US20150344913A1

US20150344913A1 - Recombinant microorganism and method for producing a substance using the same

Info

Publication number: US20150344913A1
Application number: US14/717,019
Authority: US
Inventors: Chikara Ohto; Masayoshi Muramatsu; Masakazu Ito; Jun Ogawa; Shigenobu Kishino
Original assignee: Toyota Motor Corp; Kyoto University NUC
Current assignee: Toyota Motor Corp; Kyoto University NUC
Priority date: 2014-05-30
Filing date: 2015-05-20
Publication date: 2015-12-03
Anticipated expiration: 2035-05-20
Also published as: US9714436B2; JP2015226477A; BR102015012223A2; JP6034332B2

Abstract

This invention provides a recombinant microorganism into which an acyl-CoA reductase exerting excellent activity in a reduction reaction involving the use of acyl-CoA as a substrate has been introduced. Such recombinant microorganism comprises a nucleic acid encoding a protein (a) or (b) below introduced into a host microorganism: (a) a protein comprising the amino acid sequence of SEQ ID NO: 2; or (b) a protein comprising an amino acid sequence having 70% or higher identity to the amino acid sequence of SEQ ID NO: 2 and having activity for synthesizing an aldehyde compound from acyl-CoA.

Description

TECHNICAL FIELD

The present invention relates to a recombinant microorganism into which a gene associated with production of a target substance has been introduced and a method for producing a substance using such recombinant microorganism.

BACKGROUND ART

Microorganisms capable of synthesizing an aldehyde, an alcohol, or a hydrocarbon, such as alkane, alkene, or alkyne, have been known. JP 2011-520455 A discloses an alkane synthase gene and an aldehyde synthase gene derived from Synechococcus elongatus, and it also discloses a method for producing an alkane or an aldehyde using such genes.
JP 2002-223788 A discloses the production of an alcohol using a transformed plant into which the acyl reductase gene has been introduced and, as a substrate, an aliphatic-acyl group bound to CoA and/or ACP. While JP 2002-223788 A describes that the acyl reductase gene is isolated from green algae, it does not disclose that a transformed plant is actually produced.
Further, JP 2013-528057 A discloses that aliphatic acyl-CoA reductase derived from Clostridium kluyveri is prepared and transformed into an E. coli strain together with another lipid synthesis-associated gene.
Furthermore, JP 2012-506715 A discloses a method for producing an aliphatic alcohol comprising expressing a gene encoding an aliphatic aldehyde biosynthetic polypeptide that reduces carboxylic acid into an aldehyde or a variant thereof in a host, so as to synthesize an aliphatic aldehyde, and producing an alcohol from an aliphatic aldehyde.
In addition, JP 2011-512848 A discloses a method for genetically engineering microorganisms capable of producing a primary alcohol using a malonyl-CoA-independent FAS metabolic pathway and an acyl reduction metabolic pathway.
Further, JP 2010-528627 A discloses a method for producing an oil component by introducing genes associated with oil and fat production into microalgae of Chlorella.
JP 2012-511928 A discloses microorganisms into which nucleic acids encoding isopropanol pathway enzymes such as succinyl-CoA:3-ketoacid-CoA transferase have been introduced and a method for producing isopropanol using such microorganisms.

SUMMARY OF THE INVENTION

Objects to Be Attained by the Invention

There have been no acyl-CoA reductases known to exert excellent activity in microorganisms, and productivity has been disadvantageously low regarding an aldehyde generated via reduction from aliphatic acyl-CoA as a substrate or an alcohol or a hydrocarbon generated from such an aldehyde as a substrate.
Under the above circumstances, it is an object of the present invention to provide a recombinant microorganism into which an acyl-CoA reductase exerting excellent activity in a reduction reaction using acyl-CoA as a substrate has been introduced, and it is another object of the present invention to provide a method for producing a substance using such recombinant microorganism.

Means for Attaining the Objects

The present inventors have conducted concentrated studies in order to attain the above objects. As a result, they discovered that a particular type of aldehyde dehydrogenase has activity of synthesizing an aldehyde compound from acyl-CoA. This has led to the completion of the present invention.

(1) A recombinant microorganism comprising a nucleic acid encoding a protein (a) or (b) below introduced into a host microorganism:

(a) a protein comprising the amino acid sequence of SEQ ID NO: 2; or
(b) a protein comprising an amino acid sequence having 70% or higher identity to the amino acid sequence of SEQ ID NO: 2 and having activity for synthesizing an aldehyde compound from acyl-CoA.

(2) The recombinant microorganism according to (1), wherein the host microorganism is selected from the group consisting of Escherichia coli, Corynebacterium, and yeast.
(3) The recombinant microorganism according to (1), which has aldehyde decarbonylase activity for synthesizing a hydrocarbon using an aldehyde as a substrate.
(4) The recombinant microorganism according to (1), wherein the host microorganism has a nucleic acid encoding an aldehyde decarbonylase that synthesizes a hydrocarbon using an aldehyde as a substrate.
(5) The recombinant microorganism according to (1), which produces a hydrocarbon comprising a carbon chain of 13 to 15 carbon atoms.
(6) A method for producing a substance comprising a step of culturing the recombinant microorganism according to any of (1) to (5) in a medium containing a carbon source and a step of recovering a target substance from the cultured recombinant microorganism.
(7) The method for producing a substance according to (6), wherein the target substance is at least one member selected from the group consisting of an aliphatic aldehyde, an aliphatic alcohol, and a hydrocarbon.

