-425 19 mer Anti-sense Strand GGCUGCACUGAGAGUCAGG 470
    MTARC1-426 19 mer Anti-sense Strand AGGCUGCACUGAGAGUCAG 471
    MTARC1-427 19 mer Anti-sense Strand UAGGCUGCACUGAGAGUCA 472
    MTARC1-428 19 mer Anti-sense Strand GUAGGCUGCACUGAGAGUC 473
    MTARC1-429 19 mer Anti-sense Strand UGUAGGCUGCACUGAGAGU 474
    MTARC1-430 19 mer Anti-sense Strand GUGUAGGCUGCACUGAGAG 475
    MTARC1-431 19 mer Anti-sense Strand UGUGUAGGCUGCACUGAGA 476
    MTARC1-433 19 mer Anti-sense Strand UUUGUGUAGGCUGCACUGA 477
    MTARC1-434 19 mer Anti-sense Strand CUUUGUGUAGGCUGCACUG 478
    MTARC1-435 19 mer Anti-sense Strand CCUUUGUGUAGGCUGCACU 479
    MTARC1-436 19 mer Anti-sense Strand UCCUUUGUGUAGGCUGCAC 480
    MTARC1-437 19 mer Anti-sense Strand GUCCUUUGUGUAGGCUGCA 481
    MTARC1-438 19 mer Anti-sense Strand GGUCCUUUGUGUAGGCUGC 482
    MTARC1-439 19 mer Anti-sense Strand AGGUCCUUUGUGUAGGCUG 483
    MTARC1-440 19 mer Anti-sense Strand UAGGUCCUUUGUGUAGGCU 484
    MTARC1-441 19 mer Anti-sense Strand GUAGGUCCUUUGUGUAGGC 485
    MTARC1-445 19 mer Anti-sense Strand AGUAGUAGGUCCUUUGUGU 486
    MTARC1-446 19 mer Anti-sense Strand CAGUAGUAGGUCCUUUGUG 487
    MTARC1-447 19 mer Anti-sense Strand GCAGUAGUAGGUCCUUUGU 488
    MTARC1-448 19 mer Anti-sense Strand GGCAGUAGUAGGUCCUUUG 489
    MTARC1-449 19 mer Anti-sense Strand AGGCAGUAGUAGGUCCUUU 490
    MTARC1-450 19 mer Anti-sense Strand UAGGCAGUAGUAGGUCCUU 491
    MTARC1-451 19 mer Anti-sense Strand AUAGGCAGUAGUAGGUCCU 492
    MTARC1-452 19 mer Anti-sense Strand GAUAGGCAGUAGUAGGUCC 493
    MTARC1-453 19 mer Anti-sense Strand UGAUAGGCAGUAGUAGGUC 494
    MTARC1-454 19 mer Anti-sense Strand UUGAUAGGCAGUAGUAGGU 495
    MTARC1-456 19 mer Anti-sense Strand UUUUGAUAGGCAGUAGUAG 496
    MTARC1-457 19 mer Anti-sense Strand GUUUUGAUAGGCAGUAGUA 497
    MTARC1-458 19 mer Anti-sense Strand CGUUUUGAUAGGCAGUAGU 498
    MTARC1-459 19 mer Anti-sense Strand GCGUUUUGAUAGGCAGUAG 499
    MTARC1-460 19 mer Anti-sense Strand GGCGUUUUGAUAGGCAGUA 500
    MTARC1-462 19 mer Anti-sense Strand UGGGCGUUUUGAUAGGCAG 501
    MTARC1-468 19 mer Anti-sense Strand UUGUGGUGGGCGUUUUGAU 502
    MTARC1-469 19 mer Anti-sense Strand UUUGUGGUGGGCGUUUUGA 503
    MTARC1-470 19 mer Anti-sense Strand AUUUGUGGUGGGCGUUUUG 504
    MTARC1-471 19 mer Anti-sense Strand CAUUUGUGGUGGGCGUUUU 505
    MTARC1-473 19 mer Anti-sense Strand UGCAUUUGUGGUGGGCGUU 506
    MTARC1-475 19 mer Anti-sense Strand ACUGCAUUUGUGGUGGGCG 507
    MTARC1-476 19 mer Anti-sense Strand CACUGCAUUUGUGGUGGGC 508
    MTARC1-482 19 mer Anti-sense Strand CUUGUGCACUGCAUUUGUG 509
    MTARC1-483 19 mer Anti-sense Strand ACUUGUGCACUGCAUUUGU 510
    MTARC1-484 19 mer Anti-sense Strand CACUUGUGCACUGCAUUUG 511
    MTARC1-552 19 mer Anti-sense Strand AGCUGGUUAUCCACUGGGC 512
    MTARC1-553 19 mer Anti-sense Strand AAGCUGGUUAUCCACUGGG 513
    MTARC1-554 19 mer Anti-sense Strand GAAGCUGGUUAUCCACUGG 514
    MTARC1-555 19 mer Anti-sense Strand GGAAGCUGGUUAUCCACUG 515
    MTARC1-556 19 mer Anti-sense Strand AGGAAGCUGGUUAUCCACU 516
    MTARC1-557 19 mer Anti-sense Strand CAGGAAGCUGGUUAUCCAC 517
    MTARC1-558 19 mer Anti-sense Strand UCAGGAAGCUGGUUAUCCA 518
    MTARC1-559 19 mer Anti-sense Strand UUCAGGAAGCUGGUUAUCC 519
    MTARC1-560 19 mer Anti-sense Strand CUUCAGGAAGCUGGUUAUC 520
    MTARC1-561 19 mer Anti-sense Strand ACUUCAGGAAGCUGGUUAU 521
    MTARC1-562 19 mer Anti-sense Strand GACUUCAGGAAGCUGGUUA 522
    MTARC1-563 19 mer Anti-sense Strand UGACUUCAGGAAGCUGGUU 523
    MTARC1-564 19 mer Anti-sense Strand GUGACUUCAGGAAGCUGGU 524
    MTARC1-565 19 mer Anti-sense Strand UGUGACUUCAGGAAGCUGG 525
    MTARC1-566 19 mer Anti-sense Strand CUGUGACUUCAGGAAGCUG 526
    MTARC1-567 19 mer Anti-sense Strand GCUGUGACUUCAGGAAGCU 527
    MTARC1-568 19 mer Anti-sense Strand GGCUGUGACUUCAGGAAGC 528
    MTARC1-589 19 mer Anti-sense Strand UCGAAGUGCACCAGGCGGU 529
    MTARC1-591 19 mer Anti-sense Strand GCUCGAAGUGCACCAGGCG 530
    MTARC1-592 19 mer Anti-sense Strand GGCUCGAAGUGCACCAGGC 531
    MTARC1-593 19 mer Anti-sense Strand AGGCUCGAAGUGCACCAGG 532
    MTARC1-597 19 mer Anti-sense Strand UGUGAGGCUCGAAGUGCAC 533
    MTARC1-600 19 mer Anti-sense Strand GCAUGUGAGGCUCGAAGUG 534
    MTARC1-612 19 mer Anti-sense Strand GACGUCUCGGUCGCAUGUG 535
    MTARC1-614 19 mer Anti-sense Strand AGGACGUCUCGGUCGCAUG 536
    MTARC1-617 19 mer Anti-sense Strand AUGAGGACGUCUCGGUCGC 537
    MTARC1-618 19 mer Anti-sense Strand GAUGAGGACGUCUCGGUCG 538
    MTARC1-620 19 mer Anti-sense Strand UUGAUGAGGACGUCUCGGU 539
    MTARC1-621 19 mer Anti-sense Strand UUUGAUGAGGACGUCUCGG 540
    MTARC1-622 19 mer Anti-sense Strand AUUUGAUGAGGACGUCUCG 541
    MTARC1-623 19 mer Anti-sense Strand UAUUUGAUGAGGACGUCUC 542
    MTARC1-624 19 mer Anti-sense Strand CUAUUUGAUGAGGACGUCU 543
    MTARC1-625 19 mer Anti-sense Strand GCUAUUUGAUGAGGACGUC 544
    MTARC1-626 19 mer Anti-sense Strand UGCUAUUUGAUGAGGACGU 545
    MTARC1-627 19 mer Anti-sense Strand CUGCUAUUUGAUGAGGACG 546
    MTARC1-628 19 mer Anti-sense Strand UCUGCUAUUUGAUGAGGAC 547
    MTARC1-629 19 mer Anti-sense Strand GUCUGCUAUUUGAUGAGGA 548
    MTARC1-630 19 mer Anti-sense Strand AGUCUGCUAUUUGAUGAGG 549
    MTARC1-631 19 mer Anti-sense Strand AAGUCUGCUAUUUGAUGAG 550
    MTARC1-632 19 mer Anti-sense Strand CAAGUCUGCUAUUUGAUGA 551
    MTARC1-633 19 mer Anti-sense Strand ACAAGUCUGCUAUUUGAUG 552
    MTARC1-634 19 mer Anti-sense Strand AACAAGUCUGCUAUUUGAU 553
    MTARC1-635 19 mer Anti-sense Strand GAACAAGUCUGCUAUUUGA 554
    MTARC1-636 19 mer Anti-sense Strand GGAACAAGUCUGCUAUUUG 555
    MTARC1-637 19 mer Anti-sense Strand CGGAACAAGUCUGCUAUUU 556
    MTARC1-638 19 mer Anti-sense Strand UCGGAACAAGUCUGCUAUU 557
    MTARC1-639 19 mer Anti-sense Strand GUCGGAACAAGUCUGCUAU 558
    MTARC1-640 19 mer Anti-sense Strand GGUCGGAACAAGUCUGCUA 559
    MTARC1-641 19 mer Anti-sense Strand GGGUCGGAACAAGUCUGCU 560
    MTARC1-642 19 mer Anti-sense Strand UGGGUCGGAACAAGUCUGC 561
    MTARC1-643 19 mer Anti-sense Strand UUGGGUCGGAACAAGUCUG 562
    MTARC1-644 19 mer Anti-sense Strand CUUGGGUCGGAACAAGUCU 563
    MTARC1-645 19 mer Anti-sense Strand CCUUGGGUCGGAACAAGUC 564
    MTARC1-646 19 mer Anti-sense Strand UCCUUGGGUCGGAACAAGU 565
    MTARC1-647 19 mer Anti-sense Strand GUCCUUGGGUCGGAACAAG 566
    MTARC1-648 19 mer Anti-sense Strand GGUCCUUGGGUCGGAACAA 567
    MTARC1-649 19 mer Anti-sense Strand UGGUCCUUGGGUCGGAACA 568
    MTARC1-650 19 mer Anti-sense Strand CUGGUCCUUGGGUCGGAAC 569
    MTARC1-651 19 mer Anti-sense Strand UCUGGUCCUUGGGUCGGAA 570
    MTARC1-652 19 mer Anti-sense Strand AUCUGGUCCUUGGGUCGGA 571
    MTARC1-653 19 mer Anti-sense Strand AAUCUGGUCCUUGGGUCGG 572
    MTARC1-654 19 mer Anti-sense Strand CAAUCUGGUCCUUGGGUCG 573
    MTARC1-655 19 mer Anti-sense Strand GCAAUCUGGUCCUUGGGUC 574
    MTARC1-656 19 mer Anti-sense Strand AGCAAUCUGGUCCUUGGGU 575
    MTARC1-657 19 mer Anti-sense Strand AAGCAAUCUGGUCCUUGGG 576
    MTARC1-658 19 mer Anti-sense Strand UAAGCAAUCUGGUCCUUGG 577
    MTARC1-659 19 mer Anti-sense Strand GUAAGCAAUCUGGUCCUUG 578
    MTARC1-660 19 mer Anti-sense Strand AGUAAGCAAUCUGGUCCUU 579
    MTARC1-661 19 mer Anti-sense Strand GAGUAAGCAAUCUGGUCCU 580
    MTARC1-662 19 mer Anti-sense Strand UGAGUAAGCAAUCUGGUCC 581
    MTARC1-663 19 mer Anti-sense Strand CUGAGUAAGCAAUCUGGUC 582
    MTARC1-664 19 mer Anti-sense Strand UCUGAGUAAGCAAUCUGGU 583
    MTARC1-665 19 mer Anti-sense Strand GUCUGAGUAAGCAAUCUGG 584
    MTARC1-666 19 mer Anti-sense Strand UGUCUGAGUAAGCAAUCUG 585
    MTARC1-667 19 mer Anti-sense Strand GUGUCUGAGUAAGCAAUCU 586
    MTARC1-668 19 mer Anti-sense Strand GGUGUCUGAGUAAGCAAUC 587
    MTARC1-669 19 mer Anti-sense Strand UGGUGUCUGAGUAAGCAAU 588
    MTARC1-670 19 mer Anti-sense Strand CUGGUGUCUGAGUAAGCAA 589
    MTARC1-671 19 mer Anti-sense Strand GCUGGUGUCUGAGUAAGCA 590
    MTARC1-672 19 mer Anti-sense Strand GGCUGGUGUCUGAGUAAGC 591
    MTARC1-673 19 mer Anti-sense Strand GGGCUGGUGUCUGAGUAAG 592
    MTARC1-674 19 mer Anti-sense Strand UGGGCUGGUGUCUGAGUAA 593
    MTARC1-675 19 mer Anti-sense Strand AUGGGCUGGUGUCUGAGUA 594
    MTARC1-676 19 mer Anti-sense Strand AAUGGGCUGGUGUCUGAGU 595
    MTARC1-677 19 mer Anti-sense Strand GAAUGGGCUGGUGUCUGAG 596
    MTARC1-678 19 mer Anti-sense Strand AGAAUGGGCUGGUGUCUGA 597
    MTARC1-679 19 mer Anti-sense Strand AAGAAUGGGCUGGUGUCUG 598
    MTARC1-680 19 mer Anti-sense Strand CAAGAAUGGGCUGGUGUCU 599
    MTARC1-681 19 mer Anti-sense Strand UCAAGAAUGGGCUGGUGUC 600
    MTARC1-682 19 mer Anti-sense Strand AUCAAGAAUGGGCUGGUGU 601
    MTARC1-683 19 mer Anti-sense Strand GAUCAAGAAUGGGCUGGUG 602
    MTARC1-684 19 mer Anti-sense Strand GGAUCAAGAAUGGGCUGGU 603
    MTARC1-685 19 mer Anti-sense Strand AGGAUCAAGAAUGGGCUGG 604
    MTARC1-686 19 mer Anti-sense Strand AAGGAUCAAGAAUGGGCUG 605
    MTARC1-687 19 mer Anti-sense Strand AAAGGAUCAAGAAUGGGCU 606
    MTARC1-691 19 mer Anti-sense Strand UCAGAAAGGAUCAAGAAUG 607
    MTARC1-692 19 mer Anti-sense Strand CUCAGAAAGGAUCAAGAAU 608
    MTARC1-724 19 mer Anti-sense Strand UCUAGCCUGGAGUUGAGAU 609
    MTARC1-726 19 mer Anti-sense Strand UCUCUAGCCUGGAGUUGAG 610
    MTARC1-728 19 mer Anti-sense Strand CUUCUCUAGCCUGGAGUUG 611
    MTARC1-729 19 mer Anti-sense Strand UCUUCUCUAGCCUGGAGUU 612
    MTARC1-730 19 mer Anti-sense Strand UUCUUCUCUAGCCUGGAGU 613
    MTARC1-731 19 mer Anti-sense Strand UUUCUUCUCUAGCCUGGAG 614
    MTARC1-733 19 mer Anti-sense Strand ACUUUCUUCUCUAGCCUGG 615
    MTARC1-734 19 mer Anti-sense Strand AACUUUCUUCUCUAGCCUG 616
    MTARC1-735 19 mer Anti-sense Strand UAACUUUCUUCUCUAGCCU 617
    MTARC1-736 19 mer Anti-sense Strand UUAACUUUCUUCUCUAGCC 618
    MTARC1-737 19 mer Anti-sense Strand UUUAACUUUCUUCUCUAGC 619
    MTARC1-738 19 mer Anti-sense Strand CUUUAACUUUCUUCUCUAG 620
    MTARC1-739 19 mer Anti-sense Strand GCUUUAACUUUCUUCUCUA 621
    MTARC1-740 19 mer Anti-sense Strand UGCUUUAACUUUCUUCUCU 622
    MTARC1-741 19 mer Anti-sense Strand UUGCUUUAACUUUCUUCUC 623
    MTARC1-742 19 mer Anti-sense Strand GUUGCUUUAACUUUCUUCU 624
    MTARC1-743 19 mer Anti-sense Strand GGUUGCUUUAACUUUCUUC 625
    MTARC1-744 19 mer Anti-sense Strand UGGUUGCUUUAACUUUCUU 626
    MTARC1-745 19 mer Anti-sense Strand UUGGUUGCUUUAACUUUCU 627
    MTARC1-746 19 mer Anti-sense Strand GUUGGUUGCUUUAACUUUC 628
    MTARC1-747 19 mer Anti-sense Strand AGUUGGUUGCUUUAACUUU 629
    MTARC1-748 19 mer Anti-sense Strand AAGUUGGUUGCUUUAACUU 630
    MTARC1-750 19 mer Anti-sense Strand UGAAGUUGGUUGCUUUAAC 631
    MTARC1-751 19 mer Anti-sense Strand CUGAAGUUGGUUGCUUUAA 632
    MTARC1-752 19 mer Anti-sense Strand CCUGAAGUUGGUUGCUUUA 633
    MTARC1-753 19 mer Anti-sense Strand GCCUGAAGUUGGUUGCUUU 634
    MTARC1-754 19 mer Anti-sense Strand GGCCUGAAGUUGGUUGCUU 635
    MTARC1-755 19 mer Anti-sense Strand GGGCCUGAAGUUGGUUGCU 636
    MTARC1-756 19 mer Anti-sense Strand UGGGCCUGAAGUUGGUUGC 637
    MTARC1-758 19 mer Anti-sense Strand AUUGGGCCUGAAGUUGGUU 638
    MTARC1-759 19 mer Anti-sense Strand UAUUGGGCCUGAAGUUGGU 639
    MTARC1-760 19 mer Anti-sense Strand AUAUUGGGCCUGAAGUUGG 640
    MTARC1-761 19 mer Anti-sense Strand AAUAUUGGGCCUGAAGUUG 641
    MTARC1-762 19 mer Anti-sense Strand CAAUAUUGGGCCUGAAGUU 642
    MTARC1-763 19 mer Anti-sense Strand ACAAUAUUGGGCCUGAAGU 643
    MTARC1-764 19 mer Anti-sense Strand UACAAUAUUGGGCCUGAAG 644
    MTARC1-765 19 mer Anti-sense Strand UUACAAUAUUGGGCCUGAA 645
    MTARC1-766 19 mer Anti-sense Strand AUUACAAUAUUGGGCCUGA 646
    MTARC1-767 19 mer Anti-sense Strand AAUUACAAUAUUGGGCCUG 647
    MTARC1-768 19 mer Anti-sense Strand AAAUUACAAUAUUGGGCCU 648
    MTARC1-769 19 mer Anti-sense Strand GAAAUUACAAUAUUGGGCC 649
    MTARC1-770 19 mer Anti-sense Strand UGAAAUUACAAUAUUGGGC 650
    MTARC1-771 19 mer Anti-sense Strand CUGAAAUUACAAUAUUGGG 651
    MTARC1-772 19 mer Anti-sense Strand CCUGAAAUUACAAUAUUGG 652
    MTARC1-773 19 mer Anti-sense Strand UCCUGAAAUUACAAUAUUG 653
    MTARC1-774 19 mer Anti-sense Strand AUCCUGAAAUUACAAUAUU 654
    MTARC1-775 19 mer Anti-sense Strand CAUCCUGAAAUUACAAUAU 655
    MTARC1-776 19 mer Anti-sense Strand GCAUCCUGAAAUUACAAUA 656
    MTARC1-777 19 mer Anti-sense Strand CGCAUCCUGAAAUUACAAU 657
    MTARC1-778 19 mer Anti-sense Strand UCGCAUCCUGAAAUUACAA 658
    MTARC1-779 19 mer Anti-sense Strand AUCGCAUCCUGAAAUUACA 659
    MTARC1-780 19 mer Anti-sense Strand CAUCGCAUCCUGAAAUUAC 660
    MTARC1-781 19 mer Anti-sense Strand ACAUCGCAUCCUGAAAUUA 661
    MTARC1-782 19 mer Anti-sense Strand GACAUCGCAUCCUGAAAUU 662
    MTARC1-783 19 mer Anti-sense Strand AGACAUCGCAUCCUGAAAU 663
    MTARC1-784 19 mer Anti-sense Strand UAGACAUCGCAUCCUGAAA 664
    MTARC1-785 19 mer Anti-sense Strand AUAGACAUCGCAUCCUGAA 665
    MTARC1-786 19 mer Anti-sense Strand CAUAGACAUCGCAUCCUGA 666
    MTARC1-787 19 mer Anti-sense Strand GCAUAGACAUCGCAUCCUG 667
    MTARC1-788 19 mer Anti-sense Strand UGCAUAGACAUCGCAUCCU 668
    MTARC1-789 19 mer Anti-sense Strand CUGCAUAGACAUCGCAUCC 669
    MTARC1-790 19 mer Anti-sense Strand UCUGCAUAGACAUCGCAUC 670
    MTARC1-791 19 mer Anti-sense Strand CUCUGCAUAGACAUCGCAU 671
    MTARC1-792 19 mer Anti-sense Strand CCUCUGCAUAGACAUCGCA 672
    MTARC1-863 19 mer Anti-sense Strand UAAAAUGCAUCUGGAACAA 673
    MTARC1-929 19 mer Anti-sense Strand AUAACUCUUCAGUGUUUCC 674
    MTARC1-930 19 mer Anti-sense Strand GAUAACUCUUCAGUGUUUC 675
    MTARC1-934 19 mer Anti-sense Strand UGGCGAUAACUCUUCAGUG 676
    MTARC1-955 19 mer Anti-sense Strand UUUCGUUCUGAAGGGUCAC 677
    MTARC1-959 19 mer Anti-sense Strand UAACUUUCGUUCUGAAGGG 678
    MTARC1-960 19 mer Anti-sense Strand AUAACUUUCGUUCUGAAGG 679
    MTARC1-963 19 mer Anti-sense Strand CAUAUAACUUUCGUUCUGA 680
    MTARC1-964 19 mer Anti-sense Strand CCAUAUAACUUUCGUUCUG 681
    MTARC1-965 19 mer Anti-sense Strand UCCAUAUAACUUUCGUUCU 682
    MTARC1-966 19 mer Anti-sense Strand UUCCAUAUAACUUUCGUUC 683
    MTARC1-967 19 mer Anti-sense Strand UUUCCAUAUAACUUUCGUU 684
    MTARC1-969 19 mer Anti-sense Strand AUUUUCCAUAUAACUUUCG 685
    MTARC1-970 19 mer Anti-sense Strand GAUUUUCCAUAUAACUUUC 686
    MTARC1-971 19 mer Anti-sense Strand UGAUUUUCCAUAUAACUUU 687
    MTARC1-1107 19 mer Anti-sense Strand CAUUUUUGAGAACAUUUUU 688
    MTARC1-1113 19 mer Anti-sense Strand UGUUGUCAUUUUUGAGAAC 689
    MTARC1-1118 19 mer Anti-sense Strand UCAAGUGUUGUCAUUUUUG 690
    MTARC1-1123 19 mer Anti-sense Strand AUGCUUCAAGUGUUGUCAU 691
    MTARC1-1126 19 mer Anti-sense Strand ACCAUGCUUCAAGUGUUGU 692
    MTARC1-1127 19 mer Anti-sense Strand CACCAUGCUUCAAGUGUUG 693
    MTARC1-1128 19 mer Anti-sense Strand ACACCAUGCUUCAAGUGUU 694
    MTARC1-1129 19 mer Anti-sense Strand AACACCAUGCUUCAAGUGU 695
    MTARC1-1130 19 mer Anti-sense Strand AAACACCAUGCUUCAAGUG 696
    MTARC1-1132 19 mer Anti-sense Strand UGAAACACCAUGCUUCAAG 697
    MTARC1-1133 19 mer Anti-sense Strand CUGAAACACCAUGCUUCAA 698
    MTARC1-1134 19 mer Anti-sense Strand UCUGAAACACCAUGCUUCA 699
    MTARC1-1135 19 mer Anti-sense Strand UUCUGAAACACCAUGCUUC 700
    MTARC1-1139 19 mer Anti-sense Strand UCAGUUCUGAAACACCAUG 701
    MTARC1-1144 19 mer Anti-sense Strand AGGUCUCAGUUCUGAAACA 702
    MTARC1-1165 19 mer Anti-sense Strand ACAAAUUUAAAGAAAAUGU 703
    MTARC1-1167 19 mer Anti-sense Strand UCACAAAUUUAAAGAAAAU 704
    MTARC1-1173 19 mer Anti-sense Strand UGAAAAUCACAAAUUUAAA 705
    MTARC1-1177 19 mer Anti-sense Strand AAUGUGAAAAUCACAAAUU 706
    MTARC1-1179 19 mer Anti-sense Strand AAAAUGUGAAAAUCACAAA 707
    MTARC1-1329 19 mer Anti-sense Strand AUUCCAUAAUCAGUUAAAC 708
    MTARC1-1330 19 mer Anti-sense Strand UAUUCCAUAAUCAGUUAAA 709
    MTARC1-1332 19 mer Anti-sense Strand ACUAUUCCAUAAUCAGUUA 710
    MTARC1-1333 19 mer Anti-sense Strand AACUAUUCCAUAAUCAGUU 711
    MTARC1-1334 19 mer Anti-sense Strand GAACUAUUCCAUAAUCAGU 712
    MTARC1-1335 19 mer Anti-sense Strand AGAACUAUUCCAUAAUCAG 713
    MTARC1-1620 19 mer Anti-sense Strand UAUGGAAAAUUAAUAUCUG 714
    MTARC1-1622 19 mer Anti-sense Strand UCUAUGGAAAAUUAAUAUC 715
    MTARC1-1660 19 mer Anti-sense Strand UCCAAUGCUGUCUGAGAAG 716
    MTARC1-1663 19 mer Anti-sense Strand AAAUCCAAUGCUGUCUGAG 717
    MTARC1-1664 19 mer Anti-sense Strand GAAAUCCAAUGCUGUCUGA 718
    MTARC1-1812 19 mer Anti-sense Strand AUCACUGAAUCACUUUUCU 719
    MTARC1-1816 19 mer Anti-sense Strand UGAAAUCACUGAAUCACUU 720
    MTARC1-1868 19 mer Anti-sense Strand CAACUGACAUAUGCUUUCC 721
    MTARC1-1869 19 mer Anti-sense Strand ACAACUGACAUAUGCUUUC 722
    MTARC1-1876 19 mer Anti-sense Strand GUUUUAAACAACUGACAUA 723
    MTARC1-1877 19 mer Anti-sense Strand GGUUUUAAACAACUGACAU 724
    MTARC1-1878 19 mer Anti-sense Strand GGGUUUUAAACAACUGACA 725
    MTARC1-1879 19 mer Anti-sense Strand UGGGUUUUAAACAACUGAC 726
    MTARC1-1882 19 mer Anti-sense Strand UAUUGGGUUUUAAACAACU 727
    MTARC1-1883 19 mer Anti-sense Strand AUAUUGGGUUUUAAACAAC 728
    MTARC1-1884 19 mer Anti-sense Strand GAUAUUGGGUUUUAAACAA 729
    MTARC1-1885 19 mer Anti-sense Strand AGAUAUUGGGUUUUAAACA 730
    MTARC1-1886 19 mer Anti-sense Strand UAGAUAUUGGGUUUUAAAC 731
    MTARC1-1935 19 mer Anti-sense Strand UAAAAAAUAUACUUCAUCA 732
    MTARC1-1936 19 mer Anti-sense Strand AUAAAAAAUAUACUUCAUC 733
    MTARC1-1937 19 mer Anti-sense Strand AAUAAAAAAUAUACUUCAU 734
    MTARC1-1939 19 mer Anti-sense Strand GCAAUAAAAAAUAUACUUC 735
    MTARC1-1941 19 mer Anti-sense Strand UGGCAAUAAAAAAUAUACU 736
    MTARC1-1953 19 mer Anti-sense Strand CAAAGGACAAAAUGGCAAU 737
    MTARC1-1955 19 mer Anti-sense Strand AUCAAAGGACAAAAUGGCA 738
    MTARC1-1981 19 mer Anti-sense Strand UCAAGUUUAGUCAACUUCC 739
    MTARC1-1983 19 mer Anti-sense Strand UUUCAAGUUUAGUCAACUU 740
    MTARC1-1985 19 mer Anti-sense Strand UUUUUCAAGUUUAGUCAAC 741
    MTARC1-1986 19 mer Anti-sense Strand AUUUUUCAAGUUUAGUCAA 742
    MTARC1-1988 19 mer Anti-sense Strand ACAUUUUUCAAGUUUAGUC 743
    MTARC1-1989 19 mer Anti-sense Strand AACAUUUUUCAAGUUUAGU 744
    MTARC1-1990 19 mer Anti-sense Strand AAACAUUUUUCAAGUUUAG 745
    MTARC1-1995 19 mer Anti-sense Strand UUUAAAAACAUUUUUCAAG 746
    MTARC1-1996 19 mer Anti-sense Strand UUUUAAAAACAUUUUUCAA 747
    MTARC1-1998 19 mer Anti-sense Strand AGUUUUAAAAACAUUUUUC 748
    MTARC1-1999 19 mer Anti-sense Strand CAGUUUUAAAAACAUUUUU 749
    MTARC1-2000 19 mer Anti-sense Strand ACAGUUUUAAAAACAUUUU 750
    MTARC1-2001 19 mer Anti-sense Strand CACAGUUUUAAAAACAUUU 751
    MTARC1-2002 19 mer Anti-sense Strand UCACAGUUUUAAAAACAUU 752
    MTARC1-2005 19 mer Anti-sense Strand UAUUCACAGUUUUAAAAAC 753
    MTARC1-2006 19 mer Anti-sense Strand UUAUUCACAGUUUUAAAAA 754
    MTARC1-2010 19 mer Anti-sense Strand CCAUUUAUUCACAGUUUUA 755
    MTARC1-2011 19 mer Anti-sense Strand UCCAUUUAUUCACAGUUUU 756
    MTARC1-2012 19 mer Anti-sense Strand UUCCAUUUAUUCACAGUUU 757
    MTARC1-2013 19 mer Anti-sense Strand CUUCCAUUUAUUCACAGUU 758
    MTARC1-2015 19 mer Anti-sense Strand AGCUUCCAUUUAUUCACAG 759
    MTARC1-2016 19 mer Anti-sense Strand UAGCUUCCAUUUAUUCACA 760
    MTARC1-2017 19 mer Anti-sense Strand GUAGCUUCCAUUUAUUCAC 761
    MTARC1-2018 19 mer Anti-sense Strand AGUAGCUUCCAUUUAUUCA 762
    MTARC1-2019 19 mer Anti-sense Strand AAGUAGCUUCCAUUUAUUC 763
    MTARC1-2020 19 mer Anti-sense Strand AAAGUAGCUUCCAUUUAUU 764
    MTARC1-2022 19 mer Anti-sense Strand UCAAAGUAGCUUCCAUUUA 765
    MTARC1-2023 19 mer Anti-sense Strand GUCAAAGUAGCUUCCAUUU 766
    MTARC1-2025 19 mer Anti-sense Strand UAGUCAAAGUAGCUUCCAU 767
    MTARC1-2027 19 mer Anti-sense Strand ACUAGUCAAAGUAGCUUCC 768
    MTARC1-231 25 mer Sense Strand GCGCAGCUCUGGAUCUACCAUGUGA 769
    MTARC1-233 25 mer Sense Strand GCAGCUCUGGAUCUACCCUAUGAAA 770
    MTARC1-234 25 mer Sense Strand CAGCUCUGGAUCUACCCUGAGAAAU 771
    MTARC1-235 25 mer Sense Strand AGCUCUGGAUCUACCCUGUAAAAUC 772
    MTARC1-236 25 mer Sense Strand GCUCUGGAUCUACCCUGUGAAAUCC 773
    MTARC1-237 25 mer Sense Strand CUCUGGAUCUACCCUGUGAAAUCCU 774
    MTARC1-238 25 mer Sense Strand UCUGGAUCUACCCUGUGAAAUCCUG 775
    MTARC1-239 25 mer Sense Strand CUGGAUCUACCCUGUGAAAACCUGC 776
    MTARC1-240 25 mer Sense Strand UGGAUCUACCCUGUGAAAUACUGCA 777
    MTARC1-241 25 mer Sense Strand GGAUCUACCCUGUGAAAUCAUGCAA 778
    MTARC1-242 25 mer Sense Strand GAUCUACCCUGUGAAAUCCAGCAAG 779
    MTARC1-243 25 mer Sense Strand AUCUACCCUGUGAAAUCCUACAAGG 780
    MTARC1-244 25 mer Sense Strand UCUACCCUGUGAAAUCCUGAAAGGG 781
    MTARC1-245 25 mer Sense Strand CUACCCUGUGAAAUCCUGCAAGGGG 782
    MTARC1-247 25 mer Sense Strand ACCCUGUGAAAUCCUGCAAAGGGGU 783
    MTARC1-248 25 mer Sense Strand CCCUGUGAAAUCCUGCAAGAGGGUG 784
    MTARC1-249 25 mer Sense Strand CCUGUGAAAUCCUGCAAGGAGGUGC 785
    MTARC1-253 25 mer Sense Strand UGAAAUCCUGCAAGGGGGUACCGGU 786
    MTARC1-255 25 mer Sense Strand AAAUCCUGCAAGGGGGUGCAGGUGA 787
    MTARC1-318 25 mer Sense Strand AACCUGCGGGACAGGUUUUAGCUUG 788
    MTARC1-319 25 mer Sense Strand ACCUGCGGGACAGGUUUUGACUUGU 789
    MTARC1-320 25 mer Sense Strand CCUGCGGGACAGGUUUUGGAUUGUG 790
    MTARC1-321 25 mer Sense Strand CUGCGGGACAGGUUUUGGCAUGUGA 791
    MTARC1-323 25 mer Sense Strand GCGGGACAGGUUUUGGCUUAUGAUC 792
    MTARC1-324 25 mer Sense Strand CGGGACAGGUUUUGGCUUGAGAUCA 793
    MTARC1-325 25 mer Sense Strand GGGACAGGUUUUGGCUUGUAAUCAA 794
    MTARC1-326 25 mer Sense Strand GGACAGGUUUUGGCUUGUGAUCAAC 795
    MTARC1-327 25 mer Sense Strand GACAGGUUUUGGCUUGUGAACAACC 796
    MTARC1-328 25 mer Sense Strand ACAGGUUUUGGCUUGUGAUAAACCA 797
    MTARC1-329 25 mer Sense Strand CAGGUUUUGGCUUGUGAUCAACCAG 798
    MTARC1-330 25 mer Sense Strand AGGUUUUGGCUUGUGAUCAACCAGG 799
    MTARC1-331 25 mer Sense Strand GGUUUUGGCUUGUGAUCAAACAGGA 800
    MTARC1-332 25 mer Sense Strand GUUUUGGCUUGUGAUCAACAAGGAG 801
    MTARC1-334 25 mer Sense Strand UUUGGCUUGUGAUCAACCAAGAGGG 802
    MTARC1-335 25 mer Sense Strand UUGGCUUGUGAUCAACCAGAAGGGA 803
    MTARC1-337 25 mer Sense Strand GGCUUGUGAUCAACCAGGAAGGAAA 804
    MTARC1-338 25 mer Sense Strand GCUUGUGAUCAACCAGGAGAGAAAC 805
    MTARC1-339 25 mer Sense Strand CUUGUGAUCAACCAGGAGGAAAACA 806
    MTARC1-340 25 mer Sense Strand UUGUGAUCAACCAGGAGGGAAACAU 807
    MTARC1-341 25 mer Sense Strand UGUGAUCAACCAGGAGGGAAACAUG 808
    MTARC1-342 25 mer Sense Strand GUGAUCAACCAGGAGGGAAACAUGG 809
    MTARC1-343 25 mer Sense Strand UGAUCAACCAGGAGGGAAAAAUGGU 810
    MTARC1-345 25 mer Sense Strand AUCAACCAGGAGGGAAACAAGGUUA 811
    MTARC1-346 25 mer Sense Strand UCAACCAGGAGGGAAACAUAGUUAC 812
    MTARC1-347 25 mer Sense Strand CAACCAGGAGGGAAACAUGAUUACU 813
    MTARC1-348 25 mer Sense Strand AACCAGGAGGGAAACAUGGAUACUG 814
    MTARC1-349 25 mer Sense Strand ACCAGGAGGGAAACAUGGUAACUGC 815
    MTARC1-350 25 mer Sense Strand CCAGGAGGGAAACAUGGUUACUGCU 816
    MTARC1-351 25 mer Sense Strand CAGGAGGGAAACAUGGUUAAUGCUC 817
    MTARC1-352 25 mer Sense Strand AGGAGGGAAACAUGGUUACAGCUCG 818
    MTARC1-353 25 mer Sense Strand GGAGGGAAACAUGGUUACUACUCGC 819
    MTARC1-354 25 mer Sense Strand GAGGGAAACAUGGUUACUGAUCGCC 820
    MTARC1-356 25 mer Sense Strand GGGAAACAUGGUUACUGCUAGCCAG 821
    MTARC1-357 25 mer Sense Strand GGAAACAUGGUUACUGCUCACCAGG 822
    MTARC1-358 25 mer Sense Strand GAAACAUGGUUACUGCUCGACAGGA 823
    MTARC1-359 25 mer Sense Strand AAACAUGGUUACUGCUCGCAAGGAA 824
    MTARC1-360 25 mer Sense Strand AACAUGGUUACUGCUCGCCAGGAAC 825
    MTARC1-361 25 mer Sense Strand ACAUGGUUACUGCUCGCCAAGAACC 826
    MTARC1-362 25 mer Sense Strand CAUGGUUACUGCUCGCCAGAAACCU 827
    MTARC1-365 25 mer Sense Strand GGUUACUGCUCGCCAGGAAACUCGC 828
    MTARC1-376 25 mer Sense Strand GCCAGGAACCUCGCCUGGUACUGAU 829
    MTARC1-379 25 mer Sense Strand AGGAACCUCGCCUGGUCCUAAUUUC 830
    MTARC1-384 25 mer Sense Strand CCUCGCCUGGUCCUGAUUUACCUGA 831
    MTARC1-385 25 mer Sense Strand CUCGCCUGGUCCUGAUUUCACUGAC 832
    MTARC1-388 25 mer Sense Strand GCCUGGUCCUGAUUUCCCUAACCUG 833
    MTARC1-390 25 mer Sense Strand CUGGUCCUGAUUUCCCUGAACUGCG 834
    MTARC1-391 25 mer Sense Strand UGGUCCUGAUUUCCCUGACAUGCGA 835
    MTARC1-393 25 mer Sense Strand GUCCUGAUUUCCCUGACCUACGAUG 836
    MTARC1-395 25 mer Sense Strand CCUGAUUUCCCUGACCUGCAAUGGU 837
    MTARC1-405 25 mer Sense Strand CUGACCUGCGAUGGUGACAACCUGA 838
    MTARC1-409 25 mer Sense Strand CCUGCGAUGGUGACACCCUAACUCU 839
    MTARC1-411 25 mer Sense Strand UGCGAUGGUGACACCCUGAAUCUCA 840
    MTARC1-412 25 mer Sense Strand GCGAUGGUGACACCCUGACACUCAG 841
    MTARC1-413 25 mer Sense Strand CGAUGGUGACACCCUGACUAUCAGU 842
    MTARC1-414 25 mer Sense Strand GAUGGUGACACCCUGACUCACAGUG 843
    MTARC1-415 25 mer Sense Strand AUGGUGACACCCUGACUCUAAGUGC 844
    MTARC1-416 25 mer Sense Strand UGGUGACACCCUGACUCUCAGUGCA 845
    MTARC1-417 25 mer Sense Strand GGUGACACCCUGACUCUCAAUGCAG 846
    MTARC1-418 25 mer Sense Strand GUGACACCCUGACUCUCAGAGCAGC 847
    MTARC1-419 25 mer Sense Strand UGACACCCUGACUCUCAGUACAGCC 848
    MTARC1-420 25 mer Sense Strand GACACCCUGACUCUCAGUGAAGCCU 849
    MTARC1-421 25 mer Sense Strand ACACCCUGACUCUCAGUGCAGCCUA 850
    MTARC1-422 25 mer Sense Strand CACCCUGACUCUCAGUGCAACCUAC 851
    MTARC1-423 25 mer Sense Strand ACCCUGACUCUCAGUGCAGACUACA 852
    MTARC1-424 25 mer Sense Strand CCCUGACUCUCAGUGCAGCAUACAC 853
    MTARC1-425 25 mer Sense Strand CCUGACUCUCAGUGCAGCCAACACA 854
    MTARC1-426 25 mer Sense Strand CUGACUCUCAGUGCAGCCUACACAA 855
    MTARC1-427 25 mer Sense Strand UGACUCUCAGUGCAGCCUAAACAAA 856
    MTARC1-428 25 mer Sense Strand GACUCUCAGUGCAGCCUACACAAAG 857
    MTARC1-429 25 mer Sense Strand ACUCUCAGUGCAGCCUACAAAAAGG 858
    MTARC1-430 25 mer Sense Strand CUCUCAGUGCAGCCUACACAAAGGA 859
    MTARC1-431 25 mer Sense Strand UCUCAGUGCAGCCUACACAAAGGAC 860
    MTARC1-433 25 mer Sense Strand UCAGUGCAGCCUACACAAAAGACCU 861
    MTARC1-434 25 mer Sense Strand CAGUGCAGCCUACACAAAGAACCUA 862
    MTARC1-435 25 mer Sense Strand AGUGCAGCCUACACAAAGGACCUAC 863
    MTARC1-436 25 mer Sense Strand GUGCAGCCUACACAAAGGAACUACU 864
    MTARC1-437 25 mer Sense Strand UGCAGCCUACACAAAGGACAUACUA 865
    MTARC1-438 25 mer Sense Strand GCAGCCUACACAAAGGACCAACUAC 866
    MTARC1-439 25 mer Sense Strand CAGCCUACACAAAGGACCUACUACU 867
    MTARC1-440 25 mer Sense Strand AGCCUACACAAAGGACCUAAUACUG 868
    MTARC1-441 25 mer Sense Strand GCCUACACAAAGGACCUACAACUGC 869
    MTARC1-445 25 mer Sense Strand ACACAAAGGACCUACUACUACCUAU 870
    MTARC1-446 25 mer Sense Strand CACAAAGGACCUACUACUGACUAUC 871
    MTARC1-447 25 mer Sense Strand ACAAAGGACCUACUACUGCAUAUCA 872
    MTARC1-448 25 mer Sense Strand CAAAGGACCUACUACUGCCAAUCAA 873
    MTARC1-449 25 mer Sense Strand AAAGGACCUACUACUGCCUAUCAAA 874
    MTARC1-450 25 mer Sense Strand AAGGACCUACUACUGCCUAACAAAA 875
    MTARC1-451 25 mer Sense Strand AGGACCUACUACUGCCUAUAAAAAC 876
    MTARC1-452 25 mer Sense Strand GGACCUACUACUGCCUAUCAAAACG 877
    MTARC1-453 25 mer Sense Strand GACCUACUACUGCCUAUCAAAACGC 878
    MTARC1-454 25 mer Sense Strand ACCUACUACUGCCUAUCAAAACGCC 879
    MTARC1-456 25 mer Sense Strand CUACUACUGCCUAUCAAAAAGCCCA 880
    MTARC1-457 25 mer Sense Strand UACUACUGCCUAUCAAAACACCCAC 881
    MTARC1-458 25 mer Sense Strand ACUACUGCCUAUCAAAACGACCACC 882
    MTARC1-459 25 mer Sense Strand CUACUGCCUAUCAAAACGCACACCA 883
    MTARC1-460 25 mer Sense Strand UACUGCCUAUCAAAACGCCAACCAC 884
    MTARC1-462 25 mer Sense Strand CUGCCUAUCAAAACGCCCAACACAA 885
    MTARC1-468 25 mer Sense Strand AUCAAAACGCCCACCACAAAUGCAG 886
    MTARC1-469 25 mer Sense Strand UCAAAACGCCCACCACAAAAGCAGU 887
    MTARC1-470 25 mer Sense Strand CAAAACGCCCACCACAAAUACAGUG 888
    MTARC1-471 25 mer Sense Strand AAAACGCCCACCACAAAUGAAGUGC 889
    MTARC1-473 25 mer Sense Strand AACGCCCACCACAAAUGCAAUGCAC 890
    MTARC1-475 25 mer Sense Strand CGCCCACCACAAAUGCAGUACACAA 891
    MTARC1-476 25 mer Sense Strand GCCCACCACAAAUGCAGUGAACAAG 892
    MTARC1-482 25 mer Sense Strand CACAAAUGCAGUGCACAAGAGCAGA 893
    MTARC1-483 25 mer Sense Strand ACAAAUGCAGUGCACAAGUACAGAG 894
    MTARC1-484 25 mer Sense Strand CAAAUGCAGUGCACAAGUGAAGAGU 895
    MTARC1-552 25 mer Sense Strand GCCCAGUGGAUAACCAGCUACCUGA 896
    MTARC1-553 25 mer Sense Strand CCCAGUGGAUAACCAGCUUACUGAA 897
    MTARC1-554 25 mer Sense Strand CCAGUGGAUAACCAGCUUCAUGAAG 898
    MTARC1-555 25 mer Sense Strand CAGUGGAUAACCAGCUUCCAGAAGU 899
    MTARC1-556 25 mer Sense Strand AGUGGAUAACCAGCUUCCUAAAGUC 900
    MTARC1-557 25 mer Sense Strand GUGGAUAACCAGCUUCCUGAAGUCA 901
    MTARC1-558 25 mer Sense Strand UGGAUAACCAGCUUCCUGAAGUCAC 902
    MTARC1-559 25 mer Sense Strand GGAUAACCAGCUUCCUGAAAUCACA 903
    MTARC1-560 25 mer Sense Strand GAUAACCAGCUUCCUGAAGACACAG 904
    MTARC1-561 25 mer Sense Strand AUAACCAGCUUCCUGAAGUAACAGC 905
    MTARC1-562 25 mer Sense Strand UAACCAGCUUCCUGAAGUCACAGCC 906
    MTARC1-563 25 mer Sense Strand AACCAGCUUCCUGAAGUCAAAGCCC 907
    MTARC1-564 25 mer Sense Strand ACCAGCUUCCUGAAGUCACAGCCCU 908
    MTARC1-565 25 mer Sense Strand CCAGCUUCCUGAAGUCACAACCCUA 909
    MTARC1-566 25 mer Sense Strand CAGCUUCCUGAAGUCACAGACCUAC 910
    MTARC1-567 25 mer Sense Strand AGCUUCCUGAAGUCACAGCACUACC 911
    MTARC1-568 25 mer Sense Strand GCUUCCUGAAGUCACAGCCAUACCG 912
    MTARC1-589 25 mer Sense Strand ACCGCCUGGUGCACUUCGAACCUCA 913
    MTARC1-591 25 mer Sense Strand CGCCUGGUGCACUUCGAGCAUCACA 914
    MTARC1-592 25 mer Sense Strand GCCUGGUGCACUUCGAGCCACACAU 915
    MTARC1-593 25 mer Sense Strand CCUGGUGCACUUCGAGCCUAACAUG 916
    MTARC1-597 25 mer Sense Strand GUGCACUUCGAGCCUCACAAGCGAC 917
    MTARC1-600 25 mer Sense Strand CACUUCGAGCCUCACAUGCAACCGA 918
    MTARC1-612 25 mer Sense Strand CACAUGCGACCGAGACGUCAUCAUC 919
    MTARC1-614 25 mer Sense Strand CAUGCGACCGAGACGUCCUAAUCAA 920
    MTARC1-617 25 mer Sense Strand GCGACCGAGACGUCCUCAUAAAAUA 921
    MTARC1-618 25 mer Sense Strand CGACCGAGACGUCCUCAUCAAAUAG 922
    MTARC1-620 25 mer Sense Strand ACCGAGACGUCCUCAUCAAAUAGCA 923
    MTARC1-621 25 mer Sense Strand CCGAGACGUCCUCAUCAAAAAGCAG 924
    MTARC1-622 25 mer Sense Strand CGAGACGUCCUCAUCAAAUAGCAGA 925
    MTARC1-623 25 mer Sense Strand GAGACGUCCUCAUCAAAUAACAGAC 926
    MTARC1-624 25 mer Sense Strand AGACGUCCUCAUCAAAUAGAAGACU 927
    MTARC1-625 25 mer Sense Strand GACGUCCUCAUCAAAUAGCAGACUU 928
    MTARC1-626 25 mer Sense Strand ACGUCCUCAUCAAAUAGCAAACUUG 929
    MTARC1-627 25 mer Sense Strand CGUCCUCAUCAAAUAGCAGACUUGU 930
    MTARC1-628 25 mer Sense Strand GUCCUCAUCAAAUAGCAGAAUUGUU 931
    MTARC1-629 25 mer Sense Strand UCCUCAUCAAAUAGCAGACAUGUUC 932
    MTARC1-630 25 mer Sense Strand CCUCAUCAAAUAGCAGACUAGUUCC 933
    MTARC1-631 25 mer Sense Strand CUCAUCAAAUAGCAGACUUAUUCCG 934
    MTARC1-632 25 mer Sense Strand UCAUCAAAUAGCAGACUUGAUCCGA 935
    MTARC1-633 25 mer Sense Strand CAUCAAAUAGCAGACUUGUACCGAC 936
    MTARC1-634 25 mer Sense Strand AUCAAAUAGCAGACUUGUUACGACC 937
    MTARC1-635 25 mer Sense Strand UCAAAUAGCAGACUUGUUCAGACCC 938
    MTARC1-636 25 mer Sense Strand CAAAUAGCAGACUUGUUCCAACCCA 939
    MTARC1-637 25 mer Sense Strand AAAUAGCAGACUUGUUCCGACCCAA 940
    MTARC1-638 25 mer Sense Strand AAUAGCAGACUUGUUCCGAACCAAG 941
    MTARC1-639 25 mer Sense Strand AUAGCAGACUUGUUCCGACACAAGG 942
    MTARC1-640 25 mer Sense Strand UAGCAGACUUGUUCCGACCAAAGGA 943
    MTARC1-641 25 mer Sense Strand AGCAGACUUGUUCCGACCCAAGGAC 944
    MTARC1-642 25 mer Sense Strand GCAGACUUGUUCCGACCCAAGGACC 945
    MTARC1-643 25 mer Sense Strand CAGACUUGUUCCGACCCAAAGACCA 946
    MTARC1-644 25 mer Sense Strand AGACUUGUUCCGACCCAAGAACCAG 947
    MTARC1-645 25 mer Sense Strand GACUUGUUCCGACCCAAGGACCAGA 948
    MTARC1-646 25 mer Sense Strand ACUUGUUCCGACCCAAGGAACAGAU 949
    MTARC1-647 25 mer Sense Strand CUUGUUCCGACCCAAGGACAAGAUU 950
    MTARC1-648 25 mer Sense Strand UUGUUCCGACCCAAGGACCAGAUUG 951
    MTARC1-649 25 mer Sense Strand UGUUCCGACCCAAGGACCAAAUUGC 952
    MTARC1-650 25 mer Sense Strand GUUCCGACCCAAGGACCAGAUUGCU 953
    MTARC1-651 25 mer Sense Strand UUCCGACCCAAGGACCAGAAUGCUU 954
    MTARC1-652 25 mer Sense Strand UCCGACCCAAGGACCAGAUAGCUUA 955
    MTARC1-653 25 mer Sense Strand CCGACCCAAGGACCAGAUUACUUAC 956
    MTARC1-654 25 mer Sense Strand CGACCCAAGGACCAGAUUGAUUACU 957
    MTARC1-655 25 mer Sense Strand GACCCAAGGACCAGAUUGCAUACUC 958
    MTARC1-656 25 mer Sense Strand ACCCAAGGACCAGAUUGCUAACUCA 959
    MTARC1-657 25 mer Sense Strand CCCAAGGACCAGAUUGCUUACUCAG 960
    MTARC1-658 25 mer Sense Strand CCAAGGACCAGAUUGCUUAAUCAGA 961
    MTARC1-659 25 mer Sense Strand CAAGGACCAGAUUGCUUACACAGAC 962
    MTARC1-660 25 mer Sense Strand AAGGACCAGAUUGCUUACUAAGACA 963
    MTARC1-661 25 mer Sense Strand AGGACCAGAUUGCUUACUCAGACAC 964
    MTARC1-662 25 mer Sense Strand GGACCAGAUUGCUUACUCAAACACC 965
    MTARC1-663 25 mer Sense Strand GACCAGAUUGCUUACUCAGACACCA 966
    MTARC1-664 25 mer Sense Strand ACCAGAUUGCUUACUCAGAAACCAG 967
    MTARC1-665 25 mer Sense Strand CCAGAUUGCUUACUCAGACACCAGC 968
    MTARC1-666 25 mer Sense Strand CAGAUUGCUUACUCAGACAACAGCC 969
    MTARC1-667 25 mer Sense Strand AGAUUGCUUACUCAGACACAAGCCC 970
    MTARC1-668 25 mer Sense Strand GAUUGCUUACUCAGACACCAGCCCA 971
    MTARC1-669 25 mer Sense Strand AUUGCUUACUCAGACACCAACCCAU 972
    MTARC1-670 25 mer Sense Strand UUGCUUACUCAGACACCAGACCAUU 973
    MTARC1-671 25 mer Sense Strand UGCUUACUCAGACACCAGCACAUUC 974
    MTARC1-672 25 mer Sense Strand GCUUACUCAGACACCAGCCAAUUCU 975
    MTARC1-673 25 mer Sense Strand CUUACUCAGACACCAGCCCAUUCUU 976
    MTARC1-674 25 mer Sense Strand UUACUCAGACACCAGCCCAAUCUUG 977
    MTARC1-675 25 mer Sense Strand UACUCAGACACCAGCCCAUACUUGA 978
    MTARC1-676 25 mer Sense Strand ACUCAGACACCAGCCCAUUAUUGAU 979
    MTARC1-677 25 mer Sense Strand CUCAGACACCAGCCCAUUCAUGAUC 980
    MTARC1-678 25 mer Sense Strand UCAGACACCAGCCCAUUCUAGAUCC 981
    MTARC1-679 25 mer Sense Strand CAGACACCAGCCCAUUCUUAAUCCU 982
    MTARC1-680 25 mer Sense Strand AGACACCAGCCCAUUCUUGAUCCUU 983
    MTARC1-681 25 mer Sense Strand GACACCAGCCCAUUCUUGAACCUUU 984
    MTARC1-682 25 mer Sense Strand ACACCAGCCCAUUCUUGAUACUUUC 985
    MTARC1-683 25 mer Sense Strand CACCAGCCCAUUCUUGAUCAUUUCU 986
    MTARC1-684 25 mer Sense Strand ACCAGCCCAUUCUUGAUCCAUUCUG 987
    MTARC1-685 25 mer Sense Strand CCAGCCCAUUCUUGAUCCUAUCUGA 988
    MTARC1-686 25 mer Sense Strand CAGCCCAUUCUUGAUCCUUACUGAG 989
    MTARC1-687 25 mer Sense Strand AGCCCAUUCUUGAUCCUUUAUGAGG 990
    MTARC1-691 25 mer Sense Strand CAUUCUUGAUCCUUUCUGAAGCGUC 991
    MTARC1-692 25 mer Sense Strand AUUCUUGAUCCUUUCUGAGACGUCG 992
    MTARC1-724 25 mer Sense Strand AUCUCAACUCCAGGCUAGAAAAGAA 993
    MTARC1-726 25 mer Sense Strand CUCAACUCCAGGCUAGAGAAGAAAG 994
    MTARC1-728 25 mer Sense Strand CAACUCCAGGCUAGAGAAGAAAGUU 995
    MTARC1-729 25 mer Sense Strand AACUCCAGGCUAGAGAAGAAAGUUA 996
    MTARC1-730 25 mer Sense Strand ACUCCAGGCUAGAGAAGAAAGUUAA 997
    MTARC1-731 25 mer Sense Strand CUCCAGGCUAGAGAAGAAAAUUAAA 998
    MTARC1-733 25 mer Sense Strand CCAGGCUAGAGAAGAAAGUAAAAGC 999
    MTARC1-734 25 mer Sense Strand CAGGCUAGAGAAGAAAGUUAAAGCA 1000
    MTARC1-735 25 mer Sense Strand AGGCUAGAGAAGAAAGUUAAAGCAA 1001
    MTARC1-736 25 mer Sense Strand GGCUAGAGAAGAAAGUUAAAGCAAC 1002
    MTARC1-737 25 mer Sense Strand GCUAGAGAAGAAAGUUAAAACAACC 1003
    MTARC1-738 25 mer Sense Strand CUAGAGAAGAAAGUUAAAGAAACCA 1004
    MTARC1-739 25 mer Sense Strand UAGAGAAGAAAGUUAAAGCAACCAA 1005
    MTARC1-740 25 mer Sense Strand AGAGAAGAAAGUUAAAGCAACCAAC 1006
    MTARC1-741 25 mer Sense Strand GAGAAGAAAGUUAAAGCAAACAACU 1007
    MTARC1-742 25 mer Sense Strand AGAAGAAAGUUAAAGCAACAAACUU 1008
    MTARC1-743 25 mer Sense Strand GAAGAAAGUUAAAGCAACCAACUUC 1009
    MTARC1-744 25 mer Sense Strand AAGAAAGUUAAAGCAACCAACUUCA 1010
    MTARC1-745 25 mer Sense Strand AGAAAGUUAAAGCAACCAAAUUCAG 1011
    MTARC1-746 25 mer Sense Strand GAAAGUUAAAGCAACCAACAUCAGG 1012
    MTARC1-747 25 mer Sense Strand AAAGUUAAAGCAACCAACUACAGGC 1013
    MTARC1-748 25 mer Sense Strand AAGUUAAAGCAACCAACUUAAGGCC 1014
    MTARC1-750 25 mer Sense Strand GUUAAAGCAACCAACUUCAAGCCCA 1015
    MTARC1-751 25 mer Sense Strand UUAAAGCAACCAACUUCAGACCCAA 1016
    MTARC1-752 25 mer Sense Strand UAAAGCAACCAACUUCAGGACCAAU 1017
    MTARC1-753 25 mer Sense Strand AAAGCAACCAACUUCAGGCACAAUA 1018
    MTARC1-754 25 mer Sense Strand AAGCAACCAACUUCAGGCCAAAUAU 1019
    MTARC1-755 25 mer Sense Strand AGCAACCAACUUCAGGCCCAAUAUU 1020
    MTARC1-756 25 mer Sense Strand GCAACCAACUUCAGGCCCAAUAUUG 1021
    MTARC1-758 25 mer Sense Strand AACCAACUUCAGGCCCAAUAUUGUA 1022
    MTARC1-759 25 mer Sense Strand ACCAACUUCAGGCCCAAUAAUGUAA 1023
    MTARC1-760 25 mer Sense Strand CCAACUUCAGGCCCAAUAUAGUAAU 1024
    MTARC1-761 25 mer Sense Strand CAACUUCAGGCCCAAUAUUAUAAUU 1025
    MTARC1-762 25 mer Sense Strand AACUUCAGGCCCAAUAUUGAAAUUU 1026
    MTARC1-763 25 mer Sense Strand ACUUCAGGCCCAAUAUUGUAAUUUC 1027
    MTARC1-764 25 mer Sense Strand CUUCAGGCCCAAUAUUGUAAUUUCA 1028
    MTARC1-765 25 mer Sense Strand UUCAGGCCCAAUAUUGUAAAUUCAG 1029
    MTARC1-766 25 mer Sense Strand UCAGGCCCAAUAUUGUAAUAUCAGG 1030
    MTARC1-767 25 mer Sense Strand CAGGCCCAAUAUUGUAAUUACAGGA 1031
    MTARC1-768 25 mer Sense Strand AGGCCCAAUAUUGUAAUUUAAGGAU 1032
    MTARC1-769 25 mer Sense Strand GGCCCAAUAUUGUAAUUUCAGGAUG 1033
    MTARC1-770 25 mer Sense Strand GCCCAAUAUUGUAAUUUCAAGAUGC 1034
    MTARC1-771 25 mer Sense Strand CCCAAUAUUGUAAUUUCAGAAUGCG 1035
    MTARC1-772 25 mer Sense Strand CCAAUAUUGUAAUUUCAGGAUGCGA 1036
    MTARC1-773 25 mer Sense Strand CAAUAUUGUAAUUUCAGGAAGCGAU 1037
    MTARC1-774 25 mer Sense Strand AAUAUUGUAAUUUCAGGAUACGAUG 1038
    MTARC1-775 25 mer Sense Strand AUAUUGUAAUUUCAGGAUGAGAUGU 1039
    MTARC1-776 25 mer Sense Strand UAUUGUAAUUUCAGGAUGCAAUGUC 1040
    MTARC1-777 25 mer Sense Strand AUUGUAAUUUCAGGAUGCGAUGUCU 1041
    MTARC1-778 25 mer Sense Strand UUGUAAUUUCAGGAUGCGAAGUCUA 1042
    MTARC1-779 25 mer Sense Strand UGUAAUUUCAGGAUGCGAUAUCUAU 1043
    MTARC1-780 25 mer Sense Strand GUAAUUUCAGGAUGCGAUGACUAUG 1044
    MTARC1-781 25 mer Sense Strand UAAUUUCAGGAUGCGAUGUAUAUGC 1045
    MTARC1-782 25 mer Sense Strand AAUUUCAGGAUGCGAUGUCAAUGCA 1046
    MTARC1-783 25 mer Sense Strand AUUUCAGGAUGCGAUGUCUAUGCAG 1047
    MTARC1-784 25 mer Sense Strand UUUCAGGAUGCGAUGUCUAAGCAGA 1048
    MTARC1-785 25 mer Sense Strand UUCAGGAUGCGAUGUCUAUACAGAG 1049
    MTARC1-786 25 mer Sense Strand UCAGGAUGCGAUGUCUAUGAAGAGG 1050
    MTARC1-787 25 mer Sense Strand CAGGAUGCGAUGUCUAUGCAGAGGA 1051
    MTARC1-788 25 mer Sense Strand AGGAUGCGAUGUCUAUGCAAAGGAU 1052
    MTARC1-789 25 mer Sense Strand GGAUGCGAUGUCUAUGCAGAGGAUU 1053
    MTARC1-790 25 mer Sense Strand GAUGCGAUGUCUAUGCAGAAGAUUC 1054
    MTARC1-791 25 mer Sense Strand AUGCGAUGUCUAUGCAGAGAAUUCU 1055
    MTARC1-792 25 mer Sense Strand UGCGAUGUCUAUGCAGAGGAAACAC 1056
    MTARC1-863 25 mer Sense Strand UUGUUCCAGAUGCAUUUUAACCACA 1057
    MTARC1-929 25 mer Sense Strand GGAAACACUGAAGAGUUAUAGCCAG 1058
    MTARC1-930 25 mer Sense Strand GAAACACUGAAGAGUUAUCACCAGU 1059
    MTARC1-934 25 mer Sense Strand CACUGAAGAGUUAUCGCCAAUGUGA 1060
    MTARC1-955 25 mer Sense Strand GUGACCCUUCAGAACGAAAAUUAUA 1061
    MTARC1-959 25 mer Sense Strand CCCUUCAGAACGAAAGUUAAAUGGA 1062
    MTARC1-960 25 mer Sense Strand CCUUCAGAACGAAAGUUAUAUGGAA 1063
    MTARC1-963 25 mer Sense Strand UCAGAACGAAAGUUAUAUGAAAAAU 1064
    MTARC1-964 25 mer Sense Strand CAGAACGAAAGUUAUAUGGAAAAUC 1065
    MTARC1-965 25 mer Sense Strand AGAACGAAAGUUAUAUGGAAAAUCA 1066
    MTARC1-966 25 mer Sense Strand GAACGAAAGUUAUAUGGAAAAUCAC 1067
    MTARC1-967 25 mer Sense Strand AACGAAAGUUAUAUGGAAAAUCACC 1068
    MTARC1-969 25 mer Sense Strand CGAAAGUUAUAUGGAAAAUAACCAC 1069
    MTARC1-970 25 mer Sense Strand GAAAGUUAUAUGGAAAAUCACCACU 1070
    MTARC1-971 25 mer Sense Strand AAAGUUAUAUGGAAAAUCAACACUC 1071
    MTARC1-1107 25 mer Sense Strand AAAAAUGUUCUCAAAAAUGACAACA 1072
    MTARC1-1113 25 mer Sense Strand GUUCUCAAAAAUGACAACAAUUGAA 1073
    MTARC1-1118 25 mer Sense Strand CAAAAAUGACAACACUUGAAGCAUG 1074
    MTARC1-1123 25 mer Sense Strand AUGACAACACUUGAAGCAUAGUGUU 1075
    MTARC1-1126 25 mer Sense Strand ACAACACUUGAAGCAUGGUAUUUCA 1076
    MTARC1-1127 25 mer Sense Strand CAACACUUGAAGCAUGGUGAUUCAG 1077
    MTARC1-1128 25 mer Sense Strand AACACUUGAAGCAUGGUGUAUCAGA 1078
    MTARC1-1129 25 mer Sense Strand ACACUUGAAGCAUGGUGUUACAGAA 1079
    MTARC1-1130 25 mer Sense Strand CACUUGAAGCAUGGUGUUUAAGAAC 1080
    MTARC1-1132 25 mer Sense Strand CUUGAAGCAUGGUGUUUCAAAACUG 1081
    MTARC1-1133 25 mer Sense Strand UUGAAGCAUGGUGUUUCAGAACUGA 1082
    MTARC1-1134 25 mer Sense Strand UGAAGCAUGGUGUUUCAGAACUGAG 1083
    MTARC1-1135 25 mer Sense Strand GAAGCAUGGUGUUUCAGAAAUGAGA 1084
    MTARC1-1139 25 mer Sense Strand CAUGGUGUUUCAGAACUGAAACCUC 1085
    MTARC1-1144 25 mer Sense Strand UGUUUCAGAACUGAGACCUAUACAU 1086
    MTARC1-1165 25 mer Sense Strand ACAUUUUCUUUAAAUUUGUAAUUUU 1087
    MTARC1-1167 25 mer Sense Strand AUUUUCUUUAAAUUUGUGAAUUUCA 1088
    MTARC1-1173 25 mer Sense Strand UUUAAAUUUGUGAUUUUCAAAUUUU 1089
    MTARC1-1177 25 mer Sense Strand AAUUUGUGAUUUUCACAUUAUUCGU 1090
    MTARC1-1179 25 mer Sense Strand UUUGUGAUUUUCACAUUUUACGUCU 1091
    MTARC1-1329 25 mer Sense Strand GUUUAACUGAUUAUGGAAUAGUUCU 1092
    MTARC1-1330 25 mer Sense Strand UUUAACUGAUUAUGGAAUAAUUCUU 1093
    MTARC1-1332 25 mer Sense Strand UAACUGAUUAUGGAAUAGUACUUUC 1094
    MTARC1-1333 25 mer Sense Strand AACUGAUUAUGGAAUAGUUAUUUCU 1095
    MTARC1-1334 25 mer Sense Strand ACUGAUUAUGGAAUAGUUCAUUCUC 1096
    MTARC1-1335 25 mer Sense Strand CUGAUUAUGGAAUAGUUCUAUCUCC 1097
    MTARC1-1620 25 mer Sense Strand CAGAUAUUAAUUUUCCAUAAAUCUG 1098
    MTARC1-1622 25 mer Sense Strand GAUAUUAAUUUUCCAUAGAACUGGA 1099
    MTARC1-1660 25 mer Sense Strand CUUCUCAGACAGCAUUGGAAUUCCU 1100
    MTARC1-1663 25 mer Sense Strand CUCAGACAGCAUUGGAUUUACUAAA 1101
    MTARC1-1664 25 mer Sense Strand UCAGACAGCAUUGGAUUUCAUAAAG 1102
    MTARC1-1812 25 mer Sense Strand AGAAAAGUGAUUCAGUGAUAUCAGA 1103
    MTARC1-1816 25 mer Sense Strand AAGUGAUUCAGUGAUUUCAAAUAGA 1104
    MTARC1-1868 25 mer Sense Strand GGAAAGCAUAUGUCAGUUGAUUAAA 1105
    MTARC1-1869 25 mer Sense Strand GAAAGCAUAUGUCAGUUGUAUAAAA 1106
    MTARC1-1876 25 mer Sense Strand UAUGUCAGUUGUUUAAAACACAAUA 1107
    MTARC1-1877 25 mer Sense Strand AUGUCAGUUGUUUAAAACCAAAUAU 1108
    MTARC1-1878 25 mer Sense Strand UGUCAGUUGUUUAAAACCCAAUAUC 1109
    MTARC1-1879 25 mer Sense Strand GUCAGUUGUUUAAAACCCAAUAUCU 1110
    MTARC1-1882 25 mer Sense Strand AGUUGUUUAAAACCCAAUAACUAUU 1111
    MTARC1-1883 25 mer Sense Strand GUUGUUUAAAACCCAAUAUAUAUUU 1112
    MTARC1-1884 25 mer Sense Strand UUGUUUAAAACCCAAUAUCAAUUUU 1113
    MTARC1-1885 25 mer Sense Strand UGUUUAAAACCCAAUAUCUAUUUUU 1114
    MTARC1-1886 25 mer Sense Strand GUUUAAAACCCAAUAUCUAAUUUUU 1115
    MTARC1-1935 25 mer Sense Strand UGAUGAAGUAUAUUUUUUAAUGCCA 1116
    MTARC1-1936 25 mer Sense Strand GAUGAAGUAUAUUUUUUAUAGCCAU 1117
    MTARC1-1937 25 mer Sense Strand AUGAAGUAUAUUUUUUAUUACCAUU 1118
    MTARC1-1939 25 mer Sense Strand GAAGUAUAUUUUUUAUUGCAAUUUU 1119
    MTARC1-1941 25 mer Sense Strand AGUAUAUUUUUUAUUGCCAAUUUGU 1120
    MTARC1-1953 25 mer Sense Strand AUUGCCAUUUUGUCCUUUGAUUAUA 1121
    MTARC1-1955 25 mer Sense Strand UGCCAUUUUGUCCUUUGAUAAUAUU 1122
    MTARC1-1981 25 mer Sense Strand GGAAGUUGACUAAACUUGAAAAAUG 1123
    MTARC1-1983 25 mer Sense Strand AAGUUGACUAAACUUGAAAAAUGUU 1124
    MTARC1-1985 25 mer Sense Strand GUUGACUAAACUUGAAAAAAGUUUU 1125
    MTARC1-1986 25 mer Sense Strand UUGACUAAACUUGAAAAAUAUUUUU 1126
    MTARC1-1988 25 mer Sense Strand GACUAAACUUGAAAAAUGUAUUUAA 1127
    MTARC1-1989 25 mer Sense Strand ACUAAACUUGAAAAAUGUUAUUAAA 1128
    MTARC1-1990 25 mer Sense Strand CUAAACUUGAAAAAUGUUUAUAAAA 1129
    MTARC1-1995 25 mer Sense Strand CUUGAAAAAUGUUUUUAAAACUGUG 1130
    MTARC1-1996 25 mer Sense Strand UUGAAAAAUGUUUUUAAAAAUGUGA 1131
    MTARC1-1998 25 mer Sense Strand GAAAAAUGUUUUUAAAACUAUGAAU 1132
    MTARC1-1999 25 mer Sense Strand AAAAAUGUUUUUAAAACUGAGAAUA 1133
    MTARC1-2000 25 mer Sense Strand AAAAUGUUUUUAAAACUGUAAAUAA 1134
    MTARC1-2001 25 mer Sense Strand AAAUGUUUUUAAAACUGUGAAUAAA 1135
    MTARC1-2002 25 mer Sense Strand AAUGUUUUUAAAACUGUGAAUAAAU 1136
    MTARC1-2005 25 mer Sense Strand GUUUUUAAAACUGUGAAUAAAUGGA 1137
    MTARC1-2006 25 mer Sense Strand UUUUUAAAACUGUGAAUAAAUGGAA 1138
    MTARC1-2010 25 mer Sense Strand UAAAACUGUGAAUAAAUGGAAGCUA 1139
    MTARC1-2011 25 mer Sense Strand AAAACUGUGAAUAAAUGGAAGCUAC 1140
    MTARC1-2012 25 mer Sense Strand AAACUGUGAAUAAAUGGAAACUACU 1141
    MTARC1-2013 25 mer Sense Strand AACUGUGAAUAAAUGGAAGAUACUU 1142
    MTARC1-2015 25 mer Sense Strand CUGUGAAUAAAUGGAAGCUACUUUG 1143
    MTARC1-2016 25 mer Sense Strand UGUGAAUAAAUGGAAGCUAAUUUGA 1144
    MTARC1-2017 25 mer Sense Strand GUGAAUAAAUGGAAGCUACAUUGAC 1145
    MTARC1-2018 25 mer Sense Strand UGAAUAAAUGGAAGCUACUAUGACU 1146
    MTARC1-2019 25 mer Sense Strand GAAUAAAUGGAAGCUACUUAGACUA 1147
    MTARC1-2020 25 mer Sense Strand AAUAAAUGGAAGCUACUUUAACUAG 1148
    MTARC1-2022 25 mer Sense Strand UAAAUGGAAGCUACUUUGAAUAGUU 1149
    MTARC1-2023 25 mer Sense Strand AAAUGGAAGCUACUUUGACAAGUUU 1150
    MTARC1-2025 25 mer Sense Strand AUGGAAGCUACUUUGACUAAUUUCA 1151
    MTARC1-2027 25 mer Sense Strand GGAAGCUACUUUGACUAGUAUCAGA 1152
    MTARC1-231 27 mer Anti-sense Strand UCACAUGGUAGAUCCAGAGCUGCG CCA 1153
    MTARC1-233 27 mer Anti-sense Strand UUUCAUAGGGUAGAUCCAGAGCUG CGC 1154
    MTARC1-234 27 mer Anti-sense Strand AUUUCUCAGGGUAGAUCCAGAGCU GCG 1155
    MTARC1-235 27 mer Anti-sense Strand GAUUUUACAGGGUAGAUCCAGAGC UGC 1156
    MTARC1-236 27 mer Anti-sense Strand GGAUUUCACAGGGUAGAUCCAGAG CUG 1157
    MTARC1-237 27 mer Anti-sense Strand AGGAUUUCACAGGGUAGAUCCAGA GCU 1158
    MTARC1-238 27 mer Anti-sense Strand CAGGAUUUCACAGGGUAGAUCCAG AGC 1159
    MTARC1-239 27 mer Anti-sense Strand GCAGGUUUUCACAGGGUAGAUCCA GAG 1160
    MTARC1-240 27 mer Anti-sense Strand UGCAGUAUUUCACAGGGUAGAUCC AGA 1161
    MTARC1-241 27 mer Anti-sense Strand UUGCAUGAUUUCACAGGGUAGAUC CAG 1162
    MTARC1-242 27 mer Anti-sense Strand CUUGCUGGAUUUCACAGGGUAGAU CCA 1163
    MTARC1-243 27 mer Anti-sense Strand CCUUGUAGGAUUUCACAGGGUAGA UCC 1164
    MTARC1-244 27 mer Anti-sense Strand CCCUUUCAGGAUUUCACAGGGUAG AUC 1165
    MTARC1-245 27 mer Anti-sense Strand CCCCUUGCAGGAUUUCACAGGGUA GAU 1166
    MTARC1-247 27 mer Anti-sense Strand ACCCCUUUGCAGGAUUUCACAGGG UAG 1167
    MTARC1-248 27 mer Anti-sense Strand CACCCUCUUGCAGGAUUUCACAGG GUA 1168
    MTARC1-249 27 mer Anti-sense Strand GCACCUCCUUGCAGGAUUUCACAG GGU 1169
    MTARC1-253 27 mer Anti-sense Strand ACCGGUACCCCCUUGCAGGAUUUC ACA 1170
    MTARC1-255 27 mer Anti-sense Strand UCACCUGCACCCCCUUGCAGGAUU UCA 1171
    MTARC1-318 27 mer Anti-sense Strand CAAGCUAAAACCUGUCCCGCAGGU UGC 1172
    MTARC1-319 27 mer Anti-sense Strand ACAAGUCAAAACCUGUCCCGCAGG UUG 1173
    MTARC1-320 27 mer Anti-sense Strand CACAAUCCAAAACCUGUCCCGCAG GUU 1174
    MTARC1-321 27 mer Anti-sense Strand UCACAUGCCAAAACCUGUCCCGCA GGU 1175
    MTARC1-323 27 mer Anti-sense Strand GAUCAUAAGCCAAAACCUGUCCCG CAG 1176
    MTARC1-324 27 mer Anti-sense Strand UGAUCUCAAGCCAAAACCUGUCCC GCA 1177
    MTARC1-325 27 mer Anti-sense Strand UUGAUUACAAGCCAAAACCUGUCC CGC 1178
    MTARC1-326 27 mer Anti-sense Strand GUUGAUCACAAGCCAAAACCUGUC CCG 1179
    MTARC1-327 27 mer Anti-sense Strand GGUUGUUCACAAGCCAAAACCUGU CCC 1180
    MTARC1-328 27 mer Anti-sense Strand UGGUUUAUCACAAGCCAAAACCUG UCC 1181
    MTARC1-329 27 mer Anti-sense Strand CUGGUUGAUCACAAGCCAAAACCU GUC 1182
    MTARC1-330 27 mer Anti-sense Strand CCUGGUUGAUCACAAGCCAAAACC UGU 1183
    MTARC1-331 27 mer Anti-sense Strand UCCUGUUUGAUCACAAGCCAAAAC CUG 1184
    MTARC1-332 27 mer Anti-sense Strand CUCCUUGUUGAUCACAAGCCAAAA CCU 1185
    MTARC1-334 27 mer Anti-sense Strand CCCUCUUGGUUGAUCACAAGCCAA AAC 1186
    MTARC1-335 27 mer Anti-sense Strand UCCCUUCUGGUUGAUCACAAGCCA AAA 1187
    MTARC1-337 27 mer Anti-sense Strand UUUCCUUCCUGGUUGAUCACAAGC CAA 1188
    MTARC1-338 27 mer Anti-sense Strand GUUUCUCUCCUGGUUGAUCACAAG CCA 1189
    MTARC1-339 27 mer Anti-sense Strand UGUUUUCCUCCUGGUUGAUCACAA GCC 1190
    MTARC1-340 27 mer Anti-sense Strand AUGUUUCCCUCCUGGUUGAUCACA AGC 1191
    MTARC1-341 27 mer Anti-sense Strand CAUGUUUCCCUCCUGGUUGAUCAC AAG 1192
    MTARC1-342 27 mer Anti-sense Strand CCAUGUUUCCCUCCUGGUUGAUCA CAA 1193
    MTARC1-343 27 mer Anti-sense Strand ACCAUUUUUCCCUCCUGGUUGAUC ACA 1194
    MTARC1-345 27 mer Anti-sense Strand UAACCUUGUUUCCCUCCUGGUUGA UCA 1195
    MTARC1-346 27 mer Anti-sense Strand GUAACUAUGUUUCCCUCCUGGUUG AUC 1196
    MTARC1-347 27 mer Anti-sense Strand AGUAAUCAUGUUUCCCUCCUGGUU GAU 1197
    MTARC1-348 27 mer Anti-sense Strand CAGUAUCCAUGUUUCCCUCCUGGU UGA 1198
    MTARC1-349 27 mer Anti-sense Strand GCAGUUACCAUGUUUCCCUCCUGG UUG 1199
    MTARC1-350 27 mer Anti-sense Strand AGCAGUAACCAUGUUUCCCUCCUG GUU 1200
    MTARC1-351 27 mer Anti-sense Strand GAGCAUUAACCAUGUUUCCCUCCU GGU 1201
    MTARC1-352 27 mer Anti-sense Strand CGAGCUGUAACCAUGUUUCCCUCC UGG 1202
    MTARC1-353 27 mer Anti-sense Strand GCGAGUAGUAACCAUGUUUCCCUC CUG 1203
    MTARC1-354 27 mer Anti-sense Strand GGCGAUCAGUAACCAUGUUUCCCU CCU 1204
    MTARC1-356 27 mer Anti-sense Strand CUGGCUAGCAGUAACCAUGUUUCC CUC 1205
    MTARC1-357 27 mer Anti-sense Strand CCUGGUGAGCAGUAACCAUGUUUC CCU 1206
    MTARC1-358 27 mer Anti-sense Strand UCCUGUCGAGCAGUAACCAUGUUU CCC 1207
    MTARC1-359 27 mer Anti-sense Strand UUCCUUGCGAGCAGUAACCAUGUU UCC 1208
    MTARC1-360 27 mer Anti-sense Strand GUUCCUGGCGAGCAGUAACCAUGU UUC 1209
    MTARC1-361 27 mer Anti-sense Strand GGUUCUUGGCGAGCAGUAACCAUG UUU 1210
    MTARC1-362 27 mer Anti-sense Strand AGGUUUCUGGCGAGCAGUAACCAU GUU 1211
    MTARC1-365 27 mer Anti-sense Strand GCGAGUUUCCUGGCGAGCAGUAAC CAU 1212
    MTARC1-376 27 mer Anti-sense Strand AUCAGUACCAGGCGAGGUUCCUGG CGA 1213
    MTARC1-379 27 mer Anti-sense Strand GAAAUUAGGACCAGGCGAGGUUCC UGG 1214
    MTARC1-384 27 mer Anti-sense Strand UCAGGUAAAUCAGGACCAGGCGAG GUU 1215
    MTARC1-385 27 mer Anti-sense Strand GUCAGUGAAAUCAGGACCAGGCGA GGU 1216
    MTARC1-388 27 mer Anti-sense Strand CAGGUUAGGGAAAUCAGGACCAGG CGA 1217
    MTARC1-390 27 mer Anti-sense Strand CGCAGUUCAGGGAAAUCAGGACCA GGC 1218
    MTARC1-391 27 mer Anti-sense Strand UCGCAUGUCAGGGAAAUCAGGACC AGG 1219
    MTARC1-393 27 mer Anti-sense Strand CAUCGUAGGUCAGGGAAAUCAGGA CCA 1220
    MTARC1-395 27 mer Anti-sense Strand ACCAUUGCAGGUCAGGGAAAUCAG GAC 1221
    MTARC1-405 27 mer Anti-sense Strand UCAGGUUGUCACCAUCGCAGGUCA GGG 1222
    MTARC1-409 27 mer Anti-sense Strand AGAGUUAGGGUGUCACCAUCGCAG GUC 1223
    MTARC1-411 27 mer Anti-sense Strand UGAGAUUCAGGGUGUCACCAUCGC AGG 1224
    MTARC1-412 27 mer Anti-sense Strand CUGAGUGUCAGGGUGUCACCAUCG CAG 1225
    MTARC1-413 27 mer Anti-sense Strand ACUGAUAGUCAGGGUGUCACCAUC GCA 1226
    MTARC1-414 27 mer Anti-sense Strand CACUGUGAGUCAGGGUGUCACCAU CGC 1227
    MTARC1-415 27 mer Anti-sense Strand GCACUUAGAGUCAGGGUGUCACCA UCG 1228
    MTARC1-416 27 mer Anti-sense Strand UGCACUGAGAGUCAGGGUGUCACC AUC 1229
    MTARC1-417 27 mer Anti-sense Strand CUGCAUUGAGAGUCAGGGUGUCAC CAU 1230
    MTARC1-418 27 mer Anti-sense Strand GCUGCUCUGAGAGUCAGGGUGUCA CCA 1231
    MTARC1-419 27 mer Anti-sense Strand GGCUGUACUGAGAGUCAGGGUGUC ACC 1232
    MTARC1-420 27 mer Anti-sense Strand AGGCUUCACUGAGAGUCAGGGUGU CAC 1233
    MTARC1-421 27 mer Anti-sense Strand UAGGCUGCACUGAGAGUCAGGGUG UCA 1234
    MTARC1-422 27 mer Anti-sense Strand GUAGGUUGCACUGAGAGUCAGGGU GUC 1235
    MTARC1-423 27 mer Anti-sense Strand UGUAGUCUGCACUGAGAGUCAGGG UGU 1236
    MTARC1-424 27 mer Anti-sense Strand GUGUAUGCUGCACUGAGAGUCAGG GUG 1237
    MTARC1-425 27 mer Anti-sense Strand UGUGUUGGCUGCACUGAGAGUCAG GGU 1238
    MTARC1-426 27 mer Anti-sense Strand UUGUGUAGGCUGCACUGAGAGUCA GGG 1239
    MTARC1-427 27 mer Anti-sense Strand UUUGUUUAGGCUGCACUGAGAGUC AGG 1240
    MTARC1-428 27 mer Anti-sense Strand CUUUGUGUAGGCUGCACUGAGAGU CAG 1241
    MTARC1-429 27 mer Anti-sense Strand CCUUUUUGUAGGCUGCACUGAGAG UCA 1242
    MTARC1-430 27 mer Anti-sense Strand UCCUUUGUGUAGGCUGCACUGAGA GUC 1243
    MTARC1-431 27 mer Anti-sense Strand GUCCUUUGUGUAGGCUGCACUGAG AGU 1244
    MTARC1-433 27 mer Anti-sense Strand AGGUCUUUUGUGUAGGCUGCACUG AGA 1245
    MTARC1-434 27 mer Anti-sense Strand UAGGUUCUUUGUGUAGGCUGCACU GAG 1246
    MTARC1-435 27 mer Anti-sense Strand GUAGGUCCUUUGUGUAGGCUGCAC UGA 1247
    MTARC1-436 27 mer Anti-sense Strand AGUAGUUCCUUUGUGUAGGCUGCA CUG 1248
    MTARC1-437 27 mer Anti-sense Strand UAGUAUGUCCUUUGUGUAGGCUGC ACU 1249
    MTARC1-438 27 mer Anti-sense Strand GUAGUUGGUCCUUUGUGUAGGCUG CAC 1250
    MTARC1-439 27 mer Anti-sense Strand AGUAGUAGGUCCUUUGUGUAGGCU GCA 1251
    MTARC1-440 27 mer Anti-sense Strand CAGUAUUAGGUCCUUUGUGUAGGC UGC 1252
    MTARC1-441 27 mer Anti-sense Strand GCAGUUGUAGGUCCUUUGUGUAGG CUG 1253
    MTARC1-445 27 mer Anti-sense Strand AUAGGUAGUAGUAGGUCCUUUGUG UAG 1254
    MTARC1-446 27 mer Anti-sense Strand GAUAGUCAGUAGUAGGUCCUUUGU GUA 1255
    MTARC1-447 27 mer Anti-sense Strand UGAUAUGCAGUAGUAGGUCCUUUG UGU 1256
    MTARC1-448 27 mer Anti-sense Strand UUGAUUGGCAGUAGUAGGUCCUUU GUG 1257
    MTARC1-449 27 mer Anti-sense Strand UUUGAUAGGCAGUAGUAGGUCCUU UGU 1258
    MTARC1-450 27 mer Anti-sense Strand UUUUGUUAGGCAGUAGUAGGUCCU UUG 1259
    MTARC1-451 27 mer Anti-sense Strand GUUUUUAUAGGCAGUAGUAGGUCC UUU 1260
    MTARC1-452 27 mer Anti-sense Strand CGUUUUGAUAGGCAGUAGUAGGUC CUU 1261
    MTARC1-453 27 mer Anti-sense Strand GCGUUUUGAUAGGCAGUAGUAGGU CCU 1262
    MTARC1-454 27 mer Anti-sense Strand GGCGUUUUGAUAGGCAGUAGUAGG UCC 1263
    MTARC1-456 27 mer Anti-sense Strand UGGGCUUUUUGAUAGGCAGUAGUA GGU 1264
    MTARC1-457 27 mer Anti-sense Strand GUGGGUGUUUUGAUAGGCAGUAGU AGG 1265
    MTARC1-458 27 mer Anti-sense Strand GGUGGUCGUUUUGAUAGGCAGUAG UAG 1266
    MTARC1-459 27 mer Anti-sense Strand UGGUGUGCGUUUUGAUAGGCAGUA GUA 1267
    MTARC1-460 27 mer Anti-sense Strand GUGGUUGGCGUUUUGAUAGGCAGU AGU 1268
    MTARC1-462 27 mer Anti-sense Strand UUGUGUUGGGCGUUUUGAUAGGCA GUA 1269
    MTARC1-468 27 mer Anti-sense Strand CUGCAUUUGUGGUGGGCGUUUUGA UAG 1270
    MTARC1-469 27 mer Anti-sense Strand ACUGCUUUUGUGGUGGGCGUUUUG AUA 1271
    MTARC1-470 27 mer Anti-sense Strand CACUGUAUUUGUGGUGGGCGUUUU GAU 1272
    MTARC1-471 27 mer Anti-sense Strand GCACUUCAUUUGUGGUGGGCGUUU UGA 1273
    MTARC1-473 27 mer Anti-sense Strand GUGCAUUGCAUUUGUGGUGGGCGU UUU 1274
    MTARC1-475 27 mer Anti-sense Strand UUGUGUACUGCAUUUGUGGUGGGC GUU 1275
    MTARC1-476 27 mer Anti-sense Strand CUUGUUCACUGCAUUUGUGGUGGG CGU 1276
    MTARC1-482 27 mer Anti-sense Strand UCUGCUCUUGUGCACUGCAUUUGU GGU 1277
    MTARC1-483 27 mer Anti-sense Strand CUCUGUACUUGUGCACUGCAUUUG UGG 1278
    MTARC1-484 27 mer Anti-sense Strand ACUCUUCACUUGUGCACUGCAUUU GUG 1279
    MTARC1-552 27 mer Anti-sense Strand UCAGGUAGCUGGUUAUCCACUGGG CGG 1280
    MTARC1-553 27 mer Anti-sense Strand UUCAGUAAGCUGGUUAUCCACUGG GCG 1281
    MTARC1-554 27 mer Anti-sense Strand CUUCAUGAAGCUGGUUAUCCACUG GGC 1282
    MTARC1-555 27 mer Anti-sense Strand ACUUCUGGAAGCUGGUUAUCCACU GGG 1283
    MTARC1-556 27 mer Anti-sense Strand GACUUUAGGAAGCUGGUUAUCCAC UGG 1284
    MTARC1-557 27 mer Anti-sense Strand UGACUUCAGGAAGCUGGUUAUCCA CUG 1285
    MTARC1-558 27 mer Anti-sense Strand GUGACUUCAGGAAGCUGGUUAUCC ACU 1286
    MTARC1-559 27 mer Anti-sense Strand UGUGAUUUCAGGAAGCUGGUUAUC CAC 1287
    MTARC1-560 27 mer Anti-sense Strand CUGUGUCUUCAGGAAGCUGGUUAU CCA 1288
    MTARC1-561 27 mer Anti-sense Strand GCUGUUACUUCAGGAAGCUGGUUA UCC 1289
    MTARC1-562 27 mer Anti-sense Strand GGCUGUGACUUCAGGAAGCUGGUU AUC 1290
    MTARC1-563 27 mer Anti-sense Strand GGGCUUUGACUUCAGGAAGCUGGU UAU 1291
    MTARC1-564 27 mer Anti-sense Strand AGGGCUGUGACUUCAGGAAGCUGG UUA 1292
    MTARC1-565 27 mer Anti-sense Strand UAGGGUUGUGACUUCAGGAAGCUG GUU 1293
    MTARC1-566 27 mer Anti-sense Strand GUAGGUCUGUGACUUCAGGAAGCU GGU 1294
    MTARC1-567 27 mer Anti-sense Strand GGUAGUGCUGUGACUUCAGGAAGC UGG 1295
    MTARC1-568 27 mer Anti-sense Strand CGGUAUGGCUGUGACUUCAGGAAG CUG 1296
    MTARC1-589 27 mer Anti-sense Strand UGAGGUUCGAAGUGCACCAGGCGG UAG 1297
    MTARC1-591 27 mer Anti-sense Strand UGUGAUGCUCGAAGUGCACCAGGC GGU 1298
    MTARC1-592 27 mer Anti-sense Strand AUGUGUGGCUCGAAGUGCACCAGG CGG 1299
    MTARC1-593 27 mer Anti-sense Strand CAUGUUAGGCUCGAAGUGCACCAG GCG 1300
    MTARC1-597 27 mer Anti-sense Strand GUCGCUUGUGAGGCUCGAAGUGCA CCA 1301
    MTARC1-600 27 mer Anti-sense Strand UCGGUUGCAUGUGAGGCUCGAAGU GCA 1302
    MTARC1-612 27 mer Anti-sense Strand GAUGAUGACGUCUCGGUCGCAUGU GAG 1303
    MTARC1-614 27 mer Anti-sense Strand UUGAUUAGGACGUCUCGGUCGCAU GUG 1304
    MTARC1-617 27 mer Anti-sense Strand UAUUUUAUGAGGACGUCUCGGUCG CAU 1305
    MTARC1-618 27 mer Anti-sense Strand CUAUUUGAUGAGGACGUCUCGGUC GCA 1306
    MTARC1-620 27 mer Anti-sense Strand UGCUAUUUGAUGAGGACGUCUCGG UCG 1307
    MTARC1-621 27 mer Anti-sense Strand CUGCUUUUUGAUGAGGACGUCUCG GUC 1308
    MTARC1-622 27 mer Anti-sense Strand UCUGCUAUUUGAUGAGGACGUCUC GGU 1309
    MTARC1-623 27 mer Anti-sense Strand GUCUGUUAUUUGAUGAGGACGUCU CGG 1310
    MTARC1-624 27 mer Anti-sense Strand AGUCUUCUAUUUGAUGAGGACGUC UCG 1311
    MTARC1-625 27 mer Anti-sense Strand AAGUCUGCUAUUUGAUGAGGACGU CUC 1312
    MTARC1-626 27 mer Anti-sense Strand CAAGUUUGCUAUUUGAUGAGGACG UCU 1313
    MTARC1-627 27 mer Anti-sense Strand ACAAGUCUGCUAUUUGAUGAGGAC GUC 1314
    MTARC1-628 27 mer Anti-sense Strand AACAAUUCUGCUAUUUGAUGAGGA CGU 1315
    MTARC1-629 27 mer Anti-sense Strand GAACAUGUCUGCUAUUUGAUGAGG ACG 1316
    MTARC1-630 27 mer Anti-sense Strand GGAACUAGUCUGCUAUUUGAUGAG GAC 1317
    MTARC1-631 27 mer Anti-sense Strand CGGAAUAAGUCUGCUAUUUGAUGA GGA 1318
    MTARC1-632 27 mer Anti-sense Strand UCGGAUCAAGUCUGCUAUUUGAUG AGG 1319
    MTARC1-633 27 mer Anti-sense Strand GUCGGUACAAGUCUGCUAUUUGAU GAG 1320
    MTARC1-634 27 mer Anti-sense Strand GGUCGUAACAAGUCUGCUAUUUGA UGA 1321
    MTARC1-635 27 mer Anti-sense Strand GGGUCUGAACAAGUCUGCUAUUUG AUG 1322
    MTARC1-636 27 mer Anti-sense Strand UGGGUUGGAACAAGUCUGCUAUUU GAU 1323
    MTARC1-637 27 mer Anti-sense Strand UUGGGUCGGAACAAGUCUGCUAUU UGA 1324
    MTARC1-638 27 mer Anti-sense Strand CUUGGUUCGGAACAAGUCUGCUAU UUG 1325
    MTARC1-639 27 mer Anti-sense Strand CCUUGUGUCGGAACAAGUCUGCUA UUU 1326
    MTARC1-640 27 mer Anti-sense Strand UCCUUUGGUCGGAACAAGUCUGCU AUU 1327
    MTARC1-641 27 mer Anti-sense Strand GUCCUUGGGUCGGAACAAGUCUGC UAU 1328
    MTARC1-642 27 mer Anti-sense Strand GGUCCUUGGGUCGGAACAAGUCUG CUA 1329
    MTARC1-643 27 mer Anti-sense Strand UGGUCUUUGGGUCGGAACAAGUCU GCU 1330
    MTARC1-644 27 mer Anti-sense Strand CUGGUUCUUGGGUCGGAACAAGUC UGC 1331
    MTARC1-645 27 mer Anti-sense Strand UCUGGUCCUUGGGUCGGAACAAGU CUG 1332
    MTARC1-646 27 mer Anti-sense Strand AUCUGUUCCUUGGGUCGGAACAAG UCU 1333
    MTARC1-647 27 mer Anti-sense Strand AAUCUUGUCCUUGGGUCGGAACAA GUC 1334
    MTARC1-648 27 mer Anti-sense Strand CAAUCUGGUCCUUGGGUCGGAACA AGU 1335
    MTARC1-649 27 mer Anti-sense Strand GCAAUUUGGUCCUUGGGUCGGAAC AAG 1336
    MTARC1-650 27 mer Anti-sense Strand AGCAAUCUGGUCCUUGGGUCGGAA CAA 1337
    MTARC1-651 27 mer Anti-sense Strand AAGCAUUCUGGUCCUUGGGUCGGA ACA 1338
    MTARC1-652 27 mer Anti-sense Strand UAAGCUAUCUGGUCCUUGGGUCGG AAC 1339
    MTARC1-653 27 mer Anti-sense Strand GUAAGUAAUCUGGUCCUUGGGUCG GAA 1340
    MTARC1-654 27 mer Anti-sense Strand AGUAAUCAAUCUGGUCCUUGGGUC GGA 1341
    MTARC1-655 27 mer Anti-sense Strand GAGUAUGCAAUCUGGUCCUUGGGU CGG 1342
    MTARC1-656 27 mer Anti-sense Strand UGAGUUAGCAAUCUGGUCCUUGGG UCG 1343
    MTARC1-657 27 mer Anti-sense Strand CUGAGUAAGCAAUCUGGUCCUUGG GUC 1344
    MTARC1-658 27 mer Anti-sense Strand UCUGAUUAAGCAAUCUGGUCCUUG GGU 1345
    MTARC1-659 27 mer Anti-sense Strand GUCUGUGUAAGCAAUCUGGUCCUU GGG 1346
    MTARC1-660 27 mer Anti-sense Strand UGUCUUAGUAAGCAAUCUGGUCCU UGG 1347
    MTARC1-661 27 mer Anti-sense Strand GUGUCUGAGUAAGCAAUCUGGUCC UUG 1348
    MTARC1-662 27 mer Anti-sense Strand GGUGUUUGAGUAAGCAAUCUGGUC CUU 1349
    MTARC1-663 27 mer Anti-sense Strand UGGUGUCUGAGUAAGCAAUCUGGU CCU 1350
    MTARC1-664 27 mer Anti-sense Strand CUGGUUUCUGAGUAAGCAAUCUGG UCC 1351
    MTARC1-665 27 mer Anti-sense Strand GCUGGUGUCUGAGUAAGCAAUCUG GUC 1352
    MTARC1-666 27 mer Anti-sense Strand GGCUGUUGUCUGAGUAAGCAAUCU GGU 1353
    MTARC1-667 27 mer Anti-sense Strand GGGCUUGUGUCUGAGUAAGCAAUC UGG 1354
    MTARC1-668 27 mer Anti-sense Strand UGGGCUGGUGUCUGAGUAAGCAAU CUG 1355
    MTARC1-669 27 mer Anti-sense Strand AUGGGUUGGUGUCUGAGUAAGCAA UCU 1356
    MTARC1-670 27 mer Anti-sense Strand AAUGGUCUGGUGUCUGAGUAAGCA AUC 1357
    MTARC1-671 27 mer Anti-sense Strand GAAUGUGCUGGUGUCUGAGUAAGC AAU 1358
    MTARC1-672 27 mer Anti-sense Strand AGAAUUGGCUGGUGUCUGAGUAAG CAA 1359
    MTARC1-673 27 mer Anti-sense Strand AAGAAUGGGCUGGUGUCUGAGUAA GCA 1360
    MTARC1-674 27 mer Anti-sense Strand CAAGAUUGGGCUGGUGUCUGAGUA AGC 1361
    MTARC1-675 27 mer Anti-sense Strand UCAAGUAUGGGCUGGUGUCUGAGU AAG 1362
    MTARC1-676 27 mer Anti-sense Strand AUCAAUAAUGGGCUGGUGUCUGAG UAA 1363
    MTARC1-677 27 mer Anti-sense Strand GAUCAUGAAUGGGCUGGUGUCUGA GUA 1364
    MTARC1-678 27 mer Anti-sense Strand GGAUCUAGAAUGGGCUGGUGUCUG AGU 1365
    MTARC1-679 27 mer Anti-sense Strand AGGAUUAAGAAUGGGCUGGUGUCU GAG 1366
    MTARC1-680 27 mer Anti-sense Strand AAGGAUCAAGAAUGGGCUGGUGUC UGA 1367
    MTARC1-681 27 mer Anti-sense Strand AAAGGUUCAAGAAUGGGCUGGUGU CUG 1368
    MTARC1-682 27 mer Anti-sense Strand GAAAGUAUCAAGAAUGGGCUGGUG UCU 1369
    MTARC1-683 27 mer Anti-sense Strand AGAAAUGAUCAAGAAUGGGCUGGU GUC 1370
    MTARC1-684 27 mer Anti-sense Strand CAGAAUGGAUCAAGAAUGGGCUGG UGU 1371
    MTARC1-685 27 mer Anti-sense Strand UCAGAUAGGAUCAAGAAUGGGCUG GUG 1372
    MTARC1-686 27 mer Anti-sense Strand CUCAGUAAGGAUCAAGAAUGGGCU GGU 1373
    MTARC1-687 27 mer Anti-sense Strand CCUCAUAAAGGAUCAAGAAUGGGC UGG 1374
    MTARC1-691 27 mer Anti-sense Strand GACGCUUCAGAAAGGAUCAAGAAU GGG 1375
    MTARC1-692 27 mer Anti-sense Strand CGACGUCUCAGAAAGGAUCAAGAA UGG 1376
    MTARC1-724 27 mer Anti-sense Strand UUCUUUUCUAGCCUGGAGUUGAGA UCC 1377
    MTARC1-726 27 mer Anti-sense Strand CUUUCUUCUCUAGCCUGGAGUUGA GAU 1378
    MTARC1-728 27 mer Anti-sense Strand AACUUUCUUCUCUAGCCUGGAGUU GAG 1379
    MTARC1-729 27 mer Anti-sense Strand UAACUUUCUUCUCUAGCCUGGAGU UGA 1380
    MTARC1-730 27 mer Anti-sense Strand UUAACUUUCUUCUCUAGCCUGGAG UUG 1381
    MTARC1-731 27 mer Anti-sense Strand UUUAAUUUUCUUCUCUAGCCUGGA GUU 1382
    MTARC1-733 27 mer Anti-sense Strand GCUUUUACUUUCUUCUCUAGCCUG GAG 1383
    MTARC1-734 27 mer Anti-sense Strand UGCUUUAACUUUCUUCUCUAGCCU GGA 1384
    MTARC1-735 27 mer Anti-sense Strand UUGCUUUAACUUUCUUCUCUAGCC UGG 1385
    MTARC1-736 27 mer Anti-sense Strand GUUGCUUUAACUUUCUUCUCUAGC CUG 1386
    MTARC1-737 27 mer Anti-sense Strand GGUUGUUUUAACUUUCUUCUCUAG CCU 1387
    MTARC1-738 27 mer Anti-sense Strand UGGUUUCUUUAACUUUCUUCUCUA GCC 1388
    MTARC1-739 27 mer Anti-sense Strand UUGGUUGCUUUAACUUUCUUCUCU AGC 1389
    MTARC1-740 27 mer Anti-sense Strand GUUGGUUGCUUUAACUUUCUUCUC UAG 1390
    MTARC1-741 27 mer Anti-sense Strand AGUUGUUUGCUUUAACUUUCUUCU CUA 1391
    MTARC1-742 27 mer Anti-sense Strand AAGUUUGUUGCUUUAACUUUCUUC UCU 1392
    MTARC1-743 27 mer Anti-sense Strand GAAGUUGGUUGCUUUAACUUUCUU CUC 1393
    MTARC1-744 27 mer Anti-sense Strand UGAAGUUGGUUGCUUUAACUUUCU UCU 1394
    MTARC1-745 27 mer Anti-sense Strand CUGAAUUUGGUUGCUUUAACUUUC UUC 1395
    MTARC1-746 27 mer Anti-sense Strand CCUGAUGUUGGUUGCUUUAACUUU CUU 1396
    MTARC1-747 27 mer Anti-sense Strand GCCUGUAGUUGGUUGCUUUAACUU UCU 1397
    MTARC1-748 27 mer Anti-sense Strand GGCCUUAAGUUGGUUGCUUUAACU UUC 1398
    MTARC1-750 27 mer Anti-sense Strand UGGGCUUGAAGUUGGUUGCUUUAA CUU 1399
    MTARC1-751 27 mer Anti-sense Strand UUGGGUCUGAAGUUGGUUGCUUUA ACU 1400
    MTARC1-752 27 mer Anti-sense Strand AUUGGUCCUGAAGUUGGUUGCUUU AAC 1401
    MTARC1-753 27 mer Anti-sense Strand UAUUGUGCCUGAAGUUGGUUGCUU UAA 1402
    MTARC1-754 27 mer Anti-sense Strand AUAUUUGGCCUGAAGUUGGUUGCU UUA 1403
    MTARC1-755 27 mer Anti-sense Strand AAUAUUGGGCCUGAAGUUGGUUGC UUU 1404
    MTARC1-756 27 mer Anti-sense Strand CAAUAUUGGGCCUGAAGUUGGUUG CUU 1405
    MTARC1-758 27 mer Anti-sense Strand UACAAUAUUGGGCCUGAAGUUGGU UGC 1406
    MTARC1-759 27 mer Anti-sense Strand UUACAUUAUUGGGCCUGAAGUUGG UUG 1407
    MTARC1-760 27 mer Anti-sense Strand AUUACUAUAUUGGGCCUGAAGUUG GUU 1408
    MTARC1-761 27 mer Anti-sense Strand AAUUAUAAUAUUGGGCCUGAAGUU GGU 1409
    MTARC1-762 27 mer Anti-sense Strand AAAUUUCAAUAUUGGGCCUGAAGU UGG 1410
    MTARC1-763 27 mer Anti-sense Strand GAAAUUACAAUAUUGGGCCUGAAG UUG 1411
    MTARC1-764 27 mer Anti-sense Strand UGAAAUUACAAUAUUGGGCCUGAA GUU 1412
    MTARC1-765 27 mer Anti-sense Strand CUGAAUUUACAAUAUUGGGCCUGA AGU 1413
    MTARC1-766 27 mer Anti-sense Strand CCUGAUAUUACAAUAUUGGGCCUG AAG 1414
    MTARC1-767 27 mer Anti-sense Strand UCCUGUAAUUACAAUAUUGGGCCU GAA 1415
    MTARC1-768 27 mer Anti-sense Strand AUCCUUAAAUUACAAUAUUGGGCC UGA 1416
    MTARC1-769 27 mer Anti-sense Strand CAUCCUGAAAUUACAAUAUUGGGC CUG 1417
    MTARC1-770 27 mer Anti-sense Strand GCAUCUUGAAAUUACAAUAUUGGG CCU 1418
    MTARC1-771 27 mer Anti-sense Strand CGCAUUCUGAAAUUACAAUAUUGG GCC 1419
    MTARC1-772 27 mer Anti-sense Strand UCGCAUCCUGAAAUUACAAUAUUG GGC 1420
    MTARC1-773 27 mer Anti-sense Strand AUCGCUUCCUGAAAUUACAAUAUU GGG 1421
    MTARC1-774 27 mer Anti-sense Strand CAUCGUAUCCUGAAAUUACAAUAU UGG 1422
    MTARC1-775 27 mer Anti-sense Strand ACAUCUCAUCCUGAAAUUACAAUA UUG 1423
    MTARC1-776 27 mer Anti-sense Strand GACAUUGCAUCCUGAAAUUACAAU AUU 1424
    MTARC1-777 27 mer Anti-sense Strand AGACAUCGCAUCCUGAAAUUACAA UAU 1425
    MTARC1-778 27 mer Anti-sense Strand UAGACUUCGCAUCCUGAAAUUACA AUA 1426
    MTARC1-779 27 mer Anti-sense Strand AUAGAUAUCGCAUCCUGAAAUUAC AAU 1427
    MTARC1-780 27 mer Anti-sense Strand CAUAGUCAUCGCAUCCUGAAAUUA CAA 1428
    MTARC1-781 27 mer Anti-sense Strand GCAUAUACAUCGCAUCCUGAAAUU ACA 1429
    MTARC1-782 27 mer Anti-sense Strand UGCAUUGACAUCGCAUCCUGAAAU UAC 1430
    MTARC1-783 27 mer Anti-sense Strand CUGCAUAGACAUCGCAUCCUGAAA UUA 1431
    MTARC1-784 27 mer Anti-sense Strand UCUGCUUAGACAUCGCAUCCUGAA AUU 1432
    MTARC1-785 27 mer Anti-sense Strand CUCUGUAUAGACAUCGCAUCCUGA AAU 1433
    MTARC1-786 27 mer Anti-sense Strand CCUCUUCAUAGACAUCGCAUCCUG AAA 1434
    MTARC1-787 27 mer Anti-sense Strand UCCUCUGCAUAGACAUCGCAUCCU GAA 1435
    MTARC1-788 27 mer Anti-sense Strand AUCCUUUGCAUAGACAUCGCAUCC UGA 1436
    MTARC1-789 27 mer Anti-sense Strand AAUCCUCUGCAUAGACAUCGCAUC CUG 1437
    MTARC1-790 27 mer Anti-sense Strand GAAUCUUCUGCAUAGACAUCGCAU CCU 1438
    MTARC1-791 27 mer Anti-sense Strand AGAAUUCUCUGCAUAGACAUCGCA UCC 1439
    MTARC1-792 27 mer Anti-sense Strand GUGUUUCCUCUGCAUAGACAUCGC AUC 1440
    MTARC1-863 27 mer Anti-sense Strand UGUGGUUAAAAUGCAUCUGGAACA AGC 1441
    MTARC1-929 27 mer Anti-sense Strand CUGGCUAUAACUCUUCAGUGUUUC CAG 1442
    MTARC1-930 27 mer Anti-sense Strand ACUGGUGAUAACUCUUCAGUGUUU CCA 1443
    MTARC1-934 27 mer Anti-sense Strand UCACAUUGGCGAUAACUCUUCAGU GUU 1444
    MTARC1-955 27 mer Anti-sense Strand UAUAAUUUUCGUUCUGAAGGGUCA CAC 1445
    MTARC1-959 27 mer Anti-sense Strand UCCAUUUAACUUUCGUUCUGAAGG GUC 1446
    MTARC1-960 27 mer Anti-sense Strand UUCCAUAUAACUUUCGUUCUGAAG GGU 1447
    MTARC1-963 27 mer Anti-sense Strand AUUUUUCAUAUAACUUUCGUUCUG AAG 1448
    MTARC1-964 27 mer Anti-sense Strand GAUUUUCCAUAUAACUUUCGUUCU GAA 1449
    MTARC1-965 27 mer Anti-sense Strand UGAUUUUCCAUAUAACUUUCGUUC UGA 1450
    MTARC1-966 27 mer Anti-sense Strand GUGAUUUUCCAUAUAACUUUCGUU CUG 1451
    MTARC1-967 27 mer Anti-sense Strand GGUGAUUUUCCAUAUAACUUUCGU UCU 1452
    MTARC1-969 27 mer Anti-sense Strand GUGGUUAUUUUCCAUAUAACUUUC GUU 1453
    MTARC1-970 27 mer Anti-sense Strand AGUGGUGAUUUUCCAUAUAACUUU CGU 1454
    MTARC1-971 27 mer Anti-sense Strand GAGUGUUGAUUUUCCAUAUAACUU UCG 1455
    MTARCI-1107 27 mer Anti-sense Strand UGUUGUCAUUUUUGAGAACAUUUU UAA 1456
    MTARC1-1113 27 mer Anti-sense Strand UUCAAUUGUUGUCAUUUUUGAGAA CAU 1457
    MTARC1-1118 27 mer Anti-sense Strand CAUGCUUCAAGUGUUGUCAUUUUU GAG 1458
    MTARC1-1123 27 mer Anti-sense Strand AACACUAUGCUUCAAGUGUUGUCA UUU 1459
    MTARC1-1126 27 mer Anti-sense Strand UGAAAUACCAUGCUUCAAGUGUUG UCA 1460
    MTARC1-1127 27 mer Anti-sense Strand CUGAAUCACCAUGCUUCAAGUGUU GUC 1461
    MTARC1-1128 27 mer Anti-sense Strand UCUGAUACACCAUGCUUCAAGUGU UGU 1462
    MTARC1-1129 27 mer Anti-sense Strand UUCUGUAACACCAUGCUUCAAGUG UUG 1463
    MTARC1-1130 27 mer Anti-sense Strand GUUCUUAAACACCAUGCUUCAAGU GUU 1464
    MTARC1-1132 27 mer Anti-sense Strand CAGUUUUGAAACACCAUGCUUCAA GUG 1465
    MTARC1-1133 27 mer Anti-sense Strand UCAGUUCUGAAACACCAUGCUUCA AGU 1466
    MTARC1-1134 27 mer Anti-sense Strand CUCAGUUCUGAAACACCAUGCUUC AAG 1467
    MTARC1-1135 27 mer Anti-sense Strand UCUCAUUUCUGAAACACCAUGCUU CAA 1468
    MTARC1-1139 27 mer Anti-sense Strand GAGGUUUCAGUUCUGAAACACCAU GCU 1469
    MTARC1-1144 27 mer Anti-sense Strand AUGUAUAGGUCUCAGUUCUGAAAC ACC 1470
    MTARC1-1165 27 mer Anti-sense Strand AAAAUUACAAAUUUAAAGAAAAUG UAG 1471
    MTARC1-1167 27 mer Anti-sense Strand UGAAAUUCACAAAUUUAAAGAAAA UGU 1472
    MTARC1-1173 27 mer Anti-sense Strand AAAAUUUGAAAAUCACAAAUUUAA AGA 1473
    MTARC1-1177 27 mer Anti-sense Strand ACGAAUAAUGUGAAAAUCACAAAU UUA 1474
    MTARC1-1179 27 mer Anti-sense Strand AGACGUAAAAUGUGAAAAUCACAA AUU 1475
    MTARC1-1329 27 mer Anti-sense Strand AGAACUAUUCCAUAAUCAGUUAAA CGG 1476
    MTARC1-1330 27 mer Anti-sense Strand AAGAAUUAUUCCAUAAUCAGUUAA ACG 1477
    MTARC1-1332 27 mer Anti-sense Strand GAAAGUACUAUUCCAUAAUCAGUU AAA 1478
    MTARC1-1333 27 mer Anti-sense Strand AGAAAUAACUAUUCCAUAAUCAGU UAA 1479
    MTARC1-1334 27 mer Anti-sense Strand GAGAAUGAACUAUUCCAUAAUCAG UUA 1480
    MTARC1-1335 27 mer Anti-sense Strand GGAGAUAGAACUAUUCCAUAAUCA GUU 1481
    MTARC1-1620 27 mer Anti-sense Strand CAGAUUUAUGGAAAAUUAAUAUCU GCA 1482
    MTARC1-1622 27 mer Anti-sense Strand UCCAGUUCUAUGGAAAAUUAAUAU CUG 1483
    MTARC1-1660 27 mer Anti-sense Strand AGGAAUUCCAAUGCUGUCUGAGAA GCA 1484
    MTARC1-1663 27 mer Anti-sense Strand UUUAGUAAAUCCAAUGCUGUCUGA GAA 1485
    MTARC1-1664 27 mer Anti-sense Strand CUUUAUGAAAUCCAAUGCUGUCUG AGA 1486
    MTARC1-1812 27 mer Anti-sense Strand UCUGAUAUCACUGAAUCACUUUUC UUC 1487
    MTARC1-1816 27 mer Anti-sense Strand UCUAUUUGAAAUCACUGAAUCACU UUU 1488
    MTARC1-1868 27 mer Anti-sense Strand UUUAAUCAACUGACAUAUGCUUUC CUU 1489
    MTARC1-1869 27 mer Anti-sense Strand UUUUAUACAACUGACAUAUGCUUU CCU 1490
    MTARC1-1876 27 mer Anti-sense Strand UAUUGUGUUUUAAACAACUGACAU AUG 1491
    MTARC1-1877 27 mer Anti-sense Strand AUAUUUGGUUUUAAACAACUGACA UAU 1492
    MTARC1-1878 27 mer Anti-sense Strand GAUAUUGGGUUUUAAACAACUGAC AUA 1493
    MTARC1-1879 27 mer Anti-sense Strand AGAUAUUGGGUUUUAAACAACUGA CAU 1494
    MTARC1-1882 27 mer Anti-sense Strand AAUAGUUAUUGGGUUUUAAACAAC UGA 1495
    MTARC1-1883 27 mer Anti-sense Strand AAAUAUAUAUUGGGUUUUAAACAA CUG 1496
    MTARC1-1884 27 mer Anti-sense Strand AAAAUUGAUAUUGGGUUUUAAACA ACU 1497
    MTARC1-1885 27 mer Anti-sense Strand AAAAAUAGAUAUUGGGUUUUAAAC AAC 1498
    MTARC1-1886 27 mer Anti-sense Strand AAAAAUUAGAUAUUGGGUUUUAAA CAA 1499
    MTARC1-1935 27 mer Anti-sense Strand UGGCAUUAAAAAAUAUACUUCAUC AGA 1500
    MTARC1-1936 27 mer Anti-sense Strand AUGGCUAUAAAAAAUAUACUUCAU CAG 1501
    MTARC1-1937 27 mer Anti-sense Strand AAUGGUAAUAAAAAAUAUACUUCA UCA 1502
    MTARC1-1939 27 mer Anti-sense Strand AAAAUUGCAAUAAAAAAUAUACUU CAU 1503
    MTARC1-1941 27 mer Anti-sense Strand ACAAAUUGGCAAUAAAAAAUAUAC UUC 1504
    MTARC1-1953 27 mer Anti-sense Strand UAUAAUCAAAGGACAAAAUGGCAA UAA 1505
    MTARC1-1955 27 mer Anti-sense Strand AAUAUUAUCAAAGGACAAAAUGGC AAU 1506
    MTARC1-1981 27 mer Anti-sense Strand CAUUUUUCAAGUUUAGUCAACUUC CCA 1507
    MTARC1-1983 27 mer Anti-sense Strand AACAUUUUUCAAGUUUAGUCAACU UCC 1508
    MTARC1-1985 27 mer Anti-sense Strand AAAACUUUUUUCAAGUUUAGUCAA CUU 1509
    MTARC1-1986 27 mer Anti-sense Strand AAAAAUAUUUUUCAAGUUUAGUCA ACU 1510
    MTARC1-1988 27 mer Anti-sense Strand UUAAAUACAUUUUUCAAGUUUAGU CAA 1511
    MTARC1-1989 27 mer Anti-sense Strand UUUAAUAACAUUUUUCAAGUUUAG UCA 1512
    MTARC1-1990 27 mer Anti-sense Strand UUUUAUAAACAUUUUUCAAGUUUA GUC 1513
    MTARC1-1995 27 mer Anti-sense Strand CACAGUUUUAAAAACAUUUUUCAA GUU 1514
    MTARC1-1996 27 mer Anti-sense Strand UCACAUUUUUAAAAACAUUUUUCA AGU 1515
    MTARC1-1998 27 mer Anti-sense Strand AUUCAUAGUUUUAAAAACAUUUUU CAA 1516
    MTARC1-1999 27 mer Anti-sense Strand UAUUCUCAGUUUUAAAAACAUUUU UCA 1517
    MTARC1-2000 27 mer Anti-sense Strand UUAUUUACAGUUUUAAAAACAUUU UUC 1518
    MTARC1-2001 27 mer Anti-sense Strand UUUAUUCACAGUUUUAAAAACAUU UUU 1519
    MTARC1-2002 27 mer Anti-sense Strand AUUUAUUCACAGUUUUAAAAACAU UUU 1520
    MTARC1-2005 27 mer Anti-sense Strand UCCAUUUAUUCACAGUUUUAAAAA CAU 1521
    MTARC1-2006 27 mer Anti-sense Strand UUCCAUUUAUUCACAGUUUUAAAA ACA 1522
    MTARC1-2010 27 mer Anti-sense Strand UAGCUUCCAUUUAUUCACAGUUUU AAA 1523
    MTARC1-2011 27 mer Anti-sense Strand GUAGCUUCCAUUUAUUCACAGUUU UAA 1524
    MTARC1-2012 27 mer Anti-sense Strand AGUAGUUUCCAUUUAUUCACAGUU UUA 1525
    MTARC1-2013 27 mer Anti-sense Strand AAGUAUCUUCCAUUUAUUCACAGU UUU 1526
    MTARC1-2015 27 mer Anti-sense Strand CAAAGUAGCUUCCAUUUAUUCACA GUU 1527
    MTARC1-2016 27 mer Anti-sense Strand UCAAAUUAGCUUCCAUUUAUUCAC AGU 1528
    MTARC1-2017 27 mer Anti-sense Strand GUCAAUGUAGCUUCCAUUUAUUCA CAG 1529
    MTARC1-2018 27 mer Anti-sense Strand AGUCAUAGUAGCUUCCAUUUAUUC ACA 1530
    MTARC1-2019 27 mer Anti-sense Strand UAGUCUAAGUAGCUUCCAUUUAUU CAC 1531
    MTARC1-2020 27 mer Anti-sense Strand CUAGUUAAAGUAGCUUCCAUUUAU UCA 1532
    MTARC1-2022 27 mer Anti-sense Strand AACUAUUCAAAGUAGCUUCCAUUU AUU 1533
    MTARC1-2023 27 mer Anti-sense Strand AAACUUGUCAAAGUAGCUUCCAUU UAU 1534
    MTARC1-2025 27 mer Anti-sense Strand UGAAAUUAGUCAAAGUAGCUUCCA UUU 1535
    MTARC1-2027 27 mer Anti-sense Strand UCUGAUACUAGUCAAAGUAGCUUC CAU 1536
    MARC1-0324 36 mer Sense Strand CGGGACAGGUUUUGGCUUGAGCAG CCGAAAGGCUGC 1537
    MARC1-0326 36 mer Sense Strand GGACAGGUUUUGGCUUGUGAGCAG CCGAAAGGCUGC 1538
    MARC1-0327 36 mer Sense Strand GACAGGUUUUGGCUUGUGAAGCAG CCGAAAGGCUGC 1539
    MARC1-0330 36 mer Sense Strand AGGUUUUGGCUUGUGAUCAAGCAG CCGAAAGGCUGC 1540
    MARC1-0331 36 mer Sense Strand GGUUUUGGCUUGUGAUCAAAGCAG CCGAAAGGCUGC 1541
    MARC1-0735 36 mer Sense Strand AGGCUAGAGAAGAAAGUUAAGCAG CCGAAAGGCUGC 1542
    MARC1-0736 36 mer Sense Strand GGCUAGAGAAGAAAGUUAAAGCAG CCGAAAGGCUGC 1543
    MARC1-0788 36 mer Sense Strand AGGAUGCGAUGUCUAUGCAAGCAG CCGAAAGGCUGC 1544
    MARC1-0863 36 mer Sense Strand UUGUUCCAGAUGCAUUUUAAGCAG CCGAAAGGCUGC 1545
    MARC1-1179 36 mer Sense Strand UUUGUGAUUUUCACAUUUUAGCAG CCGAAAGGCUGC 1546
    MARC1-2012 36 mer Sense Strand AAACUGUGAAUAAAUGGAAAGCAG CCGAAAGGCUGC 1547
    MARC1-2013 36 mer Sense Strand AACUGUGAAUAAAUGGAAGAGCAG CCGAAAGGCUGC 1548
    MARC1-0661 36 mer Sense Strand AGGACCAGAUUGCUUACUCAGCAG CCGAAAGGCUGC 1549
    MARC1-1869 36 mer Sense Strand GAAAGCAUAUGUCAGUUGUAGCAG CCGAAAGGCUGC 1550
    MARC1-1876 36 mer Sense Strand UAUGUCAGUUGUUUAAAACAGCAG CCGAAAGGCUGC 1551
    MARC1-1886 36 mer Sense Strand GUUUAAAACCCAAUAUCUAAGCAG CCGAAAGGCUGC 1552
    MARC1-2016 36 mer Sense Strand UGUGAAUAAAUGGAAGCUAAGCAG CCGAAAGGCUGC 1553
    MARC1-0413 36 mer Sense Strand CGAUGGUGACACCCUGACUAGCAG CCGAAAGGCUGC 1554
    MARC1-0416 36 mer Sense Strand UGGUGACACCCUGACUCUCAGCAG CCGAAAGGCUGC 1555
    MARC1-0622 36 mer Sense Strand CGAGACGUCCUCAUCAAAUAGCAG CCGAAAGGCUGC 1556
    MARC1-0638 36 mer Sense Strand AAUAGCAGACUUGUUCCGAAGCAG CCGAAAGGCUGC 1557
    MARC1-0657 36 mer Sense Strand CCCAAGGACCAGAUUGCUUAGCAG CCGAAAGGCUGC 1558
    MARC1-0660 36 mer Sense Strand AAGGACCAGAUUGCUUACUAGCAG CCGAAAGGCUGC 1559
    MARC1-0965 36 mer Sense Strand AGAACGAAAGUUAUAUGGAAGCAG CCGAAAGGCUGC 1560
    MARC1-0966 36 mer Sense Strand GAACGAAAGUUAUAUGGAAAGCAG CCGAAAGGCUGC 1561
    MARC1-0967 36 mer Sense Strand AACGAAAGUUAUAUGGAAAAGCAG CCGAAAGGCUGC 1562
    MARC1-0969 36 mer Sense Strand CGAAAGUUAUAUGGAAAAUAGCAG CCGAAAGGCUGC 1563
    MARC1-1177 36 mer Sense Strand AAUUUGUGAUUUUCACAUUAGCAG CCGAAAGGCUGC 1564
    MARC1-1884 36 mer Sense Strand UUGUUUAAAACCCAAUAUCAGCAG CCGAAAGGCUGC 1565
    MARC1-1885 36 mer Sense Strand UGUUUAAAACCCAAUAUCUAGCAG CCGAAAGGCUGC 1566
    MARC1-1955 36 mer Sense Strand UGCCAUUUUGUCCUUUGAUAGCAG CCGAAAGGCUGC 1567
    MARC1-1983 36 mer Sense Strand AAGUUGACUAAACUUGAAAAGCAG CCGAAAGGCUGC 1568
    MARC1-1986 36 mer Sense Strand UUGACUAAACUUGAAAAAUAGCAG CCGAAAGGCUGC 1569
    MARC1-2011 36 mer Sense Strand AAAACUGUGAAUAAAUGGAAGCAG CCGAAAGGCUGC 1570
    MARC1-1113 36 mer Sense Strand CGAGCAAGCACUAUAUGGAAGCAG CCGAAAGGCUGC 1571
    MARC1-1575 36 mer Sense Strand AAGAAUGUUCCAGAAUGUUAGCAG CCGAAAGGCUGC 1572
    MARC1-0324 22 mer Anti-sense Strand UCAAGCCAAAACCUGUCCCGGG 1573
    MARC1-0326 22 mer Anti-sense Strand UCACAAGCCAAAACCUGUCCGG 1574
    MARC1-0327 22 mer Anti-sense Strand UUCACAAGCCAAAACCUGUCGG 1575
    MARC1-0330 22 mer Anti-sense Strand UUGAUCACAAGCCAAAACCUGG 1576
    MARC1-0331 22 mer Anti-sense Strand UUUGAUCACAAGCCAAAACCGG 1577
    MARC1-0735 22 mer Anti-sense Strand UUAACUUUCUUCUCUAGCCUGG 1578
    MARC1-0736 22 mer Anti-sense Strand UUUAACUUUCUUCUCUAGCCGG 1579
    MARC1-0788 22 mer Anti-sense Strand UUGCAUAGACAUCGCAUCCUGG 1580
    MARC1-0863 22 mer Anti-sense Strand UUAAAAUGCAUCUGGAACAAGG 1581
    MARC1-1179 22 mer Anti-sense Strand UAAAAUGUGAAAAUCACAAAGG 1582
    MARC1-2012 22 mer Anti-sense Strand UUUCCAUUUAUUCACAGUUUGG 1583
    MARC1-2013 22 mer Anti-sense Strand UCUUCCAUUUAUUCACAGUUGG 1584
    MARC1-0661 22 mer Anti-sense Strand UGAGUAAGCAAUCUGGUCCUGG 1585
    MARC1-1869 22 mer Anti-sense Strand UACAACUGACAUAUGCUUUCGG 1586
    MARC1-1876 22 mer Anti-sense Strand UGUUUUAAACAACUGACAUAGG 1587
    MARC1-1886 22 mer Anti-sense Strand UUAGAUAUUGGGUUUUAAACGG 1588
    MARC1-2016 22 mer Anti-sense Strand UUAGCUUCCAUUUAUUCACAGG 1589
    MARC1-0413 22 mer Anti-sense Strand UAGUCAGGGUGUCACCAUCGGG 1590
    MARC1-0416 22 mer Anti-sense Strand UGAGAGUCAGGGUGUCACCAGG 1591
    MARC1-0622 22 mer Anti-sense Strand UAUUUGAUGAGGACGUCUCGGG 1592
    MARC1-0638 22 mer Anti-sense Strand UUCGGAACAAGUCUGCUAUUGG 1593
    MARC1-0657 22 mer Anti-sense Strand UAAGCAAUCUGGUCCUUGGGGG 1594
    MARC1-0660 22 mer Anti-sense Strand UAGUAAGCAAUCUGGUCCUUGG 1595
    MARC1-0965 22 mer Anti-sense Strand UUCCAUAUAACUUUCGUUCUGG 1596
    MARC1-0966 22 mer Anti-sense Strand UUUCCAUAUAACUUUCGUUCGG 1597
    MARC1-0967 22 mer Anti-sense Strand UUUUCCAUAUAACUUUCGUUGG 1598
    MARC1-0969 22 mer Anti-sense Strand UAUUUUCCAUAUAACUUUCGGG 1599
    MARC1-1177 22 mer Anti-sense Strand UAAUGUGAAAAUCACAAAUUGG 1600
    MARC1-1884 22 mer Anti-sense Strand UGAUAUUGGGUUUUAAACAAGG 1601
    MARC1-1885 22 mer Anti-sense Strand UAGAUAUUGGGUUUUAAACAGG 1602
    MARC1-1955 22 mer Anti-sense Strand UAUCAAAGGACAAAAUGGCAGG 1603
    MARC1-1983 22 mer Anti-sense Strand UUUUCAAGUUUAGUCAACUUGG 1604
    MARC1-1986 22 mer Anti-sense Strand UAUUUUUCAAGUUUAGUCAAGG 1605
    MARC1-2011 22 mer Anti-sense Strand UUCCAUUUAUUCACAGUUUUGG 1606
    MARC1-1113 22 mer Anti-sense Strand UUCCAUAUAGUGCUUGCUCGGG 1607
    MARC1-1575 22 mer Anti-sense Strand UAACAUUCUGGAACAUUCUUGG 1608
    MARC1-0324 36 mer Sense Strand [mCs][mG][mG][mG][mA][mC][mA][fG] [fG][fU][fU][mU][mU][mG][mG][mC][m U][mU][mG][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1609
    MARC1-0326 36 mer Sense Strand [mGs|[mG|[mA|[mC|[mA|[mG|[mG|[fU| [fU][fU][fU][mG][mG][mC][mU][mU][m G][mU][mG][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1610
    MARC1-0327 36 mer Sense Strand [mGs][mA][mC][mA][mG][mG][mU][fU] [fU][fU][fG][mG][mC][mU][mU][mG][m U][mG][mA] [mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA- 1611
    GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]
    MARC1-0330 36 mer Sense Strand [mAs][mG][mG][mU][mU][mU][mU][fG] [fG][fC][fU][mU][mG][mU][mG][mA][m U][mC][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1612
    MARC1-0331 36 mer Sense Strand [mGs][mG][mU][mU][mU][mU][mG][fG] [fC][fU][fU][mG][mU][mG][mA][mU][m C][mA][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG]mG]mC|[mU][mG][mC] 1613
    MARC1-0735 36 mer Sense Strand [mAs][mG][mG][mC][mU][mA][mG][fA] [fG][fA][fA][mG][mA][mA][mA][mG][m U][mU][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1614
    MARC1-0736 36 mer Sense Strand [mGs][mG][mC][mU][mA][mG][mA][fG] [fA][fA][fG][mA][mA][mA][mG][mU][m U][mA][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1615
    MARC1-0788 36 mer Sense Strand [mAs][mG][mG][mA][mU][mG][mC][fG] [fA][fU][fG][mU][mC][mU][mA][mU][m G][mC][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG]mG]mC|[mU][mG][mC] 1616
    MARC1-0863 36 mer Sense Strand [mUs][mU][mG][mU][mU][mC][mC][fA] [fG] [fA] [fU] [mG] [mC] [mA] [mU] [mU] [m U][mU][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc] [ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1617
    MARC1-1179 36 mer Sense Strand [mUs][mU][mU][mG][mU][mG][mA][fU] [fU] [fU] [fU] [mC] [mA] [mC] [mA] [mU] [m U][mU][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc] [ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1618
    MARC1-2012 36 mer Sense Strand [mAs][mA][mA][mC][mU][mG][mU][fG] [fA][fA][fU][mA][mA][mA][mU][mG][m G][mA][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1619
    MARC1-2013 36 mer Sense Strand [mAs][mA][mC][mU][mG][mU][mG][fA] [fA][fU][fA][mA][mA][mU][mG][mG][m A][mA][mG][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA- 1620
    GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]
    MARC1-0661 36 mer Sense Strand [mAs][mG][mG][mA][mC][mC][mA][fG] [fA][fU][fU][mG][mC][mU][mU][mA][m C][mU][mC][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1621
    MARC1-1869 36 mer Sense Strand [mGs][mA][mA][mA][mG][mC][mA][fU] [fA][fU][fG][mU][mC][mA][mG][mU][m U][mG][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG]mG]mC|[mU][mG][mC] 1622
    MARC1-1876 36 mer Sense Strand [mUs][mA][mU][mG][mU][mC][mA][fG] [fU][fU][fG][mU][mU][mU][mA][mA][m A][mA][mC][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1623
    MARC1-1886 36 mer Sense Strand [mGs][mU][mU][mU][mA][mA][mA][fA] [fC][fC][fC][mA][mA][mU][mA][mU][m C][mU][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1624
    MARC1-2016 36 mer Sense Strand [mUs][mG][mU][mG][mA][mA][mU][fA] [fA][fA][fU][mG][mG][mA][mA][mG][m C][mU][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG]mG]mC|[mU][mG][mC] 1625
    MARC1-0413 36 mer Sense Strand [mCs][mG][mA][mU][mG][mG][mU][fG] [fA][fC][fA][mC][mC][mC][mU][mG][m A][mC][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1626
    MARC1-0416 36 mer Sense Strand [mUs][mG][mG][mU][mG][mA [mC][fA] [fC][fC][fC][mU][mG][mA][mC][mU][m C][mU][mC][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc] [ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1627
    MARC1-0622 36 mer Sense Strand [mCs][mG][mA][mG][mA][mC][mG][fU] [fC][fC][fU][mC][mA][mU][mC][mA][m A][mA][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1628
    MARC1-0638 36 mer Sense Strand [mAs][mA][mU][mA][mG][mC][mA][fG] [fA][fC][fU][mU][mG][mU][mU][mC][m C][mG][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA- 1629
    GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]
    MARC1-0657 36 mer Sense Strand [mCs][mC][mC][mA][mA][mG][mG][fA] [fC][fC][fA][mG][mA][mU][mU][mG][m C][mU][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1630
    MARC1-0660 36 mer Sense Strand [mAs][mA][mG][mG][mA][mC][mC][fA] [fG][fA][fU][mU][mG][mC][mU][mU][m A][mC][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG]mG]mC|[mU][mG][mC] 1631
    MARC1-0965 36 mer Sense Strand [mAs][mG][mA][mA][mC][mG][mA][fA] [fA][fG][fU][mU][mA][mU][mA][mU][m G][mG][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1632
    MARC1-0966 36 mer Sense Strand [mGs][mA][mA][mC][mG][mA][mA][fA] [fG][fU][fU][mA][mU][mA][mU][mG][m G][mA][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1633
    MARC1-0967 36 mer Sense Strand [mAs][mA][mC][mG][mA][mA][mA][fG] [fU][fU][fA][mU][mA][mU][mG][mG][m A][mA][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG]mG]mC|[mU][mG][mC] 1634
    MARC1-0969 36 mer Sense Strand [mCs][mG][mA][mA][mA][mG][mU][fU] [fA][fU][fA][mU][mG][mG][mA][mA][m A][mA][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1635
    MARC1-1177 36 mer Sense Strand [mAs][mA][mU][mU][mU][mG][mU][fG] [fA][fU][fU][mU][mU][mC][mA][mC][m A][mU][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1636
    MARC1-1884 36 mer Sense Strand [mUs][mU][mG][mU][mU][mU][mA][fA] [fA][fA][fC][mC][mC][mA][mA][mU][m A][mU][mC][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1637
    MARC1-1885 36 mer Sense Strand [mUs][mG][mU][mU][mU][mA][mA][fA] [fA][fC][fC][mC][mA][mA][mU][mA][m U][mC][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA- 1638
    GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]
    MARC1-1955 36 mer Sense Strand [mUs][mG][mC][mC][mA][mU][mU][fU] [fU][fG][fU][mC][mC][mU][mU][mU][m G][mA][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1639
    MARC1-1983 36 mer Sense Strand [mAs][mA][mG][mU][mU][mG][mA][fC] [fU][fA][fA][mA][mC][mU][mU][mG][m A][mA][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG]mG]mC|[mU][mG][mC] 1640
    MARC1-1986 36 mer Sense Strand [mUs][mU][mG][mA][mC][mU][mA][fA] [fA][fC][fU][mU][mG][mA][mA][mA][m A][mA][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1641
    MARC1-2011 36 mer Sense Strand [mAs][mA][mA][mA][mC][mU][mG][fLJ] [fG][fA][fA][mU][mA][mA][mA][mU][m G][mG][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1642
    MARC1-1113 36 mer Sense Strand [mCs][mG][mA][mG][mC][mA][mA][fG] [fC][fA][fC][mU][mA][mU][mA][mU][m G][mG][mA][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG]mG]mC|[mU][mG][mC] 1643
    MARC1-1575 36 mer Sense Strand [mAs][mA][mG][mA][mA][mU][mG][fU] [fU][fC][fC][mA][mG][mA][mA][mU][m G][mU][mU][mA][mG][mC][mA][mG][m C][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC] 1644
    MARC1-0324 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fCs][fAs][fA][fG][mC][fC][mA][m A][fA][mA][mC][mC][fU][mG][mU][mC] [mC][mC][mGs][mGs][mG] 1645
    MARC1-0326 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fCs][fAs][fC][fA][mA][fG][mC][m C][fA][mA][mA][mA][fC][mC][mU][mG] [mU][mC][mCs][mGs][mG] 1646
    MARC1-0327 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fCs][fA][fC][mA][fA][mG][m C][fC][mA][mA][mA][fA][mC][mC][mU] [mG][mU][mCs][mGs][mG] 1647
    MARC1-0330 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fGs][fA][fU][mC][fA][mC][m A][fA][mG][mC][mC][fA][mA][mA][mA] [mC][mC][mUs][mGs][mG] 1648
    MARC1-0331 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fUs][fG][fA][mU][fC][mA][m C][fA][mA][mG][mC][fC][mA][mA][mA] [mA][mC][mCs] mGs][mG] 1649
    MARC1-0735 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fAs][fA][fC][mU][fU][mU][m C][fU][mU][mC] mU][fC][mU][mA][mG] [mC][mC][mUs][mGs][mG] 1650
    MARC1-0736 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fUs][fA][fA][mC][fU][mU][m U][fC][mU][mU][mC][fU][mC][mU][mA] [mG][mC][mCs][mGs][mG] 1651
    MARC1-0788 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fGs][fC][fA][mU][fA][mG][m A][fC][mA][mU][mC][fG][mC][mA][mU] [mC][mC][mUs][mGs][mG] 1652
    MARC1-0863 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fAs][fA][fA][mA][fU][mG][m C][fA] [mU][mC][mU][fG][mG][mA][mA] [mC][mA][mAs][mGs][mG] 1653
    MARC1-1179 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fAs][fAs][fA][fA][mU][fG][mU][m G][fA][mA][mA][mA][fU][mC][mA][mC] [mA][mA][mAs][mGs][mG] 1654
    MARC1-2012 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fUs][fC][fC][mA][fU][mU][m U][fA][mU][mU][mC][fA][mC][mA][mG] [mU][mU][mUs][mGs][mG] 1655
    MARC1-2013 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fCs][fUs][fU][fC][mC][fA][mU][m U][fU][mA][mU][mU][fC][mA][mC][mA] [mG][mU][mUs][mGs][mG] 1656
    MARC1-0661 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fGs][fAs][fG][fU][mA][fA][mG][m C][fA][mA][mU][mC][fU][mG][mG][mU] [mC][mC][mUs][mGs][mG] 1657
    MARC1-1869 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fAs][fCs][fA][fA][mC][fU][mG][m A][fC][mA][mU][mA][fU][mG][mC][mU] [mU][mU][mCs][mGs][mG] 1658
    MARC1-1876 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fGs][fUs][fU][fU][mU][fA][mA][m A][fC][mA][mA][mC][fU][mG][mA][mC] [mA][mU][mAs][mGs][mG] 1659
    MARC1-1886 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fAs][fG][fA][mU][fA][mU][m U][fG][mG][mG][mU][fU][mU][mU][mA ][mA][mA][mCs][mGs][mG] 1660
    MARC1-2016 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fUs][fAs][fG][fC][mU][fU][mC][m C][fA][mU][mU][mU][fA][mU][mU][mC] [mA][mC][mAs][mGs][mG] 1661
    MARC1-0413 22 mer Anti-sense Strand [MePhosphonate-40-mUs][fAs][fGs][fU][fC][mA][fG][mG][m 1662
    G][fU][mG][mU][mC][fA][mC][mC][mA] [mU][mC][mGs][mGs][mG]
    MARC1-0416 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fGs][fAs][fG][fA][mG][fU][mC][m A][fG][mG][mG][mU][fG][mU][mC][mA ][mC][mC][mAs][mGs][mG] 1663
    MARC1-0622 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fAs][fUs][fU][fU][mG][fA][mU][m G][fA][mG][mG][mA][fC][mG][mU][mC] [mU][mC][mGs][mGs][mG] 1664
    MARC1-0638 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fUs][fCs][fG][fG][mA][fA][mC][m A][fA][mG][mU][mC][fU][mG][mC][mU] [mA][mU][mUs][mGs][mG] 1665
    MARC1-0657 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fAs][fAs][fG][fC][mA][fA][mU][m C][fU][mG][mG][mU][fC][mC][mU][mU] [mG][mG][mGs][mGs][mG] 1666
    MARC1-0660 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fAs][fGs][fU][fA][mA][fG][mC][m A][fA][mU][mC][mU][fG][mG][mU][mC] [mC][mU][mUs][mGs][mG] 1667
    MARC1-0965 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fUs][fCs][fC][fA][mU][fA][mU][m A][fA][mC][mU][mU][fU][mC][mG][mU] [mU][mC][mUs][mGs][mG] 1668
    MARC1-0966 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fUs][fUs][fC][fC][mA][fU][mA][m U][fA][mA][mC][mU][fU][mU][mC][mG] [mU][mU][mCs][mGs][mG] 1669
    MARC1-0967 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fUs][fUs][fU][fC][mC][fA][mU][m A][fU][mA][mA][mC][fU][mU][mU][mC] [mG][mU][mUs][mGs][mG] 1670
    MARC1-0969 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fAs][fUs][fU][fU][mU][fC][mC][m A][fU][mA][mU][mA][fA][mC][mU][mU ][mU][mC][mGs][mGs][mG] 1671
    MARC1-1177 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fAs][fAs][fU][fG][mU][fG][mA][m A][fA][mA][mU][mC][fA][mC][mA][mA] [mA][mU][mUs][mGs][mG] 1672
    MARC1-1884 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fGs][fAs][fU][fA][mU][fU][mG][m G][fG][mU][mU][mU][fU][mA][mA][mA ][mC][mA][mAs][mGs][mG] 1673
    MARC1-1885 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fAs][fGs][fA][fU][mA][fU][mU][m G][fG][mG][mU][mU][fU][mU][mA][mA ][mA][mC][mAs][mGs][mG] 1674
    MARC1-1955 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fAs][fUs][fC][fA][mA][fA][mG][m G][fA][mC][mA][mA][fA][mA][mU][mG ][mG][mC][mAs][mGs][mG] 1675
    MARC1-1983 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fUs][fUs][fU][fC][mA][fA][mG][m U][fU][mU][mA][mG][fU][mC][mA][mA ][mC][mU][mUs][mGs][mG] 1676
    MARC1-1986 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fAs][fUs][fU][fU][mU][fU][mC][m A][fA][mG][mU][mU][fU][mA][mG][mU ][mC][mA][mAs][mGs][mG] 1677
    MARC1-2011 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fUs][fCs][fC][fA][mU][fU][mU][m A][fU][mU][mC][mA][fC][mA][mG][mU] [mU][mU][mUs][mGs][mG] 1678
    MARC1-1113 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fUs][fC][fC][fA][mU][fA][mU][mA ][fG][mU][mG][mC][fU][mU][mG][mC][ mU][mC][mGs][mGs][mG] 1679
    MARC1-1575 22 mer Anti-sense Strand [MePhosphonate-4O-mUs][fAs][fA][fC][fA][mU][fU][mC][mU ][fG][mG][mA][mA][fC][mA][mU][mU][ mC][mU][mUs][mGs][mG] 1680
    Stem Loop GCAGCCGAAAGGCUGC 1681
    MARC1 cDNA plasmid GACGGATCGGGAGATCTCCCGATCC CCTATGGTCGACTCTCAGTACAATC TGCTCTGATGCCGCATAGTTAAGCC AGTATCTGCTCCCTGCTTGTGTGTTG GAGGTCGCTGAGTAGTGCGCGAGCA AAATTTAAGCTACAACAAGGCAAGG CTTGACCGACAATTGCATGAAGAAT CTGCTTAGGGTTAGGCGTTTTGCGCT GCTTCGCGATGTACGGGCCAGATAT ACGCGTTGACATTGATTATTGACTA GTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATG GAGTTCCGCGTTACATAACTTACGG TAAATGGCCCGCCTGGCTGACCGCC CAACGACCCCCGCCCATTGACGTCA ATAATGACGTATGTTCCCATAGTAA CGCCAATAGGGACTTTCCATTGACG TCAATGGGTGGAGTATTTACGGTAA ACTGCCCACTTGGCAGTACATCAAG TGTATCATATGCCAAGTACGCCCCC TATTGACGTCAATGACGGTAAATGG CCCGCCTGGCATTATGCCCAGTACA TGACCTTATGGGACTTTCCTACTTGG CAGTACATCTACGTATTAGTCATCG CTATTACCATGGTGATGCGGTTTTG GCAGTACATCAATGGGCGTGGATAG CGGTTTGACTCACGGGGATTTCCAA GTCTCCACCCCATTGACGTCAATGG GAGTTTGTTTTGGCACCAAAATCAA CGGGACTTTCCAAAATGTCGTAACA ACTCCGCCCCATTGACGCAAATGGG CGGTAGGCGTGTACGGTGGGAGGTC TATATAAGCAGAGCTCTCTGGCTAA 1682
    CTAGAGAACCCACTGCTTACTGGCT TATCGAAATTAATACGACTCACTAT AGGGAGACCCAAGCTGGCTAGCGTT TAAACTTAAGCTTACAGCGCCCTGC AGCGCAGGCGACGGAAGGTTGCAG AGGCAGTGGGGCGCCGACCAAGTG GAAGCTGAGCCACCACCTCCCACTC CCCGCGCCGCCCCCCAGAAGGACGC ACTGCTCTGATTGGCCCGGAAGGGT TCAGGAGCTGCCCAGCCTTTGGGCT CGGGGCCAAAGGCCGCACCTTCCCC CAGCGGCCCCGGGCGACCAGCGCGC TCCGGCCTTGCCGCCGCCACCTCGC GGAGAAGCCAGCCATGGGCGCCGC CGGCTCCTCCGCGCTGGCGCGCTTT GTCCTCCTCGCGCAATCCCGGCCCG GGTGGCTCGGGGTTGCCGCGCTGGG CCTGACCGCGGTGGCGCTGGGGGCT GTCGCCTGGCGCCGCGCATGGCCCA CGCGGCGCCGGCGGCTGCTGCAGCA GGTGGGCACAGTGGCGCAGCTCTGG ATCTACCCTGTGAAATCCTGCAAGG GGGTGCCGGTGAGCGAGGCGGAGT GCACGGCCATGGGGCTGCGCAGCGG CAACCTGCGGGACAGGTTTTGGCTT GTGATCAACCAGGAGGGAAACATG GTTACTGCTCGCCAGGAACCTCGCC TGGTCCTGATTTCCCTGACCTGCGAT GGTGACACCCTGACTCTCAGTGCAG CCTACACAAAGGACCTACTACTGCC TATCAAAACGCCCACCACAAATGCA GTGCACAAGTGCAGAGTGCACGGCC TGGAGATAGAGGGCAGGGACTGTG GCGAGGCCACCGCCCAGTGGATAAC CAGCTTCCTGAAGTCACAGCCCTAC CGCCTGGTGCACTTCGAGCCTCACA TGCGACCGAGACGTCCTCATCAAAT AGCAGACTTGTTCCGACCCAAGGAC CAGATTGCTTACTCAGACACCAGCC CATTCTTGATCCTTTCTGAGGCGTCG CTGGCGGATCTCAACTCCAGGCTAG AGAAGAAAGTTAAAGCAACCAACTT CAGGCCCAATATTGTAATTTCAGGA TGCGATGTCTATGCAGAGGTAACAC TATGCCCCTTTGGATCTTTCCTTGGA TTTGACTTCTTTTTTAAGGATTCTTG GGATGAGCTTCTTATTGGTGACGTG GAACTGAAAAGGGTGATGGCTTGTT CCAGATGCATTTTAACCACAGTGGA CCCAGACACCGGTGTCATGAGCAGG AAGGAACCGCTGGAAACACTGAAG AGTTATCGCCAGTGTGACCCTTCAG AACGAAAGTTATATGGAAAATCACC ACTCTTTGGGCAGTATTTTGTGCTGG AAAACCCAGGGACCATCAAAGTGG
    GAGACCCTGTGTACCTGCTGGGCCA GTAATGGGAACCGTATGTCCTGGAA TATTAGATGCCTTTTAAAAATGTTCT CAAAAATGACAACACTTGAAGCATG GTGTTTCAGAACTGAGACCTCTACA TTTTCTTTAAATTTGTGATTTTCACA TTTTTCGTCTTTTGGACTTCTGGTGT CTCAATGCTTCAATGTCCCAGTGCA AAAAGTAAAGAAATATAGTCTCAAT AACTTAGTAGGACTTCAGTAAGTCA CTTAAATGACAAGACAGGATTCTGA AAACTCCCCGTTTAACTGATTATGG AATAGTTCTTTCTCCTGCTTCTCCGT TTATCTACCAAGAGCGCAGACTTGC ATCCTGTCACTACCACTCGTTAGAG AAAGAGAAGAAGAGAAAGAGGAAG AGTGGGTGGGCTGGAAGAATATCCT AGAATGTGTTATTGCCCCTGTTCATG AGGTACGCAATGAAAATTAAATTGC ACCCCAAATATGGCTGGAATGCCAC TTCCCTTTTCTTCTCAAGCCCCGGGC TAGCTTTTGAAATGGCATAAAGACT GAGGTGACCTTCAGGAAGCACTGCA GATATTAATTTTCCATAGATCTGGAT CTGGCCCTGCTGCTTCTCAGACAGC ATTGGATTTCCTAAAGGTGCTCAGG AGGATGGTTGTGTAGTCATGGAGGA CCCCTGGATCCTTGCCATTCCCCTCA GCTAATGACGGAGTGCTCCTTCTCC AGTTCCGGGTGAAAAAGTTCTGAAT TCTGTGGAGGAGAAGAAAAGTGATT CAGTGATTTCAGATAGACTACTGAA AACCTTTAAAGGGGGAAAAGGAAA GCATATGTCAGTTGTTTAAAACCCA ATATCTATTTTTTAACTGATTGTATA ACTCTAAGATCTGATGAAGTATATT TTTTATTGCCATTTTGTCCTTTGATT ATATTGGGAAGTTGACTAAACTTGA AAAATGTTTTTAAAACTGTGAATAA ATGGAAGCTACTTTGACTAGTTTCA GAGCGGCCGCTCGAGTCTAGAGGGC CCGTTTAAACCCGCTGATCAGCCTC GACTGTGCCTTCTAGTTGCCAGCCA TCTGTTGTTTGCCCCTCCCCCGTGCC TTCCTTGACCCTGGAAGGTGCCACT CCCACTGTCCTTTCCTAATAAAATG AGGAAATTGCATCGCATTGTCTGAG TAGGTGTCATTCTATTCTGGGGGGT GGGGTGGGGCAGGACAGCAAGGGG GAGGATTGGGAAGACAATAGCAGG CATGCTGGGGATGCGGTGGGCTCTA TGGCTTCTGAGGCGGAAAGAACCAG CTGGGGCTCTAGGGGGTATCCCCAC GCGCCCTGTAGCGGCGCATTAAGCG CGGCGGGTGTGGTGGTTACGCGCAG
    CGTGACCGCTACACTTGCCAGCGCC CTAGCGCCCGCTCCTTTCGCTTTCTT CCCTTCCTTTCTCGCCACGTTCGCCG GCTTTCCCCGTCAAGCTCTAAATCG GGGGCTCCCTTTAGGGTTCCGATTT AGTGCTTTACGGCACCTCGACCCCA AAAAACTTGATTAGGGTGATGGTTC ACGTAGTGGGCCATCGCCCTGATAG ACGGTTTTTCGCCCTTTGACGTTGGA GTCCACGTTCTTTAATAGTGGACTCT TGTTCCAAACTGGAACAACACTCAA CCCTATCTCGGTCTATTCTTTTGATT TATAAGGGATTTTGGGGATTTCGGC CTATTGGTTAAAAAATGAGCTGATT TAACAAAAATTTAACGCGAATTAAT TCTGTGGAATGTGTGTCAGTTAGGG TGTGGAAAGTCCCCAGGCTCCCCAG GCAGGCAGAAGTATGCAAAGCATG CATCTCAATTAGTCAGCAACCAGGT GTGGAAAGTCCCCAGGCTCCCCAGC AGGCAGAAGTATGCAAAGCATGCAT CTCAATTAGTCAGCAACCATAGTCC CGCCCCTAACTCCGCCCATCCCGCC CCTAACTCCGCCCAGTTCCGCCCATT CTCCGCCCCATGGCTGACTAATTTTT TTTATTTATGCAGAGGCCGAGGCCG CCTCTGCCTCTGAGCTATTCCAGAA GTAGTGAGGAGGCTTTTTTGGAGGC CTAGGCTTTTGCAAAAAGCTCCCGG GAGCTTGTATATCCATTTTCGGATCT GATCAAGAGACAGGATGAGGATCG TTTCGCATGATTGAACAAGATGGAT TGCACGCAGGTTCTCCGGCCGCTTG GGTGGAGAGGCTATTCGGCTATGAC TGGGCACAACAGACAATCGGCTGCT CTGATGCCGCCGTGTTCCGGCTGTC AGCGCAGGGGCGCCCGGTTCTTTTT GTCAAGACCGACCTGTCCGGTGCCC TGAATGAACTGCAGGACGAGGCAG CGCGGCTATCGTGGCTGGCCACGAC GGGCGTTCCTTGCGCAGCTGTGCTC GACGTTGTCACTGAAGCGGGAAGGG ACTGGCTGCTATTGGGCGAAGTGCC GGGGCAGGATCTCCTGTCATCTCAC CTTGCTCCTGCCGAGAAAGTATCCA TCATGGCTGATGCAATGCGGCGGCT GCATACGCTTGATCCGGCTACCTGC CCATTCGACCACCAAGCGAAACATC GCATCGAGCGAGCACGTACTCGGAT GGAAGCCGGTCTTGTCGATCAGGAT GATCTGGACGAAGAGCATCAGGGG CTCGCGCCAGCCGAACTGTTCGCCA GGCTCAAGGCGCGCATGCCCGACGG CGAGGATCTCGTCGTGACCCATGGC GATGCCTGCTTGCCGAATATCATGG
    TGGAAAATGGCCGCTTTTCTGGATT CATCGACTGTGGCCGGCTGGGTGTG GCGGACCGCTATCAGGACATAGCGT TGGCTACCCGTGATATTGCTGAAGA GCTTGGCGGCGAATGGGCTGACCGC TTCCTCGTGCTTTACGGTATCGCCGC TCCCGATTCGCAGCGCATCGCCTTCT ATCGCCTTCTTGACGAGTTCTTCTGA GCGGGACTCTGGGGTTCGAAATGAC CGACCAAGCGACGCCCAACCTGCCA TCACGAGATTTCGATTCCACCGCCG CCTTCTATGAAAGGTTGGGCTTCGG AATCGTTTTCCGGGACGCCGGCTGG ATGATCCTCCAGCGCGGGGATCTCA TGCTGGAGTTCTTCGCCCACCCCAA CTTGTTTATTGCAGCTTATAATGGTT ACAAATAAAGCAATAGCATCACAA ATTTCACAAATAAAGCATTTTTTTCA CTGCATTCTAGTTGTGGTTTGTCCAA ACTCATCAATGTATCTTATCATGTCT GTATACCGTCGACCTCTAGCTAGAG CTTGGCGTAATCATGGTCATAGCTG TTTCCTGTGTGAAATTGTTATCCGCT CACAATTCCACACAACATACGAGCC GGAAGCATAAAGTGTAAAGCCTGG GGTGCCTAATGAGTGAGCTAACTCA CATTAATTGCGTTGCGCTCACTGCCC GCTTTCCAGTCGGGAAACCTGTCGT GCCAGCTGCATTAATGAATCGGCCA ACGCGCGGGGAGAGGCGGTTTGCGT ATTGGGCGCTCTTCCGCTTCCTCGCT CACTGACTCGCTGCGCTCGGTCGTT CGGCTGCGGCGAGCGGTATCAGCTC ACTCAAAGGCGGTAATACGGTTATC CACAGAATCAGGGGATAACGCAGG AAAGAACATGTGAGCAAAAGGCCA GCAAAAGGCCAGGAACCGTAAAAA GGCCGCGTTGCTGGCGTTTTTCCATA GGCTCCGCCCCCCTGACGAGCATCA CAAAAATCGACGCTCAAGTCAGAGG TGGCGAAACCCGACAGGACTATAAA GATACCAGGCGTTTCCCCCTGGAAG CTCCCTCGTGCGCTCTCCTGTTCCGA CCCTGCCGCTTACCGGATACCTGTC CGCCTTTCTCCCTTCGGGAAGCGTG GCGCTTTCTCAATGCTCACGCTGTA GGTATCTCAGTTCGGTGTAGGTCGT TCGCTCCAAGCTGGGCTGTGTGCAC GAACCCCCCGTTCAGCCCGACCGCT GCGCCTTATCCGGTAACTATCGTCTT GAGTCCAACCCGGTAAGACACGACT TATCGCCACTGGCAGCAGCCACTGG TAACAGGATTAGCAGAGCGAGGTAT GTAGGCGGTGCTACAGAGTTCTTGA AGTGGTGGCCTAACTACGGCTACAC
    TAGAAGGACAGTATTTGGTATCTGC GCTCTGCTGAAGCCAGTTACCTTCG GAAAAAGAGTTGGTAGCTCTTGATC CGGCAAACAAACCACCGCTGGTAGC GGTGGTTTTTTTGTTTGCAAGCAGCA GATTACGCGCAGAAAAAAAGGATCT CAAGAAGATCCTTTGATCTTTTCTAC GGGGTCTGACGCTCAGTGGAACGAA AACTCACGTTAAGGGATTTTGGTCA TGAGATTATCAAAAAGGATCTTCAC CTAGATCCTTTTAAATTAAAAATGA AGTTTTAAATCAATCTAAAGTATAT ATGAGTAAACTTGGTCTGACAGTTA CCAATGCTTAATCAGTGAGGCACCT ATCTCAGCGATCTGTCTATTTCGTTC ATCCATAGTTGCCTGACTCCCCGTC GTGTAGATAACTACGATACGGGAGG GCTTACCATCTGGCCCCAGTGCTGC AATGATACCGCGAGACCCACGCTCA CCGGCTCCAGATTTATCAGCAATAA ACCAGCCAGCCGGAAGGGCCGAGC GCAGAAGTGGTCCTGCAACTTTATC CGCCTCCATCCAGTCTATTAATTGTT GCCGGGAAGCTAGAGTAAGTAGTTC GCCAGTTAATAGTTTGCGCAACGTT GTTGCCATTGCTACAGGCATCGTGG TGTCACGCTCGTCGTTTGGTATGGCT TCATTCAGCTCCGGTTCCCAACGAT CAAGGCGAGTTACATGATCCCCCAT GTTGTGCAAAAAAGCGGTTAGCTCC TTCGGTCCTCCGATCGTTGTCAGAA GTAAGTTGGCCGCAGTGTTATCACT CATGGTTATGGCAGCACTGCATAAT TCTCTTACTGTCATGCCATCCGTAAG ATGCTTTTCTGTGACTGGTGAGTACT CAACCAAGTCATTCTGAGAATAGTG TATGCGGCGACCGAGTTGCTCTTGC CCGGCGTCAATACGGGATAATACCG CGCCACATAGCAGAACTTTAAAAGT GCTCATCATTGGAAAACGTTCTTCG GGGCGAAAACTCTCAAGGATCTTAC CGCTGTTGAGATCCAGTTCGATGTA ACCCACTCGTGCACCCAACTGATCT TCAGCATCTTTTACTTTCACCAGCGT TTCTGGGTGAGCAAAAACAGGAAG GCAAAATGCCGCAAAAAAGGGAAT AAGGGCGACACGGAAATGTTGAAT ACTCATACTCTTCCTTTTTCAATATT ATTGAAGCATTTATCAGGGTTATTG TCTCATGAGCGGATACATATTTGAA TGTATTTAGAAAAATAAACAAATAG GGGTTCCGCGCACATTTCCCCGAAA AGTGCCACCTGACGTC
    MARC1 cDNA (XM_011509900 .3) ACAGCGCCCTGCAGCGCAGGCGACG GAAGGTTGCAGAGGCAGTGGGGCG CCGACCAAGTGGAAGCTGAGCCACC ACCTCCCACTCCCCGCGCCGCCCCC CAGAAGGACGCACTGCTCTGATTGG CCCGGAAGGGTTCAGGAGCTGCCCA GCCTTTGGGCTCGGGGCCAAAGGCC GCACCTTCCCCCAGCGGCCCCGGGC GACCAGCGCGCTCCGGCCTTGCCGC CGCCACCTCGCGGAGAAGCCAGCCA TGGGCGCCGCCGGCTCCTCCGCGCT GGCGCGCTTTGTCCTCCTCGCGCAA TCCCGGCCCGGGTGGCTCGGGGTTG CCGCGCTGGGCCTGACCGCGGTGGC GCTGGGGGCTGTCGCCTGGCGCCGC GCATGGCCCACGCGGCGCCGGCGGC TGCTGCAGCAGGTGGGCACAGTGGC GCAGCTCTGGATCTACCCTGTGAAA TCCTGCAAGGGGGTGCCGGTGAGCG AGGCGGAGTGCACGGCCATGGGGCT GCGCAGCGGCAACCTGCGGGACAG GTTTTGGCTTGTGATCAACCAGGAG GGAAACATGGTTACTGCTCGCCAGG AACCTCGCCTGGTCCTGATTTCCCTG ACCTGCGATGGTGACACCCTGACTC TCAGTGCAGCCTACACAAAGGACCT ACTACTGCCTATCAAAACGCCCACC ACAAATGCAGTGCACAAGTGCAGA GTGCACGGCCTGGAGATAGAGGGC AGGGACTGTGGCGAGGCCACCGCCC AGTGGATAACCAGCTTCCTGAAGTC ACAGCCCTACCGCCTGGTGCACTTC GAGCCTCACATGCGACCGAGACGTC CTCATCAAATAGCAGACTTGTTCCG ACCCAAGGACCAGATTGCTTACTCA GACACCAGCCCATTCTTGATCCTTTC TGAGGCGTCGCTGGCGGATCTCAAC TCCAGGCTAGAGAAGAAAGTTAAA GCAACCAACTTCAGGCCCAATATTG TAATTTCAGGATGCGATGTCTATGC AGAGGTAACACTATGCCCCTTTGGA TCTTTCCTTGGATTTGACTTCTTTTTT AAGGATTCTTGGGATGAGCTTCTTA TTGGTGACGTGGAACTGAAAAGGGT GATGGCTTGTTCCAGATGCATTTTA ACCACAGTGGACCCAGACACCGGTG TCATGAGCAGGAAGGAACCGCTGG AAACACTGAAGAGTTATCGCCAGTG TGACCCTTCAGAACGAAAGTTATAT GGAAAATCACCACTCTTTGGGCAGT ATTTTGTGCTGGAAAACCCAGGGAC CATCAAAGTGGGAGACCCTGTGTAC CTGCTGGGCCAGTAATGGGAACCGT ATGTCCTGGAATATTAGATGCCTTTT AAAAATGTTCTCAAAAATGACAACA 1683
    CTTGAAGCATGGTGTTTCAGAACTG AGACCTCTACATTTTCTTTAAATTTG TGATTTTCACATTTTTCGTCTTTTGG ACTTCTGGTGTCTCAATGCTTCAATG TCCCAGTGCAAAAAGTAAAGAAATA TAGTCTCAATAACTTAGTAGGACTT CAGTAAGTCACTTAAATGACAAGAC AGGATTCTGAAAACTCCCCGTTTAA CTGATTATGGAATAGTTCTTTCTCCT GCTTCTCCGTTTATCTACCAAGAGC GCAGACTTGCATCCTGTCACTACCA CTCGTTAGAGAAAGAGAAGAAGAG AAAGAGGAAGAGTGGGTGGGCTGG AAGAATATCCTAGAATGTGTTATTG CCCCTGTTCATGAGGTACGCAATGA AAATTAAATTGCACCCCAAATATGG CTGGAATGCCACTTCCCTTTTCTTCT CAAGCCCCGGGCTAGCTTTTGAAAT GGCATAAAGACTGAGGTGACCTTCA GGAAGCACTGCAGATATTAATTTTC CATAGATCTGGATCTGGCCCTGCTG CTTCTCAGACAGCATTGGATTTCCTA AAGGTGCTCAGGAGGATGGTTGTGT AGTCATGGAGGACCCCTGGATCCTT GCCATTCCCCTCAGCTAATGACGGA GTGCTCCTTCTCCAGTTCCGGGTGA AAAAGTTCTGAATTCTGTGGAGGAG AAGAAAAGTGATTCAGTGATTTCAG ATAGACTACTGAAAACCTTTAAAGG GGGAAAAGGAAAGCATATGTCAGTT GTTTAAAACCCAATATCTATTTTTTA ACTGATTGTATAACTCTAAGATCTG ATGAAGTATATTTTTTATTGCCATTT TGTCCTTTGATTATATTGGGAAGTTG ACTAAACTTGAAAAATGTTTTTAAA ACTGTGAATAAATGGAAGCTACTTT GACTAGTTTCAGA
    3′ Assay Forward Primer GCTTCTCAGACAGCATTGGA 1684
    3′ Assay Reverse Primer GAAGGAGCACTCCGTCATTAG 1685
    5′ Assay Forward Primer AGTCCCTGCCCTCTATCTC 1686
    5′ Assay reverse Primer CTACACAAAGGACCTACTACTGC 1687
    HPRT Forward Primer GACTTTGCTTTCCTTGGTCAG 1688
    HPRT Reverse Primer GGCTTATATCCAACACTTCGTGGG 1689
    NHP MARC1 Forward Primer GACCGAGACATCCTCACCAAA 1690
    NHP MARC1 Reverse Primer CCCAAGAATCCTCTGCATAGAC 1691
    MARC1 Human cDNA (NM_022746.4) CTTGCCGCCGCCACCTCGCGGAGAA GCCAGCCATGGGCGCCGCCGGCTCC TCCGCGCTGGCGCGCTTTGTCCTCCT CGCGCAATCCCGGCCCGGGTGGCTC GGGGTTGCCGCGCTGGGCCTGACCG CGGTGGCGCTGGGG 1692
    GCTGTCGCCTGGCGCCGCGCATGGC CCACGCGGCGCCGGCGGCTGCTGCA GCAGGTGGGCACAGTGGCGCAGCTC TGGATCTACCCTGTGAAATCCTGCA AGGGGGTGCCGGTGAGCGAGGCGG AGTGCACGGCCATGGG
    GCTGCGCAGCGGCAACCTGCGGGAC AGGTTTTGGCTTGTGATCAACCAGG AGGGAAACATGGTTACTGCTCGCCA GGAACCTCGCCTGGTCCTGATTTCC CTGACCTGCGATGGTGACACCCTGA CTCTCAGTGCAGCCT
    ACACAAAGGACCTACTACTGCCTAT CAAAACGCCCACCACAAATGCAGTG CACAAGTGCAGAGTGCACGGCCTGG AGATAGAGGGCAGGGACTGTGGCG AGGCCACCGCCCAGTGGATAACCAG CTTCCTGAAGTCACAG
    CCCTACCGCCTGGTGCACTTCGAGC CTCACATGCGACCGAGACGTCCTCA TCAAATAGCAGACTTGTTCCGACCC AAGGACCAGATTGCTTACTCAGACA CCAGCCCATTCTTGATCCTTTCTGAG GCGTCGCTGGCGGA
    TCTCAACTCCAGGCTAGAGAAGAAA GTTAAAGCAACCAACTTCAGGCCCA ATATTGTAATTTCAGGATGCGATGT CTATGCAGAGGATTCTTGGGATGAG CTTCTTATTGGTGACGTGGAACTGA AAAGGGTGATGGCTT
    GTTCCAGATGCATTTTAACCACAGT GGACCCAGACACCGGTGTCATGAGC AGGAAGGAACCGCTGGAAACACTG AAGAGTTATCGCCAGTGTGACCCTT CAGAACGAAAGTTATATGGAAAATC ACCACTCTTTGGGCAG
    TATTTTGTGCTGGAAAACCCAGGGA CCATCAAAGTGGGAGACCCTGTGTA CCTGCTGGGCCAGTAATGGGAACCG TATGTCCTGGAATATTAGATGCCTTT
    TAAAAATGTTCTCAAAAATGACAAC ACTTGAAGCATGGT
    GTTTCAGAACTGAGACCTCTACATT TTCTTTAAATTTGTGATTTTCACATT TTTCGTCTTTTGGACTTCTGGTGTCT CAATGCTTCAATGTCCCAGTGCAAA AAGTAAAGAAATATAGTCTCAATAA CTTAGTAGGACTT
    CAGTAAGTCACTTAAATGACAAGAC AGGATTCTGAAAACTCCCCGTTTAA CTGATTATGGAATAGTTCTTTCTCCT GCTTCTCCGTTTATCTACCAAGAGC GCAGACTTGCATCCTGTCACTACCA CTCGTTAGAGAAAG
    AGAAGAAGAGAAAGAGGAAGAGTG GGTGGGCTGGAAGAATATCCTAGAA TGTGTTATTGCCCCTGTTCATGAGGT ACGCAATGAAAATTAAATTGCACCC CAAATATGGCTGGAATGCCACTTCC CTTTTCTTCTCAAGC
    CCCGGGCTAGCTTTTGAAATGGCAT AAAGACTGAGGTGACCTTCAGGAAG CACTGCAGATATTAATTTTCCATAG ATCTGGATCTGGCCCTGCTGCTTCTC AGACAGCATTGGATTTCCTAAAGGT GCTCAGGAGGATGG
    TTGTGTAGTCATGGAGGACCCCTGG ATCCTTGCCATTCCCCTCAGCTAATG ACGGAGTGCTCCTTCTCCAGTTCCG GGTGAAAAAGTTCTGAATTCTGTGG AGGAGAAGAAAAGTGATTCAGTGA TTTCAGATAGACTAC
    TGAAAACCTTTAAAGGGGGAAAAG GAAAGCATATGTCAGTTGTTTAAAA CCCAATATCTATTTTTTAACTGATTG TATAACTCTAAGATCTGATGAAGTA TATTTTTTATTGCCATTTTGTCCTTTG ATTATATTGGGAA
    GTTGACTAAACTTGAAAAATGTTTT TAAAACTGTGAATAAATGGAAGCTA CTTTGACTAGTTTCAGATCTTACTAA CTTCTTGGCACAAAGTTAGACTGTG AAAGCTGACTGAGGCTGGGCACAG GGGCTCATGCCTGTA
    ATTCCAGCACTTTGGGAGGCCAAGG TGGGAGAATGGCTTGAGCCCAGGAG
    TTTGAGACCAGCCCAGAAAATATAA TGGGATCCTGTCGCTACAAAATGTT TTTAAAATGCACTCGGTGTGGTGGT GTGTGCCTGCAGTCC
    TGGCTATGGCTACTCGGGAGGATGA GGTAGAAGGATTGGTTGAGCCCAGG AGCGGGAGATTGAGGCTGCAGTGA GTTATGATTGCACCACTACACTCCA GCCTGAGTGATAGAGTGAGACCCTA TCTCTAAAAAAGAAAC
    AGGAAAAAAAAAGAAAGCTGACTG AGGTGAATGGGCAAAGCCAGTAATT CTGACACCTGACCACAGCTGGGTCT TCTGCATAATGGACCTCCTCACCCA CAGCCTCCCAGGCAAGCACCCATGT TTGAAGGACTATCAAG
    TCAACATGCTTTTTACCAAAAGCTG CACATTTTTCACTTTGATTTTATAAA AGAGGTCAGTAATCGCTGAAATCTA GCTGAGCCCTGAAGTAAAGTTCTGA GCAAAGAGGTGCATGTGCTTGTTTT ATGGTTGGTGAATT
    ATTACAGTTTGTTTTCTGCATGCTTG GCATGAGGTGAATAATTACATCAAT TTTCCAGAGAACCTGGGCCATCACC TTCCCCAACAAGTCCAGTTGATGTT GAAACTACAGATAGATTGAGACAA AGCGAAGTGTTCAGC
    AAGTAGCATTACTAATGGGACCGGG GGACCCGTGGGAGAGTGAGTGTACA CAGGATTTAGGAAACCATGTGAATA TGGGCTCTCTGGGAATAGCCAATAG GTAGGGAGCAATCAGAAACCCAAG GTTTGGTGGCTCTTCC
    TAGGTATTTATAATTAGTGGCAAGT GAAAGCCTTAGTCCTGAATTTCTAA CCACTTGTAAGAACTAACAGCCACT TCTCTGTGCCCCGTCCGGGCAGTAA CCATCATTCTCCATGGACAGGCTCT CGGGGTAGCTAGCTC
    TGCAGGGCAGCACCCACGTGGAAG GGAGCACCCAGAAACCCTCCTCACT GGGCAGACCTGTCCTTCTGTGCCTC ACAGTGTGAGGAAGATTCCTGTTTG AAGAGAGAAGTTCCAGTGACCTCTA GAATCTCAGAGTAGTT
    GCCAAGCTTTCTGTCAGTGAGATTT AAAGGCCATTTACTTGTGTTTATTTT ATATTTAATGAGTTGGTTAATGCCA GAGACAAAGCTGATATCCCATTTAT TTTGGATACTGAGCATTTGCACACT ATTCCACTTGAAAT
    ATAGAATCAGGAATGTAGGCCATCC CAGACTTTCAGATCTTACAACAGCA AATGACAGATGTTTGAGATCAGGCC AAAATATCCACCCTCGGTGGGCATC TCCTCTGTGTGGCAACTTATGCTGCA GCCACAGTGGGGAG
    TCACAAACTCAGAGCTGGAGGTCTT GAAAAGGACAATGTGGGCCAGGCT CCGGAGGGGCTGCCTAAAGGCTTGC TTTTGTGACTCTCCTGCAGAAAATGT TAGAAACTTCCAACCGAAAGACGAG GGCAGCAACTTATAC
    ACACGAAGGCAGAAAGAAATTGGG GAAGGGGAGGCTGTTGGAATTCAGG CCGTTGTCCTATAGGGAGAAATACT CCTCCTCTCCTTCTCCCTTTACTGAT AACGGGGCATGGTGAGGAGATGAG CTTGTGAGGGTCTGCC
    AGTTTGGTAAGAGTGCATGGGGAGG TTGGGTAAATTAGACTAGCCAAATG GGACTTCGGGAAACCATTTATGAGG CTGTCACCAACAGTGATGGCAGGCT GAAATTCCAGGCAAGTGCTCCCAGC ATTCCAAGAGTGTAT
    CAAATTAAAGCAACCCATGATGGTG GAGAACAGATACATTAAAGTTCCTT GAAAATGACAGAGTGGCTCTCAGAC CAGACCTTGATTGTGGGTATAATCG GAGTGTTGCTACCACACCCTAACAC TGCATTTCCCGTGTT
    TTATTGGTCCATGGAATTCTGAAAG TTTGCCTTTCGGGATGCTTCTAAAAA CAATTCCATGGACCAGTAAGTTTGG AAAGTCCTGCGTGCCTCACTTCTCTT CAAAGGCAAAAGGCTCTGGAGAGG CCTTCATGAAGACA
    TCTGTGTTTAATGCTGCCCTTCCCAA AGGTCTGTTTTTGACTGTCTTTTGAG AAATGATCCTCTGATCTCTAGGCAG AATGCCAGTGAGCCAAGGAATCCCA
    GTTAGCAGGAGGGGTGCACTCATGG GAAGACTGAAGAA
    GTTAAAAGTTCCCGCCAAGTGAAGG AGACCTATCTTGGGACACTTCCCCTT GTCCTCTCCCTTGCCCCTCTTGCTGG AGTAAAAGGATGGAACTGGGACTTG ATAGGTTAAAGGAGGTGTGGAGAA GTGTCTTAGACCAG
    CTCTCCTGTTGTGGGCCTTAGGGAG AAGCACTCTCTTTCTTCGGGATCATT TTCCAAACATGCATTTTTGGATGGA TAGGGTGGATCAGGGTGAGGGAAG GGAAACCAAACTCTCTCTAACCTTG CCCTTACAGCAATAC
    CTGTGATGTAAGTTACAAAACCACC TGTGATGAAAGTGCTCCAGGATGCT TCATGCACCAGGGAGGGGTGCCCTG TTTCTCTTCTGCTAGCTTCTCCTTTCT TTTTTTTTTTTCTTCTTTTTTTTGAGA CAGTGTCTCAC
    TCTGTTGCCAGGCTGGAGTGCAGTG GTGAGATCTCAGCTCACTGCAGCCT CTGCCTCCCAGGTTCAAGCAATTCTT CTGCCTCAGCCTCCCGAGTAGCTGG TGTGTCTGGAGTTGGTTCCTTCTGGT GGGTTCTTGGTCT
    CGCTGACTTCAAGAATGAAGCCACA GACCTTCGCAGTGAGTGTTACAGCT CTTAAAGGTGGCACGGACCCAAAGT GAGCAGTAGCAAGATTTATTGTGGA GAGCGAAAGAACAAAGCTTCGGAA GGGGACCCAAATGGGC
    TGCTGCTGCTGGCTGGGGTGGCCAC CTTTTATTCCCTTATTTGTCCCTGCC CATGTCCTGCTGATTGCTCCATTTTA CAGAGTGCTGATTGGTCCATTTTAC AGAGTGCTGATTGGTGCATTTACAA TCCTTTAGCTAGA
    CACAGAGTGCCGATTGGTGAGTTTT TACAGTGCTGATTGGTGCATTTACA ATCCTTTAGCTAGACACAGAACACT GACTGGTGCATTTATAATCCTCTAG CTAGAAAGAAAAGTTCTCCAAGTCC CCACTAGACCCAGGA
    AGTCCAGCTGGCTTCACCTCTCACT GGGACTACAGGTGCACACCACCACA
    CCCAGCTAATTTTTGTATTTTTAGTA GAGACGGGGTTTCACCATGTTGTTC AGGATGGTCTCGAACTCTTGATCTC GTGATCTGCCCGCC
    TCGGCCTCCCAAAGTGCTGGGATTA CAGTTGTGAGCCACCACGCCCGGCC CTAGCTTTTCCTTTCTGTTGCAAGTC CTCTCAACTAGTGTTGCCTTCCACCC TACAAAGCAGAATTACCTCAGAAGT CCTATGGCCCTGA
    CTCTATCTATGTCTGCACAAAGCAC TACTGTGCTTTGCTGTCTGCAAGAA CAGAGATTGTTTGCTTCAACCACTTT CTCTGAATGGATGAATGAGTTATGA TGATATCTAAAGTTACCCAATTTCA AGCAAGAGGAAGAA
    TCTGGCTCGGTACCACAGATGTTCTT GGAATTGGGATAGTAAAAAAGTCCC TGAGGCATCCCTTGGTCTGCTCTGA CCACACTCTCTTCACAGGAAGAGGC TTGGGCCACAGCTCTGACTATAACT CTGCTCTTCCTCCA
    AACACAGCTGAGGAATTGGGTGGTG GGGCACCTGCTCCCATGCTCTGTGG CCTGGCTCAGAGAGAAGAGTTGCCT TAATTACATTATTATTCTTCCTGGAC AGGCTGTAGGTTGTGTAAAGTAACA AAAAGGACTGAGAA
    GTGACTTCCCATTCAGCCTCTTCCAA GGCCATTTTTGATAGGCAGGTCAAA TTCACTCACATTTGGTTATTTGTTGG CCAGTCTAGTGCATTCACCCTTGCTG GTCCTCAGTCATGCTCCTTTACCTTT ACAGAGCATCCTAGACTGCTCTTCC TCTTACCTTCCTTGTGAAACCCACAA CCCCTAGTCCCTCCCCTTCCCTGGCA TTTGTTATGCCCTCTACCAATCCCTG ACCTGGTATTGGTCAGTCTCCAATC CTGGTGGATCCCTGTGGGAACTAAG TTAAGTCTAACTTTTGTCTCCCTCTT TAGAATTTACTGGGAGTACTGTAAA TAAACTATTGTTGTTATAATTATTTC TGATTAACATTTTTACACCTAACAA AGTCTCAGAGAGATTGAATTTACTG GGTTGAAGGGAGGAGCACCTTCCAC ATGACCTGCCCAGCAATTAAAGCCG
    CTTGTTAGTCCGAGGCCCAGGACGG CCGAGG
    ACAGCTGGAGAGCTCTTCGTTGCAG GCAGCTCTGGTTAACATCAACCGGG AAAGCTCTTTGTAAACACATGAATA ATTGATCGTCCAGCGCTCACATAGC TACCGCGGATCTGAGCCCGTATGAC TCATTTGCGAGCCAT
    TCCTGTCGTCTGGATGCCATAACATT GGAGGAATGATGATCGTTTCTTGGA GGTTCTTCTGTGGCCAGAGTTGCCA AGACCAAGGCTGTAATGGTTTGTTA TGATGACCTTTGTTATTCCATTAGGC TCAATTGCTTTAA
    AAAATGATGTGTGCATACTTTAGGA ACGTTTTTACCCTTTATGTTGACCTG ACATCATAGTTTATATTATAAAATG TATTAATGACAGAAGAGTGTTTTCA TGTCCCAAGGACAAATTTTAACAAC CATAATCTGCCCTC
    AGTCATCATAAATATAAATGTATTG GTCAAACAGATCTCGTTAATGTGGC CAAGATAAATGCAAGTCTATATTTT AAGGCAGTCGAAGTCCTAGAGAATA TATCTGGAGCTTTTGTGGGGCTAAG AGATCTTGTATATAT
    GCTATCAAAAGGCTGAGAAAATTAA CATGTTCCCCCCTCTGATTTTGCATT GGACAGATATAAATGTCTTGGGGAT GTCAAGTAAGATTGTTCACATAGTT TCTGGACACCATTAATGCCTGATGG GGTGAATCTTAGTT
    CTTAAAGCTATATTCTGCTCATTATG CTCACAGGGCTTTTGAAAAGAGAAC AAAATAAAGATTTCAAGTCTTAGCA A
    MARC1 Macaca fascicularis cDNA (XM_005540898 .2) AAAAAAAAAGTGGTAAGTGAGCTG TAGCCCTGGGTAAATTCTGGAAGTG ATGAAATGGAAGAATCAGAACTTTA AAGTCAACCATTAAAATAGGGGAGC CATTTTTTCCTCTTAAATTTTCAAAG AGGAATTCAGGAGGG 1693
    AGATAAACAGAAACACATATTTGGT GCCCCGGAGCTGCCTTTCCGAGGAG GATCAAGTGGTACGTCCTGCGGAGC TGTGTCCTTTACAGACAGGGTGTGA
    CCTGGGGTTGGAAGAGAAGAGAAG AGAGCAGAAAAGCAGG
    ACAGATAAGTGTTCAGGCCAGTAAA GACAGAGCCTCCCTGAGCACGGAAC TGCTCTGCAGTGAGTTGCCATCTGG AGGAGAGGGTTGTTCTTTTCTCTTGG CGAACTCCCGCTTCTCTCTTCCAAGG CACCCTTGCCCTG
    CATGGACAATTCTGGCTGAGTCTTG AAATGTACACTCCTGGCTCAGGGGA CCATGGCTGAGCTGCGGATGACACA GGCTCTCGACCAAACTTCAGTCTCC TCTGAGCCCTTTTCTTCGTGAGGCCT TGACCTTGCCACCC
    TACTCCCTGCAGAGCCCAGTTTAGC AAGAATCCTGCTTAGTCAGTTTCCA GAGTATTCTCCCATCCTTGATATCTG ATCATCCTTGATATCTGCTCAGATTC CTCATCTGTCACCCTCAGTGTGTAA GTCCTTGCCTAGT
    TCAGTAGAATCCTGTTAAGTGGGTT TATCAAGAATCCTCTACACTTGATG TCTCCTCTTAGAGATTTTTCATTCAC TGACCCCCAGGAACTTTGCTCTTTG GCTATAAACCCCCAGCAGTCTTCGC TGTAATACAGAGCT
    GAGCCTAATCTCTTTCCCCTATTGTG ATGCCCCTGTTACAATAGCCGTGAA TAGTCTTCCTTACCTTTTTAATAAGC GTTTGAGTAATTTTTTCCTTTGATAG CTTGGTACATCAAACAGGAGCCTGA CTCCTAAACCAT
    GCTGTTCGGGTGTGCTGATATTGTTG ACTGGAATATAACCTGATTTGGAAG TGACAAGTGACTGAGGTGAGTGCCT GCAGGACCAGGTGACATTCCCTCCC GCCAGAAGCAGCCTGGGGACCTTGT GCAGTGCTGAACTT
    CTGAGCCAAGGCCTTGCCAATGCAG CTGCAGCTGAGGCTCCCCGCCGGGA GCGTAGAAGGCGCTCTCAGACGCCC ATTGCCGCTCCGAACTGCCGCTGGG AGAACTCTGGCCTTGTCTCGCTGGC GCAGAGGGCCTGGTA
    GCATCCTCCTCCACCAGACCCCCAC TCTTTGGAACCTCCCTAAACCCTGG
    GCAGCCTGCGGGGACGGCGGCCGC AGCAGAGAGCTGGACACTGCGCAG GCCAGGCAGGGCCAACCCGCTCTCT ACTATTCCTGGGAGAAG
    CTGCTGCCCGCTGTCTGATTTTTAAT TTCAAAATCACGCTTTGTCCTGCAA ATGTTGTCTATTGTTTATTTTAGGTC AAATAACCCCATAAATACGTAAGTA AATAAACTGGTCACTTGCAGAGATC GTGGGGGAGGGCACGGCGCCCTGA GCTGCAGGCGACGGAAGGTTGCAG AAGCCATGGGGCGCAGACCAAGTG GAAGCTGAGCCGCCACCTCCCACTC CCCGCGCCGCCCCCCAAAAGGACGC ACTGCTCTGATTGGCCCGGAAGGGT TTGGGAACTGCCCACCCTTTGGGCT CAGGGCCAAAGGCCGCACCTTCCCC CAGCTGCCCGGGGCTACCAGCGCGC TGCGGCCTTGCCGCCGGCACCTCGC GGAGAAGCCAGCCATGGGCGCCGC CGGTTCCTCCGCGCTGGCCGGC
    TTTGTCCTCCTCGCTCAGCCCCGGCC CGGGTGGCTCGGGGTCGCCGTGCTG GGACTGACCGCGGTGGCGCTGGGGG CTGTCGCCTGGCGCCGCGCATGGCC CACGCAGCGCCGGCGGCTGCTGCAG CAGGTGGGCACAGT
    GGCGCAGCTCTGGATCTACCCTGTG AAATCCTGCAAGGGGGTGCCAGTGA GCGAGGCCGAGTGCACTGCCATGGG GCTGCGCAGCGGCAACCTGCGGGAC AGGTTTTGGCTTGTGATCAACCAGG AGGGAAACATGGTTA
    CCGCTCGCCAGGAACCTCGCCTGGT CCTGATTTCCCTGACCTGTGATGGTG ACACCCTGACTCTCAGTGCAGCCTA CACAAAGGATCTACTACTGCCCATC AAAACGCCCACCACAAATGCAGTGC GCAAGTGCAGAGTC
    CATGGCCTGGAGATTGAGGGCAGAG ACTGTGGTGAGGCCGCCGCCCAGTG GATAACCAGCTTCCTGAAGTCACAG TCCTACCGCCTGGTGCACTTCGAGC CTCACATGCGACCGAGACATCCTCA CCAAATAGCAGACTT
    GTTCCGACCCAAGGACCAGATTGCT TACTCAGACACCAGCCCATTCATGA
    TCCTTTCTGAGGCGTCGCTAGCGGA TCTCAACTCCAGGCTAGAGAAGAAA GTTAAAGCAACCAACTTCAGGCCCA ATATTGTAATTTCAG
    GATGCGATGTCTATGCAGAGGTAAC GCTATGCCCCTTTGCATCTTTCCTTG GATTTGACTTCTTTTTTAAGGATTCT TGGGACGAGCTTCTTATTGGTGACG TGGAACTGAAAAGGTTGATGGCTTG TTCCAGATGCATT
    TTAACCACAGTGGACCCAGACACCG GCGTCATGAGCAGGAAGGAGCCGCT GGAAACACTGAAGAGTTATCGCCAG TGTGACCCTTCAGAACGAAAGTTAT ATGGAAAATCACCACTCTTTGGGCA GTATTTTGTGCTGGA
    AAACCCAGGGACCATCAAAGTGGG AGACCCTGTGTACCTGCTGGGCCAG TAATGGGAACTGTATGTCCTGGAAT ATTAGATGCCTTTAAAAAATGTTCT CAAAAATGACAACACTTGAAGCATG GTGTTTCAGAACTGAG
    ACCTCAACATTTTCTTTAAATTTGTG ATTTTCACATTTTTCCTCTTTTGGAC TTCTCGTGTCTCAATGCTTCAATGTC CCAGTGCACAAAGCAAAGAAATAT AGTCTTGATAACTTAGTAGGCTTTC AGTAAGACACTTAAGTGACAAGACA GGATTCTGAAAACTCCCTGTTTAAC TGATTATGGAATAGTTCTTTCTCCTG CTTTGCCATTTATCTACCAAGAGTGC AGACTTCCATCCTGTCACTACCACTC ATGAGGGAAAGAGAAGAAGAGAAA GAGGAAGAGTGGGTAGGCCAGAAG AATGTCCTAGAATGTGTTATTACCC CTGTGCATGAGGTATGCAATGAAAA TTAAATAGCTCCCCAAATATGGCTG GAATGTCACTTGCCTTTTCTTCTGAA GCCCCGGGCTAGCTTTTGAAATGGC ATGAAGACTGAGGTGACCTTCAGGA AGCACTTCAGATATTAATTTTCCATA GATCTGGATCTGGCCCCGCTGCTTCT CAGACAGCATTGGATTTCCTAAAGG TGCTCAGGAGGGTGGTTGTGTAGTC ACGGAGGACCCCTGGATCCTTGCCA TTCCCCTCAGCTAATGACTGAGTGC TCCTTCTCCAGTTCTGGGTGAAAA
    AGTTCTGAAGTCTGTGGAGGAGAAG AAAAGTGATTCAGTGATTTCAAATG GATACTGAAAACCTTTAAAGGGGGA AAAGGAAAGCGTATGTCAGTTGTTT AAAACCCAATATCTACTTTTTTAACT GATTGCATAACTCTAAGATCTGATG AAGTATATTTTTTATTGCCATTTTGT CCTTTGATTGTATTGGGAAGTTGACT AAACTTGAAAAATGTTTTTAAAACT GTGAATAAATGGAAGCTACTTTGAC TAGTT
    Probe CAGGAGGATG GTTGT 1694
    Probe CCACCACAAA TGCA 1695
    Probe GTCGCAAGCTTGCTGGT 1696
    • LIST OF EMBODIMENTS
  • 1. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 2. The RNAi oligonucleotide of embodiment 1, wherein the sense strand is 15 to 50 nucleotides in length.
  • 3. The RNAi oligonucleotide of embodiments 1 or 2, wherein the sense strand is 18 to 36 nucleotides in length.
  • 4. The RNAi oligonucleotide of any one of embodiments 1 to 3, wherein the antisense strand is 15 to 30 nucleotides in length.
  • 5. The RNAi oligonucleotide of any one of embodiments 1 to 4, wherein the antisense strand is 22 nucleotides in length and wherein antisense strand and the sense strand form a duplex region of at least 19 nucleotides in length, optionally at least 20 nucleotides in length.
  • 6. The RNAi oligonucleotide of any one of embodiments 1 to 5, wherein the region of complementarity is at least 19 contiguous nucleotides in length, optionally at least 20 nucleotides in length.
  • 7. The RNAi oligonucleotide of any one of embodiments 1 to 6, wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length.
  • 8. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand of 15 to 50 nucleotides in length and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 9. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand of 15 to 50 nucleotides in length and an antisense strand of 15 to 30 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 10. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand of 15 to 50 nucleotides in length and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 11. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand of 18 to 36 nucleotides in length and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 12. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand of 18 to 36 nucleotides in length and an antisense strand of 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 13. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand of 18 to 36 nucleotides in length and an antisense strand of 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 14. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand of 36 nucleotides in length and an antisense strand of 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 15. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand of 36 nucleotides in length and an antisense strand of 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region of at least 19 nucleotides in length, optionally 20 nucleotides in length, wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is 19 contiguous nucleotides in length, differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 16. A double stranded RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising:
    • (i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is selected from SEQ ID NOs: 385-768, and
    • (ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
  • 17. The RNAi oligonucleotide of embodiment 16, wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein S1 is complementary to S2, and wherein L forms a loop between S1 and S2 of 3-5 nucleotides in length.
  • 18. The RNAi oligonucleotide of any one of embodiments 7 and 13-17, wherein L is a triloop or a tetraloop.
  • 19. The RNAi oligonucleotide of embodiment 18, wherein L is a tetraloop.
  • 20. The RNAi oligonucleotide of embodiment 19, wherein the tetraloop comprises the sequence 5′-GAAA-3′.
  • 21. The RNAi oligonucleotide of any one of embodiments 18-20, wherein the S1 and S2 are 1-10 nucleotides in length and have the same length.
  • 22. The RNAi oligonucleotide of embodiment 21, wherein S1 and S2 are 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides in length.
  • 23. The RNAi oligonucleotide of embodiment 22, wherein S1 and S2 are 6 nucleotides in length.
  • 24. The RNAi oligonucleotide of any one of embodiments 18 to 23, wherein the stem-loop comprises the sequence 5′-GCAGCCGAAAGGCUGC-3′ (SEQ ID NO: 1681).
  • 25. The RNAi oligonucleotide of any one of embodiments 1-24, comprising a nicked tetraloop structure.
  • 26. The RNAi oligonucleotide of any one of embodiments 1-24, comprising a nick between the 3′ terminus of the sense strand and the 5′ terminus of the antisense strand.
  • 27. The RNAi oligonucleotide of any one of embodiments 1-26, wherein the antisense and sense strands are not covalently linked.
  • 28. The RNAi oligonucleotide of any one of embodiments 1 to 15 and 17-27, wherein the antisense strand comprises an overhang sequence of one or more nucleotides in length at the 3′ terminus.
  • 29. The RNAi oligonucleotide of any one of embodiments 16-28, wherein the overhang comprises purine nucleotides.
  • 30. The RNAi oligonucleotide of embodiment 29, wherein the 3′-overhang sequence is 2 nucleotides in length.
  • 31. The RNAi oligonucleotide of embodiment 30, wherein the 3′-overhang is selected from AA, GG, AG, and GA.
  • 32. The RNAi oligonucleotide of embodiment 31, wherein the overhang is GG or AA.
  • 33. The RNAi oligonucleotide of embodiment 31, wherein the overhang is GG.
  • 34. The RNAi oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises at least one modified nucleotide.
  • 35. The RNAi oligonucleotide of embodiment 34, wherein the modified nucleotide comprises a 2′-modification.
  • 36. The RNAi oligonucleotide of embodiment 35, wherein the 2′-modification is a modification selected from 2′-aminoethyl, 2′-fluoro, 2′-O-methyl, 2′-O-methoxyethyl, and 2′-deoxy-2′-fluoro- β -d-arabinonucleic acid.
  • 37. The RNAi oligonucleotide of any one of embodiments 34 to 36, wherein all nucleotides comprising the oligonucleotide are modified, optionally wherein the modification is a 2′-modification selected from 2′-fluoro and 2′-O-methyl.
  • 38. The RNAi oligonucleotide of any one of embodiments 34-37, wherein about 10-15%, 10%, 11%, 12%, 13%, 14%, or 15% of the nucleotides of the sense strand comprise a 2′ -fluoro modification.
  • 39. The RNAi oligonucleotide of any one of embodiments 34-38, wherein about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the antisense strand comprise a 2′-fluoro modification.
  • 40. The RNAi oligonucleotide of any one of embodiments 34-39, wherein about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the oligonucleotide comprise a 2′-fluoro modification
  • 41. The RNAi oligonucleotide of any one of embodiments 34-40, wherein the sense strand comprises 36 nucleotides with positions 1-36 from 5′ to 3′, wherein positions 8-11 comprise a 2′-fluoro modification.
  • 42. The RNAi oligonucleotide of any one of embodiments 34-41, wherein the antisense strand comprises 22 nucleotides with positions 1-22 from 5′ to 3′, and wherein positions 2, 3, 4, 5, 7, 10, and 14 comprise a 2′-fluoro modification.
  • 43. The RNAi oligonucleotide of any one of embodiments 34-42, wherein the remaining nucleotides comprise a 2′-O-methyl modification.
  • 44. The RNAi oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises at least one modified internucleotide linkage.
  • 45. The RNAi oligonucleotide of embodiment 44, wherein the at least one modified internucleotide linkage is a phosphorothioate linkage.
  • 46. The RNAi oligonucleotide of embodiment 45, wherein the antisense strand comprises a phosphorothioate linkage (i) between positions 1 and 2, and between positions 2 and 3; or (ii) between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4, wherein positions are numbered 1-4 from 5′ to 3′.
  • 47. The RNAi oligonucleotide of embodiment 45 or 64, wherein the antisense strand is 22 nucleotides in length, and wherein the antisense strand comprises a phosphorothioate linkage between positions 20 and 21 and between positions 21 and 22, wherein positions are numbered 1-22 from 5′ to 3′.
  • 48. The RNAi oligonucleotide of any one of embodiments 1-47, wherein the antisense strand comprises a phosphorylated nucleotide at the 5′ terminus, wherein the phosphorylated nucleotide is selected from uridine and adenosine.
  • 49. The RNAi oligonucleotide of embodiment 48, wherein the phosphorylated nucleotide is uridine.
  • 50. The RNAi oligonucleotide of any one of the preceding embodiments, wherein the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog.
  • 51. The RNAi oligonucleotide of embodiment 50, wherein the phosphate analog is oxymethylphosphonate, vinylphosphonate, or malonylphosphonate, optionally wherein the phosphate analog is a 4′-phosphate analog comprising 5′-methoxyphosphonate-4′-oxy.
  • 52. The RNAi oligonucleotide of any one of the preceding embodiments, wherein at least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands.
  • 53. The RNAi oligonucleotide of embodiment 42, wherein each targeting ligand comprises a carbohydrate, amino sugar, cholesterol, polypeptide, or lipid.
  • 54. The RNAi oligonucleotide of any one of embodiments 17-53, wherein the stem loop comprises one or more targeting ligands conjugated to one or more nucleotides of the stem loop.
  • 55. The RNAi oligonucleotide of embodiment 54, wherein the one or more targeting ligands is conjugated to one or more nucleotides of the loop.
  • 56. The RNAi oligonucleotide of embodiment 55, wherein the loop comprises 4 nucleotides numbered 1-4 from 5′ to 3′, wherein nucleotides at positions 2, 3, and 4 each comprise one or more targeting ligands, wherein the targeting ligands are the same or different.
  • 57. The RNAi oligonucleotide of any one of embodiments 52-56, wherein each targeting ligand comprises a N-acetylgalactosamine (GalNAc) moiety.
  • 58. The RNAi oligonucleotide of embodiment 57, wherein the GalNAc moiety is a monovalent GalNAc moiety, a bivalent GalNAc moiety, a trivalent GalNAc moiety or a tetravalent GalNAc moiety.
  • 59. The RNAi oligonucleotide of any one of embodiments 17 to 58, wherein up to 4 nucleotides of L of the stem-loop are each conjugated to a monovalent GalNAc moiety.
  • 60. The RNAi oligonucleotide of any one of embodiments 1-59, wherein the region of complementarity is fully complementary to the MARC1 mRNA target sequence at nucleotide positions 2-8 of the antisense strand, wherein nucleotide positions are numbered 5′ to 3′.
  • 61. The RNAi oligonucleotide of any one of embodiments 1-59, wherein the region of complementarity is fully complementary to the MARC1 mRNA target sequence at nucleotide positions 2-11 of the antisense strand, wherein nucleotide positions are numbered 5′ to 3′.
  • 62. The RNAi oligonucleotide of any one of embodiments 1 to 61, wherein the sense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1537-1570.
  • 63. The RNAi oligonucleotide of any one of embodiments 1 to 62, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1573-1606.
  • 64. The RNAi oligonucleotide of any one of embodiments 1 to 63, wherein the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively.
  • 65. The RNAi oligonucleotide of any one of embodiments 1 to 64, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1543, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1579.
  • 66. The RNAi oligonucleotide of any one of embodiments 1 to 64, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1560, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1596.
  • 67. The RNAi oligonucleotide of any one of embodiments 1 to 64, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1568, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1604.
  • 68. The RNAi oligonucleotide of any one of embodiments 1 to 64, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1553, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1589.
  • 69. The RNAi oligonucleotide of any one of embodiments 1-61, wherein the antisense strand is 22 nucleotides in length.
  • 70. The RNAi oligonucleotide of embodiment 69, wherein the antisense strand comprises a nucleotide sequence selected from SEQ ID NOs: 1579, 1596, 1604, and 1589.
  • 71. The RNAi oligonucleotide of any one of embodiments 1-61 and 69-70, wherein the sense strand comprises a nucleotide sequence selected from SEQ ID NOs: 234, 298, 356, and 376.
  • 72. The RNAi oligonucleotide of any one of embodiments 1-61 and 69-71, wherein the sense strand is 36 nucleotides in length.
  • 73. The RNAi oligonucleotide of embodiment 72, wherein the sense strand comprises a nucleotide sequence selected from SEQ ID NOs: 1543, 1560, 1568, and 1553.
  • 74. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein all nucleotides comprising the sense strand and antisense strand are modified, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 75. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein all nucleotides comprising the sense strand and antisense strand are modified, wherein the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 76. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein all nucleotides comprising the sense strand and antisense strand are modified, wherein the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 77. An RNAi oligonucleotide for reducing MARC1 expression, the oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein all nucleotides comprising the sense strand and the antisense strand are modified, wherein the antisense strand and the sense strand comprise one or more 2′-fluoro and 2′-O-methyl modified nucleotides and at least one phosphorothioate linkage, wherein the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 78. The RNAi oligonucleotide of any one of embodiments 1-77, wherein the sense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1609-1642.
  • 79. The RNAi oligonucleotide of any one of embodiments 1-78, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1645-1678.
  • 80. The RNAi oligonucleotide of any one of embodiments 1-79, wherein the sense and antisense strands comprise nucleotide sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1609 and 1645, respectively;
    • (b) SEQ ID NOs: 1610 and 1646, respectively;
    • (c) SEQ ID NOs: 1611 and 1647, respectively;
    • (d) SEQ ID NOs: 1612 and 1648, respectively;
    • (e) SEQ ID NOs: 1613 and 1649, respectively;
    • (f) SEQ ID NOs: 1614 and 1650, respectively;
    • (g) SEQ ID NOs: 1615 and 1651, respectively;
    • (h) SEQ ID NOs: 1616 and 1652, respectively;
    • (i) SEQ ID NOs: 1617 and 1653, respectively;
    • (j) SEQ ID NOs: 1618 and 1654, respectively;
    • (k) SEQ ID NOs: 1619 and 1655, respectively;
    • (l) SEQ ID NOs: 1620 and 1656, respectively;
    • (m) SEQ ID NOs: 1621 and 1657, respectively;
    • (n) SEQ ID NOs: 1622 and 1658, respectively;
    • (o) SEQ ID NOs: 1623 and 1659, respectively;
    • (p) SEQ ID NOs: 1624 and 1660, respectively;
    • (q) SEQ ID NOs: 1625 and 1661, respectively;
    • (r) SEQ ID NOs: 1626 and 1662, respectively;
    • (s) SEQ ID NOs: 1627 and 1663, respectively;
    • (t) SEQ ID NOs: 1628 and 1664, respectively;
    • (u) SEQ ID NOs: 1628 and 1665, respectively;
    • (v) SEQ ID NOs: 1630 and 1666, respectively;
    • (w) SEQ ID NOs: 1631 and 1667, respectively;
    • (x) SEQ ID NOs: 1632 and 1668, respectively;
    • (y) SEQ ID NOs: 1633 and 1669, respectively;
    • (z) SEQ ID NOs: 1634 and 1670, respectively;
    • (aa) SEQ ID NOs: 1635 and 1671, respectively;
    • (bb) SEQ ID NOs: 1636 and 1672, respectively;
    • (cc) SEQ ID NOs: 1637 and 1673, respectively;
    • (dd) SEQ ID NOs: 1638 and 1674, respectively;
    • (ee) SEQ ID NOs: 1639 and 1675, respectively;
    • (ff) SEQ ID NOs: 1640 and 1676, respectively;
    • (gg) SEQ ID NOs: 1641 and 1677, respectively; and,
    • (hh) SEQ ID NOs: 1642 and 1678, respectively.
  • 81. The RNAi oligonucleotide of any one of embodiments 1-80, wherein the sense and antisense strands comprise the nucleotide sequences set forth in SEQ ID NOs: 1615 and 1651, respectively.
  • 82. The RNAi oligonucleotide of any one of embodiments 1-80, wherein the sense and antisense strands comprise the nucleotide sequences set forth in SEQ ID NOs: 1632 and 1668, respectively.
  • 83. The RNAi oligonucleotide of any one of embodiments 1-80, wherein the sense and antisense strands comprise the nucleotide sequences set forth in SEQ ID NOs: 1640 and 1676, respectively.
  • 84. The RNAi oligonucleotide of any one of embodiments 1-80, wherein the sense and antisense strands comprise the nucleotide sequences set forth in SEQ ID NOs: 1625 and 1661, respectively.
  • 85. An RNAi oligonucleotide for inhibiting expression of MARC1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mGs-mG-mC-mU-mA-mG-mA-fG-fA-fA-fG-mA-mA-mA-mG-mU-mU-mA-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1615), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhosphonate-4O-mUs-fUs-fUs-fA-fA-mC-fU-mU-mU-fC-mU-mU-mC-fU-mC-mU-mA-mG-mC-mCs-mGs-mG-3′ (SEQ ID NO: 1651), wherein mC, mA, mG, and mU = 2′-OMe ribonucleosides; fA, fC, fG, and fU = 2′F ribonucleosides; s = phosphorothioate, and wherein ademA-GalNAc =
  • Figure US20230340490A1-20231026-C00015
  • 86. An RNAi oligonucleotide for inhibiting expression of MARC1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mAs-mG-mA-mA-mC-mG-mA-fA-fA-fG-fU-mU-mA-mU-mA-mU-mG-mG-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1632), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhosphonate-4O-mUs-fUs-fCs-fC-fA-mU-fA-mU-mA-fA-mC-mU-mU-fU-mC-mG-mU-mU-mC-mUs-mGs-mG-3′ (SEQ ID NO: 1668), wherein mC, mA, mG, and mU = 2′-OMe ribonucleosides; fA, fC, fG, and fU = 2′F ribonucleosides; s = phosphorothioate, and wherein ademA-GalNAc =
  • Figure US20230340490A1-20231026-C00016
  • 87. An RNAi oligonucleotide for inhibiting expression of MARC1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mAs-mA-mG-mU-mU-mG-mA-fC-fU-fA-fA-mA-mC-mU-mU-mG-mA-mA-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1640), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhosphonate-4O-mUs-fUs-fUs-fU-fC-mA-fA-mG-mU-fU-mU-mA-mG-fU-mC-mA-mA-mC-mU-mUs-mGs-mG-3′ (SEQ ID NO: 1676), wherein mC, mA, mG, and mU = 2′-OMe ribonucleosides; fA, fC, fG, and fU = 2′F ribonucleosides; s = phosphorothioate, and wherein ademA-GalNAc =
  • Figure US20230340490A1-20231026-C00017
  • 88. A double stranded RNAi oligonucleotide (dsRNAi) for inhibiting expression of MARC1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a MARC1 RNA transcript, wherein the sense strand comprises the sequence and all of the modifications of 5′-mUs-mG-mU-mG-mA-mA-mU-fA-fA-fA-fU-mG-mG-mA-mA-mG-mC-mU-mA-mA-mG-mC-mA-mG-mC-mC-mG-[ademA-GalNAc]-[ademA-GalNAc]-[ademA-GalNAc]-mG-mG-mC-mU-mG-mC-3′ (SEQ ID NO: 1625), and wherein the antisense strand comprises the sequence and all of the modifications of 5′-MePhosphonate-4O-mUs-fUs-fAs-fG-fC-mU-fU-mC-mC-fA-mU-mU-mU-fA-mU-mU-mC-mA-mC-mAs-mGs-mG-3′ (SEQ ID NO: 1661), wherein mC, mA, mG, and mU = 2′-OMe ribonucleosides; fA, fC, fG, and fU = 2′F ribonucleosides; s = phosphorothioate, and wherein ademA-GalNAc =
  • Figure US20230340490A1-20231026-C00018
  • 89. The RNAi oligonucleotide of any one of embodiments 1-88, wherein the oligonucleotide is a Dicer substrate.
  • 90. The RNAi oligonucleotide of any one of embodiments 1-88, wherein the oligonucleotide is a Dicer substrate that, upon endogenous Dicer processing, yields double-stranded nucleic acids of 19-23 nucleotides in length capable of reducing MARC1 expression in a mammalian cell.
  • 91. A method for treating a subject having a disease, disorder or condition associated with MARC1 expression, the method comprising administering to the subject a therapeutically effective amount of the RNAi oligonucleotide of any one of the preceding embodiments, or pharmaceutical composition thereof, thereby treating the subject.
  • 92. A pharmaceutical composition comprising the RNAi oligonucleotide of any one of embodiments 1 to 90, and a pharmaceutically acceptable carrier, delivery agent or excipient.
  • 93. A method of delivering an oligonucleotide to a subject, the method comprising administering pharmaceutical composition of embodiment 92 to the subject.
  • 94. A method for reducing MARC1 expression in a cell, a population of cells or a subject, the method comprising the step of:
    • i. contacting the cell or the population of cells with the RNAi oligonucleotide of any one of embodiments 1 to 90, or the pharmaceutical composition of embodiment 92; or
    • ii. administering to the subject the RNAi oligonucleotide of any one of embodiments 1 to 90, or the pharmaceutical composition of embodiment 92.
  • 95. The method of embodiment 94, wherein reducing MARC1 expression comprises reducing an amount or level of MARC1 mRNA, an amount or level of MARC 1 protein, or both.
  • 96. The method of embodiment 94 or 95, wherein the subject has a disease, disorder or condition associated with MARC1 expression, for example MARC1 expression in the liver.
  • 97. The method of embodiment 96, wherein the subject has a disease, disorder or condition associated with MARC1 expression in the liver.
  • 98. The method of embodiment 97, wherein the subject has a disease, disorder or condition associated with MARC1 expression in hepatocytes.
  • 99. The method of embodiment 91 or 96 to 98, wherein the disease, disorder or condition associated with MARC1 expression is non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), and alcoholic steatohepatitis (ASH).
  • 100. The method of any one of embodiments 91 and 94 to 99, wherein the RNAi oligonucleotide, or pharmaceutical composition, is administered in combination with a second composition or therapeutic agent.
  • 101. A method for treating a subject having a disease, disorder or condition associated with MARC1 expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
  • 102. A method for treating a subject having a disease, disorder or condition associated with MARC1 expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand selected from a row set forth in Table 4 or Table 6, or pharmaceutical composition thereof, thereby treating the subject.
  • 103. A method for treating a subject having a disease, disorder or condition associated with MARC1 expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1537 and 1573, respectively;
    • (b) SEQ ID NOs: 1538 and 1574, respectively;
    • (c) SEQ ID NOs: 1539 and 1575, respectively;
    • (d) SEQ ID NOs: 1540 and 1576, respectively;
    • (e) SEQ ID NOs: 1541 and 1577, respectively;
    • (f) SEQ ID NOs: 1542 and 1578, respectively;
    • (g) SEQ ID NOs: 1543 and 1579, respectively;
    • (h) SEQ ID NOs: 1544 and 1580, respectively;
    • (i) SEQ ID NOs: 1545 and 1581, respectively;
    • (j) SEQ ID NOs: 1546 and 1582, respectively;
    • (k) SEQ ID NOs: 1547 and 1583, respectively;
    • (l) SEQ ID NOs: 1548 and 1584, respectively;
    • (m) SEQ ID NOs: 1549 and 1585, respectively;
    • (n) SEQ ID NOs: 1550 and 1586, respectively;
    • (o) SEQ ID NOs: 1551 and 1587, respectively;
    • (p) SEQ ID NOs: 1552 and 1588, respectively;
    • (q) SEQ ID NOs: 1553 and 1589, respectively;
    • (r) SEQ ID NOs: 1554 and 1590, respectively;
    • (s) SEQ ID NOs: 1555 and 1591, respectively;
    • (t) SEQ ID NOs: 1556 and 1592, respectively;
    • (u) SEQ ID NOs: 1557 and 1593, respectively;
    • (v) SEQ ID NOs: 1558 and 1594, respectively;
    • (w) SEQ ID NOs: 1559 and 1595, respectively;
    • (x) SEQ ID NOs: 1560 and 1596, respectively;
    • (y) SEQ ID NOs: 1561 and 1597, respectively;
    • (z) SEQ ID NOs: 1562 and 1598, respectively;
    • (aa) SEQ ID NOs: 1563 and 1599, respectively;
    • (bb) SEQ ID NOs: 1564 and 1600, respectively;
    • (cc) SEQ ID NOs: 1565 and 1601, respectively;
    • (dd) SEQ ID NOs: 1566 and 1602, respectively;
    • (ee) SEQ ID NOs: 1567 and 1603, respectively;
    • (ff) SEQ ID NOs: 1568 and 1604, respectively;
    • (gg) SEQ ID NOs: 1569 and 1605, respectively; and,
    • (hh) SEQ ID NOs: 1570 and 1606, respectively.
  • 104. The method of embodiment 103, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1543, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1579.
  • 105. The method of embodiment 103, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1560, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1596.
  • 106. The method of embodiment 103, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1568, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1604.
  • 107. The method of embodiment 103, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1553, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1589.
  • 108. A method for treating a subject having a disease, disorder or condition associated with MARC1 expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
    • (a) SEQ ID NOs: 1609 and 1645, respectively;
    • (b) SEQ ID NOs: 1610 and 1646, respectively;
    • (c) SEQ ID NOs: 1611 and 1647, respectively;
    • (d) SEQ ID NOs: 1612 and 1648, respectively;
    • (e) SEQ ID NOs: 1613 and 1649, respectively;
    • (f) SEQ ID NOs: 1614 and 1650, respectively;
    • (g) SEQ ID NOs: 1615 and 1651, respectively;
    • (h) SEQ ID NOs: 1616 and 1652, respectively;
    • (i) SEQ ID NOs: 1617 and 1653, respectively;
    • (j) SEQ ID NOs: 1618 and 1654, respectively;
    • (k) SEQ ID NOs: 1619 and 1655, respectively;
    • (l) SEQ ID NOs: 1620 and 1656, respectively;
    • (m) SEQ ID NOs: 1621 and 1657, respectively;
    • (n) SEQ ID NOs: 1622 and 1658, respectively;
    • (o) SEQ ID NOs: 1623 and 1659, respectively;
    • (p) SEQ ID NOs: 1624 and 1660, respectively;
    • (q) SEQ ID NOs: 1625 and 1661, respectively;
    • (r) SEQ ID NOs: 1626 and 1662, respectively;
    • (s) SEQ ID NOs: 1627 and 1663, respectively;
    • (t) SEQ ID NOs: 1628 and 1664, respectively;
    • (u) SEQ ID NOs: 1628 and 1665, respectively;
    • (v) SEQ ID NOs: 1630 and 1666, respectively;
    • (w) SEQ ID NOs: 1631 and 1667, respectively;
    • (x) SEQ ID NOs: 1632 and 1668, respectively;
    • (y) SEQ ID NOs: 1633 and 1669, respectively;
    • (z) SEQ ID NOs: 1634 and 1670, respectively;
    • (aa) SEQ ID NOs: 1635 and 1671, respectively;
    • (bb) SEQ ID NOs: 1636 and 1672, respectively;
    • (cc) SEQ ID NOs: 1637 and 1673, respectively;
    • (dd) SEQ ID NOs: 1638 and 1674, respectively;
    • (ee) SEQ ID NOs: 1639 and 1675, respectively;
    • (ff) SEQ ID NOs: 1640 and 1676, respectively;
    • (gg) SEQ ID NOs: 1641 and 1677, respectively; and,
    • (hh) SEQ ID NOs: 1642 and 1678, respectively.
  • 109. The method of embodiment 108, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1615, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1651.
  • 110. The method of embodiment 108, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1632, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1668.
  • 111. The method of embodiment 108, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1640, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1676.
  • 112. The method of embodiment 108, wherein the sense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1625, wherein the antisense strand comprises a nucleotide sequence as set forth in SEQ ID NO: 1661.
  • 113. The method of any one of embodiments 101 to 112, wherein the disease, disorder or condition associated with MARC1 expression is non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), or alcoholic steatohepatitis (ASH).
  • 114. Use of the RNAi oligonucleotide of any one of embodiments 1 to 90, or the pharmaceutical composition of embodiment 92, in the manufacture of a medicament for the treatment of a disease, disorder or condition associated with MARC1 expression, optionally for the treatment of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), or alcoholic steatohepatitis (ASH).
  • 115. The RNAi oligonucleotide of any one of embodiments 1 to 90, or the pharmaceutical composition of embodiment 92, for use, or adaptable for use, in the treatment of a disease, disorder or condition associated with MARC1 expression, optionally for the treatment of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), or alcoholic steatohepatitis (ASH).
  • 116. The RNAi oligonucleotide of any one of embodiments 1 to 90, or the pharmaceutical composition of embodiment 92, for use, or adaptable for use, in the treatment of a disease, disorder or condition associated with MARC1 expression in the liver, for the treatment of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), or alcoholic steatohepatitis (ASH).
  • 117. A kit comprising the RNAi oligonucleotide of any one of embodiments 1 to 90, an optional pharmaceutically acceptable carrier, and a package insert comprising instructions for administration to a subject having a disease, disorder or condition associated with MARC1 expression.
  • 118. The use of embodiment 114, the RNAi oligonucleotide or pharmaceutical composition for use, or adaptable for use, of embodiment 115, or the kit of embodiment 116, wherein the disease, disorder or condition associated with MARC1 expression is non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), or alcoholic steatohepatitis (ASH).

Claims (23)

1. An RNAi oligonucleotide for reducing MARC1 expression, comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region of complementarity to a MARC1 mRNA target sequence of any one of SEQ ID NOs: 1-384, and wherein the region of complementarity is at least 15 contiguous nucleotides in length differing by no more than 3 nucleotides from the MARC1 mRNA target sequence.
2. The RNAi oligonucleotide of claim 1, comprising:
(i) an antisense strand of 19-30 nucleotides in length, wherein the antisense strand comprises a nucleotide sequence comprising a region of complementarity to a MARC1 mRNA target sequence, wherein the region of complementarity is selected from SEQ ID NOs: 385-768, and
(ii) a sense strand of 19-50 nucleotides in length comprising a region of complementarity to the antisense strand, wherein the antisense and sense strands are separate strands which form an asymmetric duplex region having an overhang of 1-4 nucleotides at the 3′ terminus of the antisense strand.
3. The RNAi oligonucleotide of claim 1, wherein:
(i) the sense strand is 15 to 50 or 18 to 36 nucleotides in length,
(ii) the antisense strand is 15 to 30 nucleotides in length, and
(iii) the duplex region is at least 19 nucleotides or at least 20 nucleotides in length.
4. The RNAi oligonucleotide of claim 3, wherein the sense strand is 36 nucleotides in length, and the antisense strand is 22 nucleotides in length.
5. The RNAi oligonucleotide of claim 1, wherein the 3′ end of the sense strand comprises a stem-loop set forth as S1-L-S2, wherein
(i) S1 is complementary to S2, and S1 and S2 are each 1-10 nucleotides in length and have the same length; and
(ii) L forms a loop between S1 and S2 of 3-5 nucleotides in length.
6. The RNAi oligonucleotide of claim 5, wherein S1 and S2 are 6 nucleotides in length and L is a triloop or a tetraloop.
7. The RNAi oligonucleotide of claim 6, wherein L is a tetraloop comprising the sequence of 5′-GAAA-3′.
8. The RNAi oligonucleotide of claim 5, wherein the stem-loop comprises the sequence 5′-GCAGCCGAAAGGCUGC-3′ (SEQ ID NO: 1681).
9. The RNAi oligonucleotide of claim 5, wherein at least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands, wherein:
(a) each targeting ligand comprises a carbohydrate, amino sugar, cholesterol, polypeptide or lipid;
(b) the stem loop comprises one or more targeting ligands conjugated to one or more nucleotides of the stem loop;
(c) the one or more targeting ligands is conjugated to one or more nucleotides of the loop, optionally wherein the loop comprises 4 nucleotides numbered 1-4 from 5′ to 3′, wherein nucleotides at positions 2, 3, and 4 each comprise one or more targeting ligands, wherein the targeting ligands are the same or different;
(d) the targeting ligand is a hepatocyte targeting ligand and each targeting ligand comprises a N-acetylgalactosamine (GalNAc) moiety, wherein the GalNAc moiety is a monovalent GalNAc moiety, a bivalent GalNAc moiety, a trivalent GalNAc moiety or a tetravalent GalNAc moiety; and/or
(e) the targeting ligand is a hepatocyte targeting ligand and up to 4 nucleotides of L of the stem-loop are each conjugated to a monovalent GalNAc moiety.
10. The RNAi oligonucleotide of claim 8, wherein at least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands, wherein:
(a) each targeting ligand comprises a carbohydrate, amino sugar, cholesterol, polypeptide or lipid;
(b) the stem loop comprises one or more targeting ligands conjugated to one or more nucleotides of the stem loop;
(c) the one or more targeting ligands is conjugated to one or more nucleotides of the loop, optionally wherein the loop comprises 4 nucleotides numbered 1-4 from 5′ to 3′, wherein nucleotides at positions 2, 3, and 4 each comprise one or more targeting ligands, wherein the targeting ligands are the same or different;
(d) the targeting ligand is a hepatocyte targeting ligand and each targeting ligand comprises a N-acetylgalactosamine (GalNAc) moiety, wherein the GalNAc moiety is a monovalent GalNAc moiety, a bivalent GalNAc moiety, a trivalent GalNAc moiety or a tetravalent GalNAc moiety; and/or
(e) the targeting ligand is a hepatocyte targeting ligand and up to 4 nucleotides of L of the stem-loop are each conjugated to a monovalent GalNAc moiety.
11. The RNAi oligonucleotide of claim 1, wherein:
(i) the oligonucleotide comprises at least one modified nucleotide, wherein the modified nucleotide comprises a 2′-modification, wherein:
(a) the 2′-modification is a modification selected from 2′-aminoethyl, 2′-fluoro, 2′-O-methyl, 2′-O-methoxyethyl, and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid, optionally wherein the modification is selected from 2′-fluoro and 2′-O-methyl, optionally wherein all nucleotides of the oligonucleotide are modified, wherein the modification is 2′-fluoro and 2′-O-methyl;
(b) about 10-15%, 10%, 11%, 12%, 13%, 14%, or 15% of the nucleotides of the sense strand comprise a 2′-fluoro modification;
(c) about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the antisense strand comprise a 2′-fluoro modification;
(d) about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the oligonucleotide comprise a 2′-fluoro modification;
(e) the sense strand comprises 36 nucleotides with positions 1-36 from 5′ to 3′, wherein positions 8-11 comprise a 2′-fluoro modification;
(f) the antisense strand comprises 22 nucleotides with positions 1-22 from 5′ to 3′, and wherein positions 2, 3, 4, 5, 7, 10, and 14 comprise a 2′-fluoro modification; and/or
(g) the remaining nucleotides comprise a 2′-O-methyl modification, and/or
(ii) the oligonucleotide comprises at least one modified internucleotide linkage, wherein the at least one modified internucleotide linkage is a phosphorothioate linkage, wherein:
(a) the antisense strand comprises a phosphorothioate linkage (i) between positions 1 and 2, and between positions 2 and 3; or (ii) between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4, wherein positions are numbered 1-4 from 5′ to 3′; and/or
(b) the antisense strand is 22 nucleotides in length, and wherein the antisense strand comprises a phosphorothioate linkage between positions 20 and 21 and between positions 21 and 22, wherein positions are numbered 1-22 from 5′ to 3′, and/or
(iii) the antisense strand comprises a phosphorylated nucleotide at the 5′ terminus, wherein the phosphorylated nucleotide is selected from uridine and adenosine, and/or
(iv) the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog selected from the group consisting of oxymethylphosphonate, vinylphosphonate and malonylphosphonate, and/or
(v) the antisense strand comprises an overhang sequence of one or more nucleotides in length at the 3′ terminus, and wherein the overhang comprises purine nucleotides, and optionally the overhang is selected from AA, GG, AG, and GA.
12. The RNAi oligonucleotide of claim 11, wherein the phosphorylated nucleotide is uridine.
13. The RNAi oligonucleotide of claim 11, wherein the phosphate analog is a 4′-phosphate analog comprising 5′-methoxyphosphonate-4′-oxy.
14. The RNAi oligonucleotide of claim 11, wherein the overhang is GG.
15. The RNAi oligonucleotide of claim 9, wherein:
(i) the oligonucleotide comprises at least one modified nucleotide, wherein the modified nucleotide comprises a 2′-modification, wherein:
(a) the 2′-modification is a modification selected from 2′-aminoethyl, 2′-fluoro, 2′-O-methyl, 2′-O-methoxyethyl, and 2′-deoxy-2′-fluoro-β-d-arabinonucleic acid, optionally wherein the modification is selected from 2′-fluoro and 2′-O-methyl, optionally wherein all nucleotides of the oligonucleotide are modified, wherein the modification is 2′-fluoro and 2′-O-methyl;
(b) about 10-15%, 10%, 11%, 12%, 13%, 14%, or 15% of the nucleotides of the sense strand comprise a 2′-fluoro modification;
(c) about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the antisense strand comprise a 2′-fluoro modification;
(d) about 25-35%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, or 35% of the nucleotides of the oligonucleotide comprise a 2′-fluoro modification;
(e) the sense strand comprises 36 nucleotides with positions 1-36 from 5′ to 3′, wherein positions 8-11 comprise a 2′-fluoro modification;
(f) the antisense strand comprises 22 nucleotides with positions 1-22 from 5′ to 3′, and wherein positions 2, 3, 4, 5, 7, 10, and 14 comprise a 2′-fluoro modification; and/or
(g) the remaining nucleotides comprise a 2′-O-methyl modification, and/or
(ii) the oligonucleotide comprises at least one modified internucleotide linkage, wherein the at least one modified internucleotide linkage is a phosphorothioate linkage, wherein:
(a) the antisense strand comprises a phosphorothioate linkage (i) between positions 1 and 2, and between positions 2 and 3; or (ii) between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4, wherein positions are numbered 1-4 from 5′ to 3′; and/or
(b) the antisense strand is 22 nucleotides in length, and wherein the antisense strand comprises a phosphorothioate linkage between positions 20 and 21 and between positions 21 and 22, wherein positions are numbered 1-22 from 5′ to 3′, and/or
(iii) the antisense strand comprises a phosphorylated nucleotide at the 5′ terminus, wherein the phosphorylated nucleotide is selected from uridine and adenosine, and/or
(iv) the 4′-carbon of the sugar of the 5′-nucleotide of the antisense strand comprises a phosphate analog, selected from the group consisting of oxymethylphosphonate, vinylphosphonate and malonylphosphonate, and/or
(v) the antisense strand comprises an overhang sequence of one or more nucleotides in length at the 3′ terminus and wherein the overhang comprises purine nucleotides and optionally the overhang is selected from AA, GG, AG and GA.
16. The RNAi oligonucleotide of claim 15, wherein the phosphorylated nucleotide is uridine.
17. The RNAi oligonucleotide of claim 15, wherein the phosphate analog is a 4′-phosphate analog comprising 5′-methoxyphosphonate-4′-oxy.
18. The RNAi oligonucleotide of claim 15, wherein the overhang is GG.
19. The RNAi oligonucleotide of claim 1, wherein the sense strand and antisense strands comprise nucleotide sequences selected from the group consisting of:
(a) SEQ ID NOs: 1537 and 1573, respectively;
(b) SEQ ID NOs: 1538 and 1574, respectively;
(c) SEQ ID NOs: 1539 and 1575, respectively;
(d) SEQ ID NOs: 1540 and 1576, respectively;
(e) SEQ ID NOs: 1541 and 1577, respectively;
(f) SEQ ID NOs: 1542 and 1578, respectively;
(g) SEQ ID NOs: 1543 and 1579, respectively;
(h) SEQ ID NOs: 1544 and 1580, respectively;
(i) SEQ ID NOs: 1545 and 1581, respectively;
(j) SEQ ID NOs: 1546 and 1582, respectively;
(k) SEQ ID NOs: 1547 and 1583, respectively;
(l) SEQ ID NOs: 1548 and 1584, respectively;
(m) SEQ ID NOs: 1549 and 1585, respectively;
(n) SEQ ID NOs: 1550 and 1586, respectively;
(o) SEQ ID NOs: 1551 and 1587, respectively;
(p) SEQ ID NOs: 1552 and 1588, respectively;
(q) SEQ ID NOs: 1553 and 1589, respectively;
(r) SEQ ID NOs: 1554 and 1590, respectively;
(s) SEQ ID NOs: 1555 and 1591, respectively;
(t) SEQ ID NOs: 1556 and 1592, respectively;
(u) SEQ ID NOs: 1557 and 1593, respectively;
(v) SEQ ID NOs: 1558 and 1594, respectively;
(w) SEQ ID NOs: 1559 and 1595, respectively;
(x) SEQ ID NOs: 1560 and 1596, respectively;
(y) SEQ ID NOs: 1561 and 1597, respectively;
(z) SEQ ID NOs: 1562 and 1598, respectively;
(aa) SEQ ID NOs: 1563 and 1599, respectively;
(bb) SEQ ID NOs: 1564 and 1600, respectively;
(cc) SEQ ID NOs: 1565 and 1601, respectively;
(dd) SEQ ID NOs: 1566 and 1602, respectively;
(ee) SEQ ID NOs: 1567 and 1603, respectively;
(ff) SEQ ID NOs: 1568 and 1604, respectively;
(gg) SEQ ID NOs: 1569 and 1605, respectively; and
(hh) SEQ ID NOs: 1570 and 1606, respectively.
20. The RNAi oligonucleotide of claim 1, wherein the sense and antisense strands comprise nucleotide sequences selected from the group consisting of:
(a) SEQ ID NOs: 1609 and 1645, respectively;
(b) SEQ ID NOs: 1610 and 1646, respectively;
(c) SEQ ID NOs: 1611 and 1647, respectively;
(d) SEQ ID NOs: 1612 and 1648, respectively;
(e) SEQ ID NOs: 1613 and 1649, respectively;
(f) SEQ ID NOs: 1614 and 1650, respectively;
(g) SEQ ID NOs: 1615 and 1651, respectively;
(h) SEQ ID NOs: 1616 and 1652, respectively;
(i) SEQ ID NOs: 1617 and 1653, respectively;
(j) SEQ ID NOs: 1618 and 1654, respectively;
(k) SEQ ID NOs: 1619 and 1655, respectively;
(l) SEQ ID NOs: 1620 and 1656, respectively;
(m) SEQ ID NOs: 1621 and 1657, respectively;
(n) SEQ ID NOs: 1622 and 1658, respectively;
(o) SEQ ID NOs: 1623 and 1659, respectively;
(p) SEQ ID NOs: 1624 and 1660, respectively;
(q) SEQ ID NOs: 1625 and 1661, respectively;
(r) SEQ ID NOs: 1626 and 1662, respectively;
(s) SEQ ID NOs: 1627 and 1663, respectively;
(t) SEQ ID NOs: 1628 and 1664, respectively;
(u) SEQ ID NOs: 1628 and 1665, respectively;
(v) SEQ ID NOs: 1630 and 1666, respectively;
(w) SEQ ID NOs: 1631 and 1667, respectively;
(x) SEQ ID NOs: 1632 and 1668, respectively;
(y) SEQ ID NOs: 1633 and 1669, respectively;
(z) SEQ ID NOs: 1634 and 1670, respectively;
(aa) SEQ ID NOs: 1635 and 1671, respectively;
(bb) SEQ ID NOs: 1636 and 1672, respectively;
(cc) SEQ ID NOs: 1637 and 1673, respectively;
(dd) SEQ ID NOs: 1638 and 1674, respectively;
(ee) SEQ ID NOs: 1639 and 1675, respectively;
(ff) SEQ ID NOs: 1640 and 1676, respectively;
(gg) SEQ ID NOs: 1641 and 1677, respectively; and
(hh) SEQ ID NOs: 1642 and 1678, respectively.
21. A pharmaceutical composition comprising the RNAi oligonucleotide of claim 20, and a pharmaceutically acceptable carrier, delivery agent or excipient.
22. A method of treating a disease or condition associated with MARC1 expression in hepatocytes selected from the group consisting of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), and alcoholic steatohepatitis (ASH), comprising administering a therapeutically effective amount of the double stranded RNAi oligonucleotide of claim 20.
23. A kit comprising the double stranded RNAi oligonucleotide of claim 20, a pharmaceutically acceptable carrier, and a package insert comprising instructions for administration to a subject having a disease, disorder or condition associated with MARC1 expression selected from the group consisting of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), and alcoholic steatohepatitis (ASH).
US18/134,585 2021-05-28 2023-04-14 Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (marc1) expression Pending US20230340490A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US18/134,585 US20230340490A1 (en) 2021-05-28 2023-04-14 Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (marc1) expression

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US202163194395P 2021-05-28 2021-05-28
EP21183860.2 2021-07-06
EP21183860 2021-07-06
US17/826,211 US11655473B2 (en) 2021-05-28 2022-05-27 Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (MARC1) expression
US18/134,585 US20230340490A1 (en) 2021-05-28 2023-04-14 Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (marc1) expression

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US17/826,211 Division US11655473B2 (en) 2021-05-28 2022-05-27 Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (MARC1) expression

Publications (1)

Publication Number Publication Date
US20230340490A1 true US20230340490A1 (en) 2023-10-26

Family

ID=82067447

Family Applications (2)

Application Number Title Priority Date Filing Date
US17/826,211 Active US11655473B2 (en) 2021-05-28 2022-05-27 Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (MARC1) expression
US18/134,585 Pending US20230340490A1 (en) 2021-05-28 2023-04-14 Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (marc1) expression

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US17/826,211 Active US11655473B2 (en) 2021-05-28 2022-05-27 Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (MARC1) expression

Country Status (15)

Country Link
US (2) US11655473B2 (en)
EP (1) EP4347820A1 (en)
JP (2) JP7463621B2 (en)
KR (1) KR102662071B1 (en)
AR (1) AR125992A1 (en)
AU (1) AU2022282579A1 (en)
BR (1) BR112023023807A2 (en)
CA (1) CA3215836A1 (en)
CL (1) CL2023003363A1 (en)
CO (1) CO2023016136A2 (en)
IL (1) IL308418A (en)
MX (1) MX2023013504A (en)
PE (1) PE20250074A1 (en)
TW (1) TWI831225B (en)
WO (1) WO2022248665A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2023013504A (en) * 2021-05-28 2024-02-23 Novo Nordisk As Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (marc1) expression.
KR20230010593A (en) * 2021-07-08 2023-01-19 올릭스 주식회사 RNAi agents targeting MARC1 gene and use thereof
WO2024192379A1 (en) * 2023-03-16 2024-09-19 Arrowhead Pharmaceuticals, Inc. Rnai agents for inhibiting expression of mitochondrial amidoxime reducing component 1 (marc1), pharmaceutical compositions thereof, and methods of use

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050255487A1 (en) * 2002-11-14 2005-11-17 Dharmacon, Inc. Methods and compositions for selecting siRNA of improved functionality
CA3075425A1 (en) * 2017-09-22 2019-03-28 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US20220047621A1 (en) * 2020-08-13 2022-02-17 Amgen Inc. RNAi CONSTRUCTS AND METHODS FOR INHIBITING MARC1 EXPRESSION
US20220170025A1 (en) * 2019-04-04 2022-06-02 Dicerna Pharmaceuticals Inc. Compositions and methods for inhibiting gene expression in the central nervous system
US20230183707A1 (en) * 2020-05-21 2023-06-15 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting marc1 gene expression

Family Cites Families (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6469158B1 (en) 1992-05-14 2002-10-22 Ribozyme Pharmaceuticals, Incorporated Synthesis, deprotection, analysis and purification of RNA and ribozymes
US5977343A (en) 1992-05-14 1999-11-02 Ribozyme Pharmaceuticals, Inc. Synthesis, deprotection, analysis and purification of RNA and ribozymes
US5804683A (en) 1992-05-14 1998-09-08 Ribozyme Pharmaceuticals, Inc. Deprotection of RNA with alkylamine
ES2186690T3 (en) 1993-09-02 2003-05-16 Ribozyme Pharm Inc ENZYMATIC NUCLEIC ACID CONTAINING NON-NUCLEOTIDES.
US5889136A (en) 1995-06-09 1999-03-30 The Regents Of The University Of Colorado Orthoester protecting groups in RNA synthesis
US5998203A (en) 1996-04-16 1999-12-07 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
US6111086A (en) 1998-02-27 2000-08-29 Scaringe; Stephen A. Orthoester protecting groups
DE60140676D1 (en) 2000-03-30 2010-01-14 Massachusetts Inst Technology RNA INTERFERENCE MEDIATORS WHICH ARE RNA SEQUENCE SPECIFIC
DK2813582T3 (en) 2000-12-01 2017-07-31 Max-Planck-Gesellschaft Zur Förderung Der Wss E V Small RNA molecules that mediate RNA interference
US20050159378A1 (en) 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA)
JP2005508196A (en) 2001-11-07 2005-03-31 アプレラ コーポレイション General purpose nucleotides for nucleic acid analysis
WO2006006948A2 (en) 2002-11-14 2006-01-19 Dharmacon, Inc. METHODS AND COMPOSITIONS FOR SELECTING siRNA OF IMPROVED FUNCTIONALITY
US20070265220A1 (en) 2004-03-15 2007-11-15 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
NL1026610C2 (en) 2004-07-08 2006-01-10 Wp Suspension B V Shock absorber with pressure-assisted adjustment.
US20090018097A1 (en) 2005-09-02 2009-01-15 Mdrna, Inc Modification of double-stranded ribonucleic acid molecules
DK2341943T3 (en) 2008-09-22 2019-02-25 Dicerna Pharmaceuticals Inc COMPOSITIONS AND METHODS OF SPECIFIC INHIBITION OF DSRNA REPRINT WITH MODIFICATIONS
CA3151965A1 (en) 2008-12-18 2010-07-15 Dicerna Pharmaceuticals, Inc. Extended dicer substrate agents and methods for the specific inhibition of gene expression
US20100249214A1 (en) 2009-02-11 2010-09-30 Dicerna Pharmaceuticals Multiplex dicer substrate rna interference molecules having joining sequences
WO2011005860A2 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. 5' phosphate mimics
US9725479B2 (en) 2010-04-22 2017-08-08 Ionis Pharmaceuticals, Inc. 5′-end derivatives
EP2771463A4 (en) 2011-10-25 2015-09-09 Isis Pharmaceuticals Inc ANTISENSE MODULATION OF GCCR EXPRESSION
WO2016100401A1 (en) 2014-12-15 2016-06-23 Dicerna Pharmaceuticals, Inc. Ligand-modified double-stranded nucleic acids
PT3506909T (en) 2016-09-02 2022-08-16 Dicerna Pharmaceuticals Inc 4'-phosphate analogs and oligonucleotides comprising the same
MX2019010060A (en) 2017-03-27 2019-10-21 Univ California Compositions and method of treating cancer.
US10835581B2 (en) 2017-11-28 2020-11-17 University of Pittsburgh—of the Commonwealth System of Higher Education Method of treating insulin resistance
US20200241005A1 (en) 2019-01-25 2020-07-30 Viscient Biosciences, Inc. Compositions and methods for the diagnosis and treatment of diseases of the liver
MX2023013504A (en) * 2021-05-28 2024-02-23 Novo Nordisk As Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (marc1) expression.

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050255487A1 (en) * 2002-11-14 2005-11-17 Dharmacon, Inc. Methods and compositions for selecting siRNA of improved functionality
US20070031844A1 (en) * 2002-11-14 2007-02-08 Anastasia Khvorova Functional and hyperfunctional siRNA
US8090542B2 (en) * 2002-11-14 2012-01-03 Dharmacon Inc. Functional and hyperfunctional siRNA
CA3075425A1 (en) * 2017-09-22 2019-03-28 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and methods of inducing exon skipping
US20220170025A1 (en) * 2019-04-04 2022-06-02 Dicerna Pharmaceuticals Inc. Compositions and methods for inhibiting gene expression in the central nervous system
US20230183707A1 (en) * 2020-05-21 2023-06-15 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting marc1 gene expression
US20220047621A1 (en) * 2020-08-13 2022-02-17 Amgen Inc. RNAi CONSTRUCTS AND METHODS FOR INHIBITING MARC1 EXPRESSION

Also Published As

Publication number Publication date
AR125992A1 (en) 2023-08-30
KR20230130609A (en) 2023-09-12
AU2022282579A9 (en) 2023-11-16
US20230042451A1 (en) 2023-02-09
EP4347820A1 (en) 2024-04-10
CA3215836A1 (en) 2022-12-01
JP7463621B2 (en) 2024-04-08
JP2024071571A (en) 2024-05-24
JP2024508069A (en) 2024-02-22
WO2022248665A1 (en) 2022-12-01
TW202307206A (en) 2023-02-16
PE20250074A1 (en) 2025-01-13
AU2022282579A1 (en) 2023-11-02
US11655473B2 (en) 2023-05-23
CO2023016136A2 (en) 2024-02-15
CL2023003363A1 (en) 2024-06-21
KR102662071B1 (en) 2024-05-03
BR112023023807A2 (en) 2024-02-20
MX2023013504A (en) 2024-02-23
IL308418A (en) 2024-01-01
TWI831225B (en) 2024-02-01

Similar Documents

Publication Publication Date Title
AU2021236674B2 (en) Compositions and methods for inhibiting ANGPTL3 expression
AU2021320550A1 (en) Compositions and methods for inhibiting
US20230340490A1 (en) Compositions and methods for inhibiting mitochondria amidoxime reducing component 1 (marc1) expression
US20250092403A1 (en) Compositions and methods for inhibiting ketohexokinase (khk)
US20220072024A1 (en) Compositions and methods for inhibiting hmgb1 expression
KR102759742B1 (en) Compositions and methods for inhibiting transmembrane serine protease 6 (tmprss6) expression
US11578329B2 (en) Compositions and methods for inhibiting nuclear receptor subfamily 1 group H member 3 (NR1H3) expression
CN117396606A (en) Compositions and methods for inhibiting mitochondrial amidoxime reducing component 1 (MARC1) expression
KR20240111757A (en) Compositions and methods for regulating APOC3 expression
AU2023254798A1 (en) Compositions and methods for modulating scap activity
EA050095B1 (en) COMPOSITIONS AND METHODS FOR INHIBITING ANGPTL3 EXPRESSION
CN117280031A (en) Compositions and methods for inhibiting expression of nuclear receptor subfamily 1 group H member 3 (NR 1H 3)

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

AS Assignment

Owner name: NOVO NORDISK A/S, DENMARK

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DICERNA PHARMACEUTICALS, INC.;REEL/FRAME:070892/0437

Effective date: 20250417