US20170314039A1

US20170314039A1 - Phytophthora resistant plants belonging to the solanaceae family

Info

Publication number: US20170314039A1
Application number: US15/314,778
Authority: US
Inventors: Christianus Cornelis Nicolaas Van Schie; Karin Ingeborg Posthuma; Tieme Zeilmaker; Geert Johannes De Boer
Original assignee: Enza Zaden Beheer BV
Current assignee: Enza Zaden Beheer BV
Priority date: 2014-06-18
Filing date: 2015-06-18
Publication date: 2017-11-02
Also published as: US20200332313A1; US11299746B2; JP6675332B2; WO2015193418A8; PL3167051T3; HUE055977T2; RS62325B1; JP2017518067A; CN106573963B; ES2886551T3; EP3167051A1; WO2015193418A1; EP3167051B1; CN106573963A

Abstract

The present invention relates to a plant belonging to the Solanaceae family wherein said plant comprises a genetic trait providing Phytophthora resistance and wherein said resistance trait is encoded by a combination of at least two genes having a reduced expression, or transcription, of said genes or a reduced activity of proteins encoded by said genes as compared to said plant belonging to Solanaceae family being susceptible to Phytophthora. The present invention especially relates to plants belonging to the Solanaceae family selected from the group consisting of sweet pepper (Capsicum annuum), Capsicum spp., potato (Solanum tuberosum), petunia, tomato (Solanum lycopersicum), Nicotinia benthamiana, and tabacco (Nicotinia tabacum), and the present Phytophthora resistance is especially a resistance to a plant pathogen selected from the group consisting of Phytophthora spp., Phytophthora capsici, Phytophthora infestans, and Phytophthora nicotinae.

Description

DESCRIPTION

The present invention relates to Phytophthora resistance plants belonging to Solanaceae family wherein said resistance is encoded by a combination of two separate genes. The present invention further relates to the use of these genes for providing Phytophthora resistant plants belonging to Solanaceae family and proteins encoded by the present genes.
The plant pathogen Phytophthora (class: Oomycetes, order: Peronosporales, family: Pythiaceae) is a genus of plant-damaging Oomycetes (water molds) capable of causing large economic losses on crops worldwide, as well as environmental damage in natural ecosystems. Phytophthora pathogens are mostly pathogens of dicotyledons and generally are host-specific parasites. The genus was first described by Heinrich Anton de Bary in 1875. Approximately 100 species have been described amongst which economically important plant pathogens as Phytophthora capsici, Phytophthora infestans, and Phytophthora nicotinae.
Phytophthora infestans was the infective agent of the potato blight that caused the Great fish Famine (1845-1849), and still remains the most destructive pathogen of solanaceous crops, including tomato and potato. The soya bean root and stem rot agent, Phytophthora sojae, has also caused longstanding problems for the agricultural industry. In general, plant diseases caused by this genus are difficult to control chemically, and thus the growth of resistant cultivars is the main management strategy. Other important Phytophthora diseases are:
Phytophthora cactorum—causes rhododendron root rot affecting rhododendrons, azaleas and causes bleeding canker in hardwood trees; Phytophthora capsici—infects Cucurbitaceae fruits, such as cucumbers and squash, Phytophthora cinnamomi—causes cinnamon root rot affecting woody ornamentals including arborvitae and azalea, Phytophthora fragariae—causes red root rot affecting strawberries; Phytophthora kemoviae—pathogen of beech and rhododendron, also occurring on other trees and shrubs including oak, and holm oak, Phytophthora megakarya—one of the cocoa black pod disease species, is invasive and probably responsible for the greatest cocoa crop loss in Africa; Phytophthora palmivora—causes fruit rot in coconuts and betel nuts, Phytophthora ramorum, Phytophthora quercina—causes oak death, and Phytophthora sojae—causes soybean root rot.
Phytophthora is sometimes referred to as a fungal-like organism but it is classified under a different kingdom: Chromalveolata (formerly Stramenopila and previously Chromista). Phytophthora is morphologically very similar to “true” fungi yet its evolutionary history is quite distinct. In contrast to fungi, chromalveolatas are more closely related to plants than animals. Whereas fungal cell walls are made primarily of chitin, chromalveolata cell walls are constructed mostly of cellulose. Ploidy levels are different between these two groups; Phytophthora have diploid (paired) chromosomes in the vegetative (growing, non-reproductive) stage of life, Fungi are almost always haploid in this state. Biochemical pathways also differ, notably the highly conserved.
Phytophthoras may reproduce sexually or asexually. In many species, sexual structures have never been observed, or have only been observed in laboratory matings. In homothallic species, sexual structures occur in single culture. Heterothallic species have mating strains, designated as A1 and A2. When mated, antheridia introduce gametes into oogonia, either by the oogonium passing through the antheridium (amphigyny) or by the antheridium attaching to the proximal (lower) half of the oogonium (paragyny), and the union producing oospores. Like animals, but not like most “true” fungi, meiosis is gametic, and somatic nuclei are diploid. Asexual (mitotic) spore types are chlamydospores, and sporangia which produce zoospores. Chlamydospores are usually spherical and pigmented, and may have a thickened cell wall to aid in its role as a survival structure. Sporangia may be retained by the subtending hyphae (non-caducous) or be shed readily by wind or water tension (caducous) acting as dispersal structures. Also, sporangia may release zoospores, which have two unlike flagella which they use to swim towards a host plant.
The Solanaceae, or nightshades, is an economically important family of flowering plants. The family ranges from herbs to trees, and includes a number of important agricultural crops, medicinal plants, spices, weeds, and ornamentals. Many members of the family contain potent alkaloids, and some are highly toxic.
The Solanaceae family belongs to the order Solanales, in the asterid group dicotyledons (Magnoliopsida). The Solanaceae family consists of approximately 98 genera and some 2,700 species, with a great diversity of habitats, morphology and ecology.
The family has a worldwide distribution being present on all continents except Antarctica. The greatest diversity in species is found in South America and Central America. Solanaceae includes a number of commonly collected or cultivated species. Perhaps the most economically important genus of the family is Solanum, which comprises potato (Solanum tuberosum, in fact, another common name of the family is the “potato family”), tomato (Solanum lycopersicum), and the aubergine or eggplant (Solanum melongena). Another important genus is Capsicum comprising peppers and sweet or bell peppers (Capsicum annuum).
The genus Physalis produces the so-called groundcherries, as well as the tomatillo (Physalis philadelphica), the Cape gooseberry and the Chinese lantern. The genus Lycium contains the boxthorns and the wolfberry Lycium barbarum. Nicotiana contains, among other species, the tabacco plant. Some other important members of Solanaceae include a number of ornamental plants such as Petunia, Browallia and Lycianthes, the source of psychoactive alkaloids, Datura, Mandragora (mandrake), and Atropa belladonna (deadly nightshade). Certain species are universally known for their medicinal uses, their psychotropic effects or for being poisonous.
With the exception of tobacco (Nicotianoideae) and petunia (Petunioideae), most of the economically important genera are contained in the subfamily Solanoideae. Finally, but not less importantly, the Solanacea include many model organisms which are important in the investigation of fundamental biological questions at a cellular, molecular and genetic level, such as tobacco, petunia and N. benthaminia.
Considering the economic importance of many plant members of the Solanaceae family and the destructive effect of the plant pathogen Phytophthora on many members of this family, it is an object, amongst other objects, of the present invention to provide Phytophthora resistant plants.
The above object, amongst other objects, is met by the present invention by providing plants as outlined in the appended claims.
Specifically, the above object of the present invention, amongst other objects, is met, according to a first aspect, by plants belonging to the Solanaceae family wherein the present plants comprise a genetic trait providing Phytophthora resistance and wherein the present resistance trait is encoded by a combination of at least two genes having a reduced expression, or reduced transcription, or a reduced activity of proteins encoded by the present genes as compared to the same plant belonging to Solanaceae family being susceptible to Phytophthora.
According to a preferred embodiment of this first aspect of the present invention, the present plants belonging to the Solanaceae family are selected from the group consisting of potato, petunia, tomato, aubergine, eggplant, tobacco and sweet pepper, more preferably potato, petunia, tomato, sweet pepper and tabacco.
According to another preferred embodiment of this first aspect of the present invention, the present Phytophthora resistance is resistance to a plant pathogen selected from the group consisting of Phytophthora spp., Phytophthora capsici, Phytophthora infestans, and Phytophthora nicotinae.
According to an especially preferred embodiment of this first aspect, the present invention relates to potato, the present Phytophthora resistance is resistance to Phytophthora infestans and the present combination of at least two genes are genes encoding proteins according to SEQ ID No. 1 and SEQ ID No. 2 or proteins having at least 80%, 85%, or 90% sequence identity with SEQ ID No. 1 and SEQ ID No. 2, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.
According to another especially preferred embodiment of this first aspect, the present invention relates to petunia, the present Phytophthora resistance is resistance to Phytophthora nicotianae and the present combination of at least two genes are genes encoding proteins according to SEQ ID No. 3 and SEQ ID No. 4 or proteins having at least 80%, 85%, or 90% sequence identity with SEQ ID No. 3 and SEQ ID No. 4, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.
According to another especially preferred embodiment of this first aspect, the present invention relates to tomato, the present Phytophthora resistance is resistance to Phytophthora infestans and the present combination of at least two genes are genes encoding proteins according to SEQ ID No. 5 and SEQ ID No. 6 or proteins having at least 80%, 85%, or 90% sequence identity with SEQ ID No. 5 and SEQ ID No. 6, such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.
According to another especially preferred embodiment of this first aspect, the present invention relates to sweet pepper (Capsicum annuum) or Capsicum spp., the Phytophthora resistance is resistance to Phytophthora capsici and the combination of at least two genes are genes encoding proteins according to SEQ ID No. 16 and SEQ ID No. 17 or proteins having at least 90% sequence identity with SEQ ID No. 16 and/or SEQ ID No. 17, preferably at least 95% sequence identity, most preferably at least 99% sequence identity.
According to another especially preferred embodiment of this first aspect, the present invention relates to Nicotinia benthamiana, the Phytophthora resistance is resistance to Phytophthora capsici; Phytophthora infestans; or Phytophtora nicotinanae; or combinations thereof and said combination of at least two genes are genes encoding proteins according to SEQ ID No. 18 and a protein having at least 70% sequence identity with SEQ ID No. 18, preferably at least 85% sequence identity, most preferably at least 95% sequence identity.
According to another especially preferred embodiment of this first aspect, the present invention relates to tabacco (Nicotinia tabacum), the Phytophthora resistance is resistance to Phytophthora capsici and/or Phytophthora infestans and/or Phytophtora nicotinanae and the combination of at least two genes are genes encoding proteins according to SEQ ID No. 19 and a protein having at least 70% sequence identity with SEQ ID No. 19, preferably at least 85% sequence identity, most preferably at least 95% sequence identity.
According to yet another especially preferred embodiment of this first aspect, the present invention relates to a plant belonging to the Solanaceae family wherein the present plant comprises a genetic trait providing Phytophthora resistance, wherein the present resistance trait is obtainable by down regulating the activity of combination of two genes or reducing the activity of proteins encoded by the present genes in a Phytophthora susceptible plant, wherein the present two genes encode the combinations of SEQ ID Nos. 1 and 2 or SEQ ID Nos. 3 and 4 or SEQ ID Nos. 5 and 6 or proteins having at least 80%, 85%, or 90% sequence identity therewith such as 91%, 92%, 93% and 94% sequence identity, preferably at least 95% sequence identity, such as 96%, 97%, 98% and 99% sequence identity.
According to a further preferred embodiment, the present plant belonging to the Solanaceae family is selected from the group consisting of potato, petunia and tomato.
Given the advantageous properties of the present genes for providing Phytophthora resistance plants, the present invention relates, according to a second aspect, to the use of a combination of two genes, wherein said combination of two genes encode protein combinations selected from the group consisting of SEQ ID Nos. 1 and 2; SEQ ID Nos. 3 and 4; SEQ ID Nos. 5 and 6; SEQ ID Nos. 16 and 17; SEQ ID No. 18 and a protein having at least 70% sequence identity with SEQ ID No. 18, preferably at least 85% sequence identity, most preferably at least 95% sequence identity; and SEQ ID No. 19 and a protein having at least 70% sequence identity with SEQ ID No. 19, preferably at least 85% sequence identity, most preferably at least 95% sequence identity for providing Phytophthora resistance in plants belonging to the Solanaceae family.
According to the present invention, the present resistance is preferably a resistance against a plant pathogen selected from the group consisting of Phytophthora spp., Phytophthora capsici, Phytophthora infestans, and Phytophthora nicotinae.
According to a further preferred embodiment, the present use for providing Phytophthora resistance in plants belonging to the Solanaceae family comprises reduced expression, or reduced transcription, of the present genes or a reduced activity of proteins encoded by the present genes as compared to the plant belonging to Solanaceae family being susceptible to Phytophthora.
According to a further preferred embodiment of this second aspect, the present plants belonging to the Solanaceae family are selected from the group consisting of sweet pepper (Capsicum annuum), Capsicum spp., potato (Solanum tuberosum), petunia, tomato (Solanum lycopersicum), Nicotinia benthamiana, and tabacco (Nicotinia tabacum).
Given the Phytophthora resistance providing properties of the present proteins and genes, the present invention relates according a third aspect to proteins and genes suitable for providing Phytophthora resistance to plants. Specifically, the present invention relates according to this third aspect to proteins selected from the group consisting of SEQ ID No. 1, 2, 3, 4, 5, 6, 16, 17, 18 and 19 and proteins having at least 90% sequence identity therewith, preferably at least 95%, most preferably at least 99%.
The invention will be further illustrated in the examples below, referring to figures, wherein:
FIG. 1 shows a detached leaf assay of control potato plants after infection with Phytophthora infestans, wherein all leaves are infected by Phytophthora infestans.
FIG. 2 shows a detached leaf assay of SEQ ID NOS. 7 & 8 silenced potato plants after infection with Phytophthora infestans, wherein each leaf is from an independent plant. FIG. 2a shows leaves from plants silenced with a middle construct, silencing both SEQ ID NOS. 7&8. FIG. 2b shows leaves from chimeric silenced plants.
FIG. 3 shows the percentage of plants which are infected by Phytophthora infestans, wherein the first bar shows a control group (about 10% is partially)infected, the second bar shows plants of which only SEQ ID NO 7 is silenced (about 10% partially infected), the third bar shows plants of which both SEQ ID NO 7 and 8 is silenced in the middle part of the respective sequences (about 50% clean), the fourth bar shows plants of which both SEQ ID NO 7 and 8 is silenced at the 5′ end (about 40% clean).
FIG. 4 shows the percentages of living petunia plants after inoculation with Phytophthora nicotianae, wherein the first bar shows wild type control plant (0% living), the second bar shows SEQ ID NO 9 mutants (20% living plants), the third bar shows SEQ ID NO 10 mutants (20% living plants) and the fourth bar shows double mutants, i.e. both SEQ ID NO 9 and 10 (45% living plants).
FIG. 5 shows leaves of tomato plants from a Phytophthora infestans disease test.

EXAMPLES

Example 1 (Potato)

RNAi Constructs Targeting Potato SEQ ID NOS. 7 and 8
3 different RNAi constructs were made, harboring/targeting:
1. 5′ end of SEQ ID NO 7: equivalent to coding sequence −159-200 (−159 from start means in 5′ utr).
2. Chimera of 5′ end of SEQ ID NOS. 7 and 8: equivalent to coding sequence 4-199+1-204.
3. Middle part of SEQ ID NO. 7 (highly homologous to middle of SEQ ID NO 8): equivalent to coding sequence 334-743.
The fragments were amplified from genomic DNA and cloned into the pENTR-D-TOPO vector. For the chimeric construct, 2 fragments were coupled using primers with complementary overhangs, and subsequent extension and amplification to create the fused fragment. Fragments were transferred using a Gateway LR reaction to the RNAi vector pK7GWiWG2 (Karimi et al., 2002, Trends Plant Sci 7), creating an inverted repeat with hairpin structure. Because the pK7GWiWG2 vector requires Streptomycin for bacterial selection, and the Agrobacterium strain used for potato transformation (LBA4404) already carries a Streptomycin selection marker, the complete RNAi (hairpin) cassette was transferred to a different plant transformation vector, pGreen0029 (bacterial as well as plant selection marker=Kanamycin) (Hellens et al., 2000, Plant Mol Biol 42). The final constructs allow stable expression of a 35S-promoter driven hairpin RNA that forms a silencing-inducing dsRNA, after the hairpin-loop forming intron gets spliced out. At least six independent T1 transformants were maintained for each construct.
Phytophthora Infestans Assay Details
Detached leaves were taken from T1 (first generation transgenics) plants, and placed in a tray with 100% RH with petioles in wet cotton-wool or Oasis. Phytophthora infestans (P.inf) zoospores/sporangia were harvested from P.inf cultures (rye-sucrose-agar plates), and a 10 μl drop of spore suspension containing 10e3 sporangia (10e5/ml) was placed on each side of the midvein. Trays were incubated at 18 C. Leaf infection rates were scored on day 11, as 1. Completely infected/overgrown, 2. Partially infected (10-50% area), and 3. Clean (<10% area).
As shown in FIGS. 1 and 2, the double silenced (SEQ ID NO. 7 & 8) plants of FIG. 2a show that only 50% is infected, the double silenced (chimeric) plants of FIG. 2b show that only 60% is infected, whereas the control group of FIG. 1 shows that all plants were infected. As shown in FIG. 3, 40 to 50% of the both SEQ ID NO. 7 and SEQ ID NO. 8 silenced plants are clean, whereas the plants having only SEQ ID NO. 7 silenced only 10% of the plants score partially infected. Accordingly, silencing of both SEQ ID NO. 7 and 8 provides resistance to Phytophthora infestans.

Example 2 (Petunia)

Transposon insertion lines were identified from a collection/library (Vandenbussche et al., 2008, Plant Journal 54). 2 dTph1 transposon insertion alleles were found in SEQ ID NO 9 and 3 dTph1 transposon insertion alleles in SEQ ID NO 10. Several crosses were made to generate double mutants.
Phytophthora Nicotianae Assay Details
Plants were grown in standard potting soil, individually potted, at 23 C.
P.nicotianae spores were harvested from cultures (lima-bean-agar or V8-agar plates), and 2 ml of spore suspension containing 10e4 (assay Sept) spores was dripped onto the soil with each plant. Plant collapse was monitored regularly.
As shown in FIG. 4, double mutants, i.e. plants having mutations in both SEQ ID NO 9 and SEQ ID NO 10 have a percentage of living plants of 45%, whereas the percentage of living plants of single mutants (mutant in SEQ ID NO. 9 or SEQ ID NO. 10) is only 20%.

Example 3 (Tomato)

Tomato plants were transformed with two constructs, either for providing over expression of both SEQ ID NO. 11 and 12, or for providing silencing of both SEQ ID NO. 11 and 12. Tomato SEQ ID NO. 11 silencing constructs were generated using Gateway cloning of a 300 bp fragment identical to the middle part of the CDS of SEQ ID NO. 11.

Sequence:

TTGGGTGAACAAGGACAACATATGGCTATCAATTATTATCCTCCTTGTCC

ACAACCAGAACTTACTTATGGGCTTCCGGCCCATACTGATCCAAATTCAC

TTACAATTCTTCTTCAAGACTTGCAAGTTGCGGGTCTTCAAGTTCTTAAA

GATGGCAAATGGTTAGCTGTAAAACCTCAACCTGACGCCTTTGTCATTAA

TCTTGGGGATCAATTGCAGGCAGTAAGTAACGGTAAGTACAGAAGTGTAT

GGCATCGAGCTATTGTGAATTCAGATCAAGCTAGGATGTCAGTGGCTTCG

TTT

Using primers:

S. Lycopersicum AttB1-F

aaaaagcaggcttcttgggtgaacaaggacaaca

S. Lycopersicum AttB2-R

agaaagctgggtaaaacgaagccactgacatcc

The generated ENTRY vector was Gateway cloned into the pHellsgate12 binary vector. Following Agrobacterium transformation according standard procedure for tomato. The silencing constructs were able to silence both SEQ ID NO. 11 and 12, due to similarities in the sequences.
Offspring from transformed tomato plants were subjected to a disease test by inoculation of Phytophthora infestans isolate US11. 7 days after inoculation the plants were visually analysed by scoring leaves on a visual scale from 1 to 9, wherein 1 means susceptible and 9 means resistant. As a control for susceptible the plants TS33, TS19 and OT9 were used. As control for resistant the known resistant wild accession LA1269 is used. Per plant 8 leaves were measured. Table below provides the average score from the 8 leaves per plant.
In the table is shown that the SEQ ID NO. 11 and 12 overexpressing plants are susceptible for isolate US11. The silenced plant provides significant higher scores than the susceptible control OT9. For example plant 556-01-08 has an average score of 8.5. A sample of this plant is shown in FIG. 5 in box G10, and is not infected similar to resistant control plant LA1296 as shown in box D8. Accordingly, silencing of both SEQ ID NO. 11 and 12 provides resistance to Phytophthora infestans.

Example 4 (N. Benthamiana)

To investigate if DMR6 mediated resistance in N. benthamiana against Phytophthora infestans the DMR6 ortholog was cloned in an VIGS expression vector. N. benthamiana plants were silenced for DMR6 and subsequent dropinoculated with a spore solution of P. infestans. Up to 7 dpi, plants were scored for disease development. This experiment was performed three times with similar results. DMR6 silencing clearly results in less colonization by the pathogen compared to the empty vector control or wildtype non silenced plants.

Sequence of silencing construct DMR6:

acaactcgggttcagattgcaggaagccatagcagagagcctaggctta

gagaaagagtgtataaaggatgtattgggcgaacaaggtcaacacatgg

ctatcaatttctatcctccttgtccacaaccagaactcacttatgggct

gccagcacatactgatccaaatgcccttacaattcttcttcaagactta

gaagtagctggtcttcaagttcttaaagatggcgaatggttggccgtca

agcctcaaccagatgcctttgtcattaatcttggtgatcaactgcaggc

agtgagtaatgggagatacaaaagcgtatggcatcgagctattgtaaat

tcagacaaagccaggttgtcagtggcttcgttcctttgtccgtgcgata

gcgcgaaaatcagtgct

VIGS was used to silence and test the function of N. benthamiana DMR6. As a visual control for the procedures, the PDS gene was also targeted. The PDS silenced plants were used to indicate at which time the silencing started. The silencing must have started ±2 days before the bleaching is observed due to the protein levels already established in the plant. But at the start of the silencing time frame, the silencing will not be at a high rate and waiting two days gives the mechanism time to establish a good silencing rate. Another advantage of using PDS silenced plants is that they give an indication which parts of the plants are silenced. The bleaching was observed in all parts above the inoculation. In the vacuum inoculated plants the new tissue showed strong photobleaching and parts of some of the cotelydons showed white areas as well. In the syringe inoculated plants the bleaching was the strongest in the youngest leaves, in full grown leaves the pigment is already synthesized and silencing will be harder to observe visually. Bleaching of the PDS silenced plants was observed 8-10 days past inoculation with the Agrobacterium strain containing the TRV vector. On day 8 the infection assays were started.
Two separate VIGS experiments were performed. Plants from both experiments were used for detached leaf infection assays. The P. capsici infection assay was done 8 days after Agro-infiltration, on leaves 2-6 above infiltrated leaf. Zoospore solution containing 5*10³spores/ml-1 was applied to detached leaves. The first VIGS showed low infection rates of the P. capsici after 7 days (see table 1.). Ideally, 100% of non-silenced leaves show infection.
TABLE 1

Results from the infection assay of the 1^stVIGS

expteriment. No DMR6 silenced leaves showed infection.

3 out of 7 Non-silenced leaves showed infection.

Infected Not infected Total % Infected

DMR6 silenced 0 11 11 0%

Not silenced 3 4 7 43%

This low sporulation is thought to be the cause of the low infection of the N. benthamiana leaves. However, none of the DMR6 silenced leaves showed infection symptoms, as opposed to 40% of the leaves which were not silenced showed infection. To increase infection rate, changes were made in the acquiring of spores and infection method causing more aggressive infection during the second infection assay. One DMR6 silenced uninfected leaf was found and other DMR6 silenced leaves showed delayed infection and slower spreading of infection.

Example 5

Introduction
A number of genes encoding negative regulators of immunity are activated during pathogen infection so that the inducible defense response is controlled and down-regulated to prevent over-activation. Examples are the Nudix hydrolase-encoding NUDT7 and transcription factor-encoding WRKY48 that are induced upon infection or MAMP treatment. Similarly, the DOWNY MILDEW RESISTANT 6 gene (DMR6) is activated during infection with compatible and incompatible isolates of the downy mildew Hyaloperonospora arabidopsidis. Inactivation of DMR6 by mutation leads to a low constitutive activation of defense-related genes and resistance to the downy mildew H. arabidopsidis.
DMR6 belongs to the superfamily of 2-oxoglutarate Fe(II) dependent oxygenases (2OG oxygenases, Pfam domain PF03171). This superfamily comprises 151 members in Arabidopsis. However, for most of these proteins, including DMR6, their metabolic activity is unknown. 2OG oxygenases are known to catalyze a plethora of reactions that involve the oxidation of a substrate using molecular O₂. They commonly use iron as co-factor and require 2-oxoglutarate as co-substrate for supplying two electrons. A general hallmark of these enzymes is the presence of the conserved HxD/Ex_nH motif located on a double-stranded beta sheet. Together with two four-stranded beta sheets (jelly roll fold) it capsulates the active center. 2OG oxygenases are implicated in secondary metabolism and biosynthesis of signaling molecules e.g. the biosynthesis of flavonoids, gibberellins, and alkaloids.
In this example, we functionally analyse the Arabidopsis DMR6 oxygenase and related DMR6-LIKE OXYGENASES (DLO) 1 and 2. Overexpression of DMR6, DLO1, and DLO2 increased disease susceptibility indicating the three proteins can act as a negative regulator of immunity. DLO1, but not DLO2, is highly co-regulated with DMR6, however they differ in their spatial expression during downy mildew-infection. The dmr6-3_dlo1 double mutant was found to be completely resistant to H. arabidopsidis and showed a strongly reduced growth associated with high levels of salicylic acid.

RESULTS

Overexpression of DMR6 Results in Enhanced Susceptibility to (Hemi-)Biotrophic Pathogens

Seedlings of the dmr6-1 mutant were previously described to be more resistant to H. arabidopsidis, but not to P. syringae. When tested on adult dmr6-1 plants, however, strong resistance to P. syringae DC3000 was observed. Also adult dmr6-1 plants were more resistant to the obligate biotroph H. arabidopsis compared to seedlings. In addition, strong resistance to the hemi-biotrophic oomycete Phytophthora capsici was evident in dmr6-1 plants when compared to the parental line Ler eds1-2; whereas all dmr6-1 mutant plants survived, P. capsici destroyed the vast majority of plants of the parental line and complemented dmr6-1 mutant. The resistance of the dmr6-1 mutant to different (hemi-)biotrophs suggests that in wild-type plants DMR6 negatively regulates immunity to these pathogens.
To study this, the DMR6 coding sequence was expressed from the constitutive 35S promoter in transgenic Col-0 lines. The DMR6-overexpression lines showed a clear increase in disease susceptibility to H. arabidopsidis and P. syringae. The level of H. arabidopsidis sporulation, which is a measure of downy mildew infection, was doubled in DMR6-overexpression lines compared to the control. Also the development of disease-associated chlorosis was more pronounced in DMR6-overexpression lines than in non-transgenic Col-0 plants.
The increased susceptibility of six-week old plants to P. syringae bacteria was also clearly visible. While the control line (Col-0) showed a relatively low level of chlorosis and lesions at 3 days post inoculation, the DMR6-overexpression line showed more severe disease symptoms, i.e. more chlorosis and more and larger lesions. The increased susceptibility of DMR6-overexpressors to P. syringae infection was confirmed by bacterial growth assays that showed increased bacterial titres at 1 and 3 days post inoculation compared to the Col-0 control. Furthermore, expression of the defense marker genes PR-1, PR-2, and PR-5 in uninfected leaf tissue was reduced by 50 to 80% in the DMR6-overexpression line compared to wild type Col-0 plants that already have a very low level of expression. The reduced immunity of the DMR6-overexpression line, together with the enhanced resistance of the drm6-1 mutant, strongly supports the role of DMR6 as a negative regulator of immunity.

DMR6 and DMR6-Like Oxygenases Represent Separate Branches of a Distinct Clade in Flowering Plants

The Arabidopsis genome contains more than 150 2OG oxygenase genes some of which are similar to DMR6. To analyse the evolutionary conservation of DMR6 and related oxygenases in flowering plants we phylogenetically analysed the family of 2OG oxygenases that contain the 2OG-Fe(II) oxygenase superfamily Pfam domain PF03171. From Arabidopsis thaliana and eighteen flowering plants, of which genome sequences and protein models were available in the Phytozome v7.0 database (www.Phytozome.net), a total of 2951 proteins containing the PF03171 domain were selected using the HMMER3 algorithm. To filter small protein fragments and remove very large proteins, we only included proteins that did not exceed a 20% length difference to DMR6. Furthermore, only proteins were retained that have a length difference of the oxidoreductase domain of less than 20% compared to DMR6. This resulted in a selection of 2038 proteins that fulfill all criteria, including 110 of 151 predicted A. thaliana 2OG oxygenases. Phylogenetic clustering resulted in a tree in which many distinct clades representing different enzyme activities are shown. Well-characterized oxygenases include flavonone-3-hydroxylase (F3H), 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase, and anthocyanidin synthase (ANS) which are present in distinct clades different from the DMR6 clade. Two separate branches can be distinguished in the DMR6 clade that each contain 2OG oxygenases from dicots and monocots indicating that these subclades were already present in the ancestor of all flowering plants or earlier (82% bootstrap confidence). Gene duplications in the DMR6 clade are frequent in monocots in the upper part of the tree and in soybean and grapevine in both branches of the DMR6 clade. In the lower subclade, two A. thaliana DMR6 homologues cluster together with two proteins from Arabidopsis lyrata suggesting they are the result of a relatively recent gene duplication in the common ancestor of these two species.
These A. thaliana proteins are now designated DMR6-LIKE OXYGENASE or DLO (with gene At4g10500 encoding DLO1 and At4g10490 encoding DLO2). Also the DLO subclade shows a clear separation of the monocot and dicot proteins suggesting that the ancestor of all flowering plants already possessed a DLO besides DMR6. Grouping closely to DMR6, the DLOs form an interesting group that was subsequently analysed in more detail, focusing on the A. thaliana DLO1 and DLO2 genes.

Overexpression of DLO1 and DLO2 Complements the Dmr6 Mutant

The DLOs could have the same biological activity as DMR6 and were, therefore, tested for complementation of the dmr6-1 mutant. To this end, DLO1 and DLO2 were expressed under the constitutive 35S promoter and transformed into the dmr6-1 mutant background. Four independent T3 lines, transformed with 35S:DLO1 or 35S:DLO2, were analysed for their expression level and 3 lines per construct were selected that showed clear transgene expression. To check for complementation, 2-week old plants were infected with H. arabidopsidis isolate Cala2 and at 5 days post inoculation (dpi) the number of spores per mg seedlings was scored as measure of susceptibility.
Intriguingly, while dmr6-1 showed clear resistance, the 35S::DLO1 and 35S::DLO2 plants were highly susceptible, similar to or higher than Ler eds1-2 that is the parental line of the dmr6-1 mutant. As both DLO1 and DLO2 can complement the dmr6-1 mutant phenotype we conclude that the DLOs have a function similar to that of DMR6.
As overexpression of DMR6 in the Col-0 background results in enhanced susceptibility to downy mildew and other pathogens, we next investigated if overexpressing DLO1 and DLO2 would also make Col-0 more susceptible. Transformants expressing the 35S:DLO1 and 35S:DLO2 transgenes were selected and as controls Col-0 overexpressing DMR6 and the highly susceptible Col eds1-2 mutant were included. Disease assays with H. arabidopsidis showed that overexpression of DLO1 and DLO2 enhanced susceptibility compared to the Col-0 parental line as shown by the higher level of sporulation. The observed enhanced susceptibility was comparable to the DMR6 overexpression plants and the Col eds1-2 mutant. This confirms that the DLO1 and DLO2 protein have an activity similar or identical to DMR6 resulting in the same phenotypic effects.

Expression of DLO1, but not DLO2, is Immunity-Related

The DLO1 and DLO2 complementation and overexpression lines were all generated using the 35S promoter. It is, however, likely that the expression of the wild-type DLOs is highly regulated similar to that of DMR6, which is strongly activated during plant defense. Therefore, we analysed publicly available gene expression data to determine if DLO1 and DLO2 show immunity-related expression similar to DMR6. For this analysis, data of 9 different Affymetrix microarray experiments all dealing with transcriptional profiling after pathogen attack, defense related hormone application and elicitor/effector treatment, were used.
The expression analysis was focused on 30 2OG oxygenases that belong to the large clade containing the DLOs and DMR6. Hierarchical clustering of the genes allowed grouping of the 2OG oxygenase genes according to their expression patterns, providing information about which genes are co-regulated during plant immune responses. Strikingly, DLO1 clusters with DMR6, whereas DLO2 does not show any co-regulation with DMR6 or DLO1. DMR6 and DLO1 are both activated after infection with the downy mildew H. arabidopsidis, the powdery mildew Erysiphe orontii, and the bacterium P. syringae and as well as SA treatment. DLO2 clusters well away from DMR6 and DLO1 and appears to be unresponsive in the different experiments. Further analysis of available microarray data using Genevestigator revealed that DLO2 is not expressed in response to any treatment or in any tissue, except for siliques, suggesting that DLO2 does not have a role in immunity of the vegetative plant tissues.
The responsiveness of the DLOs to H. arabidopsidis infection was experimentally verified by quantitative PCR (qPCR). DMR6 and DLO1 are highly activated in plants infected with a compatible or incompatible isolate of H. arabidopsidis. Also following treatment with the SA mimic BTH, both DMR6 and DLO1 are strongly activated. In contrast, DMR6 and DLO1 are unresponsive to methyl jasmonate (MeJA), which is known to activate jasmonic acid-induced genes. DLO2 expression is undetectable (cT values higher than 35) in the different experimental conditions confirming the Genevestigator data. The fact that both DMR6 and DLO1 are activated during the plant's immune response suggests that in leaves of wild-type plants DLO1 also acts as a negative regulator of defense. However, the question remains why the dmr6 mutants have such a clear resistance phenotype in the presence of an intact DLO1 gene that could take over DMR6 function?

DLO1 and DMR6 Show Different Spatial Expression in Infected Leaves

To analyze the tissue-specific expression of DLO1 during downy mildew infection, we generated transgenic lines containing a construct with the DLO1 promoter fused to the GUS reporter gene (pro_DLO1:GUS). Since we did not observe any expression of DLO2, no GUS fusion with the promoter of DLO2 was constructed. Following H. arabidopsidis infection, DMR6 spatial expression was specifically detected to the sites that are in direct contact with the pathogen as has been described previously. In contrast, DLO1 expression was not induced in cells that are in close contact with the pathogen but only in or around the main veins of infected cotyledons and leaves. Interestingly, DLO1 expression was observed only in areas of the leaf that are close to H. arabidopsidis infection sites, indicating that the activation of DLO1 depends on the presence of the pathogen. The absence of DLO1 activity in haustoria-containing cells could explain why DLO1 cannot fully complement for loss of DMR6 activity in the dmr6 mutants. Whereas these data show distinct activities of the DMR6 and DLO1 genes, the extent of redundancy of these genes is unclear and was therefore further studied genetically.

DLO1 Function is Partially Redundant with DMR6

Redundancy analysis in mutant lines is best performed in the same genetic background. We, therefore, obtained mutants in the Col-0 background for DMR6 (GABI-KAT line GK-249H03.01, designated mutant dmr6-3) and DLO1 (SALK line 059907, named dlo1). dmr6-3_dlo1 double mutants were generated and phenotypically analyzed together with the dmr6-3 and dlo1 single mutants, as well as with the parental Col-0 line. The level of susceptibility to H. arabidopsidis Waco9 was strongly reduced in the dmr6-3 mutant, but only slightly reduced in the dlo1 mutant. Combining the two mutations in the dmr6-3_dlo1 double mutant resulted in plants that showed complete resistance to H. arabidopsidis.
We next tested the level of defense gene expression in the mutants, as previous research on the dmr6-1 and dmr6-2 mutants showed increased levels of expression of PR-1 and other defense genes. Also the dmr6-3 mutant showed elevated expression of PR-1, PR-2 and PR-5, confirming previous results. The dlo1 mutant only showed no significant induction of expression of the three PR genes.
In contrast, the dmr6-3_dlo1 double mutant showed extremely high levels of defense gene expression. PR-1 transcripts were more than 30,000-fold higher in more the dmr6-3_dlo1 mutant than in Col-0, and a more than 100-fold higher than in the dmr6-3 single mutant. In the tested mutants there was a clear correlation between the level of resistance to downy mildew and increase in defense gene expression, suggesting that resistance is caused by activation of plant immune responses. Our data shows that the dlo1 mutation enhances the immunity of the dmr6-3 single mutant, indicating DLO1 and DMR6 act partially redundant.
This was further corroborated by the growth phenotype of the mutants. Plants grown for 5.5 weeks under short day conditions showed striking differences between the genotypes. Whereas the dlo1 mutant grows similar to Col-0, and the dmr6-3 mutant only shows a slight growth reduction, the dmr6-3_dlo1 double mutant displayed strong growth reduction resulting in dwarfed plants. The growth reduction and level of resistance to downy mildew are correlated in the tested mutants, suggesting these two phenotypes are functionally linked.
It is well known that strong activation of plant immunity can be accompanied by severe growth reduction, which in many cases can be linked to high SA levels. Indeed, levels of SA were more than 200 times higher in the dmr6-3_dlo1 double mutant than in the Col-0 control, and ˜20 times higher than in the dmr6-3 mutant. The single mutant dmr6-3 showed a modest ˜10 fold increase in SA compared to the Col-0 control, whereas the dlo1 mutant did not accumulate more SA than Col-0.
To test if the high SA level in dmr6-3_dlo1 is the cause of the dwarf phenotype and high level of resistance to downy mildew, the double mutant was crossed to the sid2 mutant, which is strongly compromised in SA biosynthesis as a result of loss of isochorismate synthase 1. The triple mutant dmr6-3_dlo1_sid2 showed almost complete recovery of the growth phenotype of the dmr6-3_dlo1 double mutant, although it remained slightly smaller than the sid2 mutant. Disease assays showed that also the high level of resistance of the dmr6-3_dlo1 double mutant and dmr6-3 single mutant was strongly reduced in the absence of SID2. Because of the low SA level, the sid2 mutant is more susceptible to H. arabidopsidis than the wild type Col-0. The level of susceptibility to H. arabidopsidis correlates well to the level of total SA in the mutants. Both dmr6 as well as the dmr6-3_dlo1 double mutant show no sporulation at 5 dpi and have the highest SA levels. The triple mutant dmr6-3_dlo1_sid2 still produces more SA than Col-0, which might explain it lower susceptibility to downy mildew.
It was concluded that both the resistance to H. arabidopsidis, as well as the growth reduction of the dmr6-3_dlo1 mutant is the result of increased SA levels. The extreme phenotypes of the double mutant demonstrate that the DLO1 and DMR6 genes act redundantly. However, the dmr6 single mutant is more resistant to downy mildew than the dlo1 mutant. Together with the observed different localization of expression of the DMR6 and DLO1 genes, the present data indicate that the DMR6 and DLO1 genes have distinct but partially redundant functions as negative regulators of plant immunity.

Claims

1. A plant belonging to the Solanaceae family wherein said plant comprises a genetic trait providing Phytophthora resistance and wherein said resistance trait is encoded by a combination of at least two genes having a reduced expression, or transcription, of said two genes or a reduced activity of proteins encoded by said two genes as compared to said plant belonging to Solanaceae family being susceptible to Phytophthora.

2. The plant according to claim 1, wherein said plant belonging to the Solanaceae family is selected from the group consisting of sweet pepper (Capsicum annuum), Capsicum spp., potato (Solanum tuberosum), petunia, tomato (Solanum lycopersicum), Nicotinia benthamiana, and tabacco (Nicotinia tabacum).

3. The plant according to claim 1, wherein said Phytophthora resistance is resistance to a plant pathogen selected from the group consisting of Phytophthora spp., Phytophthora capsici, Phytophthora infestans, and Phytophthora nicotinae.

4. The plant according to claim 1, wherein said plant is potato (Solanum tuberosum), said Phytophthora resistance is resistance to Phytophthora infestans and said combination of at least two genes are genes encoding proteins according to SEQ ID No. 1 and SEQ ID No. 2 or proteins having at least 90% sequence identity with SEQ ID No. 1 and/or SEQ ID No. 2, preferably at least 95% sequence identity, most preferably at least 99% sequence identity.

5. The plant according to claim 1, wherein said plant is petunia, said Phytophthora resistance is resistance to Phytophthora nicotianae and said combination of at least two genes are genes encoding proteins according to SEQ ID No. 3 and SEQ ID No. 4 or or proteins having at least 90% sequence identity with SEQ ID No. 3 and/or SEQ ID No. 4, preferably at least 95% sequence identity, most preferably at least 99% sequence identity.

6. The plant according to claim 1, wherein said plant is tomato (Solanum lycopersicum), said Phytophthora resistance is resistance to Phytophthora infestans and/or Phytophthora capsici and said combination of at least two genes are genes encoding proteins according to SEQ ID No. 5 and SEQ ID No. 6 or proteins having at least 90% sequence identity with SEQ ID No. 5 and/or SEQ ID No. 6, preferably at least 95% sequence identity, most preferably at least 99% sequence identity.

7. The plant according to claim 1, wherein said plant is sweet pepper (Capsicum annuum) or Capsicum spp., said Phytophthora resistance is resistance to Phytophthora capsici and said combination of at least two genes are genes encoding proteins according to SEQ ID No. 16 and SEQ ID No. 17 or proteins having at least 90% sequence identity with SEQ ID No. 16 and/or SEQ ID No. 17, preferably at least 95% sequence identity, most preferably at least 99% sequence identity.

8. The plant according to claim 1, wherein said plant is Nicotinia benthamiana, said Phytophthora resistance is resistance to Phytophthora capsici and/or Phytophthora infestans and/or Phytophtora nicotinanae and said combination of at least two genes are genes encoding proteins according to SEQ ID No. 18 and a protein having at least 70% sequence identity with SEQ ID No. 18, preferably at least 85% sequence identity, most preferably at least 95% sequence identity.

9. The plant according to claim 1, wherein said plant is tabacco (Nicotinia tabacum), said Phytophthora resistance is resistance to Phytophthora capsici and/or Phytophthora infestans and/or Phytophtora nicotinanae and said combination of at least two genes are genes encoding proteins according to SEQ ID No. 19 and a protein having at least 70% sequence identity with SEQ ID No. 19, preferably at least 85% sequence identity, most preferably at least 95% sequence identity.

10. A plant belonging to the Solanaceae family, wherein said plant comprises a genetic trait providing Phytophthora resistance said resistance trait is obtainable by down regulating the expression, or translation, of a combination of two genes or reducing the activity of proteins encoded by said combination of two genes in an Phytophthora susceptible plant wherein said combination of two genes encode for proteins selected from the group consisting of SEQ ID Nos. 1 and 2; SEQ ID Nos. 3 and 4; SEQ ID Nos. 5 and 6; SEQ ID Nos. 16 and 17; SEQ ID No. 18 and a protein having at least 70% sequence identity with SEQ ID No. 18, preferably at least 85% sequence identity, most preferably at least 95% sequence identity; and SEQ ID No. 19 and a protein having at least 70% sequence identity with SEQ ID No. 19, preferably at least 85% sequence identity, most preferably at least 95% sequence identity.

11. The plant according to claim 10, wherein said plant belonging to the Solanaceae family is selected from the group consisting of sweet pepper (Capsicum annuum), Capsicum spp., potato (Solanum tuberosum), petunia, tomato (Solanum lycopersicum), Nicotinia benthamiana, and tabacco (Nicotinia tabacum).

12. The plant according to claim 10, wherein said Phytophthora resistance is resistance to a plant pathogen selected from the group consisting of Phytophthora spp., Phytophthora capsici, Phytophthora infestans, and Phytophthora nicotinae.

13. Use of a combination of two genes, wherein said combination of two genes encodes protein combinations selected from the group consisting of SEQ ID Nos. 1 and 2; SEQ ID Nos. 3 and 4; SEQ ID Nos. 5 and 6; SEQ ID Nos. 16 and 17; SEQ ID No. 18 and a protein having at least 70% sequence identity with SEQ ID No. 18; and SEQ ID No. 19 and a protein having at least 70% sequence identity with SEQ ID No. 19, for providing Phytophthora resistance in plants belonging to the Solanaceae family.

14. The use according to claim 13, wherein said plant belonging to the Solanaceae family is selected from the group consisting of sweet pepper (Capsicum annuum), Capsicum spp., potato (Solanum tuberosum), petunia, tomato (Solanum lycopersicum), Nicotinia benthamiana, and tabacco (Nicotinia tabacum).

15. The plant according to claim 13, wherein said Phytophthora resistance is resistance to a plant pathogen selected from the group consisting of Phytophthora spp., Phytophthora capsici, Phytophthora infestans, and Phytophthora nicotinae.

16. A protein selected from the group consisting of SEQ ID No. 1, 2, 3, 4, 5, 6, 16, 17, 18 and 19 and proteins having at least 90% sequence identity therewith.