Effects of the Invention

The recombinant microorganism according to the present invention expresses an acyl-CoA reductase that exerts excellent activity in a reduction reaction from an aliphatic acyl-CoA as a substrate. Accordingly, such recombinant microorganism is excellent in terms of productivity of an aliphatic aldehyde caused by reduction of an aliphatic acyl-CoA with the aid of the acyl-CoA reductase, an aliphatic alcohol converted from the aliphatic aldehyde, and a hydrocarbon.
According to the method for producing a substance of the present invention, a recombinant microorganism that is excellent in terms of productivity of an aliphatic aldehyde caused by reduction of an aliphatic acyl-CoA with the aid of the acyl-CoA reductase, an aliphatic alcohol converted from the aliphatic aldehyde, and a hydrocarbon is used. Thus, productivity of substances, including an aliphatic aldehyde, an aliphatic alcohol, and a hydrocarbon, can be remarkably improved.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 schematically shows constitutions of the two expression vectors (pCDFDuet-1 and pRSFDuet-1) prepared in examples.

FIG. 2 shows a characteristic diagram demonstrating the results of GC/MS analysis of the suspension comprising ground recombinant E. coli cells prepared in examples.

EMBODIMENTS FOR CARRYING OUT THE INVENTION

Hereafter, the present invention is described in more detail with reference to the drawings and the examples.
The recombinant microorganism according to the present invention comprises a nucleic acid encoding a particular acyl-CoA reductase introduced thereinto. The recombinant microorganism according to the present invention expresses the acyl-CoA reductase to thereby reduce acyl-CoA (it is occasionally referred to as “aliphatic acyl-CoA”), which is a thioester compound of an aliphatic acid with CoA, and produce an aldehyde compound with high efficiency. The aldehyde compound produced is oxidized in the metabolic reaction within the microorganism and converted into an alcohol, or it is used as a substrate for hydrocarbon synthesis by an enzyme having hydrocarbon-synthesizing activity. Thus, the recombinant microorganism according to the present invention is not only capable of producing an aldehyde with high efficiency, but it is also capable of producing an alcohol and/or hydrocarbon from such aldehyde compound with high efficiency, through expression of the acyl-CoA reductase.
The term “nucleic acid” refers to a nucleic acid existing in nature, such as DNA or RNA, or an artificial nucleic acid, such as a nucleic acid molecule resulting from chemical modification to PNA (peptide nucleic acid), a nucleotide, a sugar, or a diester phosphate moiety. The term “a nucleic acid encoding an acyl-CoA reductase” refers both to a region comprising an expression regulatory region and a coding region in the genome and a region consisting of a coding region in the genome.
Acyl-CoA is synthesized from a sugar as a result of the metabolic reaction in a host microorganism. A sugar is a substance represented by a chemical formula C_n(H₂O)_m. Examples thereof include an aldehyde of a polyhydric alcohol, a ketone derivative of a polyhydric alcohol, and derivatives and condensates of substances related thereto, and specific examples include polysaccharides, oligosaccharides, disaccharides, and monosaccharides. Specific examples of monosaccharides include glucose, fructose, galactose, mannose, xylose, xylulose, ribose, erythrose, threose, erythrulose, glyceraldehyde, and dihydroxyacetone. Specific examples of disaccharides include sucrose (saccharose), lactose, maltose, trehalose, and cellobiose.

[Acyl-CoA Reductase]

With regard to the recombinant microorganism of the present invention, a nucleic acid encoding a particular acyl-CoA reductase is, for example, a nucleic acid encoding a protein comprising the amino acid sequence of SEQ ID NO: 2. The amino acid sequence of SEQ ID NO: 2 can be identified as a sequence similar to that of a known aldehyde dehydrogenase (AldDH) via genomic analysis of Klebsiella pneumoniae subsp. pneumoniae NBRC3321. However, functions and other properties of the protein comprising the amino acid sequence of SEQ ID NO: 2 remain unknown.
A nucleic acid encoding a particular acyl-CoA reductase may encode a protein comprising an amino acid sequence that is different from the amino acid sequence of SEQ ID NO: 2 and having activity of an acyl-CoA reductase.
For example, a nucleic acid encoding a particular type of acyl-CoA reductase may encode a protein comprising an amino acid sequence derived from the amino acid sequence of SEQ ID NO: 2 by deletion, substitution, addition, or insertion of 1 or a plurality of amino acids and having activity of an acyl-CoA reductase. A plurality of amino acids is, for example, 1 to 20, preferably 1 to 10, more preferably 1 to 7, further preferably 1 to 5, and particularly preferably 1 to 3 amino acids. Amino acid deletion, substitution, or addition can be performed by modifying the nucleotide sequence of the nucleic acid encoding the acyl-CoA reductase in accordance with a technique known in the art. A mutation can be introduced into a nucleotide sequence by conventional techniques, such as the Kunkel method or the Gapped duplex method, or a technique in accordance therewith. For example, a site-directed mutagenesis kit (e.g., Mutant-K or Mutant-G (trade names); manufactured by TAKARA Bio) may be used. Alternatively, a mutation may be introduced using the LA PCR in vitro Mutagenesis Series Kit (trade name: manufactured by TAKARA Bio). Further, mutagenesis may be carried out with the use of a chemical mutagen. Representative examples of chemical mutagens include EMS (ethylmethane sulfonate), 5-bromouracil, 2-aminopurine, hydroxylamine, N-methyl-N′-nitro-N-nitrosoguanidine, and other carcinogenic compounds. Also, it may be carried out by radiation application and ultraviolet processing with the use of x rays, α rays, β rays, γ rays, or ion beams.
For example, a nucleic acid encoding a particular type of acyl-CoA reductase may encode a protein comprising an amino acid sequence having 70% or higher, preferably 75% or higher, more preferably 80% or higher, further preferably 90% or higher, still further preferably 95% or higher, and most preferably 99% or higher similarity or identity to the amino acid sequence of SEQ ID NO: 2 and having activity of an acyl-CoA reductase. The degree of similarity or identity is determined using a computer program equipped with the basic local alignment search tool (BLAST) program and a database storing gene sequence information by default.
More specifically, Table 1 shows the results of searching of the database storing protein amino acid sequences with the use of the so-called Blast Search Programs on the basis of the amino acid sequence of SEQ ID NO: 2.

TABLE 1

Gene ID	Gene origin	SEQ ID NO

D364_14210	Klebsiella pneumoniae CG43	SEQ ID NO 3
KPN2242_17010	Klebsiella pneumoniae KCTC	SEQ ID NO 4
	2242
CFSAN002069_19445	Salmonella enterica subsp.	SEQ ID NO 5
	enterica Serovar Heidelberg
	CFSAN002069
SG2494	Salmonella enterica subsp.	SEQ ID NO 6
	enterica serovar Gallinarum
	287/91
EcDH1_1215	Escherichia coli DH1	SEQ ID NO 7
O3M_07220	Escherichia coli O104 H4	SEQ ID NO 8
	2009EL-2050
Dda3937_03173	Dickeya dadantii 3937	SEQ ID NO 9
Dd1591_0964	Dickeya zeae	SEQ ID NO 10
MU9_1040	Morganella morganii	SEQ ID NO 11

As shown in Table 1, 9 types of genes can be identified as genes encoding proteins having 75% or higher homology to the amino acid sequence of SEQ ID NO: 2. Since these 9 types of genes show as high as 75% or higher homology to a protein comprising the amino acid sequence of SEQ ID NO: 2, these genes encode proteins having activity of an acyl-CoA reductase, as well as the protein comprising the amino acid sequence of SEQ ID NO: 2.
An example of a nucleic acid encoding a particular acyl-CoA reductase is a nucleic acid hybridizing under stringent conditions to a nucleic acid encoding the amino acid sequence of SEQ ID NOs: 2 (e.g., a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1) and encoding a protein having activity of an acyl-CoA reductase. Under stringent conditions, namely, a specific hybrid is formed, but a non-specific hybrid is not formed. For example, such conditions comprise hybridization at 45° C. with 6×SSC (sodium chloride/sodium citrate), followed by washing at 50° C. to 65° C. with 0.2 to 1×SSC and 0.1% SDS. Alternatively, such conditions comprise hybridization at 65° C. to 70° C. with 1×SSC, followed by washing at 65° C. to 70° C. with 0.3×SSC. Hybridization can be carried out by a conventional technique, such as the method described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, 1989.
Alternatively, a nucleic acid encoding a particular type of acyl-CoA reductase may encode a protein comprising, for example, an amino acid sequence derived from the amino acid sequence of SEQ ID NO: 2 by conservative amino acid substitution and having activity of an acyl-CoA reductase. The term “conservative amino acid substitution” used herein may be defined as follows. As described in Reference Document (1) (McKee Biochemistry, Third Edition, Chapter 5: Amino acids, Peptides, and Proteins, 5.1: Amino acids, Atsushi Ichikawa (supervising editor), Shinichi Fukuoka (supervising translator), Ryosuke Sone (publisher), Kagaku-Dojin Publishing Company, Inc., ISBN4-7598-0944-9), specifically, it is well known that amino acids are classified in accordance with side chains having similar properties (chemical properties or physical sizes). Also, it is well known that molecular evolutionary substitutions frequently occur between amino acid residues classified as members of a given group while maintaining protein activity. On the basis thereof, the amino acid substitution scoring matrix (BLOSUM) shown in FIG. 2 in Reference Document (2): Henikoff S., Henikoff J. G., Amino-acid substitution matrices from protein blocks, Proc. Natl. Acad. Sci. U.S.A., 89, 10915-10919, 1992 was proposed, and such technique has been extensively employed. Reference Document (2) is based on the finding such that substitution between amino acids having similar side-chain chemical properties would reduce changes in structures and functions occurring throughout a protein. According to Reference Documents (1) and (2), a group of side-chain amino acids to be taken into consideration for multiple alignment can be based on indicators such as chemical properties and physical sizes. According to the scoring matrix (BLOSUM) disclosed in Reference Document (2), such group of side-chain amino acids is indicated as a group of amino acids having a score of 0 or more, and preferably of 1 or more. Examples of representative groups include the 8 groups described below. Amino acids can be classified into more specific groups: for example, a group of amino acids having a score of 0 or more; a group of amino acids having a score of 1 or more; and a group of amino acids having a score of 2 or more.

1) Aliphatic Hydrophobic Amino Acids Group (ILMV Group)

This group consists of amino acids comprising aliphatic hydrophobic side chains among the neutral non-polar amino acids described in Reference Document (1); i.e., V (Val, valine), L (Leu, leucine), I (Ile, isoleucine), and M (Met, methionine). Among the amino acids that are classified as the neutral non-polar amino acids according to Reference Document (1), FGACWP are not included in “the group of hydrophobic aliphatic amino acids” for the following reasons. That is, the size of G (Gly, glycine) or A (Ala, alanine) is less than or equal to that of a methyl group, and the effects of non-polar amino acids are weak. Also, C (Cys, cysteine) occasionally plays a key role in S—S bonding, and it forms a hydrogen bond with an oxygen or nitrogen atom. In addition, the side chain molecular weights of F (Phe, phenylalanine) and W (Trp, tryptophane) are particularly high, and the effects of aromatic amino acids are strong. Further, P (Pro, proline) fixes the angle of the polypeptide main chain because of its strong imino acid effects.

2) Group of Amino Acids Having Hydroxymethylene Groups (ST Group)

This group consists of amino acids having hydroxymethylene groups in the side chains among the neutral polar amino acids; i.e., S (Ser, serine) and T (Thr, threonine). Since sugars bind at the sites of hydroxyl groups existing in the S and T side chains, such sites of hydroxyl groups are often important for a given type of polypeptide (protein) to have particular activity.

3) Group of Acidic Amino Acids (DE Group)

This group consists of amino acids having acidic carboxyl groups in the side chains; i.e., D (Asp, aspartic acid) and E (Glu, glutamic acid).
4) Group of Basic Amino acids (KR Group)
This group consists of basic amino acids; i.e., K (Lys, lysine) and R (Arg, arginine). K and R are positively charged over an extensive pH range and they have basic properties. In contrast, H (His, histidine), classified as a basic amino acid, is not substantially ionized at pH 7, and it is accordingly not classified as a member of this group.

5) Group of Amino Acids Comprising Methylene Group=Polar Group (DHN Group)

All amino acids classified as members of this group comprise methylene groups bound as side chains to carbon atoms at position cc and polar groups at sites closer to the ends thereof. The amino acids of this group are very similar in terms of physical sizes of non-polar methylene groups, and the group consists of N (Asn, asparagine, with the polar group being an amide group), D (Asp, aspartic acid, with the polar group being a carboxyl group), and H (His, histidine, with the polar group being an imidazole group).

6) Group of Amino Acids Comprising Dimethylene Group=Polar Group (EKQR Group)

All amino acids classified as members of this group comprise linear hydrocarbons equal to or larger than dimethylene groups bound as side chains to carbon atoms at position α and polar groups at sites closer to the ends thereof. The amino acids of this group are very similar in terms of physical sizes of non-polar dimethylene groups, and the group consists of E (Glu, glutamic acid, with the polar group being a carboxyl group), K (Lys, lysine, with the polar group being an amino group), Q (Gln, glutamine, with the polar group being an amide group), and R (Arg, arginine, with the polar groups being imino and amino groups).

7) Group of Aromatic Amino Acids (FYW Group)

This group consists of aromatic amino acids comprising benzene nuclei in the side chains and having chemical properties peculiar to aromatic amino acids: i.e., F (Phe, phenylalanine), Y (Tyr, tyrosine), and W (Trp, tryptophane).

8) Group of Cyclic Polar Amino Acids (HY Group)

This group consists of amino acids having both cyclic structures and polar groups in the side chains; i.e., H (H, histidine, with both the cyclic structure and the polar group being imidazole groups) and Y (Tyr, tyrosine, with the cyclic structure being a benzene nucleus and the polar group being a hydroxyl group).
On the basis of the groups of amino acids described above, it can be easily deduced that novel proteins having the same functions are obtained by substituting an amino acid residue in the amino acid sequence of a protein having a given function with another amino acid residue of the same group. On the basis of “1) Aliphatic hydrophobic amino acids group (ILMV group)” above, for example, it can be easily deduced that novel proteins having the same functions are obtained even if an isoleucine residue in the amino acid sequence of a protein having a particular function is substituted with a leucine residue. When there are a plurality of proteins having particular functions, amino acid sequences are occasionally described as consensus sequences. Even in such cases, it can be easily deduced that novel proteins having the same functions are obtained by substituting a particular amino acid residue with another amino acid residue of the same group. When there are a plurality of proteins having particular functions and the amino acid residue in the consensus sequence determined based thereon is isoleucine or leucine (L/I), for example, it can be easily deduced that novel proteins having the same functions are obtained even if the isoleucine or leucine residue is substituted with a methionine or valine residue on the basis of “1) Aliphatic hydrophobic amino acids group (ILMV group).”
Whether or not a nucleic acid comprising a particular nucleotide sequence encodes the acyl-CoA reductase can be determined by preparing an expression vector comprising the nucleic acid incorporated into a site between an adequate promoter and a terminator, transforming an adequate host using the prepared expression vector, and assaying the acyl-CoA reductase activity of the protein expressed. Acyl-CoA reductase activity can be assayed by culturing the transformant in a medium containing a carbon source and analyzing the synthesized aldehyde compound or an alcohol derived from the aldehyde compound via gas chromatography, mass analysis, or other means. When culturing the transformant, acyl-CoA may be added to the medium.

[Expression Vector and Host Microorganism]

The nucleic acid encoding the acyl-CoA reductase described above is incorporated into an adequate expression vector and it is then introduced into a host microorganism. A host microorganism is not particularly limited, provided that it is capable of expressing an acyl-CoA reductase. Examples of host microorganisms include: bacteria of Escherichia such as Escherichia coli, Corynebacterium such as Corynebacterium glutamicum, Bacillus such as Bacillus subtilis, Pseudomonas such as Pseudomonas putida, and Rhizobium such as Rhizobium meliloti; and fungi including yeast and filamentous fungi, such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, and Pichia pastoris.
When bacteria such as Escherichia coli are used for host microorganisms, it is preferable that an expression vector be capable of autonomous replication in such bacteria and be composed of a promoter, a ribosome binding sequence, the gene(s) described above, and a transcription terminator sequence. Also, an expression vector may comprise a gene that regulates promoter activity.
Any Escherichia coli strains that have heretofore been known can be used, and examples thereof include the Escherichia coli BL21 (DE3) strain, K12 strain, DH1 strain, and JM109 strain. As Escherichia coli strains, in particular, the K12 strains and strains prepared therefrom-that is, so-called K strains-can be used. An example of the Bacillus subtilis strain is the Bacillus subtilis 168 strain.
Any promoter can be used, provided that it allows a gene of interest to be expressed in a host such as Escherichia coli. Examples thereof include Escherichia coli-derived promoters, such as trp promoters, lac promoters, PL promoters, and PR promoters, and phage-derived promoters, such as T7 promoters. Artificially designed and/or modified promoters, such as tac promoters, may also be used.
An expression vector can be introduced by any method, provided that such method is intended to introduce DNA into bacteria. Examples thereof include a method involving the use of calcium ions (Cohen, S. N. et al., Proc. Natl. Acad. Sci., U.S.A., 69: 2110-2114, 1972) and electroporation.
Examples of yeast strains that can be used for host microorganisms include, but are not particularly limited to, Candida yeast strains, such as Candida Shehatae, Pichia yeast strains, such as Pichia stipites, Pachysolen yeast strains, such as Pachysolen tannophilus, Saccharomyces yeast strains, such as Saccharomyces cerevisiae, and Schizosaccharomyces yeast strains, such as Schizosaccharomyces pombe, with Saccharomyces cerevisiae being particularly preferable.
When the expression level of the acyl-CoA reductase is to be enhanced, an adequate promoter with high transcriptional activity is used. Examples of promoters that can be used include, but are not particularly limited to, glyceraldehyde-3-phosphate dehydrogenase gene (TDH3) promoters, 3-phosphoglycerate kinase gene (PGK1) promoters, and hyperosmolarity-responsive 7 gene (HOR7) promoters. Pyruvate decarboxylase gene (PDC1) promoters are particularly preferable because of their high capacity for enhancing the expression level of the target downstream genes. Also, gal1 promoters, gal10 promoters, heat shock protein promoters, MFα1 promoters, PHOS promoters, GAP promoters, ADH promoters, or AOX1 promoters may be used, so that the expression level of the downstream genes can be enhanced.
As methods for introducing the genes described above, any conventional techniques that are known as yeast transformation techniques can be employed. Specific examples include, but are not limited to, the electroporation method (Meth. Enzym., 194, p. 182, 1990), the spheroplast method (Proc. Natl. Acad. Sci., U.S.A., 75, p. 1929, 1978), the lithium acetate method (J. Bacteriology, 153, p. 163, 1983), and methods described in Proc. Natl. Acad. Sci., U.S.A., 75, p. 1929, 1978 and Methods in Yeast Genetics, 2000 Edition: A Cold Spring Harbor Laboratory Course Manual.
The nucleic acid encoding the acyl-CoA reductase is preferably introduced into a microorganism capable of hydrocarbon synthesis with the use of an aldehyde compound as a substrate. In such a case, a recombinant microorganism expressing the acyl-CoA reductase can produce a hydrocarbon from an aldehyde compound with high efficiency. For example, a nucleic acid encoding an enzyme having decarbonylase activity (i.e., a decarbonylase) may be introduced into the microorganism, and a recombinant microorganism capable of hydrocarbon synthesis from an aldehyde compound can then be produced. The recombinant microorganism thus obtained or a microorganism that inherently has decarbonylase activity may be used as a host, the acyl-CoA reductase may be introduced into such host, and hydrocarbon synthesis can then be carried out with very high efficiency.
Enzymes having decarbonylase activity are not particularly limited, and conventional enzymes can be used. For example, WO 2006/109558 discloses a method in which novel microalgae, Pseudochoricystis ellipsoidea, capable of hydrocarbon production or microalgae of Pseudochoricystis or Choricystis capable of hydrocarbon production are cultured and a hydrocarbon is collected from the culture product. A nucleic acid encoding an enzyme having decarbonylase activity can be isolated from such an organism and used. Also, the gene converting an aldehyde into an alkane disclosed in JP 2010-528627 A and the alkane synthase gene or the aldehyde synthase gene derived from Synechococcus elongatus disclosed in JP 2011-520455 A can be used. In addition, a gene encoding a protein involved with aliphatic aldehyde decarbonylase activity derived from Arabidopsis thaliana disclosed in JP H09-322780 A (1997) can be used.
Further, WO 2013/129393 discloses a hydrocarbon synthase gene encoding an enzyme comprising a given motif sequence and having decarbonylase activity. With the use of the hydrocarbon synthase gene disclosed in WO 2013/129393, hydrocarbons as described above can be produced with high efficiency.
A recombinant microorganism that comprises an introduced nucleic acid encoding decarbonylase (e.g., recombinant Escherichia coli or recombinant yeast) would be capable of synthesizing a hydrocarbon from an aldehyde compound in the presence of an aldehyde compound and a coenzyme, such as NADH, through the expression of the decarbonylase.
Examples of hydrocarbons that can be synthesized include a hydrocarbon having a chain structure (i.e., a chain hydrocarbon) and a hydrocarbon having a cyclic structure (i.e., a cyclic hydrocarbon). A chain hydrocarbon may have one or more branches. Examples of branches include alkyl groups, such as methyl, ethyl, propyl, and butyl (including tert-butyl) groups, alkynyl groups, and alkenyl groups. Further examples of branches include chloromethyl, acetyl, 2-pyridyl, hydroxyphenyl, aminoacetyl, methoxy, phenoxy, methylthio, and phenylthio groups. Also, hydrocarbons to be synthesized may be saturated hydrocarbons (alkane) or unsaturated hydrocarbons (alkene and alkyne).
It is preferable that a hydrocarbon to be synthesized have about 5 to 20 carbon atoms, which is liquid at room temperature, although the number of carbon atoms is not limited thereto. A hydrocarbon to be synthesized is preferably a saturated hydrocarbon having 10 to 20 carbon atoms, more preferably 12 to 14 carbon atoms, and most preferably 13 carbon atoms, from the viewpoint of the application thereof for a diesel fuel. Specific examples of hydrocarbons to be synthesized include dodecane having 12 carbon atoms, tridecane having 13 carbon atoms, and tetradecane having 14 carbon atoms.

[Method for Substance Production]

As described above, the recombinant microorganism according to the present invention has excellent activity for synthesizing an aldehyde compound using acyl-CoA as a substrate. With the use of the recombinant microorganism according to the present invention, therefore, at least one compound selected from the group consisting of an aldehyde compound and an alcohol and a hydrocarbon synthesized from an aldehyde compound can be produced.
For example, the recombinant microorganism according to the present invention is cultured in a medium containing a carbon source, such as glucose, fructose, galactose, mannose, xylose, xylulose, ribose, erythrose, threose, erythrulose, glyceraldehyde, dihydroxyacetone, sucrose (saccharose), lactose, maltose, trehalose, or cellobiose. Thus, a target substance, such as the aldehyde compound, alcohol, or hydrocarbon as described above, can be produced.
The recombinant microorganism according to the present invention can also be used for a method for producing a target substance in vitro. For example, the recombinant microorganism according to the present invention is ground, the resulting solution containing the ground microorganism is used, and a target substance can then be synthesized in vitro. Specifically, acyl-CoA (a coenzyme such as NADH, if necessary) is added as a substrate to the solution, and a target substance can then be synthesized in vitro.
A target substance, such as a synthesized hydrocarbon, can be isolated in accordance with a conventional technique. For example, the recombinant yeast is cultured in a medium to produce a hydrocarbon. Since a hydrocarbon is synthesized in a medium, strains are separated from the medium via centrifugation or other means, and the target substance can then be isolated from the supernatant fraction. A hydrocarbon can be isolated from the supernatant fraction by, for example, adding an organic solvent, such as ethyl acetate or methanol, to the supernatant fraction and thoroughly agitating the solution. The aqueous phase is separated from the solvent phase, and a hydrocarbon can be extracted from the solvent phase.

EXAMPLES

Hereafter, the present invention is described in greater detail with reference to examples, although the technical scope of the present invention is not limited to these examples.

Example 1

In this example, an expression vector comprising the aldehyde decarbonylase gene (Gene ID: Npun R1711) derived from Nostoc punctiform and an expression vector comprising a gene encoding a protein comprising the amino acid sequence of SEQ ID NO: 2, which had been isolated from K. pneumoniae subsp. pneumoniae NBRC3321 (this gene is hereafter referred to as the “acyl-CoA reductase gene”), were introduced into Escherichia coli strains, and the alkane productivity of the resulting recombinant Escherichia coli strains was evaluated.
In this example, the full-length sequence of the acyl-CoA reductase gene was determined in the manner described below and the acyl-CoA reductase gene was artificially synthesized based on the determined full-length sequence. At the outset, the K. pneumoniae subsp. pneumoniae NBRC3321 cell extract was fractionated using columns on the basis of aldehyde synthesizing activity as an index, and the acyl-CoA reductase protein was purified. Subsequently, the N-terminal amino acid sequence of the purified protein was determined. Primers were then designed based on the determined N-terminal amino acid sequence, and the full-length sequence of the acyl-CoA reductase gene was determined by PCR using the primers.
More specifically, cells were ultrasonically ground and centrifuged at 20,000×g for 30 minutes. The resulting supernatant was designated to be a cell-free extract. The resulting cell-free extract was subjected to ultracentrifugation at 100,000×g for 60 minutes, and a soluble fraction was obtained as the supernatant. The resulting soluble fraction was subjected to gel filtration column chromatography using Hiload 20/60 Superdex 200 pg, and fractions having activity of an acyl-CoA reductase were collected. Thereafter, the collected fractions were subjected to anion exchange column chromatography using MonoQ 10/100 GL, and fractions having activity of an acyl-CoA reductase were collected. Further, the collected fractions were subjected to gel filtration column chromatography using Superdex 200 10/300, and fractions having activity of an acyl-CoA reductase were collected. When assaying acyl-CoA reductase activity, at the outset, 1 μmol of tetradecanoyl-CoA, 5 μmol of NADH, 5 μmol of NADPH, 10 μmol of 2-mercaptoethanol, 20 μmol of potassium phosphate buffer (pH 8.0), and a crude enzyme solution were mixed, and the mixture was subjected to incubation at 37° C. for 16 hours. Thereafter, tetradecanal contained in the reaction solution was measured using a gas chromatography mass spectrometer (GC/MS) so as to evaluate the acyl-CoA reductase activity of the crude enzyme solution. Protein componenta contained in the crude enzyme solution were developed using SDS-PAGE and then electroblotted on the Sequi-Blot PVDF membrane. Thereafter, the N-terminal amino acid sequence of the enzyme was determined by the automated Edman degradation method using the PPSQ-33A protein sequencer.
Genomic DNA of the K. pneumoniae subsp. pneumoniae NBRC3321 was prepared in the manner described below. Specifically, the cultured cells were collected via centrifugation at 6,500×g for 10 minutes, and genome DNA was extracted using the DNeassy Blood & Tissue Kit (QIAGEN).
The acyl-CoA reductase gene was amplified by PCR using the obtained genome DNA as a template and the resultant was cloned into the pET-21b (+) vector. PCR was carried out using the sets of primers shown in Table 2. The underlined region in the table is the NdeI recognition sequence.

TABLE 2

Primer	Nucleotide sequence	SEQ ID NO:

acrI F	5′-CGCGCCATATGAATCAACAGGAC-3′	SEQ ID NO 12

acrI R	5′-TACGATTCGAAACGCATCCACCAG-3′	SEQ ID NO 13

A PCR solution was composed of 10 ng of genome DNA, 0.2 mM each dNTP, 0.25 mM each primer, and 0.02 units/μl of KOD FX neo DNA polymerase (Toyobo). PCR was carried out at 94° C. for 2 minutes, followed by 30 cycles each consisting of 98° C. for 10 seconds, 68° C. for 1 minute, and 72° C. for 10 minutes. Thereafter, the amplified fragment was processed with NdeI and HindIII, and the resultant was ligated to the pET-21b(+) vector, which had been processed with the same restriction enzymes. The full-length nucleotide sequence of the acyl-CoA reductase gene was determined using the resulting vector.
The aldehyde decarbonylase gene used in this example was artificially synthesized on the basis of the nucleotide sequence information stored in the database. SEQ ID NOs: 14 and 15 show the nucleotide sequence and the amino acid sequence of the aldehyde decarbonylase gene (Gene ID: Npun R1711), respectively.
The acyl-CoA reductase gene isolated in the manner described above was inserted into the NdeI-XhoI site of the pCDFDuet-1 vector (Novagen), and the artificially synthesized aldehyde decarbonylase gene was inserted into the Pst1 site of the pRSFDuet-1 vector (Novagen) (see FIG. 1). When isolating the acyl-CoA reductase gene, the sequence: TACCATGGGCATACATATGGCCATCATAACGGTTCTGGCAAATATTCTGAAATGA GCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAAC AATTTCACACAAGGAGATATACG (SEQ ID NO: 16) comprising the Ndel recognition sequence was added to the 5′ terminus, and the sequence: TAATTAACCTAGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGG CCTCTAAACGGGTCTTGAGGGGTTTTTTGCCCTCGAGTCCGGCCGCATGCGGCCG CAT (SEQ ID NO: 17) comprising the XhoI recognition sequence was added to the 3′ terminus.
Subsequently, the two types of prepared expression vectors were transformed into the E. coli BL21 (DE3) strain. Transformation was carried out by preparing E. coli BL21 (DE3) competent cells with reference to User Protocol TB009 Rev. F0104 (Novagen).
Subsequently, the resulting transformant was subjected to shake culture in 0.5 ml of LB medium, which contains 30 mg/ml streptomycin and 50 mg/ml kanamycin, at 37° C. and 130 rpm overnight. The culture solution was inoculated into 2 ml of M9 medium, which contains 2% glucose, 0.1% yeast extract, 30 mg/ml streptomycin, and 50 mg/ml kanamycin, to an amount of 1% therein by volume, and shake culture was conducted at 37° C. and 130 rpm for about 4 hours (final absorption: OD 600 of 0.4 to 0.6). Isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to the culture solution to a final concentration of 1 mM therein, and culture was conducted at 37° C. and 130 rpm for 3 days.
The culture solution (1 ml) was sampled in a 1.5-ml Eppendorf tube, the bacterial strains were collected using a centrifuge (6,000 rpm, 1 minute, room temperature), and the supernatant was removed. Ethyl acetate (100 ml) was added to the pellets, and a suspension was prepared via vortex for about 1 minute. The resultant was centrifuged at 10,000 rpm for 1 minute at room temperature, and the resulting supernatant was then subjected to GC/MS analysis. The conditions for GC/MS analysis are shown in Table 3.

	TABLE 3

	[GC/MS analysis conditions]
	Column: HP-5MS (Agilent: 19091S-433)
	Inlet temperature: 260° C.
	Detector temperature: 260° C.
	Split ratio: 1/20
	Carrier gas: He 1.0 ml/min
	Oven heating conditions
	60° C., 1 min
	Raised to 260° C. at 50° C./min
	260° C., 1 min

FIG. 2 shows a chart demonstrating the results of GC/MS analysis regarding the recombinant Escherichia coli strains prepared in this example. As shown in FIG. 2, the recombinant Escherichia coli strains prepared in this example were found to be able to produce an alcohol having 14 carbon atoms, an alcohol having 16 carbon atoms, an alkane having 13 carbon atoms, and an alkane having 15 carbon atoms. The results demonstrate that the recombinant Escherichia coli strains prepared in this example had achieved the capacity to produce an aldehyde compound from acyl-CoA upon introduction of the acyl-CoA reductase gene. In other words, the acyl-CoA reductase gene that had been introduced into the recombinant Escherichia coli strains prepared in this example was found to encode acyl-CoA reductases having activity for reducing acyl-CoA to generate an aldehyde compound in the host microorganisms.
All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.

Claims

1. A recombinant microorganism comprising a nucleic acid encoding a protein (a) or (b) below introduced into a host microorganism:

(a) a protein comprising the amino acid sequence of SEQ ID NO: 2; or

(b) a protein comprising an amino acid sequence having 70% or higher identity to the amino acid sequence of SEQ ID NO: 2 and having activity for synthesizing an aldehyde compound from acyl-CoA.

2. The recombinant microorganism according to claim 1, wherein the host microorganism is selected from the group consisting of Escherichia coli, Corynebacterium, and yeast.

3. The recombinant microorganism according to claim 1, which has aldehyde decarbonylase activity for synthesizing a hydrocarbon using an aldehyde as a substrate.

4. The recombinant microorganism according to claim 1, wherein the host microorganism comprises a nucleic acid encoding an aldehyde decarbonylase that synthesizes a hydrocarbon using an aldehyde as a substrate.

5. The recombinant microorganism according to claim 1, which produces a hydrocarbon comprising a carbon chain of 13 to 15 carbon atoms.

6. A method for producing a substance comprising a step of culturing the recombinant microorganism according to claim 1 in a medium containing a carbon source and a step of recovering a target substance from the cultured recombinant microorganism.

7. The method for producing a substance according to claim 6, wherein the target substance is at least one member selected from the group consisting of an aliphatic aldehyde, an aliphatic alcohol, and a hydrocarbon.

8. A method for producing a substance comprising a step of culturing the recombinant microorganism according to claim 2, in a medium containing a carbon source and a step of recovering a target substance from the cultured recombinant microorganism.

9. A method for producing a substance comprising a step of culturing the recombinant microorganism according to claim 3, in a medium containing a carbon source and a step of recovering a target substance from the cultured recombinant microorganism.

10. A method for producing a substance comprising a step of culturing the recombinant microorganism according to claim 4, in a medium containing a carbon source and a step of recovering a target substance from the cultured recombinant microorganism.

11. A method for producing a substance comprising a step of culturing the recombinant microorganism according to claim 5, in a medium containing a carbon source and a step of recovering a target substance from the cultured recombinant microorganism.