US20190292231A1

US20190292231A1 - Recombinant proteins of parapoxvirus ovis and pharmaceutical compositions therefrom

Info

Publication number: US20190292231A1
Application number: US16/439,604
Authority: US
Inventors: Olaf Weber; Sonja Maria Tennagels; Angela Siegling; Tobias Schlapp; Andrew Allan Mercer; Stephen Bruce Fleming; Hans-Dieter Volk
Original assignee: Aicuris GmbH and Co KG
Current assignee: Aicuris GmbH and Co KG
Priority date: 2001-06-13
Filing date: 2019-06-12
Publication date: 2019-09-26
Also published as: US20170320918A1; US20140377297A1; US20130108704A1; NZ512341A; US9714272B2; GB2392445B; WO2003006654A3; US8357363B2; US8852577B2; US20040235721A1; GB2392445A; GB0328745D0; WO2003006654A2

Abstract

The invention relates to polynucleotides coding for the PPVO viral genome, to fragments of the polynucleotides coding for the PPVO genome and to polynucleotides coding for individual open reading frames (ORFs) of the PPVO viral genome. The invention also relates to recombinant proteins expressed from the above mentioned polynucleotides and to fragments of said recombinant proteins, and to the use of said recombinant proteins or fragments for the preparation of pharmaceutical compositions.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a divisional of U.S. patent application Ser. No. 15/655,825, filed 20 Jul. 2017, now pending, which is a continuation of U.S. patent application Ser. No. 14/480,463, filed 8 Sep. 2014, now U.S. Pat. No. 9,714,272 issued on 25 Jul. 2017, which is a continuation of U.S. patent application Ser. No. 13/717,640, filed 17 Dec. 2012, now U.S. Pat. No. 8,852,577 issued on 7 Oct. 2014, which is a continuation of U.S. patent application Ser. No. 10/481,112, filed 11 Jun. 2004, now U.S. Pat. No. 8,357,363 issued on 22 Jan. 2013, which is a U.S. National Phase Application of International Patent Application No. PCT/EP2002/006440, having an international filing date of 12 Jun. 2002, which claims priority to New Zealand Patent Application No. 512341 filed 13 Jun. 2001. The contents of each of these applications are incorporated herein by reference in their entirety.

SUBMISSION OF SEQUENCE LISTING ON ASCII TEXT FILE

The content of the following submission on ASCII text file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: 595282000310SeqList.txt, date recorded: 12 Jun. 2019, size: 234,845 bytes).

FIELD OF THE INVENTION

The present invention relates to polynucleotides and recombinant proteins of Parapoxvirus ovis (PPVO) and their use, alone or in combination with other substances, for the manufacture of pharmaceutical compositions.

BACKGROUND OF THE INVENTION

It is known that latent and chronically persistent viral infections can be activated or reactivated by immunosuppression, or conversely that the immune system suppresses acute diseases which may be caused by a latent virus (for example a latent herpes virus infection recurs as a result of immunosuppression in the form of lip vesicles in cases of stress or the administration of cortisone). It is also known that chronically persistent latent viral infections can only be treated with difficulty or not at all using conventional low-molecular-weight antiviral substances.
It was demonstrated that class I restricted cytotoxic T cells were capable of inhibiting hepatocellular HBV gene expression in HBV-transgenic mice, and that this process was caused by TNF-α and IFN-γ.
It is also known that in the case of chronically persistent viral infections a superinfection with another virus can produce antiviral effects against the chronically persistent virus. The dependence of this effect on interferons such as IFN-γ, as well as other cytokines and chemokines, such as TNF-α, which are secreted by T cells, natural killer cells and macrophages, has been demonstrated.
BAYPAMUN®, a pharmaceutical product for inducing “paraspecific immunity”, i.e., a pharmaceutical product for inducing the unspecific immune system, is used therapeutically, metaphylactically and prophylactically for the treatment of animals in need. BAYPAMUN® is manufactured from chemically inactivated PPVO strain D1701 (see German Patent DE3504940). The inactivated PPVO induces in animals non-specific protection against infections with the most diverse types of pathogens. It is assumed that this protection is mediated via various mechanisms in the body's own defense system. These mechanisms include the induction of interferons, the activation of natural killer cells, the induction of “colony-stimulating activity” (CSA) and the stimulation of lymphocyte proliferation. Earlier investigations of the mechanism of action demonstrated the stimulation of interleukin-2 and interferon-α.
The processes for the production of the above-mentioned pharmaceutical compositions are based on the replication of the virus in cultures of suitable host cells.
One aspect of the invention relates to the use of particle-like structures comprising recombinant proteins of the invention. These particle-like structures can be, e.g., fusion proteins, protein-coated particles or virus-like particles.
Methods to produce fusion proteins, protein-coated particles or virus-like particles comprising recombinant proteins of the invention are well known to persons skilled in the art: Casal (Biotechnol. Genet. Eng. Rev. (2001) 18:73-87) describes the use of baculovirus expression systems for the generation of virus-like particles. Ellis (Curr. Opin. Biotechnol. (1996) 7(6):646-652) presents methods to produce virus-like particles and the application of suitable adjuvants. Roy (Intervirology (1996) 39(1-2):62-71) presents genetically engineered particulate virus-like structures and their use as vaccine delivery systems. Methods to produce fusion proteins are also well known to the person skilled in the art (Gaudin, et al., Gen. Virol. (1995) 76:1541-1556; Hughson, Curr. Biol. (1995) 5(3):365-374; Uhlen, et al., Curr. Opin. Biotechnol. (1992) 3(4):363-369). Known to the person skilled in the art is also the preparation of protein-coated micro- and nanospheres (Arshady, Biomaterials (1993) 14(1):5-15). Proteins can be attached to biodegradable microspheres (Cleland, Pharm Biotechnol. (1997) 10:1-43) or attached to other polymer microspheres (Hanes, et al., Pharm. Biotechnol. (1995) 6:389-412) such as, e.g., polysaccharides (Janes, et al., Adv. Drug Deliv. Rev. (2001) 47(1):83-97).
PPVO NZ2 is another Parapoxvirus strain that exhibits immunostimulatory effects when administered in inactivated form to mammals.
The closest prior art describes the construction of an expression library representing about 95% of the PPVO NZ2 genome using the Vaccina lister virus to create recombinant viruses comprising the complete Vaccina lister genome and various fragments of the PPVO genome (Mercer, et al., Virology, (1997) 229:193-200). For the construction of the library, 16 PPVO DNA fragments with an average size of 11.4 kb were inserted into the Vaccinia lister genome. Each fragment was mapped relative to the PPVO restriction endonuclease maps but was otherwise uncharacterized (FIG. 1). It was found that a major portion of the PPVO genes were expressed in cells infected by the recombinant virus. The authors also showed that the entirety of all PPVO proteins expressed by some of the recombinant viruses of the expression library was able to provide protection against challenge with virulent PPVO. Expression of PPVO genes of the individual recombinant viruses has been demonstrated by immunofluorescence and immune precipitation (Mercer, et al., Virology (1997) 229:193-200).
To identify components of PPVO responsible for the vaccinating activity of PPVO, the Vaccinia lister/PPVO NZ2 expression library was applied.
Based on the above background it was desirable to develop PPVO based pharmaceutical compositions with antiviral and anti-tumor efficacy as well as with efficacy in paraimmunization and other desirable therapeutic effects. It was also desirable to obtain a pharmaceutical composition that exerts its full therapeutic effect while showing fewer side effects. It was furthermore desirable to find methods to produce PPVO based pharmaceutical compositions in large quantities and in economically advantageous manners.
These desirable effects have been achieved by the systematic use of selected recombinant proteins of PPVO alone or in combination with other recombinant proteins from PPVO for the preparation of pharmaceutical compositions for the treatment of objects in need.

SUMMARY OF THE INVENTION

The invention relates to polynucleotides coding for the PPVO viral genome, to fragments of the polynucleotides coding for the PPVO genome and to polynucleotides coding for individual open reading frames (ORFs) of the PPVO viral genome. The invention also relates to fragments of said polynucleotides of at least 15 or 30 or 100 base pairs in length. The invention also relates to recombinant proteins expressed from the above mentioned polynucleotides and to fragments of said recombinant proteins of at least 5 or 10 or 30 amino acids, and to the use of recombinant proteins or fragments for the preparation of pharmaceutical compositions.
“Fragments” of a polynucleotide, within the meaning of the invention, shall be understood as polynucleotides that have the same nucleotide sequence as contiguous parts of the full length (the original) polynucleotide.
“Active fragments”, within the meaning of the invention, shall be those fragments of the PPVO genome the expression products of which have demonstrated to be pharmacologically active according to the invention, when inserted into the Vaccina lister genome and expressed in a suitable host.
Whereas the use of the complete PPVO virus for the manufacture of vaccines against PPVO challenge has been described, the present invention relates to the use of polynucleotides coding for the PPVO viral genome and selected fragments of the PPVO viral genome and of selected PPVO expression products, alone or in combination with others, for the preparation of improved pharmaceutical compositions for the treatment of various diseases.
The systematic use of selected genomic fragments of PPVO and their recombinant expression products makes it possible to produce pharmaceutical compositions which contain fewer (and may not contain any) inactive components (i.e., polynucleotides and proteins of PPVO) in addition to the active components.
These pharmaceutical compositions which contain less, or do not contain any additional inactive components are generally preferred by doctors and patients compared to the less well defined biological preparations of inactivated virus material. Furthermore, the possibility of producing the recombinant product in fermentation processes allows an economically advantageous mode of production. It is well known to persons skilled in the art that an economically advantageous mode of production can be achieved, e.g., by using rapidly growing production organisms (host organisms) which might also place low demands on the culture medium employed. Microorganisms which can advantageously be used as hosts for the production of recombinant proteins include, e.g., but are not limited to, Escherichia coli, Bacillus spec., Corynebacterium spec., Streptomyces spec., as well as yeasts, e.g., Saccharomyces cerevisiae, Candida spec., Pichia spec., Hansenula spec., and filamentous fungi, e.g., Aspergillus spec., Penicillium spec. and other suitable microorganisms.
Recombinant proteins of the invention can also be produced from cell lines expressing the proteins of interest. These cell lines can be recombinant mammalian cell lines, recombinant insect cell lines (e.g., using the baculovirus transfection system) or other suitable expression systems. Transfection can be achieved by various techniques known to the skilled person, one of which is the use or recombinant viruses such as the Vaccinia virus/PPVO recombinants (VVOVs) described in the examples.

DESCRIPTION OF THE INVENTION

The invention relates to fragments of the PPVO genome of at least 15 or 30 or 100 base pairs in length, and recombinant proteins expressed therefrom and to the use of said fragments and recombinant proteins for the preparation of pharmaceutical compositions. The invention also relates to individual genes (ORFs) of PPVO and their expression products, and their use, alone or in combination with others, for the preparation of pharmaceutical compositions.
A protein, within the meaning of the invention, is any polypeptide of at least five amino acids. A recombinant protein, within the meaning of the invention, is any protein that is expressed in a cell, to which the coding polynucleotide was introduced using recombinant DNA technology.
A polynucleotide, within the meaning of the invention, is meant to comprise, polyribonucleotides and/or polydesoxyribonucleotides.
Pharmaceutical compositions of the invention can be used as immunotherapeutic or immunoprophylactic agents for the treatment of infectious and non-infectious immunodeficiencies. They can also be used for the treatment of tumor diseases, cancer, viral infections and diseases associated therewith, such as, e.g., hepatitis, papillomatosis, herpes virus infections, liver fibrosis, for the prevention or prophylaxis of infectious diseases after stress (e.g., operations), for the prevention and prophylaxis of infectious diseases by administration prior to operations or procedures (e.g., preceding implantations of artificial limbs or dental procedures), for the prophylactic and metaphylactic treatment of non-viral infections, for the healing of wounds, and in particular for accelerating wound-healing processes and for promoting the healing of poorly healing or non-healing wounds (e.g., Ulcus cruris), for diseases such as multiple sclerosis, warts and other skin neoplasms, for allergic diseases, for preventing the onset of systemic allergies and for topical allergies and for improving well-being, e.g., in old age, for autoimmune diseases, chronic inflammatory diseases, such as, e.g., Crohn's disease, COPD and asthma. It is an object of the invention to use of polynucleotides and recombinant proteins of PPVO for the production of pharmaceutical compositions for the treatment of the above mentioned conditions and diseases in humans and animals.
The viral strains of the invention are PPVO NZ2 and homologues, such as D1701, NZ7, NZ10 and orf-11 strains. It is also possible to use polynucleotides and recombinant proteins of the progeny of these strains obtained by passaging and/or adaptation using specific cells, such as, e.g., WI-38, MRC-5 or Vero cells.
We have found that the identified recombinant proteins are effective for the treatment of viral diseases, cancer and other diseases or conditions in which a Thl type immune response is of benefit. The results obtained also imply that PPVO gene products or parts thereof protect hepatitis virus-expressing hepatocytes (e.g., hepatitis B virus, HBV, or hepatitis C virus, HCV) from immune attack through HBV or HCV specific cytotoxic CD8+ T cells circulating in the blood because T cells will not leave the blood stream if their specific antigen is not presented by liver sinus endothelial cells (LSEC, that anatomically separate hepatocytes from T cells passing the liver with the blood). Therefore, we expect to have a recombinant protein that is derived from the ORFs 120-R3 (base pairs 122616-136025 Bp, recombinant virus VVOV82) that is able to down-modulate or prevent side effects such as necroinflammatory liver disease when immunostimulants, e.g., cytokines or any others including the proteins described above administered to, e.g., hepatitis patients.
Considering the knowledge about the influence of a Thl type immune induction in conditions and diseases such as latent and or chronic viral infections, proliferative diseases such as cancer and the capability of recombinant proteins that contain gene products of PPVO or parts thereof to induce a Thl immune response or a local immune response selectively, we claim the use of polynucleotides and recombinant polypeptides of PPVO and recombinant proteins that contain gene products of PPVO or parts thereof for the manufacture of pharmaceutical compositions for use in humans and animals. The recombinant proteins are made from products or parts thereof of the following open reading frames (ORFs) of PPVO NZ2: 64r-96r (recombinants VVOV 285 and VVOV 330 as well as VVOV 243 and VVOV 283), 18r-57 (recombinants VVOV 97, VVOV 96 and VVOV 245), 4r-14r (recombinant VVOV 215). The recombinant protein may also be made from gene products or parts thereof of ORFs 120-R3 (recombinant VVOV 82). The proteins may be prepared and used in any combination.
Recombinant proteins of PPVO within the meaning of the invention shall be understood as proteins that derive from PPVO and are expressed in homologous or heterologous systems other than the systems in which PPVO is naturally produced. Examples for recombinant proteins of PPVO are proteins of PPVO which are expressed using Vaccinia virus vectors and fibroblasts as host cells or baculovirus vectors and insect cells as host cells. Recombinant proteins, within the meaning of the invention, could also be produced in bacterial cells (e.g., Escherichia coli, Bacillus spec., Streptomyces spec.) or in yeast (e.g., Saccharomyces cerevisiae, Candida spec., Pichia pastoris, Hansenula spec.) systems. In these cases, polynucleotides of the PPVO genome would typically be brought into the respective host genome so that PPVO genes are expressed by the host. Recombinant proteins of PPVO could also be expressed by the object in need in the sense of a gene therapy.
Recombinant proteins, within the meaning of the invention, could also be recombinant virus particles that contain PPVO derived proteins. Recombinant proteins, within the meaning of the invention, could also be in form of viral-like particles that are formed or assembled from PPVO derived proteins. Recombinant proteins, within the meaning of the invention, could also be chimeric proteins that contain PPVO gene products.
In a preferred embodiment of the invention the recombinant proteins are attached to particle-like structures or be part of particle-like structures.
In another preferred embodiment of the invention the recombinant proteins are attached to, or part of, fusion proteins.
In another preferred embodiment of the invention the recombinant proteins are attached to, or part of, protein-coated particles.
In another preferred embodiment of the invention the recombinant proteins are attached to, or part of, virus-like particles.
Particle-like structures, such as particle-like fusion proteins, protein-coated particles or virus-like particles can be phagocytosed and processed by monocytes or macrophages. The process of phagocytosis enhances the efficacy of recombinant proteins of the invention in uses within the meaning of the invention.
A particle-like structure, within the meaning of the invention, is particulate matter in particle-like form of which the average particle size and other characteristics are suitable for medical application. Preferred particle-like structures are, e.g., fusion proteins, protein-coated particles, or virus-like particles.
Immunomodulating activity is defined as local or systemic suppression and/or stimulation and/or induction of any Th-1 or Th-2 type cytokine response or of any effector function of these cytokines, (e.g., cytolytic or antiviral activity or humoral response) or the modulation of MHC cross-presentation. Immunomodulating activity could also be the induction of apoptosis in antigen presenting cells or recruiting of antigen presenting cells.
Nucleotides and recombinant proteins of the invention can be administered at the same time or sequentially, administered with other agents and drugs, e.g., with drugs that treat the disease or are supportive, e.g., in the case of cancer therapy with antineoplastic or other anti-cancer agents or/and anti-coagulants or vitamins, pain relief and others.
The nucleotides and recombinant proteins can be administered systemically (e.g., intravenously, subcutaneously, intramuscularly, intracutaneously, intraperitoneally), locally (e.g., into a tumor) or orally (per os). The recombinant proteins or products thereof should be formulated appropriately, e.g., in a non-pyrogenic solution or suspension for i.v. use or in capsules for implantation or in capsules for per os use. Pharmaceutical compositions of the invention can be administered, e.g., oral, nasal, anal, vaginal etc., as well as parenteral administration. Pharmaceutical compositions of the invention can be in the form of suspensions, solutions, syrups, elixirs or appropriate formulations in polymers as well as liposomes.
Recombinant proteins of the invention can also be prepared with suitable recombinant cell lines and other cell lines. Alternatively, non-recombinant cell lines, such as WI-38, MRC-5, Vero cells could be infected with recombinant viruses that carry the recombinant genes using viral vectors such as, but not limited to, the Vaccina virus (e.g., Vaccina lister). In addition, other suitable viruses can be used in combination with other suitable cells (e.g., using Vaccinia virus vectors and fibroblasts as host cells or baculovirus vectors and insect cells as host cells). It is advantageous to cultivate the recombinant cell cultures in high-cell-density fermentations to achieve favorable productivity and a good overall process performance.
The invention relates to purified and isolated polynucleotides with the sequence of SEQ ID NO:1. The invention also relates to purified and isolated polynucleotides of at least 15 or 30 or 100 nucleotides which bind under stringent conditions to the polynucleotide of SEQ ID NO:1 or its complementary sequences.
Stringent conditions, within the meaning of the invention are 65° C. in a buffer containing 1 mM EDTA, 0.5 M NaHPO₄(pH 7.2), 7% (w/v) SDS.
The invention also relates to purified and isolated polynucleotides which comprise the polynucleotide sequence of SEQ ID NO:1 or polynucleotide sequences encoding the same amino acid sequence and fragments of at least 15 or 30 or 100 nucleotides thereof. The invention also relates to recombinant proteins of five and more amino acids encoded by these polynucleotides.
The invention also relates to purified and isolated polynucleotides which show at least 99%, 95% or 90% or 80% sequence homology to the polynucleotides of the previous paragraph.
Homology of biological sequences, within the meaning of the invention, shall be understood as the homology between two biological sequences as calculated by the algorithm of Needleman and Wunsch. (J. Mol. Biol. (1970) 48:443-453) using the BLOSUM62 substitution matrix (Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA (1992) 89:10915-10919) for proteins and penalties of +4 and −3 for identical and non-identical bases, respectively, when comparing polynucleotide sequences. For comparison of protein sequences the gap creation penalty and the gap extension penalty are 8 and 2, respectively. For comparison of polynucleotide sequences the gap creation penalty and the gap extension penalty are 20 and 3, respectively.
The invention also relates to purified and isolated polynucleotides which are active fragments of the PPVO genome, with a sequence selected from a group of sequences consisting of nucleotides 122616-136025 of SEQ ID NO:1 (PPVO insert of VVOV 82), 31003-46845 of SEQ ID NO:1 (PPVO insert of VVOV 96), 24056-33789 of SEQ ID NO:1 (PPVO insert of VVOV 97), 10264-20003 of SEQ ID NO:1 (PPVO insert of VVOV 215), 82324-92502 of SEQ ID NO:1 (PPVO insert of VVOV 243), 47952-66263 of SEQ ID NO:1 (PPVO insert of VVOV 245), 89400-103483 of SEQ ID NO:1 (PPVO insert of VVOV 283), 74804-88576 of SEQ ID NO:1 (PPVO insert of VVOV 285), and 102490-108393 of SEQ ID NO:1 (PPVO insert of VVOV 330).
The invention also relates to purified and isolated polynucleotide which encode for the same amino acid sequence as the active fragments of the PPVO genome of the previous paragraph and to polynucleotides of at least 15 or 30 or 100 nucleotides binding under stringent conditions to the above mentioned active fragments of the PPVO genome or its complementary sequence.
The invention also relates to polynucleotides with 99%, 95%, or 90%, or 80% sequence homology to sequences consisting of nucleotides 122616-136025 of SEQ ID NO:1 (PPVO insert of VVOV 82), 31003-46845 of SEQ ID NO:1 (PPVO insert of VVOV 96), 24056-33789 of SEQ ID NO:1 (PPVO insert of VVOV 97), 10264-20003 of SEQ ID NO:1 (PPVO insert of VVOV 215), 82324-92502 of SEQ ID NO:1 (PPVO insert of VVOV 243), 47952-66263 of SEQ ID NO:1 (PPVO insert of VVOV 245), 89400-103483 of SEQ ID NO:1 (PPVO insert of VVOV 283), 74804-88576 of SEQ ID NO:1 (PPVO insert of VVOV 285), and 102490-108393 of SEQ ID NO:1 (PPVO insert of VVOV 330) or the respective complementary sequences.
The invention also relates to purified and isolated polynucleotide, with a sequence of nucleotides 3 to 539 (ORF L1), 781 to 449 (ORF L2r), 1933 to 1664 (ORF L3r), 3269 to 2790 (ORF L4r), 2799 to 3851 (ORF L5), 2962 to 3753 (ORF L6), 3784 to 3122 (ORF L7r), 4341 to 4129 (ORF L8r), 4904 to 4428 (ORF 1ar), 6517 to 4970 (ORF 1r), 8042 to 6684 (ORF 2r), 9989 to 8070 (ORF 3r), 11195 to 10062 ORF 4r), 11493 to 11227 (ORF 5r), 11802 to 12038 (ORF 6), 12358 to 12080 (ORF 7r), 13980 to 12364 (ORF 8r), 14826 to 14053 (ORF 9ar), 15080 to 15394 (ORF 10), 16838 to 15423 (ORF 11r), 19021 to 16847 (ORF 12r), 19704 to 19156 (ORF 13r), 20314 to 19736 (ORF 14r), 20401 to 22101 (ORF 15), 22125 to 22940 (ORF 6), 23003 to 23866 (ORF 17), 26908 to 23873 (ORF 18r), 26926 to 27213 (ORF 19), 27626 to 27216 (ORF 20r), 29754 to 27616 (ORF 21r), 32217 to 29800 (ORF 22r), 33380 to 32418 (ORF 23r), 33602 to 33393 (ORF 24r), 34466 to 33612 (ORF 25r), 34735 to 34502 (ORF 26r), 35905 to 34739 (ORF 27r), 37194 to 35905 (ORF 28r), 37200 to 39248 (ORF 29), 41037 to 39229 (ORF 30r), 41374 to 42066 (ORF 31), 42336 to 41731 (ORF 32r), 42407 to 41997 (ORF 33r), 42410 to 43765 (ORF 34), 43770 to 43958 (ORF 35), 43980 to 44534 (ORF 36), 45727 to 44537 (ORF 37r), 45760 to 46557 (ORF 38), 46567 to 47568 (ORF 39), 47572 to 48303 (ORF 40), 48352 to 48621 (ORF 41), 49887 to 48634 (ORF 42r), 49917 to 50693 (ORF 43), 50719 to 51102 (ORF 44), 51059 to 51511 (ORF 44a), 51584 to 52591 (ORF 45), 52509 to 53066 (ORF 46), 53523 to 53023 (ORF 47r), 53607 to 57473 (ORF 48), 58070 to 57528 (ORF 49r), 57700 to 58662 (ORF 50), 59674 to 58673 (ORF 51r), 62089 to 59678 (ORF 52r), 62198 to 62881 (ORF 53), 62909 to 63862 (ORF 55), 63858 to 64271 (ORF 56), 64309 to 66831 (ORF 57), 67266 to 66799 (ORF 58r), 67803 to 67273 (ORF 58ar), 67915 to 68607 (ORF 59), 68624 to 70984 (ORF 60), 70994 to 72898 (ORF 61), 72938 to 73507 (ORF 62), 73540 to 74211 (ORF 63), 76120 to 74207 (ORF 64r), 76749 to 76186 (ORF 65r), 77698 to 76799 (ORF 66r), 79343 to 77709 (ORF 67r), 79816 to 79367 (ORF 68r), 80529 to 79858 (ORF 69r), 80774 to 80529 (ORF 70r), 82815 to 80788 (ORF 71r), 83835 to 82834 (ORF 72r), 83874 to 85583 (ORF 73), 85535 to 84402 (ORF 74r), 88096 to 85574 (ORF 75r), 87759 to 88667 (ORF 76), 88920 to 88642 (ORF 77r), 91652 to 88938 (ORF 78r), 91667 to 92674 (ORF 79), 93466 to 92681 (ORF 80r), 93761 to 93486 (ORF 81r), 94060 to 93788 (ORF 82r), 94238 to 94080 (ORF 83r), 94508 to 94242 (ORF 84r), 95571 to 94498 (ORF 85r), 96187 to 95600 (ORF 86r), 96202 to 97665 (ORF 87), 97915 to 97643 (ORF 88r), 98251 to 99537 (ORF 89), 99537 to 99974 (ORF 90), 100001 to 101140 (ORF 91), 101168 to 104650 (ORF 92), 106354 to 104795 (ORF 93r), 107947 to 106400 (ORF 94r), 108256 to 107990 ORF 95r), 108719 to 108300 (ORF 96r), 109679 to 108738 (ORF 97r), 109861 to 109682 (ORF 98r), 110830 to 10033 (ORF 99r), 110208 to 110417 (ORF 100), 110469 to 110651 (ORF 100a), 110915 to 111397 (ORF 101), 111419 to 111913 (ORF 102), 111949 to 112485 (ORF 103), 112593 to 113450 (ORF 104), 113323 to 112967 ORF 105r), 113526 to 114152 (ORF 106), 114199 to 115236 (ORF 107), 115353 to 115787 (ORF 108), 115859 o 116551 (ORF 109), 116729 to 117523 (ORF 110), 117572 to 117114 (ORF 111r), 117423 to 118085 (ORF 12), 118968 to 118375 (ORF 114r), 118508 to 119119 (ORF 115), 119588 to 120202 (ORF 116), 120314 to 21231 (ORF 117), 121380 to 123920 (ORF 118), 121288 to 122256 (ORF 119), 122350 to 123924 (ORF 120), 123962 to 125566 (ORF 121), 125193 to 124591 (ORF 122r), 125689 to 123935 (ORF 123r), 123839 to 123297 ORF 123ar), 125652 to 126170 (ORF 124), 126121 to 125699 (ORF 125r), 126279 to 127769 (ORF 126), 127851 to 128408 (ORF 127), 128520 to 130076 (ORF 128), 130105 to 131700 (ORF 129), 131790 to 133283 (ORF 130), 133246 to 133920 (ORF 131), 133972 to 134370 (ORF 132), 134418 to 134693 (ORF 133a), 134402 to 134992 (ORF R1), 134853 to 134419 (ORF R2r), 135628 to 135897 (ORF R3), 136780 to 137112 ORF R4), and 137558 to 137022 (ORF R5r) of SEQ ID NO:1, which encode for the identified open reading frames (ORFs) listed in Table 7. ORFs of this paragraph of which the start position is a larger number than the stop position are coded by the complementary sequence of SEQ ID NO:1. The names of these ORFs end with the letter “r”. The invention also relates to the complementary sequences of the sequences of this paragraph.
The invention also relates to polynucleotides which encode for the same amino acid sequence as encoded by the identified ORFs of the previous paragraph. The invention also relates to polynucleotides of at least 15, 30 or 100 nucleotides binding under stringent conditions to the identified ORFs. The invention also relates to polynucleotides which show at least 99%, 95% or 90% or 80% sequence homology to the sequences of the previous paragraph or which are functional variants a sequence of the previous paragraph.
A functional variant of a gene, within the meaning of the invention, shall be defined as a gene which is at least 99%, or 95%, or 90%, or 80% homologous to the first gene and which has a similar biological function as the first gene. A functional variant of a gene can also be a second gene encoding the same amino acid sequence as does the first gene (or as does a functional variant thereof), employing the degeneration of the genetic code. A functional variant of a gene can also be a polynucleotide comprising the same sequence as has said gene, however said polynucleotide being shorter (i.e., by means of deletions of one or several nucleotides at one or both ends of the polynucleotide) or said polynucleotide having additional nucleotides at one or both ends of the identical part of the polynucleotide.
A functional variant of a protein, within the meaning of the invention, shall be defined as another protein which is at least 99%, or 95%, or 90%, or 80% homologous to the first protein and which has a similar biological function as has the original protein.
The invention also relates to recombinant proteins encoded by nucleotides of the invention and parts and fragments of said proteins which are at least 5 or 7 or 10 or 30 amino acids long.
The invention also relates to recombinant proteins encoded by nucleotides of the invention and parts and fragments of said proteins which are at least 5 or 7 or 10 or 30 amino acids long, said recombinant proteins being attached to a carrier protein or to another carrier. Attaching a protein to a carrier protein can improve or strengthen the immune response to said protein, thereby enhancing the therapeutic or prophylactic effect of administering said protein to a subject.
The invention also relates to vectors containing polynucleotides of the invention and cells containing these vectors or polynucleotides of the invention.
The invention also relates to the use of recombinant proteins and polynucleotides of the invention, alone or in combination with at least one other recombinant protein or polynucleotide of the invention for the manufacture of pharmaceutical compositions.
Combinations of recombinant proteins (or polynucleotides) according to the invention, comprise

- combinations of at least two recombinant proteins encoded by SEQ ID NO:1 (or combinations of at least two fragments of a polynucleotide of SEQ ID NO:1),
- combinations of at least two recombinant proteins encoded by the same active fragment of the PPVO genome, i.e., two or more recombinant proteins encoded by the same VVOV of
- Table 3, Table 4, Table 5, and Table 6 (or combinations of at least two fragments of the same active fragment (VVOV) of the PPVO genome),
- combinations of at least two recombinant proteins, encoded by at least two distinct active fragments of the PPVO genome, i.e., from distinct VVOVs of
- Table 3, Table 4, Table 5, and Table 6 (or combinations of at least two fragments of at least two distinct active fragments (VVOVs) of the PPVO genome), or
- combinations of at least two distinct recombinant proteins encoded by ORFs of Table 7 (or combinations of at least two polynucleotides with the sequence of any of the ORFs listed in Table 7).

The invention also relates to the use of recombinant viruses comprising the Vaccina lister genome and selected fragments of the PPVO genome for the manufacture of pharmaceutical compositions.
The invention also relates to the use of recombinant proteins and polynucleotides of the invention for the manufacture of pharmaceutical compositions for the treatment of virus related diseases, viral infections, non-viral infections, proliferative diseases, inflammatory diseases, allergic diseases, and autoimmune diseases.
Viral infections, within the meaning of the invention, shell be understood as diseases associated with viral infections of the human or animal body, such as hepatitis, papillomatosis, herpes virus infections, liver fibrosis, HIV infections, AIDS, and influenza.
Non-viral infections, within the meaning of the invention, shell be understood as diseases associated with non-viral infections of the human or animal body, such as infections with mycobacteria, mycoplasma, amoeba, and plasmodia.
Proliferative diseases, within the meaning of the invention, shell be understood as diseases associated with proliferative disorders, such as cancer, leukemia, warts, tumor diseases, and other skin neoplasms.
Inflammatory diseases, within the meaning of the invention, shell be understood as diseases associated with acute or chronic inflammatory conditions, such as inflammation of the skin or organs, Crohn's disease, COPD, asthma, but also conditions related to the healing of wounds, e.g., Ulcus cruris, and others.
Allergic diseases, within the meaning of the invention, shell be understood as comprising both systemic and topical allergies.
Autoimmune diseases within the meaning of the invention, shell be understood as comprising systemic lupus erythematosus, Sjogren's syndrome, Hashimoto's thyroiditis, rheumatoid arthritis, and juvenile diabetes mellitus, and other autoimmune diseases.
The invention also relates to the use of recombinant viruses comprising a Vaccinia lister genome and fragments of a PPVO genome for the manufacture of pharmaceutical compositions.
The invention also relates to the use of recombinant viruses comprising a Vaccinia lister genome and at least one heterologous gene to express at least one heterologous gene in a subject, e.g., for prophylactic and/or therapeutic purposes.
The invention also relates to the use of a recombinant viruses comprising a Vaccinia lister genome and at least one heterologous gene for gene therapy.
“Gene therapy”, within the meaning of the invention, shall be understood as the act of administering to a subject polynucleotides (and, if necessary, suitable adjuvants or suitable carriers) for the purpose of obtaining a prophylactic or therapeutic effect in said subject. Typically, the polynucleotides administered are expressed in the subject and the expressed gene products exert a prophylactic or therapeutic effect.
The invention also relates to

(a) a particle-like structure comprising a recombinant polypeptide encoded by an open reading frame (ORF) of the polynucleotide of SEQ ID NO:1 or functional variants of said polypeptides,
(b) the use of a particle-like structure of (a) for the preparation of a medicament,
(c) the use of a particle-like structure of (a) for the preparation of a medicament for the treatment of virus related diseases, viral infections, non-viral infections, proliferative diseases, inflammatory diseases, allergic diseases, and/or autoimmune diseases,
(d) pharmaceutical compositions comprising a particle-like structure of (a), and to
(e) pharmaceutical compositions comprising a particle-like structure of (a) for the treatment of virus related diseases, viral infections, non-viral infections, proliferative diseases, inflammatory diseases, allergic diseases, and/or autoimmune diseases.

BRIEF DESCRIPTION OF THE FIGURE

FIG. 1 shows the genomic locations of the DNA fragments constituting the insertion library. The position of each DNA fragment is shown against the KpnI map of PPVO NZ2 (Mercer, et al., Virology (1997) 229:193-200).

EXAMPLES

Example 1: Determination of the Integrated PPVO Fragments in the Active VVOVs

DNA Preparation from Vaccinia lister/PPVO Recombinants was Performed as Follows

BK-KL 3A cells were grown to confluency in 175 cm²flasks (Becton Dickson Labware, Heidelberg, Germany). Cells were infected with a recombinant Vaccina lister/PPVO virus (VVOV) of Mercer, et al. (Virology (1997) 229:193-200) at a MOI (multiplicity of infection) of 0.01-0.32 and incubated at 37° C. until 100% CPE (cytopathic effect) had been reached. The infected cells were frozen at −80° C., thawed and processed as follows, with modification to the RNA extraction method of Vilcek, et al. (J. Clin. Microbiol. (1994) 32:2225-2231). Using 2 ml PLG Heavy Eppendorf tubes (Eppendorf, Hamburg, Germany) 0.5 ml aliquots of cellular suspension were incubated with 100 μg Proteinase K (Roche Molecular Biochemicals, Mannheim, Germany) and 50 μl SDS (Sigma-Aldrich, Chemie GmbH, Taufkirchen, Germany) at 56° C. for 25 min. 0.5 ml Roti®-Phenol/Chloroform (Carl Roth GmbH, Karlsruhe, Germany) was added and the tubes were inverted for several times. After centrifugation at 12000×g for 10 min, the upper phase was transferred into a fresh tube and two volumes of ethanol (Merck Eurolab GmbH, Darmstadt, Germany) and 1/10 volume of sodium acetate (Sigma-Aldrich, Chemie GmbH, Taufkirchen, Germany) was added. The reagents were mixed several times and stored at −80° C. for 3 h. The tubes were centrifuged at 14000×g for 30 min, the supernatant was decanted and the pellet was air-dried for 5-10 min. Finally the DNA pellet was resuspended in 30 μl nuclease free water and stored at −20° C. until used.
DNA concentration was measured spectrophotometrically on a BioPhotometer 6131 (Eppendorf, Hamburg, Germany) at 260/280 nm. The DNA yield of different sample preparations spanned from 100 ng/ml up to 1 μg/ml.

Polymerase Chain Reaction (PCR) of Terminal Flanking Regions of the Integrated Fragments in the Vaccinia lister/PPVO Recombinants was Performed as Follows

Three different PCR amplification systems were used for amplifying the terminal flanking regions. Each reaction mixture of 50 μl contained 100 ng-1 μg resuspended DNA and primers (Table 1)) were added in a final concentration of 300 nM. Amplifications were carried out on a Mastercycler® gradient (Eppendorf, Hamburg, Germany).
The 3-prime flanking region of recombinant VVOV 285 had been analyzed using 2× Ready-Mix™ PCR Master Mix (1.5 mM MgCl₂) (AB Gene, Hamburg, Germany). 1 μl BSA (MBI Fermentas GmbH, St. Leon-Rot, Germany) was added to each reaction. Denaturation was performed at 94° C. for 3 min, followed by 30 cycles (94° C. for 30 s, 58.7° C.-65.3° C. for 30 s, 72° C. for 1 min) and 72° C. for 5 min.
The 5-prime flanking region of the PPVO insert of recombinant VVOV 285, the 3-prime flanking region of VVOV 97, and both terminal flanking regions of VVOV 215, VVOV 243, VVOV 245 were amplified using PfuTurbo® DNA Polymerase (Stratagene, Amsterdam, Netherlands). The reactions were setup with 2.5 U of enzyme, 1.5 mM MgCl₂and 200 μM of each dNTP. Denaturation was performed at 94° C. for 3 min, followed by 30 cycles (94° C. for 30 s, 58.7° C.-65.3° C. for 30 s, 72° C. for 1 min) and 72° C. for 5 min.
The amplification of the 5-prime flanking region of VVOV 97 and VVOV 82, the 3-prime flanking region of VVOV 96 and VVOV 283 were performed with Platinium® Pfx DNA Polymerase (Life Technologies GmbH, Karlsruhe, Germany). A reaction of 50 μl contained 1.25 U polymerase, 1-1.5 mM MgCl₂and 300 μM of each dNTP. Additional use of PCRx Enhancer Solution was necessary for amplification of the 5-prime flanking regions of VVOV 96 (1× concentrated) and the 3-prime flanking regions of VVOV 82 (2× concentrated). Denaturation was performed at 94° C. for 2 min, followed by 30 cycles (94° C. for 15 s, 54.6° C.-60.7° C. for 30 s, 68° C. for 1-2 min) and 68° C. for 5-7 min.
18 μl of each amplification product was analyzed by agarose gel electrophoresis on 1.5-2% SeaKem LE agarose (Biozym, Hessisch Oldendorf, Germany). After staining in a ethidium bromide solution for 20 min the DNA fragments were visualized on an UV transilluminator UVT-20 M/W (Herolab, Wiesloch, Germany).
The sequence of the amplified DNA-fragments were determined by standard sequencing procedures and compared to the published Vaccinia lister thymidine kinase-sequence and the genome sequence of PPVO NZ2 to determine exactly the integrated PPVO NZ2 sequences.

TABLE 1

PCR-primers, amplification and sequencing of the terminal flanking regions
of the integrated fragments in the Vaccinia lister/PPVO NZ2 recombinants

	Amplified				Length of
	terminal				amplification

region of

Primers used for amplification

product

VVVO	NZ2 insert	Primer name	Sequence 5′→3′	SEQ ID NO:	[bp]

VVOV	5′	VAC-P11-1	ATTACAGTGATGCCTACATGCCG	2	264
215		PPVO 14r-1	GCTGTAGTCGTGGTCCGGC	3
	3′	PPVO 4r-2	CTTCCTAGGCTTCTACCGCACG	4	402
		VAC-TK-1	CGGTTTACGTTGAAATGTCCCAT	5

VVOV	5′	VAC-P11-1	ATTACAGTGATGCCTACATGCCG	2	553
245		PPVO 57-1	CTGGCCAACGACGCCTTC	6
	3′	PPVO 40-1	TCTGGTACCCCTTGCCGG	7	321
		VAC-TK-1	CGGTTTACGTTGAAATGTCCCAT	5

VVOV	5′	VAC-P11-1	ATTACAGTGATGCCTACATGCCG	2	241
285		PPVO 78r-5	GAACCCGCTCTCGCTCGA	8
	3′	PPVO 64r-1	GCCGGGCAAGTGTCTGGTC	9	320
		VAC-TK-1	CGGTTTACGTTGAAATGTCCCAT	5

VVOV	5′	VAC-P11-1	ATTACAGTGATGCCTACATGCCG	2	392
330		PPVO 92-1	CTCGAAGTAGCTGATGTCGCG	10
	3′	PPVO 96r-1	AGAGCTTTACGTAGACTCTCCAAGTGTC	11	462
		VAC-TK-1	CGGTTTACGTTGAAATGTCCCAT	5

VVOV	5′	VAC-TK-fwd	ATACGGAACGGGACTATGGACG	12	239
96		PPVO 22r-3	GCGGTGGCCATGTACGTG	13
	3′	PPVO 22r-4	GGTTGTGGCGATGGTCGG	14	1055
		VAC-TK-1	CGGTTTACGTTGAAATGTCCCAT	5

VVOV	5′	VAC-TK-fwd	ATACGGAACGGGACTATGGACG	12	309
97		PPVO 18r-1	CTTGATGAGCCGGACGCA	15
	3′	PPVO 25r-1	CCGAGTTGGAGAGGAAGGAGC	16	318
		VAK-TK-1	CGGTTTACGTTGAAATGTCCCAT	5

VVOV	5′	VAC-P11-1	ATTACAGTGATGCCTACATGCCG	2	478
243		PPVO 79-1	CTGTTGGAGGATGAGGTCAAGGA	17
	3′	PPVO 71r-1	CGTGCTCATGCCTGTGGAC	18	269
		VAC-TK-1	CGGTTTACGTTGAAATGTCCCAT	5

VVOV	5′
283	3′	PPVO 92-4	CGACATCCTCACCTGCAAGAAG	19	234
		VAC-TK-1	CGGTTTACGTTGAAATGTCCCAT	5

VVOV	5′	VAK-TK-fwd	ATACGGAACGGGACTATGGACG	12	275
82		PPVO 120-1	TACAGGCAGCCCGTGACC	20
	3′	PPVO R3R4-3	GCCGTGTGTCACGTTGATGC	21	1960
		VAC-TK-1	CGGTTTACGTTGAAATGTCCCAT	5

Example 2: Induction of Interferon Gamma and Tumor Necrosis Factor Alpha by PPVO Gene Products

The 16 recombinants were tested of their ability to induce tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ) in whole blood cultures.
Whole blood cultures containing blood and RPMI medium (Life Technologies GmbH, Karlsruhe, Germany) in the ratio of 1:5 were stimulated with the recombinant viruses. A pure Vaccinia lister and a whole PPVO preparation served as controls. All preparations were used at a final dilution of 1:10. The stimulation for the IFN-γ determination was done together with Concanavalin A (SIGMA, St. Louis, Mo.), because the virus alone does not induce IFN-γ. Then the cells were incubated for 24 h (TNF-α) and or 72 h (IFN-γ). The cytokine concentration was then determined in the cell culture supernatants by TNF-α or IFN-γ specific ELISA. These time points were found to be optimal when the experimental conditions were determined using whole PPVO as a control.
It was possible to identify 5 active recombinant viruses (VVOV 96, VVOV 97, VVOV 243, VVOV 285, and VVOV 330) that induced both TNF-α and IFN-γ secretion and, thus, could mimic the effect of the whole PPVO. The results are depicted in Table 2.

TABLE 2

Recombinant Virus Clone or	Interferon	TNF
control	Induction (%)	Induction (%)

Vaccinia virus control	100	100
NZ-2 control	2224	264
VVOV 80	200	66
VVOV 82	173	65
VVOV 85	209	94
VVOV 86	138	73
VVOV 96	1638	1016
VVOV 97	1713	1285
VVOV 212	94	62
VVOV 213	192	38
VVOV 215	97	82
VVOV 216	197	71
VVOV 243	1446	933
VVOV 245	98	45
VVOV 247	85	74
VVOV 283	115	78
VVOV 285	1128	1127
VVOV 330	1762	2135

TNF-α was determined after 24 h stimulation of blood cells with the recombinant virus or the controls, respectively. IFN-γ was determined after 72 h stimulation of blood cells with the recombinant virus or the controls. Stimulation was performed in the presence of the mitogen ConA. The relative induction in percent of the Vaccinia virus control is shown. Therefore, values greater than 100% are due to the activity of the PPVO fragments. Active PPVO fragments are in bold. The data represent mean values of three different blood donors.

TABLE 3

	PPVO NZ2 Sequence	PPVO NZ2 ORFs
Active recombinant	[Bp] that is contained in	that are contained in
PPVO Vaccinia virus	the recombinant	the recombinant

VVOV
97	24056-33789	18r-25r
VVOV
96	31003-46845	22r-39
VVOV 285	74804-88576	64r-76
VVOV 243	82324-92502	71r-79
VVOV 330	102490-108393	92-96r

The recombinant Vaccinia lister/PPVO viruses that induce both interferon gamma and TNF-α expression are listed in column 1, the corresponding PPVO sequence in column 2 and all open reading frames (ORFs) that are completely or partially contained in the recombinant are depicted in column 3.

Example 3: Local Immunomodulation by PPVO Gene Products in Liver Sinus Endothelial Cells (LSEC)

We have established a new cell-based assay system that allows testing of hepatoprotective properties of recombinant PPVO proteins expressed in different systems (e.g., Vaccinia virus). This assay system uses primary murine liver cells, which play the central role in deciding whether immunity or tolerance is induced in the liver, the LSEC. The unique ability of LSEC to present exogenous antigens to CD8+ T cells on MHC class I molecules allows immune surveillance of hepatocytes as viral antigens released by infected hepatocytes are likely to be taken by LSEC and presented to cells of the immune system. The new assay allows to measure the ability of LSEC to interact antigen-specifically with CD8+ T cells, that are responsible for tissue destruction in necroinflammatory hepatitis.
Pure populations of LSEC are isolated from murine liver by a stepwise procedure of portal-vein perfusion with collagenase A (0.05%), mechanical dispersion and further enzymatic digestion in a rotatory waterbath for 40 min at 37° C. (245 rpm), gradient centrifugation (metrizamide 1.089 g/cm³) and centrifugal elutriation using a Beckman Avanti J25I centrifuge equipped with a JE-6B rotor and a standard elutriation chamber. LSEC cell populations isolated by this method are typically around 95-99% pure as measured by uptake of endothelial cell specific substrate (acetylated low density lipoprotein). LSEC were seeded onto collagen type I coated 24 well tissue culture plates at a density of 100.000 cells per well and were further cultured in Dulbecco's modified Eagle Medium supplemented with 5% fetal calf serum (specially tested not to interfere with the assay system) and 2% glutamine. Three days after isolation, when LSEC gained a post mitotic and quiescent state, we tested for the ability of LSEC to present soluble ovalbumin to (ovalbumin-specific) CD8+ T cells. LSEC were incubated with 1 μM of ovalbumin for three hours (antigen dose and time were previously shown to be optimal for testing of substances suspected to influence antigen-presentation), washed and incubated with a CD8+ T cell hybridoma (200.000 cells/well) that recognizes the peptide SIINFEKL (SEQ ID NO:320). SIINFEKL (SEQ ID NO:320) is recognized in a H2b context and directly binds on the MHC-I molecules. Therefore, it has not to be processed by the cell. This allows to differentiate between accessory functions of LSEC (such as MHC-I expression) and antigen-processing function.
The extent of CD8+ T cell activation was measured by determining the extent of IL-2 release from T cells by specific sandwich ELISA.
Using Vaccinia virus expressed recombinant proteins derived from PPVO we have been able to attribute hepatoprotective activity to individual clones. To be able to compare different clones directly with respect to their ability to influence cross-presentation by LSEC, we used equal amounts of “infectious units”.
We found that LSEC cross-present exogenous ovalbumin very efficiently on MHC class I molecules (k^b) to CD8+ T cells. To our surprise we found if LSEC were incubated with several recombinant PPVO proteins we observed subsequently a potent downregulation of cross-presentation by more than 60% compared to the mock-treated control that includes all but the active ingredient. Several regions within the genome of PPVO have immunoregulatory properties. Especially the region termed 82 (43% reduction) which is located at the 3′ end of the genome appears to be responsible for the overall effect of PPVO on cross-presentation by LSEC. Further regions (VVOV 215, VVOV 212, VVOV 247 and VVOV 86) bear further immunoregulatory potential, although to a lesser degree (around 30% reduction in cross-presentation). It further appears that genes coding for proteins that downregulate cross-presentation are arranged in clusters. It is of interest to note that we identified two gene clusters coding for proteins that improved cross-presentation (VVOV 330, VVOV 283, VVOV 285, VVOV 97, and VVOV 96). However, for unknown reasons the downregulatory effect of the proteins mentioned above is dominant in the activity of PPVO on cross-presentation.
Our results strongly suggest that PPVO contains a mixture of different proteins that in a complementary way work to eliminate hepatocytes from hepatitis B virus while conserving hepatic integrity and avoiding long lasting damage secondary to hepatic fibrosis. As PPVO contains a gene with high homology to the anti-inflammatory agent IL-10 (located in the 5-prime region of the genome) we wondered whether the potent downregulatory effect of the clone 82 was due to expression of ovine IL-10. This assumes that there is cross-reactivity between murine and ovine IL-10 at the level of receptor recognition. We have been unable to demonstrate involvement of ovine IL-10 on the immunoregulatory potential of PPVO. Recombinant murine IL-10 did not show any influence on cross-presentation through LSEC and several monoclonal antibodies to murine and human IL-10 did not influence PPVO mediated downregulation of cross-presentation. We conclude that the immunoregulatory component of PPVO is probably not IL-10 but a new, so far not identified mediator. The data for the MHC-I cross-presentation-down-modulating recombinant virus are depicted in Table 4, those for the MHC-I cross-presentation-stimulating recombinant viruses in Table 5.

TABLE 4

	PPVO NZ2 Sequence	PPVO NZ2 ORFs
Active recombinant	[Bp] that is contained in	that are contained in
PPVO Vaccinia virus	the recombinant	the recombinant

VVOV
82	122616-136025	120-R3

The recombinant Vaccinia lister/PPVO virus that down-modulates the MHC-I cross presentation is designated in column 1, the corresponding PPVO sequence in column 2 and all open reading frames (ORFs) that are completely or partially contained in the recombinant are depicted in column 3.

TABLE 5

	PPVO NZ2-Sequence	PPVO NZ2-ORFs
Active recombinant	[Bp] that is contained in	that are contained in
PPVO Vaccinia virus	the recombinant	the recombinant

VVOV
97	24056-33789	18r-25r
VVOV
96	31003-46845	22r-39
VVOV 285	74804-88576	64r-76
VVOV 283	89.4-103483	78r-92
VVOV 330	102490-108393	92-96r

The recombinant Vaccinia lister/PPVO viruses that stimulate the MHC-I cross presentation are designated in column 1, the corresponding PPVO sequence in column 2 and all open reading frames (ORFs) that are completely or partially contained in the recombinant are depicted in column 3.

Example 4: Determination of the Immunostimulatory Activity of the Vaccinia lister/PPVO Recombinants in the Aujeszky Mouse Model

We also tested the activity of recombinant Vaccinia lister/PPVO NZ2-viruses in the Aujeszky mouse model, a lethal challenge model of acute Suid Herpesvirus 1 disease for determining the activity of various immunostimulators (e.g., Baypamun®, CpG oligonucleotides).
a) Conditions Employed for the Mice
The NMRI mice (outbreed strain HdsWin:NMRT; female; weight: 18-20 g; obtained via Harlan/Winkelmann, Borchen, Germany) were kept in autoclavable polycarbonate crates lined with sawdust in an S2 isolation stall at 20-22° C. (atmospheric humidity: 50-60%) and subjected to an artificial day/night rhythm (illumination from 6:30 h to 18:30 h and darkness from 18:30 h to 6:30 h). They had free access to feed and water.
b) Challenge Model
Groups of mice consisting of 10 mice per group were used for the tests. All of the animals in one group were given the same test substance.
After the mice were supplied they were kept in the animal stall for 2-3 days. Then the Vaccinia lister/PPVO NZ2 recombinants were diluted with PBS (Life Technologies GmbH, Karlsruhe, Germany) to a titer equivalent of approx. 10⁸TCID₅₀/ml and thermally inactivated (twice for one hour at 58° C.). Of these solutions 0.2 ml was administered per mouse intraperitoneally.
24 hours after the treatment the mice were infected with the pseudorabies virus of the Hannover H2 strain by intraperitoneal administration. For this purpose the virus was diluted in PBS to a test titer of approx. 10⁴TCID₅₀/ml and 0.2 ml of this suspension was administered.
As a negative control one group of mice was treated with PBS and then infected. The mice in this group died 3-8 days after infection. A large proportion of the mice treated the Vaccinia lister IPPVO NZ2 recombinants VVOV 215, VVOV 245, VVOV 285 or VVOV 330 survived infection with the pseudorabies virus. 10 days after the infection with the virus the test was ended.
The level of induced immunostimulation was determined by comparing the number of dead mice in the PBS control group with the number of dead mice in the test groups and was quantified by the efficacy index (EI). This index indicates the percentage proportion of mice protected against the lethal effects of the Aujeszky virus infection through immune stimulation by the substance to be tested. It is calculated by means of the following formula:
EI=(b−a)/b×100,
where b is the percentage proportion of the dead mice in the control group and a the percentage proportion of the dead mice in the test group.
A chi-square test was used for the statistical evaluation. This test reveals the minimum activity indices indicating a significant difference between the mortality rate of those mice treated with the test substance and those treated with PBS. Activity indices of 60% are significant where at least 5 of the mice used in tests with n=6 mice per group in the PBS control group and at least 7 of the mice used in tests with n=10 in the PBS control group do not survive the infection with the Aujeszky virus.
Altogether 3 separate tests were carried out in each case. The testing of Vaccinia lister/PPVO NZ2 recombinants in the Aujeszky mouse model shows the following:
Surprisingly, after the treatment of the mice with the Vaccinia lister/PPVO NZ2 recombinants VVOV 215, VVOV 245, VVOV 285 or VVOV 330 the average activity indices of higher than 60% demonstrated immunostimulation. By contrast all of the other Vaccinia lister/PPVO NZ2 recombinants were ineffective. The data is summarized in Table 6.

TABLE 6

	PPVO NZ2-Sequence	PPVO NZ2 ORFs
Active recombinant	[Bp] that is contained in	that are contained in
PPVO Vaccinia virus	the recombinant	the recombinant

VVOV
215	10264-20003	4r-14r
VVOV
245	47952-66263	40r-57
VVOV 285	74804-88576	64r-76
VVOV 330	102490-108393	92-96r

The recombinant Vaccinia lister/PPVO viruses that protected mice from herpesvirus induced death are designated in column 1, the corresponding PPVO sequence in column 2 and all open reading frames (ORFs) that are completely or partially contained in the recombinant are depicted in column 3.

TABLE 7

ORF	from	to	N-term	SEQ ID NO	C-term	SEQ ID NO	Comment

L1	3	539	IRGFAG	22	PQKVFRL	23	long termal repeat (LTR)-protein,
							retroviral pseudoprotease

L2r	781	449	MSEGGRL	24	LLGLLFP	25	LTR-protein, retroviral
							pseudoprotease

L3r	1933	1664	MTVHPPK	26	VLPPNSL	27	LTR-protein, retroviral
							pseudoprotease

L4r	3269	2790	MHPSPRR	28	PVSHPFL	29	LTR-protein, retroviral
							pseudoprotease

L5	2799	3851	MGDREGE	30	FEDGVKC	31	LTR-protein, retroviral
							pseudoprotease

L6	2962	3753	MCTVATF	32	GAPRAGW	33	LTR-protein, similar to 134r,
							retroviral pseudoprotease

L7r	3784	3122	MTPTSRE	34	ARTAPPR	35	LTR-protein, retroviral
							pseudoprotease

L8r	4341	4129	MPGEGQY	36	NGGLGKI	37	LTR-protein, retroviral
							pseudoprotease

1ar	4904	4428	MEFCHTE	38	DTAWYIS	39	dUTPase

1r	6517	4970	MLSRESV	40	RAMLTRP	41	homolog of G1L in NZ2, Ankyrin-
							repeats

2r	8042	6684	MFFWFWC	42	SGEGVPV	43

3r	9989	8070	MLGFWGK	44	VLPSVSR	45	involved in maturation of EEV
							(Extracellular Enveloped Virions)

4r	11195	10062	MWPFSSI	46	EFCKPIN	47	Phospholipase D-type enzyme

5r	11493	11227	MLIYGPR	48	RLLKDFP	49	homolog of B3L in NZ2

6	11802	12038	MGVVMCG	50	APAGVIE	51

7r	12358	12080	MPVKVKQ	52	ASREFIV	53	ubiquitination protein with RING-
							finger-motiv (related to yeast
							proteins APC11 and HRT1)

8r	13980	12364	MEEELTR	54	SPMVVFN	55	no Vaccinia virus homolog

9ar	14826	14053	MIRIGGG	56	DNMRVDD	57

10	15080	15394	MDGGVHK	58	EQMCRRQ	59	virion core DNA-binding
							phosphoprotein

11r	16838	15423	MAPPVIE	60	AKNVITH	61	polyA polymerase

12r	19021	16847	MLQLLKR	62	NNRGFRK	63

13r	19704	19156	MACECAS	64	NNCGISF	65	interferon resistance protein,
							homology to mammalian PACT
							(protein activator of the
							interferon-induced protein kinase)
							also called PRKRA (dsRNA
							dependent activator of
							Interferon-induced protein kinase),
							13r-protein contains a dsRBD motiv
							(double-stranded RNA binding
							domain) and a ′DRADA′-domain that
							is typical for RNA-editing enzymes)

14r	20314	19736	MDEDRLR	66	KKGKPKS	67	RNA polymerase

15	20401	22101	MDFVRRK	68	VVLQGRA	69

16	22125	22940	MVDSGTH	70	PENVVLL	71

17	23003	23866	MASYISG	72	RTHTVYV	73

18r	26908	23873	MLFEMEL	74	SKPVFTG	75	DNA polymerase

19	26926	27213	MEPRFWG	76	AKVRPLV	77	distant homolog of the ERV1/ALR-
							protein-family (ERV1: yeast protein,
							Essential for Respiration and
							Vegatative growth, ALR:
							mammalian protein, Augmenter of
							Liver Regeneration)

20r	27626	27216	MEAINVF	78	RAYEGML	79

21r	29754	27616	MLLYPKK	80	LLGDGGD	81	related to 12r

22r	32217	29800	MLIRTTD	82	EAQNMQN	83

23r	33380	32418	MEDERLI	84	PSPCGGE	85

24r	33602	33393	MDKLYTG	86	FHYLKLV	87

25r	34466	33612	MKRAVSK	88	LEAPFNI	89	DNA binding phosphoprotein

26r	34735	34502	MESRDLG	90	LNARRQN	91

27r	35905	34739	MNHFFKQ	92	RSLYTVL	93

28r	37194	35905	MDKYTDL	94	PEKPAAP	95	core protein

29	37200	39248	MENHLPD	96	IEAEPPF	97	RNA helicase

30r	41037	39229	MIVLENG	98	RMGARPR	99	Zn-protease, involved in virion
							morphogenesis

31	41374	42066	MTFRELI	100	DSMASRS	101	late transcription factor

32r	42336	41731	MRGHPAH	102	VAPREEL	103

33r	42407	41997	MASDASP	104	QPSSSRR	105	Glutaredoxin-like enzyme

34	42410	43765	MGIKNLK	106	PRLLKLR	107

35	43770	43958	MVFPIVC	108	LPMLDIS	109	RNA polymerase

36	43980	44534	MREFGLA	110	AEPPWLV	111

37r	45727	44537	MESSKQA	112	TRAPPLF	113	core virion protein precursor

38	45760	46557	MTLRIKL	114	DRSLSCD	115	late transcription factor

39	46567	47568	MGGSVSL	116	YLLIVWL	117

40	47572	48303	MGAAASI	118	TEFPPSV	119	virion protein, related to vaccinia
							F9L

41	48352	48621	MVRRVLL	120	LCLFSMD	121

42r	49887	48634	MEEKRGR	122	ARAMVCL	123

43	49917	50693	MTNLLSL	124	TGAEAAP	125	core protein, DNA binding domain

44	50719	51102	MAAPTTP	126	VDVLGGR	127

44a	51059	51511	MDHEKYV	128	ATLSPGL	129

45	51584	52591	MEGVEMD	130	RPLRGGK	131	poly A polymerase

46	52509	53066	MNRHNTR	132	SVSVVLD	133	RNA polymerase

47r	53523	53023	MFFRRRA	134	GRRPPRP	135

48	53607	57473	MSVVARV	136	EAAEEEF	137	RNA polymerase chain 1

49r	58070	57528	MGDKSEW	138	FVCDSPS	139	tyrosine phosphatase

50	57700	58662	MAAAPLR	140	ATSGVLT	141

51r	59674	58673	MDPPEIT	142	LLVTAIV	143	immunodominant envelope protein

52r	62089	59678	MDSRESI	144	YMINFNN	145	RNA polymerase-associated
							transcription specificity factor (also
							called RAP94)

53	62198	62881	MSSWRLK	146	KAAACKK	147	late transcription factor

55	62909	63862	MRALHLS	148	NSEQVNG	149	topoisomerase I

56	63858	64271	MDEALRV	150	FIRAAVA	151

57	64309	66831	MDAPSLD	152	LYVFSKR	153	mRNA capping enzyme

58r	67266	66799	MEPSAMR	154	DVQHVDL	155	virion protein

58ar	67803	67273	MAGFSQS	156	TTCVPPQ	157

59	67915	68607	MATPANA	158	FSFYSEN	159	Uracil DNA glycosylase

60	68624	70984	MAAPICD	160	IEDVENK	161	ATPase, involved in DNA
							replication

61	70994	72898	MNSDVIK	162	EVSVVNI	163	early transcription factor

62	72938	73507	MSTFRQT	164	ASPAAKN	165	RNA polymerase

63	73540	74211	MRTYTSL	166	WGAAVTR	167	NTP pyrophosphohydrolase

64r	76120	74207	MTSAHAA	168	VDPASIA	169	virion NTPase

65r	76749	76186	MEGRARF	170	RFCNYCP	171

66r	77698	76799	MKTDCAS	172	KLKLLLQ	173	mRNA capping enzyme

67r	79343	77709	MNNSVVS	174	AEKVTAQ	175	rifampicin resistance, virion
							membrane

68r	79816	79367	MKRIALS	176	MALKSLI	177	late transactivator protein

69r	80529	79858	MNLRMCG	178	AACSLDL	179	late transactivator protein

70r	80774	80529	MGDNVWF	180	VLGLEQA	181	thioredoxin-like protein

71r	82815	80788	MESPACA	182	NMCDVLC	183	major core protein

72r	83835	82834	MDLRRRF	184	VDNTGTS	185	core protein

73	83874	85583	MEESVAV	186	LLNYGCG	187	RNA-polymerase

74r	85535	84402	MDRLRTC	188	AEAAESA	189

75r	88096	85574	MVSVMRK	190	QEFYPQP	191	early transcription factor

76	87759	88667	MFQPVPD	192	SACRASP	193

77r	88920	88642	MRPCYVT	194	TRGTQTG	195

78r	91652	88938	MTAPNVH	196	AVSFDSE	197	major core protein

79	91667	92674	MTAVPVT	198	VRKLNLI	199

80r	93466	92681	MASEKMA	200	DLDGGMC	201	virion protein

81r	93761	93486	MGLLDAL	202	RFSAASS	203	virion membrane protein

82r	94060	93788	MDIFETL	204	DIELTAR	205	virion membrane protein

83r	94238	94080	MVSDYDP	206	HFVHSVI	207

84r	94508	94242	MFLDSDT	208	DMPFSVV	209

85r	95571	94498	MGDTVSK	210	KTINVSR	211

86r	96187	95600	MESYFSY	212	EDLFFAE	213	virion membrane protein

87	96202	97665	MFGGVQV	214	GRDLAAV	215	RNA helicase

88r	97915	97643	MSAVKAK	216	PLRDLAR	217	Zn-finger protein

89	98251	99537	MTSESDL	218	AIARAQP	219	DNA polymerase processivity factor

90	99537	99974	MIVAAFD	220	NYVLRIN	221

91	100001	101140	MLALFEF	222	LKELLGP	223	intermiediate transcription factor

92	101168	104650	MEQALGY	224	SLFSPED	225	RNA polymerase b-chain

93r	106354	104795	MESDNAL	226	GQHAAIW	227	A-type inclusion body/Fusion peptide

94r	107947	106400	MEKLVSD	228	GRSGAIW	229	A-type inclusion body/Fusion peptide

95r	108256	107990	MDENDGE	230	QTGYSRY	231	viral fusion protein

96r	108719	108300	MDAVSAL	232	LFLKSIL	233

97r	109679	108738	MADAPLV	234	RELRANE	235	RNA polymerase subunit

98r	109861	109682	MEEDLNE	236	MGQASSA	237

99r	110830	110033	MDVVQEV	238	ADSDGGN	239	ATPase

100	110208	110417	MRSWFWQ	240	PLTGMCL	241

100a	110469	110651	FRPKSVG	242	SGHTKPS	243

101	110915	111397	MAHNTFE	244	KYFCVSD	245	enveloped virion glycoprotein

102	111419	111913	MGCCKVP	246	CMKEMHG	247	enveloped virion glycoprotein

103	111949	112485	MSRLQIL	248	RKLDVPI	249

104	112593	113450	MKAVLLL	250	LNLNPGN	251	GM-CSF/IL-2 inhibition factor

105r	113323	112967	MHASLSS	252	DETLTYR	253

106	113526	114152	MEVLVII	254	GEFFYDE	255

107	114199	115236	MPLFRKL	256	RDALDGL	257

108	115353	115787	MACFIEL	258	TTFSSSE	259

109	115859	116551	MSSSSSE	260	TTGTSTS	261
			TT

110	116729	117523	MACLRVF	262	CSMQTAR	263	GM-CSF/IL-2 inhibition factor

111r	117572	117114	MAIAHTT	264	FRFRTPG	265

112	117423	118085	MAATIQI	266	KRDGYSR	267

114r	118968	118375	MEGLMPK	268	RPISVQK	269

115	118508	119119	MDSRRLA	270	LGDSDSD	271

116	119588	120202	MRLILAL	272	PQMMRIG	273

117	120314	121231	MAGFLGA	274	CKVEEVL	275

118	121380	123920	MHLKKDP	276	LAFPSLA	277

119	121288	122256	MANRLVF	278	RPMEIDG	279

120	122350	123924	MENNDGN	280	RFLPSHK	281	related to 1r/G1L with Ankyrin-repeats

121	123962	125566	MDPAGQR	282	CSETDRW	283

122r	125193	124591	MSSSAAA	284	IAPDSRM	285

123r	125689	123935	MTAEASI	286	DPVYHKK	287

123ar	123839	123297	MPRTTSG	288	REQTEGL	289

124	125652	126170	MANREEI	290	VRVLRRT	291

125r	126121	125699	MTAPTPR	292	AAYSLAR	293

126	126279	127769	MADEREA	294	LACAMRK	295

127	127851	128408	MSKNKIL	296	SYMTTKM	297	sheep-like Interleukin 10

128	128520	130076	MLTRCYI	298	RASGLAE	299	related to 1r/G1L with Ankyrin-repeats

129	130105	131700	MVGFDRR	300	CGRRAPE	301	related to 1r/G1L, with Ankyrin-
							repeats (NT slightly changed)

130	131790	133283	MILARAG	302	PDAAALS	303	Kinase

131	133246	133920	MPPRTPP	304	RPAALRA	305

132	133972	134370	MKLLVGI	306	RPPRRRR	307	homolog to the sheep VEGF (Vascular
							Endothelial Growth Factor)

133a	134417	134693	MRKKAPR	308	ARTAPPR	309	corresponds to L7r

R1	134402	134992	MMRSGHA	310	RMHRSEL	311	LTR-protein (corresponds to L4r),
							retroviral pseudoprotease

R2r	134853	134419	MCTVATF	312	SVAPSSA	313	LTR-protein (corresponds to L6, 134r),
							retroviral pseudoprotease

R3	135628	135897	MTVHPPK	314	VLPPNSL	315	LTR-protein (corresponds to L3r),
							retroviral pseudoprotease

R4	136780	137112	MSEGGRL	316	LLGLLFP	317	LTR-protein (corresponds to L2r),
							retroviral pseudoprotease

R4r	137558	137022	IRGFAGG	318	PQKVFRL	319	LTR-protein (corresponds to L1r),
							retroviral pseudoprotease

Sequences of the Parapox ovis open reading frames. ORFs the names of which end with “r” are encoded on the complementary DNA strand. Base pair positions in the “from” and “to” column are relative to SEQ ID NO:1.

Claims

1. A method for inducing an immunomodulatory activity in a subject, consisting of administering to the subject an individual recombinant protein encoded by a polynucleotide selected from the group consisting of:

(i) a polynucleotide having the sequence consisting of nucleotide residues 31003 to 46845 of SEQ ID NO:1 (PPVO insert of VVOV 96),

(ii) a polynucleotide having the sequence consisting of nucleotide residues 24056 to 33789 of SEQ ID NO:1 (PPVO insert of VVOV 97),

(iii) a polynucleotide having the sequence consisting of nucleotide residues 82324 to 92502 of SEQ ID NO:1 (PPVO insert of VVOV 243), and

(iv) a polynucleotide having the sequence consisting of nucleotide residues 74804 to 88576 of SEQ ID NO:1 (PPVO insert of VVOV 285).

2. The method of claim 1, wherein the immunomodulatory activity results in the induction of interferon-gamma.

3. The method of claim 1, wherein the immunomodulatory activity results in the induction of tumor necrosis factor-alpha.

4. The method of claim 1, wherein the immunomodulatory activity results in the stimulation of MHC-I cross-presentation.

5. The method of claim 1, wherein the recombinant protein is attached to or is a part of a structure selected from the group consisting of: particle-like structure, fusion protein—protein coated particle, and virus-like particle.

6. A method for inducing an immunomodulatory activity in a subject, consisting of administering to the subject an individual recombinant virus containing a recombinant protein encoded by a polynucleotide selected from the group consisting of:

7. The method of claim 6 wherein the immunomodulatory activity results in the induction of interferon-gamma.

8. The method of claim 6 wherein the immunomodulatory activity results in the induction of tumor necrosis factor-alpha.

9. The method of claim 6 wherein the immunomodulatory activity results in the stimulation of MHC-I cross-presentation.