US20150322472A1 - Reducing Template Independent Primer Extension and Threshold Time for Loop Mediated Isothermal Amplification - Google Patents

Reducing Template Independent Primer Extension and Threshold Time for Loop Mediated Isothermal Amplification Download PDF

Info

Publication number
US20150322472A1
US20150322472A1 US14/809,635 US201514809635A US2015322472A1 US 20150322472 A1 US20150322472 A1 US 20150322472A1 US 201514809635 A US201514809635 A US 201514809635A US 2015322472 A1 US2015322472 A1 US 2015322472A1
Authority
US
United States
Prior art keywords
seq
ssb
amplification
primers
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/809,635
Inventor
Nathan Tanner
Thomas C. Evans, Jr.
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
New England Biolabs Inc
Original Assignee
New England Biolabs Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by New England Biolabs Inc filed Critical New England Biolabs Inc
Priority to US14/809,635 priority Critical patent/US20150322472A1/en
Assigned to NEW ENGLAND BIOLABS, INC. reassignment NEW ENGLAND BIOLABS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: EVANS, THOMAS C., JR., TANNER, Nathan
Publication of US20150322472A1 publication Critical patent/US20150322472A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction

Definitions

  • Amplification of target nucleic acids is a fundamental method in modern molecular biology and diagnostics. Factors that adversely affect the outcome of amplification reactions include: extension of primers due to non-specific template annealing during amplification, resulting in false positives (Schlötterer and Tautz, Nucleic Acids Research, 20 (2):211-215 (1992); Ogata and Miura, Nucleic Acids Research, 26(20):4657-4661 (1998); Brukner, et al. Analytical Biochemistry, 339:345-347 (2005)); reduced amplification reaction efficiency and rate due to primer or template secondary structure; and variability of amplification due to primer dimer formation.
  • RT room temperature
  • LAMP loop-mediated isothermal amplification
  • a preparation in general in one aspect, includes a SSB; a thermostable polymerase; at least four oligonucleotide primers, and a buffer.
  • the buffer in the preparation has a pH in the range of pH6-pH9, a monovalent salt having a concentration in the range of 0-500 mM, a divalent metal cation having a concentration of 0.5 mM-10 mM and optionally a stabilization agent selected from the group consisting of BSA, glycerol and detergent.
  • the SSB in the preparation is an extreme thermophile single strand binding protein (ET SSB) (New England Biolabs, Ipswich, Mass.).
  • E SSB extreme thermophile single strand binding protein
  • thermostable polymerase in the preparation has strand displacement activity and is active at temperatures of greater than 50° C.
  • the preparation is used in a method for amplifying a nucleic acid, which includes adding to the preparation, dNTPs and template nucleic acid; performing LAMP; and obtaining amplified template DNA.
  • a method for inhibiting primer extension of a primer in an amplification reaction includes: combining a SSB with a thermostable polymerase, at least four primers and a template nucleic acid in a reaction buffer at a first temperature; performing a LAMP reaction at a second temperature which is greater than the first temperature; and determining the inhibition with respect to the same mixture without the SSB.
  • the method includes obtaining an increased rate of LAMP of the template DNA.
  • a method for obtaining an increase in a rate of LAMP includes combining a SSB with a thermostable polymerase, at least four primers and a template nucleic acid in a reaction buffer at a first temperature; and immediately or after a lag time at a temperature above 4° C. but below 70° C., performing a LAMP reaction at a second temperature, wherein the increase is determined with respect to the same mixture without the SSB.
  • the increase in the rate of amplification is measured by time taken to reach threshold amplification is more than 25%.
  • FIGS. 1A-B show the effect on amplification efficiencies when a LAMP reaction mixture (Notomi, et al. (2000)) was tested either immediately after removal of the sample from incubation on ice (solid line); or after a 2 hour pre-incubation of the sample at 25° C. before moving the sample to the 65° C. reaction temperature (dashed line).
  • FIGS. 1A and 1B showed that the reaction time to threshold signal for LAMP increased from 25 minutes for samples subjected to 0 hour pre-incubation at 25° C. to 40 minutes for the samples that had been subjected to a 2 hour pre-incubation at 25° C. for a reaction mixture containing Bst DNA polymerase, large fragment, and primers.
  • FIG. 1A shows results for reactions that contained LAMP primers, where the primers were forward internal primer (FIP), backward internal primer (BIP), forward external primer (F3) and backward external primer (B3). Results are shown for samples that contained Bst DNA polymerase, large fragment (Bst) only; Bst polymerase plus all primers; and Bst polymerase plus all primers plus lambda DNA template (temp). The deleterious effect of pre-incubation at 25° C. was observed for reactions that contained Bst polymerase and primers.
  • FIP forward internal primer
  • F3 forward external primer
  • B3 backward external primer
  • FIG. 1B shows the result of pre-incubation of Bst polymerase with specified LAMP primers (FIP; BIP; F3; B3; FIP+BIP; F3+B3; no primers or all primers) at 25° C. prior to the amplification reaction at 65° C.
  • LAMP primers FIP; BIP; F3; B3; FIP+BIP; F3+B3; no primers or all primers
  • FIGS. 2A-B show capillary electrophoresis (CE) analysis of primer extension reactions that occurred at 25° C.
  • the estimated number of nucleotides based on retention time in the CE is provided on the x-axis and the peak height in relative fluorescence units is given on the y-axis of each electropherogram.
  • Primer extension was measured for individual primers in the presence or absence of an ET SSB.
  • the results show that ET SSB is capable of protecting primers from undesirable extension reactions in the presence of a DNA polymerase, PoID, during LAMP reaction setup (2 hours at 25° C.). Template DNA was not included in the reaction.
  • the observed protection was not primer specific as demonstrated in FIG. 2A , which utilized the BIP primer from the primer set described above and FIG. 2B which utilized a BIP from a different LAMP primer set.
  • the LAMP primers were incubated at 1.6 ⁇ M in reaction buffer as follows, with all reactions performed in 25 ⁇ L volumes:
  • FIG. 2A shows data obtained using a 5′-FAM labeled lambda1 BIP primer from LAMP primer set used in FIGS. 1A-B , 3 , and 4 A-B (5′-6FAM-GAGAGAATTTGTACCACCTCCCACCGGGCACATAGCAGTCCTAGGGACAGT, IDT) (SEQ ID NO:1).
  • FIG. 2B shows data obtained using a 5′-FAM labeled lambda 2 BIP primer from a different set of LAMP primers (5′-6FAM -3′) CAGGACGCTGTGGCATTGCAGATCATAGGTAAAGCGCCACGC (SEQ ID NO:2).
  • FIG. 3 shows the results of an assay for determining optimal amounts of ET SSB (1-3 ⁇ g) in the reaction mixture.
  • a single sample was divided into two aliquots. One aliquot was amplified immediately after removal from setup on ice (solid line). The second aliquot was amplified after the sample was pre-incubated at RT (25° C.) for 2 hours (dashed line). An increase in the rate of the amplification reaction as measured by a reduction in threshold time was observed, with the greatest stimulation observed above 1 ⁇ g ET SSB (reactions performed in 25 A volume). The lag time between immediate (solid) and 2 hour incubated (dashed) samples also decreased, with an approximately 100% (20 minutes) delay observed without ET SSB, but no delay observed with 2 ⁇ g ET SSB. This demonstrates that ET SSB added to primers during the pre-incubation at RT enhanced amplification rates.
  • FIGS. 4A-B show the beneficial effect of ET SSB on threshold time for amplification and protection of primers from non-template extension.
  • FIG. 4A shows percent stimulation in threshold time for LAMP of target DNA when 0-3 ⁇ g ET SSB was added to primers prior to amplification (no incubation time). Concentrations of 1.5-3.0 ⁇ g ET SSB added to 25 ⁇ L reactions resulted in greater than 50% stimulation of amplification as measured by decreasing time to amplification threshold.
  • FIG. 4B shows the effect of 0-3 ⁇ g ET SSB on protection of primers from non-template extension due to pre-incubation at RT prior to performing LAMP reactions. 100% protection of the primers was achieved by use of 1-3 ⁇ g ET SSB added to 25 ⁇ L reactions. Protection was measured by difference between threshold times of the sample with no pre-incubation and the sample pre-incubated at RT for 2 hours, with no threshold time delay defined as 100% protection.
  • a stimulation of amplification reaction efficiency can decrease time to reach a defined threshold level of amplification, minimizing required reaction and diagnostic times.
  • the beneficial effect of SSBs is observed when the time to reach the defined threshold is decreased.
  • An increase in the rate of LAMP has been identified when SSBs are added to a buffer in which the reaction is subsequently performed. The increase in rate is measured by the time required to achieve a threshold yield of amplicon.
  • the observed increase is at least 50% when SSB is added to a polymerase primer mix at, for example, one to two molar equivalents of the DNA primers or for example 0.5-10 ⁇ g, 1.0-5 ⁇ g or 1.5-3.0 ⁇ g of SSB.
  • Threshold times may be based on sufficient amplification to produce a detectable signal, for example, a fluorescent signal with an intercalating dye on a real time fluorimeter in the range of 100-500,000 RFU, preferably at least 1000 RFU.
  • turbidity methods can be used where threshold is defined as dT/dt greater than 0.1.
  • protection from non-template primer extension is also provided by the SSB. While the protection from non-template primer extension is not primer dependent and is observed for primers regardless of sequence, some variation in the extent of protection may occur. However, in all cases, the benefit is significant.
  • the protection can range from 25% to 100% where 100% protection is equivalent to the optimal efficiency of amplification when a sample is removed from a 4° C. environment and immediately amplified without any RT incubation and 0% is the protection against non-template primer extension afforded after a pre-incubation of primers with polymerase for 2 hours at 25° C. in the absence of SSB (see FIGS. 2A-B and 4 A-B).
  • Protection can be achieved when an SSB is added to a polymerase primer mix at, for example, one to two molar equivalents of the DNA primers or for example 0.5-10 ⁇ g, 1.0-5 ⁇ g or 1.5-3.0 ⁇ g of SSB in a 25-50 ⁇ l reaction.
  • the addition of SSB protects against the negative consequences of RT setup of amplification reactions prior to raising the temperature to initiate amplification as the SSB prevents primer extension to an extent of at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%.
  • the pre-incubation time although exemplified as 2 hours at RT could be as little as 5 minutes or as much as 24 hours.
  • the pre-incubation temperature although exemplified by 25° C. is intended to include any temperature greater than 4° C. and less than 50° C.
  • the present methods and compositions can be used for a hot start amplification in which any non-template primer extension is blocked at RT in the presence of SSB prior to raising the temperature to 50° C-70° C. in an isothermal reaction such as LAMP.
  • SSBs examples include: bacterial SSBs (e.g. E. coli SSB) and phage SSBs (T4 gp32, T7 gp2.5) (Hamdan and Richardson, Annual Review of Biochemistry, 78:205-243 (2009)).
  • SSBs from eukaryotic organisms e.g. RPA
  • RPA eukaryotic organisms
  • ET SSB is a 16 kDa single-stranded DNA binding protein which is fully active after 60 minutes at 95° C. and can destabilize secondary structure, and improve DNA polymerase activity (Richard, et al. Nucleic Acids Research, 32 (3):1065-1074, (2004)).
  • the ET SSB can be used for hot start amplification and for PCR, RT-PCR, HDA, RCA, sequencing, and isothermal amplification reactions.
  • Thermostable polymerases for use in LAMP include PoID; Bst DNA polymerase large fragment; or mutants thereof; or WarmStart® Bst 2.0 DNA polymerase (New England Biolabs, Ipswich, Mass.) (Notomi et al. (2000); Tanner, et al., BioTechniques, 53:81-89, (2012)).
  • LAMP reactions were performed at 65° C. either immediately or with indicated components incubated for 2 hours at 25° C. Reactions were performed in 25 ⁇ L volumes and consisted of 8U Bst DNA Polymerase (New England Biolabs, Ipswich, Mass.), 5 ng ⁇ DNA (New England Biolabs, Ipswich, MA), and LAMP primers used together or separately as shown in FIG. 1A and 1B .
  • the primers (Integrated DNA Technologies, Coralville, Iowa) were added to an amplification buffer (20 mM Tris, 10 mM KCl, 10 mM (NH 4 ) 2 SO 4 , 2 mM MgSO 4 , pH 8.8 25° C.) (New England Biolabs, Ipswich, Mass.) and supplemented with additional 6 mM MgSO 4 , 0.01% Tween-20 and 1.4 mM dNTPs.
  • FIGS. 1A-B The results are shown in FIGS. 1A-B .
  • a lag time of about 15 minutes to reach threshold levels of amplification was calculated in the sample subjected to 2 hour pre-incubation before LAMP reached the threshold value. This decrease in efficiency occurred only when the reaction was incubated in the presence of primers and DNA polymerase, indicating unwanted activity of DNA polymerase on primers at RT.
  • FIGS. 2A-B shows that the unmodified primer (i) becomes extended in length when a polymerase is added over the indicated pre-incubation period (ii). This corresponds to the extension products of the fluorescently-labeled primer due to DNA polymerase activity. These extension peaks became diminished in the presence of the increasing amounts of SSB (iii and iv), indicating inhibition of extension of primer in the absence of template.
  • FIG. 2A shows data obtained using a 5′-FAM labeled lambda BIP primer (from primer set 1, see Example 1) and
  • FIG. 2B shows data obtained using a 5′-FAM labeled lambda BIP primer (from set 2), demonstrating that non-template primer extension and SSB protection are not limited to a specific primer sequence.
  • LAMP reactions were set up using 1.6 ⁇ M FIP and BIP, and 0.2 ⁇ M F3 and B3 plus 5 ng ⁇ DNA in a buffer containing 20 mM Tris, 10 mM KCl, 10 mM (NH 4 ) 2 SO 4 , 2 mM MgSO 4 , pH 8.8 25° C. supplemented with additional 6 mM MgSO 4 , 0.01% Tween-20 and 1.4 mM dNTPs. Reactions were all 25 ⁇ L, contained 10U Polymerase D, and were incubated at 65° C.
  • Threshold time was defined by fluorescence measurement in Bio-Rad CFX96TM (Bio-Rad, Hercules, Calif.) due to presence of 2 ⁇ M SYTO-9® intercalating dye (Life Technologies, Grand Island, N.Y.). The resulting amplification threshold times are shown in FIG. 3 . The results are shown in FIGS. 3 and 4 A-B.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Compositions and methods are provided for loop mediated isothermal amplification in which single stranded binding proteins are shown to protect primers from non-specific extension and to stimulate the rate of threshold amplification.

Description

    CROSS REFEREENCE
  • This application is a divisional of U.S. application Ser. No. 13/671,123 filed Nov. 7, 2012 which claims right of priority to U.S. Provisional Application No. 61/560,518 filed Nov. 16, 2011.
  • BACKGROUND
  • Amplification of target nucleic acids is a fundamental method in modern molecular biology and diagnostics. Factors that adversely affect the outcome of amplification reactions include: extension of primers due to non-specific template annealing during amplification, resulting in false positives (Schlötterer and Tautz, Nucleic Acids Research, 20 (2):211-215 (1992); Ogata and Miura, Nucleic Acids Research, 26(20):4657-4661 (1998); Brukner, et al. Analytical Biochemistry, 339:345-347 (2005)); reduced amplification reaction efficiency and rate due to primer or template secondary structure; and variability of amplification due to primer dimer formation. The effects of these factors are enhanced by room temperature (RT) incubation of complete reaction mixtures prior to placement at specified reaction temperature. This would occur, for example, when large numbers of samples are prepared at one time necessitating a certain amount of sample incubation at RT. Therefore, high-throughput and diagnostic applications are often negatively impacted by reaction set-up at RT. This is a significant issue for molecular diagnostic applications, which, demands a high level of consistency and accuracy.
  • Various amplification methods are currently utilized in molecular diagnostics. A popular isothermal amplification diagnostic method is loop-mediated isothermal amplification (LAMP) (Notomi, et al. Nucleic Acids Research, 28(12):e63 (2000)). Typically, LAMP employs a DNA polymerase and a set of four to six synthetic primers that recognize a total of six distinct sequences on the target DNA. Recognizing six distinct sequences makes LAMP extremely specific for a target sequence. Despite the specificity of LAMP, it is adversely affected by unwanted, non-specific primer extension reactions during reaction set-up at RT.
  • SUMMARY
  • In general in one aspect, a preparation includes a SSB; a thermostable polymerase; at least four oligonucleotide primers, and a buffer.
  • In another aspect, the buffer in the preparation has a pH in the range of pH6-pH9, a monovalent salt having a concentration in the range of 0-500 mM, a divalent metal cation having a concentration of 0.5 mM-10 mM and optionally a stabilization agent selected from the group consisting of BSA, glycerol and detergent.
  • In another aspect, the SSB in the preparation is an extreme thermophile single strand binding protein (ET SSB) (New England Biolabs, Ipswich, Mass.).
  • In another aspect, the thermostable polymerase in the preparation has strand displacement activity and is active at temperatures of greater than 50° C.
  • In another aspect, the preparation is used in a method for amplifying a nucleic acid, which includes adding to the preparation, dNTPs and template nucleic acid; performing LAMP; and obtaining amplified template DNA.
  • In general in one aspect, a method for inhibiting primer extension of a primer in an amplification reaction, includes: combining a SSB with a thermostable polymerase, at least four primers and a template nucleic acid in a reaction buffer at a first temperature; performing a LAMP reaction at a second temperature which is greater than the first temperature; and determining the inhibition with respect to the same mixture without the SSB.
  • In another aspect, the method includes obtaining an increased rate of LAMP of the template DNA.
  • In general in one aspect, a method for obtaining an increase in a rate of LAMP, includes combining a SSB with a thermostable polymerase, at least four primers and a template nucleic acid in a reaction buffer at a first temperature; and immediately or after a lag time at a temperature above 4° C. but below 70° C., performing a LAMP reaction at a second temperature, wherein the increase is determined with respect to the same mixture without the SSB.
  • In another aspect, the increase in the rate of amplification is measured by time taken to reach threshold amplification is more than 25%.
  • BRIEF DESCRIPTION OF THE FIGURES
  • FIGS. 1A-B show the effect on amplification efficiencies when a LAMP reaction mixture (Notomi, et al. (2000)) was tested either immediately after removal of the sample from incubation on ice (solid line); or after a 2 hour pre-incubation of the sample at 25° C. before moving the sample to the 65° C. reaction temperature (dashed line).
  • After the pre-incubation, LAMP amplification was performed and the threshold time required to produce a threshold amount of fluorescent signal from a DNA intercalating dye was determined (see also Examples 1 and 2).
  • The results in FIGS. 1A and 1B showed that the reaction time to threshold signal for LAMP increased from 25 minutes for samples subjected to 0 hour pre-incubation at 25° C. to 40 minutes for the samples that had been subjected to a 2 hour pre-incubation at 25° C. for a reaction mixture containing Bst DNA polymerase, large fragment, and primers.
  • FIG. 1A shows results for reactions that contained LAMP primers, where the primers were forward internal primer (FIP), backward internal primer (BIP), forward external primer (F3) and backward external primer (B3). Results are shown for samples that contained Bst DNA polymerase, large fragment (Bst) only; Bst polymerase plus all primers; and Bst polymerase plus all primers plus lambda DNA template (temp). The deleterious effect of pre-incubation at 25° C. was observed for reactions that contained Bst polymerase and primers.
  • FIG. 1B shows the result of pre-incubation of Bst polymerase with specified LAMP primers (FIP; BIP; F3; B3; FIP+BIP; F3+B3; no primers or all primers) at 25° C. prior to the amplification reaction at 65° C. The deleterious effect of pre-incubation at 25° C. was observed for reactions that contained Bst polymerase and primers
  • FIGS. 2A-B show capillary electrophoresis (CE) analysis of primer extension reactions that occurred at 25° C. The estimated number of nucleotides based on retention time in the CE is provided on the x-axis and the peak height in relative fluorescence units is given on the y-axis of each electropherogram. Primer extension was measured for individual primers in the presence or absence of an ET SSB. The results show that ET SSB is capable of protecting primers from undesirable extension reactions in the presence of a DNA polymerase, PoID, during LAMP reaction setup (2 hours at 25° C.). Template DNA was not included in the reaction. The observed protection was not primer specific as demonstrated in FIG. 2A, which utilized the BIP primer from the primer set described above and FIG. 2B which utilized a BIP from a different LAMP primer set.
  • The LAMP primers were incubated at 1.6 μM in reaction buffer as follows, with all reactions performed in 25 μL volumes:
      • (i) BIP primer, buffer, 2 hour incubation at 25° C. no ET SSB.
      • (ii) BIP primer, 10U PoID polymerase, buffer, 2 hour incubation at 25° C., no ET SSB.
      • (iii) BIP primer, 10U PoID polymerase, buffer, 2 hour incubation at 25° C., 1 μg ET SSB.
      • (iv) BIP primer, 10U PoID polymerase, buffer, 2 hour incubation at 25° C., 2 μg ET SSB.
  • Subsequent to pre-incubation, the 1.6 μM samples were diluted to 5 nM and analyzed using CE. A CE peak can be seen in (i) indicating the unmodified primer, which in (ii) runs significantly larger, corresponding to the extension products of the fluorescently-labeled primer due to DNA polymerase activity. These extension peaks became diminished in the presence of the increasing amounts of SSB (iii and iv), indicating inhibition of extension of the primers at RT.
  • FIG. 2A shows data obtained using a 5′-FAM labeled lambda1 BIP primer from LAMP primer set used in FIGS. 1A-B, 3, and 4A-B (5′-6FAM-GAGAGAATTTGTACCACCTCCCACCGGGCACATAGCAGTCCTAGGGACAGT, IDT) (SEQ ID NO:1).
  • FIG. 2B shows data obtained using a 5′-FAM labeled lambda 2 BIP primer from a different set of LAMP primers (5′-6FAM -3′) CAGGACGCTGTGGCATTGCAGATCATAGGTAAAGCGCCACGC (SEQ ID NO:2).
  • FIG. 3 shows the results of an assay for determining optimal amounts of ET SSB (1-3 μg) in the reaction mixture.
  • A single sample was divided into two aliquots. One aliquot was amplified immediately after removal from setup on ice (solid line). The second aliquot was amplified after the sample was pre-incubated at RT (25° C.) for 2 hours (dashed line). An increase in the rate of the amplification reaction as measured by a reduction in threshold time was observed, with the greatest stimulation observed above 1 μg ET SSB (reactions performed in 25 A volume). The lag time between immediate (solid) and 2 hour incubated (dashed) samples also decreased, with an approximately 100% (20 minutes) delay observed without ET SSB, but no delay observed with 2 μg ET SSB. This demonstrates that ET SSB added to primers during the pre-incubation at RT enhanced amplification rates.
  • FIGS. 4A-B show the beneficial effect of ET SSB on threshold time for amplification and protection of primers from non-template extension.
  • FIG. 4A shows percent stimulation in threshold time for LAMP of target DNA when 0-3 μg ET SSB was added to primers prior to amplification (no incubation time). Concentrations of 1.5-3.0 μg ET SSB added to 25 μL reactions resulted in greater than 50% stimulation of amplification as measured by decreasing time to amplification threshold.
  • FIG. 4B shows the effect of 0-3 μg ET SSB on protection of primers from non-template extension due to pre-incubation at RT prior to performing LAMP reactions. 100% protection of the primers was achieved by use of 1-3 μg ET SSB added to 25 μL reactions. Protection was measured by difference between threshold times of the sample with no pre-incubation and the sample pre-incubated at RT for 2 hours, with no threshold time delay defined as 100% protection.
  • DESCRIPTION OF EMBODIMENTS
  • The problem of variability that arises from sample handling prior to amplification has been solved by the compositions and methods described herein. Primers combined with SSB that are allowed to stand at RT in the presence of polymerase are protected from undesired DNA polymerase dependent replication or extension in the absence of template DNA otherwise observed at temperatures lower than the amplification reaction temperature. This protection is not primer sequence dependent. The protective effect of SSBs results in one or more of the following benefits: reduced variability in threshold times for amplification, shorter times to reach threshold amplification and reduced lag time before amplification is initiated.
  • Generally, a stimulation of amplification reaction efficiency can decrease time to reach a defined threshold level of amplification, minimizing required reaction and diagnostic times. The beneficial effect of SSBs is observed when the time to reach the defined threshold is decreased. An increase in the rate of LAMP has been identified when SSBs are added to a buffer in which the reaction is subsequently performed. The increase in rate is measured by the time required to achieve a threshold yield of amplicon. The observed increase is at least 50% when SSB is added to a polymerase primer mix at, for example, one to two molar equivalents of the DNA primers or for example 0.5-10 μg, 1.0-5 μg or 1.5-3.0 μg of SSB.
  • Threshold times may be based on sufficient amplification to produce a detectable signal, for example, a fluorescent signal with an intercalating dye on a real time fluorimeter in the range of 100-500,000 RFU, preferably at least 1000 RFU. Alternatively, turbidity methods can be used where threshold is defined as dT/dt greater than 0.1.
  • In addition to stimulation of reaction time efficiency, protection from non-template primer extension is also provided by the SSB. While the protection from non-template primer extension is not primer dependent and is observed for primers regardless of sequence, some variation in the extent of protection may occur. However, in all cases, the benefit is significant. The protection can range from 25% to 100% where 100% protection is equivalent to the optimal efficiency of amplification when a sample is removed from a 4° C. environment and immediately amplified without any RT incubation and 0% is the protection against non-template primer extension afforded after a pre-incubation of primers with polymerase for 2 hours at 25° C. in the absence of SSB (see FIGS. 2A-B and 4A-B).
  • Protection can be achieved when an SSB is added to a polymerase primer mix at, for example, one to two molar equivalents of the DNA primers or for example 0.5-10 μg, 1.0-5 μg or 1.5-3.0 μg of SSB in a 25-50 μl reaction.
  • The addition of SSB protects against the negative consequences of RT setup of amplification reactions prior to raising the temperature to initiate amplification as the SSB prevents primer extension to an extent of at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%. The pre-incubation time although exemplified as 2 hours at RT could be as little as 5 minutes or as much as 24 hours. The pre-incubation temperature although exemplified by 25° C. is intended to include any temperature greater than 4° C. and less than 50° C.
  • The present methods and compositions can be used for a hot start amplification in which any non-template primer extension is blocked at RT in the presence of SSB prior to raising the temperature to 50° C-70° C. in an isothermal reaction such as LAMP.
  • As described above, the protection of primers from extension by SSB under these conditions gives rise to stimulation of amplification efficiency and reduced variability in amplification reactions and enhances reaction performance.
  • Examples of SSBs known in the art that may be used in the present methods include: bacterial SSBs (e.g. E. coli SSB) and phage SSBs (T4 gp32, T7 gp2.5) (Hamdan and Richardson, Annual Review of Biochemistry, 78:205-243 (2009)). SSBs from eukaryotic organisms (e.g. RPA) have similar mechanisms of action and interaction in DNA replication and repair processes (Richard, et al. Critical Reviews in Biochemistry and Molecular Biology, 44 (2-3):98-116, (2009)) and may be used herein. While a thermostable SSB is exemplified here, this is not intended to be limiting.
  • ET SSB is a 16 kDa single-stranded DNA binding protein which is fully active after 60 minutes at 95° C. and can destabilize secondary structure, and improve DNA polymerase activity (Richard, et al. Nucleic Acids Research, 32 (3):1065-1074, (2004)). The ET SSB can be used for hot start amplification and for PCR, RT-PCR, HDA, RCA, sequencing, and isothermal amplification reactions.
  • Thermostable polymerases for use in LAMP include PoID; Bst DNA polymerase large fragment; or mutants thereof; or WarmStart® Bst 2.0 DNA polymerase (New England Biolabs, Ipswich, Mass.) (Notomi et al. (2000); Tanner, et al., BioTechniques, 53:81-89, (2012)).
  • TABLE 1
    Examples of oligonucleotides (LAMP primers) showing
    similar protection and threshold stimulation to that shown
    in Figures 3, 4A and 4B for SEQ ID NOs: 1 and 2.
    Target Primer Sequence
    lambda 1 FIP CAGCCAGCCGCAGCACGTTCGCTCATAGGAGATATGGTAGAGCCGC
    (SEQ ID NO: 3)
    BIP GAGAGAATTTGTACCACCTCCCACCGGGCACATAGCAGTCCTAGGGACAGT
    (SEQ ID NO: 1)
    F3 GGCTTGGCTCTGCTAACACGTT (SEQ ID NO: 4)
    B3 GGACGTTTGTAATGTCCGCTCC (SEQ ID NO: 5)
    Loop F CTGCATACGACGTGTCT (SEQ ID NO: 6)
    Loop B ACCATCTATGACTGTACGCC (SEQ ID NO: 7)
    lambda 2 FIP AGGCCAAGCTGCTTGCGGTAGCCGGACGCTACCAGCTTCT
    (SEQ ID NO: 8)
    BIP CAGGACGCTGTGGCATTGCAGATCATAGGTAAAGCGCCACGC
    (SEQ ID NO: 2)
    F3 AAAACTCAAATCAACAGGCG (SEQ ID NO: 9)
    B3 GACGGATATCACCACGATCA (SEQ ID NO: 10)
    Loop F GCATCCCACCAACGGGAA (SEQ ID NO: 11)
    Loop B CAGATTAAGGA (SEQ ID NO: 12)
    lambda C FIP CGAACTGTTTCGGGATTGCATTCTGGAACTCCAACCATCGCA
    (SEQ ID NO: 13)
    BIP GGAGCCTGCATAACGGTTTCGTCGACTCAATGCTCTTACCTGT
    (SEQ ID NO: 14)
    F3 GTTGGTCACTTCGACGTATCG (SEQ ID NO: 15)
    B3 GCTCGCCGACTCTTCACGAT (SEQ ID NO: 16)
    Loop F TTTGCAGACCTCTCTGCC (SEQ ID NO: 17)
    Loop B GGATTTTTTATATCTGCACA (SEQ ID NO: 18)
    E. coli dnaE FIP CTGCCCCGACGATAGGCTTAATCGTGGTCTGGTGAAGTTCTACGG
    (SEQ ID NO: 19)
    BIP TCCAGTGCGACCTGCTGGGTGGGTATTGTTCGCCGCCAGTAC
    (SEQ ID NO: 20)
    F3 GATCACCGATTTCACCAACC (SEQ ID NO: 21)
    B3 CTTTTGAGATCAGCAACGTCAG (SEQ ID NO: 22)
    Loop F TGCGCCATGTCCCGCT (SEQ ID NO: 23)
    Loop B TGAGTTAACCCACCTGACG (SEQ ID NO: 24)
    C. elegans FIP TGTTAAGGCGGACTGTGTTCGTCAAACCGCAACGAGACAGTCT
    lec-6 (SEQ ID NO: 25)
    BIP CCGAGATAATTCCACCGTTGGATCCATTCCAGCAGAACAAGAT
    (SEQ ID NO: 26)
    F3 GATGTCACGAAAAATTCCCTC (SEQ ID NO: 27)
    B3 GCAATCCGAGGATCGTCAC (SEQ ID NO: 28)
    Loop F TGCAAAGCACGTGGTGCC (SEQ ID NO: 29)
    Loop B ACACAAACTCCAGAGTGTAG (SEQ ID NO: 30)
    C. elegans FIP CTCTGTGAACGGTCATCACCTCGATGGCTTGAACCGATTGGTATGG
    lec-10a (SEQ ID NO: 31)
    BIP CTTACATGGTAATATCCAGCGTGCCACTTCACCACTCGGAGCAC
    (SEQ ID NO: 32)
    F3 GAACGTCTCCCTTCAATCC (SEQ ID NO: 33)
    B3 GGACCAGAAATCCGTCACA (SEQ ID NO: 34)
    Loop F CCGACTACCCACATCGTTAC (SEQ ID NO: 35)
    Loop B ACCTTGATGCTAAGGTGGAA (SEQ ID NO: 36)
    C. elegans FIP GATTCCACTTCCAACGTCGTTG-CATAGGCATTGTATCCAGAGTG
    lec-10b (SEQ ID NO: 37)
    BIP CGAAGTGAACCTTGTCAACATGAGACTACCCACATCGTTACC
    (SEQ ID NO: 38)
    F3 AGCAACATAGGTTTCAGTTC (SEQ ID NO: 39)
    B3 CTGTGAACGGTCATCACC (SEQ ID NO: 40)
    Loop F ACGGACATGTCGATCATGGA (SEQ ID NO: 41)
    Loop B CGTCTCCCTTCAATCCGATGGC (SEQ ID NO: 42)
    pUC19 AmpR FIP ATGGGGGATCATGTAACTCGCCTCGTCGTTTGGTATGGCTTC
    (SEQ ID NO: 43)
    BIP AAGCGGTTAGCTCCTTCGGTCTGCTGCCATAACCATGAGTG
    (SEQ ID NO: 44)
    F3 CTACAGGCATCGTGGTGTC (SEQ ID NO: 45)
    B3 CTTACGGATGGCATGACAGT (SEQ ID NO: 46)
    Loop F TGGGAACCGGAGCTGAAT (SEQ ID NO: 47)
    Loop B TCCGATCGTTGTCAGAAGTAAGTTG (SEQ ID NO: 48)
    Human CFTR FIP CCAAAGAGTAAAGTCCTTCTCTCTCGAGAGACTGTTGGCCCTTGAAGG
    (SEQ ID NO: 49)
    BIP GTGTTGATGTTATCCACCTTTTGTGGACTAGGAAAACAGATCAATAG
    (SEQ ID NO: 50)
    F3 TAATCCTGGAACTCCGGTGC (SEQ ID NO: 51)
    B3 TTTATGCCAATTAACATTTTGAC (SEQ ID NO: 52)
    Loop F ATCCACAGGGAGGAGCTCT (SEQ ID NO: 53)
    Loop B CTCCACCTATAAAATCGGC (SEQ ID NO: 54)
    Human FIP GGGCGTGGTAGCGCAGACCAGTCAAGTGATCCTCCTGCCTCAG
    BRCA-1 (SEQ ID NO: 55)
    BIP GAGGTTTCCCTATGTTGCCCAGGCCCAAAGTTCAAGGATCACTTGG
    (SEQ ID NO: 56)
    F3 CAGCCTCAACCTCCTGGGC (SEQ ID NO: 57)
    B3 TAATCCCAGCATTTTGGGAG (SEQ ID NO: 58)
    Loop F GGTCCCAGCTATTTGGAAGG (SEQ ID NO: 59)
    Loop B TGGTCTTGAACTTCTGGGC (SEQ ID NO: 60)
  • All references cited herein, as well as U.S. application Ser. No. 13/671,123 filed Nov. 7, 2012 and U.S. Provisional Application Ser. No. 61/560,518 filed Nov. 16, 2011, are hereby incorporated by reference.
  • EXAMPLES Example 1 Determination of the Difference in Time to Reach Threshold Amplification Levels for Samples Pre-Incubated at RT Prior to Amplification with LAMP Primers in the Absence of SSB Compared with Samples that are Amplified without Pre-Incubation
  • LAMP reactions were performed at 65° C. either immediately or with indicated components incubated for 2 hours at 25° C. Reactions were performed in 25 μL volumes and consisted of 8U Bst DNA Polymerase (New England Biolabs, Ipswich, Mass.), 5 ng λ DNA (New England Biolabs, Ipswich, MA), and LAMP primers used together or separately as shown in FIG. 1A and 1B.
  • Primers:
    (1.6 μM FIP
    5'-CAGCCAGCCGCAGCACGTTCGCTCATAGGAGATATGGTAGAGCCGC
    (SEQ ID NO: 3);
    1.6 μM BIP
    5'GAGAGAATTTGTACCACCTCCCACCGGGCACATAGCAGTCCTAGGGA
    CAGT (SEQ ID NO: 1);
    0.2 μM F3
    5'-GGCTTGGCTCTGCTAACACGTT (SEQ ID NO: 4);
    and
    0.2 μM B3
    5'-GGACGTTTGTAATGTCCGCTCC. (SEQ ID NO: 5))
  • The primers (Integrated DNA Technologies, Coralville, Iowa) were added to an amplification buffer (20 mM Tris, 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, pH 8.8 25° C.) (New England Biolabs, Ipswich, Mass.) and supplemented with additional 6 mM MgSO4, 0.01% Tween-20 and 1.4 mM dNTPs.
  • The results are shown in FIGS. 1A-B.
  • A lag time of about 15 minutes to reach threshold levels of amplification was calculated in the sample subjected to 2 hour pre-incubation before LAMP reached the threshold value. This decrease in efficiency occurred only when the reaction was incubated in the presence of primers and DNA polymerase, indicating unwanted activity of DNA polymerase on primers at RT.
  • Example 2 Protection of Primers Using SSB from Non-Templated Extension by DNA Polymerase
  • Single LAMP primers with 5′-conjugated fluorophores were incubated at RT for 2 hours under various conditions to demonstrate non-template addition by DNA polymerase and inhibition of this extension by SSB. The primers were incubated at 1.6 μM in amplification buffer as follows, with all reactions performed in 25 μL volumes:
      • (i) BIP primer (from set 1 or 2), amplification buffer, 2 hour incubation at 25° C. no ET SSB.
      • (ii) BIP primer, 10U PoID polymerase, amplification buffer, 2 hour incubation at 25° C., no ET SSB.
      • (iii) BIP primer, 10U PoID polymerase, amplification buffer, 2 hour incubation at 25° C., 1 μg ET SSB.
      • (iv) BIP primer, 10U PoID polymerase, amplification buffer, 2 hour incubation at 25° C., 2 μg ET SSB.
  • Subsequent to pre-incubation, the primers were diluted to 5nM and analyzed using CE (FIGS. 2A-B). FIGS. 2A-B shows that the unmodified primer (i) becomes extended in length when a polymerase is added over the indicated pre-incubation period (ii). This corresponds to the extension products of the fluorescently-labeled primer due to DNA polymerase activity. These extension peaks became diminished in the presence of the increasing amounts of SSB (iii and iv), indicating inhibition of extension of primer in the absence of template. FIG. 2A shows data obtained using a 5′-FAM labeled lambda BIP primer (from primer set 1, see Example 1) and FIG. 2B shows data obtained using a 5′-FAM labeled lambda BIP primer (from set 2), demonstrating that non-template primer extension and SSB protection are not limited to a specific primer sequence.
  • Example 3 Determining Optimum Amount of ET SSB for Stimulating Amplification Rate and Protection from Non-Templated Primer Extension
  • LAMP reactions were set up using 1.6 μM FIP and BIP, and 0.2 μM F3 and B3 plus 5 ng λ DNA in a buffer containing 20 mM Tris, 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, pH 8.8 25° C. supplemented with additional 6 mM MgSO4, 0.01% Tween-20 and 1.4 mM dNTPs. Reactions were all 25 μL, contained 10U Polymerase D, and were incubated at 65° C. Threshold time was defined by fluorescence measurement in Bio-Rad CFX96™ (Bio-Rad, Hercules, Calif.) due to presence of 2 μM SYTO-9® intercalating dye (Life Technologies, Grand Island, N.Y.). The resulting amplification threshold times are shown in FIG. 3. The results are shown in FIGS. 3 and 4A-B.

Claims (7)

What is claimed is:
1. A preparation, comprising: a single stranded binding protein (SSB); a thermostable polymerase; at least four oligonucleotide primers, and a buffer.
2. A preparation according to claim 1, wherein the buffer has a pH in the range of pH6-pH9, and optionally a stabilization agent selected from the group consisting of BSA, glycerol and detergent.
3. A preparation according to claim 1 wherein the buffer comprises a monovalent salt having a concentration in the range of 0-500 mM.
4. A preparation according to claim 1 wherein the buffer comprises a divalent metal cation having a concentration of 0.5 mM-10 mM.
5. A preparation according to claim 1, wherein the buffer has a pH in the range of pH6-pH9, a monovalent salt having a concentration in the range of 0-500 mM, a divalent metal cation having a concentration of 0.5 mM-10 mM and optionally a stabilization agent selected from the group consisting of BSA, glycerol and detergent.
6. A preparation according to claim 1, wherein the SSB is an extreme thermophile single strand binding protein (ET SSB).
7. A preparation according to claim 1, wherein the thermostable polymerase has strand displacement activity and is active at temperatures of greater than 50° C.
US14/809,635 2011-11-16 2015-07-27 Reducing Template Independent Primer Extension and Threshold Time for Loop Mediated Isothermal Amplification Abandoned US20150322472A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/809,635 US20150322472A1 (en) 2011-11-16 2015-07-27 Reducing Template Independent Primer Extension and Threshold Time for Loop Mediated Isothermal Amplification

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201161560518P 2011-11-16 2011-11-16
US13/671,123 US9121046B2 (en) 2011-11-16 2012-11-07 Reducing template independent primer extension and threshold time for loop mediated isothermal amplification
US14/809,635 US20150322472A1 (en) 2011-11-16 2015-07-27 Reducing Template Independent Primer Extension and Threshold Time for Loop Mediated Isothermal Amplification

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US13/671,123 Division US9121046B2 (en) 2011-11-16 2012-11-07 Reducing template independent primer extension and threshold time for loop mediated isothermal amplification

Publications (1)

Publication Number Publication Date
US20150322472A1 true US20150322472A1 (en) 2015-11-12

Family

ID=48281014

Family Applications (2)

Application Number Title Priority Date Filing Date
US13/671,123 Active 2033-07-13 US9121046B2 (en) 2011-11-16 2012-11-07 Reducing template independent primer extension and threshold time for loop mediated isothermal amplification
US14/809,635 Abandoned US20150322472A1 (en) 2011-11-16 2015-07-27 Reducing Template Independent Primer Extension and Threshold Time for Loop Mediated Isothermal Amplification

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US13/671,123 Active 2033-07-13 US9121046B2 (en) 2011-11-16 2012-11-07 Reducing template independent primer extension and threshold time for loop mediated isothermal amplification

Country Status (1)

Country Link
US (2) US9121046B2 (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017136387A1 (en) 2016-02-01 2017-08-10 Integrated Dna Technologies, Inc. Cleavable primers for isothermal amplification
WO2017141067A1 (en) 2016-02-16 2017-08-24 The University Of Tokyo Method of eliminating background amplification of nucleic acid targets
US11732315B2 (en) 2020-03-12 2023-08-22 New England Biolabs, Inc. Rapid diagnostic test for lamp
US10968493B1 (en) 2020-03-12 2021-04-06 New England Biolabs, Inc. Rapid diagnostic test using colorimetric LAMP
US11345970B2 (en) 2020-03-12 2022-05-31 New England Biolabs, Inc. Rapid diagnostic test for LAMP
EP4118233A1 (en) 2020-03-12 2023-01-18 New England Biolabs, Inc. A rapid diagnostic test for lamp
CN111766387B (en) * 2020-07-10 2022-02-01 北京华益精点生物技术有限公司 Preparation method of quality control card and quality control card
EP4110945A2 (en) 2020-08-21 2023-01-04 New England Biolabs, Inc. A rapid diagnostic test for lamp
WO2025129195A1 (en) 2023-12-15 2025-06-19 New England Biolabs, Inc. Dna polymerases and related methods
CN117925874B (en) * 2024-03-21 2024-06-18 北京起源聚禾生物科技有限公司 Primer probe combination and kit for detecting pathogenic microorganisms and drug resistance genes of urinary tract infection

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010083561A1 (en) * 2009-01-21 2010-07-29 Human Genetic Signatures Pty Ltd Improved isothermal strand displacement amplification
US20120122161A1 (en) * 2009-05-22 2012-05-17 Esther Musgrave-Brown Sorting Asymmetrically Tagged Nucleic Acids by Selective Primer Extension
US20140045221A1 (en) * 2011-04-20 2014-02-13 Mesa Tech International, Inc. Oscillating Amplification Reaction for Nucleic Acids

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010083561A1 (en) * 2009-01-21 2010-07-29 Human Genetic Signatures Pty Ltd Improved isothermal strand displacement amplification
US20120122161A1 (en) * 2009-05-22 2012-05-17 Esther Musgrave-Brown Sorting Asymmetrically Tagged Nucleic Acids by Selective Primer Extension
US20140045221A1 (en) * 2011-04-20 2014-02-13 Mesa Tech International, Inc. Oscillating Amplification Reaction for Nucleic Acids

Also Published As

Publication number Publication date
US9121046B2 (en) 2015-09-01
US20130122551A1 (en) 2013-05-16

Similar Documents

Publication Publication Date Title
US9121046B2 (en) Reducing template independent primer extension and threshold time for loop mediated isothermal amplification
JP6574178B2 (en) Ligase-assisted nucleic acid circularization and amplification
CN104685066B (en) Compositions and methods for quantifying nucleic acid sequences in a sample
EP2582850B1 (en) Compositions, kits, and methods for synthesis and/or detection of nucleic acids
EP1446508B1 (en) A method of reducing non-specific amplification in pcr
JP2009284896A (en) Nucleic acid amplification method
US20180171399A1 (en) Helicase Suppression of Non-Template Amplification
EP2103693A1 (en) Nucleic acid amplification in the presence of modified randomers
WO2016135300A1 (en) Efficiency improving methods for gene library generation
RU2018144299A (en) RING DNA AMPLIFICATION METHOD
US9212378B2 (en) Method of amplifying DNA from RNA in a sample
US20020172972A1 (en) Use of a selectively inactivatable enzyme to digest contaminating nucleic acid
US20090286251A1 (en) Enzyme Reagents for Amplification of Polynucleotides in the Presence of Inhibitors
US8685648B2 (en) Endonuclease-enhanced helicase-dependent amplification
EP3464596B1 (en) Thermostable polymerase inhibitor compositions and methods
KR20140123858A (en) Polynucleotide and use thereof
EP3250715A1 (en) Substrate molecule
US20240218438A1 (en) Improvements in or relating to digestion of reaction products
CN104093835A (en) Method for improving nucleic acid synthesis reaction
JP2008178338A (en) Nucleic acid amplification method for amplifying target nucleic acid in nucleic acid sample contaminated with fragmented nucleic acid, and kit thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: NEW ENGLAND BIOLABS, INC., MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TANNER, NATHAN;EVANS, THOMAS C., JR.;REEL/FRAME:036189/0842

Effective date: 20121107

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION