US20190316151A1 - Engineered viral vector reduces induction of inflammatory and immune responses - Google Patents

Engineered viral vector reduces induction of inflammatory and immune responses Download PDF

Info

Publication number
US20190316151A1
US20190316151A1 US16/167,764 US201816167764A US2019316151A1 US 20190316151 A1 US20190316151 A1 US 20190316151A1 US 201816167764 A US201816167764 A US 201816167764A US 2019316151 A1 US2019316151 A1 US 2019316151A1
Authority
US
United States
Prior art keywords
viral genome
recombinant viral
seq
aav
egfp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US16/167,764
Inventor
Ying Kai Chan
George Church
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harvard University
Original Assignee
Harvard University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Harvard University filed Critical Harvard University
Priority to US16/167,764 priority Critical patent/US20190316151A1/en
Assigned to PRESIDENT AND FELLOWS OF HARVARD COLLEGE reassignment PRESIDENT AND FELLOWS OF HARVARD COLLEGE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHURCH, GEORGE M., CHAN, Ying Kai
Publication of US20190316151A1 publication Critical patent/US20190316151A1/en
Priority to US18/332,109 priority patent/US20240043849A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/17Immunomodulatory nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/50Biochemical production, i.e. in a transformed host cell
    • C12N2330/51Specially adapted vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/00032Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/00041Use of virus, viral particle or viral elements as a vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151Methods of production or purification of viral material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14171Demonstrated in vivo effect
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention is related to the area of viral based therapies. In particular, it relates to recombinant viruses.
  • GlyberaTM alipogene tiparvovec
  • AAV adeno-associated virus
  • LPL human lipoprotein lipase
  • AAV is a small, non-enveloped virus that packages a single-stranded linear DNA genome that is approximately 5 kb long, and has been adapted for use as a gene transfer vehicle [4].
  • the coding regions of AAV are flanked by inverted terminal repeats (ITRs), which act as the origins for DNA replication and serve as the primary packaging signal [7, 8]. Both positive and negative strands are packaged into virions equally well and capable of infection [9-11].
  • ITRs inverted terminal repeats
  • Both positive and negative strands are packaged into virions equally well and capable of infection [9-11].
  • a small deletion in one of the two ITRs allows packaging of self-complementary vectors, in which the genome self-anneals after viral uncoating. This results in more efficient transduction of cells but reduces the coding capacity by half [12, 13].
  • AAV is not associated with any human disease, >70% of humans are seropositive for one or most serotypes [14, 15].
  • Typical routes of administration for AAV vectors include intravenous, intramuscular, subretinal and intracranal injections.
  • AAV gene therapy is most often used to deliver a wild-type gene to treat monogenic diseases, and AAV vectors have been used to transduce cells in the liver, skeletal and cardiac muscle, retina and central nervous system [16-26].
  • AAV CRISPR-Cas9 gene editing or to deliver broadly neutralizing antibodies against infectious diseases such as human immunodeficiency virus (HIV) and influenza A virus [27-32].
  • immunosuppressive and anti-inflammatory drugs compromise the patient's immune system during treatment, and all patients still developed neutralizing antibodies against AAV capsid, precluding future re-administration.
  • many AAV gene therapy clinical trials do not utilize immunosuppression prophylactically and only administer corticosteroids upon signs of inflammation or tissue damage, which has been associated with variable therapeutic efficacy [22, 23].
  • AAV vectors have also been developed as vaccine vehicles against infectious diseases and cancer [39-41].
  • Inflammation has been implicated as a critical determinant of successful AAV-mediated transgene expression.
  • a study found that following AAV administration in mice, artificially inducing systemic inflammation such as the upregulation of tumor necrosis factor (TNF), led to a decline in transgene expression in the liver [42]. This indicates that immunological tolerance to AAV-encoded transgene can be broken given sufficient inflammatory responses.
  • TNF tumor necrosis factor
  • Another study characterized inflammation in the murine liver following AAV infection and found transient increases in liver enzymes in the serum, and also liver pathology consistent with portal and lobular inflammation [43].
  • TLR9 Toll-like receptor 9
  • PRR pattern recognition receptor
  • NF-kB in turn drives the transcriptional upregulation of multiple proinflammatory cytokines such as TNF leading to inflammation and immune cell recruitment, while secreted IFNs induce the expression of numerous interferon-stimulated genes (ISGs) and establish an antiviral state.
  • ISGs interferon-stimulated genes
  • TLR9 plays a critical role in stimulating an early inflammatory and innate immune response during AAV infection, which also contributes to priming adaptive immunity.
  • TLR2 and TLR4 have been implicated in triggering responses to AAV structural proteins [47, 48].
  • TLR9 In the TLR9 field, a commonly used tool to block TLR9 activation in cell culture is short, single-stranded DNA oligonucleotides that bind TLR9 but do not activate it [49, 50]. Several such sequences are known—some synthetic and others derived from organisms—and they often bear no sequence homology [51-59]. Structural studies have revealed how an inhibitory oligonucleotide binds TLR9 tightly but does not trigger TLR9 dimerization, which is required for TLR9 activation and downstream signaling [60].
  • TLR9-inhibitory oligonucleotides In addition to binding TLR9 directly to antagonize its activation, other mechanisms to block TLR9 activation or TLR9-mediated inflammation have been postulated or shown for other TLR9-inhibitory oligonucleotides [reviewed in 49]. These include competing for receptor-mediated endocytosis or phagocytosis, inhibition of TLR9 trafficking or TLR9 processing into a functionally active product, inhibition of endosomal acidification or activity of key proteases in endosomes, or blocking signaling proteins downstream of TLR9.
  • inhibitory oligonucleotides When these inhibitory oligonucleotides are supplied in trans with TLR9 ligands (such as a DNA virus, or a CpG-containing oligonucleotide) in cell culture media, they are endocytosed and can bind to TLR9, preventing its activation by stimulatory ligands. Supplementation of inhibitory oligonucleotides in trans is widely adopted in immunology experiments, but it is unknown in the field if incorporation of these sequences into a viral genome allows it to evade eliciting inflammatory and immune responses.
  • TLR9 ligands such as a DNA virus, or a CpG-containing oligonucleotide
  • GlyberaTM alipogene tiparvovec treatment still includes twelve weeks of immunosuppression, beginning three days before GlyberaTM alipogene tiparvovec administration.
  • These immunosuppressive drugs strongly hamper T cell activation and therefore compromise the patient's immune system during treatment. It would be advantageous to engineer viral vectors that evade and elicit diminished or no inflammatory response upon administration. Furthermore, it would be beneficial if the immune suppression was not systemic, and if it was transient. Preventing inflammatory and immune responses could also improve transgene expression and may allow the re-administration of the viral vector for future purposes.
  • a nucleic acid molecule comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation.
  • a recombinant virus for delivery of a desired function to a mammalian cell.
  • the recombinant virus comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation.
  • Another embodiment is an aspect of treating a mammal.
  • the method comprises administering a recombinant virus to a mammal in need thereof.
  • the recombinant virus comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation.
  • Still another aspect is a method of making a viral genome of a recombinant virus.
  • An inhibitory nucleic acid sequence is inserted into a viral genome.
  • the inhibitory nucleic acid sequence binds to TLR9 but does not trigger TLR9 activation.
  • a nucleic acid molecule comprises an inverted terminal repeat (ITR) and a nucleic acid sequence which inhibits TLR9-mediated inflammation.
  • ITR inverted terminal repeat
  • the molecule comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which inhibits TLR9-mediated inflammation.
  • Yet another aspect of the invention is a recombinant virus for delivery of a desired function to a mammalian cell.
  • the recombinant virus comprises a viral genome comprising an inhibitory nucleic acid sequence which inhibits TLR9-mediated inflammation.
  • Still another aspect of the invention is a method of making a viral genome of a recombinant virus.
  • a nucleic acid sequence is inserted into a viral genome.
  • the nucleic acid sequence inhibits TLR9-mediated inflammation.
  • a nucleic acid vector comprising at least one nucleic acid sequence.
  • the nucleic acid sequence is capable of inhibiting TLR9-mediated inflammation.
  • Another aspect of the invention is a method of reducing immunogenicity of a modified virus having a genome.
  • the method comprises inserting a nucleic acid sequence into the genome.
  • the nucleic acid sequence inhibits TLR9-mediated inflammation.
  • the modified virus causes a reduced inflammatory response in a host as compared to a virus that does not contain the inhibitory sequence.
  • Still another aspect of the invention is a method of increasing expression in a host cell of a virally introduced transgene.
  • the method comprises introducing into a host a modified virus having a genome.
  • the genome comprises a nucleic acid sequence.
  • the nucleic acid sequence inhibits TLR9-mediated inflammation.
  • the modified virus results in higher transgene expression in a host cell as compared to a virus that does not contain the inhibitory sequence.
  • compositions comprising a viral capsid encapsidating a nucleic acid sequence that inhibits TLR9-mediated inflammation.
  • the viral genome may be adeno-associated virus (AAV) genome.
  • AAV adeno-associated virus
  • the viral genome may be selected from the group consisting of adenovirus, herpes simplex virus, varicella, variola virus, hepatitis B, cytomegalovirus, JC polyomavirus, BK polyomavirus, monkeypox virus, Herpes Zoster, Epstein-Barr virus, human herpes virus 7, Kaposi's sarcoma-associated herpesvirus, and human parvovirus B19.
  • the viral genome may be single stranded.
  • the viral genome may be packaged in a virion.
  • the viral genome may comprise a gene which may be expressible in a human cell.
  • the viral genome may be a cytotoxic virus for lysing target tumor cells.
  • the inhibitory nucleic acid sequence may comprise c41 oligonucleotide sequence TGGCGCGCACCCACGGCCTG (SEQ ID NO: 1).
  • the inhibitory nucleic acid sequence may comprise a plurality of copies of c41 sequence (SEQ ID NO: 1).
  • the inhibitory nucleic acid sequence may comprise two copies of c41 sequence (SEQ ID NO: 1) separated by a linker sequence.
  • the linker sequence is AAAAA (SEQ ID NO: 8).
  • the inhibitory nucleic acid sequence may be selected from the group consisting of:
  • ODN 2088 (SEQ ID NO: 2) TCC TGG CGG GGA AGT; ODN 4084-F: (SEQ ID NO: 3) CCTGGATGGGAA; ODN INH-1: (SEQ ID NO: 4) CCTGGATGGGAATTCCCATCCAGG; ODN INH-18: (SEQ ID NO: 5) CCT GGA TGG GAA CTT ACC GCT GCA; ODN TTAGGG: (SEQ ID NO: 6) TT AGG GTT AGG GTT AGG GTT AGG GTT AGG G; and G-ODN: (SEQ ID NO: 7) CTC CTA TTG GGG GTT TCC TAT.
  • the inhibitory nucleic acid sequence may be a bacterial sequence.
  • the viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a non-human gene.
  • the inhibitory nucleic acid sequence may be inserted downstream of or in a 3′ untranslated region of the viral genome.
  • the viral genome may be covalently linked to the inhibitory nucleic acid sequence by a phosphodiester bond.
  • the viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a detectable marker.
  • the detectable marker may be inducible.
  • the inhibitory nucleic acid sequence may comprise a human telomere sequence shown in SEQ ID NO: 9.
  • the viral genome may be self-complementary.
  • the viral genome may be covalently linked to a plurality of inhibitory nucleic acid sequences.
  • the plurality of inhibitory nucleic acid sequences may comprise an inhibitory sequence and its reverse complement.
  • the inhibitory nucleic acid sequence may comprise three copies of c41 sequence (SEQ ID NO: 1), each copy separated by a linker sequence.
  • the inhibitory nucleic acid sequence may be selected from the group consisting of:
  • ODN 2114 (SEQ ID NO: 16) TCCTGGAGGGGAAGT; ODN 4024: (SEQ ID NO: 17) TCCTGGATGGGAAGT; ODN INH-4: (SEQ ID NO: 18) TTCCCATCCAGGCCTGGATGGGAA; ODN INH-13: (SEQ ID NO: 19) CTTACCGCTGCACCTGGATGGGAA; ODN Poly-G: (SEQ ID NO: 20) GGGGGGGGGGGGGGGGGGGGGG; ODN GpG: (SEQ ID NO: 21) TGACTGTGAAGGTTAGAGATGA; ODN IRS-869: (SEQ ID NO: 22) TCCTGGAGGGGTTGT; ODN IRS-954: (SEQ ID NO: 23) TGCTCCTGGAGGGGTTGT; and ODN 21158: (SEQ ID NO: 24) CCTGGCGGGG.
  • the inhibitory nucleic acid sequence may be ODN TTAGGG (SEQ ID NO: 6).
  • the inhibitory sequence may be covalently linked to a linker.
  • the inhibitory sequence may be upstream of the linker.
  • the inhibitory nucleic acid sequence may comprise a plurality of copies of ODN TTAGGG (SEQ ID NO: 6).
  • the plurality of copies of ODN TTAGGG may each be separated by a linker.
  • the inhibitory nucleic acid sequence may comprise at least 2, at least 3, at least 4, or at least 5 copies of ODN TTAGGG (SEQ ID NO: 6), each copy separated by a linker.
  • the inhibitory nucleic acid sequence may be a human sequence.
  • the viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a non-human nucleic acid sequence.
  • the viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a human gene.
  • the viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a human nucleic acid sequence.
  • the inhibitory nucleic acid sequence may be inserted in the 5′ untranslated region of the viral genome.
  • the inhibitory nucleic acid sequence may be inserted upstream of a promoter of the viral genome.
  • the viral genome, recombinant virus, vector, or nucleic acid sequence may comprise an inducible promoter.
  • the inhibitory nucleic acid sequence may comprise two repeated monomers of SEQ ID NO: 1.
  • the inhibitory nucleic acid sequence may comprise three repeated monomers of SEQ ID NO: 1.
  • the inhibitory nucleic acid sequence may comprise SEQ ID NO: 6 or SEQ ID NO: 9.
  • the inhibitory nucleic acid sequence may comprise three repeated monomers of SEQ ID NO: 6 or SEQ ID NO: 9.
  • the inhibitory nucleic acid sequence may comprise five repeated monomers of SEQ ID NO: 6 or SEQ ID NO: 9.
  • the step of administering may be repeated.
  • the viral genome may be packaged in virions.
  • the step of inserting may utilize a DNA ligase.
  • the viral genome may be single stranded when in virions.
  • the viral genome of the recombinant virus may comprise a gene for delivery to and expression in a human cell.
  • the viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a linker separating each of the nucleic acid sequences.
  • the viral genome, recombinant virus, vector, or nucleic acid sequence may comprise at least 2, at least 3, at least 4, or at least 5 copies of the nucleic acid sequence.
  • the inhibitory nucleic acid may be covalently linked to a gene.
  • the inhibitory nucleic acid sequence may be 95% identical to c41 oligonucleotide sequence TGGCGCGCACCCACGGCCTG (SEQ ID NO: 1).
  • the inhibitory nucleic acid sequence may be 95% identical to SEQ ID NO: 9.
  • the inhibitory nucleic acid sequence may be 95% identical to a sequence selected from the group consisting of:
  • ODN 2088 (SEQ ID NO: 2) TCC TGG CGG GGA AGT; ODN 4084-F: (SEQ ID NO: 3) CCTGGATGGGAA; ODN INH-1: (SEQ ID NO: 4) CCTGGATGGGAATTCCCATCCAGG; ODN INH-18: (SEQ ID NO: 5) CCT GGA TGG GAA CTT ACC GCT GCA; ODN TTAGGG: (SEQ ID NO: 6) TT AGG GTT AGG GTT AGG GTT AGG GTT AGG G; and G-ODN: (SEQ ID NO: 7) CTC CTA TTG GGG GTT TCC TAT.
  • the inhibitory nucleic acid sequence may be 95% identical to a sequence selected from the group consisting of:
  • ODN 2114 (SEQ ID NO: 16) TCCTGGAGGGGAAGT; ODN 4024: (SEQ ID NO: 17) TCCTGGATGGGAAGT; ODN INH-4: (SEQ ID NO: 18) TTCCCATCCAGGCCTGGATGGGAA; ODN INH-13: (SEQ ID NO: 19) CTTACCGCTGCACCTGGATGGGAA; ODN Poly-G: (SEQ ID NO: 20) GGGGGGGGGGGGGGGGGGGGGG; ODN GpG: (SEQ ID NO: 21) TGACTGTGAAGGTTAGAGATGA; ODN IRS-869: (SEQ ID NO: 22) TCCTGGAGGGGTTGT; ODN IRS-954: (SEQ ID NO: 23) TGCTCCTGGAGGGGTTGT; and ODN 21158: (SEQ ID NO: 24) CCTGGCGGGG.
  • the inhibitory nucleic acid sequence may comprise a plurality of copies of SEQ ID NO: 6 and/or SEQ ID NO: 9
  • the inhibitory nucleic acid sequence may comprise two copies of SEQ ID NO: 6 and/or SEQ ID NO: 9 separated by a linker sequence.
  • FIG. 1 Schematic drawing of viral gene therapy and inflammatory and immune responses.
  • FIG. 2 Schematic drawing showing TLR9 sensing AAV DNA during viral entry and inflammatory and immune responses. From Rogers et al., 2011, Frontiers in Microbiology, “Innate Immune Responses to AAV Vectors,” vol. 2, article 194.
  • FIGS. 3A-3B show nucleotide sequence of c41 (SEQ ID NO: 1), a single-stranded oligonucleotide.
  • FIG. 3B shows organization of AAV-eGFP and AAV-eGFP-c41 genomes. ITR, inverted terminal repeat; LPA, late polyadenylation signal. Transgene of interest depicted in this case is eGFP. The insertion is of c41 sequence. Spacer depicted in FIG. 3B is shown in SEQ ID NO: 8.
  • FIG. 4 shows NF-kB activity in HEK293 TLR9 cells mock-infected or infected with AAV virus (DJ capsid, self-complementary AAV genome, encoding eGFP). **, p ⁇ 0.005; n.s., not significant. This experiment used a crude viral preparation.
  • FIG. 5 Flow cytometry histograms showing GFP expression in HEK293 TLR9 cells mock-infected or infected with AAV virus with or without c41. This experiment used a crude viral preparation.
  • FIGS. 6A-6B show nucleotide sequence of “telomere” (SEQ ID NO: 9), a single-stranded oligonucleotide containing the (TTAGGG) 4 (SEQ ID NO: 6) motif from mammalian telomeres.
  • FIG. 6B shows organization of AAV-eGFP-telomere genome. The insertion is of “telomere” sequence. Spacers shown in FIG. 6B are SEQ ID NO: 8.
  • FIGS. 7A-7B show the percentage of transduced cells (GFP+) 2 days after infection of a B cell line with similar amounts of indicated AAV viruses, analyzed by flow cytometry.
  • FIG. 7B shows TNF production in the supernatant of primary human CD14+ monocytes 18 hours after infection, as assayed by ELISA.
  • FIG. 8A-8B Engineering a self-complementary AAV vector.
  • FIG. 8A DNA sequences of “c41” and “telomere”.
  • FIG. 8B Genome organization of an AAV vector (scAAV-eGFP) and modified vectors.
  • LpA polyA signal.
  • FIG. 9A-9C Inflammatory response to various AAV vectors in human immune cells in vitro.
  • FIG. 9A Primary human macrophages were infected with AAV2 viruses (MOI: 10 5 vg/cell) and supernatants were collected 18 h later and analyzed by ELISA for TNF levels. Five uM ODN 2006, a CpG-containing oligonucleotide, served as a positive control.
  • FIG. 10A-10E Further characterization of AAV vectors.
  • FIG. 10A DNA sequence of “control”.
  • FIG. 10B Genome organization of modified vectors.
  • FIG. 10C Primary human macrophages were infected with AAV2 viruses similar to ( FIG. 9A ) and analyzed by ELISA for TNF levels.
  • FIG. 11A-11B Primary human macrophages using a different lot of both AAV2 viruses were infected similar to ( FIG. 9A ) and analyzed for TNF levels.
  • FIG. 12A-12C Inflammatory response to intravenous administration of various AAV vectors in adult mice in vivo.
  • FIG. 13 Genome organization of a single-stranded AAV vector (ssAAV-eGFP) and ssAAV-eGFP-5 ⁇ telomere.
  • FIG. 14A-14C Inflammatory and immune response following subretinal administration of various AAV vectors in neonatal mice in vivo.
  • Neonatal CD1 mice P1 received indicated AAV8 viruses (1.8 ⁇ 10 8 vg per mouse eye) by subretinal injections.
  • the animals were euthanized and the eyecup was dissected out.
  • the retina and the rest of the eyecup were analyzed for indicated gene expression by qRT-PCR. Saline injection was set to 1 fold expression for each gene.
  • FIG. 15A-15C Analysis of immune cell markers in the retina following subretinal administration of various AAV vectors in neonatal mice in vivo.
  • FIG. 15A , FIG. 15B and FIG. 15C Similar to ( FIG. 14A-14C ), the retina was analyzed for indicated gene expression by qRT-PCR.
  • Aif1 (Iba1) is known to be expressed in microglia, while Cd4 and Cd8a are markers of helper and cytolytic T cells respectively.
  • FIG. 16 GFP expression in the eye.
  • Neonatal CD1 mice P1 received indicated AAV8 viruses (1.8 ⁇ 10 8 vg per mouse eye) by subretinal injections.
  • FIGS. 17A-17B show nucleotide sequence of c41 (SEQ ID NO: 1), a single-stranded oligonucleotide.
  • FIG. 17B shows organization of AAV-eGFP and AAV-eGFP-c41 genomes. ITR, inverted terminal repeat; LPA, late polyadenylation signal. Transgene of interest depicted in this case is eGFP. The insertion is of c41 sequence. Spacer depicted in FIG. 17B is shown in SEQ ID NO: 8.
