US20160114029A1 - Porcine pseudorabies virus, vaccine composition and preparation method and use thereof - Google Patents

Porcine pseudorabies virus, vaccine composition and preparation method and use thereof Download PDF

Info

Publication number
US20160114029A1
US20160114029A1 US14/980,673 US201514980673A US2016114029A1 US 20160114029 A1 US20160114029 A1 US 20160114029A1 US 201514980673 A US201514980673 A US 201514980673A US 2016114029 A1 US2016114029 A1 US 2016114029A1
Authority
US
United States
Prior art keywords
vaccine
strain
prv
vaccine composition
pseudorabies virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
US14/980,673
Other versions
US9650424B2 (en
Inventor
Xuke Zhang
Jinzhong Sun
Rui Wu
Feifei Tan
Chaoyong Bai
Kegong Tian
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pulaike Biological Engineering Co Ltd
Original Assignee
Pulaike Biological Engineering Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pulaike Biological Engineering Co Ltd filed Critical Pulaike Biological Engineering Co Ltd
Priority to US14/980,673 priority Critical patent/US9650424B2/en
Assigned to PULIKE BIOLOGICAL ENGINEERING, INC. reassignment PULIKE BIOLOGICAL ENGINEERING, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BAI, Chaoyong, SUN, Jinzhong, TAN, Feifei, TIAN, KEGONG, WU, Rui, ZHANG, Xuke
Publication of US20160114029A1 publication Critical patent/US20160114029A1/en
Application granted granted Critical
Publication of US9650424B2 publication Critical patent/US9650424B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/245Herpetoviridae, e.g. herpes simplex virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • A61P31/22Antivirals for DNA viruses for herpes viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C12N7/04Inactivation or attenuation; Producing viral sub-units
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5252Virus inactivated (killed)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552Veterinary vaccine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16711Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16721Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16711Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16722New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16711Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16734Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16711Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16761Methods of inactivation or attenuation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16711Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16771Demonstrated in vivo effect

Definitions

  • This invention relates to a vaccine composition, belonging to the field of animal virology.
  • Pseudorabies also called Aujeszky's disease
  • Aujeszky's disease is an acute infectious disease caused by Suid herpesvirus 1 (SuHV1) belonging to the Alphaherpesvirinae subfamily for many kinds of livestock such as swine, cattle and sheep, as well as poultry and wild animals, with the main symptoms of fever, intense itching (except swine) and encephalomyelitis.
  • Pseudorabies in swine is found nationwide in China causing severe damages, and is one of the major diseases limiting the large-scale production of pig farms. Infection can result in abortion, stillborn or mummified fetuses in pregnant sows, and neurological signs, paralysis and a high death rate in piglets.
  • Pseudorabies virus with strong pantropic properties, neurotropic properties and latent infectivity, may establish long-term latent infection in the peripheral nervous system, and then the latently infected host starts to get sick when the latent virus is activated into the infectious virus.
  • subunit vaccine which is a vaccine prepared by cloning the protective antigen genes of pathogen into prokaryote and eukaryote expression systems with methods of genetic engineering so as to highly express those genes. It has been found so far that either of glycoprotein B, C and D (gB, gC and gD) in the PRV glycoproteins can make the body generate neutralizing antibodies, which have the ability to neutralize PRV, no matter in vivo or in vitro, or no matter with the presence or absence of complements.
  • glycoprotein B, C and D gB, gC and gD
  • gB, gC and gD are the most preferred proteins for developing PRV subunit vaccine.
  • the glycoprotein, gD is an important neutralizing antigen as well as the main target for protective antibodies, and it can induce better protective response.
  • vaccine for preventing pseudorabies can be prepared by use of gD of porcine pseudorabies virus.
  • porcine PRV has only one serotype, thus usually the cross-protection immunity between strains of porcine PRV is considered to be very strong.
  • piglets may still suffer from typical porcine pseudorabies after their injection with commercial vaccines, with symptoms such as long-term high fever, depression, loss of appetite, respiratory and/or neurological signs.
  • the significant manifestations include that infection among swine at any ages, horizontal transmission among swine herds, short incubation period (1 ⁇ 2 days), morbidity rates between 10% ⁇ 100%, mortality rate in pigs between 10% ⁇ 100% (mortality rate in piglets can reach up to 100%), high fever in pigs after being infected (40° C. ⁇ 42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion, and the infection also can cause reproductive disorder symptoms such as declined semen quality of boar, as well as abortion of pregnant sow (the abortion rate can reach up to 35%), premature birth, stillbirth, weakened piglets (weakened piglets die by 14 days of age), etc.
  • vaccinated pigs cannot completely resist attacks by the wild virus, and still have symptoms like high fever, depression, partially or completely loss of appetite, with a infection rate of more than 30% and a mortality rate between 10% and 20%.
  • the present invention aims to provide a porcine pseudorabies virus strain for preparing vaccines, which have been proved by animal testing to provide a good immune function for porcine pseudorabies.
  • the present invention provides a nucleotide sequence substantially encoding the protein as shown in SEQ ID NO. 1 of the sequence listing.
  • the present invention provides a nucleotide sequence substantially encoding the protein as shown in SEQ ID NO.2 of the sequence listing.
  • the present invention provides a nucleotide sequence substantially encoding the protein as shown in SEQ ID NO. 3 of the sequence listing.
  • nucleotide sequence in the present invention refers to a deoxyribonucleic acid (DNA) sequence, which can be transcribed into a corresponding RNA sequence.
  • the main aim of present invention is to provide a porcine pseudorabies virus strain comprising gD glycoprotein encoded by the nucleotide sequence as shown in SEQ ID NO.4 of the sequence listing.
  • glycoprotein in the present invention refers to a structural protein required for infection of PRV, which is one of the major glycoproteins in the surface of envelope of mature virus particles, also called gp50 protein.
  • homology in the present invention refers to the level of similarity between two amino acid sequences or two nucleotide sequences.
  • the homology between amino acid sequences or nucleotide sequences can be calculated by any appropriate methods well known in the art, for example, the target amino acid (or nucleotide) sequence and the reference amino acid (or nucleotide) sequence is aligned, and gaps can be induced if necessary to optimize the number of the identical amino acids (or nucleotides) between two aligned sequences, and the percentage of the identical amino acids (or nucleotides) between two aligned sequences can be calculated accordingly.
  • Alignment of amino acid (or nucleotide) sequences and calculation of homology can be achieved by software well kwon in the art.
  • Examples of such software include, but is not limited to, BLAST (which can be accessed through the website of the National Center for Biotechnology Information, NCBI, http://blast.ncbi.nlm.nih.gov/Blast.cgi or can be found in Altschul S. F. et al, J. Mol. Biol, 215:403-410 (1990); Stephen F.
  • said PRV strain comprises the gB glycoprotein encoded by the nucleotide sequence shown in SEQ ID NO.5 of the sequence listing.
  • said PRV comprises the gB glycoprotein encoded by the amino acid sequence as shown in SEQ ID NO.2 of the sequence listing.
  • said PRV according to the invention comprises the gC glycoprotein encoded by the amino acid sequence as shown in SEQ ID NO.3 of the sequence listing.
  • said PRV strain is HN1201 strain (pseudorabies virus, strain HN1201), or culture thereof, of which the accession number is CCTCC NO. V 201311; the HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May, 20, 2013, of which the address is Wuhan University, Wuhan City, Hubei province.
  • CTCC China Center for Type Culture Collection
  • culture refers to cultures of different passages of the virus, known to those skilled in the art, which may only have minute variations from one passage to another.
  • said culture is a culture within 5-35 passages.
  • Another aim of the invention is to provide a vaccine composition comprising an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of the porcine pseudorabies virus strain.
  • the vaccine composition comprises an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of the said PRV HN1201 strain or culture thereof.
  • the vaccine composition according to the present invention comprises said PRV or antigen thereof as an active component.
  • the PRV in the vaccine composition comprises gD glycoprotein represented by the amino acid sequence of SEQ ID NO. 1 or the amino acid sequence which shares at least 98% homology to the sequence of SEQ ID NO. 1.
  • the PRV in said vaccine composition is the HN1201 strain or culture thereof.
  • the antigen used in the invention is the antigen ingredients in the components of virus, which induces the immune response, and comprises gD protein with the amino acid sequence of SEQ ID NO. 1.
  • the antigen may comprise gB protein with the amino acid sequence of SEQ ID NO. 2 or the one of which the fragment shares at least 95% homology to the sequence of SEQ ID NO. 2.
  • the antigen may comprise gC protein with the amino acid sequence of SEQ ID NO.3 or the one of which the fragment shares at least 95% homology to the sequence of SEQ ID NO. 3.
  • live vaccines refer to vaccines prepared by viruses which still can reproduce in the host or on the cells and in the meanwhile their virulence has been weakened.
  • attenuated refers to artificially reducing the virulence of pathogens via mutation of gene by preparing pathogens which are deprived of pathogenicity but maintain immunogenicity. Generally attenuation can be achieved by UV irradiation, chemical processing or continuous high-order subculturing in vitro. Artificial alteration of gene attenuates the virulence via, for example, the deletion of some specific nucleotides in the given sequence.
  • inactivated vaccine also called non-living vaccine, refers to suspension of inactivated virus used as an antigen for producing immunity
  • examples of inactivated vaccines include whole virus vaccines and split virus vaccines.
  • split virus vaccines By using known methods it is easy to produce inactivated vaccines. For instance, one can obtain inactivated whole virus vaccines by treatment with formaldehyde solution.
  • Split virus vaccines can be prepared with virus envelopes after treatment with ether.
  • subunit vaccine refers to a vaccine prepared via highly effectively expression of protective antigen gene of a pathogen by cloning it into a prokaryotic or eukaryotic expression system.
  • a subunit vaccine has less risk of adverse reactions than a whole virus vaccine.
  • the expressed gD protein or gC protein of PRV can be used for preparing subunit vaccines.
  • synthetic peptide vaccine refers to a small peptide only comprising the component of immunogenic determinants, i.e. a vaccine prepared by synthesizing a protective short peptide according to the amino acid sequence of natural proteins, and adding in an adjuvant after connecting them to a carrier.
  • said vaccine composition in the invention comprises an inactivated vaccine of the PRV HN1201 strain or culture thereof, of which the content is not less than 10 6.0 TCID 50 /ml.
  • said vaccine composition in the present invention may comprise 10 6.0 TCID 50 /ml PRV per pig.
  • the vaccine cannot effectively trigger the generation of antibodies when the amount of said PRV used is less than 10 6.0 TCID 50 .
  • the excessive amount may not be economical.
  • said vaccine composition comprises 25-100 m/dose of gD protein antigen of the PRV HN1201 strain or culture thereof.
  • said pseudorabies vaccine in the present invention can be used conjunctly with other inactivated pathogens or antigen to prepare combined vaccines or complex vacancies against various diseases including pseudorabies.
  • the term “combined vaccine” refers to a vaccine prepared with the virus mixture by mixing the pseudorabies virus in the present invention with at least one different virus.
  • the term “complex vaccine” refers to a vaccine prepared from viruses and bacterium.
  • the pseudorabies virus in the present invention can be mixed or combined with classical swine fever virus, porcine reproductive and respiratory syndrome virus, porcine circovirus and/or haemophilus parasuis and mycoplasma.
  • said vaccine composition further comprises medium, adjuvants and excipients.
  • Said vaccine composition according to the present invention also may comprise medium, adjuvants and/or excipients.
  • Physiological saline or distilled water can be used as medium.
  • adjuvants used in the vaccine composition include Freund's incomplete adjuvant or Freund's complete adjuvant, aluminum hydroxide gel, vegetable oil or mineral oil etc.
  • excipients include, but are not limited to, aluminum phosphate, aluminum hydroxide and potassium aluminum sulfate. In practice, all substances for preparing vaccines, known to those skilled in the art, can be adapted to the vaccine composition in the present invention.
  • One more aim of the present invention is to provide a method for preparing said vaccine composition comprising the steps: the PRV HN1201 strain is amplified and cultured, inactivated, and then added with adjuvants and mixed thoroughly.
  • the method comprises the steps: (1) inoculating the PRV vaccine strains into respective susceptible cells, and cultivating the inoculated susceptible cells; and then harvesting cell culture; and (2) treating the viruses obtained from step (1) with formaldehyde solution, BPL ( ⁇ -beta-Propiolactone) or BEI (binary ethylenimine).
  • formaldehyde solution BPL ( ⁇ -beta-Propiolactone) or BEI (binary ethylenimine).
  • the susceptible cells can be continuous cell lines or primary cell lines.
  • the susceptible cells adapted to PRV culture include but are not limited to continuous cell lines such as ST cell line (ATCC CRL-1746), PK-15 cell line(ATCC CCL-33), African green monkey kidney Marc-145 cell line (ATCC CRL-12219), Madin-Darby bovine kidney MDBK cell line (ATCC CCL-22), bovine turbinate BT cell line (ATCC CRL-1390), Vero cell line (ATCC CCL-81), BHK-21 cell line (ATCC CCL-10), pig kidney continuous cell line (such as IBRS-2, refer to e.g. DECASTRO, M.P.1964.
  • continuous cell lines such as ST cell line (ATCC CRL-1746), PK-15 cell line(ATCC CCL-33), African green monkey kidney Marc-145 cell line (ATCC CRL-12219), Madin-Darby bovine kidney MDBK cell line (ATCC CCL-22), bovine turbinate BT cell line (ATCC
  • the vaccine composition according to the present invention can be prepared into oral dosage forms or non-oral dosage forms.
  • Non-oral dosage forms are preferred which can be administrated via intradermal route, intramuscular route, intraperitoneal route, intravenous route, subcutaneous route, intranasal route or epidural route.
  • Another aim of the invention is to provide a method for preparing the vaccine composition, comprising the steps: (1) cloning said PRV recombinant gD gene; (2) expressing said PRV recombinant gD protein; and (3) mixing said PRV gD protein antigen with adjuvants based on certain ratio and emulsifying the resulting mixture.
  • a further aim of the invention is to provide a use of said vaccine composition for preparing medicine for treatment and prevention of diseases relating to PRV.
  • disease relating to PRV can further refer to diseases caused by infection of PRV. Examples includes but are not limited to, obvious neurological signs, lethargy, crying, vomiting diarrhea and fever in infected piglets, and abortion, mummified or stillborn fetuses or reproductive disorder in infected pregnant sows.
  • the term “diseases relating to PRV” can further refer to diseases with significant manifestations including but not limited to infection among swine at any ages, horizontal transmission among swine herds, short incubation period (1-2 days), morbidity rates between 10%-100%, mortality rate in pigs between 10%-100% (mortality rate in piglets can reach up to 100%), high fever of pigs after being infected (40° C. ⁇ 42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion, and reproductive disorder symptoms caused by infection such as declined semen quality of boar, as well as abortion of pregnant sow (the abortion rate can reach up to 35%), premature birth, stillbirth, weakened piglets (weakened piglets die by 14 days of age
  • prevention refers to all behaviors to inhibit the infection of pseudorabies virus or delay the onset of the disease via administration of the vaccine composition according to the present invention.
  • treatment refers to all behaviors to relieve or cure the symptoms caused by infection of PRV via administration of the vaccine composition according to the present invention.
  • FIG. 1 Result of homology analysis between amino acid sequences of gC in HN1201 strain and SA215 strain.
  • FIG. 2 Result of homology analysis between amino acid sequences of gD in HN1201 strain and SA215 strain.
  • SEQ ID NO. 1 is the amino acid sequence of gD in the PRV HN1201 strain.
  • SEQ ID NO. 2 is the amino acid sequence of gB in the PRV HN1201 strain.
  • SEQ ID NO. 3 is the amino acid sequence of gC in the PRV HN1201 strain.
  • SEQ ID NO. 4 is the nucleotide sequence of gD in the PRV HN1201 strain.
  • SEQ ID NO. 5 is the nucleotide sequence of gB in the PRV HN1201 strain.
  • SEQ ID NO.6 is the nucleotide sequence of gC in the PRV HN1201 strain.
  • the term “per pig” refers to the amount of vaccine each pig injected.
  • TCID 50 refers to 50% tissue culture infective dose, a way to represent viral infectivity.
  • MEM liquid medium is prepared with MEM dry powdered medium purchased from Life Technologies, Corp. according to the instruction.
  • Dulbecco's Modified Eagle's Medium (DMEM) in the present invention is prepared with reference to the preparation method from Appendix A of GB/T18641-2002 Diagnostic Techniques for Aujeszk's Disease.
  • PBS Phosphate Buffer Saline
  • 0.01 mM pH 7.4 PBS as used in the present invention is prepared as described in Molecular cloning: Laboratory manuals, 3 rd edition.
  • Porcine brain tissue was collected under aseptic conditions from samples isolated from samples from Henan province suspected of having pseudorabies infection, added in MEM liquid medium in a ratio of 1:10(V:V), and ground to prepare a tissue suspension. After 3 times of repeated freezing-thawing, the tissue suspension was centrifuged at 2000r/min for 15 minutes. The supernatant was then collected, filtered through a 0.2 ⁇ m pore filter, subcultured on PK-15 cells and incubated at 37° C. for lh, and then the medium was changed by adding MEM liquid medium supplemented with 2% fetal bovine serum, and incubated at 37° C. for 5 days.
  • PRV was detected by PRV PCR detection kit (Beijing Anheal Laboratories Co., Ltd), and the result was positive; PCR kit was employed to detect the exotic virus contamination (porcine reproductive and respiratory syndrome virus RT-PCR detection kit kit, porcine parvovirus PCR detection kit and classical swine fever virus RT-PCR detection kit, all purchased from Beijing Anheal Laboratories Co., Ltd) for the isolated virus and the PCR detection result was negative, indicating a pure viral specie.
  • PRV PCR detection kit Beijing Anheal Laboratories Co., Ltd
  • PCR kit was employed to detect the exotic virus contamination (porcine reproductive and respiratory syndrome virus RT-PCR detection kit kit, porcine parvovirus PCR detection kit and classical swine fever virus RT-PCR detection kit, all purchased from Beijing Anheal Laboratories Co., Ltd) for the isolated virus and the PCR detection result was negative, indicating a pure viral specie.
  • HN1201 strain Pseudorabies virus, strain HN1201
  • accession number is CCTCC NO. V 201311
  • preservation address is Wuhan University, Wuhan City, Hubei province.
  • Genomic DNA prepared from the pseudorabies virus isolated from PK-15 cells was used as template with primers shown in Table 1 for PCR amplification reactions.
  • the Primer Primer 5.0 was used for designing the primer sequence for amplifying gB, gC and gD gene, respectively.
  • the genomic DNA extracted was used as template to prepare the following PCR amplification system: 100 ⁇ g template DNA, 0.5 ⁇ L PrimerSTAR HS DNA Polymerase (2.5U/ ⁇ L), 25 ⁇ L 2 ⁇ PrimerSTAR GC Buffer, 1 ⁇ L of each upstream and downstream primer (10 pmol/ ⁇ L), 4 ⁇ L dNTP Mix (2.5 mM each), adjusted to a final volume of 50 ⁇ L with distilled water.
  • Two-step PCR reaction was carried out by an initial denaturation for 10 sec at 98° C. followed by annealing and extension at 68° C. (all the time is calculated by 1 kb/min) and there were 30 cycles in total.
  • the PCR reactions were finalized at 4° C.
  • the analysis of the amplification products was conducted by electrophoresis on 1% agarose gel containing ethidium bromide. The sequences of PCR products were determined. The sequence data was analyzed by Lasergene.
  • 8 piglets at 49 days of age which were negative for pseudorabies antibodies were randomly divided into 2 groups, each with 4 piglets, in addition two more piglets were used as control.
  • the experimental groups were inoculated with 2 ⁇ 10 7.0 TCID 50 /piglet PRV HN1201 strain or 2 ⁇ 10 8.0 TCID 50 /piglet PRV HN1201 strain by intranasal instillation, respectively, and the control group was inoculated with DMEM medium. After inoculation of virus, the body temperature of piglets was determined daily, and clinical signs and death status were observed. The results are shown in Table 3.
  • the culture of different passages of the isolated strain was inoculated, according to Table 4, onto PK-15 cell culture to form a seed lot which was then inoculated into a monolayer of PK cell culture at 1% (V/V) of the amount of the liquid virus medium, and placed in a rotary incubator at 37° C.
  • the cell medium containing viruses was harvested when the cytopathic effect of cells reached to 80%; the viruses were harvested after 2 times of freezing-thawing and the virus titer was assessed.
  • 10% (V/V) formaldehyde solution was added to different passages of virus solution respectively, with a final concentration of 0.2% (V/V). The virus solution was inactivated at 37° C.
  • PBS pH 7.4 phosphate-buffered saline
  • SEPPIC 206 adjuvant
  • 16 piglets at 21 days of age which were negative for PRV antibodies were randomly divided into 4 groups, each with 4 piglets, and injected with vaccines according to Table 5.
  • Two groups injected with inactivated vaccines were injected with 2ml/piglet of the inactivated vaccines against pseudorabies prepared in Example 4.
  • the live vaccine SA215 strain prepared by using the method in CN101186902 was applied according to the method for determining immunogenicity in the specification of the patent.
  • the control group was inoculated with 2 mL/piglet of DMEM medium.
  • the piglets were challenged with 2 ⁇ 10 8.0 TCID 50 /piglet of PRV HN1201 strain on day 28 after immunization, clinical signs and death status were observed as shown in Table 7. After challenge the body temperature of piglets was determined daily as shown in Table 8.
  • the PK-15 cells which were in excellent health were inoculated with the PRV HN1201 strain or culture thereof of different passages (the PRV strain was HN1201 strain (Pseudorabies virus, strain HN1201), of which the accession number was CCTCC NO. V 201311; the HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May, 20, 2013, of which the address was Wuhan University, Wuhan City, Hubei province), the culture of different passages was the culture within 5-35 passages.
  • the PRV genomic DNA was extracted by using MiniBEST Viral RNA/ DNA Extraction Kit Ver.3.0 (TAKARA) after harvesting viruses. PCR amplification was performed by using 1 ⁇ L genomic DNA as template and gD-specific primers:
  • gDSF 5′ ATGCTGCTCGCAGCGCTATTGGC 3′ and gDSR: 5′ CTACGGACCGGGCTGCGCTTTTAG3′.
  • the high fidelity polymerase Prime STAR® HS DNA Polymerase with GC Buffer (TAKARA) was used in the PCR reaction.
  • the amplification conditions were: 94° C. 3min; 94° C. 30 s, 68° C. 90 s, 30 cycles; 72° C. 5min.
  • the PCR product was named gD, of which the nucleotide sequence is shown in SEQ No.4, and the amino acid sequence can be derived as shown in SEQ No.1.
  • the PCR product, gD obtained from amplification with the high fidelity polymerase was cloned into the pFastBac/HBM-TOPO vector (Invitrogen, A11339).
  • the cloning system was as follows: 4 ⁇ L PCR product, gD, 1 ⁇ L salt solution, 1 ⁇ L TOPO vector; 60 ⁇ L in total. The mixture was mixed thoroughly and incubated at room temperature for 5 minutes, and then used to transform One Shot® MachlTM T1R competent cells. The transformation mix was spread onto plates containing ampicillin. A single colony was picked to identify insert directionality of gD gene, and the plasmid with the correct insert directionality was delivered to Invitrogen for sequencing, in order to verify the correct sequence.
  • the plasmid with the correct sequence was named pFastBac/HBM-TOPO-gD.
  • This step was carried out based on the method provided by the instruction of Bac-to-Bac HBM TOPO Secreted Expression System (Invitrogen). 8 ⁇ 10 5 sf9 cells were layered in each well of a 6-well plate, transfection was performed according to the instruction of Cellfectin® II transfection agent after adherence of the cells: 8 ⁇ L Cellfectin® II and 1 ⁇ g Bacmid-gD DNA were diluted respectively with 100 ⁇ L SF-900 II medium and mixed by vortex. The diluted DNA was combined with the diluted Cellfectin® II (total volume ⁇ 210 ⁇ L), mixed thoroughly and incubated for 15-30 minutes at room temperature. The transfection mixture was then added dropwise onto the cells.
  • the supernatant of cell culture marked as PO recombinant baculovirus vBac-gD, was collected 72 h after transfection or until the cytopathic effect was visible.
  • the PO recombinant baculovirus vBac-gD infected sf9 cells, and after three rounds of amplification the resulting P3 recombinant baculovirus vBac-gD was used for expressing the recombinant protein.
  • the P3 recombinant baculovirus vBac-gD was inoculated in High-five cells (Invitrogen, B85502). Suspension culture of High-five cells was performed in a 500 mL Erlenmeyer flask and the cells were inoculated with the virus with an MOI of 1 when the cell density reached to 7.0 ⁇ 10 5 cell/mL. The supernatant of cell culture was collected 72 h after infection. A Tangential Flow Filtration System (Millipore) was employed to concentrate the volume into 1/10 of the original one. 1% (V%) of Triton X-100 (Sigma) was used to inactivate the baculovirus, and the content of protein determined by SDS-PAGE optical density method was 200 ⁇ g/mL.
  • the piglets were challenged with 2 ⁇ 10 8.0 TCID 50 /piglet of PRV HN1201 strain on day 28 after immunization, and clinical signs and death status were observed as shown in Table 11. After challenge the body temperature of piglets was determined daily as shown in Table 12.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Provided in the embodiments of the present invention is a vaccine composition including an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic vaccine, or genetically engineered vaccine of the porcine pseudorabies virus strain. The vaccine composition can effectively induce antibody generation, and prevent infections of virulent strains of the porcine pseudorabies virus, and provides effective protection for pigs.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a continuation of U.S. patent application Ser. No. 14/779,132, filed Sep. 22, 2015 which claims priority to International Application No. PCT/CN2014/076691, filed Apr. 30, 2014, which claims priority to Chinese Application No. 201310216881.6, filed May 31, 2013 and Chinese Application No. 201310428605.6, filed Sep. 18, 2013, the entire contents of which are hereby incorporated by reference.
  • FIELD OF THE INVENTION
  • This invention relates to a vaccine composition, belonging to the field of animal virology.
  • BACKGROUND
  • Pseudorabies, also called Aujeszky's disease, is an acute infectious disease caused by Suid herpesvirus 1 (SuHV1) belonging to the Alphaherpesvirinae subfamily for many kinds of livestock such as swine, cattle and sheep, as well as poultry and wild animals, with the main symptoms of fever, intense itching (except swine) and encephalomyelitis. Pseudorabies in swine is found nationwide in China causing severe damages, and is one of the major diseases limiting the large-scale production of pig farms. Infection can result in abortion, stillborn or mummified fetuses in pregnant sows, and neurological signs, paralysis and a high death rate in piglets. Pseudorabies virus (PRV) with strong pantropic properties, neurotropic properties and latent infectivity, may establish long-term latent infection in the peripheral nervous system, and then the latently infected host starts to get sick when the latent virus is activated into the infectious virus.
  • It has been indicated by many researches that a corresponding protection can be provided for the vaccinated animals by a subunit vaccine, which is a vaccine prepared by cloning the protective antigen genes of pathogen into prokaryote and eukaryote expression systems with methods of genetic engineering so as to highly express those genes. It has been found so far that either of glycoprotein B, C and D (gB, gC and gD) in the PRV glycoproteins can make the body generate neutralizing antibodies, which have the ability to neutralize PRV, no matter in vivo or in vitro, or no matter with the presence or absence of complements. The article, Progress in Subunit Vaccine against Pseudorabies Virus Development (Chenghuai Yang, Gaoming Lou, Nanhui Chen, Jiangxi Journal of Animal Husbandry & Veterinary Medicine 2004 Issue 3) has disclosed that either of gB, gC and gD among 11 PRV glycoproteins which have been found so far, can induce the body to generate neutralizing antibodies. In the absence of complements, monoclonal antibodies directed against gB, gC and gD can neutralize PRV. The swine and mice injected with monoclonal antibodies directed against gB, gC and gD can resist attacks by virulent PRV strains. Therefore gB, gC and gD are the most preferred proteins for developing PRV subunit vaccine. The glycoprotein, gD, is an important neutralizing antigen as well as the main target for protective antibodies, and it can induce better protective response. As disclosed by U.S. Pat. No. 6,858,385 and U.S. Pat. No. 6,521,231, vaccine for preventing pseudorabies can be prepared by use of gD of porcine pseudorabies virus.
  • The porcine PRV has only one serotype, thus usually the cross-protection immunity between strains of porcine PRV is considered to be very strong. However, piglets may still suffer from typical porcine pseudorabies after their injection with commercial vaccines, with symptoms such as long-term high fever, depression, loss of appetite, respiratory and/or neurological signs. The significant manifestations include that infection among swine at any ages, horizontal transmission among swine herds, short incubation period (1˜2 days), morbidity rates between 10%˜100%, mortality rate in pigs between 10%˜100% (mortality rate in piglets can reach up to 100%), high fever in pigs after being infected (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion, and the infection also can cause reproductive disorder symptoms such as declined semen quality of boar, as well as abortion of pregnant sow (the abortion rate can reach up to 35%), premature birth, stillbirth, weakened piglets (weakened piglets die by 14 days of age), etc. By means of prior art, vaccinated pigs cannot completely resist attacks by the wild virus, and still have symptoms like high fever, depression, partially or completely loss of appetite, with a infection rate of more than 30% and a mortality rate between 10% and 20%. There are no vaccines in the prior art capable of solving the pseudorabies caused by variant strains of porcine pseudorabies virus.
  • SUMMARY OF INVENTION
  • In order to solve the deficiency of the prior art, the present invention aims to provide a porcine pseudorabies virus strain for preparing vaccines, which have been proved by animal testing to provide a good immune function for porcine pseudorabies.
  • The present invention provides a nucleotide sequence substantially encoding the protein as shown in SEQ ID NO. 1 of the sequence listing.
  • The present invention provides a nucleotide sequence substantially encoding the protein as shown in SEQ ID NO.2 of the sequence listing.
  • The present invention provides a nucleotide sequence substantially encoding the protein as shown in SEQ ID NO. 3 of the sequence listing.
  • The “nucleotide sequence” in the present invention refers to a deoxyribonucleic acid (DNA) sequence, which can be transcribed into a corresponding RNA sequence.
  • To solve the deficiency of the prior art, the main aim of present invention is to provide a porcine pseudorabies virus strain comprising gD glycoprotein encoded by the nucleotide sequence as shown in SEQ ID NO.4 of the sequence listing.
  • The term “gD glycoprotein” in the present invention refers to a structural protein required for infection of PRV, which is one of the major glycoproteins in the surface of envelope of mature virus particles, also called gp50 protein.
  • The term “homology” in the present invention refers to the level of similarity between two amino acid sequences or two nucleotide sequences. The homology between amino acid sequences or nucleotide sequences can be calculated by any appropriate methods well known in the art, for example, the target amino acid (or nucleotide) sequence and the reference amino acid (or nucleotide) sequence is aligned, and gaps can be induced if necessary to optimize the number of the identical amino acids (or nucleotides) between two aligned sequences, and the percentage of the identical amino acids (or nucleotides) between two aligned sequences can be calculated accordingly. Alignment of amino acid (or nucleotide) sequences and calculation of homology can be achieved by software well kwon in the art. Examples of such software include, but is not limited to, BLAST (which can be accessed through the website of the National Center for Biotechnology Information, NCBI, http://blast.ncbi.nlm.nih.gov/Blast.cgi or can be found in Altschul S. F. et al, J. Mol. Biol, 215:403-410 (1990); Stephen F. et al, Nucleic Acids Res., 25:3389-3402(1997)), ClustalW2 (which can be accessed through the website of the European Bioinformatics Institute, EBI, http://www.eji.ac.uk/Toolsa/clustalw2/, or can be found in Higgins D. G et al, Methods in Enzymology, 266:383-402(1996); Larkin M. A. et al, Bioinformatics (Oxford, England), 23(21):2947-8(2007)), and TCoffee (which can be accessed through the website of the Swiss Institute of Bioinformatics, SIB, http://tcoffee.vital-it.ch/cgi-bin/Tcoffee/tcoffee_cgi/index.cgi, or can be found in, Poirot O. et al, Nucleic Acids Res., 31(13):3503-6(2003); Notredame C. et al, J. Mol. Boil, 302(1):205-17(2000)) etc. It is all within the knowledge scope of a person skilled in the art that when using the software to do sequence alignment, he can use the default parameters provided by the software or adjust the parameters provided by the software according to the actual condition.
  • Preferably, said PRV strain comprises the gB glycoprotein encoded by the nucleotide sequence shown in SEQ ID NO.5 of the sequence listing.
  • Preferably, said PRV comprises the gB glycoprotein encoded by the amino acid sequence as shown in SEQ ID NO.2 of the sequence listing.
  • Preferably, said PRV according to the invention comprises the gC glycoprotein encoded by the amino acid sequence as shown in SEQ ID NO.3 of the sequence listing.
  • Preferably, said PRV strain is HN1201 strain (pseudorabies virus, strain HN1201), or culture thereof, of which the accession number is CCTCC NO. V 201311; the HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May, 20, 2013, of which the address is Wuhan University, Wuhan City, Hubei Province.
  • The term “culture” refers to cultures of different passages of the virus, known to those skilled in the art, which may only have minute variations from one passage to another. Preferably said culture is a culture within 5-35 passages.
  • Another aim of the invention is to provide a vaccine composition comprising an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of the porcine pseudorabies virus strain.
  • Preferably the vaccine composition comprises an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of the said PRV HN1201 strain or culture thereof.
  • Preferably the vaccine composition according to the present invention comprises said PRV or antigen thereof as an active component. The PRV in the vaccine composition comprises gD glycoprotein represented by the amino acid sequence of SEQ ID NO. 1 or the amino acid sequence which shares at least 98% homology to the sequence of SEQ ID NO. 1.
  • Preferably the PRV in said vaccine composition is the HN1201 strain or culture thereof.
  • The antigen used in the invention is the antigen ingredients in the components of virus, which induces the immune response, and comprises gD protein with the amino acid sequence of SEQ ID NO. 1.
  • Optionally, the antigen may comprise gB protein with the amino acid sequence of SEQ ID NO. 2 or the one of which the fragment shares at least 95% homology to the sequence of SEQ ID NO. 2.
  • Optionally, the antigen may comprise gC protein with the amino acid sequence of SEQ ID NO.3 or the one of which the fragment shares at least 95% homology to the sequence of SEQ ID NO. 3.
  • As used herein, the term “live vaccines” refer to vaccines prepared by viruses which still can reproduce in the host or on the cells and in the meanwhile their virulence has been weakened. As used herein, the term “attenuated” refers to artificially reducing the virulence of pathogens via mutation of gene by preparing pathogens which are deprived of pathogenicity but maintain immunogenicity. Generally attenuation can be achieved by UV irradiation, chemical processing or continuous high-order subculturing in vitro. Artificial alteration of gene attenuates the virulence via, for example, the deletion of some specific nucleotides in the given sequence.
  • As used herein, the term “inactivated vaccine”, also called non-living vaccine, refers to suspension of inactivated virus used as an antigen for producing immunity Examples of inactivated vaccines include whole virus vaccines and split virus vaccines. By using known methods it is easy to produce inactivated vaccines. For instance, one can obtain inactivated whole virus vaccines by treatment with formaldehyde solution. Split virus vaccines can be prepared with virus envelopes after treatment with ether.
  • The term “subunit vaccine” refers to a vaccine prepared via highly effectively expression of protective antigen gene of a pathogen by cloning it into a prokaryotic or eukaryotic expression system. A subunit vaccine has less risk of adverse reactions than a whole virus vaccine. For example, the expressed gD protein or gC protein of PRV can be used for preparing subunit vaccines.
  • The term “synthetic peptide vaccine” refers to a small peptide only comprising the component of immunogenic determinants, i.e. a vaccine prepared by synthesizing a protective short peptide according to the amino acid sequence of natural proteins, and adding in an adjuvant after connecting them to a carrier.
  • Preferably, said vaccine composition in the invention comprises an inactivated vaccine of the PRV HN1201 strain or culture thereof, of which the content is not less than 106.0TCID50/ml.
  • Preferably, said vaccine composition in the present invention may comprise 106.0TCID50/ml PRV per pig. The vaccine cannot effectively trigger the generation of antibodies when the amount of said PRV used is less than 106.0TCID50. On the other hand the excessive amount may not be economical.
  • Preferably, said vaccine composition comprises 25-100 m/dose of gD protein antigen of the PRV HN1201 strain or culture thereof.
  • In addition, said pseudorabies vaccine in the present invention can be used conjunctly with other inactivated pathogens or antigen to prepare combined vaccines or complex vacancies against various diseases including pseudorabies. As used herein, the term “combined vaccine” refers to a vaccine prepared with the virus mixture by mixing the pseudorabies virus in the present invention with at least one different virus. The term “complex vaccine” refers to a vaccine prepared from viruses and bacterium. For example, the pseudorabies virus in the present invention can be mixed or combined with classical swine fever virus, porcine reproductive and respiratory syndrome virus, porcine circovirus and/or haemophilus parasuis and mycoplasma.
  • Preferably, said vaccine composition further comprises medium, adjuvants and excipients.
  • Said vaccine composition according to the present invention also may comprise medium, adjuvants and/or excipients. Physiological saline or distilled water can be used as medium. Examples of adjuvants used in the vaccine composition include Freund's incomplete adjuvant or Freund's complete adjuvant, aluminum hydroxide gel, vegetable oil or mineral oil etc. Examples of excipients include, but are not limited to, aluminum phosphate, aluminum hydroxide and potassium aluminum sulfate. In practice, all substances for preparing vaccines, known to those skilled in the art, can be adapted to the vaccine composition in the present invention.
  • One more aim of the present invention is to provide a method for preparing said vaccine composition comprising the steps: the PRV HN1201 strain is amplified and cultured, inactivated, and then added with adjuvants and mixed thoroughly.
  • Specifically, the method comprises the steps: (1) inoculating the PRV vaccine strains into respective susceptible cells, and cultivating the inoculated susceptible cells; and then harvesting cell culture; and (2) treating the viruses obtained from step (1) with formaldehyde solution, BPL (β-beta-Propiolactone) or BEI (binary ethylenimine).
  • The susceptible cells can be continuous cell lines or primary cell lines. The susceptible cells adapted to PRV culture include but are not limited to continuous cell lines such as ST cell line (ATCC CRL-1746), PK-15 cell line(ATCC CCL-33), African green monkey kidney Marc-145 cell line (ATCC CRL-12219), Madin-Darby bovine kidney MDBK cell line (ATCC CCL-22), bovine turbinate BT cell line (ATCC CRL-1390), Vero cell line (ATCC CCL-81), BHK-21 cell line (ATCC CCL-10), pig kidney continuous cell line (such as IBRS-2, refer to e.g. DECASTRO, M.P.1964. Behavior of foot and mouth disease virus in cell culture: susceptibility of the IB-RS-2 swine cell line. Arquivos Instituto Biologica 31:63-78), rabbit kidney continuous cell line (RK, e.g. ATCC CCL-106) etc., and primary cell lines such as chicken embryo fibroblasts and porcine kidney cells etc. The primary cells can be isolated and prepared from tissues of animals via methods well known in the art.
  • The vaccine composition according to the present invention can be prepared into oral dosage forms or non-oral dosage forms. Non-oral dosage forms are preferred which can be administrated via intradermal route, intramuscular route, intraperitoneal route, intravenous route, subcutaneous route, intranasal route or epidural route.
  • Another aim of the invention is to provide a method for preparing the vaccine composition, comprising the steps: (1) cloning said PRV recombinant gD gene; (2) expressing said PRV recombinant gD protein; and (3) mixing said PRV gD protein antigen with adjuvants based on certain ratio and emulsifying the resulting mixture.
  • A further aim of the invention is to provide a use of said vaccine composition for preparing medicine for treatment and prevention of diseases relating to PRV.
  • As used herein, the term “diseases relating to PRV” can further refer to diseases caused by infection of PRV. Examples includes but are not limited to, obvious neurological signs, lethargy, crying, vomiting diarrhea and fever in infected piglets, and abortion, mummified or stillborn fetuses or reproductive disorder in infected pregnant sows.
  • As used herein, the term “diseases relating to PRV” can further refer to diseases with significant manifestations including but not limited to infection among swine at any ages, horizontal transmission among swine herds, short incubation period (1-2 days), morbidity rates between 10%-100%, mortality rate in pigs between 10%-100% (mortality rate in piglets can reach up to 100%), high fever of pigs after being infected (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion, and reproductive disorder symptoms caused by infection such as declined semen quality of boar, as well as abortion of pregnant sow (the abortion rate can reach up to 35%), premature birth, stillbirth, weakened piglets (weakened piglets die by 14 days of age), etc. The differences between above described symptoms and symptoms caused by infection of regular pseudorabies virus in the prior art are: in adult pigs (whose weight is above 50 kg), high fever of infected pigs (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion; sudden incidence of pseudorabies in newborn piglets and piglets below the age of 4 weeks , further resulting in massive death with a mortality of more than 90%; main manifestations in infected piglets including increased body temperature over 41° C., completely loss of appetite, obvious neurological signs and diarrhea; and in piglets just before or after being weaned, mainly respiratory symptoms, such as dyspnea, coughing and runny noses, etc.
  • As used herein, the term “prevention” refers to all behaviors to inhibit the infection of pseudorabies virus or delay the onset of the disease via administration of the vaccine composition according to the present invention. The term “treatment” refers to all behaviors to relieve or cure the symptoms caused by infection of PRV via administration of the vaccine composition according to the present invention.
  • BRIEF DESCRIPTION OR THE DRAWINGS
  • FIG. 1. Result of homology analysis between amino acid sequences of gC in HN1201 strain and SA215 strain.
  • FIG. 2. Result of homology analysis between amino acid sequences of gD in HN1201 strain and SA215 strain.
  • SEQUENCE LISTING
  • SEQ ID NO. 1 is the amino acid sequence of gD in the PRV HN1201 strain.
  • SEQ ID NO. 2 is the amino acid sequence of gB in the PRV HN1201 strain.
  • SEQ ID NO. 3 is the amino acid sequence of gC in the PRV HN1201 strain.
  • SEQ ID NO. 4 is the nucleotide sequence of gD in the PRV HN1201 strain.
  • SEQ ID NO. 5 is the nucleotide sequence of gB in the PRV HN1201 strain.
  • SEQ ID NO.6 is the nucleotide sequence of gC in the PRV HN1201 strain.
  • DETAILED DESCRIPTION
  • The description of the present invention is further provided as follows with reference to the specific embodiments, and features and advantages of the present invention will become more apparent from the following description. However, these embodiments are only exemplary, but not forming any limitation to the scope of the present invention. It should be understood by a person skilled in the art that modifications or alternatives to details and forms of the technical solution of the present invention without deviation from the spirit and scope of the present invention will be allowed, while those modification and alternatives should all fall within the scope of the present invention.
  • In the invention, the term “per pig” refers to the amount of vaccine each pig injected.
  • In the invention, the term “TCID50” refers to 50% tissue culture infective dose, a way to represent viral infectivity.
  • Minimum Essential Medium (MEM) liquid medium is prepared with MEM dry powdered medium purchased from Life Technologies, Corp. according to the instruction.
  • Dulbecco's Modified Eagle's Medium (DMEM) in the present invention is prepared with reference to the preparation method from Appendix A of GB/T18641-2002 Diagnostic Techniques for Aujeszk's Disease.
  • In the present invention, the term “PBS” is the abbreviation for Phosphate Buffer Saline, and 0.01 mM pH 7.4 PBS as used in the present invention is prepared as described in Molecular cloning: Laboratory manuals, 3rd edition.
  • EXAMPLE 1
  • Collection and Isolation of Viruses
  • Porcine brain tissue was collected under aseptic conditions from samples isolated from samples from Henan province suspected of having pseudorabies infection, added in MEM liquid medium in a ratio of 1:10(V:V), and ground to prepare a tissue suspension. After 3 times of repeated freezing-thawing, the tissue suspension was centrifuged at 2000r/min for 15 minutes. The supernatant was then collected, filtered through a 0.2 μm pore filter, subcultured on PK-15 cells and incubated at 37° C. for lh, and then the medium was changed by adding MEM liquid medium supplemented with 2% fetal bovine serum, and incubated at 37° C. for 5 days. PRV was detected by PRV PCR detection kit (Beijing Anheal Laboratories Co., Ltd), and the result was positive; PCR kit was employed to detect the exotic virus contamination (porcine reproductive and respiratory syndrome virus RT-PCR detection kit kit, porcine parvovirus PCR detection kit and classical swine fever virus RT-PCR detection kit, all purchased from Beijing Anheal Laboratories Co., Ltd) for the isolated virus and the PCR detection result was negative, indicating a pure viral specie.
  • The isolated PRV strain was deposited in the China Type Culture Collection on May, 20, 2013 named HN1201 strain (Pseudorabies virus, strain HN1201) of which the accession number is CCTCC NO. V 201311 and the preservation address is Wuhan University, Wuhan City, Hubei Province.
  • EXAMPLE 2
  • Genetic Characteristics of the Isolated Virus
  • Genetic characteristics of the isolated virus in Example 1 were determined by means of gene analysis. Genomic DNA prepared from the pseudorabies virus isolated from PK-15 cells was used as template with primers shown in Table 1 for PCR amplification reactions. The Primer Primer 5.0 was used for designing the primer sequence for amplifying gB, gC and gD gene, respectively.
  • The genomic DNA extracted was used as template to prepare the following PCR amplification system: 100 μg template DNA, 0.5 μL PrimerSTAR HS DNA Polymerase (2.5U/μL), 25 μL 2 ×PrimerSTAR GC Buffer, 1 μL of each upstream and downstream primer (10 pmol/μL), 4 μL dNTP Mix (2.5 mM each), adjusted to a final volume of 50 μL with distilled water. Two-step PCR reaction was carried out by an initial denaturation for 10 sec at 98° C. followed by annealing and extension at 68° C. (all the time is calculated by 1 kb/min) and there were 30 cycles in total. The PCR reactions were finalized at 4° C. The analysis of the amplification products was conducted by electrophoresis on 1% agarose gel containing ethidium bromide. The sequences of PCR products were determined. The sequence data was analyzed by Lasergene.
  • TABLE 1
    PCR primer sequences
    Target Size of
    gene Primer sequence (5′→3′) PCR product
    gB aagcgcatctttattgtttcccg 2957 bp
    ggcttctaccgcttccagacgg
    gC accgtcgccatgtgcgccacta 1603 bp
    cgggtcggactcgctgtcgtttatt
    gD ttcccatacactcacctgccagc 1250 bp
    tcgacgccggtactgcggag
  • EXAMPLE 3
  • Pathogenicity Test of the Virus
  • 3.1 Pathogenicity of the Virus in Piglets at Different Days of Age
  • 6 piglets at 34˜35 days of age which were negative for pseudorabies antibodies were randomly divided into 2 groups, one with 4 piglets (experimental group) and the other with 2 piglets (control group), wherein the experimental group was inoculated with PRV HN1201 strain by intranasal instillation (challenge dosage is 2×108.0TCID50/piglet) and the control group was inoculated with DMEM medium. Meanwhile 4 piglets at 49 days of age were inoculated with third passage of the virulent HN1201 strain after preservation (challenge dose was 2×108.0TCID50/piglet), and the control is still piglets at 35 days of age. After inoculation of virus, the temperature of piglets was determined daily, and clinical signs and death status were observed. The results are shown in Table 2.
  • TABLE 2
    Pathogenicity of PRV HN1201 strain in piglets at different
    days of age
    Num- Inoculation
    Group ber Days Dose Clinical signs Death status
    1 A1 35 2 × 108.0TCID50/ Body Temper- Died on day
    piglet ature increased, 4 after viral
    depression, challenge
    A2 loss of appetite, Died on day
    onset of respi- 5 after viral
    ratory and/or challenge
    A3 neurological Died on day
    signs 5 after viral
    challenge
    A4 Died on day
    6 after viral
    challenge
    2 B1 49 2 × 108.0TCID50/ Body Temper- Died on day
    piglet ature increased, 7 after viral
    depression, challenge
    B2 loss of appetite, Died on day
    onset of respi- 7 after viral
    ratory and/or challenge
    B3 neurological Died on day
    signs 5 after viral
    challenge
    B4 Survived
    3 C1 35 DMEM control Normal Survived
    C2 Survived
  • It showed in the results that inoculation with PRV HN1201 strain in piglets at different days of age could lead to onset of pseudorabies in piglets, as well as death of over ¾ of inoculated piglets.
  • 3.2 Pathogenicity of the Virus at Different Doses in Piglets
  • 8 piglets at 49 days of age which were negative for pseudorabies antibodies were randomly divided into 2 groups, each with 4 piglets, in addition two more piglets were used as control. The experimental groups were inoculated with 2×107.0TCID50/piglet PRV HN1201 strain or 2×108.0TCID50/piglet PRV HN1201 strain by intranasal instillation, respectively, and the control group was inoculated with DMEM medium. After inoculation of virus, the body temperature of piglets was determined daily, and clinical signs and death status were observed. The results are shown in Table 3.
  • TABLE 3
    Pathogenicity of different doses of PRV HN1201 strain in piglets
    Group Number Inoculation Dose Clinical signs Death status
    1 A1 2 × Significant Died on day 5
    107.0TCID50/piglet clinical signs: after viral
    temperature challenge
    A2 increased, Died on day 6
    depression, after viral
    loss of challenge
    A3 appetite Died on day 6
    after viral
    challenge
    A4 Died on day 6
    after viral
    challenge
    2 B1 2 × Significant Died on day 2
    108.0TCID50/piglet clinical signs: after viral
    temperature challenge
    B2 increased, Died on day 3
    depression, after viral
    loss of challenge
    B3 appetite Died on day 4
    after viral
    challenge
    B4 Died on day 4
    after viral
    challenge
    3 C1 DMEM control Normal Survived
    C2 Survived
  • It showed in the results that inoculation with different doses of clinically isolated PRV HN1201 strain in piglets at 49 days of age could all lead to onset of pseudorabies in piglets, of which 4/4 died.
  • EXAMPLE 4
  • Preparation of the Inactivated PRV Vaccine
  • The culture of different passages of the isolated strain was inoculated, according to Table 4, onto PK-15 cell culture to form a seed lot which was then inoculated into a monolayer of PK cell culture at 1% (V/V) of the amount of the liquid virus medium, and placed in a rotary incubator at 37° C. The cell medium containing viruses was harvested when the cytopathic effect of cells reached to 80%; the viruses were harvested after 2 times of freezing-thawing and the virus titer was assessed. 10% (V/V) formaldehyde solution was added to different passages of virus solution respectively, with a final concentration of 0.2% (V/V). The virus solution was inactivated at 37° C. for 18 hours, being stirred for 10 min every 4 hours, and diluted with pH 7.4 phosphate-buffered saline (PBS) to the content of viruses as shown in Table 4, mixed with 206 adjuvant (SEPPIC, France) according to the volume ratio of 54:46, and stirred at 120 rpm for 15 min at 30° C.
  • TABLE 4
    Preparation of each group of pseudorabies vaccines
    Ratio of vaccines
    (inactivated virus
    Passage number of Content of virus solution:206
    Group HN1201 culture before inactivation adjuvant)
    A 5 108.43TCID50/mL 54:46
    B 35 106.0TCID50/mL 54:46
  • EXAMPLE 5
  • Immunogenicity Assay of Inactivated Vaccines
  • 16 piglets at 21 days of age which were negative for PRV antibodies were randomly divided into 4 groups, each with 4 piglets, and injected with vaccines according to Table 5. Two groups injected with inactivated vaccines were injected with 2ml/piglet of the inactivated vaccines against pseudorabies prepared in Example 4. As a control vaccine, the live vaccine SA215 strain prepared by using the method in CN101186902 was applied according to the method for determining immunogenicity in the specification of the patent. The control group was inoculated with 2 mL/piglet of DMEM medium.
  • TABLE 5
    Grouping of immunogenicity assay
    Group Vaccines injected Dose
    Group A injected with Group A vaccine 2 mL/piglet
    inactivated vaccine prepared in
    Example 4
    Group B injected with Group B vaccine 2 mL/piglet
    inactivated vaccine prepared in
    Example 4
    Group injected with Live Live PRV vaccine 106.0TCID50/piglet
    vaccine SA215
    Control group DMEM medium 2 mL/piglet
  • After immunization with vaccines, neutralizing titers of antibodies of the inactivated vaccines groups were determined weekly according to the method of serum neutralization test from GB/T 18641-2002 Diagnostic Techniques for Aujeszk's Disease. The results are shown in Table 6.
  • TABLE 6
    Nneutralizing titers of antibodies at different time in
    piglets after immunization with PRV inactivated vaccines
    Average value of neutralizing titers of antibodies
    at different time (weeks)
    Group 1 2 3 4
    Group A injected 1:4.8  1:11.2 1:16.0 1:37.7
    with inactivated
    vaccine
    Group B injected 1:4.0 1:6.3 1:13.5 1:22.4
    with inactivated
    vaccine
    Group injected 1:3.7 1:4.0 1:10.0 1:16.0
    with live vaccine
    Control group Negative Negative Negative Negative
  • The result from Table 6 indicated that immunization with inactivated PRV vaccines in piglets can produce high neutralizing titers which increase with immunization time.
  • The piglets were challenged with 2×108.0TCID50/piglet of PRV HN1201 strain on day 28 after immunization, clinical signs and death status were observed as shown in Table 7. After challenge the body temperature of piglets was determined daily as shown in Table 8.
  • TABLE 7
    Viral challenge for piglets after immunization
    with PRV inactivated vaccines
    Rate of
    Group clinical signs and death status protection
    Group A injected with Body temperature increased 100% (4/4)
    inactivated vaccine for 2-3 days, normal appetite,
    basically no neurological
    signs, survived
    Group B injected with Body temperature increased 100% (4/4)
    inactivated vaccine for 2-3 days, normal appetite,
    basically no neurological
    signs, survived
    Group injected with live Body temperature increased 100% (4/4)
    vaccine for 7-10 days, loss of appetite,
    significant neurological signs,
    survived
    Control group Significant signs, two piglets  0% (0/4)
    died on day 2 after challenge,
    and all died within 3 days after
    challenge.
  • TABLE 8
    Body temperature change after challenge
    for piglets immunized with PRV vaccines
    Group A Group B Group
    injected with injected with injected
    inactivated inactivated with live
    Day vaccine vaccine vaccine
    day 1 after challenge 39.5 39.6 39.4
    day 2 after challenge 41.2 41.6 41.8
    day 3 after challenge 40.5 40.3 41.2
    day 4 after challenge 40.2 39.7 41.6
    day 5 after challenge 39.7 39.5 41.4
    day 6 after challenge 39.6 39.4 41.3
    day 7 after challenge 39.7 39.5 41.4
    day 8 after challenge 39.5 39.7 41.2
    day 9 after challenge 39.6 39.4 41.5
    day 10 after challenge 39.2 39.5 40.6
    day 11 after challenge 39.5 39.7 39.7
    day 12 after challenge 39.4 39.5 39.8
    day 13 after challenge 39.3 39.4 39.7
    day 14 after challenge 39.2 39.1 39.4
  • The results from Table 7 and 8 indicated that immunization of piglets with inactivated PRV vaccines could provide a 100% (4/4) protection rate for piglets, even though the infection of viruses could not be avoided (they showed clinical signs), while all piglets in the control group died on day 4 after challenge, therefore the inactivated PRV vaccines can provide excellent protection. In addition, compared with the live vaccine as the control vaccine, it took less time for the body temperature of piglets immunized with the inactivated vaccines to increase, and also they kept a basically normal appetite with no clinical signs, indicating excellent immune protection.
  • EXAMPLE 6
  • Preparation of the PRV gD Protein
  • 1. Amplification of the PRV gD Gene
  • The PK-15 cells which were in excellent health were inoculated with the PRV HN1201 strain or culture thereof of different passages (the PRV strain was HN1201 strain (Pseudorabies virus, strain HN1201), of which the accession number was CCTCC NO. V 201311; the HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May, 20, 2013, of which the address was Wuhan University, Wuhan City, Hubei Province), the culture of different passages was the culture within 5-35 passages. The PRV genomic DNA was extracted by using MiniBEST Viral RNA/ DNA Extraction Kit Ver.3.0 (TAKARA) after harvesting viruses. PCR amplification was performed by using 1 μL genomic DNA as template and gD-specific primers:
  • gDSF: 5′ ATGCTGCTCGCAGCGCTATTGGC 3′
    and
    gDSR: 5′ CTACGGACCGGGCTGCGCTTTTAG3′.
  • The high fidelity polymerase, Prime STAR® HS DNA Polymerase with GC Buffer (TAKARA) was used in the PCR reaction. The amplification conditions were: 94° C. 3min; 94° C. 30 s, 68° C. 90 s, 30 cycles; 72° C. 5min. The PCR product was named gD, of which the nucleotide sequence is shown in SEQ No.4, and the amino acid sequence can be derived as shown in SEQ No.1.
  • 2. Acquisition and Identification of Recombinant Bacmid
  • The PCR product, gD obtained from amplification with the high fidelity polymerase was cloned into the pFastBac/HBM-TOPO vector (Invitrogen, A11339). The cloning system was as follows: 4 μL PCR product, gD, 1 μL salt solution, 1 μL TOPO vector; 60 μL in total. The mixture was mixed thoroughly and incubated at room temperature for 5 minutes, and then used to transform One Shot® Machl™ T1R competent cells. The transformation mix was spread onto plates containing ampicillin. A single colony was picked to identify insert directionality of gD gene, and the plasmid with the correct insert directionality was delivered to Invitrogen for sequencing, in order to verify the correct sequence. The plasmid with the correct sequence was named pFastBac/HBM-TOPO-gD.
  • After the pFastBac/HBM-TOPO-gD plasmid was transformed into DH10Bac competent cells, transposition occurred between the pFastBac/HBM-TOPO-gD plasmid and the shuttle plasmid Bacmid in the competent cells, and the resulting recombinant plasmid was extracted by using PureLink™ HiPure Plasmid DNA Miniprep Kit (Invitrogen), and the insertion of gD was identified with pUCM13 Forward/pUCM13 Reverse primer. The positive Bacmid was named Bacmid-gD.
  • 3. Transfection for Obtaining Recombinant Baculovirus
  • This step was carried out based on the method provided by the instruction of Bac-to-Bac HBM TOPO Secreted Expression System (Invitrogen). 8×105 sf9 cells were layered in each well of a 6-well plate, transfection was performed according to the instruction of Cellfectin® II transfection agent after adherence of the cells: 8 μL Cellfectin® II and 1 μg Bacmid-gD DNA were diluted respectively with 100 μL SF-900 II medium and mixed by vortex. The diluted DNA was combined with the diluted Cellfectin® II (total volume ˜210 μL), mixed thoroughly and incubated for 15-30 minutes at room temperature. The transfection mixture was then added dropwise onto the cells. The supernatant of cell culture, marked as PO recombinant baculovirus vBac-gD, was collected 72 h after transfection or until the cytopathic effect was visible. The PO recombinant baculovirus vBac-gD infected sf9 cells, and after three rounds of amplification the resulting P3 recombinant baculovirus vBac-gD was used for expressing the recombinant protein.
  • 4. Infection of High-Five Cells with the Recombinant Baculovirus for Expression of the Recombinant Protein
  • The P3 recombinant baculovirus vBac-gD was inoculated in High-five cells (Invitrogen, B85502). Suspension culture of High-five cells was performed in a 500 mL Erlenmeyer flask and the cells were inoculated with the virus with an MOI of 1 when the cell density reached to 7.0×105 cell/mL. The supernatant of cell culture was collected 72 h after infection. A Tangential Flow Filtration System (Millipore) was employed to concentrate the volume into 1/10 of the original one. 1% (V%) of Triton X-100 (Sigma) was used to inactivate the baculovirus, and the content of protein determined by SDS-PAGE optical density method was 200 μg/mL.
  • EXAMPLE 7
  • Preparation of the PRV Subunit Vaccines
  • The subunit antigens prepared in Example 6 were diluted with PBS (pH=7.4) to the contents of protein in Table 9, mixed with 206 adjuvant (SEPPIC, France) at a volume ratio of 54:46, and stirred at 120 rpm for 15 min at 30° C.
  • TABLE 9
    Preparation of each group of the pseudorabies subunit vaccines
    Ratio of vaccines (inactivated virus
    Group Content of protein solution:206 adjuvant)
    A  25 μg/mL 54:46
    B 100 μg/mL 54:46
  • EXAMPLE 8
  • Immunogenicity Assay of the Vaccines in Pigs 12 piglets at 21 days of age which were negative for PRV antibodies were randomly divided into 3 groups, each with 4 piglets, and injected with 2 ml/piglet of the subunit vaccines against PRV prepared in Example 7 according to Table 10. The control group was inoculated with 2 mL/piglet of DMEM medium.
  • TABLE 10
    Grouping of immunogenicity assay
    Group Vaccines injected Dose
    Group A injected with Group A vaccine prepared 2 mL/piglet
    subunit vaccine in Example 7
    Group B injected with Group B vaccine prepared 2 mL/piglet
    subunit vaccine in Example 7
    Control group DMEM medium 2 mL/piglet
  • The piglets were challenged with 2×108.0TCID50/piglet of PRV HN1201 strain on day 28 after immunization, and clinical signs and death status were observed as shown in Table 11. After challenge the body temperature of piglets was determined daily as shown in Table 12.
  • TABLE 11
    Viral challenge for piglets after immunization
    with the PRV subunit vaccines
    Rate of
    Group Clinical signs and death status protection
    Group A injected with Body temperature increased 100% (4/4)
    subunit vaccine for 2-3 days, normal appetite,
    basically no neurological
    signs, survived
    Group B injected with Body temperature increased 100% (4/4)
    subunit vaccine for 2-3 days, normal appetite,
    basically no neurological
    signs, survived
    Control group Significant signs, two died on  0% (0/4)
    day 2 after challenge, and all
    died within 3 days after
    challenge.
  • TABLE 12
    Body temperature change of piglets immunized
    with the PRV subunit vaccines after challenge
    Group A injected with Group B injected with
    Day subunit vaccine subunit vaccine
    day 1 after challenge 39.5 39.5
    day 2 after challenge 41.2 41.6
    day 3 after challenge 40.3 40.2
    day 4 after challenge 40.1 39.7
    day 5 after challenge 39.6 39.5
    day 6 after challenge 39.6 39.3
    day 7 after challenge 39.6 39.5
    day 8 after challenge 39.5 39.4
    day 9 after challenge 39.5 39.6
    day 10 after challenge 39.2 39.3
    day 11 after challenge 39.3 39.4
    day 12 after challenge 39.4 39.4
    day 13 after challenge 39.2 39.4
    day 14 after challenge 39.2 39.1
  • The results from Table 11 and 12 indicated that immunization with the PRV subunit vaccines for piglets could provide a 100% (4/4) protection rate for piglets, even though the infection of viruses could not be avoided (they showed clinical signs), while all the control piglets died on day 4 after challenge, therefore the PRV subunit vaccines can provide excellent protection.
  • Those are only preferred embodiments of the present invention as described above, which cannot be used to limit the present invention. Any change, substitution or modification etc., which are within the spirit and principle of the invention, should be included within the scope of protection of the present invention.

Claims (12)

What is claimed is:
1. A nucleotide sequence substantially encoding the protein as shown in SEQ ID NO. 1 of the sequence listing.
2. A porcine pseudorabies virus strain comprising gD glycoprotein encoded by the nucleotide sequence as shown in SEQ ID NO.4 of the sequence listing.
3. The pseudorabies virus strain as described in claim 2, wherein said pseudorabies virus strain comprises gB glycoprotein encoded by the nucleotide sequence shown in SEQ ID NO.5 of the sequence listing.
4. The pseudorabies virus strain as described in claim 3, wherein said pseudorabies virus strain is the HN1201 strain or culture thereof, of which the accession number is CCTCC NO. V 201311; said HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May, 20, 2013, of which the address is Wuhan University, Wuhan City, Hubei Province.
5. A vaccine composition, comprising an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of the porcine pseudorabies virus strain as described in claim 2.
6. The vaccine composition as described in claim 5, wherein said pseudorabies virus strain comprises gB glycoprotein encoded by the nucleotide sequence shown in SEQ ID NO.5 of the sequence listing.
7. The vaccine composition as described in claim 6, wherein said pseudorabies virus strain is the HN1201 strain or culture thereof, of which the accession number is CCTCC NO. V 201311; said HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May, 20, 2013, of which the address is Wuhan University, Wuhan City, Hubei Province.
8. The vaccine composition as described in claim 7, wherein said vaccine composition comprising an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of said PRV HN1201 strain or culture thereof.
9. The vaccine composition as described in claim 8, wherein said vaccine composition comprises an inactivated vaccine of the PRV HN1201 strain or culture thereof, of which the concentration is not less than 106.0TCID50/ml.
10. The vaccine composition as described in claim 8, wherein said vaccine composition comprises 25-100m/dose gD protein antigen of the PRV HN1201 strain or culture thereof.
11. The vaccine composition as described in claim 5, wherein said vaccine composition further comprises medium, adjuvants and excipient.
12. A method for preparing said vaccine composition as described in claim 8 comprising the steps:
(1) cloning said PRV recombinant gD gene; (2) expressing said PRV recombinant gD protein;
and (3) mixing said PRV gD protein antigen with adjuvants based on certain ratio and emulsifying the resulting mixture.
US14/980,673 2013-05-31 2015-12-28 Porcine pseudorabies virus, vaccine composition and preparation method and use thereof Active US9650424B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/980,673 US9650424B2 (en) 2013-05-31 2015-12-28 Porcine pseudorabies virus, vaccine composition and preparation method and use thereof

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
CN201310216881 2013-05-31
CN201310216881 2013-05-31
CN201310216881.6 2013-05-31
CN201310428605 2013-09-18
CN201310428605 2013-09-18
CN201310428605.6 2013-09-18
PCT/CN2014/076691 WO2014190838A1 (en) 2013-05-31 2014-04-30 Porcine pseudorabies virus, vaccine composition and preparation method and use thereof
US201514779132A 2015-09-22 2015-09-22
US14/980,673 US9650424B2 (en) 2013-05-31 2015-12-28 Porcine pseudorabies virus, vaccine composition and preparation method and use thereof

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/CN2014/076691 Continuation WO2014190838A1 (en) 2013-05-31 2014-04-30 Porcine pseudorabies virus, vaccine composition and preparation method and use thereof
US14/779,132 Continuation US20160137700A1 (en) 2013-05-31 2014-04-30 Porcine pseudorabies virus, vaccine composition and preparation method and use thereof

Publications (2)

Publication Number Publication Date
US20160114029A1 true US20160114029A1 (en) 2016-04-28
US9650424B2 US9650424B2 (en) 2017-05-16

Family

ID=51365682

Family Applications (2)

Application Number Title Priority Date Filing Date
US14/779,132 Abandoned US20160137700A1 (en) 2013-05-31 2014-04-30 Porcine pseudorabies virus, vaccine composition and preparation method and use thereof
US14/980,673 Active US9650424B2 (en) 2013-05-31 2015-12-28 Porcine pseudorabies virus, vaccine composition and preparation method and use thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US14/779,132 Abandoned US20160137700A1 (en) 2013-05-31 2014-04-30 Porcine pseudorabies virus, vaccine composition and preparation method and use thereof

Country Status (6)

Country Link
US (2) US20160137700A1 (en)
EP (1) EP2985288B1 (en)
JP (1) JP6236144B2 (en)
CN (2) CN105255910A (en)
ES (1) ES2762535T3 (en)
WO (1) WO2014190838A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018064513A1 (en) * 2016-09-30 2018-04-05 The Brigham And Women's Hospital, Inc. Natural killer cell-evasive oncolytic viruses
CN110028590A (en) * 2019-04-22 2019-07-19 福建省农业科学院畜牧兽医研究所 A kind of pCzn1-gC fusion protein and its application
CN114652828A (en) * 2022-03-18 2022-06-24 天津瑞普生物技术股份有限公司 Biological product containing novel goose parvovirus and duck circovirus antigen-antibody complex
CN114908056A (en) * 2022-05-18 2022-08-16 华中农业大学 Recombinant CHO cell line for expressing porcine PRV gDFc or gBFc fusion protein and construction method and application thereof
CN115779084A (en) * 2022-09-15 2023-03-14 华中农业大学 Application of preparation for activating pig TUSC1 gene expression in preparation of pig pseudorabies virus infection resisting medicine

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103923884B (en) * 2014-02-21 2017-03-29 普莱柯生物工程股份有限公司 A kind of porcine pseudorabies virus gene-deleted strain, vaccine combination and its preparation method and application
CN105251000B (en) * 2014-09-30 2018-12-14 普莱柯生物工程股份有限公司 Porcine pseudorabies virus vaccine composition and its preparation method and application
CN105727277A (en) * 2014-12-12 2016-07-06 普莱柯生物工程股份有限公司 Method for preparation of swine pseudorabies virus vaccine and vaccine product
CN111560355A (en) * 2015-03-20 2020-08-21 普莱柯生物工程股份有限公司 Porcine pseudorabies virus weakening method, porcine pseudorabies virus weakening virus strain, porcine pseudorabies virus vaccine composition and application of porcine pseudorabies virus weakening virus strain
CN106267182B (en) * 2015-06-29 2020-02-07 普莱柯生物工程股份有限公司 Preparation method of porcine pseudorabies virus subunit vaccine, vaccine composition and application
CN105693827B (en) * 2015-06-29 2020-05-15 普莱柯生物工程股份有限公司 Porcine pseudorabies virus subunit vaccine and preparation method and application thereof
CN106552263A (en) * 2015-09-25 2017-04-05 普莱柯生物工程股份有限公司 Application of the pseudorabies live vaccine composition in the medicine for preparing prevention and treatment porcine pseudorabies virus subclinical infection
CN108048413B (en) * 2017-12-20 2021-06-25 哈药集团生物疫苗有限公司 Pseudorabies virus canine animal isolate, inactivated vaccine prepared from pseudorabies virus canine animal isolate and application of pseudorabies virus canine animal isolate
CN109655610B (en) * 2018-11-27 2022-03-29 广东省农业科学院动物卫生研究所 Indirect ELISA (enzyme-linked immunosorbent assay) detection kit for pseudorabies virus
CN110327461B (en) * 2019-07-17 2022-06-24 苏州世诺生物技术有限公司 Preparation method and application of porcine pseudorabies virus subunit vaccine
CN110527669B (en) * 2019-09-06 2021-07-06 中牧实业股份有限公司 Porcine pseudorabies virus gene deletion strain and construction method and application thereof
CN113151190B (en) * 2021-01-26 2023-10-31 铜仁职业技术学院 Porcine pseudorabies virus virulent strain
CN113831408B (en) * 2021-10-26 2023-03-24 国家开放大学 Monoclonal antibody of porcine pseudorabies virus EP0 protein, preparation method and application
CN114146172B (en) * 2021-12-07 2022-09-16 重庆市动物疫病预防控制中心 Nano antibody vaccine capable of preventing porcine pseudorabies virus infection, preparation method and application

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5240703A (en) * 1991-03-01 1993-08-31 Syntro Corporation Attenuated, genetically-engineered pseudorabies virus s-prv-155 and uses thereof
US5738854A (en) * 1992-10-06 1998-04-14 Akzo Nobel N.V. Pseudorabies virus vaccine
CN104459121A (en) * 2014-11-28 2015-03-25 洛阳普莱柯万泰生物技术有限公司 PRV (pseudorabies virus) antibody detection system and preparation method thereof

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6172186B1 (en) * 1986-03-26 2001-01-09 Pharmacia & Upjohn Company Pseudorabies virus protein
US6255078B1 (en) * 1986-03-26 2001-07-03 Pharmacia & Upjohn Company Pseudorabies virus protein cross reference to related applications
US5352596A (en) * 1992-09-11 1994-10-04 The United States Of America As Represented By The Secretary Of Agriculture Pseudorabies virus deletion mutants involving the EPO and LLT genes
FR2751224B1 (en) * 1996-07-19 1998-11-20 Rhone Merieux POLYNUCLEOTIDE VACCINE FORMULA AGAINST BREATHING AND PIG REPRODUCTIVE CONDITIONS
KR20030054139A (en) * 2001-12-24 2003-07-02 학교법인 건국대학교 Recombinant expression vector comprising the gD gene of the swine Aujeszky's disease virus and DNA vaccine using the same
CN100438919C (en) * 2004-07-06 2008-12-03 谭启堂 Nucleic acid vaccine, and its application
WO2007134385A1 (en) * 2006-05-19 2007-11-29 The Walter And Eliza Hall Institute Of Medical Research Immunogenic compositions
CN101186902B (en) 2006-07-04 2010-11-10 四川农业大学 Pseudorabies virus SA215, pseudorabies virus polygene deletion bacterin and preparation method thereof
KR20100052254A (en) * 2008-11-10 2010-05-19 충북대학교 산학협력단 Nucleotide sequences of swine aujeszky's disease virus glycoprotein gb, gc and gd
CN102399755B (en) * 2011-09-21 2013-03-20 上海创宏生物科技有限公司 Pig pseudorabies virus natural low-virulent C strain and heatproof preservation method thereof
CN102952785B (en) * 2012-11-19 2013-12-11 江苏省农业科学院 Porcine pseudorabies virus, and vaccine composition and applications thereof
CN102994458B (en) * 2012-11-26 2014-04-02 中国农业科学院哈尔滨兽医研究所 Porcine pseudorabies virus virulent strain, and gene deletion vaccine strain thereof and applications thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5240703A (en) * 1991-03-01 1993-08-31 Syntro Corporation Attenuated, genetically-engineered pseudorabies virus s-prv-155 and uses thereof
US5738854A (en) * 1992-10-06 1998-04-14 Akzo Nobel N.V. Pseudorabies virus vaccine
CN104459121A (en) * 2014-11-28 2015-03-25 洛阳普莱柯万泰生物技术有限公司 PRV (pseudorabies virus) antibody detection system and preparation method thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Lytle et al., "Predicted Inactivation of Viruses of Relevance to Biodefense by Solar Radiation," J. Virol. 79(22):14244 (2005) *
Wang et al. (CN104459121-A)(2015)(Google/English translation) *
Yang et al., "Pathogenicity of a currently circulating Chinese variant pesudorabies virus in pigs," World J. Virol 5(1): 23-30 (2016) *
Ye et al., "Genomic characterization of emergent pseudorabies virus in China reveals marked sequence divergence: Evidence for the existence of two major genotypes," Virology 483: 32-43 (2015) *
Zhong et al. (GenBank Accession Number KC981239.1, “Suid herpesvirus 1 strain BJ/YT Genome”)(2013) *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018064513A1 (en) * 2016-09-30 2018-04-05 The Brigham And Women's Hospital, Inc. Natural killer cell-evasive oncolytic viruses
CN110028590A (en) * 2019-04-22 2019-07-19 福建省农业科学院畜牧兽医研究所 A kind of pCzn1-gC fusion protein and its application
CN114652828A (en) * 2022-03-18 2022-06-24 天津瑞普生物技术股份有限公司 Biological product containing novel goose parvovirus and duck circovirus antigen-antibody complex
CN114908056A (en) * 2022-05-18 2022-08-16 华中农业大学 Recombinant CHO cell line for expressing porcine PRV gDFc or gBFc fusion protein and construction method and application thereof
CN115779084A (en) * 2022-09-15 2023-03-14 华中农业大学 Application of preparation for activating pig TUSC1 gene expression in preparation of pig pseudorabies virus infection resisting medicine

Also Published As

Publication number Publication date
US9650424B2 (en) 2017-05-16
CN104004774A (en) 2014-08-27
US20160137700A1 (en) 2016-05-19
WO2014190838A1 (en) 2014-12-04
JP6236144B2 (en) 2017-11-22
EP2985288B1 (en) 2019-11-13
CN104004774B (en) 2016-06-29
JP2016520294A (en) 2016-07-14
EP2985288A4 (en) 2016-06-08
CN105255910A (en) 2016-01-20
EP2985288A9 (en) 2016-06-01
ES2762535T3 (en) 2020-05-25
EP2985288A1 (en) 2016-02-17

Similar Documents

Publication Publication Date Title
US9650424B2 (en) Porcine pseudorabies virus, vaccine composition and preparation method and use thereof
US10201605B2 (en) Gene-deleted variant strain of porcine pseudorabies virus, vaccine composition, method of making the same and use thereof
US9801936B2 (en) Method of attenuating porcine pseudorabies virus, attenuated strains of porcine pseudorabies virus, vaccine composition and use thereof
US10449246B2 (en) Subunit vaccine of porcine pseudorabies virus and preparation method
CN105018433B (en) Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application
KR20140036262A (en) Combined vaccines for prevention of porcine virus infections
KR20210121293A (en) Effective vaccination against european strains of porcine reproductive and respiratory syndrome (prrs) virus prior to weaning
CN105251000A (en) Porcine pseudorabies virus vaccine composition and preparing method and application thereof
CN102727884B (en) Combined live vaccine against porcine reproductive and respiratory syndrome and pseudorabies, and preparation method thereof
CA3081982A1 (en) Porcine reproductive and respiratory syndrome vaccine virus
CN105018436B (en) Porcine pseudorabies virus gene-deleted strain, vaccine composition and its preparation method and application
CN104328090B (en) A kind of porcine pseudorabies virus strain, vaccine composition and its preparation method and application

Legal Events

Date Code Title Description
AS Assignment

Owner name: PULIKE BIOLOGICAL ENGINEERING, INC., CHINA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ZHANG, XUKE;SUN, JINZHONG;TIAN, KEGONG;AND OTHERS;REEL/FRAME:037395/0979

Effective date: 20150914

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4