  • FIGS. 18A-18B show nucleotide sequence of “telomere” (SEQ ID NO: 9), a single-stranded oligonucleotide containing the (TTAGGG) 4 (SEQ ID NO: 6) motif from mammalian telomeres.
  • FIG. 18B shows organization of AAV-eGFP-telomere genome. The insertion is of “telomere” sequence. Spacers shown in FIG. 18B are SEQ ID NO: 8.
  • the inventors have developed viral vectors and virions that harbor their own protection against host immune and inflammatory systems. These vectors and virions carry short nucleic acid sequences which inhibit the activation of toll-like receptor 9 (TLR9), a host protein which activates inflammatory and immune responses in mammalian cells.
  • TLR9 toll-like receptor 9
  • a short nucleotide sequence for inhibition of TLR9 may be of any origin. It can be bacterial, human, synthetic, or from other sources.
  • One particular sequence is the 20 nucleotide long “c41” [TGGCGCGCACCCACGGCCTG (SEQ ID NO: 1)] from Pseudomonas aeruginosa .
  • Another particular sequence is from human telomeres and comprises (TTAGGG) 4 (SEQ ID NO:6).
  • Other inhibitory sequences are shown in SEQ ID NO: 2-5, 7, 9, and 16-24. Inhibitory sequences may also be used which share at least 80% homology/identity with these sequences.
  • Inhibitory sequences may also be used which share at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and/or at least 99% homology/identity with these sequences.
  • Multiple copies of the inhibitory sequence can be used, either in tandem arrays or separated in the viral vector by spacer or linker sequences or other portions of the viral genome. In some embodiments one, two, three, four, five, six, seven, eight, nine, ten, fifteen, or twenty copies are used. In some embodiments one or more copies of the inhibitory sequence are on the plus strand and some on the minus strand of the virus genome.
  • the inhibitory oligonucleotide sequences are introduced into host cells as part of the viral genome or virion, rather than as a separate agent. This renders the effect of the oligonucleotide sequences local rather than systemic. Moreover, the immune evasion is transient as it occurs during AAV or other virus entry, unlike immune suppression with drugs which can last for weeks. Additionally, it ensures that the beneficial antagonist activity is where it needs to be—with the virus or viral genome. If the virus or viral genome is not replicated in the host cell, then the effect of the oligonucleotide will be transient. If the virus or viral genome is replicated, the effect will be coextensive with the replication.
  • An inhibitory nucleic acid sequence may be inserted into a viral genome using any means of recombinant DNA engineering. This may involve in vitro or in vivo recombination. In vitro recombination may be accomplished using a DNA ligase or other nucleic acid joining enzyme, for example. In vivo recombination may be accomplished by co-transforming a host cell with separate donor molecules that share homology by which they will recombine using host cell machinery. Alternatively, a single donor molecule may recombine in vivo with a host cell sequence. Combinations of these approaches may also be used. Typically the insertion will involve a standard linkage of one deoxyribonucleotide to another (a phosphodiester bond). However, there may be circumstances in which non-standard linkages will be used between the inhibitory nucleic acid sequence and the rest of the viral genome. Optionally, the inhibitory nucleic acid sequence is located in an untranslated region of the viral genome.
  • the genome may optionally contain a therapeutic gene and/or a marker gene.
  • this gene will be a non-viral gene, or a gene that is not naturally present in the viral genome.
  • the gene may be expressible in a mammalian host cell or animal. Expression may be under the control of a viral promoter or a promoter that is introduced with the gene. Expression may be inducible, repressible, condition-responsive, or constitutive, as examples.
  • a therapeutic gene is one which encodes an RNA or protein product beneficial to the host. The benefit may be, for example, to improve health, protect against infection, or remedy a deficiency.
  • the marker may enable one to track the location, the level of replication, the level of propagation, the level of transcription, or the level of translation of the virus or its products or components.
  • Suitable markers include those which are readily detectable, such as fluorescent proteins, chromogenic proteins, etc.
  • a second agent may be used or added for detection of the marker protein or for development of a detectable substance. Introduced genes may be human or non-human, heterologous (from another species) or homologous (from same species) or endogenous (from the same subject).
  • Any DNA viral genome can be used, whether single stranded or double stranded.
  • suitable viruses include without limitation, wild-type or variants of adeno-associated virus (AAV), adenovirus, herpes simplex virus, varicella, variola virus, hepatitis B, cytomegalovirus, JC polyomavirus, BK polyomavirus, monkeypox virus, Herpes Zoster, Epstein-Barr virus, human herpes virus 7, Kaposi's sarcoma-associated herpesvirus, human parvovirus B19, and enterovirus.
  • AAV adeno-associated virus
  • adenovirus herpes simplex virus
  • varicella varicella
  • variola virus hepatitis B
  • JC polyomavirus JC polyomavirus
  • BK polyomavirus monkeypox virus
  • Herpes Zoster Epstein-Barr virus
  • human herpes virus 7 Kaposi's sar
  • Viral vectors in which viral genomes have been modified may also be used.
  • a genome that is modified to encode fewer viral proteins may be used.
  • a viral genome that is modified to encode no viral proteins may be used.
  • Viral genomes may include, by way of non-limiting example, inverted terminal repeats and/or other non-coding genetic elements that facilitate packaging of engineered viral genomes into the capsid.
  • Viral genomes may be delivered to a mammalian host cell as naked DNA, in a liposome, complexed to a polymer, in a condensed or compacted state, in a gold particle, in a virion, or any other means that is suitable for the application.
  • a complete viral genome will be administered, but in some situations, it may be desirable to use a partial genome.
  • the partial genome may be complemented by helper functions provided by the host cell or another genomic or viral entity. Partial genomes may be used, for example, if the therapeutic payload is large and some essential viral functions must be omitted to package.
  • Recombinant viruses may be administered to a mammal or mammalian cells according to any route which is effective for the purpose.
  • the administration may be systemic, e.g., via the blood. It may be delivered orally, subcutaneously, topically, bucally, anally, intramuscularly, intravenously, intratumorally, intracranially, intrathecally, subretinally, etc. Any suitable carrier or vehicle may also be used for administration. It may be desirable to pre-treat the cells or mammal to render them more permeable to or receptive to the recombinant virus. A mammal “in need of” a recombinant virus may be one for whom the virus will be beneficial.
  • the inhibitory nucleic acid sequences we used, as well as others known in the art, may be incorporated into other viruses that, like AAV, have potential utility for humans and other mammals but elicit inflammatory/immune responses that may be undesirable.
  • oncolytic viruses that preferentially infect and lyse cancer cells are used to kill or shrink tumors. These viruses are replicative (unlike AAV vectors used for gene therapy) so they can release new virions to shrink the remaining tumor. Examples include wild-type or variants of herpes simplex virus, adenovirus, and enterovirus.
  • Some reports have shown that immunosuppression by chemotherapy can enhance oncolytic virus therapy, as the immune system normally attempts to inactivate the oncolytic virus, which would prevent it from infecting cancer cells. Therefore, it is possible that incorporating inhibitory oligonucleotides in the genomes of oncolytic viruses like herpes simplex virus may allow it to evade immune clearance and persist longer for oncolysis.
  • AAV vector that has the ability to specifically evade TLR9 activation in immune cells
  • c41 separated by a 5-nucleotide-long spacer (AAAAA; SEQ ID NO: 8) into the 3′ untranslated region of AAV vector encoding enhanced green fluorescent protein (eGFP)
  • eGFP enhanced green fluorescent protein
  • HEK293 cells stably expressing TLR9 HEK293 TLR9 cells
  • NF-kB alkaline phosphatase
  • alkaline phosphatase is secreted into the media and acts on a provided substrate, leading to a change in color of the media that can be measured on a plate reader.
  • AAV-eGFP infection induced a small but statistically significant increase in NF-kB activity ( FIG. 4 ).
  • AAV-eGFP-c41 infection was not significantly different compared to mock-infected cells, indicating that the virus was able to evade eliciting an inflammatory response.
  • telomere a sequence derived from mammalian telomeres that contains the suppressive (TTAGGG) 4 motif (SEQ ID NO: 6), which has been shown to block TLR9 signaling ( FIG. 6A and FIG. 6B ).
  • AAV-eGFP-telomere virus yielded similar viral titers as AAV-eGFP and AAV-eGFP-c41 when titered on HeLa cells, demonstrating that incorporation of “telomere” does not hinder viral packaging and infectivity.
  • both AAV-eGFP-c41 and AAV-eGFP-telomere viruses transduced more cells than AAV-eGFP ( FIG. 7A ). This finding suggests too that incorporation of inhibitory sequences in the genome of AAV increases transgene expression.
  • TNF is a prototypical pro-inflammatory cytokine induced by NF-kB activation.
  • AAV-eGFP infection increased TNF production compared to mock-infection, while AAV-eGFP-c41 and AAV-eGFP-telomere infections showed no or little increase in TNF production ( FIGS. 7A-7B ), showing that the two viruses were able to evade eliciting inflammatory responses.
  • inhibitory oligonucleotides typically 10-30 nucleotides in length
  • eGFP enhanced green fluorescent protein
  • telomere derived from bacteria and mammalian telomeres respectively [52, 57, 58, 61]
  • sc AAV vectors As they have been shown to be more efficient at triggering TLR9 activation and inducing more inflammation in the mouse liver than single-stranded (ss) AAV vectors.
  • ss single-stranded
  • c41 and telomere are predicted to have strong secondary structure, we used an AAAAA linker between copies of the inhibitory oligonucleotide.
  • telomere sequences were placed after the polyA sequence and upstream of the right inverted terminal repeat (ITR) so they would be present in the DNA genome during viral entry, but would be absent from subsequent mRNA transcripts upon successful transduction (“scAAV-eGFP-3 ⁇ c41” and “scAAV-eGFP-3 ⁇ telomere”).
  • ITR right inverted terminal repeat
  • AAV2 serotype and infected primary human monocyte-derived macrophages at a multiplicity of infection (MOI) of 10 5 viral genomes (vg) per cell.
  • MOI multiplicity of infection
  • scAAV-eGFP infection of macrophages elicited robust induction of TNF in the supernatant, a prototypical inflammatory cytokine with well-described roles in stimulating fever, apoptosis and inflammation, and is produced upon TLR9 signaling and NF-kB activation ( FIG. 9A ).
  • scAAV-eGFP-3 ⁇ 41 and scAAV-eGFP-3 ⁇ telomere markedly decreased TNF induction by >95%, indicating that incorporation of “c41” or “telomere” in these viruses could evade eliciting inflammatory responses compared to the wild-type (WT) vector.
  • WT wild-type
  • scAAV-3 ⁇ telomere-eGFP was also able to prevent TNF induction by >95%, demonstrating that the inserted inhibitory oligonucleotides can be placed in other parts of the viral genome and retain the ability to block inflammation.
  • telomere As further characterization, we inserted 3 copies of “control,” a random sequence that does not block TLR9, or 1 copy of “telomere”, into a plasmid harboring the vector genome ( FIG. 10A , FIG. 10B ). We picked the sequence “control” as it has been used as a negative control oligonucleotide in TLR9 experiments. We found that scAAV-eGFP-lx telomere was able to reduce TNF induction compared to scAAV-eGFP in human macrophages, but not as efficiently as scAAV-eGFP-3 ⁇ telomere ( FIG. 10C ). This indicates that 1 copy of telomere can reduce inflammation.
  • AAV vectors are considered biologics and may exhibit lot-to-lot variability
  • FIGS. 9A-9C , FIGS. 10A-10E and FIGS. 11A-11B we conclude that our engineered vectors containing 3 copies of “c41” or “telomere” reduce TNF induction by approximately 75-98% compared to the WT vector.
  • scAAV-eGFP-3 ⁇ telomere reduced ⁇ 85% of TNF induction compared to scAAV-eGFP.
  • Intravenous delivery of AAV is often used to transduce hepatocytes for gene therapy.
  • Kupffer cells resident hepatic antigen-presenting cells
  • inflammatory and innate immune responses 1-9 h later [36].
  • These responses include induction of proinflammatory cytokines such as TNF and IL6 and type I interferons such as IFN- ⁇ .
  • TLR9 ⁇ / ⁇ mice do not exhibit these inflammatory and innate immune responses in the liver, demonstrating a central role for TLR9 in vivo as an innate immune sensor.
  • telomere a telomere derived from human sequences and might be preferable for clinical use.
  • Example 8 Engineing a Single-Stranded AAV Vector and Determining Inflammatory Responses in Eye Tissues of Mice In Vivo
  • ssAAV-eGFP single-stranded AAV vector, ssAAV-eGFP, by inserting 5 copies of “telomere” with AAAAA linkers, followed by another 5 copies but in anti-sense orientation, into the plasmid, giving ssAAV-eGFP-5 ⁇ telomere ( FIG. 13 ). Since both positive and negative strands of the viral genome are equally likely to be packaged into a viral particle, this ensures that each packaged viral genome would have 5 copies of “telomere” in the correct orientation.
  • Two AAV8 viruses were produced and purified. Again, we did not observe differences in titers between the two vectors, suggesting similar packaging efficiency (data not shown). ssAAV-eGFP was selected as it has been previously used for subretinal injections in mice and efficiently transduces photoreceptors in the eye [62].
  • ssAAV-eGFP or ss-AAV-eGFP-5 ⁇ telomere were delivered via subretinal injection into neonates eyes and measured the expression of inflammatory and immune genes.
  • the three mice that received saline injections were uniformly low for Tnf expression in the retina and were set to 1 fold expression ( FIG. 14A ).
  • two mice that received ssAAV-eGFP two exhibited mild upregulation of Tnf (1.9 fold and 8.3 fold), while three animals demonstrated large induction of Tnf (62.2 fold, 534 fold, and 1003 fold), with a mean of 321 fold for the five animals.
  • the engineered vector is able to reduce inflammatory and immune responses in the retina and also augment transgene expression.
  • mice Male, 7-9 weeks old were purchased from the Jackson Laboratory and CD1 mice were purchased from Charles River Laboratories.
  • scAAV-eGFP Single-stranded AAV vectors were used in this study.
  • Self-complementary vectors lack the terminal resolution sequence in one ITR. All vector genomes were flanked by AAV2 ITRs.
  • scAAV-eGFP was purchased from Cell Biolabs (VPK-430) and has been previously described [73].
  • scAAV-eGFP expressed enhanced green fluorescent protein (eGFP) from the cytomegalovirus (CMV) promoter, and included an SV40 intron and SV40 polyA sequence.
  • ssAAV-eGFP has been previously described [62] and was originally obtained from the Harvard DF/HCC DNA Resource Core (clone ID: EvN000061595).
  • ssAAV-eGFP contained a CMV enhancer/promoter, human ⁇ -globin intron, eGFP, and ⁇ -globin polyA sequence.
  • the sequences of “c41” (5′-TGGCGCGCACCCACGGCCTG-3′; SEQ ID NO: 1) derived from Pseudomonas aeruginosa and “telomere” (5′-TTTAGGGTTAGGGTTAGGGTTAGGG-3′; SEQ ID NO: 9; initial T nucleotide is optional for function) derived from mammalian telomeres have been described [52, 57, 58, 61].
  • telomere A widely used “telomere” oligonucleotide (manufactured by Invivogen, catalog code “tlrl-ttag”) harbored an additional T (in bold) compared to published studies and thus was included in the sequence. During the course of this study, Invivogen removed the additional T in their manufactured “telomere” oligonucleotide (catalog code “tlrl-ttag151”). In addition, “control” (5′-GCTAGATGTTAGCGT-3′; SEQ ID NO: 34) was used as a negative control sequence that does not inhibit TLR9 activation (Invivogen, catalog code “tlrl-2088c”).
  • sequences were inserted into the unique SpeI site found immediately 5′ of the right ITR.
  • a unique ClaI site was created immediately 5′ of the inserted sequences, thus allowing ClaI/SpeI sub-cloning of sequences.
  • 3 copies of “c41,” “telomere,” or “control” were inserted, separated by AAAAA linkers, giving scAAV-eGFP-3 ⁇ c41, scAAV-eGFP-3 ⁇ telomere and scAAV-eGFP-3 ⁇ control, respectively.
  • telomere Alternatively, one copy of “telomere” was inserted, with an AAAAA linker (SEQ ID NO: 8), giving scAAV-eGFP-lx telomere.
  • AAAAA linker SEQ ID NO: 8
  • telomere 3 ⁇ telomere between the left ITR and CMV promoter using the unique AvrII site, giving scAAV-3 ⁇ telomere-eGFP.
  • telomere(sense)-5 ⁇ telomere(anti-sense)-NheI was inserted immediately 5′ of the XbaI site adjacent to the right ITR.
  • AAAAA was used as a linker between copies of “telomere”.
  • sense and anti-sense sequences of “telomere” were added as single-stranded AAV vectors have an equal chance of packaging positive or negative strands of the viral genome, thus ensuring that all packaged AAV genomes will carry 5 copies of “telomere” in the right orientation.
  • Self-complementary vectors were packaged into AAV2 (Vigene Biosciences) by triple transfection of HEK293 cells and purified using iodixanol gradient ultracentrifugation and then concentrated to 500 ul using Amicon Ultra-15 columns in PBS.
  • the purified viruses were titered by qPCR using primers derived from ITR and an AAV standard. The final yield of the viruses ranged from 0.5-3 ⁇ 10 13 vg.
  • AAV8 Single-stranded vectors were packaged into AAV8 based on previously described protocols [74, 75]. Briefly, AAV vector, rep2-cap8 packaging plasmid and adenoviral helper plasmid were transfected into HEK293T cells with polyethylenimine and supernatant was collected 72 h after transfection. AAV8 viruses were precipitated with 8.5% w/v PEG8000 and 0.4M NaCl and centrifuged at 7000 g. The pellet was resuspended in lysis buffer (150 mM NaCl and 20 mM Tris, pH 8.0) and MgCl2 was added to a final concentration of 1 mM.
  • lysis buffer 150 mM NaCl and 20 mM Tris, pH 8.0
  • the resuspended viruses were incubated with 25 U/ml Benzonase (Sigma) at 37° C. for 15 min and run on an iodixanol gradient. Recovered AAV vectors were washed 3 times with PBS using Amicon 100K columns (EMD Millipore) and concentrated to 100-500 ul of PBS. Protein gels were run to determine virus titers, using serial dilutions of previous AAV standards for comparison.
  • PBMCs Human peripheral blood mononuclear cells
  • ZenBio Human peripheral blood mononuclear cells
  • CD14+ monocytes were positively selected from PBMCs using anti-CD14 magnetic microbeads according to the manufacturer's instructions (Miltenyi Biotec) or purchased from Stemcell Technologies.
  • monocyte-derived macrophages monocytes were cultured with 50 ng/ml of recombinant human macrophage colony stimulation factor (rhM-CSF, purchased from Peprotech) for 5 to 6 d to allow differentiation into macrophages.
  • rhM-CSF recombinant human macrophage colony stimulation factor
  • HeLa cells are highly permissive for AAV2 vectors and are commonly used to determine the transducing titer of AAV2 vector preparations [76]. Briefly, HeLa cells were seeded overnight in 12 wells and were approximately 80% confluent at time of infection (3 ⁇ 10 5 cells). Cells were infected with serial ten-fold dilutions of viruses at indicated MOIs and incubated for 48 h before fixing with 1% paraformaldehyde in PBS and followed by flow cytometry analysis for GFP+ cells. PBS mock-infected cells were used to determine GFP+ signal.
  • RNAlater solution (OMEGA Bio-Tek).
  • RNA-to-cDNA kit Similar amounts of RNA were reverse transcribed into cDNA with a high-capacity RNA-to-cDNA kit (Thermo Scientific) and similar amounts of cDNA were assayed with quantitative PCR (qPCR) using TaqMan Fast Advanced Master Mix (Thermo Scientific) and commercially available pre-designed primers/probes with FAM reporter dye for the indicated target genes (IDT).
  • qPCR quantitative PCR
  • qMan Fast Advanced Master Mix Thermo Scientific
  • IDT FAM reporter dye for the indicated target genes
  • Expression level for each gene was calculated by normalizing against the housekeeping genes Actb or Gapdh using the AACT method and expressed as fold levels compared to saline-injected mice. All qPCR reactions were run on a realplex 4 Mastercycle (Eppendorf).
  • Eye cups were dissected out by removing the cornea, lens, iris, vitreous body and peripheral muscles. Images of flat-mounted eye cups were taken using a ⁇ 10 objective on a Keyence BZ-x700 microscope. Images used for comparison between groups were taken at the same imaging settings in the same imaging session.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Modified viral genomes are able to reduce induction of inflammatory and immune anti-viral responses. This manifests itself in reduced NF-kB activity, increased viral transduction rates, and increased expression of transgenes. Viral genomes are modified by incorporating one or more oligonucleotide sequences which are able to bind to TLR9 but not induce activation of it. The oligonucleotide sequences may be synthetic, bacterial, human, or from any other source.

Description

    RELATED APPLICATION DATA
  • This application is continuation of PCT/US2017/036525 filed Jun. 8, 2017, which claims priority to U.S. Provisional Application No. 62/347,302 filed on Jun. 8, 2016, each of which is herein incorporated by reference in its entirety for all purposes.
  • FEDERALLY SPONSORED RESEARCH
  • This invention was made with government support under Grant No. HG008525 awarded by National Institutes of Health. The government has certain rights in the invention.
  • TECHNICAL FIELD OF THE INVENTION
  • This invention is related to the area of viral based therapies. In particular, it relates to recombinant viruses.
  • BACKGROUND OF THE INVENTION
  • Gene therapy has immense potential to prevent, treat, and cure multiple human diseases [1]. In 2012, Glybera™ (alipogene tiparvovec) became the first viral gene therapy to be approved for use in the western world [2]. Glybera™ utilizes adeno-associated virus (AAV) as a viral vector to deliver the human lipoprotein lipase (LPL) gene to muscle cells in patients with LPL deficiency [3]. Many AAV clinical trials are currently underway or being planned in the U.S. and the EU [4-6].
  • AAV is a small, non-enveloped virus that packages a single-stranded linear DNA genome that is approximately 5 kb long, and has been adapted for use as a gene transfer vehicle [4]. The coding regions of AAV are flanked by inverted terminal repeats (ITRs), which act as the origins for DNA replication and serve as the primary packaging signal [7, 8]. Both positive and negative strands are packaged into virions equally well and capable of infection [9-11]. In addition, a small deletion in one of the two ITRs allows packaging of self-complementary vectors, in which the genome self-anneals after viral uncoating. This results in more efficient transduction of cells but reduces the coding capacity by half [12, 13]. While AAV is not associated with any human disease, >70% of humans are seropositive for one or most serotypes [14, 15]. Typical routes of administration for AAV vectors include intravenous, intramuscular, subretinal and intracranal injections. AAV gene therapy is most often used to deliver a wild-type gene to treat monogenic diseases, and AAV vectors have been used to transduce cells in the liver, skeletal and cardiac muscle, retina and central nervous system [16-26]. In addition, there is now growing interest in using AAV to deliver CRISPR-Cas9 gene editing or to deliver broadly neutralizing antibodies against infectious diseases such as human immunodeficiency virus (HIV) and influenza A virus [27-32].
  • Despite several advances in gene therapy, a key concern is the inflammatory response elicited by the viral vector [33, 34]. This is best illustrated by a highly publicized case in 1999 when Jesse Gelsinger died four days after gene therapy with adenovirus in a clinical trial due to excessive inflammation [35]. While AAV has been shown to elicit much weaker inflammation in comparison to adenoviruses [36, 37], Glybera™ therapy still includes twelve weeks of immunosuppression, beginning three days before Glybera™ administration [38]. These immunosuppressive and anti-inflammatory drugs (cyclosporine A, mycophenolate mofetil, and methylprednisolone) compromise the patient's immune system during treatment, and all patients still developed neutralizing antibodies against AAV capsid, precluding future re-administration. Furthermore, many AAV gene therapy clinical trials do not utilize immunosuppression prophylactically and only administer corticosteroids upon signs of inflammation or tissue damage, which has been associated with variable therapeutic efficacy [22, 23]. Interestingly, in agreement with their ability to trigger inflammatory and immune responses, AAV vectors have also been developed as vaccine vehicles against infectious diseases and cancer [39-41].
  • Inflammation has been implicated as a critical determinant of successful AAV-mediated transgene expression. A study found that following AAV administration in mice, artificially inducing systemic inflammation such as the upregulation of tumor necrosis factor (TNF), led to a decline in transgene expression in the liver [42]. This indicates that immunological tolerance to AAV-encoded transgene can be broken given sufficient inflammatory responses. Another study characterized inflammation in the murine liver following AAV infection and found transient increases in liver enzymes in the serum, and also liver pathology consistent with portal and lobular inflammation [43]. Strikingly, the authors observed that the use of AAVrh.32.33 viruses, which induced higher liver enzymes than other tested AAV serotypes, also led to a decline in transgene expression to below detection levels, again suggesting that inflammatory and immune responses are associated with poor transgene expression.
  • In hemophilia B clinical trials, it has been observed that a subset of patients exhibited elevated liver enzymes, and this transient transaminitis was accompanied by declining levels of transgene-encoded factor IX [22, 23]. A tapering course of corticosteroid therapy was used on a patient with transaminitis, which subsequently normalized aminotransferase levels in the serum and rescued further decline of factor IX expression. Overall, these observations are compatible with immune-mediated destruction of AAV-transduced hepatocytes and demonstrate that inflammatory and immune responses triggered by AAV administration are a safety concern and can hamper therapeutic efficacy in humans. Thus, it would be advantageous to develop viral vectors that intrinsically evade eliciting inflammation. Furthermore, instead of systemic immunosuppression with drugs, it would be beneficial to avoid triggering specific immune responses.
  • It has been previously shown that the DNA genome of AAV is sensed by Toll-like receptor 9 (TLR9) during AAV's entry into the cell through the endocytic pathway [36, 44]. TLR9 is a pattern recognition receptor (PRR) found on endosomal membranes of immune cells such as B cells, monocytes, macrophages and plasmacytoid dendritic cells, and binds to unmethylated CpG motifs found in the AAV genome [45, 46]. This leads to TLR9 dimerization, which triggers a cascade of signal transduction that activates NF-kB (also known as p52-RelA complex) and induces type I interferons (IFNs). NF-kB in turn drives the transcriptional upregulation of multiple proinflammatory cytokines such as TNF leading to inflammation and immune cell recruitment, while secreted IFNs induce the expression of numerous interferon-stimulated genes (ISGs) and establish an antiviral state. Importantly, genetic ablation of TLR9 in mice abolishes induction of inflammatory cytokines upon AAV treatment in the liver, and also reduces formation of antibodies and T cells against AAV [36]. Thus, TLR9 plays a critical role in stimulating an early inflammatory and innate immune response during AAV infection, which also contributes to priming adaptive immunity. Finally, two other pattern recognition receptors, TLR2 and TLR4, have been implicated in triggering responses to AAV structural proteins [47, 48].
  • In the TLR9 field, a commonly used tool to block TLR9 activation in cell culture is short, single-stranded DNA oligonucleotides that bind TLR9 but do not activate it [49, 50]. Several such sequences are known—some synthetic and others derived from organisms—and they often bear no sequence homology [51-59]. Structural studies have revealed how an inhibitory oligonucleotide binds TLR9 tightly but does not trigger TLR9 dimerization, which is required for TLR9 activation and downstream signaling [60]. In addition to binding TLR9 directly to antagonize its activation, other mechanisms to block TLR9 activation or TLR9-mediated inflammation have been postulated or shown for other TLR9-inhibitory oligonucleotides [reviewed in 49]. These include competing for receptor-mediated endocytosis or phagocytosis, inhibition of TLR9 trafficking or TLR9 processing into a functionally active product, inhibition of endosomal acidification or activity of key proteases in endosomes, or blocking signaling proteins downstream of TLR9. When these inhibitory oligonucleotides are supplied in trans with TLR9 ligands (such as a DNA virus, or a CpG-containing oligonucleotide) in cell culture media, they are endocytosed and can bind to TLR9, preventing its activation by stimulatory ligands. Supplementation of inhibitory oligonucleotides in trans is widely adopted in immunology experiments, but it is unknown in the field if incorporation of these sequences into a viral genome allows it to evade eliciting inflammatory and immune responses.
  • While AAV has been shown to elicit much weaker inflammatory responses in comparison to adenoviruses, Glybera™ alipogene tiparvovec treatment still includes twelve weeks of immunosuppression, beginning three days before Glybera™ alipogene tiparvovec administration. These immunosuppressive drugs strongly hamper T cell activation and therefore compromise the patient's immune system during treatment. It would be advantageous to engineer viral vectors that evade and elicit diminished or no inflammatory response upon administration. Furthermore, it would be beneficial if the immune suppression was not systemic, and if it was transient. Preventing inflammatory and immune responses could also improve transgene expression and may allow the re-administration of the viral vector for future purposes.
  • There is a continuing need in the art to improve the efficacy of viral vectors for therapy and for in vivo production of biological products.
  • SUMMARY OF THE INVENTION
  • According to one aspect of the invention a nucleic acid molecule is provided. It comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation.
  • According to another aspect a recombinant virus is provided for delivery of a desired function to a mammalian cell. The recombinant virus comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation.
  • Another embodiment is an aspect of treating a mammal. The method comprises administering a recombinant virus to a mammal in need thereof. The recombinant virus comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which binds to TLR9 but does not trigger TLR9 activation.
  • Still another aspect is a method of making a viral genome of a recombinant virus. An inhibitory nucleic acid sequence is inserted into a viral genome. The inhibitory nucleic acid sequence binds to TLR9 but does not trigger TLR9 activation.
  • According to one aspect a nucleic acid molecule is provided. It comprises an inverted terminal repeat (ITR) and a nucleic acid sequence which inhibits TLR9-mediated inflammation.
  • Another aspect of the invention is a nucleic acid molecule. The molecule comprises a viral genome covalently linked to an inhibitory nucleic acid sequence which inhibits TLR9-mediated inflammation.
  • Yet another aspect of the invention is a recombinant virus for delivery of a desired function to a mammalian cell. The recombinant virus comprises a viral genome comprising an inhibitory nucleic acid sequence which inhibits TLR9-mediated inflammation.
  • Still another aspect of the invention is a method of making a viral genome of a recombinant virus. A nucleic acid sequence is inserted into a viral genome. The nucleic acid sequence inhibits TLR9-mediated inflammation.
  • According to another aspect of the invention a nucleic acid vector is provided. The vector comprises at least one nucleic acid sequence. The nucleic acid sequence is capable of inhibiting TLR9-mediated inflammation.
  • Another aspect of the invention is a method of reducing immunogenicity of a modified virus having a genome. The method comprises inserting a nucleic acid sequence into the genome. The nucleic acid sequence inhibits TLR9-mediated inflammation. The modified virus causes a reduced inflammatory response in a host as compared to a virus that does not contain the inhibitory sequence.
  • Still another aspect of the invention is a method of increasing expression in a host cell of a virally introduced transgene. The method comprises introducing into a host a modified virus having a genome. The genome comprises a nucleic acid sequence. The nucleic acid sequence inhibits TLR9-mediated inflammation. The modified virus results in higher transgene expression in a host cell as compared to a virus that does not contain the inhibitory sequence.
  • Yet another aspect of the invention is a composition comprising a viral capsid encapsidating a nucleic acid sequence that inhibits TLR9-mediated inflammation.
  • These and other aspects and embodiments which will be apparent to those of skill in the art upon reading the specification provide the art with tools for better treating mammals with viral vectors and virions and for better using viral vectors and virions for producing products of transgenes in host cells, host tissues, and host animals.
  • Any and all of the above described aspects may be combined with any of the following features.
  • The viral genome may be adeno-associated virus (AAV) genome.
  • The viral genome may be selected from the group consisting of adenovirus, herpes simplex virus, varicella, variola virus, hepatitis B, cytomegalovirus, JC polyomavirus, BK polyomavirus, monkeypox virus, Herpes Zoster, Epstein-Barr virus, human herpes virus 7, Kaposi's sarcoma-associated herpesvirus, and human parvovirus B19.
  • The viral genome may be single stranded.
  • The viral genome may be packaged in a virion.
  • The viral genome may comprise a gene which may be expressible in a human cell.
  • The viral genome may be a cytotoxic virus for lysing target tumor cells.
  • The inhibitory nucleic acid sequence may comprise c41 oligonucleotide sequence TGGCGCGCACCCACGGCCTG (SEQ ID NO: 1).
  • The inhibitory nucleic acid sequence may comprise a plurality of copies of c41 sequence (SEQ ID NO: 1).
  • The inhibitory nucleic acid sequence may comprise two copies of c41 sequence (SEQ ID NO: 1) separated by a linker sequence.
  • The linker sequence is AAAAA (SEQ ID NO: 8).
  • The inhibitory nucleic acid sequence may be selected from the group consisting of:
  • ODN 2088:
    (SEQ ID NO: 2)
    TCC TGG CGG GGA AGT;
    ODN 4084-F:
    (SEQ ID NO: 3)
    CCTGGATGGGAA;
    ODN INH-1:
    (SEQ ID NO: 4)
    CCTGGATGGGAATTCCCATCCAGG;
    ODN INH-18:
    (SEQ ID NO: 5)
    CCT GGA TGG GAA CTT ACC GCT GCA;
    ODN TTAGGG:
    (SEQ ID NO: 6)
    TT AGG GTT AGG GTT AGG GTT AGG G;
    and
    G-ODN:
    (SEQ ID NO: 7)
    CTC CTA TTG GGG GTT TCC TAT.
  • The inhibitory nucleic acid sequence may be a bacterial sequence.
  • The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a non-human gene.
  • The inhibitory nucleic acid sequence may be inserted downstream of or in a 3′ untranslated region of the viral genome.
  • The viral genome may be covalently linked to the inhibitory nucleic acid sequence by a phosphodiester bond.
  • The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a detectable marker.
  • The detectable marker may be inducible.
  • The inhibitory nucleic acid sequence may comprise a human telomere sequence shown in SEQ ID NO: 9.
  • The viral genome may be self-complementary.
  • The viral genome may be covalently linked to a plurality of inhibitory nucleic acid sequences.
  • The plurality of inhibitory nucleic acid sequences may comprise an inhibitory sequence and its reverse complement.
  • The inhibitory nucleic acid sequence may comprise three copies of c41 sequence (SEQ ID NO: 1), each copy separated by a linker sequence.
  • The inhibitory nucleic acid sequence may be selected from the group consisting of:
  • ODN 2114:
    (SEQ ID NO: 16)
    TCCTGGAGGGGAAGT;
    ODN 4024:
    (SEQ ID NO: 17)
    TCCTGGATGGGAAGT;
    ODN INH-4:
    (SEQ ID NO: 18)
    TTCCCATCCAGGCCTGGATGGGAA;
    ODN INH-13:
    (SEQ ID NO: 19)
    CTTACCGCTGCACCTGGATGGGAA;
    ODN Poly-G:
    (SEQ ID NO: 20)
    GGGGGGGGGGGGGGGGGGGG;
    ODN GpG:
    (SEQ ID NO: 21)
    TGACTGTGAAGGTTAGAGATGA;
    ODN IRS-869:
    (SEQ ID NO: 22)
    TCCTGGAGGGGTTGT;
    ODN IRS-954:
    (SEQ ID NO: 23)
    TGCTCCTGGAGGGGTTGT;
    and
    ODN 21158:
    (SEQ ID NO: 24)
    CCTGGCGGGG.
  • The inhibitory nucleic acid sequence may be ODN TTAGGG (SEQ ID NO: 6).
  • The inhibitory sequence may be covalently linked to a linker.
  • The inhibitory sequence may be upstream of the linker.
  • The inhibitory nucleic acid sequence may comprise a plurality of copies of ODN TTAGGG (SEQ ID NO: 6).
  • The plurality of copies of ODN TTAGGG (SEQ ID NO: 6) may each be separated by a linker.
  • The inhibitory nucleic acid sequence may comprise at least 2, at least 3, at least 4, or at least 5 copies of ODN TTAGGG (SEQ ID NO: 6), each copy separated by a linker.
  • The inhibitory nucleic acid sequence may be a human sequence.
  • The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a non-human nucleic acid sequence.
  • The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a human gene.
  • The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a human nucleic acid sequence.
  • The inhibitory nucleic acid sequence may be inserted in the 5′ untranslated region of the viral genome.
  • The inhibitory nucleic acid sequence may be inserted upstream of a promoter of the viral genome.
  • The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise an inducible promoter.
  • The inhibitory nucleic acid sequence may comprise two repeated monomers of SEQ ID NO: 1.
  • The inhibitory nucleic acid sequence may comprise three repeated monomers of SEQ ID NO: 1.
  • The inhibitory nucleic acid sequence may comprise SEQ ID NO: 6 or SEQ ID NO: 9.
  • The inhibitory nucleic acid sequence may comprise three repeated monomers of SEQ ID NO: 6 or SEQ ID NO: 9.
  • The inhibitory nucleic acid sequence may comprise five repeated monomers of SEQ ID NO: 6 or SEQ ID NO: 9.
  • The step of administering may be repeated.
  • The viral genome may be packaged in virions.
  • The step of inserting may utilize a DNA ligase.
  • The viral genome may be single stranded when in virions.
  • The viral genome of the recombinant virus may comprise a gene for delivery to and expression in a human cell.
  • The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise a linker separating each of the nucleic acid sequences.
  • The viral genome, recombinant virus, vector, or nucleic acid sequence may comprise at least 2, at least 3, at least 4, or at least 5 copies of the nucleic acid sequence.
  • The inhibitory nucleic acid may be covalently linked to a gene.
  • The inhibitory nucleic acid sequence may be 95% identical to c41 oligonucleotide sequence TGGCGCGCACCCACGGCCTG (SEQ ID NO: 1).
  • The inhibitory nucleic acid sequence may be 95% identical to SEQ ID NO: 9.
  • The inhibitory nucleic acid sequence may be 95% identical to a sequence selected from the group consisting of:
  • ODN 2088:
    (SEQ ID NO: 2)
    TCC TGG CGG GGA AGT;
    ODN 4084-F:
    (SEQ ID NO: 3)
    CCTGGATGGGAA;
    ODN INH-1:
    (SEQ ID NO: 4)
    CCTGGATGGGAATTCCCATCCAGG;
    ODN INH-18:
    (SEQ ID NO: 5)
    CCT GGA TGG GAA CTT ACC GCT GCA;
    ODN TTAGGG:
    (SEQ ID NO: 6)
    TT AGG GTT AGG GTT AGG GTT AGG G;
    and
    G-ODN:
    (SEQ ID NO: 7)
    CTC CTA TTG GGG GTT TCC TAT.
  • The inhibitory nucleic acid sequence may be 95% identical to a sequence selected from the group consisting of:
  • ODN 2114:
    (SEQ ID NO: 16)
    TCCTGGAGGGGAAGT;
    ODN 4024:
    (SEQ ID NO: 17)
    TCCTGGATGGGAAGT;
    ODN INH-4:
    (SEQ ID NO: 18)
    TTCCCATCCAGGCCTGGATGGGAA;
    ODN INH-13:
    (SEQ ID NO: 19)
    CTTACCGCTGCACCTGGATGGGAA;
    ODN Poly-G:
    (SEQ ID NO: 20)
    GGGGGGGGGGGGGGGGGGGG;
    ODN GpG:
    (SEQ ID NO: 21)
    TGACTGTGAAGGTTAGAGATGA;
    ODN IRS-869:
    (SEQ ID NO: 22)
    TCCTGGAGGGGTTGT;
    ODN IRS-954:
    (SEQ ID NO: 23)
    TGCTCCTGGAGGGGTTGT;
    and
    ODN 21158:
    (SEQ ID NO: 24)
    CCTGGCGGGG.
  • The inhibitory nucleic acid sequence may comprise a plurality of copies of SEQ ID NO: 6 and/or SEQ ID NO: 9
  • The inhibitory nucleic acid sequence may comprise two copies of SEQ ID NO: 6 and/or SEQ ID NO: 9 separated by a linker sequence.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1. Schematic drawing of viral gene therapy and inflammatory and immune responses.
  • FIG. 2. Schematic drawing showing TLR9 sensing AAV DNA during viral entry and inflammatory and immune responses. From Rogers et al., 2011, Frontiers in Microbiology, “Innate Immune Responses to AAV Vectors,” vol. 2, article 194.
  • FIGS. 3A-3B. FIG. 3A shows nucleotide sequence of c41 (SEQ ID NO: 1), a single-stranded oligonucleotide. FIG. 3B shows organization of AAV-eGFP and AAV-eGFP-c41 genomes. ITR, inverted terminal repeat; LPA, late polyadenylation signal. Transgene of interest depicted in this case is eGFP. The insertion is of c41 sequence. Spacer depicted in FIG. 3B is shown in SEQ ID NO: 8.
  • FIG. 4 shows NF-kB activity in HEK293 TLR9 cells mock-infected or infected with AAV virus (DJ capsid, self-complementary AAV genome, encoding eGFP). **, p<0.005; n.s., not significant. This experiment used a crude viral preparation.
  • FIG. 5. Flow cytometry histograms showing GFP expression in HEK293 TLR9 cells mock-infected or infected with AAV virus with or without c41. This experiment used a crude viral preparation.
  • FIGS. 6A-6B. FIG. 6A shows nucleotide sequence of “telomere” (SEQ ID NO: 9), a single-stranded oligonucleotide containing the (TTAGGG)4 (SEQ ID NO: 6) motif from mammalian telomeres. FIG. 6B shows organization of AAV-eGFP-telomere genome. The insertion is of “telomere” sequence. Spacers shown in FIG. 6B are SEQ ID NO: 8.
  • FIGS. 7A-7B. FIG. 7A shows the percentage of transduced cells (GFP+) 2 days after infection of a B cell line with similar amounts of indicated AAV viruses, analyzed by flow cytometry. FIG. 7B shows TNF production in the supernatant of primary human CD14+ monocytes 18 hours after infection, as assayed by ELISA.
  • FIG. 8A-8B. Engineering a self-complementary AAV vector. (FIG. 8A) DNA sequences of “c41” and “telomere”. (FIG. 8B) Genome organization of an AAV vector (scAAV-eGFP) and modified vectors. LpA: polyA signal.
  • FIG. 9A-9C Inflammatory response to various AAV vectors in human immune cells in vitro. (FIG. 9A) Primary human macrophages were infected with AAV2 viruses (MOI: 105 vg/cell) and supernatants were collected 18 h later and analyzed by ELISA for TNF levels. Five uM ODN 2006, a CpG-containing oligonucleotide, served as a positive control. (FIG. 9B, FIG. 9C) Primary human CD14+ monocytes from two different donors were infected similar to (A) and analyzed for TNF levels. Data shown are mean±s.d. of n=3 technical replicates. *P<0.05 (unpaired t-test) compared to scAAV-eGFP.
  • FIG. 10A-10E. Further characterization of AAV vectors. (FIG. 10A) DNA sequence of “control”. (FIG. 10B) Genome organization of modified vectors. (FIG. 10C) Primary human macrophages were infected with AAV2 viruses similar to (FIG. 9A) and analyzed by ELISA for TNF levels. (FIG. 10D) Primary human monocytes were infected similar to (FIG. 9B, FIG. 9C) and analyzed by ELISA for TNF levels. Data shown (FIG. 10C, FIG. 10D) are mean±s.d. of n=3 technical replicates. *P<0.05 (unpaired t-test) compared to scAAV-eGFP. (FIG. 10E) Adult C57BL/6 mice were infected with indicated AAV2 viruses similar to (FIG. 12A, FIG. 12B and FIG. 12C) and a piece of the liver was analyzed for indicated gene expression by qRT-PCR. Data shown are mean±s.d. of n=5 mice per condition except n=3 mice for scAAV-eGFP-3×control. *P<0.05 (unpaired t-test) compared to saline condition. N.s.: not significant (P>0.05).
  • FIG. 11A-11B. (FIG. 11A) Primary human macrophages using a different lot of both AAV2 viruses were infected similar to (FIG. 9A) and analyzed for TNF levels. (FIG. 11B) HeLa cells were infected with AAV2 viruses at indicated MOIs and cells were harvested 48 h later and analyzed by flow cytometry for GFP expression. The percentage of GFP positive cells are shown Data shown are mean±s.d. of n=3 technical replicates. *P<0.05 (unpaired t-test) compared to scAAV-eGFP.
  • FIG. 12A-12C Inflammatory response to intravenous administration of various AAV vectors in adult mice in vivo. (FIG. 12A, FIG. 12B and FIG. 12C) Adult C57BL/6 mice were infected with indicated AAV2 viruses (1011 vg per mouse) by tail vein injections. 2 h later, the animals were euthanized and a piece of the liver was analyzed for indicated gene expression by qRT-PCR. Saline injection was set to 1-fold expression for each gene. Data shown are mean±s.d. of n=3 mice per condition (FIG. 12A) or n=4 mice per condition (FIG. 12B and FIG. 12C). *P<0.05 (unpaired t-test) compared to saline condition. N.s.: not significant (P>0.05).
  • FIG. 13. Genome organization of a single-stranded AAV vector (ssAAV-eGFP) and ssAAV-eGFP-5× telomere.
  • FIG. 14A-14C. Inflammatory and immune response following subretinal administration of various AAV vectors in neonatal mice in vivo. (FIG. 14A, FIG. 14B and FIG. 14C) Neonatal CD1 mice (P1) received indicated AAV8 viruses (1.8×108 vg per mouse eye) by subretinal injections. At P21, the animals were euthanized and the eyecup was dissected out. The retina and the rest of the eyecup were analyzed for indicated gene expression by qRT-PCR. Saline injection was set to 1 fold expression for each gene. Each triangle represents an animal. Data shown are n=3 mice (saline) and n=5 mice (each virus) and mean values are indicated.
  • FIG. 15A-15C. Analysis of immune cell markers in the retina following subretinal administration of various AAV vectors in neonatal mice in vivo. (FIG. 15A, FIG. 15B and FIG. 15C) Similar to (FIG. 14A-14C), the retina was analyzed for indicated gene expression by qRT-PCR. Aif1 (Iba1) is known to be expressed in microglia, while Cd4 and Cd8a are markers of helper and cytolytic T cells respectively. Saline injection was set to 1 fold expression for each gene. Each triangle represents an animal. Data shown are n=3 mice (saline) and n=5 mice (each virus) and mean values are indicated.
  • FIG. 16. GFP expression in the eye. Neonatal CD1 mice (P1) received indicated AAV8 viruses (1.8×108 vg per mouse eye) by subretinal injections. At P30, the animals were euthanized and GFP expression was visualized in flat-mounted eye cups. Data shown are n=2 mice per condition.
  • FIGS. 17A-17B. FIG. 17A shows nucleotide sequence of c41 (SEQ ID NO: 1), a single-stranded oligonucleotide. FIG. 17B shows organization of AAV-eGFP and AAV-eGFP-c41 genomes. ITR, inverted terminal repeat; LPA, late polyadenylation signal. Transgene of interest depicted in this case is eGFP. The insertion is of c41 sequence. Spacer depicted in FIG. 17B is shown in SEQ ID NO: 8.
  • FIGS. 18A-18B. FIG. 18A shows nucleotide sequence of “telomere” (SEQ ID NO: 9), a single-stranded oligonucleotide containing the (TTAGGG)4 (SEQ ID NO: 6) motif from mammalian telomeres. FIG. 18B shows organization of AAV-eGFP-telomere genome. The insertion is of “telomere” sequence. Spacers shown in FIG. 18B are SEQ ID NO: 8.
  • DETAILED DESCRIPTION OF THE INVENTION
  • The inventors have developed viral vectors and virions that harbor their own protection against host immune and inflammatory systems. These vectors and virions carry short nucleic acid sequences which inhibit the activation of toll-like receptor 9 (TLR9), a host protein which activates inflammatory and immune responses in mammalian cells.
  • A short nucleotide sequence for inhibition of TLR9 may be of any origin. It can be bacterial, human, synthetic, or from other sources. One particular sequence is the 20 nucleotide long “c41” [TGGCGCGCACCCACGGCCTG (SEQ ID NO: 1)] from Pseudomonas aeruginosa. Another particular sequence is from human telomeres and comprises (TTAGGG)4 (SEQ ID NO:6). Other inhibitory sequences are shown in SEQ ID NO: 2-5, 7, 9, and 16-24. Inhibitory sequences may also be used which share at least 80% homology/identity with these sequences. Inhibitory sequences may also be used which share at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and/or at least 99% homology/identity with these sequences. Multiple copies of the inhibitory sequence can be used, either in tandem arrays or separated in the viral vector by spacer or linker sequences or other portions of the viral genome. In some embodiments one, two, three, four, five, six, seven, eight, nine, ten, fifteen, or twenty copies are used. In some embodiments one or more copies of the inhibitory sequence are on the plus strand and some on the minus strand of the virus genome.
  • The inhibitory oligonucleotide sequences are introduced into host cells as part of the viral genome or virion, rather than as a separate agent. This renders the effect of the oligonucleotide sequences local rather than systemic. Moreover, the immune evasion is transient as it occurs during AAV or other virus entry, unlike immune suppression with drugs which can last for weeks. Additionally, it ensures that the beneficial antagonist activity is where it needs to be—with the virus or viral genome. If the virus or viral genome is not replicated in the host cell, then the effect of the oligonucleotide will be transient. If the virus or viral genome is replicated, the effect will be coextensive with the replication.
  • An inhibitory nucleic acid sequence may be inserted into a viral genome using any means of recombinant DNA engineering. This may involve in vitro or in vivo recombination. In vitro recombination may be accomplished using a DNA ligase or other nucleic acid joining enzyme, for example. In vivo recombination may be accomplished by co-transforming a host cell with separate donor molecules that share homology by which they will recombine using host cell machinery. Alternatively, a single donor molecule may recombine in vivo with a host cell sequence. Combinations of these approaches may also be used. Typically the insertion will involve a standard linkage of one deoxyribonucleotide to another (a phosphodiester bond). However, there may be circumstances in which non-standard linkages will be used between the inhibitory nucleic acid sequence and the rest of the viral genome. Optionally, the inhibitory nucleic acid sequence is located in an untranslated region of the viral genome.
  • The genome may optionally contain a therapeutic gene and/or a marker gene. Typically this gene will be a non-viral gene, or a gene that is not naturally present in the viral genome. The gene may be expressible in a mammalian host cell or animal. Expression may be under the control of a viral promoter or a promoter that is introduced with the gene. Expression may be inducible, repressible, condition-responsive, or constitutive, as examples. A therapeutic gene is one which encodes an RNA or protein product beneficial to the host. The benefit may be, for example, to improve health, protect against infection, or remedy a deficiency. The marker may enable one to track the location, the level of replication, the level of propagation, the level of transcription, or the level of translation of the virus or its products or components. Suitable markers include those which are readily detectable, such as fluorescent proteins, chromogenic proteins, etc. Optionally, a second agent may be used or added for detection of the marker protein or for development of a detectable substance. Introduced genes may be human or non-human, heterologous (from another species) or homologous (from same species) or endogenous (from the same subject).
  • Any DNA viral genome can be used, whether single stranded or double stranded. Examples of suitable viruses which may be used, include without limitation, wild-type or variants of adeno-associated virus (AAV), adenovirus, herpes simplex virus, varicella, variola virus, hepatitis B, cytomegalovirus, JC polyomavirus, BK polyomavirus, monkeypox virus, Herpes Zoster, Epstein-Barr virus, human herpes virus 7, Kaposi's sarcoma-associated herpesvirus, human parvovirus B19, and enterovirus. The virus may be, without limitation, cytotoxic, cytolytic, or cause latent infections. Viral vectors in which viral genomes have been modified may also be used. As an example, a genome that is modified to encode fewer viral proteins may be used. As a further example, a viral genome that is modified to encode no viral proteins may be used. Viral genomes may include, by way of non-limiting example, inverted terminal repeats and/or other non-coding genetic elements that facilitate packaging of engineered viral genomes into the capsid.
  • Viral genomes may be delivered to a mammalian host cell as naked DNA, in a liposome, complexed to a polymer, in a condensed or compacted state, in a gold particle, in a virion, or any other means that is suitable for the application. Typically a complete viral genome will be administered, but in some situations, it may be desirable to use a partial genome. The partial genome may be complemented by helper functions provided by the host cell or another genomic or viral entity. Partial genomes may be used, for example, if the therapeutic payload is large and some essential viral functions must be omitted to package.
  • Recombinant viruses may be administered to a mammal or mammalian cells according to any route which is effective for the purpose. The administration may be systemic, e.g., via the blood. It may be delivered orally, subcutaneously, topically, bucally, anally, intramuscularly, intravenously, intratumorally, intracranially, intrathecally, subretinally, etc. Any suitable carrier or vehicle may also be used for administration. It may be desirable to pre-treat the cells or mammal to render them more permeable to or receptive to the recombinant virus. A mammal “in need of” a recombinant virus may be one for whom the virus will be beneficial. It may be a mammal with a disease or deficiency. It may be one for whom a diagnosis or analysis will be made. It may be one who can benefit from the administered recombinant virus, even though it does not have a disease or deficiency.
  • Taken together, our results show that incorporation of c41 or human telomeric sequences into the AAV genome (a) does not lower viral packaging and infectivity, (b) prevents TLR9-mediated inflammation, (c) reduces induction of pro-inflammatory cytokines, and (d) increases transgene expression. The increased transgene expression may be due to a reduced immune response, as TLR9 activation also induces interferon expression, which triggers an antiviral state. The engineered immune-evasion property we show below is specific (against TLR9), transient (e.g., may occur during viral entry), and does not result in systemic immune suppression (only targets AAV-infected immune cells).
  • The inhibitory nucleic acid sequences we used, as well as others known in the art, may be incorporated into other viruses that, like AAV, have potential utility for humans and other mammals but elicit inflammatory/immune responses that may be undesirable. For example, oncolytic viruses that preferentially infect and lyse cancer cells are used to kill or shrink tumors. These viruses are replicative (unlike AAV vectors used for gene therapy) so they can release new virions to shrink the remaining tumor. Examples include wild-type or variants of herpes simplex virus, adenovirus, and enterovirus. Some reports have shown that immunosuppression by chemotherapy can enhance oncolytic virus therapy, as the immune system normally attempts to inactivate the oncolytic virus, which would prevent it from infecting cancer cells. Therefore, it is possible that incorporating inhibitory oligonucleotides in the genomes of oncolytic viruses like herpes simplex virus may allow it to evade immune clearance and persist longer for oncolysis.
  • The above disclosure generally describes the present invention. All references disclosed herein are expressly incorporated by reference. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention. The disclosure of the invention includes all embodiments explicitly recited in the claims. Additionally, all features disclosed in the dependent claims apply equally to the independent claim from which they are based as to the other independent claims. Thus such combinations of dependent claims with other independent claims are expressly contemplated and disclosed.
  • Example 1—Construction of Modified Viral Genome
  • To engineer an AAV vector that has the ability to specifically evade TLR9 activation in immune cells, we inserted two copies of c41 separated by a 5-nucleotide-long spacer (AAAAA; SEQ ID NO: 8) into the 3′ untranslated region of AAV vector encoding enhanced green fluorescent protein (eGFP) (FIG. 3B). Subsequently, we produced wild-type AAV-eGFP virus and AAV-eGFP-c41 virus (harboring two c41 insertions). Infectious titers of both viruses were comparable (˜109 infectious units/ml, as determined by titering on HeLa cells), suggesting that addition of c41 into the viral genome did not hamper viral packaging and infectivity, an important consideration for viral vectors that have to be mass-produced for gene therapy.
  • Example 2—Modified Viral Genome Reduces NF-kB Activation
  • To measure the inflammatory response, we used HEK293 cells stably expressing TLR9 (HEK293 TLR9 cells), which senses AAV DNA genomes, and also expressing alkaline phosphatase under the transcriptional control of NF-kB. When NF-kB is activated, which indicates inflammation, alkaline phosphatase is secreted into the media and acts on a provided substrate, leading to a change in color of the media that can be measured on a plate reader. We mock-infected HEK293 TLR9 cells or infected them with either AAV-eGFP or AAV-eGFP-c41. In agreement with the literature, AAV-eGFP infection induced a small but statistically significant increase in NF-kB activity (FIG. 4). In contrast, AAV-eGFP-c41 infection was not significantly different compared to mock-infected cells, indicating that the virus was able to evade eliciting an inflammatory response.
  • Example 3—Modified Viral Genome Transduced More Cells and Expresses More Transgene
  • We analyzed the above three conditions (described in FIG. 4) for eGFP expression using flow cytometry. We found that AAV-eGFP-c41 transduced more cells than AAV-eGFP (52.7% GFP+ compared to 34.6% GFP+) (FIG. 5). In addition, GFP+ cells from AAV-eGFP-c41 infection expressed ˜twice as much eGFP as GFP+ cells from AAV-eGFP infection (mean fluorescence intensity [MFI] of 5335 compared to 2749).
  • In summary, we engineered an AAV vector to evade TLR9-mediated inflammation by incorporating an inhibitory oligonucleotide in the viral genome.
  • Example 4—Incorporation of c41 or Telomeric Sequences in AAV Genome Transduced More Cells and Reduced TNF Induction
  • We inserted three copies of “telomere,” a sequence derived from mammalian telomeres that contains the suppressive (TTAGGG)4 motif (SEQ ID NO: 6), which has been shown to block TLR9 signaling (FIG. 6A and FIG. 6B). AAV-eGFP-telomere virus yielded similar viral titers as AAV-eGFP and AAV-eGFP-c41 when titered on HeLa cells, demonstrating that incorporation of “telomere” does not hinder viral packaging and infectivity.
  • When we infected a B cell line with similar amounts of AAV-eGFP or AAV-eGFP-c41 or AAV-eGFP-telomere virus, both AAV-eGFP-c41 and AAV-eGFP-telomere viruses transduced more cells than AAV-eGFP (FIG. 7A). This finding suggests too that incorporation of inhibitory sequences in the genome of AAV increases transgene expression.
  • Subsequently, we harvested primary human CD14+ monocytes from blood and subjected them to similar infection conditions as above. We performed ELISA on the supernatant to analyze TNF production, as TNF is a prototypical pro-inflammatory cytokine induced by NF-kB activation. AAV-eGFP infection increased TNF production compared to mock-infection, while AAV-eGFP-c41 and AAV-eGFP-telomere infections showed no or little increase in TNF production (FIGS. 7A-7B), showing that the two viruses were able to evade eliciting inflammatory responses.
  • Example 5—Engineering a Self-Complementary AAV Vector
  • Investigators often use short inhibitory oligonucleotides (typically 10-30 nucleotides in length) to antagonize TLR9 signaling in cell culture. However, it is unknown if these inhibitory oligonucleotides retain functionality in the context of a much larger viral genome (i.e., the sequence is covalently linked on both ends to much longer sequences). To test this possibility, we utilized a self-complementary (sc) AAV vector encoding enhanced green fluorescent protein (eGFP), and inserted 3 copies of “c41” or “telomere”, derived from bacteria and mammalian telomeres respectively [52, 57, 58, 61], into a plasmid harboring the vector genome (FIGS. 8A and 8B). We started with sc AAV vectors as they have been shown to be more efficient at triggering TLR9 activation and inducing more inflammation in the mouse liver than single-stranded (ss) AAV vectors. As “c41” and “telomere” are predicted to have strong secondary structure, we used an AAAAA linker between copies of the inhibitory oligonucleotide. In addition, 3×c41 and 3× telomere sequences were placed after the polyA sequence and upstream of the right inverted terminal repeat (ITR) so they would be present in the DNA genome during viral entry, but would be absent from subsequent mRNA transcripts upon successful transduction (“scAAV-eGFP-3×c41” and “scAAV-eGFP-3× telomere”). Finally, to determine if the location of inhibitory oligonucleotide in the viral genome matters, we also created a vector where 3× telomere was located between the left ITR and the promoter (“scAAV-3× telomere-eGFP”).
  • Example 6—Inflammatory Responses in Primary Human Macrophages and Monocytes In Vitro
  • We packaged the various AAV vectors into AAV2 serotype and infected primary human monocyte-derived macrophages at a multiplicity of infection (MOI) of 105 viral genomes (vg) per cell. As expected, we found that scAAV-eGFP infection of macrophages elicited robust induction of TNF in the supernatant, a prototypical inflammatory cytokine with well-described roles in stimulating fever, apoptosis and inflammation, and is produced upon TLR9 signaling and NF-kB activation (FIG. 9A). In contrast, both scAAV-eGFP-3×41 and scAAV-eGFP-3× telomere markedly decreased TNF induction by >95%, indicating that incorporation of “c41” or “telomere” in these viruses could evade eliciting inflammatory responses compared to the wild-type (WT) vector. Furthermore, scAAV-3× telomere-eGFP was also able to prevent TNF induction by >95%, demonstrating that the inserted inhibitory oligonucleotides can be placed in other parts of the viral genome and retain the ability to block inflammation. Mock infection with phosphate-buffered saline (PBS) and treatment with ODN 2006, a commercially available CpG-containing oligonucleotide that is known to strongly activate TLR9/NF-kB and inflammation, served as negative and positive controls respectively. We tested primary human CD14+ monocytes and found that again, scAAV-eGFP triggered robust TNF induction while scAAV-eGFP-3×c41 and scAAV-eGFP-3× telomere negated most of the TNF induction (FIG. 9B). scAAV-3× telomere-eGFP likewise reduced TNF induction, although inhibition was ˜85%, which may be due to differences between cell types or donor tissue. The evasion of TNF induction was also reproduced in primary CD14+ monocytes obtained from another donor (FIG. 9C).
  • As further characterization, we inserted 3 copies of “control,” a random sequence that does not block TLR9, or 1 copy of “telomere”, into a plasmid harboring the vector genome (FIG. 10A, FIG. 10B). We picked the sequence “control” as it has been used as a negative control oligonucleotide in TLR9 experiments. We found that scAAV-eGFP-lx telomere was able to reduce TNF induction compared to scAAV-eGFP in human macrophages, but not as efficiently as scAAV-eGFP-3× telomere (FIG. 10C). This indicates that 1 copy of telomere can reduce inflammation. We also observed that scAAV-eGFP-3×control elicited TNF secretion as efficiently as scAAV-eGFP in human monocytes, suggesting that insertion of sequences that inhibit TLR9 are required to block inflammation (FIG. 10D).
  • As AAV vectors are considered biologics and may exhibit lot-to-lot variability, we produced another batch of both scAAV-eGFP and scAAV-eGFP-3× telomere AAV2 viruses, and found that scAAV-eGFP-3× telomere was able to reduce ˜75% of TNF induction compared to the WT vector (FIG. 11A). Based on the multiple viral preps and donor monocytes and macrophages (FIGS. 9A-9C, FIGS. 10A-10E and FIGS. 11A-11B), we conclude that our engineered vectors containing 3 copies of “c41” or “telomere” reduce TNF induction by approximately 75-98% compared to the WT vector. On average, scAAV-eGFP-3× telomere reduced ˜85% of TNF induction compared to scAAV-eGFP. Importantly, we did not observe differences in viral titers (assayed by qPCR for viral genomes) obtained from producing any of the above AAV2 vectors, suggesting that the engineered vectors are not defective in packaging (data not shown). Furthermore, when we infected HeLa cells, a permissive cell line widely used to titer AAV infectivity, with a range of MOIs of scAAV-eGFP and scAAV-eGFP-3× telomere, we did not observe differences in transduction (% GFP+ cells) over 4 logs of viral titers, demonstrating that the engineered vector is equally competent at transducing cells (FIG. 11B).
  • Example 7—Inflammatory Responses in Liver Tissues of Mice In Vivo
  • Intravenous delivery of AAV is often used to transduce hepatocytes for gene therapy. Previous work has shown that upon intravenous administration of AAV, Kupffer cells (resident hepatic antigen-presenting cells) in the liver of mice are capable of sensing sc AAV genomes and triggering inflammatory and innate immune responses 1-9 h later [36]. These responses include induction of proinflammatory cytokines such as TNF and IL6 and type I interferons such as IFN-β. TLR9−/− mice do not exhibit these inflammatory and innate immune responses in the liver, demonstrating a central role for TLR9 in vivo as an innate immune sensor. In addition, immune cells such as neutrophils, macrophages and natural killer (NK) cells infiltrate the liver 2 h after AAV administration. To determine if our engineered vectors can reduce inflammation in the liver in vivo, we administered PBS or equal amounts of scAAV-eGFP or scAAV-eGFP-3× telomere via tail vein injection. We selected scAAV-eGFP-3× telomere for in vivo characterization as “telomere” is derived from human sequences and might be preferable for clinical use. In agreement with previous work, scAAV-eGFP stimulated increased Tnf and 116 expression in the liver (approximately 3 to 10 fold, compared to saline), indicating inflammation (FIG. 12A). In contrast, scAAV-eGFP-3× telomere showed little to no increase in inflammatory markers. We tested more mice in subsequent experiments and found that scAAV-eGFP stimulated statistically significant Tnf induction in the liver compared to saline, while scAAV-eGFP-3× telomere and scAAV-eGFP-3×c41 did not (FIGS. 12B and 12C), demonstrating their ability to evade eliciting inflammation in the liver. Finally, we confirmed that scAAV-eGFP-3×control is not able to prevent inflammation in the liver compared to scAAV-eGFP (FIG. 10E).
  • Example 8—Engineering a Single-Stranded AAV Vector and Determining Inflammatory Responses in Eye Tissues of Mice In Vivo
  • Next, we engineered a single-stranded AAV vector, ssAAV-eGFP, by inserting 5 copies of “telomere” with AAAAA linkers, followed by another 5 copies but in anti-sense orientation, into the plasmid, giving ssAAV-eGFP-5× telomere (FIG. 13). Since both positive and negative strands of the viral genome are equally likely to be packaged into a viral particle, this ensures that each packaged viral genome would have 5 copies of “telomere” in the correct orientation. Two AAV8 viruses were produced and purified. Again, we did not observe differences in titers between the two vectors, suggesting similar packaging efficiency (data not shown). ssAAV-eGFP was selected as it has been previously used for subretinal injections in mice and efficiently transduces photoreceptors in the eye [62].
  • Several studies have suggested that AAV gene therapy in the eye and brain appears to be generally safe [63]. While the eye is often assumed to be an immune-privileged site, it is known to harbor microglia, resident macrophages of the central nervous system which have been reported to express TLR9 and respond to CpG motifs [64-67]. A recent study delivering AAV vectors by subretinal injection in cynomolgus macaques reported dose-related anterior and posterior segment inflammation in the animals, and a macaque was euthanized prematurely due to severe ocular inflammation [68]. Furthermore, vitreous aspirate from the euthanized animal demonstrated the presence of neutrophils and macrophages. Another study utilizing canine models similarly observed anterior and posterior uvetitis upon subretinal injection of AAV vectors, and 3 of 17 eyes developed a multifocal chorioretinitis, which was likewise associated with higher vector doses [69]. These findings strongly suggest that AAV vectors are subject to innate immune surveillance in the eye and can trigger deleterious inflammatory and immune responses.
  • Saline or similar amounts of ssAAV-eGFP or ss-AAV-eGFP-5× telomere were delivered via subretinal injection into neonates eyes and measured the expression of inflammatory and immune genes. The three mice that received saline injections were uniformly low for Tnf expression in the retina and were set to 1 fold expression (FIG. 14A). In contrast, of the five mice that received ssAAV-eGFP, two exhibited mild upregulation of Tnf (1.9 fold and 8.3 fold), while three animals demonstrated large induction of Tnf (62.2 fold, 534 fold, and 1003 fold), with a mean of 321 fold for the five animals. This finding indicates that while there is variability in inflammation, some animals mount a very strong inflammatory response in the retina upon ssAAV-eGFP subretinal injection. The variability may be due to differences in each injection procedure or the immune status of each animal. Strikingly, the five animals receiving ssAAV-eGFP-5× telomere had a mean Tnf induction of 5.6 fold with much less variability, suggesting that ssAAV-eGFP-5× telomere was able to avoid eliciting strong inflammation. Similar results were observed in the rest of the eyecup but at a lower magnitude, indicating inflammation was not restricted to the retina (FIG. 14B). We also measured Ifng expression in the retina, a type II interferon critical for antiviral immune responses [70], and observed a similar pattern (FIG. 14C). Prior studies have suggested that subretinal injection of AAV may trigger immune cell infiltration in the eye. Therefore, we also analyzed expression of genes that are known to be expressed specifically in different types of immune cells. We found 18.2 fold higher expression of Aif1 (encoding Iba1, a specific marker for microglia [71, 72]) in ssAAV-eGFP injections compared to saline, suggesting microglia proliferation and/or activation in the retina (FIG. 15A). In contrast, ssAAV-eGFP-5× telomere only showed 1.9 fold induction of Aif1 expression. In addition, we found 45.8 fold and 41.8 fold induction of Cd4 and Cd8a, markers of CD4+ helper T cells and CD8+ cytolytic T cells respectively, by ssAAV-eGFP, while ssAAV-eGFP-5× telomere only showed 1.5 fold and 3.4 fold induction (FIGS. 15B and 15C). Again, there was considerable variability among mice treated with ssAAV-eGFP with a subset of animals showing robust induction. These results demonstrate that subretinal injection of ssAAV-eGFP administration can stimulate T cells infiltration in the retina, while ssAAV-eGFP-5× telomere strongly diminishes it. Taken together, our data indicate that while ssAAV-eGFP induces robust inflammatory and immune responses in the retina and the surrounding tissue, and significant variability is observed, ssAAV-eGFP-5× telomere is capable of mitigating a large portion of these responses.
  • Given the marked differences in inflammation both in vitro and in vivo, we sought to determine if there are any differences in long-term gene expression. We examined flat-mounted eye cups at P30, 29 d after subretinal injection of the mice, and found that more cells were GFP+ and GFP expression was stronger in ssAAV-eGFP-5× telomere treated eyes compared to ssAAV-eGFP, suggesting enhanced gene expression (FIG. 16). Thus, the engineered vector is able to reduce inflammatory and immune responses in the retina and also augment transgene expression.
  • Example 9—Material and Methods Animals
  • C57BL/6 mice (male, 7-9 weeks old) were purchased from the Jackson Laboratory and CD1 mice were purchased from Charles River Laboratories.
  • AAV Vectors
  • Self-complementary (sc) or single-stranded (ss) AAV vectors were used in this study. Self-complementary vectors lack the terminal resolution sequence in one ITR. All vector genomes were flanked by AAV2 ITRs. scAAV-eGFP was purchased from Cell Biolabs (VPK-430) and has been previously described [73]. scAAV-eGFP expressed enhanced green fluorescent protein (eGFP) from the cytomegalovirus (CMV) promoter, and included an SV40 intron and SV40 polyA sequence. ssAAV-eGFP has been previously described [62] and was originally obtained from the Harvard DF/HCC DNA Resource Core (clone ID: EvN000061595). ssAAV-eGFP contained a CMV enhancer/promoter, human β-globin intron, eGFP, and β-globin polyA sequence. The sequences of “c41” (5′-TGGCGCGCACCCACGGCCTG-3′; SEQ ID NO: 1) derived from Pseudomonas aeruginosa and “telomere” (5′-TTTAGGGTTAGGGTTAGGGTTAGGG-3′; SEQ ID NO: 9; initial T nucleotide is optional for function) derived from mammalian telomeres have been described [52, 57, 58, 61]. A widely used “telomere” oligonucleotide (manufactured by Invivogen, catalog code “tlrl-ttag”) harbored an additional T (in bold) compared to published studies and thus was included in the sequence. During the course of this study, Invivogen removed the additional T in their manufactured “telomere” oligonucleotide (catalog code “tlrl-ttag151”). In addition, “control” (5′-GCTAGATGTTAGCGT-3′; SEQ ID NO: 34) was used as a negative control sequence that does not inhibit TLR9 activation (Invivogen, catalog code “tlrl-2088c”).
  • To engineer scAAV-eGFP, sequences were inserted into the unique SpeI site found immediately 5′ of the right ITR. To facilitate sub-cloning, a unique ClaI site was created immediately 5′ of the inserted sequences, thus allowing ClaI/SpeI sub-cloning of sequences. 3 copies of “c41,” “telomere,” or “control” were inserted, separated by AAAAA linkers, giving scAAV-eGFP-3×c41, scAAV-eGFP-3× telomere and scAAV-eGFP-3× control, respectively. Alternatively, one copy of “telomere” was inserted, with an AAAAA linker (SEQ ID NO: 8), giving scAAV-eGFP-lx telomere. We also inserted 3× telomere between the left ITR and CMV promoter using the unique AvrII site, giving scAAV-3× telomere-eGFP.
  • To engineer ssAAV-eGFP, KpnI-5× telomere(sense)-5× telomere(anti-sense)-NheI was inserted immediately 5′ of the XbaI site adjacent to the right ITR. Again, AAAAA was used as a linker between copies of “telomere”. Both sense and anti-sense sequences of “telomere” were added as single-stranded AAV vectors have an equal chance of packaging positive or negative strands of the viral genome, thus ensuring that all packaged AAV genomes will carry 5 copies of “telomere” in the right orientation.
  • Self-complementary vectors were packaged into AAV2 (Vigene Biosciences) by triple transfection of HEK293 cells and purified using iodixanol gradient ultracentrifugation and then concentrated to 500 ul using Amicon Ultra-15 columns in PBS. The purified viruses were titered by qPCR using primers derived from ITR and an AAV standard. The final yield of the viruses ranged from 0.5-3×1013 vg.
  • Single-stranded vectors were packaged into AAV8 based on previously described protocols [74, 75]. Briefly, AAV vector, rep2-cap8 packaging plasmid and adenoviral helper plasmid were transfected into HEK293T cells with polyethylenimine and supernatant was collected 72 h after transfection. AAV8 viruses were precipitated with 8.5% w/v PEG8000 and 0.4M NaCl and centrifuged at 7000 g. The pellet was resuspended in lysis buffer (150 mM NaCl and 20 mM Tris, pH 8.0) and MgCl2 was added to a final concentration of 1 mM. The resuspended viruses were incubated with 25 U/ml Benzonase (Sigma) at 37° C. for 15 min and run on an iodixanol gradient. Recovered AAV vectors were washed 3 times with PBS using Amicon 100K columns (EMD Millipore) and concentrated to 100-500 ul of PBS. Protein gels were run to determine virus titers, using serial dilutions of previous AAV standards for comparison.
  • Primary Human Monocytes and Monocyte-Derived Macrophages for In Vitro Studies
  • Human peripheral blood mononuclear cells (PBMCs) from unidentified healthy donors were purchased (ZenBio). This study was done in accordance with the ethical guidelines of Harvard Medical School. CD14+ monocytes were positively selected from PBMCs using anti-CD14 magnetic microbeads according to the manufacturer's instructions (Miltenyi Biotec) or purchased from Stemcell Technologies. To obtain monocyte-derived macrophages, monocytes were cultured with 50 ng/ml of recombinant human macrophage colony stimulation factor (rhM-CSF, purchased from Peprotech) for 5 to 6 d to allow differentiation into macrophages. Monocytes and macrophages were either used fresh or cryopreserved for subsequent studies.
  • 1×105 monocytes or macrophages were seeded in 190 ul of RPMI growth media per well in 96 well round bottom plates or 96 well flat bottom plates respectively, and infected with 10 ul AAV2 viruses at indicated MOIs in PBS. Mock infection (addition of 10 ul PBS) and ODN 2006 (final concentration of 5 uM, Invivogen), a CpG-containing oligonucleotide known to activate TLR9 and trigger inflammation, served as negative and positive controls. 18 h after infection, supernatants were collected and clarified by low speed centrifugation, followed by ELISA for human TNF (Thermo Scientific).
  • HeLa Cells Infection
  • HeLa cells are highly permissive for AAV2 vectors and are commonly used to determine the transducing titer of AAV2 vector preparations [76]. Briefly, HeLa cells were seeded overnight in 12 wells and were approximately 80% confluent at time of infection (3×105 cells). Cells were infected with serial ten-fold dilutions of viruses at indicated MOIs and incubated for 48 h before fixing with 1% paraformaldehyde in PBS and followed by flow cytometry analysis for GFP+ cells. PBS mock-infected cells were used to determine GFP+ signal.
  • Liver Studies In Vivo
  • Adult C57BL/6 mice were injected intravenously with 100 ul PBS or AAV2 viruses (1011 vg per animal) by tail vein injection as previously described [36]. 2 h later, the animals were sacrificed and a portion of the right median lobe of the liver was saved in RNAlater solution (Thermo Scientific). Total RNA was extracted from 10-30 mg of mechanically disrupted liver sample by using an RNA extraction kit (OMEGA Bio-Tek). Similar amounts of RNA were reverse transcribed into cDNA with a high-capacity RNA-to-cDNA kit (Thermo Scientific) and similar amounts of cDNA were assayed with quantitative PCR (qPCR) using TaqMan Fast Advanced Master Mix (Thermo Scientific) and commercially available pre-designed primers/probes with FAM reporter dye for the indicated target genes (IDT). Expression level for each gene was calculated by normalizing against the housekeeping genes Actb or Gapdh using the AACT method and expressed as fold levels compared to saline-injected mice. All qPCR reactions were run on a realplex4 Mastercycle (Eppendorf).
  • Eye Studies In Vivo
  • Subretinal injection into postnatal day 1 (P1) CD1 neonate eyes were performed as previously described [74, 75]. Approximately 0.2 ul AAV8 virus (1.8×108 vg per eye) was introduced into the subretinal space using a pulled angled glass pipette controlled by a FemtoJet (Eppendorf). At P21, animals were sacrificed and the eyecup was dissected out. The retina and the rest of the eyecup were subjected to RNA extraction, reverse transcription, and qPCR as described in the liver studies. To visualize GFP expression by histology, eyes were excised at P30, fixed in 4% paraformaldehyde for 2 h, and washed in PBS 3 times. Eye cups were dissected out by removing the cornea, lens, iris, vitreous body and peripheral muscles. Images of flat-mounted eye cups were taken using a ×10 objective on a Keyence BZ-x700 microscope. Images used for comparison between groups were taken at the same imaging settings in the same imaging session.
  • Statistics
  • Unpaired two-tailed Student's t-tests were used to compare differences between two unpaired experimental groups in all cases. A P value of <0.05 was considered statistically significant. No pre-specified effect size was assumed and in general three to five replicates for each condition was used.
  • REFERENCES
    • 1. Naldini L. Gene therapy returns to centre stage. Nature. 2015; 526(7573):351-60. doi: 10.1038/nature15818. PubMed PMID: 26469046.
    • 2. Yla-Herttuala S. Endgame: glybera finally recommended for approval as the first gene therapy drug in the European union. Mol Ther. 2012; 20(10):1831-2. doi: 10.1038/mt.2012.194. PubMed PMID: 23023051; PubMed Central PMCID: PMCPMC3464639.
    • 3. Gaudet D, Methot J, Kastelein J. Gene therapy for lipoprotein lipase deficiency. Curr Opin Lipidol. 2012; 23(4):310-20. doi: 10.1097/MOL.0b013e3283555a7e. PubMed PMID: 22691709.
    • 4. Samulski R J, Muzyczka N. AAV-Mediated Gene Therapy for Research and Therapeutic Purposes. Annu Rev Virol. 2014; 1(1):427-51. doi: 10.1146/annurev-virology-031413-085355. PubMed PMID: 26958729.
    • 5. Mingozzi F, High K A. Therapeutic in vivo gene transfer for genetic disease using AAV: progress and challenges. Nat Rev Genet. 2011; 12(5):341-55. doi: 10.1038/nrg2988. PubMed PMID: 21499295.
    • 6. Kotterman M A, Schaffer D V. Engineering adeno-associated viruses for clinical gene therapy. Nat Rev Genet. 2014; 15(7):445-51. doi: 10.1038/nrg3742. PubMed PMID: 24840552; PubMed Central PMCID: PMCPMC4393649.
    • 7. McLaughlin S K, Collis P, Hermonat P L, Muzyczka N. Adeno-associated virus general transduction vectors: analysis of proviral structures. J Virol. 1988; 62(6):1963-73. PubMed PMID: 2835501; PubMed Central PMCID: PMCPMC253280.
    • 8. Hauswirth W W, Berns K I. Origin and termination of adeno-associated virus DNA replication. Virology. 1977; 78(2):488-99. PubMed PMID: 867815.
    • 9. Zhong L, Zhou X, Li Y, Qing K, Xiao X, Samulski R J, et al. Single-polarity recombinant adeno-associated virus 2 vector-mediated transgene expression in vitro and in vivo: mechanism of transduction. Mol Ther. 2008; 16(2):290-5. doi: 10.1038/sj.mt.6300376. PubMed PMID: 18087261.
    • 10. Zhou X, Zeng X, Fan Z, Li C, McCown T, Samulski R J, et al. Adeno-associated virus of a single-polarity DNA genome is capable of transduction in vivo. Mol Ther. 2008; 16(3):494-9. doi: 10.1038/sj.mt.6300397. PubMed PMID: 18180769.
    • 11. Samulski R J, Chang L S, Shenk T. A recombinant plasmid from which an infectious adeno-associated virus genome can be excised in vitro and its use to study viral replication. J Virol. 1987; 61(10):3096-101. PubMed PMID: 3041032; PubMed Central PMCID: PMCPMC255885.
    • 12. McCarty D M. Self-complementary AAV vectors; advances and applications. Mol Ther. 2008; 16(10):1648-56. doi: 10.1038/mt.2008.171. PubMed PMID: 18682697.
    • 13. McCarty D M, Monahan P E, Samulski R J. Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther. 2001; 8(16):1248-54. doi: 10.1038/sj.gt.3301514. PubMed PMID: 11509958.
    • 14. Calcedo R, Morizono H, Wang L, McCarter R, He J, Jones D, et al. Adeno-associated virus antibody profiles in newborns, children, and adolescents. Clin Vaccine Immunol. 2011; 18(9):1586-8. doi: 10.1128/CVI.05107-11. PubMed PMID: 21775517; PubMed Central PMCID: PMCPMC3165215.
    • 15. Calcedo R, Vandenberghe L H, Gao G, Lin J, Wilson J M. Worldwide epidemiology of neutralizing antibodies to adeno-associated viruses. J Infect Dis. 2009; 199(3):381-90. doi: 10.1086/595830. PubMed PMID: 19133809.
    • 16. Bainbridge J W, Smith A J, Barker S S, Robbie S, Henderson R, Balaggan K, et al. Effect of gene therapy on visual function in Leber's congenital amaurosis. N Engl J Med. 2008; 358(21):2231-9. doi: 10.1056/NEJMoa0802268. PubMed PMID: 18441371.
    • 17. Maguire A M, High K A, Auricchio A, Wright J F, Pierce E A, Testa F, et al. Age-dependent effects of RPE65 gene therapy for Leber's congenital amaurosis: a phase 1 dose-escalation trial. Lancet. 2009; 374(9701):1597-605. doi: 10.1016/S0140-6736(09)61836-5. PubMed PMID: 19854499; PubMed Central PMCID: PMCPMC4492302.
    • 18. Maguire A M, Simonelli F, Pierce E A, Pugh E N, Jr., Mingozzi F, Bennicelli J, et al. Safety and efficacy of gene transfer for Leber's congenital amaurosis. N Engl J Med. 2008; 358(21):2240-8. doi: 10.1056/NEJMoa0802315. PubMed PMID: 18441370; PubMed Central PMCID: PMCPMC2829748.
    • 19. Jacobson S G, Cideciyan A V, Ratnakaram R, Heon E, Schwartz S B, Roman A J, et al. Gene therapy for leber congenital amaurosis caused by RPE65 mutations: safety and efficacy in 15 children and adults followed up to 3 years. Arch Ophthalmol. 2012; 130(1):9-24. doi: 10.1001/archophthalmo1.2011.298. PubMed PMID: 21911650; PubMed Central PMCID: PMCPMC3600816.
    • 20. Kaplitt M G, Feigin A, Tang C, Fitzsimons H L, Mattis P, Lawlor P A, et al. Safety and tolerability of gene therapy with an adeno-associated virus (AAV) borne GAD gene for Parkinson's disease: an open label, phase I trial. Lancet. 2007; 369(9579):2097-105. doi: 10.1016/S0140-6736(07)60982-9. PubMed PMID: 17586305.
    • 21. Leone P, Shera D, McPhee S W, Francis J S, Kolodny E H, Bilaniuk L T, et al. Long-term follow-up after gene therapy for canavan disease. Sci Transl Med. 2012; 4(165):165ra3. doi: 10.1126/scitranslmed.3003454. PubMed PMID: 23253610; PubMed Central PMCID: PMCPMC3794457.
    • 22. Manno C S, Pierce G F, Arruda V R, Glader B, Ragni M, Rasko J J, et al. Successful transduction of liver in hemophilia by AAV-Factor IX and limitations imposed by the host immune response. Nat Med. 2006; 12(3):342-7. doi: 10.1038/nm1358. PubMed PMID: 16474400.
    • 23. Nathwani A C, Tuddenham E G, Rangarajan S, Rosales C, McIntosh J, Linch D C, et al. Adenovirus-associated virus vector-mediated gene transfer in hemophilia B. N Engl J Med. 2011; 365(25):2357-65. doi: 10.1056/NEJMoa1108046. PubMed PMID: 22149959; PubMed Central PMCID: PMCPMC3265081.
    • 24. Carpentier A C, Frisch F, Labbe S M, Gagnon R, de Wal J, Greentree S, et al. Effect of alipogene tiparvovec (AAV1-LPL(S447X)) on postprandial chylomicron metabolism in lipoprotein lipase-deficient patients. J Clin Endocrinol Metab. 2012; 97(5):1635-44. doi: 10.1210/jc.2011-3002. PubMed PMID: 22438229.
    • 25. Manno C S, Chew A J, Hutchison S, Larson P J, Herzog R W, Arruda V R, et al. AAV-mediated factor I X gene transfer to skeletal muscle in patients with severe hemophilia B. Blood. 2003; 101(8):2963-72. doi: 10.1182/blood-2002-10-3296. PubMed PMID: 12515715.
    • 26. Jaski B E, Jessup M L, Mancini D M, Cappola T P, Pauly D F, Greenberg B, et al. Calcium upregulation by percutaneous administration of gene therapy in cardiac disease (CUPID Trial), a first-in-human phase 1/2 clinical trial. J Card Fail. 2009; 15(3):171-81. doi: 10.1016/j.cardfail.2009.01.013. PubMed PMID: 19327618; PubMed Central PMCID: PMCPMC2752875.
    • 27. Ran F A, Cong L, Yan W X, Scott D A, Gootenberg J S, Kriz A J, et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015; 520(7546):186-91. doi: 10.1038/nature14299. PubMed PMID: 25830891; PubMed Central PMCID: PMCPMC4393360.
    • 28. Balazs A B, Chen J, Hong C M, Rao D S, Yang L, Baltimore D. Antibody-based protection against HIV infection by vectored immunoprophylaxis. Nature. 2011; 481(7379):81-4. doi: 10.1038/nature10660. PubMed PMID: 22139420; PubMed Central PMCID: PMCPMC3253190.
    • 29. Gardner M R, Kattenhorn L M, Kondur H R, von Schaewen M, Dorfman T, Chiang J J, et al. AAV-expressed eCD4-Ig provides durable protection from multiple SHIV challenges. Nature. 2015; 519(7541):87-91. doi: 10.1038/nature14264. PubMed PMID: 25707797; PubMed Central PMCID: PMCPMC4352131.
    • 30. Adam V S, Crosariol M, Kumar S, Ge M Q, Czack S E, Roy S, et al. Adeno-associated virus 9-mediated airway expression of antibody protects old and immunodeficient mice against influenza virus. Clin Vaccine Immunol. 2014; 21(11):1528-33. doi: 10.1128/CVI.00572-14. PubMed PMID: 25209558; PubMed Central PMCID: PMCPMC4248762.
    • 31. Balazs A B, Bloom J D, Hong C M, Rao D S, Baltimore D. Broad protection against influenza infection by vectored immunoprophylaxis in mice. Nat Biotechnol. 2013; 31(7):647-52. doi: 10.1038/nbt.2618. PubMed PMID: 23728362; PubMed Central PMCID: PMCPMC4030719.
    • 32. Swiech L, Heidenreich M, Banerjee A, Habib N, Li Y, Trombetta J, et al. In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nat Biotechnol. 2015; 33(1):102-6. doi: 10.1038/nbt.3055. PubMed PMID: 25326897; PubMed Central PMCID: PMCPMC4492112.
    • 33. Gene-therapy trials must proceed with caution. Nature. 2016; 534(7609):590. doi: 10.1038/534590a. PubMed PMID: 27357758.
    • 34. Retracing events. Nat Biotechnol. 2007; 25(9):949. doi: 10.1038/nbt0907-949. PubMed PMID: 17846606.
    • 35. Sibbald B. Death but one unintended consequence of gene-therapy trial. CMAJ. 2001; 164(11):1612. PubMed PMID: 11402803; PubMed Central PMCID: PMCPMC81135.
    • 36. Martino A T, Suzuki M, Markusic D M, Zolotukhin I, Ryals R C, Moghimi B, et al. The genome of self-complementary adeno-associated viral vectors increases Toll-like receptor 9-dependent innate immune responses in the liver. Blood. 2011; 117(24):6459-68. doi: 10.1182/blood-2010-10-314518. PubMed PMID: 21474674; PubMed Central PMCID: PMCPMC3123017.
    • 37. Zaiss A K, Liu Q, Bowen G P, Wong N C, Bartlett J S, Muruve D A. Differential activation of innate immune responses by adenovirus and adeno-associated virus vectors. J Virol. 2002; 76(9):4580-90. PubMed PMID: 11932423; PubMed Central PMCID: PMCPMC155101.
    • 38. Ferreira V, Petry H, Salmon F. Immune Responses to AAV-Vectors, the Glybera Example from Bench to Bedside. Front Immunol. 2014; 5:82. doi: 10.3389/fimmu.2014.00082. PubMed PMID: 24624131; PubMed Central PMCID: PMCPMC3939780.
    • 39. Manning W C, Paliard X, Zhou S, Pat Bland M, Lee A Y, Hong K, et al. Genetic immunization with adeno-associated virus vectors expressing herpes simplex virus type 2 glycoproteins B and D. J Virol. 1997; 71(10):7960-2. PubMed PMID: 9311887; PubMed Central PMCID: PMCPMC192154.
    • 40. Liu D W, Tsao Y P, Kung J T, Ding Y A, Sytwu H K, Xiao X, et al. Recombinant adeno-associated virus expressing human papillomavirus type 16 E7 peptide DNA fused with heat shock protein DNA as a potential vaccine for cervical cancer. J Virol. 2000; 74(6):2888-94. PubMed PMID: 10684306; PubMed Central PMCID: PMCPMC111780.
    • 41. Xin K Q, Urabe M, Yang J, Nomiyama K, Mizukami H, Hamajima K, et al. A novel recombinant adeno-associated virus vaccine induces a long-term humoral immune response to human immunodeficiency virus. Hum Gene Ther. 2001; 12(9):1047-61. doi: 10.1089/104303401750214276. PubMed PMID: 11399227.
    • 42. Breous E, Somanathan S, Bell P, Wilson J M Inflammation promotes the loss of adeno-associated virus-mediated transgene expression in mouse liver. Gastroenterology. 2011; 141(1):348-57, 57 e1-3. doi: 10.1053/j.gastro.2011.04.002. PubMed PMID: 21640112; PubMed Central PMCID: PMCPMC3269906.
    • 43. Wang L, Wang H, Bell P, McCarter R J, He J, Calcedo R, et al. Systematic evaluation of AAV vectors for liver directed gene transfer in murine models. Mol Ther. 2010; 18(1):118-25. doi: 10.1038/mt.2009.246. PubMed PMID: 19861950; PubMed Central PMCID: PMCPMC2839210.
    • 44. Zhu J, Huang X, Yang Y. The TLR9-MyD88 pathway is critical for adaptive immune responses to adeno-associated virus gene therapy vectors in mice. J Clin Invest. 2009; 119(8):2388-98. doi: 10.1172/JCI37607. PubMed PMID: 19587448; PubMed Central PMCID: PMCPMC2719948.
    • 45. Kumagai Y, Takeuchi O, Akira S. TLR9 as a key receptor for the recognition of DNA. Adv Drug Deliv Rev. 2008; 60(7):795-804. doi: 10.1016/j.addr.2007.12.004. PubMed PMID: 18262306.
    • 46. Rogers G L, Martino A T, Aslanidi G V, Jayandharan G R, Srivastava A, Herzog R W. Innate Immune Responses to AAV Vectors. Front Microbiol. 2011; 2:194. doi: 10.3389/fmicb.2011.00194. PubMed PMID: 21954398; PubMed Central PMCID: PMCPMC3175613.
    • 47. Hosel M, Broxtermann M, Janicki H, Esser K, Arzberger S, Hartmann P, et al. Toll-like receptor 2-mediated innate immune response in human nonparenchymal liver cells toward adeno-associated viral vectors. Hepatology. 2012; 55(1):287-97. doi: 10.1002/hep.24625. PubMed PMID: 21898480.
    • 48. Hensley S E, Amalfitano A. Toll-like receptors impact on safety and efficacy of gene transfer vectors. Mol Ther. 2007; 15(8):1417-22. doi: 10.1038/sj.mt.6300217. PubMed PMID: 17551505.
    • 49. Lenert P S. Classification, mechanisms of action, and therapeutic applications of inhibitory oligonucleotides for Toll-like receptors (TLR) 7 and 9. Mediators Inflamm. 2010; 2010:986596. doi: 10.1155/2010/986596. PubMed PMID: 20490286; PubMed Central PMCID: PMCPMC2873634.
    • 50. Trieu A, Roberts T L, Dunn J A, Sweet M J, Stacey K J. DNA motifs suppressing TLR9 responses. Crit Rev Immunol. 2006; 26(6):527-44. PubMed PMID: 17341193.
    • 51. Krieg A M, Wu T, Weeratna R, Efler S M, Love-Homan L, Yang L, et al. Sequence motifs in adenoviral DNA block immune activation by stimulatory CpG motifs. Proc Natl Acad Sci USA. 1998; 95(21):12631-6. PubMed PMID: 9770537; PubMed Central PMCID: PMCPMC22882.
    • 52. Gursel I, Gursel M, Yamada H, Ishii K J, Takeshita F, Klinman D M. Repetitive elements in mammalian telomeres suppress bacterial DNA-induced immune activation. J Immunol. 2003; 171(3):1393-400. PubMed PMID: 12874230.
    • 53. Stunz L L, Lenert P, Peckham D, Yi A K, Haxhinasto S, Chang M, et al. Inhibitory oligonucleotides specifically block effects of stimulatory CpG oligonucleotides in B cells. Eur J Immunol. 2002; 32(5):1212-22. doi: 10.1002/1521-4141(200205)32:5&lt; 1212::AID-IMMU1212&gt; 3.0.00; 2-D. PubMed PMID: 11981808.
    • 54. Lenert P, Rasmussen W, Ashman R F, Ballas Z K. Structural characterization of the inhibitory DNA motif for the type A (D)-CpG-induced cytokine secretion and N K-cell lytic activity in mouse spleen cells. DNA Cell Biol. 2003; 22(10):621-31. doi: 10.1089/104454903770238094. PubMed PMID: 14611683.
    • 55. Lenert P, Yasuda K, Busconi L, Nelson P, Fleenor C, Ratnabalasuriar R S, et al. DNA-like class R inhibitory oligonucleotides (INH-ODNs) preferentially block autoantigen-induced B-cell and dendritic cell activation in vitro and autoantibody production in lupus-prone MRL-Fas(lpr/lpr) mice in vivo. Arthritis Res Ther. 2009; 11(3):R79. doi: 10.1186/ar2710. PubMed PMID: 19476613; PubMed Central PMCID: PMCPMC2714127.
    • 56. Lenert P S. Targeting Toll-like receptor signaling in plasmacytoid dendritic cells and autoreactive B cells as a therapy for lupus. Arthritis Res Ther. 2006; 8(1):203. doi: 10.1186/ar1888. PubMed PMID: 16542467; PubMed Central PMCID: PMCPMC1526546.
    • 57. Kaminski J J, Schattgen S A, Tzeng T C, Bode C, Klinman D M, Fitzgerald K A. Synthetic oligodeoxynucleotides containing suppressive TTAGGG motifs inhibit AIM2 inflammasome activation. J Immunol. 2013; 191(7):3876-83. doi: 10.4049/jimmunol.1300530. PubMed PMID: 23986531; PubMed Central PMCID: PMCPMC3878640.
    • 58. Shirota H, Gursel I, Gursel M, Klinman D M. Suppressive oligodeoxynucleotides protect mice from lethal endotoxic shock. J Immunol. 2005; 174(8):4579-83. PubMed PMID: 15814679.
    • 59. Peter M, Bode K, Lipford G B, Eberle F, Heeg K, Dalpke A H. Characterization of suppressive oligodeoxynucleotides that inhibit Toll-like receptor-9-mediated activation of innate immunity. Immunology. 2008; 123(1):118-28. doi: 10.1111/j.1365-2567.2007.02718.x. PubMed PMID: 17961163; PubMed Central PMCID: PMCPMC2433270.
    • 60. Ohto U, Shibata T, Tanji H, Ishida H, Krayukhina E, Uchiyama S, et al. Structural basis of CpG and inhibitory DNA recognition by Toll-like receptor 9. Nature. 2015; 520(7549):702-5. doi: 10.1038/nature14138. PubMed PMID: 25686612.
    • 61. Li Y, Cao H, Wang N, Xiang Y, Lu Y, Zhao K, et al. A novel antagonist of TLR9 blocking all classes of immunostimulatory CpG-ODNs. Vaccine. 2011; 29(11):2193-8. doi: 10.1016/j.vaccine.2010.10.042. PubMed PMID: 21036131.
    • 62. Xiong W, MacColl Garfinkel A E, Li Y, Benowitz L I, Cepko C L. NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage. J Clin Invest. 2015; 125(4):1433-45. doi: 10.1172/JCI79735. PubMed PMID: 25798616; PubMed Central PMCID: PMCPMC4396467.
    • 63. Mingozzi F, High K A. Immune responses to AAV vectors: overcoming barriers to successful gene therapy. Blood. 2013; 122(1):23-36. doi: 10.1182/blood-2013-01-306647. PubMed PMID: 23596044; PubMed Central PMCID: PMCPMC3701904.
    • 64. Karlstetter M, Ebert S, Langmann T. Microglia in the healthy and degenerating retina: insights from novel mouse models. Immunobiology. 2010; 215(9-10):685-91. doi: 10.1016/j.imbio.2010.05.010. PubMed PMID: 20573418.
    • 65. Chinnery H R, Naranjo Golborne C, Leong C M, Chen W, Forrester J V, McMenamin P G. Retinal Microglial Activation Following Topical Application of Intracellular Toll-Like Receptor Ligands. Invest Ophthalmol Vis Sci. 2015; 56(12):7377-86. doi: 10.1167/iovs.15-17587. PubMed PMID: 26574796.
    • 66. Doi Y, Mizuno T, Maki Y, Jin S, Mizoguchi H, Ikeyama M, et al. Microglia activated with the toll-like receptor 9 ligand CpG attenuate oligomeric amyloid {beta} neurotoxicity in in vitro and in vivo models of Alzheimer's disease. Am J Pathol. 2009; 175(5):2121-32. doi: 10.2353/ajpath.2009.090418. PubMed PMID: 19834064; PubMed Central PMCID: PMCPMC2774075.
    • 67. Chinnery H R, McLenachan S, Binz N, Sun Y, Forrester J V, Degli-Esposti M A, et al. TLR9 ligand CpG-ODN applied to the injured mouse cornea elicits retinal inflammation. Am J Pathol. 2012; 180(1):209-20. doi: 10.1016/j.ajpath.2011.09.041. PubMed PMID: 22085974; PubMed Central PMCID: PMCPMC3338340.
    • 68. Ye G J, Budzynski E, Sonnentag P, Nork T M, Miller P E, Sharma A K, et al. Safety and Biodistribution Evaluation in Cynomolgus Macaques of rAAV2tYF-PR1.7-hCNGB3, a Recombinant AAV Vector for Treatment of Achromatopsia. Hum Gene Ther Clin Dev. 2016. doi: 10.1089/hum.2015.164. PubMed PMID: 26956923.
    • 69. Komaromy A M, Alexander J J, Rowlan J S, Garcia M M, Chiodo V A, Kaya A, et al. Gene therapy rescues cone function in congenital achromatopsia. Hum Mol Genet. 2010; 19(13):2581-93. doi: 10.1093/hmg/ddq136. PubMed PMID: 20378608; PubMed Central PMCID: PMCPMC2883338.
    • 70. Schoenborn J R, Wilson C B. Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 2007; 96:41-101. doi: 10.1016/S0065-2776(07)96002-2. PubMed PMID: 17981204.
    • 71. Imai Y, Ibata I, Ito D, Ohsawa K, Kohsaka S. A novel gene ibal in the major histocompatibility complex class III region encoding an E F hand protein expressed in a monocytic lineage. Biochem Biophys Res Commun. 1996; 224(3):855-62. doi: 10.1006/bbrc.1996.1112. PubMed PMID: 8713135.
    • 72. Ito D, Imai Y, Ohsawa K, Nakajima K, Fukuuchi Y, Kohsaka S. Microglia-specific localisation of a novel calcium binding protein, Iba1. Brain Res Mol Brain Res. 1998; 57(1):1-9. PubMed PMID: 9630473.
    • 73. Gray J T, Zolotukhin S. Design and construction of functional AAV vectors. Methods Mol Biol. 2011; 807:25-46. doi: 10.1007/978-1-61779-370-7_2. PubMed PMID: 22034025.
    • 74. Matsuda T, Cepko C L. Electroporation and RNA interference in the rodent retina in vivo and in vitro. Proc Natl Acad Sci USA. 2004; 101(1):16-22. doi: 10.1073/pnas.2235688100. PubMed PMID: 14603031; PubMed Central PMCID: PMCPMC314130.
    • 75. Wang S, Sengel C, Emerson M M, Cepko C L. A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014; 30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. PubMed PMID: 25155555; PubMed Central PMCID: PMCPMC4304698.
    • 76. Martino A T, Herzog R W, Anegon I, Adjali O. Measuring immune responses to recombinant AAV gene transfer. Methods Mol Biol. 2011; 807:259-72. doi: 10.1007/978-1-61779-370-7_11. PubMed PMID: 22034034; PubMed Central PMCID: PMCPMC3593270.

Claims (25)

1. (canceled)
2. A recombinant viral genome comprising four repeated monomers of TTAGGG (SEQ ID NO: 6).
3. The recombinant viral genome of claim 2, wherein the recombinant viral genome is an adeno-associated virus (AAV) genome.
4. The recombinant viral genome of claim 2, wherein the recombinant viral genome is selected from the group consisting of adenovirus, herpes simplex virus, varicella, variola virus, hepatitis B, cytomegalovirus, JC polyomavirus, BK polyomavirus, monkeypox virus, Herpes Zoster, Epstein-Barr virus, human herpes virus 7, Kaposi's sarcoma-associated herpesvirus, and human parvovirus B19.
5. The recombinant viral genome of claim 2, wherein the recombinant viral genome is single stranded.
6. The recombinant viral genome of claim 2, wherein the viral genome is packaged in a virion.
7. The recombinant viral genome of claim 2, wherein the recombinant viral genome comprises a therapeutic gene.
8. The recombinant viral genome of claim 2, wherein the recombinant viral genome is a cytotoxic virus.
9-14. (canceled)
15. The recombinant viral genome of claim 2, wherein the recombinant viral genome comprises a non-human gene.
16. The recombinant viral genome of claim 2, wherein the four repeated monomers of TTAGGG (SEQ ID NO: 6) are inserted downstream of or in a 3′ untranslated region of the viral genome.
17. The recombinant viral genome of claim 2, wherein the recombinant viral genome is covalently linked by a phosphodiester bond to a nucleic acid sequence comprising the four repeated monomers of TTAGGG (SEQ ID NO: 6).
18. The recombinant viral genome of claim 2 further comprising a detectable marker.
19. The recombinant viral genome of claim 18, wherein expression of the detectable marker is inducible.
20. The recombinant viral genome of claim 2 comprising the nucleotide sequence of SEQ ID NO: 9.
21-42. (canceled)
43. The recombinant viral genome of claim 2 comprising three repeated monomers of the nucleotide sequence of SEQ ID NO: 9.
44. The recombinant viral genome of claim 2 comprising five repeated monomers of the nucleotide sequence of SEQ ID NO: 9.
45. A method of treating a mammal, comprising:
administering to the mammal the recombinant viral genome of claim 2.
46-73. (canceled)
74. A method of producing a recombinant viral genome, comprising:
inserting into a viral genome four repeated monomers of TTAGGG (SEQ ID NO: 6) or the nucleotide sequence of SEQ ID NO: 9.
75. A nucleic acid vector comprising the nucleotide sequence of SEQ ID NO: 9.
76-90. (canceled)
91. The recombinant viral genome of claim 2, wherein the recombinant viral genome is self-complementary.
92. A recombinant viral genome comprising a sequence that is at least 95% identical to the sequence of SEQ ID NO: 9.
US16/167,764 2016-06-08 2018-10-23 Engineered viral vector reduces induction of inflammatory and immune responses Abandoned US20190316151A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US16/167,764 US20190316151A1 (en) 2016-06-08 2018-10-23 Engineered viral vector reduces induction of inflammatory and immune responses
US18/332,109 US20240043849A1 (en) 2016-06-08 2023-06-09 Engineered viral vector reduces induction of inflammatory and immune responses

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201662347302P 2016-06-08 2016-06-08
PCT/US2017/036525 WO2017214378A1 (en) 2016-06-08 2017-06-08 Engineered viral vector reduces induction of inflammatory and immune responses
US16/167,764 US20190316151A1 (en) 2016-06-08 2018-10-23 Engineered viral vector reduces induction of inflammatory and immune responses

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/036525 Continuation WO2017214378A1 (en) 2016-06-08 2017-06-08 Engineered viral vector reduces induction of inflammatory and immune responses

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/332,109 Continuation US20240043849A1 (en) 2016-06-08 2023-06-09 Engineered viral vector reduces induction of inflammatory and immune responses

Publications (1)

Publication Number Publication Date
US20190316151A1 true US20190316151A1 (en) 2019-10-17

Family

ID=60578967

Family Applications (3)

Application Number Title Priority Date Filing Date
US16/308,420 Active 2038-12-27 US11339396B2 (en) 2016-06-08 2017-06-08 Engineered viral vector reduces induction of inflammatory and immune responses
US16/167,764 Abandoned US20190316151A1 (en) 2016-06-08 2018-10-23 Engineered viral vector reduces induction of inflammatory and immune responses
US18/332,109 Pending US20240043849A1 (en) 2016-06-08 2023-06-09 Engineered viral vector reduces induction of inflammatory and immune responses

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US16/308,420 Active 2038-12-27 US11339396B2 (en) 2016-06-08 2017-06-08 Engineered viral vector reduces induction of inflammatory and immune responses

Family Applications After (1)

Application Number Title Priority Date Filing Date
US18/332,109 Pending US20240043849A1 (en) 2016-06-08 2023-06-09 Engineered viral vector reduces induction of inflammatory and immune responses

Country Status (7)

Country Link
US (3) US11339396B2 (en)
EP (1) EP3468605A4 (en)
JP (2) JP7034951B2 (en)
KR (1) KR20190017872A (en)
CN (2) CN114807152A (en)
AU (2) AU2017277647B2 (en)
WO (1) WO2017214378A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11339396B2 (en) 2016-06-08 2022-05-24 President And Fellows Of Harvard College Engineered viral vector reduces induction of inflammatory and immune responses
WO2022187679A1 (en) * 2021-03-04 2022-09-09 Kriya Therapeutics, Inc. Viral vector constructs incorporating dna for inhibiting toll like receptors and methods of using the same
US11981911B2 (en) 2017-11-08 2024-05-14 President And Fellows Of Harvard College Compositions and methods for inhibiting viral vector-induced inflammatory responses

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10736957B2 (en) * 2017-12-19 2020-08-11 President And Fellows Of Harvard College Enhanced immunogenicity of mRNA with co-encoded adjuvant sequences
JP2022518504A (en) * 2019-01-24 2022-03-15 ジェネレーション バイオ カンパニー Use in closed DNA (CEDNA) and methods of reducing immune responses associated with gene therapy or nucleic acid therapy
JP2022521755A (en) * 2019-02-22 2022-04-12 ライフ テクノロジーズ コーポレーション Floating system for the production of adeno-associated virus
US20220259599A1 (en) * 2019-05-15 2022-08-18 President And Fellows Of Harvard College Compositions and methods for inhibiting nucleic acid vector-induced inflammatory responses
EP4114928A4 (en) * 2020-03-05 2024-10-16 Flagship Pioneering Innovations VI, LLC HOST DEFENSE SUPPRESSING METHODS AND COMPOSITIONS FOR MODULATING A GENOME
WO2025087987A1 (en) * 2023-10-23 2025-05-01 Sartorius Stedim Cellca Gmbh Plasmids for improved aav titers and empty full ratios

Family Cites Families (84)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL104314A0 (en) 1992-01-07 1993-05-13 Novo Nordisk As Human kunitz-type protease inhibitor and variants thereof,their production and pharmaceutical compositions containing them
US5489508A (en) 1992-05-13 1996-02-06 University Of Texas System Board Of Regents Therapy and diagnosis of conditions related to telomere length and/or telomerase activity
US5643890A (en) 1995-01-31 1997-07-01 The Board Of Regents Of The University Of Nebraska Synthetic oligonucleotides which mimic telomeric sequences for use in treatment of cancer and other diseases
AU753172B2 (en) 1997-06-06 2002-10-10 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
US6551795B1 (en) 1998-02-18 2003-04-22 Genome Therapeutics Corporation Nucleic acid and amino acid sequences relating to pseudomonas aeruginosa for diagnostics and therapeutics
WO2000061597A1 (en) 1999-04-08 2000-10-19 Uab Research Foundation Antiproliferative activity of g-righ oligonucleotides and method of using same to bind to nucleolin
BR0014236A (en) 1999-09-25 2002-10-15 Univ Iowa Res Found immunostimulating nucleic acids
MXPA00011713A (en) 2000-11-28 2002-05-31 Tgt Lab S A De C V Re-combining viral and non-viral vectors containing the human gene of the urokinase plasminogen activator and its benefit in the treatment of diverse types of hepatic, renal, pulmonary, pancreatic and cardiac fibrosis and hypertrophic scars.
US7060690B2 (en) 2001-01-22 2006-06-13 Genta Incorporated Methods and compositions for treating a cell-proliferative disorder using CRE decoy oligomers, BCL-2 antisense oligomers, and hybrid oligomers thereof
WO2003027313A2 (en) 2001-09-24 2003-04-03 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services SUPPRESSORS OF CpG OLIGONUCLEOTIDES AND METHODS OF USE
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US7357928B2 (en) 2002-04-08 2008-04-15 University Of Louisville Research Foundation, Inc. Method for the diagnosis and prognosis of malignant diseases
AU2003243409A1 (en) 2002-06-05 2003-12-22 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory cpg nucleic acids
EP1575504A4 (en) 2002-08-01 2009-11-04 Us Gov Health & Human Serv METHOD OF TREATING INFLAMMATORY ARTHROPATHIES USING OLIGONUCLEOTIDE CPG SUPPRESSORS
US8043622B2 (en) 2002-10-08 2011-10-25 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides
US7790867B2 (en) 2002-12-05 2010-09-07 Rosetta Genomics Inc. Vaccinia virus-related nucleic acids and microRNA
US20050013812A1 (en) 2003-07-14 2005-01-20 Dow Steven W. Vaccines using pattern recognition receptor-ligand:lipid complexes
US20050239733A1 (en) 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050208470A1 (en) 2003-12-16 2005-09-22 University Of Massachusetts Toll-like receptor assays
DE602005012948D1 (en) 2004-05-06 2009-04-09 Us Gov Health & Human Serv METHOD AND COMPOSITIONS FOR TREATING UVEITIS
EP1784501B1 (en) 2004-05-14 2015-11-18 Rosetta Genomics Ltd VIRAL AND VIRUS ASSOCIATED MicroRNAS AND USES THEREOF
EP1751311A2 (en) 2004-05-26 2007-02-14 Rosetta Genomics ltd Viral and viral associated mirnas and uses thereof
ES2543207T3 (en) 2004-09-01 2015-08-17 Dynavax Technologies Corporation Methods and compositions for the inhibition of innate immune responses and autoimmunity
JP2008000001A (en) 2004-09-30 2008-01-10 Osaka Univ Immunostimulatory oligonucleotide and its pharmaceutical use
EP1836218A2 (en) 2004-12-17 2007-09-26 Dynavax Technologies Corporation Methods and compositions for induction or promotion of immune tolerance
US20070077231A1 (en) 2005-09-30 2007-04-05 Contag Christopher H Immune effector cells pre-infected with oncolytic virus
CA2624755C (en) 2005-10-12 2017-03-28 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (iro) compounds to modulate toll-like receptor based immune response
CA2636424A1 (en) 2006-01-09 2007-10-25 The Regents Of The University Of California Immunostimulatory combinations of tnfrsf, tlr, nlr, rhr, purinergic receptor, and cytokine receptor agonists for vaccines and tumor immunotherapy
US8298818B2 (en) * 2006-04-28 2012-10-30 University Of Florida Research Foundation, Inc. Self-complementary adeno-associated virus having a truncated CMV-chicken β-actin promoter
WO2007147011A2 (en) 2006-06-13 2007-12-21 Bayhill Therapeutics, Inc. Polynucleotide therapy
US8377898B2 (en) 2006-10-12 2013-02-19 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (IRO) compounds to modulate toll-like receptor based immune response
WO2008076981A2 (en) 2006-12-15 2008-06-26 Board Of Regents, The University Of Texas System Inhibitors of ll-37- mediated immune reactivity to self nucleic acids
AU2008220449A1 (en) 2007-03-01 2008-09-04 Rosetta Genomics Ltd. Methods for distingushing between lung squamous carcinoma and other non smallcell lung cancers
WO2009006141A2 (en) 2007-07-05 2009-01-08 Bausch & Lomb Incorporated Authority to read as follows: compositions and methods for treating or controlling infections of the eye a sequelae thereof
US7879812B2 (en) 2007-08-06 2011-02-01 University Of Iowa Research Foundation Immunomodulatory oligonucleotides and methods of use therefor
US8853375B2 (en) 2007-08-15 2014-10-07 Idera Pharmaceuticals, Inc. Toll like receptor modulators
AU2008317261B2 (en) 2007-10-26 2015-04-09 Dynavax Technologies Corporation Methods and compositions for inhibition of immune responses and autoimmunity
WO2009089399A2 (en) 2008-01-10 2009-07-16 Bausch & Lomb Incorporated Compositions comprising toll-like receptor or coreceptor antagonists and methods for ocular neuroprotection
WO2009089401A2 (en) 2008-01-10 2009-07-16 Bausch & Lomb Incorporated Compositions comprising toll-like receptor or coreceptor antagonists and methods for treating or controlling ocular allergy using same
US8222225B2 (en) 2008-05-21 2012-07-17 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating pneumoconiosis with oligodeoxynucleotides
JP5415724B2 (en) 2008-08-05 2014-02-12 長春華普生物技術有限公司 A kind of oligonucleotide and its application
US8030289B2 (en) 2008-08-06 2011-10-04 Changchun Huapu Biotechnology Co., Ltd. Oligonucleotide and use thereof
WO2010034779A2 (en) 2008-09-24 2010-04-01 The Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth Near Dublin Composition and method for treatment of preterm labor
GB0906130D0 (en) 2008-10-03 2009-05-20 Procrata Biosystems Ltd Transcription factor decoys
WO2010042543A2 (en) 2008-10-06 2010-04-15 Idera Pharmaceuticals, Inc. Use of inhibitors of toll-like receptors in the prevention and treatment of hypercholesterolemia and hyperlipidemia and diseases related thereto
US8053422B2 (en) 2008-12-04 2011-11-08 The United States Of America As Represented By The Department Of Health And Human Services Anti-cancer oligodeoxynucleotides
WO2010108035A1 (en) * 2009-03-18 2010-09-23 Isis Pharmaceuticals, Inc. Compounds and methods for modulating toxic and proinflammatory effects
WO2010127166A2 (en) 2009-04-30 2010-11-04 The Regents Of The University Of California Combination anti-hiv vectors, targeting vectors, and methods of use
CN102612561A (en) 2009-06-01 2012-07-25 艾德拉药物股份有限公司 Potentiation of autoimmune and inflammatory disease treatments by immune regulatory oligonucleotide (iro) antagonists of tlr7 and tlr9
US20110070241A1 (en) 2009-06-30 2011-03-24 Duke University Methods for modulating immune responses to aav gene therapy vectors
US20110009477A1 (en) 2009-07-08 2011-01-13 Idera Pharmaceuticals, Inc. Oligonucleotide-based compounds as inhibitors of toll-like receptors
CN101712957B (en) 2009-11-25 2011-11-23 中国人民解放军第三军医大学第一附属医院 Toll-like receptor 9 blocker and application
US8771669B1 (en) 2010-02-09 2014-07-08 David Gordon Bermudes Immunization and/or treatment of parasites and infectious agents by live bacteria
JP2013533847A (en) 2010-04-23 2013-08-29 ユニバーシティ オブ マサチューセッツ AAV-based treatment of cholesterol-related disorders
BR112012032240A2 (en) 2010-06-16 2019-09-24 Dynavax Technologies Corporation treatment method using tlr7 and / or tlr9 inhibitors
JP5921535B2 (en) 2010-06-16 2016-05-24 ディナバックス テクノロジーズ コーポレイション Methods of treatment using TLR7 and / or TLR9 inhibitors
GB201014026D0 (en) 2010-08-20 2010-10-06 Ucl Business Plc Treatment
WO2012051491A1 (en) 2010-10-14 2012-04-19 The United States Of America, As Represented By The Secretary National Institutes Of Health Compositions and methods for controlling neurotropic viral pathogenesis by micro-rna targeting
WO2012068470A2 (en) 2010-11-19 2012-05-24 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (iro) compounds to modulate toll-like receptor based immune response
WO2013116590A1 (en) 2012-02-01 2013-08-08 George Miller Inhibition of pattern recognition receptors in pancreatic cancer treatment using tlr inhibitors
AR091569A1 (en) 2012-06-28 2015-02-11 Intervet Int Bv TOLL TYPE RECEIVERS
DK2900686T3 (en) 2012-09-28 2020-08-17 Univ North Carolina Chapel Hill AAV VECTORS TARGETED FOR OLIGODENDROCYTE
CN102925485B (en) 2012-11-09 2014-07-09 中国农业科学院兰州兽医研究所 Preparation method of dually-expressed AAV (Adeno Associated Virus) recombinant virus
CA2891906A1 (en) 2012-11-29 2014-06-05 Eiji ESASHI Inhibitory oligonucleotide and use thereof
WO2014105870A1 (en) * 2012-12-27 2014-07-03 Sierra Sciences, Inc. Enhancing health in mammals using telomerase reverse transcriptase gene therapy
BR112015016420B1 (en) 2013-01-08 2022-12-06 Idera Pharmaceuticals, Inc IMMUNORREGULATORY OLIGONUCLEOTIDE COMPOUND, PHARMACEUTICAL COMPOSITION AND USE OF THE IRO COMPOUND OR PHARMACEUTICAL COMPOSITION
US20140271550A1 (en) 2013-03-14 2014-09-18 The Trustees Of The University Of Pennsylvania Constructs and Methods for Delivering Molecules via Viral Vectors with Blunted Innate Immune Responses
WO2015089114A1 (en) 2013-12-09 2015-06-18 Bullet Biotechnology, Inc. Specific virus-like particle-cpg oligonucleotide vaccines and uses thereof
CA2974651A1 (en) 2014-01-24 2015-07-30 Children's Hospital Of Eastern Ontario Research Institute Inc. Smc combination therapy for the treatment of cancer
US12139542B2 (en) 2014-05-27 2024-11-12 Trustees Of Boston University Inhibitors of aortic carboxypeptidase-like protein (ACLP)
EP2982756A1 (en) 2014-08-04 2016-02-10 Berlin Cures Holding AG Aptamers for use against autoantibody-associated diseases
EP3223858A4 (en) 2014-10-31 2018-07-11 H. Lee Moffitt Cancer Center And Research Institute, Inc. Tlr9 targeted cytotoxic agents
WO2016130832A1 (en) 2015-02-13 2016-08-18 Idera Pharmaceuticals, Inc. Toll-like receptor 9 antagonist and methods of use thereof
WO2016149612A2 (en) 2015-03-19 2016-09-22 The Johns Hopkins University Assay for telomere length regulators
US10775367B2 (en) 2015-04-15 2020-09-15 Ji Hoon Lee Aptasensor and method of detecting target material
WO2016183370A1 (en) 2015-05-13 2016-11-17 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Synthetic immunosuppressive oligodeoxynucleotides reduce ischemic tissue damage
DK3329004T3 (en) 2015-07-29 2020-04-20 Ifom Fondazione St Firc Di Oncologia Molecolare THERAPEUTIC OLIGONUCLEOTIDES
WO2017085115A1 (en) 2015-11-18 2017-05-26 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for treating rhabdomyolysis
EP3394263B1 (en) 2015-12-25 2025-02-26 SBI Biotech Co., Ltd. Tlr inhibitory oligonucleotides and their use
CN105597079A (en) * 2016-01-11 2016-05-25 中国人民解放军第三军医大学第一附属医院 Medicine for treating psoriasis
US10124062B2 (en) 2016-02-26 2018-11-13 The United States Of America As Represented By The Department Of Veterans Affairs Methods of treating, inhibiting and/or preventing an auditory impairment
WO2017214378A1 (en) 2016-06-08 2017-12-14 President And Fellows Of Harvard College Engineered viral vector reduces induction of inflammatory and immune responses
EP3845650A1 (en) 2016-11-23 2021-07-07 Berlin Cures GmbH Aptamers for use in inhibition and/or suppression of tlr9 activation
US11981911B2 (en) 2017-11-08 2024-05-14 President And Fellows Of Harvard College Compositions and methods for inhibiting viral vector-induced inflammatory responses

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Cui et al, Transcriptional Regulation of Gene Expression by microRNAs as Endogenous Decoys of Transcription Factors, Cell Physiol Biochem 2014;33:1698-1714 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11339396B2 (en) 2016-06-08 2022-05-24 President And Fellows Of Harvard College Engineered viral vector reduces induction of inflammatory and immune responses
US11981911B2 (en) 2017-11-08 2024-05-14 President And Fellows Of Harvard College Compositions and methods for inhibiting viral vector-induced inflammatory responses
WO2022187679A1 (en) * 2021-03-04 2022-09-09 Kriya Therapeutics, Inc. Viral vector constructs incorporating dna for inhibiting toll like receptors and methods of using the same

Also Published As

Publication number Publication date
US20240043849A1 (en) 2024-02-08
WO2017214378A1 (en) 2017-12-14
AU2017277647A1 (en) 2018-12-13
AU2023251424A1 (en) 2023-11-09
US20190177731A1 (en) 2019-06-13
EP3468605A1 (en) 2019-04-17
JP7394898B2 (en) 2023-12-08
CN109451729A (en) 2019-03-08
CN114807152A (en) 2022-07-29
US11339396B2 (en) 2022-05-24
JP7034951B2 (en) 2022-03-14
KR20190017872A (en) 2019-02-20
JP2019517266A (en) 2019-06-24
CN109451729B (en) 2022-03-22
EP3468605A4 (en) 2020-01-08
JP2022066336A (en) 2022-04-28
AU2017277647B2 (en) 2023-07-27

Similar Documents

Publication Publication Date Title
US20240043849A1 (en) Engineered viral vector reduces induction of inflammatory and immune responses
JP7094236B2 (en) Compositions, methods and uses for mutant AAV and gene transfer into cells, organs and tissues
Ramlogan‐Steel et al. Gene therapy and the adeno‐associated virus in the treatment of genetic and acquired ophthalmic diseases in humans: trials, future directions and safety considerations
Dyka et al. Dual adeno-associated virus vectors result in efficient in vitro and in vivo expression of an oversized gene, MYO7A
CN105408352B (en) Efficient delivery of large genes by dual AAV vectors
AU2016265255B2 (en) Gene editing of deep intronic mutations
TW201741458A (en) Gene therapy for treating hemophilia A
US20110117058A1 (en) Method of treating genetic disorders
US20110070241A1 (en) Methods for modulating immune responses to aav gene therapy vectors
TW201629225A (en) Factor IX gene therapy
US20240384295A1 (en) Compositions and methods for inhibiting viral vector-induced inflammatory responses
CN114072514A (en) Compositions and methods for treating ATPase mediated diseases
US20190010517A1 (en) Methods and compositions for facilitating homologous recombination
JP7406253B2 (en) Immune evasive vectors and use for gene therapy
JP2025114604A (en) Gene therapy for eye diseases
CN114144518A (en) Dual leucine zipper kinase inhibitors for gene therapy
EP4509606A1 (en) Nucleic acid construct for treating hereditary coagulation factor deficiency and use thereof
WO2023169115A1 (en) Aav vector having high affinity with nervous system, and application thereof
CN112840020A (en) Oncolytic viruses and their applications
Cho et al. Safety and efficacy evaluations of an adeno-associated virus variant for preparing IL10-secreting human neural stem cell-based therapeutics
AU2020212026B2 (en) Highly efficient transduction and lateral spread in the retina by a novel AAV virus enhanced by rational design
Martin Development and Characterisation of HEK293T Cell Expression Systems for Enhanced Production of Recombinant AAV Viral Vectors
CN117947040A (en) Expression cassette for target gene and its application
CN120098093A (en) A fusion adeno-associated virus and its application
Bosch Merino Intrathecal administration of AAVrh10 coding for β‐glucuronidase corrects biochemical and histological hallmarks of mucopolysaccharidosis type VII mice and improves behavior and survival

Legal Events

Date Code Title Description
AS Assignment

Owner name: PRESIDENT AND FELLOWS OF HARVARD COLLEGE, MASSACHU

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CHAN, YING KAI;CHURCH, GEORGE M.;SIGNING DATES FROM 20170920 TO 20170925;REEL/FRAME:047510/0932

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE AFTER FINAL ACTION FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: ADVISORY ACTION MAILED

STCV Information on status: appeal procedure

Free format text: NOTICE OF APPEAL FILED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STCV Information on status: appeal procedure

Free format text: NOTICE OF APPEAL FILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION