US20150082482A1 - Bronze Bug Control Agents - Google Patents

Bronze Bug Control Agents Download PDF

Info

Publication number
US20150082482A1
US20150082482A1 US14/395,595 US201314395595A US2015082482A1 US 20150082482 A1 US20150082482 A1 US 20150082482A1 US 201314395595 A US201314395595 A US 201314395595A US 2015082482 A1 US2015082482 A1 US 2015082482A1
Authority
US
United States
Prior art keywords
seq
dsrna
plant
nucleotides
bronze
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
US14/395,595
Other versions
US10155959B2 (en
Inventor
Dror Avisar
Daniel Siegel
Ziv Shani
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Futuragene Israel Ltd
Original Assignee
Futuragene Israel Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Futuragene Israel Ltd filed Critical Futuragene Israel Ltd
Priority to US14/395,595 priority Critical patent/US10155959B2/en
Assigned to FUTURAGENE ISRAEL LTD. reassignment FUTURAGENE ISRAEL LTD. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: AVISAR, DROR, SHANI, ZIV, SIEGEL, DANIEL
Assigned to FUTURAGENE ISRAEL LTD. reassignment FUTURAGENE ISRAEL LTD. CORRECTIVE ASSIGNMENT TO CORRECT THE RECEIVING PARTY'S ADDRESS PREVIOUSLY RECORDED AT REEL: 034284 FRAME: 0248. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNMENT. Assignors: AVISAR, DROR, SHANI, ZIV, SIEGEL, DANIEL R.
Publication of US20150082482A1 publication Critical patent/US20150082482A1/en
Application granted granted Critical
Publication of US10155959B2 publication Critical patent/US10155959B2/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/50Biochemical production, i.e. in a transformed host cell
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/40Monitoring or fighting invasive species

Definitions

  • the present invention relates to the field of double stranded RNA (dsRNA)-mediated gene silencing in insect species.
  • dsRNA double stranded RNA
  • Thaumastocoris peregrinus (Bronze bug) is a sap-sucking pest (Order Hemiptera: Thaumastocoridae) exclusively found on eucalyptus trees.
  • Bronze bug infestations have occurred in the Southern hemisphere and pose a threat to commercial eucalyptus farming in Australia, Africa, and South America. Infestations have been observed, for example, in the species E. camaldulensis, E. tereticornis and E. smithii and the hybrids E. grandis ⁇ E. camaldulensis and E. grandis ⁇ E. urophylla .
  • Bronze bug infestation reduces the photosynthetic ability of the tree, resulting in stunted growth. Severe infestation may cause death of trees.
  • Efforts to control Bronze bug infection of eucalyptus have included attempts to isolate naturally resistant plants and natural predators. Such efforts, however, have met with limited or no success.
  • Bronze bug infestations lead to difficulties in controlling infestations with chemical pesticides.
  • Bronze bug infestations tend to spread rapidly. Control of infestation would thus necessitate repeated spraying.
  • Bronze bug moreover, tend to aggregate in the mid-canopy, which is difficult to penetrate with insecticides.
  • chemical pesticide control has disadvantages. Chemical pesticides are potentially detrimental to the environment, are not selective and are potentially harmful to non-target crops and fauna. Chemical pesticides persist in the environment and generally are metabolized slowly, or not at all. Chemical pesticides accumulate in the food chain, particularly in the higher predator species where they can act as mutagens and/or carcinogens to cause irreversible and deleterious genetic modifications. Crop pests, moreover, may develop resistance against chemical insecticides because of repetitive usage of the same insecticide or of insecticides having the same mode of action.
  • RNA interference or “RNAi” is a process of sequence-specific down-regulation of gene expression (also referred to as “gene silencing” or “RNA-mediated gene silencing”) initiated by double-stranded RNA (dsRNA) that is complementary in sequence to a region of the target gene to be down-regulated. Down-regulation of target genes in multicellular organisms by means of RNA interference (RNAi) has become a well-established technique.
  • dsRNA double-stranded RNA
  • RNAi RNA interference
  • U.S. patent application publications US 2009/0285784 A1 and US 2009/0298787 relate to dsRNA as an insect control agent and are hereby incorporated herein by reference in their respective entireties.
  • patent application publication 2003/00150017 A1 International Publications WO 00/01846, WO 01/37654, WO 2005/019408, WO 2005/049841, WO 05/047300 relate to the use of RNAi to protect plants against insects.
  • International application, PCT/US12/31423, filed Mar. 30, 2012 relates to RNA-mediated control of eucalyptus pests in the Gall Wasp family.
  • the present invention is based, in part, on the inventors' sequencing of genes from the eucalyptus Bronze bug invasive species, Thaumastocoris peregrinus (hereinafter “Tp” or “Bronze bug”).
  • Tp Thaumastocoris peregrinus
  • the invention thus provides Bronze bug nucleic acids, derivatives thereof and the use of such nucleic acids and derivatives as Bronze bug control agents.
  • the invention provides isolated nucleic acids that hybridize selectively under high stringency hybridization conditions to a sequence set out in SEQ ID NO: 1-59 and 74-87 and complementary sequences thereof.
  • the invention provides isolated nucleic acids that are 90-99.99 percent identical to sequences set out in SEQ ID NO: 1-59 and 74-87 and complementary sequences thereof.
  • the invention provides isolated nucleic acids that include at least 17 contiguous nucleotides of the sequences set out in SEQ ID NO: 1-59 and 74-87 and complementary sequences thereof.
  • the invention provides nucleic acids from Bronze bug, including the nucleic acids set out above, that are about 80% or less identical to the honey bee ortholog of said nucleic acid.
  • the invention provides vectors that include nucleic acids from Bronze bug, or reverse compliments of such sequences, operably linked to an expression control sequence.
  • the invention provides host cells transformed with and/or harboring vectors that include nucleic acids from Bronze bug, or reverse compliments of such sequences, operably linked to an expression control sequence.
  • the invention provides plant tissues, for example, leaf tissue and seeds, transformed with and/or harboring vectors that include nucleic acids from Bronze bug operably linked to an expression control sequence.
  • the invention provides isolated small inhibitory ribonucleic acid (siRNA) molecules that inhibit expression of Bronze bug nucleic acids.
  • the invention provides isolated double stranded ribonucleic acid (dsRNA) molecules that include a first strand of nucleotides that is substantially identical to at least 17 contiguous nucleotides of SEQ ID NO: 1-59 and 74-87 and a second strand of nucleotides that is substantially complementary to the first strand of nucleotides.
  • dsRNA isolated double stranded ribonucleic acid
  • the invention provides double stranded ribonucleic acid (dsRNA) molecules with a high level of homology (greater than 80%) to mRNA from Bronze bug (Bronze bug targeting dsRNAs), including the dsRNA molecules set out above, that are about 80% or less identical to the honey bee ortholog of the dsRNA.
  • dsRNA double stranded ribonucleic acid
  • the invention provides vectors that include an expression control sequence operatively linked to a nucleotide sequence that is a template for one or both strands of a dsRNA from Bronze bug.
  • the invention provides host cells transformed with and/or harboring vectors that include an expression control sequence operatively linked to a nucleotide sequence that is a template for one or both strands of a dsRNA from Bronze bug.
  • the invention provides plant tissue transformed with and/or harboring vectors that include an expression control sequence operatively linked to a nucleotide sequence that is a template for one or both strands of a dsRNA from Bronze bug.
  • the invention provides isolated small inhibitory ribonucleic acid (siRNA) molecules that inhibit expression of an essential gene of Bronze bug.
  • siRNA small inhibitory ribonucleic acid
  • the invention provides methods of producing a pest resistant plant by expressing a Bronze bug dsRNA in the plant or in propagative or reproductive material of the plant.
  • the invention provides methods of producing pest resistant eucalyptus by expressing a Bronze bug dsRNA in the eucalyptus or in propagative or reproductive material of the eucalyptus.
  • the invention provides methods of producing eucalyptus resistant to Bronze bug infection and/or infestation by expressing a Bronze bug targeting dsRNA in the eucalyptus or in propagative or reproductive material of the eucalyptus.
  • the invention provides methods of producing a plant resistant to a plant pathogenic pest by transforming a plant cell with a recombinant DNA construct or combination of constructs that express a dsRNA; regenerating a plant from the transformed plant cell; and growing the transformed plant cell under conditions suitable for the expression of the recombinant DNA construct.
  • FIG. 1 schematically depicts certain, non-limiting nucleic acids according to the invention.
  • A Schematic of silencing construct constructed using sequences from three Bronze bug genes.
  • Transgene P1 (Promoter 1) to T1 (Termination sequence 1) encodes a hairpin RNA (hpRNA), constructed by fusing 100 bp from each of three different Bronze bug genes (Bb1, Bb2 and Bb3), by synthesizing the resulting sequence as an inverted repeat, and inserting a loop sequence between the respective sense and inverted repeat sequences.
  • Transgene P2 (Promoter 2) to T2 (termination sequence 2) encodes an mRNA with the respective fused 100 bp sequences from the three Bronze bug genes.
  • mRNA transcribed from transgene P2 to T2 is the template for cytoplasmic enhancement of the silencing signal.
  • B Schematic of hpRNA molecule produced by transcription of transgene P1 to T1.
  • C Schematic of mRNA produced by transcription of transgene P2 to T2.
  • FIG. 2 schematically depicts certain, non-limiting nucleic acids according to the invention.
  • A Schematic of silencing construct #1, constructed from sequences from three Bronze bug genes in accordance with the general scheme depicted in FIG. 1 .
  • B Schematic of hpRNA molecule produced by transcription of transgene P1 to T1.
  • C Schematic of mRNA produced by transcription of transgene P2 to T2.
  • P1 CaMV 35S Promoter (SEQ ID NO: 60); P2—sgFIMV Promoter (SEQ ID NO: 61); T1—AtActin7 Terminator (SEQ ID NO: 62); T2—Nos Terminator (SEQ ID NO: 63); Bb12—SEQ ID NO: 16; Bb13—SEQ ID NO: 18; Bb29—SEQ ID NO: 30; L—loop sequence site (SEQ ID NO: 64).
  • FIG. 3 schematically depicts certain, non-limiting nucleic acids according to the invention.
  • A Schematic of silencing construct #2, constructed from sequences from three Bronze bug genes in accordance with the general scheme depicted in FIG. 1 .
  • B Schematic of hpRNA molecule produced by transcription of transgene P1 to T1.
  • C Schematic of mRNA produced by transcription of transgene P2 to T2.
  • P1 CaMV 35S Promoter (SEQ ID NO: 60); P2—sgFIMV Promoter (SEQ ID NO: 61); T1—AtActin7 Terminator (SEQ ID NO: 62); T2—Nos Terminator (SEQ ID NO: 63); Bb31—SEQ ID NO: 34; Bb35—SEQ ID NO: 40; Bb56—SEQ ID NO: 59; L—loop sequence site (SEQ ID NO: 64).
  • FIG. 4 schematically depicts certain, non-limiting nucleic acids according to the invention.
  • A Schematic of silencing construct #3, constructed from sequences from three Bronze bug genes in accordance with the general scheme depicted in FIG. 1
  • B Schematic of hpRNA molecule produced by transcription of transgene P1 to T1.
  • C Schematic of mRNA produced by transcription of transgene P2 to T2.
  • P1 CaMV 35S Promoter (SEQ ID NO: 60); P2—sgFIMV Promoter (SEQ ID NO: 61); T1—AtActin7 Terminator (SEQ ID NO: 62); T2—Nos Terminator (SEQ ID NO: 63); Bb41—SEQ ID NO: 46; Bb53-SEQ ID NO: 52; Bb54—SEQ ID NO: 54 L—loop sequence site (SEQ ID NO: 64).
  • FIG. 5 schematically depicts certain, non-limiting nucleic acids according to the invention.
  • A Schematic of silencing construct constructed using sequences from a single Bronze bug gene.
  • Transgene P1 to T1 encodes a hairpin RNA (hpRNA) for silencing Bronze bug, constructed from 100 bp of a Bronze bug gene, by synthesizing the sequence as an inverted repeat, and inserting a loop sequence between the respective sense and inverted repeat sequences.
  • Transgene P2 to T2 encodes an mRNA with the 100 bp sequence from the Bronze bug gene.
  • mRNA transcribed from transgene P2 to T2 is the template for cytoplasmic enhancement of the silencing signal.
  • B Schematic of hpRNA molecule produced by transcription of transgene P1 to T1.
  • C Schematic of mRNA produced by transcription of transgene P2 to T2.
  • FIG. 6 schematically depicts certain, non-limiting nucleic acids according to the invention.
  • A Schematic of silencing construct constructed using sequences from two Bronze bug genes.
  • Transgene P1 to T1 encodes a hairpin RNA (hpRNA) for silencing Bronze bug, constructed by fusing 100 bp from each of two different Bronze bug genes, by, synthesizing the resulting sequence as an inverted repeat, and inserting a loop sequence between the respective sense and inverted repeat sequences.
  • Transgene P2 to T2 encodes an mRNA with the respective fused 100 bp sequences from the two Bronze bug genes.
  • mRNA transcribed from transgene P2 to T2 is the template for cytoplasmic enhancement of the silencing signal.
  • B Schematic of hpRNA molecule produced by transcription of transgene P1 to T1.
  • C Schematic of mRNA produced by transcription of transgene P2 to T2.
  • the inventors have conducted transcriptome sequencing of the natural eucalyptus pest, Bronze bug Thaumastocoris peregrinus (Tp) and mined the respective transcriptomes to identify open reading frames Bronze bug genes that correspond to Bronze bug mRNAs.
  • the identification of Bronze bug RNAs allows for the design of siRNA and dsRNA that mediate downregulation (silencing) of Bronze bug genes.
  • siRNA and dsRNAs are thus useful as biological control agents to kill or inhibit the development of Bronze bug and inhibit Bronze bug infection of plants.
  • nucleic acid based approaches for the control of Bronze bug pests.
  • nucleic acid based approaches include, without limitation, approaches based on expression of Bronze bug double-stranded (dsRNA), antisense RNA, and mRNA.
  • the methods of the invention find practical application in any area of technology where it is desirable to inhibit viability, growth, development or reproduction of Bronze bugs, or to decrease pathogenicity or infectivity of the insect.
  • the methods of the invention further find practical application where it is desirable to specifically down-regulate expression of one or more target genes in a Bronze bug insect.
  • Particularly useful practical applications include, but are not limited to, protecting plants against Bronze bug pest infestation.
  • an active ingredient for controlling Bronze bug infestation is a double-stranded RNA (dsRNA) or a nucleic acid that can promote or lead to production of a dsRNA, which can be used as an insecticidal formulation.
  • dsRNA can be expressed in a host plant, plant part, plant cell or seed to protect the plant against Bronze bugs.
  • the sequence of the dsRNA corresponds to part or whole of an essential Bronze bug gene and causes downregulation of the insect target gene via RNA interference (RNAi).
  • RNAi RNA interference
  • the dsRNA prevents expression of the target insect protein and causes death, growth arrest or sterility of the insect.
  • siRNA control of insect growth for preventing insect infestation of a cell or a plant susceptible to insect infection, is effected by contacting insects with a dsRNA produced by annealed complementary strands, one of which has a nucleotide sequence which is complementary to at least part of the nucleotide sequence of an insect target gene.
  • dsRNA is expressed in plant tissue that is ingested by the insect and then taken up by the insect through the gut, and thereby controls growth or prevents infestation. See Huvenne et al., 2010 , J Insect Physiol 56: 227-35.
  • Bronze bug target genes for siRNA-mediated intervention include are preferably non-redundant, vital genes.
  • Vital target genes may be any gene that when inhibited interferes with growth or survival or pathogenicity or infectivity of the insect. Such vital target genes are essential for viability, growth, development or reproduction of the insect, or any gene that is involved with pathogenicity or infectivity of the insect, such that specific inhibition of the target gene leads to a lethal phenotype or decreases or stops insect infestation. Down regulation of such vital target genes, whose activity cannot be complemented by other related genes, results in significant damage to the pest larvae and provides an efficient pest control system for sessile Bronze bug pests.
  • the target gene may be any of the target genes herein described, for instance a target gene that is essential for the viability, growth, development or reproduction of the pest.
  • target genes include, for example, genes that are involved in protein synthesis and/or metabolism and/or RNA synthesis and metabolism and/or cellular processes. A slight knockdown of these target genes will have an effect on many other genes and processes ultimately leading to a lethal effect on the target pest. Such a down-regulated target gene will result in the death of the insect, or the reproduction or growth of the insect being stopped or delayed.
  • target genes are vital for the viability of the insect and are referred to as vital genes.
  • RNAi mediated gene interference libraries (15, 16) may be used to identify genes that are lethal to other organisms when RNAi based on these genes is expressed and incorporated into target pest organisms by ingestion or any other means.
  • genes identified as being RNAi-lethal in Drosophila may be used to screen for orthologs in hymenoptera species. Such hymenoptera orthologs may further be used to screen Bronze bug species for potential targets.
  • Giveaways live for approximately 40 days. Females can produce at least 60 eggs during that time period (2 per day for 30 days). Eggs may be deposited singly or in clusters and may be deposited anywhere on a tree, but are typically deposited in clusters on leaves. The laying of virgin eggs is reported for this genus. At 17-22° C. the eggs hatch in approximately six days. Bronze bug development progresses through five stadia, taking approximately 4.6, 3.5, 3.3, 3.7 and 5.3 days, respectively. Bronze bug may be induced, e.g., by agitation, to lay eggs on unnatural surfaces, for example, the side of a vial.
  • Nucleotide sequences of Bronze bug target genes include, for example, the sequences set out in SEQ ID NO: 1-59 and 74-87 the complements of such sequences, the reverse complements of such sequences, and sequences that selectively hybridize to such sequences and complements under high stringency hybridization conditions.
  • target genes include, without limitation, AMP, WD40, TEF, ETI, RNA_HEL, UBIQ_LIG, Mor and TIF.
  • Nucleotide sequences useful for dsRNA-mediated downregulation of Bronze bug target genes include, for example, (i) a sequences set out in SEQ ID NO: 1-59 and 74-87 and the complements of such sequences; (ii) sequences which are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.9% identical to a sequence set out in SEQ ID NO: 1-59 and 74-87 and the complements of such sequences; (iii) sequences comprising at least 17 contiguous nucleotides of SEQ ID NO: 1-59 and 74-87 and the complements of such sequences; and (iv) sequences that selectively hybridize to such sequences and complements under high stringency hybridization conditions.
  • isolated nucleic acid as used herein is a nucleic that has been identified and separated and/or recovered from a component of its natural environment.
  • Controlling pests means killing pests, or preventing pests to develop, or to grow or preventing pests to infect or infest. Controlling pests as used herein also encompasses controlling pest progeny (development of eggs). Controlling pests as used herein also encompasses inhibiting viability, growth, development or reproduction of the pest, or to decrease pathogenicity or infectivity of the pest.
  • the compounds and/or compositions described herein may be used to keep an organism healthy and may be used curatively, preventively or systematically to control pests or to avoid pest growth or development or infection or infestation.
  • Controlling insects as used herein thus encompasses controlling insect progeny (such as development of eggs). Controlling insects as used herein also encompasses inhibiting viability, growth, development or reproduction of the insect, or decreasing pathogenicity or infectivity of the insect. As used herein, controlling insects may refer to inhibiting a biological activity in an insect, resulting in one or more of the following attributes: reduction in feeding by the insect, reduction in viability of the insect, death of the insect, inhibition of differentiation and development of the insect, absence of or reduced capacity for sexual reproduction by the insect.
  • the compounds and/or compositions described herein may be used to keep an organism healthy and may be used curatively, preventively or systematically to control an insect or to avoid insect growth or development or infection or infestation.
  • the invention may allow previously susceptible organisms to develop resistance against infestation by the insect organism.
  • complementary to at least part of refers to a nucleotide sequence that is fully complementary to the nucleotide sequence of the target over more than ten nucleotides, for instance over at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more contiguous nucleotides. Notwithstanding the above, “complementary to at least part” of may also include complementary sequences that are greater than 80% complementary to a nucleotide sequence of a target sequence over a length of more than 20 nucleotides, for instance over at least 20, 21, 22, 23, 24 or more contiguous nucleotides [13, 14].
  • the invention provides a method for down-regulating expression of a target gene in an insect, comprising contacting the insect with a dsRNA, wherein the dsRNA comprises annealed complementary strands, one of which has a nucleotide sequence that is complementary to at least part of the nucleotide sequence of the insect target gene to be down-regulated, whereby the dsRNA is taken up into the insect and thereby down-regulates expression of the insect target gene.
  • insects encompasses insects of all types and at all stages of development, including egg, larval or nymphal, pupal and adult stages.
  • plant encompasses any plant material that it is desired to treat to prevent or reduce insect growth and/or insect infestation. This includes, inter alia, whole plants, seedlings, propagation or reproductive material such as seeds, cuttings, grafts, explants, etc., and also plant cell and tissue cultures.
  • the plant material should express, or have the capability to express, the RNA molecule comprising at least one nucleotide sequence that is the RNA complement of or that represents the RNA equivalent of at least part of the nucleotide sequence of the sense strand of at least one target gene of the pest organism, such that the RNA molecule is taken up by a pest upon plant-pest interaction, said RNA molecule being capable of inhibiting the target gene or down-regulating expression of the target gene by RNA interference.
  • down-regulation of gene expression and “inhibition of gene expression” are used interchangeably and refer to a measurable or observable reduction in gene expression or a complete abolition of detectable gene expression, at the level of protein product and/or mRNA product from the target gene.
  • the down-regulation effect of the dsRNA on gene expression may be calculated as being at least 30%, 40%, 50%, 60%, preferably 70%, 80% or even more preferably 90% or 95% when compared with normal gene expression.
  • RNA solution hybridization RNA PCR
  • nuclease protection RNA PCR
  • Northern hybridization RNA blotting
  • enzyme-linked immunosorbent assay ELISA
  • other immunoassays or fluorescence-activated cell analysis (FACS).
  • the growth inhibition can be quantified as being greater than about 5%, 10%, more preferably about 20%, 25%, 33%, 50%, 60%, 75%, 80%, most preferably about 90%, 95%, or about 99% as compared to a pest organism that has been treated with control dsRNA.
  • the “target gene” may be essentially any gene that is desirable to be inhibited because it interferes with growth or pathogenicity or infectivity of the insect. For instance, if the method of the invention is to be used to prevent insect growth and/or infestation then it is preferred to select a target gene which is essential for viability, growth, development or reproduction of the insect, or any gene that is involved with pathogenicity or infectivity of the insect, such that specific inhibition of the target gene leads to a lethal phenotype or decreases or stops insect infestation.
  • the target gene is such that when its expression is down-regulated or inhibited using the method of the invention, the insect is killed, or the reproduction or growth of the insect is stopped or retarded.
  • This type of target gene is considered to be essential for the viability of the insect and is referred to as essential genes. Therefore, the present invention encompasses a method as described herein, wherein the target gene is an essential gene.
  • the target gene is such that when it is down-regulated the infestation or infection by the insect, the damage caused by the insect, and/or the ability of the insect to infest or infect host organisms and/or cause such damage, is reduced.
  • the terms “infest” and “infect” or “infestation” and “infection” are generally used interchangeably throughout.
  • This type of target genes is considered to be involved in the pathogenicity or infectivity of the insect. Therefore, the present invention extends to methods as described herein, wherein the target gene is involved in the pathogenicity or infectivity of the insect.
  • the advantage of choosing the latter type of target gene is that the insect is blocked to infect further plants or plant parts and is inhibited to form further generations.
  • the dsRNA does not share any significant homology with any host gene, or at least not with any essential gene of the host.
  • the dsRNA shows less than 30%, more preferably less that 20%, more preferably less than 10%, and even more preferably less than 5% nucleic acid sequence identity with any gene of the host cell. Percent sequence identity should be calculated across the full length of the dsRNA region. If genomic sequence data is available for the host organism one may cross-check sequence identity with the dsRNA using standard bioinformatics tools.
  • dsRNA there is no sequence identity between the dsRNA and a host sequences over 21 contiguous nucleotides, meaning that in this context, it is preferred that 21 contiguous base pairs of the dsRNA do not occur in the coding sequences (CDS) of the host organism. In another embodiment, there is less than about 10% or less than about 12.5% sequence identity over 24 contiguous nucleotides of the dsRNA with any nucleotide sequence from a host species.
  • dsRNA comprises annealed complementary strands, one of which has a nucleotide sequence which corresponds to a target nucleotide sequence of the target gene to be down-regulated.
  • the other strand of the dsRNA is able to base-pair with the first strand.
  • target region or “target nucleotide sequence” of the target insect gene may be any suitable region or nucleotide sequence of the gene.
  • the target region should comprise at least 17, at least 18 or at least 19 consecutive nucleotides of the target gene, more preferably at least 20 or at least 21 nucleotide and still more preferably at least 22, 23 or 24 nucleotides of the target gene.
  • the dsRNA will share 100% sequence identity with the target region of the insect target gene.
  • 100% sequence identity over the whole length of the double stranded region is not essential for functional RNA inhibition.
  • RNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for RNA inhibition.
  • nucleic acid strands are “substantially complementary” when at least 85% of their bases pair.
  • RNA equivalent substantially means that in the DNA sequence(s), the base “T” may be replaced by the corresponding base “U” normally present in ribonucleic acids.
  • dsRNA contains a sequence which corresponds to the target region of the target gene, it is not essential for the whole of the dsRNA to correspond to the sequence of the target region.
  • the dsRNA may contain short non-target regions flanking the target-specific sequence, provided that such sequences do not affect performance of the dsRNA in RNA inhibition to a material extent.
  • the dsRNA may contain one or more substitute bases in order to optimize performance in RNAi. It will be apparent to one of ordinary skill in the art how to vary each of the bases of the dsRNA in turn and test the activity of the resulting dsRNAs (e.g., in a suitable in vitro test system) in order to optimize the performance of a given dsRNA.
  • the dsRNA may further contain DNA bases, non-natural bases or non-natural backbone linkages or modifications of the sugar-phosphate backbone, for example to enhance stability during storage or enhance resistance to degradation by nucleases.
  • Interfering RNAs of about 21 bp are useful for effective gene silencing. Increasing the length of dsRNA preferably to at least about 80-100 bp may increase the efficiency by which dsRNA is taken up by pest organisms. Such longer fragments may be more effective in gene silencing, possibly due to a more efficient uptake of these long dsRNA by the invertebrate.
  • RNA duplexes consisting of either 27-mer blunt or short hairpin (sh) RNAs with 29 bp stems and 2-nt 3′ overhangs may also be used as siRNAs.
  • molecules based upon the targets identified above and being either 27-mer blunt or short hairpin (sh) RNA's with 29-bp stems and 2-nt 3′ overhangs are also included within the scope of the invention.
  • the dsRNA fragment (or region) will itself preferably be at least 17 bp in length, preferably 18 or 19 bp in length, more preferably at least 20 bp, more preferably at least 21 bp, or at least 22 bp, or at least 23 bp, or at least 24 bp, 25 bp, 26 bp or at least 27 bp in length.
  • the expressions “double-stranded RNA fragment” or “double-stranded RNA region” refer to a small entity of the dsRNA corresponding with (part of) the target gene.
  • the double stranded RNA is preferably between about 17-1500 bp, even more preferably between about 80-1000 bp and most preferably between about 17-27 bp or between about 80-250 bp; such as double stranded RNA regions of about 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 27 bp, 50 bp, 80 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, 550 bp, 600 bp, 650 bp, 700 bp, 900 bp, 100 bp, 1100 bp, 1200 bp, 1300 bp, 1400 bp or 1500 bp.
  • the upper limit on the length of the dsRNA may be dependent on i) the requirement for the dsRNA to be taken up by the insect and ii) the requirement for the dsRNA to be processed within the cell into fragments that direct RNAi.
  • the chosen length may also be influenced by the method of synthesis of the RNA and the mode of delivery of the RNA to the cell.
  • the dsRNA to be used in the methods of the invention will be less than 10,000 bp in length, more preferably 1000 bp or less, more preferably 500 bp or less, more preferably 300 bp or less, more preferably 100 bp or less.
  • the optimum length of the dsRNA for effective inhibition may be determined by experiment.
  • the dsRNA may be fully or partially double-stranded.
  • Partially dsRNAs may include short single-stranded overhangs at one or both ends of the double-stranded portion, provided that the RNA is still capable of being taken up by insects and directing RNAi.
  • the dsRNA may also contain internal non-complementary regions.
  • the methods of the invention encompass the simultaneous or sequential provision of two or more different dsRNAs or RNA constructs to the same insect, so as to achieve down-regulation or inhibition of multiple target genes or to achieve a more potent inhibition of a single target gene.
  • a dsRNA construct comprises multiple dsRNA regions, at least one strand of each dsRNA region comprising a nucleotide sequence that is complementary to at least part of a target nucleotide sequence of an insect target gene.
  • the dsRNA regions in the RNA construct may be complementary to the same or to different target genes and/or the dsRNA regions may be complementary to targets from the same or from different insect species.
  • hit is alternative wordings to indicate that at least one of the strands of the dsRNA is complementary to, and as such may bind to, the target gene or nucleotide sequence.
  • the double stranded RNA region comprises multiple copies of the nucleotide sequence that is complementary to the target gene.
  • the dsRNA hits more than one target sequence of the same target gene.
  • the invention thus encompasses isolated double stranded RNA constructs comprising at least two copies of said nucleotide sequence complementary to at least part of a nucleotide sequence of an insect target.
  • multiple means at least two, at least three, at least four, at least five, at least six, etc.
  • a further target gene or “at least one other target gene” mean for instance a second, a third or a fourth, etc. target gene.
  • dsRNA that hits more than one of the above-mentioned targets, or a combination of different dsRNA against different of the above mentioned targets are developed and used in the methods of the present invention.
  • dsRNA regions (or fragments) in the double stranded RNA may be combined as follows: a) when multiple dsRNA regions targeting a single target gene are combined, they may be combined in the original order (i.e., the order in which the regions appear in the target gene) in the RNA construct; b) alternatively, the original order of the fragments may be ignored so that they are scrambled and combined randomly or deliberately in any order into the double stranded RNA construct; c) alternatively, one single fragment may be repeated several times, for example from 1 to 10 times, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times, in the ds RNA construct, or d) the dsRNA regions (targeting a single or different target genes) may be combined in the sense or antisense orientation.
  • RNAi regions targeting a single or different weak gene(s) may be combined to obtain a stronger RNAi effect.
  • “Insect specific” genes or sequences e.g., Bronze bug specific, particularly Bronze bug specific genes and sequences, encompass genes that have no substantial homologous counterpart in non-insect organisms as can be determined by bioinformatics homology searches, for example by BLAST searches. The choice of a specific target gene results in a species specific RNAi effect, with no effect or no substantial (adverse) effect in non-target organisms.
  • Consed genes encompass genes that are conserved (at the amino acid level) between the target organism and non-target organism(s).
  • RNA constructs target multiple genes from different biological pathways, resulting in a broad cellular RNAi effect and more efficient insect control.
  • dsRNAs are constructed from sequences, e.g., Bronze bug transcriptome sequences, that are equal to or less than 80% identical to the sequence of a honey bee ortholog.
  • dsRNA constructs are constructed with gene sequences that affect different classes of cellular functions. Examples of such classes of cellular function include, without limitation, (i) protein synthesis and metabolism, (ii) RNA synthesis and metabolism, and (iii) cellular processes.
  • dsRNA constructs comprise sequences from each of the aforementioned claims, i.e., three classes.
  • dsRNA constructs comprise sequences from two of the aforementioned classes, e.g., protein synthesis and metabolism and RNA synthesis and metabolism; protein synthesis and cellular processes; or RNA synthesis and metabolism and cellular processes.
  • dsRNA regions comprise at least one strand that is complementary to at least part or a portion of the nucleotide sequence of any of the target genes herein described.
  • the other double stranded RNA regions may comprise at least one strand that is complementary to a portion of any other insect target gene (including known target genes).
  • dsRNAs may comprise additional sequences and optionally a linker. Additional sequences may include, for example, (i) a sequence facilitating large-scale production of the dsRNA construct; (ii) a sequence effecting an increase or decrease in the stability of the dsRNA; (iii) a sequence allowing the binding of proteins or other molecules to facilitate uptake of the RNA construct by insects; (iv) a sequence which is an aptamer that binds to a receptor or to a molecule on the surface or in the cytoplasm of an insect to facilitate uptake, endocytosis and/or transcytosis by the insect; or (v) additional sequences to catalyze processing of dsRNA regions.
  • the linker is a conditionally self-cleaving RNA sequence, preferably a pH sensitive linker or a hydrophobic sensitive linker.
  • Multiple dsRNA regions of the dsRNA construct may be connected directly or by one or more linkers.
  • a linker may be present at a site in the RNA construct, separating dsRNA regions from another region of interest.
  • Multiple dsRNA regions of dsRNA constructs may be connected without linkers.
  • linkers may be used to disconnect smaller dsRNA regions in the pest organism.
  • the linker sequence may promote division of a long dsRNA into smaller dsRNA regions under particular circumstances, resulting in the release of separate dsRNA regions under these circumstances and leading to more efficient gene silencing by these smaller dsRNA regions.
  • suitable conditionally self-cleaving linkers are RNA sequences that are self-cleaving at high pH conditions. Suitable examples of such RNA sequences are described by Borda et al. (Nucleic Acids Res. 2003 May 15; 31(10):2595-600), which document is incorporated herein by reference. This sequence originates from the catalytic core of the hammerhead ribozyme HH16.
  • Linkers may also be located at a site in the dsRNA construct, separating the dsRNA regions from another, e.g., an additional, sequence of interest, which preferably provides some additional function to the RNA construct.
  • dsRNA constructs may include aptamers to facilitate uptake of the dsRNA by the insect.
  • the aptamer is designed to bind a substance which is taken up by the insect. Such substances may be from an insect or plant origin.
  • an aptamer is an aptamer that binds to a transmembrane protein, for example a transmembrane protein of an insect.
  • the aptamer may bind a (plant) metabolite or nutrient which is taken up by the insect.
  • Linkers may undergo self-cleaving in the endosome. This may be advantageous when the constructs of the present invention are taken up by the insect via endocytosis or transcytosis, and are therefore compartmentalized in the endosomes of the insect species.
  • the endosomes may have a low pH environment, leading to cleavage of the linker.
  • Linkers that are self-cleaving in hydrophobic conditions are particularly useful in dsRNA constructs when used to be transferred from one cell to another via the transit in a cell wall, for example when crossing the cell wall of an insect pest organism.
  • An intron may be used as a linker.
  • An “intron” as used herein may be any non-coding RNA sequence of a messenger RNA.
  • a non-complementary RNA sequence ranging from about 1 base pair to about 10,000 base pairs, may also be used as a linker.
  • siRNAs small interfering RNAs
  • the dsRNA added to the exterior of the cell wall may be any dsRNA or dsRNA construct that can be taken up into the cell and then processed within the cell into siRNAs, which then mediate RNAi, or the RNA added to the exterior of the cell could itself be an siRNA that can be taken up into the cell and thereby direct RNAi.
  • siRNAs are generally short dsRNAs having a length in the range of from 19 to 25 base pairs, or from 20 to 24 base pairs. In preferred embodiments siRNAs having 19, 20, 21, 22, 23, 24 or 25 base pairs, and in particular 21 or 22 base pairs, corresponding to the target gene to be down-regulated may be used. However, the invention is not intended to be limited to the use of such siRNAs.
  • siRNAs may include single-stranded overhangs at one or both ends, flanking the double-stranded portion.
  • the siRNA may contain 3′ overhanging nucleotides, preferably two 3′ overhanging thymidines (dTdT) or uridines (UU).
  • 3′ TT or UU overhangs may be included in the siRNA if the sequence of the target gene immediately upstream of the sequence included in double-stranded part of the dsRNA is AA. This allows the TT or UU overhang in the siRNA to hybridize to the target gene.
  • siRNAs which are RNA/DNA chimeras are also contemplated.
  • chimeras include, for example, the siRNAs comprising a dsRNA with 3′ overhangs of DNA bases (e.g., dTdT), as discussed above, and also dsRNAs which are polynucleotides in which one or more of the RNA bases or ribonucleotides, or even all of the ribonucleotides on an entire strand, are replaced with DNA bases or deoxyribonucleotides.
  • dsRNAs which are polynucleotides in which one or more of the RNA bases or ribonucleotides, or even all of the ribonucleotides on an entire strand, are replaced with DNA bases or deoxyribonucleotides.
  • dsRNA may be formed from two separate (sense and antisense) RNA strands that are annealed together by (non-covalent) base pairing.
  • the dsRNA may have a foldback stem-loop or hairpin structure, wherein the two annealed strands of the dsRNA are covalently linked.
  • the sense and antisense stands of the dsRNA are formed from different regions of single polynucleotide molecule that is partially self-complementary. RNAs having this structure are convenient if the dsRNA is to be synthesized by expression in vivo, for example in a host cell or organism, or by in vitro transcription.
  • the loop structure may comprise linker sequences or additional sequences as described above.
  • the Bronze bug sequences disclosed herein and the complements of such sequences may also be used to inhibit expression of Bronze bug nucleic acids via expression of antisense RNA or overexpression of sense RNA, using methods well known in the art.
  • antisense RNAs or sense RNAs for Bronze bug target genes are expressed in eucalyptus plants. Upon ingestion by Bronze bug pests, the antisense or sense RNAs inhibit expression of the target genes to control pest infestation.
  • Target nucleotide sequences for design the dsRNA constructs are preferably at least 17, preferably at least 18, 19, 20 or 21, more preferably at least 22, 23 or 24 nucleotides in length.
  • Non-limiting examples of preferred target nucleotide sequences are given in the examples.
  • Target sequences may include sequences that are homologous to sequences disclosed herein. Homologues of target genes can be found using methods well known to those of ordinary skill in the art. Preferred homologues are genes comprising a sequence which is at least about 85% or 87.5%, still more preferably about 90%, still more preferably at least about 95% and most preferably at least about 99% or 99.9% identical to a sequence disclosed herein, or the complement thereof. Methods for determining sequence identity are routine in the art and include use of the Blast software and EMBOSS software (The European Molecular Biology Open Software Suite (2000), Rice, P. Longden, I. and Bleasby, A. Trends in Genetics 16, (6) pp 276-277).
  • identity refers to the relationship between sequences at the nucleotide level.
  • the expression “% identical” is determined by comparing optimally aligned sequences, e.g., two or more, over a comparison window wherein the portion of the sequence in the comparison window may comprise insertions or deletions as compared to the reference sequence for optimal alignment of the sequences.
  • the reference sequence does not comprise insertions or deletions.
  • the reference window is chosen from between at least 10 contiguous nucleotides to about 50, about 100 or to about 150 nucleotides, preferably between about 50 and 150 nucleotides. “percent identity” is then calculated by determining the number of nucleotides that are identical between the sequences in the window, dividing the number of identical nucleotides by the number of nucleotides in the window and multiplying by 100.
  • sequences include reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids.
  • Selectively hybridizing sequences typically have about at least 40% sequence identity, preferably 60-90% sequence identity, and most preferably 100% sequence identity (i.e., complementary) with each other.
  • stringent conditions or “stringent hybridization conditions” include reference to conditions under which a probe will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which can be up to 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Optimally, the probe is approximately 500 nucleotides in length, but can vary greatly in length from less than 500 nucleotides to equal to the entire length of the target sequence.
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide or Denhardt's.
  • Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C. and a wash in 0.5 ⁇ to 1 ⁇ SSC at 55 to 60° C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1 ⁇ SSC at 60 to 65° C.
  • the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1° C. for each 1% of mismatching; thus, T m , hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3 or 4° C.
  • T m thermal melting point
  • moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9 or 10° C. lower than the thermal melting point (T m ); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15 or 20° C. lower than the thermal melting point (T m ).
  • T m thermal melting point
  • high stringency is defined as hybridization in 4 ⁇ SSC, 5 ⁇ Denhardt's (5 g Ficoll, 5 g polyvinypyrrolidone, 5 g bovine serum albumin in 500 ml of water), 0.1 mg/ml boiled salmon sperm DNA, and 25 mM Na phosphate at 65° C. and a wash in 0.1 ⁇ SSC, 0.1% SDS at 65° C.
  • dsRNA may be expressed by (e.g., transcribed within) a host cell or host organism.
  • the host cell or organism may or may not be a host cell or organism susceptible or vulnerable to infestation by an insect. If the host cell or organism is a host cell or organism susceptible or vulnerable to infestation by an insect, RNAi-mediated gene silencing of one or more target genes in the insect may be used as a mechanism to control growth of the insect in or on the host organism and/or to prevent or reduce insect infestation of the host organism.
  • Expression of the dsRNA within cells of the host organism may thus confer resistance to a particular insect or to a class of insects. In case the dsRNA hits more than one insect target gene, expression of the dsRNA within cells of the host organism may confer resistance to more than one insect or more than one class of insects.
  • the host organism is a plant and the insect is a plant pathogenic insect.
  • the insect is contacted with the dsRNA by expressing the dsRNA in a plant, plant tissue or plant cell that is infested with or susceptible to infestation with, or ingestion by, the plant pathogenic insect.
  • a preferred plant host organism is eucalyptus .
  • eucalyptus include, without limitation, the following species: E. botryoides, E. bridgesiana, E. camaldulensis, E. cinerea, E. globule, E. grandis, E. gunii, E. nicholii, E. pulverulenta, E. robusta, E. rudis, E.
  • a preferred plant pathogenic insect is a Bronze bug, e.g., Bronze bug.
  • plant encompasses any plant material that it is desired to treat to prevent or reduce insect growth and/or insect infestation. This includes, inter alia, whole plants, seedlings, propagation or reproductive material such as seeds, cuttings, grafts, explants, etc. and also plant cell and tissue cultures.
  • the plant material should express, or have the capability to express, dsRNA corresponding to one or more target genes of the insect.
  • the invention provides a plant, preferably a transgenic plant, or propagation or reproductive material for a (transgenic) plant, or a plant cell culture expressing or capable of expressing at least one dsRNA, wherein the dsRNA comprises annealed complementary strands, one of which has a nucleotide sequence which is complementary to at least part of a target nucleotide sequence of a target gene of an insect, such that the dsRNA is taken up by an insect upon plant-insect interaction, said double stranded RNA being capable of inhibiting the target gene or down-regulating expression of the target gene by RNA interference.
  • the target gene may be any of the target genes herein described, for instance a target gene that is essential for the viability, growth, development or reproduction of the insect.
  • a plant may be provided in a form that is actively expressing (transcribing) a dsRNA in one or more cells, cell types or tissues.
  • a plant may be “capable of expressing”, meaning that it is transformed with a transgene which encodes the desired dsRNA but that the transgene is not active in the plant when (and in the form in which) the plant is supplied.
  • a recombinant DNA construct comprising a nucleotide sequence encoding a dsRNA or dsRNA construct may be thus be operably linked to at least one regulatory sequence.
  • the regulatory sequence is selected from the group comprising constitutive promoters or tissue specific promoters as described below.
  • a target gene may be any target gene herein described.
  • a regulatory element is a regulatory element that is active in a plant cell. More preferably, the regulatory element is originating from a plant.
  • the term “regulatory sequence” is to be taken in a broad context and refers to a regulatory nucleic acid capable of effecting expression of the sequences to which it is operably linked.
  • promoters and nucleic acids or synthetic fusion molecules or derivatives thereof which activate or enhance transcription of a nucleic acid so called activators or enhancers.
  • operably linked refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest.
  • the transgene nucleotide sequence encoding the dsRNA could be placed under the control of an inducible or growth or developmental stage-specific promoter which permits transcription of the dsRNA to be turned on, by the addition of the inducer for an inducible promoter or when the particular stage of growth or development is reached.
  • the transgene encoding the dsRNA is placed under the control of a strong constitutive promoter such as any selected from the group comprising the CaMV35S promoter, doubled CaMV35S promoter, ubiquitin promoter, actin promoter, rubisco promoter, GOS2 promoter, Figwort mosaic virus (FMV) 34S promoter, cassaya vein mosaic virus (CsVMV) promoter (Verdaguer B. et al, Plant Mol. Biol. 1998 37(6):1055-67).
  • a strong constitutive promoter such as any selected from the group comprising the CaMV35S promoter, doubled CaMV35S promoter, ubiquitin promoter, actin promoter, rubisco promoter, GOS2 promoter, Figwort mosaic virus (FMV) 34S promoter, cassaya vein mosaic virus (CsVMV) promoter (Verdaguer B. et al, Plant Mol. Biol. 1998 37(6):1055-67).
  • the transgene encoding the dsRNA is placed under the control of a tissue specific promoter such as any selected from the group comprising root specific promoters of genes encoding PsMTA Class III chitinase, photosynthetic tissue-specific promoters such as promoters of cab1 and cab2, rbcS, gapA, gapB and ST-LS1 proteins, JAS promoters, chalcone synthase promoter and promoter of RJ39 from strawberry.
  • a tissue specific promoter such as any selected from the group comprising root specific promoters of genes encoding PsMTA Class III chitinase, photosynthetic tissue-specific promoters such as promoters of cab1 and cab2, rbcS, gapA, gapB and ST-LS1 proteins, JAS promoters, chalcone synthase promoter and promoter of RJ39 from strawberry.
  • a transgene encoding the dsRNA may also be placed under the control of an insect-induced promoter, for instance the potato proteinase inhibitor II (PinII) promoter (Duan X et al, Nat. Biotechnol. 1996, 14(4):494-8)); or a wounding-induced promoter, for instance the jasmonates and ethylene induced promoters, PDF1.2 promoter (Manners J Metal., Plant Mol. Biol. 1998, 38(6):1071-80); or under a defense related promoter, for instance the salicylic acid induced promoters and plant-pathogenesis related protein (PR protein) promoters (PR1 promoter (Cornelissen B J et al., Nucleic Acids Res. 1987, 15(17):6799-811; COMT promoter (Toquin V et. al., Plant Mol. Biol. 2003, 52(3):495-509).
  • an insect-induced promoter for instance the potato proteinase inhibitor II (Pin
  • the plants When using the methods described herein for developing transgenic plants resistant against insects, it may be beneficial to place the nucleic acid encoding the dsRNA under the control of a tissue-specific promoter.
  • the plants could preferably express the dsRNA in a plant part that is first accessed or damaged by the plant pest.
  • preferred tissues to express the dsRNA are the leaves, stems, roots, and seeds.
  • a plant tissue-preferred promoter may be used, such as a leaf-specific promoter, a stem-specific promoter, a phloem-specific promoter, a xylem-specific promoter, a root-specific promoter, or a seed-specific promoter (sucrose transporter gene AtSUC promoter (Baud S et al., Plant J. 2005, 43(6):824-36), wheat high molecular weight glutenin gene promoter (Robert L S et al., Plant Cell. 1989, 1(6):569-78.)).
  • Suitable examples of a root specific promoter are PsMTA (Fordam-Skelton, A. P., et al., 1997 Plant Molecular Biology 34: 659-668.) and the Class III Chitinase promoter.
  • leaf- and stem-specific or photosynthetic tissue-specific promoters that are also photoactivated are promoters of two chlorophyll binding proteins (cab1 and cab2) from sugar beet (Stahl D. J., et al., 2004 BMC Biotechnology 2004 4:31), ribulose-bisphosphate carboxylase (Rubisco), encoded by rbcS (Nomura M. et al., 2000 Plant Mol. Biol.
  • a (gapA) and B (gapB) subunits of chloroplast glyceraldehyde-3-phosphate dehydrogenase (Conley T. R. et al. 1994 Mol. Cell. Biol. 19: 2525-33; Kwon H. B. et al. 1994 Plant Physiol. 105: 357-67), promoter of the Solanum tuberosum gene encoding the leaf and stem specific (ST-LS1) protein (Zaidi M. A. et al., 2005 Transgenic Res. 14:289-98), stem-regulated, defense-inducible genes, such as JAS promoters (patent publication no. 20050034192/US-A1).
  • a flower-specific promoter is for instance, the chalcone synthase promoter (Faktor O. et al. 1996 Plant Mol. Biol. 32: 849) and an example of a fruit-specific promoter is for instance RJ39 from strawberry (WO 98 31812).
  • promoters useful for the expression of dsRNA include, but are not limited to, promoters from an RNA Poll, an RNA Poll, an RNA PolIII, T7 RNA polymerase or SP6 RNA polymerase. These promoters are typically used for in vitro-production of dsRNA, which dsRNA is then included in an anti-insecticidal agent, for example, in an anti-insecticidal liquid, spray or powder.
  • the dsRNA or RNA constructs described herein may be generated by the steps of (i) contacting an isolated nucleic acid or a recombinant DNA construct with cell-free components; or (ii) introducing (e.g., by transformation, transfection or injection) an isolated nucleic acid or a recombinant DNA construct into a cell, under conditions that allow transcription of the nucleic acid or recombinant DNA construct to produce the dsRNA or RNA construct.
  • transcription termination sequences may also be incorporated in the recombinant construct.
  • transcription termination sequence encompasses a control sequence at the end of a transcriptional unit, which signals 3′ processing and poly-adenylation of a primary transcript and termination of transcription. Additional regulatory elements, such as transcriptional or translational enhancers, may be incorporated in the expression construct.
  • Recombinant constructs may further include an origin of replication which is required for maintenance and/or replication in a specific cell type.
  • an origin of replication which is required for maintenance and/or replication in a specific cell type.
  • an expression construct is required to be maintained in a bacterial cell as an episomal genetic element (e.g., plasmid or cosmid molecule) in a cell.
  • Preferred origins of replication include, but are not limited to, fl-ori and colE1 ori.
  • Recombinant construct may optionally include a selectable marker gene.
  • selectable marker gene includes any gene, which confers a phenotype on a cell in which it is expressed to facilitate the identification and/or selection of cells, which are transfected or transformed, with an expression construct of the invention.
  • suitable selectable markers include resistance genes against ampicillin (Amp r ), tetracycline (Tc r ), kanamycin (Kan r ), phosphinothricin, and chloramphenicol (CAT) gene.
  • Other suitable marker genes provide a metabolic trait, for example manA.
  • Visual marker genes may also be used and include for example beta-glucuronidase (GUS), luciferase and Green Fluorescent Protein (GFP).
  • Plants that have been stably transformed with a transgene encoding the dsRNA may be supplied as seed, reproductive material, propagation material or cell culture material which does not actively express the dsRNA but has the capability to do so.
  • the plant may be provided in a form wherein it is actively expressing (transcribing) the RNA molecule in one or more cells, cell types or tissues.
  • the plant may be “capable of expressing”, meaning that it is transformed with a transgene which encodes the desired RNA molecule but that the transgene is not active in the plant when (and in the form in which) the plant is supplied.
  • Many vectors are available for this purpose, and selection of the appropriate vector will depend mainly on the size of the nucleic acid to be inserted into the vector and the particular host cell to be transformed with the vector.
  • RNA silencing in plants the contents of which are incorporated herein by reference. More particularly, methods for expression of dsRNA in plants for the purposes of down-regulating gene expression in plant pests such as nematodes or insects are also known in the art. Similar methods can be applied in an analogous manner in order to express dsRNA in plants for the purposes of down-regulating expression of a target gene in a plant pathogenic insect.
  • the plant In order to achieve this effect it is necessary only for the plant to express (transcribe) the dsRNA in a part of the plant which will come into direct contact with the insect, such that the dsRNA can be taken up by the insect.
  • expression of the dsRNA could occur within a cell or tissue including the vasculature of a plant within which the insect is also present during its life cycle, or the RNA may be secreted into a space between cells, such as the apoplast, that is occupied by the insect during its life cycle.
  • the dsRNA may be located in the plant cell, for example in the cytosol, or in the plant cell organelles such as a chloroplast, mitochondrion, vacuole or endoplastic reticulum. dsRNA may further be expressed in and/or transported to the phloem, e.g., leaf phloem, where it may be taken up by sap sucking pests. See Pitino et al., PLoS ONE, 6(10):e25709 (2011) and Mlotshwa et al., Plant Cell, 14:S289-S301 (2002).
  • Bronze bug larvae are exposed to the extracellular environment including the vasculature and to intracellular contents, due to ingestion (e.g., ingestion of apoplasts) or cell lysis.
  • ingestion e.g., ingestion of apoplasts
  • cell lysis e.g., cell lysis
  • the dsRNA may be secreted by the plant cell and by the plant to the exterior of the plant.
  • the dsRNA may form a protective layer on the surface of the plant.
  • the invention also provides combinations of methods and compositions for preventing or protecting plants from pest infestation.
  • one means provides using the plant transgenic approach combining methods using expression of dsRNA molecules and methods using expression of Bt insecticidal proteins.
  • the invention relates to a composition for controlling insect growth and/or preventing or reducing insect infestation, comprising at least a plant part, plant cell, plant tissue or seed comprising at least one dsRNA, wherein said dsRNA comprises annealed complementary strands, one of which has a nucleotide sequence which is complementary to at least part of a nucleotide sequence of an insect target gene.
  • the composition further comprises at least one suitable carrier, excipient or diluent.
  • the target gene may be any target gene described herein.
  • the insect target gene is essential for the viability, growth, development or reproduction of the insect.
  • RNA molecule or host cell meaning “at least one” RNA molecule or host cell.
  • the methods of the invention rely on uptake by the insect of dsRNA present outside of the insect (e.g., by feeding) and does not require expression of dsRNA within cells of the insect.
  • the present invention also encompasses methods as described above wherein the insect is contacted with a composition comprising the dsRNA.
  • the invention further provides a method for down-regulating expression of at least one target gene in a target organism (which is capable of ingesting a plant, plant part, plant cell or seeds) comprising feeding a plant, plant part, plant cell or seed to the target organism which plant, plant part, plant cell or seed expresses dsRNA.
  • the invention provides a method for down-regulating expression of at least one target gene in a target organism (which is capable of ingesting a host cell, or extracts thereof) comprising feeding a host plant, plant part, plant cell or seed to the target organism which host plant, plant part, plant cell or seed expresses a dsRNA molecule comprising a nucleotide sequence complementary to or representing the RNA equivalent of at least part of the nucleotide sequence of the at least one target gene, whereby the ingestion of the host cell, host plant, plant part, plant cell or seed by the target organism causes and/or leads to down-regulation of expression of the at least one target gene.
  • the invention provides for use of a plant, plant part, plant cell or seed as defined herein for down regulation of expression of an insect target gene.
  • the invention provides for use of a host cell as defined herein and/or an RNA molecule comprising a nucleotide sequence that is the RNA complement of or that represents the RNA equivalent of at least part of the nucleotide sequence of a target gene from a target organism, as produced by transcription of a nucleic acid molecule in a plant, plant part, plant cell or seed, for instance in the manufacture of a commodity product, for down regulation of expression of a target gene.
  • the methods of the invention rely on a genetically modified organism (GMO) approach wherein the dsRNA is expressed by a cell or an organism infested with or susceptible to infestation by insects.
  • GMO genetically modified organism
  • said cell is a plant cell or said organism is a plant.
  • dsRNA is introduced and/or expressed in an insect cell, either directly or indirectly.
  • dsRNA can be added to an insect diet artificially or produced by a transgenic source of food such as bacteria and plants [2,8].
  • Transgenic plants transcribing inverted repeat RNAs comprised of insect gene specific sequences, can process it to dsRNA and later into siRNA (small interfering RNA that are the first product in the silencing pathway). Insects digesting such transgenic plants are affected by the plant synthesized dsRNA and siRNA [5].
  • This insect control method can be utilized to protect plants efficiently against specific pests [2,8]. It is not required, however, that dsRNA be processed to siRNA in plant material. dsRNA may be ingested by the insect pest and processed to siRNA for the first time within the insect cell.
  • NT polynucleotide Numerous methods for introducing foreign genes into plants are known and can be used to insert an NT polynucleotide into a plant host, including biological and physical plant transformation protocols. See, e.g., Mild et al., “Procedure for Introducing Foreign DNA into Plants,” in Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson, eds., CRC Press, Inc., Boca Raton, pp. 67-88 (1993). The methods chosen vary with the host plant, and include chemical transfection methods such as calcium phosphate, microorganism-mediated gene transfer such as Agrobacterium (Horsch et al., Science 227:1229-31 (1985)), electroporation, micro-injection, and biolistic bombardment.
  • chemical transfection methods such as calcium phosphate
  • microorganism-mediated gene transfer such as Agrobacterium (Horsch et al., Science 227:1229-31 (1985)
  • the isolated polynucleotides or polypeptides may be introduced into the plant by one or more techniques typically used for direct delivery into cells. Such protocols may vary depending on the type of organism, cell, plant or plant cell, i.e., monocot or dicot, targeted for gene modification. Suitable methods of transforming plant cells include microinjection (Crossway, et al., (1986) Biotechniques 4:320-334; and U.S. Pat. No. 6,300,543), electroporation (Riggs, et al., (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, direct gene transfer (Paszkowski et al., (1984) EMBO J.
  • A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria, which genetically transform plant cells.
  • the Ti and Ri plasmids of A. tumefaciens and A. rhizogenes carry genes responsible for genetic transformation of plants. See, e.g., Kado, (1991) Crit. Rev. Plant Sci. 10:1.
  • the gene can be inserted into the T-DNA region of a Ti or Ri plasmid derived from A. tumefaciens or A. rhizogenes , respectively.
  • expression cassettes can be constructed as above, using these plasmids.
  • Many control sequences are known which when coupled to a heterologous coding sequence and transformed into a host organism show fidelity in gene expression with respect to tissue/organ specificity of the original coding sequence. See, e.g., Benfey and Chua, (1989) Science 244:174-81.
  • Particularly suitable control sequences for use in these plasmids are promoters for constitutive leaf-specific expression of the gene in the various target plants.
  • NOS nopaline synthase gene
  • the NOS promoter and terminator are present in the plasmid pARC2, available from the American Type Culture Collection and designated ATCC 67238. If such a system is used, the virulence (vir) gene from either the Ti or Ri plasmid must also be present, either along with the T-DNA portion, or via a binary system where the vir gene is present on a separate vector.
  • vir nopaline synthase gene
  • Such systems, vectors for use therein, and methods of transforming plant cells are described in U.S. Pat. No. 4,658,082; U.S. patent application Ser. No. 913,914, filed Oct. 1, 1986, as referenced in U.S. Pat. No. 5,262,306, issued Nov. 16, 1993; and Simpson, et al., (1986) Plant Mol. Biol. 6:403-15m all incorporated by reference in their entirety.
  • these plasmids can be placed into A. rhizogenes or A. tumefaciens and these vectors used to transform cells of plant species, which are ordinarily susceptible to Fusarium or Alternaria infection.
  • A. tumefaciens or A. rhizogenes will depend on the plant being transformed thereby.
  • A. tumefaciens is the preferred organism for transformation. Most dicotyledonous plants, some gymnosperms, and a few monocotyledonous plants (e.g., certain members of the Liliales and Arales) are susceptible to infection with A. tumefaciens.
  • A. tumefaciens is the preferred organism for transformation. Most dicotyledonous plants, some gymnosperms, and a few monocotyledonous plants (e.g., certain members of the Liliales and Arales) are susceptible to infection with A. tumefaciens.
  • rhizogenes also has a wide host range, embracing most dicots and some gymnosperms, which includes members of the Leguminosae, Compositae, and Chenopodiaceae. Monocot plants can now be transformed with some success.
  • European Patent Application No. 604 662 A1 discloses a method for transforming monocots using Agrobacterium .
  • European Application No. 672 752 A1 discloses a method for transforming monocots with Agrobacterium using the scutellum of immature embryos. Ishida, et al., discuss a method for transforming maize by exposing immature embryos to A. tumefaciens (Nature Biotechnology 14:745-50 (1996)).
  • these cells can be used to regenerate transgenic plants.
  • whole plants can be infected with these vectors by wounding the plant and then introducing the vector into the wound site. Any part of the plant can be wounded, including leaves, stems and roots.
  • plant tissue in the form of an explant, such as cotyledonary tissue or leaf disks, can be inoculated with these vectors, and cultured under conditions, which promote plant regeneration. Roots or shoots transformed by inoculation of plant tissue with A. rhizogenes or A.
  • tumefaciens containing the gene coding for the fumonisin degradation enzyme, can be used as a source of plant tissue to regenerate fumonisin-resistant transgenic plants, either via somatic embryogenesis or organogenesis. Examples of such methods for regenerating plant tissue are disclosed in Shahin, (1985) Theor. Appl. Genet. 69:235-40; U.S. Pat. No. 4,658,082; Simpson, et al., supra; and U.S. patent application Nos. 913,913 and 913,914, both filed Oct. 1, 1986, as referenced in U.S. Pat. No. 5,262,306, issued Nov. 16, 1993, the entire disclosures therein incorporated herein by reference.
  • a generally applicable method of plant transformation is microprojectile-mediated transformation, where DNA is carried on the surface of microprojectiles measuring about 1 to 4 ⁇ m.
  • the expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m/s which is sufficient to penetrate the plant cell walls and membranes (Sanford, et al., (1987) Part. Sci. Technol. 5:27; Sanford, (1988) Trends Biotech 6:299; Sanford, (1990) Physiol. Plant 79:206; and Klein, et al., (1992) Biotechnology 10:268).
  • Another method for physical delivery of DNA to plants is sonication of target cells as described in Zang, et al., (1991) BioTechnology 9:996.
  • liposome or spheroplast fusions have been used to introduce expression vectors into plants. See, e.g., Deshayes, et al., (1985) EMBO J. 4:2731; and Christou, et al., (1987) Proc. Natl. Acad. Sci. USA 84:3962.
  • Direct uptake of DNA into protoplasts using CaCl 2 precipitation, polyvinyl alcohol, or poly-L-ornithine has also been reported. See, e.g., Hain, et al., (1985) Mol. Gen. Genet. 199:161; and Draper, et al., (1982) Plant Cell Physiol. 23:451.
  • Transformed plant may be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants.
  • Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein.
  • the new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant.
  • Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant.
  • the advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.
  • Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages.
  • the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening.
  • stage one initial tissue culturing
  • stage two tissue culture multiplication
  • stage three differentiation and plant formation
  • stage four greenhouse culturing and hardening.
  • stage one initial tissue culturing
  • the tissue culture is established and certified contaminant-free.
  • stage two the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals.
  • stage three the tissue samples grown in stage two are divided and grown into individual plantlets.
  • the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment.
  • the invention provides methods of producing a plant resistant to a plant pathogenic pest by transforming a plant cell with a recombinant DNA construct or combination of constructs that express a dsRNA; regenerating a plant from the transformed plant cell; and growing the transformed plant cell under conditions suitable for the expression said recombinant DNA construct.
  • the methods of the invention are applicable to Bronze bug species, e.g., Thaumastocoris peregrinus that are susceptible to gene silencing by RNA interference and that are capable of internalizing dsRNA from their immediate environment.
  • the invention is applicable to the insect at any stage in its development. Because insects have a non-living exoskeleton, they cannot grow at a uniform rate and rather grow in stages by periodically shedding their exoskeleton. This process is referred to as molting or ecdysis. The stages between molts are referred to as “instars” and these stages may be targeted according to the invention. Also, insect eggs or live young may also be targeted according to the present invention. All stages in the developmental cycle, which includes metamorphosis in the pterygotes, may be targeted according to the present invention. Thus, individual stages such as larvae, pupae, nymph etc. stages of development may all be targeted.
  • Bronze bug are pests for eucalyptus .
  • the nucleic acids, dsRNAs and methods described herein are thus useful for treating or inhibiting Bronze bug infection and infestation of eucalyptus.
  • the purified mRNA was kept at ⁇ 80° C. until 454 Sequencing was performed.
  • 454 Sequencing was carried out according to standard protocols to provide transcriptomes of the target pest. Sequences were assembled and results annotated on the basis of sequence alignment with known published hemiptera Pea Aphid Acyrthosiphon pisum (Ap) transcriptomes using the Roche software package and annotated using the Blast2Go program, available at http://www.blast2go.org/.
  • RNAi transgenic Dm Drosophila melanogaster
  • BLAST NCBI comparisons using 141 genes identified as being lethal when expressed as RNAi in Drosophila were used to identify 128 orthologous sequences Pea Aphid Acyrthosiphon pisum (Ap). Comparisons using the identified Ap sequences were further used to screen the Bronze bug 454 transcriptome library for potential target genes.
  • Potential Bronze bug target genes were limited to Bronze bug 454 transcriptome sequences that included at least 310 bp in a continuous open reading frame or were at least 50% of the full predicted gene length. The screen of the Bronze bug 454 transcriptome identified 28 potential Bronze bug target sequences.
  • ubiquitin-dependent protein catabolic process (XM_397196) 9 CG2931/nuclear mRNA SEQ ID NO: 11 SEQ ID splicing, via spliceosome NO: 12 (58) (XM_392161) 10 CG31524/procollagen-proline 4- SEQ ID NO: 13 SEQ ID dioxygenase activity.
  • oxidation- NO: 14 (52) reduction process (XM_392392) 12 CG3590/AMP AMP-lyase; SEQ ID NO: 15 SEQ ID purine nucleotide metabolic NO: 16 (59) process (XM_393961) 13 CG5451/nuclear mRNA splicing, SEQ ID NO: 17 SEQ ID via spliceosome (XM_393446) NO: 18 (66) 20 dlg 1/protein binding.anatomical SEQ ID NO: 19 SEQ ID structure development NO: 20 (64) (XM_003251584) 24 e(r)/regulation of transcription SEQ ID NO: 21 SEQ ID from RNA polymerase II NO: 22 (68) promoter (XM_00111990) 26 ebi/regulation of epidermal SEQ ID NO: 23 + SEQ ID growth factor receptor SEQ ID NO: 85 NO: 24 (70) signaling pathway; regulation of cell cycle (XM_003251282) 27 EcR/repressing
  • anatomical NO: 26 (57) structure development; biological regulation (NM_001159355) 28 Efl alpha48D/translation SEQ ID NO: 27 SEQ ID elongation factor activity. NO: 28 (65) determination of adult lifespan (NM_001014993) 29 Efl gamma/translation elon- SEQ ID NO: 29 SEQ ID gation factor autophagic NO: 30 (62) cell death; salivary gland cell autophagic cell deat (XM_623679) 30 eIF-2alpha/translational SEQ ID NO: 31 SEQ ID initiation (XM_001122232) NO: 32 (41) 31 eIF3-S8/translational initiation SEQ ID NO: 33 SEQ ID (XM_623577) NO: 34 (60) 32 eIFS/translational initiation SEQ ID NO: 35 SEQ ID (XM_392511) NO: 36 (55) 34 hay/ATP-dependent DNA SEQ ID NO: 37 or SEQ ID helicase activity (XM_
  • the identified Bronze bug genes were divided into the following categories:
  • SEQ ID NO: 1 5, 7, 9, 21, 25, 27, 29, 31, 33, 35, 47, 49 and 51, respectively.
  • FIG. 1 A schematic of the structure of dsRNA triple silencing constructs comprising segments from three Bronze bug genes is shown in FIG. 1 .
  • Silencing constructs contain two transgenes.
  • a first transgene comprises fragments from each of three Bronze bug genes which are fused and synthesized in inverted repeats, separated by a loop sequence. See FIG. 1A .
  • Transcription of this transgene (initiated at promoter P1 and terminated at T1) produces a hairpin RNA, containing a dsRNA section, formed by annealing of the inverted-repeat sequences of the three Bronze bug genes, and a loop region.
  • a second transgene contains three fused Bronze bug genes, oriented to be transcribed to yield a sense strand with the three gene fragments. See FIGS. 1A and 1C .
  • Silencing Construct #1 is shown schematically in FIG. 2 .
  • Respective 100 bp fragments of each of the Bronze bug CG3590 gene (SEQ ID NO: 15), CG5451 gene (SEQ ID NO: 17) and Ef1 gamma gene (SEQ ID NO: 29) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64).
  • Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60).
  • Transcription termination was provided by the AtActin7 Terminator (SEQ ID NO: 62).
  • the select 100 bp of Bronze bug SEQ ID NO: 15, 17 and 29 (respectively, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 30) were synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 61) to NOS Terminator (SEQ ID NO: 63).
  • Transcription of construct 1 would yield two mRNAs: (1) A hairpin RNA (hpRNA) with a stem formed by the reverse complementary sequences of the three Bronze bug 100 bp sequences, to silence the corresponding Bronze bug genes (see FIG. 2B ); and (2) sense mRNA of the three, fused Bronze bug genes (see FIG. 2C ).
  • hpRNA hairpin RNA
  • the hpRNA formed upon transcription of the hpRNA-forming transgene of Construct #1 has the following sequence (SEQ ID NO: 65):
  • hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 607-706 Respective sense and reverse complement sequences of SEQ ID NO: 16, corresponding to nucleotides 244-343 of SEQ ID NO: 15
  • Nucleotides 101-200 and 507-606 Respective sense and reverse complement sequences of SEQ ID NO: 18, corresponding to nucleotides 438-537 of SEQ ID NO: 17
  • Nucleotides 201-300 and 407-506 Respective sense and reverse complement sequences of SEQ ID NO: 30, corresponding to nucleotides 951-1050 of SEQ ID NO: 29
  • Nucleotides 301-406 106 bp Loop fragment (SEQ ID NO: 64) based on Partial Leptocibe invasa Chitin Synthase intron
  • the sense mRNA transcribed from construct 1 has the following sequence (SEQ ID NO: 66):
  • Silencing Construct #2 is shown schematically in FIG. 3 .
  • Respective 100 bp fragments of each of the Bronze bug eIF3-58 gene (SEQ ID NO: 33), He125E gene (SEQ ID NO: 39+86) and, Uev1A gene (SEQ ID NO: 57) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64). Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60). Transcription termination was provided by the AtActin7 Terminator (SEQ ID NO: 62).
  • SEQ ID NO: 33, 39+86 and 57 (respectively, SEQ ID NO: 34, SEQ ID NO: 40 and SEQ ID NO: 59 (corresponding to nucleotides 181-280 with a T253C substitution) were synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 61) to NOS Terminator (SEQ ID NO: 63).
  • hpRNA hairpin RNA
  • FIG. 3B A hairpin RNA (hpRNA) with a stem formed by the reverse complementary sequences of the three Bronze bug 100 bp sequences, to silence the corresponding Bronze bug genes
  • FIG. 3C sense mRNA of the three, fused Bronze bug genes
  • hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 607-706 Respective sense and reverse complement sequences of SEQ ID NO: 34, corresponding to nucleotides 21-120 of SEQ ID NO: 33
  • Nucleotides 101-200 and 507-606 Respective sense and reverse complement sequences of SEQ ID NO: 40, corresponding to nucleotides 15-114 of SEQ ID NO: 86
  • Nucleotides 201-300 and 407-506 Respective sense and reverse complement sequences of SEQ ID NO: 59, corresponding to nucleotides 181-280 of SEQ ID NO: 57, with a T->C mutation at position 253 of SEQ ID NO: 57, to create an Xba I site.
  • Nucleotides 301-406 106 bp Loop fragment (SEQ ID NO: 64) based on Partial Leptocibe invasa Chitin Synthase intron
  • the sense mRNA transcribed from construct 2 has the following sequence (SEQ ID NO: 68):
  • Silencing Construct #3 is shown schematically in FIG. 4 .
  • Respective 100 bp fragments of each of the Bronze bug Mor gene (SEQ ID NO: 45), Trip gene (SEQ ID NO: 51) and, tws gene (SEQ ID NO: 53) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64).
  • Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60).
  • Transcription termination was provided by the AtActin7 Terminator (SEQ ID NO: 62).
  • the select 100 bp of Bronze bug SEQ ID NO: 45, 51 and 53 (respectively, SEQ ID NO: 46, SEQ ID NO: 52 and SEQ ID NO: 54) were synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 62) to NOS Terminator (SEQ ID NO: 63).
  • hpRNA hairpin RNA
  • FIG. 4B A hairpin RNA with a stem formed by the reverse complementary sequences of the three Bronze bug 100 bp sequences, to silence the corresponding Bronze bug genes
  • FIG. 4C sense mRNA of the three, fused Bronze bug genes
  • the hpRNA formed upon transcription of the hpRNA-forming transgene of Construct #3 has the following sequence (SEQ ID NO: 69):
  • hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 607-706 Respective sense and reverse complement sequences of SEQ ID NO: 46, corresponding to nucleotides 159-258 of SEQ ID NO: 45
  • Nucleotides 101-200 and 507-606 Respective sense and reverse complement sequences of SEQ ID NO: 52, corresponding to nucleotides 1-100 of SEQ ID NO: 51
  • Nucleotides 201-300 and 407-506 Respective sense and reverse complement sequences of SEQ ID NO: 54, corresponding to nucleotides 753-852 of SEQ ID NO: 53
  • Nucleotides 301-406 106 bp Loop fragment (SEQ ID NO: 64) based on Partial Leptocibe invasa Chitin Synthase intron
  • the sense mRNA transcribed from construct 3 has the following sequence (SEQ ID NO: 70):
  • silencing constructs comprising segments from one and two Bronze bug genes are shown in FIG. 5 and FIG. 6 , respectively.
  • Silencing constructs contain two transgenes.
  • a first transgene comprises fragments from each of one (see FIG. 5 ) or two ( FIG. 6 ) Bronze bug genes which are fused (in the case of constructs containing two Bronze bug genes) and synthesized in inverted repeats, separated by a loop sequence. See FIGS. 5A and 6A .
  • This transgene (initiated at promoter P1 and terminated at T1) produces a hairpin RNA, containing a dsRNA section, formed by annealing of the inverted-repeat sequences of the respective Bronze bug genes, and a loop region. See FIGS. 5B and 6B .
  • a second transgene contains the Bronze bug genes, oriented to be transcribed to yield a sense strand with. See FIGS. 5C and 6C .
  • Single gene control sequences are generated using a combination of sequences comprising a first sequence of 100 bp sense-100 bp (approximate) loop-100 bp antisense, where “100 bp sense” and “100 bp antisense” refer to complementary sequences from a target gene, and a second 100-bp sense amplifying sequence.
  • silencing construct #4 100 bp fragments of the Bronze bug tws gene (SEQ ID NO: 53) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64). Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60).
  • AtActin7 Terminator SEQ ID NO: 62.
  • the select 100 bp of Bronze bug SEQ ID NO: 53 was synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 61) to NOS Terminator (SEQ ID NO: 63).
  • Transcription of construct 4 would yield two mRNAs: (1) A hairpin RNA (hpRNA) with a stem formed by the reverse complementary sequences of the Bronze bug 100 bp sequences, to silence the corresponding Bronze bug gene (see FIG. 5B ); and (2) sense mRNA of the Bronze bug gene (see FIG. 5C ).
  • hpRNA hairpin RNA
  • the hpRNA formed upon transcription of the hpRNA-forming transgene of Construct #4 has the following sequence:
  • hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 207-306 Respective sense and reverse complement sequences of SEQ ID NO: 54, corresponding to nucleotides 753-852 of SEQ ID NO: 53;
  • Nucleotides 101-206 106 bp Loop fragment (SEQ ID NO: 61) based on Partial Leptocibe invasa Chitin Synthase intron.
  • the sense mRNA transcribed from construct 4 has the following sequence (SEQ ID NO: 54):
  • Two gene control sequences are generated using a combination of sequences comprising a 100 bp sense sequence 1-100 bp sense sequence 2-100 bp (approximate) loop-100 bp antisense sequence 1-,100 bp sense sequence 2 where “100 bp sense” and “100 bp antisense” refer to complementary sequences from a target gene, and a second 100-bp sense amplifying sequence.
  • silencing construct #5 100 bp fragments of the Bronze bug Trip1 gene (SEQ ID NO: 51) and tws gene (SEQ ID NO: 53) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64). Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60). Transcription termination was provided by the AtActin7 Terminator (SEQ ID NO: 61). The select 100 bp of Bronze bug SEQ ID NO: 51 and 53 (SEQ ID NO: 52 and 54, respectively) were synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 62) to NOS Terminator (SEQ ID NO: 63).
  • Transcription of construct 5 would yield two mRNAs: (1) A hairpin RNA (hpRNA) with a stem formed by the reverse complementary sequences of the Bronze bug 100 bp sequences, to silence the corresponding Bronze bug genes (see FIG. 6B ); and (2) sense mRNA of the Bronze bug gene (see FIG. 6C ).
  • hpRNA hairpin RNA
  • the hpRNA formed upon transcription of the hpRNA-forming transgene of Construct #5 has the following sequence:
  • hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 407-506 Respective sense and reverse complement sequences of SEQ ID NO: 52, corresponding to nucleotides 1-100 of SEQ ID NO: 51;
  • Nucleotides 101-200 and 307-406 Respective sense and reverse complement sequences of SEQ ID NO: 54, corresponding to nucleotides 753-852 of SEQ ID NO: 53;
  • Nucleotides 201-306 106 bp Loop fragment (SEQ ID NO: 64) based on Partial Leptocibe invasa Chitin Synthase intron.
  • the sense mRNA transcribed from construct 5 has the following sequence:
  • RNA constructs are transformed into eucalyptus using a protocol essentially described in Prakash et al., In Vitro Cell Dev Biol. - Plant, 2009, 45:429-434. Briefly, shoots of Eucalyptus are propagated in vitro on Murashige and Skoog (MS) basal salt medium consisting of 3% (w/v) sucrose and 0.8% (w/v) agar. All in vitro plant materials are incubated at 25 ⁇ 2° C. under a 16-h photoperiod with cool white fluorescent lamps with an intensity of 30 ⁇ Em ⁇ 2 s ⁇ 1 .
  • MS Murashige and Skoog
  • tumefaciens strain LBA 4404 harboring a binary vector pBI121 containing nptII gene is used for transformation.
  • Bacterial culture collected at late log phase are pelleted and resuspended in MS basal salt medium. Leaves from in vitro material are collected and used as explants for transformation experiments.
  • Explants are precultured on the MS regeneration medium supplemented with 0.5 mg/l BAP and 0.1 mg/l NAA for 2 d. Precultured leaf explants are gently shaken in the bacterial suspension for 10 min and blotted dry on a sterile filter paper. Explants are then cocultivated in medium under the preculture conditions for 2 d. Following cocultivation, explants are washed in MS liquid medium, blotted dry on a sterile filter paper, and transferred to MS regeneration medium containing 0.5 mg/l BAP and 0.1 mg/l NAA supplemented with 40 mg/l kanamycin and 300 mg/l cefotaxime.
  • RNA from 50 mg fresh transgenic plant tissue was purified using EPICENTRE MasterPureTM Plant RNA Purification Kit (Cat. #MPR09010) following by DNAse treatment with Ambion TURBO DNA-freeTM Dnase (Cat. #AM1907). 1 ⁇ l of total RNA from each sample is analyzed by RT PCR.
  • RT PCR is performed using Invitrogen SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase kit (Cat. #12574-018).
  • the Platinum Taq DNA Polymerase kit (Cat. #12574-018 and #10966-018) is used to recognize traces of DNA contaminations. No fragment amplification is expected for this control.
  • RT-PCR is prepared using primer pairs that generate fragments indicative of the presence and expression of Bronze bug transgenes.
  • RNA concentration can be between 10 ng to 500 ng per microliter.
  • Bronze bugs are incubated for up to 40 days. Data on the number viable and dead bugs data is compiled daily. Candidate lethal sequences and their corresponding lethal target genes are ranked based on live to dead bug ratios data.
  • Eucalyptus plants are transformed with plasmids comprising construct 1, construct 2 or construct 3 (and transgenic lines are established.
  • Controls lines are established by transforming plants with vector alone, without insertion of Bronze bug nucleic acids or without nucleic acids that could form siRNAs.
  • Transgenic, wt, and control eucalyptus plants are grown in insect proof cages in the greenhouse together with adult Bronze bugs.
  • the insect proof cages keep the inoculums in while preventing outside pests from entering the cage.
  • Bronze bug inoculation the appearance of leaf damage is evaluated.
  • Leaf damage can be seen as bronze-like spots or areas on the upper or lower surface of the leaves. These bronze areas are formed by as direct and/or indirect result of the sap-sucking activities of the Bronze Bugs. Plants are examined to determine number of Bronze bugs number of eggs and clusters of eggs on the plant tissues including leaves, reproductive organs, branches, stems, but predominantly on the leaves, and the number of dead or dysfunctional BB specimens found on or adjacent to the plants.
  • the primary endpoints for a resistant plant can be either lack of symptoms, lack of viable pests on the plant surfaces and/or lack of eggs or egg clusters on the plants or retarded or altered growth development of nymphs. In some cases resistant plants may simply cause the contacting pests to become unviable or sterile without causing pest death.
  • Five independent transformation events of transgenic eucalyptus plants transcribing dsRNA are tested. Ten lines of each transformation event are inoculated with adult Bronze bug in 3 independent repeats. Number of vital Bronze Bugs, their size, eggs, clusters of eggs, nymphs, dead bugs are recorded every day for 40 days after inoculation.
  • Transgenic plants transcribing dsRNA targeting BB genes exhibit fewer symptoms, fewer vital Bronze bugs, less eggs and less egg clusters, less newly hatched nymphs, compared to controls.
  • Transgenic plants lines are resistant to BB infection showing less leaf and other tissue damage, compared to control and wt plants that are infected with Bronze bugs.
  • Transgenic eucalyptus will significantly differ from the wt in these parameters:
  • Transgenic trees can have part or all of the above list as a phenotype following Bronze bug infestation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Insects & Arthropods (AREA)
  • Pest Control & Pesticides (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Cosmetics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The present invention relates to the field of RNA-mediated gene silencing in insect species. The present invention is based, in part, on the inventors' sequencing of genes from eucalyptus invasive species Bronze bug pest, Thaumastocoris peregrinus. In certain aspects, the invention provides Bronze bug nucleic acids, derivatives thereof and the use of such nucleic acids and derivatives as Bronze bug control agents.

Description

    SEQUENCE LISTING
  • The instant application contains a Sequence Listing which has been submitted in ASCII format via electronic filing and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Apr. 18, 2013, is named 30407-0003WO1_SL.txt and is 54,868 bytes in size.
  • FIELD OF THE INVENTION
  • The present invention relates to the field of double stranded RNA (dsRNA)-mediated gene silencing in insect species.
  • BACKGROUND
  • Thaumastocoris peregrinus (Bronze bug) is a sap-sucking pest (Order Hemiptera: Thaumastocoridae) exclusively found on eucalyptus trees. Bronze bug infestations have occurred in the Southern hemisphere and pose a threat to commercial eucalyptus farming in Australia, Africa, and South America. Infestations have been observed, for example, in the species E. camaldulensis, E. tereticornis and E. smithii and the hybrids E. grandis×E. camaldulensis and E. grandis×E. urophylla. Bronze bug infestation reduces the photosynthetic ability of the tree, resulting in stunted growth. Severe infestation may cause death of trees. Efforts to control Bronze bug infection of eucalyptus have included attempts to isolate naturally resistant plants and natural predators. Such efforts, however, have met with limited or no success.
  • Certain characteristics of Bronze bug infestations lead to difficulties in controlling infestations with chemical pesticides. Bronze bug infestations tend to spread rapidly. Control of infestation would thus necessitate repeated spraying. Bronze bug, moreover, tend to aggregate in the mid-canopy, which is difficult to penetrate with insecticides. Even if feasible, chemical pesticide control has disadvantages. Chemical pesticides are potentially detrimental to the environment, are not selective and are potentially harmful to non-target crops and fauna. Chemical pesticides persist in the environment and generally are metabolized slowly, or not at all. Chemical pesticides accumulate in the food chain, particularly in the higher predator species where they can act as mutagens and/or carcinogens to cause irreversible and deleterious genetic modifications. Crop pests, moreover, may develop resistance against chemical insecticides because of repetitive usage of the same insecticide or of insecticides having the same mode of action.
  • RNA interference or “RNAi” is a process of sequence-specific down-regulation of gene expression (also referred to as “gene silencing” or “RNA-mediated gene silencing”) initiated by double-stranded RNA (dsRNA) that is complementary in sequence to a region of the target gene to be down-regulated. Down-regulation of target genes in multicellular organisms by means of RNA interference (RNAi) has become a well-established technique. U.S. patent application publications US 2009/0285784 A1 and US 2009/0298787 relate to dsRNA as an insect control agent and are hereby incorporated herein by reference in their respective entireties. U.S. Pat. No. 6,506,559, U.S. patent application publication 2003/00150017 A1, International Publications WO 00/01846, WO 01/37654, WO 2005/019408, WO 2005/049841, WO 05/047300 relate to the use of RNAi to protect plants against insects. International application, PCT/US12/31423, filed Mar. 30, 2012, relates to RNA-mediated control of eucalyptus pests in the Gall Wasp family. Each of the foregoing patents and published applications is hereby incorporated by reference in its entirety.
  • SUMMARY
  • The present invention is based, in part, on the inventors' sequencing of genes from the eucalyptus Bronze bug invasive species, Thaumastocoris peregrinus (hereinafter “Tp” or “Bronze bug”). In certain aspects, the invention thus provides Bronze bug nucleic acids, derivatives thereof and the use of such nucleic acids and derivatives as Bronze bug control agents.
  • In certain aspects the invention provides isolated nucleic acids that hybridize selectively under high stringency hybridization conditions to a sequence set out in SEQ ID NO: 1-59 and 74-87 and complementary sequences thereof.
  • In certain aspects the invention provides isolated nucleic acids that are 90-99.99 percent identical to sequences set out in SEQ ID NO: 1-59 and 74-87 and complementary sequences thereof.
  • In certain aspects the invention provides isolated nucleic acids that include at least 17 contiguous nucleotides of the sequences set out in SEQ ID NO: 1-59 and 74-87 and complementary sequences thereof.
  • In certain aspects the invention provides nucleic acids from Bronze bug, including the nucleic acids set out above, that are about 80% or less identical to the honey bee ortholog of said nucleic acid.
  • In certain aspects the invention provides vectors that include nucleic acids from Bronze bug, or reverse compliments of such sequences, operably linked to an expression control sequence.
  • In certain aspects the invention provides host cells transformed with and/or harboring vectors that include nucleic acids from Bronze bug, or reverse compliments of such sequences, operably linked to an expression control sequence.
  • In certain aspects the invention provides plant tissues, for example, leaf tissue and seeds, transformed with and/or harboring vectors that include nucleic acids from Bronze bug operably linked to an expression control sequence.
  • In certain aspects the invention provides isolated small inhibitory ribonucleic acid (siRNA) molecules that inhibit expression of Bronze bug nucleic acids.
  • In certain aspects the invention provides isolated double stranded ribonucleic acid (dsRNA) molecules that include a first strand of nucleotides that is substantially identical to at least 17 contiguous nucleotides of SEQ ID NO: 1-59 and 74-87 and a second strand of nucleotides that is substantially complementary to the first strand of nucleotides.
  • In certain aspects the invention provides double stranded ribonucleic acid (dsRNA) molecules with a high level of homology (greater than 80%) to mRNA from Bronze bug (Bronze bug targeting dsRNAs), including the dsRNA molecules set out above, that are about 80% or less identical to the honey bee ortholog of the dsRNA.
  • In certain aspects the invention provides vectors that include an expression control sequence operatively linked to a nucleotide sequence that is a template for one or both strands of a dsRNA from Bronze bug.
  • In certain aspects the invention provides host cells transformed with and/or harboring vectors that include an expression control sequence operatively linked to a nucleotide sequence that is a template for one or both strands of a dsRNA from Bronze bug.
  • In certain aspects the invention provides plant tissue transformed with and/or harboring vectors that include an expression control sequence operatively linked to a nucleotide sequence that is a template for one or both strands of a dsRNA from Bronze bug.
  • In certain aspects the invention provides isolated small inhibitory ribonucleic acid (siRNA) molecules that inhibit expression of an essential gene of Bronze bug.
  • In certain aspects the invention provides methods of producing a pest resistant plant by expressing a Bronze bug dsRNA in the plant or in propagative or reproductive material of the plant.
  • In certain aspects the invention provides methods of producing pest resistant eucalyptus by expressing a Bronze bug dsRNA in the eucalyptus or in propagative or reproductive material of the eucalyptus.
  • In certain aspects the invention provides methods of producing eucalyptus resistant to Bronze bug infection and/or infestation by expressing a Bronze bug targeting dsRNA in the eucalyptus or in propagative or reproductive material of the eucalyptus.
  • In certain aspects the invention provides methods of producing a plant resistant to a plant pathogenic pest by transforming a plant cell with a recombinant DNA construct or combination of constructs that express a dsRNA; regenerating a plant from the transformed plant cell; and growing the transformed plant cell under conditions suitable for the expression of the recombinant DNA construct.
  • The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
  • DESCRIPTION OF DRAWINGS
  • FIG. 1 schematically depicts certain, non-limiting nucleic acids according to the invention. (A) Schematic of silencing construct constructed using sequences from three Bronze bug genes. Transgene P1 (Promoter 1) to T1 (Termination sequence 1) encodes a hairpin RNA (hpRNA), constructed by fusing 100 bp from each of three different Bronze bug genes (Bb1, Bb2 and Bb3), by synthesizing the resulting sequence as an inverted repeat, and inserting a loop sequence between the respective sense and inverted repeat sequences. Transgene P2 (Promoter 2) to T2 (termination sequence 2) encodes an mRNA with the respective fused 100 bp sequences from the three Bronze bug genes. mRNA transcribed from transgene P2 to T2 is the template for cytoplasmic enhancement of the silencing signal. (B) Schematic of hpRNA molecule produced by transcription of transgene P1 to T1. (C) Schematic of mRNA produced by transcription of transgene P2 to T2.
  • FIG. 2 schematically depicts certain, non-limiting nucleic acids according to the invention. (A) Schematic of silencing construct #1, constructed from sequences from three Bronze bug genes in accordance with the general scheme depicted in FIG. 1. (B) Schematic of hpRNA molecule produced by transcription of transgene P1 to T1. (C) Schematic of mRNA produced by transcription of transgene P2 to T2. Definitions: P1—CaMV 35S Promoter (SEQ ID NO: 60); P2—sgFIMV Promoter (SEQ ID NO: 61); T1—AtActin7 Terminator (SEQ ID NO: 62); T2—Nos Terminator (SEQ ID NO: 63); Bb12—SEQ ID NO: 16; Bb13—SEQ ID NO: 18; Bb29—SEQ ID NO: 30; L—loop sequence site (SEQ ID NO: 64).
  • FIG. 3 schematically depicts certain, non-limiting nucleic acids according to the invention. (A) Schematic of silencing construct #2, constructed from sequences from three Bronze bug genes in accordance with the general scheme depicted in FIG. 1. (B) Schematic of hpRNA molecule produced by transcription of transgene P1 to T1. (C) Schematic of mRNA produced by transcription of transgene P2 to T2. Definitions: P1—CaMV 35S Promoter (SEQ ID NO: 60); P2—sgFIMV Promoter (SEQ ID NO: 61); T1—AtActin7 Terminator (SEQ ID NO: 62); T2—Nos Terminator (SEQ ID NO: 63); Bb31—SEQ ID NO: 34; Bb35—SEQ ID NO: 40; Bb56—SEQ ID NO: 59; L—loop sequence site (SEQ ID NO: 64).
  • FIG. 4 schematically depicts certain, non-limiting nucleic acids according to the invention. (A) Schematic of silencing construct #3, constructed from sequences from three Bronze bug genes in accordance with the general scheme depicted in FIG. 1 (B) Schematic of hpRNA molecule produced by transcription of transgene P1 to T1. (C) Schematic of mRNA produced by transcription of transgene P2 to T2. Definitions: P1—CaMV 35S Promoter (SEQ ID NO: 60); P2—sgFIMV Promoter (SEQ ID NO: 61); T1—AtActin7 Terminator (SEQ ID NO: 62); T2—Nos Terminator (SEQ ID NO: 63); Bb41—SEQ ID NO: 46; Bb53-SEQ ID NO: 52; Bb54—SEQ ID NO: 54 L—loop sequence site (SEQ ID NO: 64).
  • FIG. 5 schematically depicts certain, non-limiting nucleic acids according to the invention. (A) Schematic of silencing construct constructed using sequences from a single Bronze bug gene. Transgene P1 to T1 encodes a hairpin RNA (hpRNA) for silencing Bronze bug, constructed from 100 bp of a Bronze bug gene, by synthesizing the sequence as an inverted repeat, and inserting a loop sequence between the respective sense and inverted repeat sequences. Transgene P2 to T2 encodes an mRNA with the 100 bp sequence from the Bronze bug gene. mRNA transcribed from transgene P2 to T2 is the template for cytoplasmic enhancement of the silencing signal. (B) Schematic of hpRNA molecule produced by transcription of transgene P1 to T1. (C) Schematic of mRNA produced by transcription of transgene P2 to T2.
  • FIG. 6 schematically depicts certain, non-limiting nucleic acids according to the invention. (A) Schematic of silencing construct constructed using sequences from two Bronze bug genes. Transgene P1 to T1 encodes a hairpin RNA (hpRNA) for silencing Bronze bug, constructed by fusing 100 bp from each of two different Bronze bug genes, by, synthesizing the resulting sequence as an inverted repeat, and inserting a loop sequence between the respective sense and inverted repeat sequences. Transgene P2 to T2 encodes an mRNA with the respective fused 100 bp sequences from the two Bronze bug genes. mRNA transcribed from transgene P2 to T2 is the template for cytoplasmic enhancement of the silencing signal. (B) Schematic of hpRNA molecule produced by transcription of transgene P1 to T1. (C) Schematic of mRNA produced by transcription of transgene P2 to T2.
  • Like reference symbols in the various drawings indicate like elements.
  • DETAILED DESCRIPTION
  • The inventors have conducted transcriptome sequencing of the natural eucalyptus pest, Bronze bug Thaumastocoris peregrinus (Tp) and mined the respective transcriptomes to identify open reading frames Bronze bug genes that correspond to Bronze bug mRNAs. The identification of Bronze bug RNAs allows for the design of siRNA and dsRNA that mediate downregulation (silencing) of Bronze bug genes. Such siRNA and dsRNAs are thus useful as biological control agents to kill or inhibit the development of Bronze bug and inhibit Bronze bug infection of plants.
  • Accordingly, the present invention describes a nucleic acid based approach for the control of Bronze bug pests. Such nucleic acid based approaches include, without limitation, approaches based on expression of Bronze bug double-stranded (dsRNA), antisense RNA, and mRNA.
  • The methods of the invention find practical application in any area of technology where it is desirable to inhibit viability, growth, development or reproduction of Bronze bugs, or to decrease pathogenicity or infectivity of the insect. The methods of the invention further find practical application where it is desirable to specifically down-regulate expression of one or more target genes in a Bronze bug insect. Particularly useful practical applications include, but are not limited to, protecting plants against Bronze bug pest infestation.
  • In certain aspects, an active ingredient for controlling Bronze bug infestation is a double-stranded RNA (dsRNA) or a nucleic acid that can promote or lead to production of a dsRNA, which can be used as an insecticidal formulation. dsRNA can be expressed in a host plant, plant part, plant cell or seed to protect the plant against Bronze bugs. The sequence of the dsRNA corresponds to part or whole of an essential Bronze bug gene and causes downregulation of the insect target gene via RNA interference (RNAi). As a result of the downregulation of mRNA, the dsRNA prevents expression of the target insect protein and causes death, growth arrest or sterility of the insect. In this aspect, siRNA control of insect growth, for preventing insect infestation of a cell or a plant susceptible to insect infection, is effected by contacting insects with a dsRNA produced by annealed complementary strands, one of which has a nucleotide sequence which is complementary to at least part of the nucleotide sequence of an insect target gene. dsRNA is expressed in plant tissue that is ingested by the insect and then taken up by the insect through the gut, and thereby controls growth or prevents infestation. See Huvenne et al., 2010, J Insect Physiol 56: 227-35.
  • Bronze bug target genes for siRNA-mediated intervention include are preferably non-redundant, vital genes. Vital target genes may be any gene that when inhibited interferes with growth or survival or pathogenicity or infectivity of the insect. Such vital target genes are essential for viability, growth, development or reproduction of the insect, or any gene that is involved with pathogenicity or infectivity of the insect, such that specific inhibition of the target gene leads to a lethal phenotype or decreases or stops insect infestation. Down regulation of such vital target genes, whose activity cannot be complemented by other related genes, results in significant damage to the pest larvae and provides an efficient pest control system for sessile Bronze bug pests. The target gene may be any of the target genes herein described, for instance a target gene that is essential for the viability, growth, development or reproduction of the pest. Examples of target genes include, for example, genes that are involved in protein synthesis and/or metabolism and/or RNA synthesis and metabolism and/or cellular processes. A slight knockdown of these target genes will have an effect on many other genes and processes ultimately leading to a lethal effect on the target pest. Such a down-regulated target gene will result in the death of the insect, or the reproduction or growth of the insect being stopped or delayed. Such target genes are vital for the viability of the insect and are referred to as vital genes.
  • Potential target genes may be identified based on homologies to genes in other insect species. Published genome-wide RNAi mediated gene interference libraries (15, 16) may be used to identify genes that are lethal to other organisms when RNAi based on these genes is expressed and incorporated into target pest organisms by ingestion or any other means. Thus genes identified as being RNAi-lethal in Drosophila may be used to screen for orthologs in hymenoptera species. Such hymenoptera orthologs may further be used to screen Bronze bug species for potential targets.
  • Adult Bronze bug insects live for approximately 40 days. Females can produce at least 60 eggs during that time period (2 per day for 30 days). Eggs may be deposited singly or in clusters and may be deposited anywhere on a tree, but are typically deposited in clusters on leaves. The laying of virgin eggs is reported for this genus. At 17-22° C. the eggs hatch in approximately six days. Bronze bug development progresses through five stadia, taking approximately 4.6, 3.5, 3.3, 3.7 and 5.3 days, respectively. Bronze bug may be induced, e.g., by agitation, to lay eggs on unnatural surfaces, for example, the side of a vial.
  • Nucleotide sequences of Bronze bug target genes include, for example, the sequences set out in SEQ ID NO: 1-59 and 74-87 the complements of such sequences, the reverse complements of such sequences, and sequences that selectively hybridize to such sequences and complements under high stringency hybridization conditions. Examples of target genes include, without limitation, AMP, WD40, TEF, ETI, RNA_HEL, UBIQ_LIG, Mor and TIF.
  • Nucleotide sequences useful for dsRNA-mediated downregulation of Bronze bug target genes include, for example, (i) a sequences set out in SEQ ID NO: 1-59 and 74-87 and the complements of such sequences; (ii) sequences which are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.9% identical to a sequence set out in SEQ ID NO: 1-59 and 74-87 and the complements of such sequences; (iii) sequences comprising at least 17 contiguous nucleotides of SEQ ID NO: 1-59 and 74-87 and the complements of such sequences; and (iv) sequences that selectively hybridize to such sequences and complements under high stringency hybridization conditions.
  • An “isolated” nucleic acid as used herein is a nucleic that has been identified and separated and/or recovered from a component of its natural environment.
  • “Controlling pests” as used herein means killing pests, or preventing pests to develop, or to grow or preventing pests to infect or infest. Controlling pests as used herein also encompasses controlling pest progeny (development of eggs). Controlling pests as used herein also encompasses inhibiting viability, growth, development or reproduction of the pest, or to decrease pathogenicity or infectivity of the pest. The compounds and/or compositions described herein, may be used to keep an organism healthy and may be used curatively, preventively or systematically to control pests or to avoid pest growth or development or infection or infestation.
  • Particular pests envisaged for control by methods described herein are plant pathogenic insect pests. “Controlling insects” as used herein thus encompasses controlling insect progeny (such as development of eggs). Controlling insects as used herein also encompasses inhibiting viability, growth, development or reproduction of the insect, or decreasing pathogenicity or infectivity of the insect. As used herein, controlling insects may refer to inhibiting a biological activity in an insect, resulting in one or more of the following attributes: reduction in feeding by the insect, reduction in viability of the insect, death of the insect, inhibition of differentiation and development of the insect, absence of or reduced capacity for sexual reproduction by the insect.
  • The compounds and/or compositions described herein, may be used to keep an organism healthy and may be used curatively, preventively or systematically to control an insect or to avoid insect growth or development or infection or infestation. Thus, the invention may allow previously susceptible organisms to develop resistance against infestation by the insect organism.
  • The term “complementary to at least part of” refers to a nucleotide sequence that is fully complementary to the nucleotide sequence of the target over more than ten nucleotides, for instance over at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more contiguous nucleotides. Notwithstanding the above, “complementary to at least part” of may also include complementary sequences that are greater than 80% complementary to a nucleotide sequence of a target sequence over a length of more than 20 nucleotides, for instance over at least 20, 21, 22, 23, 24 or more contiguous nucleotides [13, 14].
  • In certain aspects, the invention provides a method for down-regulating expression of a target gene in an insect, comprising contacting the insect with a dsRNA, wherein the dsRNA comprises annealed complementary strands, one of which has a nucleotide sequence that is complementary to at least part of the nucleotide sequence of the insect target gene to be down-regulated, whereby the dsRNA is taken up into the insect and thereby down-regulates expression of the insect target gene.
  • The term “insect” encompasses insects of all types and at all stages of development, including egg, larval or nymphal, pupal and adult stages.
  • As used herein, the term “plant” encompasses any plant material that it is desired to treat to prevent or reduce insect growth and/or insect infestation. This includes, inter alia, whole plants, seedlings, propagation or reproductive material such as seeds, cuttings, grafts, explants, etc., and also plant cell and tissue cultures. The plant material should express, or have the capability to express, the RNA molecule comprising at least one nucleotide sequence that is the RNA complement of or that represents the RNA equivalent of at least part of the nucleotide sequence of the sense strand of at least one target gene of the pest organism, such that the RNA molecule is taken up by a pest upon plant-pest interaction, said RNA molecule being capable of inhibiting the target gene or down-regulating expression of the target gene by RNA interference.
  • The terms “down-regulation of gene expression” and “inhibition of gene expression” are used interchangeably and refer to a measurable or observable reduction in gene expression or a complete abolition of detectable gene expression, at the level of protein product and/or mRNA product from the target gene. The down-regulation effect of the dsRNA on gene expression may be calculated as being at least 30%, 40%, 50%, 60%, preferably 70%, 80% or even more preferably 90% or 95% when compared with normal gene expression. Depending on the nature of the target gene, down-regulation or inhibition of gene expression in cells of an insect can be confirmed by phenotypic analysis of the cell or the whole insect or by measurement of mRNA or protein expression using molecular techniques such as RNA solution hybridization, PCR, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, or fluorescence-activated cell analysis (FACS).
  • Down-regulation of an essential gene leads to growth inhibition. Depending on the assay used, the growth inhibition can be quantified as being greater than about 5%, 10%, more preferably about 20%, 25%, 33%, 50%, 60%, 75%, 80%, most preferably about 90%, 95%, or about 99% as compared to a pest organism that has been treated with control dsRNA.
  • The “target gene” may be essentially any gene that is desirable to be inhibited because it interferes with growth or pathogenicity or infectivity of the insect. For instance, if the method of the invention is to be used to prevent insect growth and/or infestation then it is preferred to select a target gene which is essential for viability, growth, development or reproduction of the insect, or any gene that is involved with pathogenicity or infectivity of the insect, such that specific inhibition of the target gene leads to a lethal phenotype or decreases or stops insect infestation.
  • According to one non-limiting embodiment, the target gene is such that when its expression is down-regulated or inhibited using the method of the invention, the insect is killed, or the reproduction or growth of the insect is stopped or retarded. This type of target gene is considered to be essential for the viability of the insect and is referred to as essential genes. Therefore, the present invention encompasses a method as described herein, wherein the target gene is an essential gene.
  • Without being bound by theory, the target gene is such that when it is down-regulated the infestation or infection by the insect, the damage caused by the insect, and/or the ability of the insect to infest or infect host organisms and/or cause such damage, is reduced. The terms “infest” and “infect” or “infestation” and “infection” are generally used interchangeably throughout. This type of target genes is considered to be involved in the pathogenicity or infectivity of the insect. Therefore, the present invention extends to methods as described herein, wherein the target gene is involved in the pathogenicity or infectivity of the insect. The advantage of choosing the latter type of target gene is that the insect is blocked to infect further plants or plant parts and is inhibited to form further generations.
  • In dsRNA-mediated methods of controlling growth or infestation of a specific insect in or on a host cell or host organism, it is preferred that the dsRNA does not share any significant homology with any host gene, or at least not with any essential gene of the host. In this context, it is preferred that the dsRNA shows less than 30%, more preferably less that 20%, more preferably less than 10%, and even more preferably less than 5% nucleic acid sequence identity with any gene of the host cell. Percent sequence identity should be calculated across the full length of the dsRNA region. If genomic sequence data is available for the host organism one may cross-check sequence identity with the dsRNA using standard bioinformatics tools. In one embodiment, there is no sequence identity between the dsRNA and a host sequences over 21 contiguous nucleotides, meaning that in this context, it is preferred that 21 contiguous base pairs of the dsRNA do not occur in the coding sequences (CDS) of the host organism. In another embodiment, there is less than about 10% or less than about 12.5% sequence identity over 24 contiguous nucleotides of the dsRNA with any nucleotide sequence from a host species.
  • dsRNA comprises annealed complementary strands, one of which has a nucleotide sequence which corresponds to a target nucleotide sequence of the target gene to be down-regulated. The other strand of the dsRNA is able to base-pair with the first strand.
  • The expression “target region” or “target nucleotide sequence” of the target insect gene may be any suitable region or nucleotide sequence of the gene. The target region should comprise at least 17, at least 18 or at least 19 consecutive nucleotides of the target gene, more preferably at least 20 or at least 21 nucleotide and still more preferably at least 22, 23 or 24 nucleotides of the target gene.
  • It is preferred that (at least part of) the dsRNA will share 100% sequence identity with the target region of the insect target gene. However, it will be appreciated that 100% sequence identity over the whole length of the double stranded region is not essential for functional RNA inhibition. RNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for RNA inhibition.
  • The terms “corresponding to” or “complementary to” are used herein interchangeably, and when these terms are used to refer to sequence correspondence between the dsRNA and the target region of the target gene, they are to be interpreted accordingly, i.e., as not absolutely requiring 100% sequence identity. However, the percent sequence identity between the dsRNA and the target region will generally be at least 80% or 85% identical, preferably at least 90%, 95%, 96%, or more preferably at least 97%, 98% and still more preferably at least 99%. Two nucleic acid strands are “substantially complementary” when at least 85% of their bases pair.
  • The term “complementary” as used herein relates to all of DNA-DNA complementarity, RNA-RNA complementarity and to DNA-RNA complementarity. In analogy herewith, the term “RNA equivalent” substantially means that in the DNA sequence(s), the base “T” may be replaced by the corresponding base “U” normally present in ribonucleic acids.
  • Although dsRNA contains a sequence which corresponds to the target region of the target gene, it is not essential for the whole of the dsRNA to correspond to the sequence of the target region. For example, the dsRNA may contain short non-target regions flanking the target-specific sequence, provided that such sequences do not affect performance of the dsRNA in RNA inhibition to a material extent.
  • The dsRNA may contain one or more substitute bases in order to optimize performance in RNAi. It will be apparent to one of ordinary skill in the art how to vary each of the bases of the dsRNA in turn and test the activity of the resulting dsRNAs (e.g., in a suitable in vitro test system) in order to optimize the performance of a given dsRNA.
  • The dsRNA may further contain DNA bases, non-natural bases or non-natural backbone linkages or modifications of the sugar-phosphate backbone, for example to enhance stability during storage or enhance resistance to degradation by nucleases.
  • Interfering RNAs (siRNAs) of about 21 bp are useful for effective gene silencing. Increasing the length of dsRNA preferably to at least about 80-100 bp may increase the efficiency by which dsRNA is taken up by pest organisms. Such longer fragments may be more effective in gene silencing, possibly due to a more efficient uptake of these long dsRNA by the invertebrate.
  • RNA duplexes consisting of either 27-mer blunt or short hairpin (sh) RNAs with 29 bp stems and 2-nt 3′ overhangs may also be used as siRNAs. Thus, molecules based upon the targets identified above and being either 27-mer blunt or short hairpin (sh) RNA's with 29-bp stems and 2-nt 3′ overhangs are also included within the scope of the invention.
  • Therefore, in one embodiment, the dsRNA fragment (or region) will itself preferably be at least 17 bp in length, preferably 18 or 19 bp in length, more preferably at least 20 bp, more preferably at least 21 bp, or at least 22 bp, or at least 23 bp, or at least 24 bp, 25 bp, 26 bp or at least 27 bp in length. The expressions “double-stranded RNA fragment” or “double-stranded RNA region” refer to a small entity of the dsRNA corresponding with (part of) the target gene.
  • More generally, the double stranded RNA is preferably between about 17-1500 bp, even more preferably between about 80-1000 bp and most preferably between about 17-27 bp or between about 80-250 bp; such as double stranded RNA regions of about 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 27 bp, 50 bp, 80 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, 350 bp, 400 bp, 450 bp, 500 bp, 550 bp, 600 bp, 650 bp, 700 bp, 900 bp, 100 bp, 1100 bp, 1200 bp, 1300 bp, 1400 bp or 1500 bp.
  • The upper limit on the length of the dsRNA may be dependent on i) the requirement for the dsRNA to be taken up by the insect and ii) the requirement for the dsRNA to be processed within the cell into fragments that direct RNAi. The chosen length may also be influenced by the method of synthesis of the RNA and the mode of delivery of the RNA to the cell. Preferably the dsRNA to be used in the methods of the invention will be less than 10,000 bp in length, more preferably 1000 bp or less, more preferably 500 bp or less, more preferably 300 bp or less, more preferably 100 bp or less. For any given target gene and insect, the optimum length of the dsRNA for effective inhibition may be determined by experiment.
  • The dsRNA may be fully or partially double-stranded. Partially dsRNAs may include short single-stranded overhangs at one or both ends of the double-stranded portion, provided that the RNA is still capable of being taken up by insects and directing RNAi. The dsRNA may also contain internal non-complementary regions.
  • The methods of the invention encompass the simultaneous or sequential provision of two or more different dsRNAs or RNA constructs to the same insect, so as to achieve down-regulation or inhibition of multiple target genes or to achieve a more potent inhibition of a single target gene.
  • Alternatively, multiple targets are hit by the provision of one dsRNA that hits multiple target sequences, and a single target is more efficiently inhibited by the presence of more than one copy of the double stranded RNA fragment corresponding to the target gene. Thus, in certain aspects, a dsRNA construct comprises multiple dsRNA regions, at least one strand of each dsRNA region comprising a nucleotide sequence that is complementary to at least part of a target nucleotide sequence of an insect target gene. The dsRNA regions in the RNA construct may be complementary to the same or to different target genes and/or the dsRNA regions may be complementary to targets from the same or from different insect species.
  • The terms “hit”, “hits” and “hitting” are alternative wordings to indicate that at least one of the strands of the dsRNA is complementary to, and as such may bind to, the target gene or nucleotide sequence.
  • In one embodiment, the double stranded RNA region comprises multiple copies of the nucleotide sequence that is complementary to the target gene. Alternatively, the dsRNA hits more than one target sequence of the same target gene. The invention thus encompasses isolated double stranded RNA constructs comprising at least two copies of said nucleotide sequence complementary to at least part of a nucleotide sequence of an insect target.
  • The term “multiple” as used herein means at least two, at least three, at least four, at least five, at least six, etc.
  • The expressions “a further target gene” or “at least one other target gene” mean for instance a second, a third or a fourth, etc. target gene.
  • dsRNA that hits more than one of the above-mentioned targets, or a combination of different dsRNA against different of the above mentioned targets are developed and used in the methods of the present invention.
  • dsRNA regions (or fragments) in the double stranded RNA may be combined as follows: a) when multiple dsRNA regions targeting a single target gene are combined, they may be combined in the original order (i.e., the order in which the regions appear in the target gene) in the RNA construct; b) alternatively, the original order of the fragments may be ignored so that they are scrambled and combined randomly or deliberately in any order into the double stranded RNA construct; c) alternatively, one single fragment may be repeated several times, for example from 1 to 10 times, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times, in the ds RNA construct, or d) the dsRNA regions (targeting a single or different target genes) may be combined in the sense or antisense orientation.
  • Multiple dsRNA regions targeting a single or different weak gene(s) may be combined to obtain a stronger RNAi effect. “Insect specific” genes or sequences, e.g., Bronze bug specific, particularly Bronze bug specific genes and sequences, encompass genes that have no substantial homologous counterpart in non-insect organisms as can be determined by bioinformatics homology searches, for example by BLAST searches. The choice of a specific target gene results in a species specific RNAi effect, with no effect or no substantial (adverse) effect in non-target organisms. “Conserved genes” encompass genes that are conserved (at the amino acid level) between the target organism and non-target organism(s). To reduce possible effects on non-target species, such effective but conserved genes are analyzed and target sequences from the variable regions of these conserved genes are chosen to be targeted by the dsRNA regions in the RNA construct. Conservation is assessed at the level of the nucleic acid sequence. Such variable regions thus encompass the least conserved sections, at the level of the nucleic acid sequence, of the conserved target gene(s). The RNA constructs according to the present invention target multiple genes from different biological pathways, resulting in a broad cellular RNAi effect and more efficient insect control. In certain embodiments dsRNAs are constructed from sequences, e.g., Bronze bug transcriptome sequences, that are equal to or less than 80% identical to the sequence of a honey bee ortholog.
  • In certain aspects, dsRNA constructs are constructed with gene sequences that affect different classes of cellular functions. Examples of such classes of cellular function include, without limitation, (i) protein synthesis and metabolism, (ii) RNA synthesis and metabolism, and (iii) cellular processes. In certain embodiments, dsRNA constructs comprise sequences from each of the aforementioned claims, i.e., three classes. In certain embodiments, dsRNA constructs comprise sequences from two of the aforementioned classes, e.g., protein synthesis and metabolism and RNA synthesis and metabolism; protein synthesis and cellular processes; or RNA synthesis and metabolism and cellular processes.
  • dsRNA regions comprise at least one strand that is complementary to at least part or a portion of the nucleotide sequence of any of the target genes herein described. However, provided one of the double stranded RNA regions comprises at least one strand that is complementary to a portion of the nucleotide sequence of any one of the target genes herein described, the other double stranded RNA regions may comprise at least one strand that is complementary to a portion of any other insect target gene (including known target genes).
  • In some constructs, dsRNAs may comprise additional sequences and optionally a linker. Additional sequences may include, for example, (i) a sequence facilitating large-scale production of the dsRNA construct; (ii) a sequence effecting an increase or decrease in the stability of the dsRNA; (iii) a sequence allowing the binding of proteins or other molecules to facilitate uptake of the RNA construct by insects; (iv) a sequence which is an aptamer that binds to a receptor or to a molecule on the surface or in the cytoplasm of an insect to facilitate uptake, endocytosis and/or transcytosis by the insect; or (v) additional sequences to catalyze processing of dsRNA regions. In one embodiment, the linker is a conditionally self-cleaving RNA sequence, preferably a pH sensitive linker or a hydrophobic sensitive linker.
  • Multiple dsRNA regions of the dsRNA construct may be connected directly or by one or more linkers. A linker may be present at a site in the RNA construct, separating dsRNA regions from another region of interest. Multiple dsRNA regions of dsRNA constructs may be connected without linkers.
  • When present, linkers may be used to disconnect smaller dsRNA regions in the pest organism. Advantageously, in this situation the linker sequence may promote division of a long dsRNA into smaller dsRNA regions under particular circumstances, resulting in the release of separate dsRNA regions under these circumstances and leading to more efficient gene silencing by these smaller dsRNA regions. Examples of suitable conditionally self-cleaving linkers are RNA sequences that are self-cleaving at high pH conditions. Suitable examples of such RNA sequences are described by Borda et al. (Nucleic Acids Res. 2003 May 15; 31(10):2595-600), which document is incorporated herein by reference. This sequence originates from the catalytic core of the hammerhead ribozyme HH16.
  • Linkers may also be located at a site in the dsRNA construct, separating the dsRNA regions from another, e.g., an additional, sequence of interest, which preferably provides some additional function to the RNA construct.
  • dsRNA constructs may include aptamers to facilitate uptake of the dsRNA by the insect. The aptamer is designed to bind a substance which is taken up by the insect. Such substances may be from an insect or plant origin. One specific example of an aptamer, is an aptamer that binds to a transmembrane protein, for example a transmembrane protein of an insect. Alternatively, the aptamer may bind a (plant) metabolite or nutrient which is taken up by the insect.
  • Linkers may undergo self-cleaving in the endosome. This may be advantageous when the constructs of the present invention are taken up by the insect via endocytosis or transcytosis, and are therefore compartmentalized in the endosomes of the insect species. The endosomes may have a low pH environment, leading to cleavage of the linker.
  • Linkers that are self-cleaving in hydrophobic conditions are particularly useful in dsRNA constructs when used to be transferred from one cell to another via the transit in a cell wall, for example when crossing the cell wall of an insect pest organism.
  • An intron may be used as a linker. An “intron” as used herein may be any non-coding RNA sequence of a messenger RNA.
  • A non-complementary RNA sequence, ranging from about 1 base pair to about 10,000 base pairs, may also be used as a linker.
  • Without wishing to be bound by any particular theory or mechanism, it is thought that long dsRNAs are taken up by the insect from their immediate environment. dsRNAs taken up into the gut and transferred to the gut epithelial cells are then processed within the cell into short dsRNAs, called small interfering RNAs (siRNAs), by the action of an endogenous endonuclease. The resulting siRNAs then mediate RNAi via formation of a multi-component RNase complex termed the RISC or RNA interfering silencing complex.
  • In order to achieve down-regulation of a target gene within an insect cell the dsRNA added to the exterior of the cell wall may be any dsRNA or dsRNA construct that can be taken up into the cell and then processed within the cell into siRNAs, which then mediate RNAi, or the RNA added to the exterior of the cell could itself be an siRNA that can be taken up into the cell and thereby direct RNAi.
  • siRNAs are generally short dsRNAs having a length in the range of from 19 to 25 base pairs, or from 20 to 24 base pairs. In preferred embodiments siRNAs having 19, 20, 21, 22, 23, 24 or 25 base pairs, and in particular 21 or 22 base pairs, corresponding to the target gene to be down-regulated may be used. However, the invention is not intended to be limited to the use of such siRNAs.
  • siRNAs may include single-stranded overhangs at one or both ends, flanking the double-stranded portion. The siRNA may contain 3′ overhanging nucleotides, preferably two 3′ overhanging thymidines (dTdT) or uridines (UU). 3′ TT or UU overhangs may be included in the siRNA if the sequence of the target gene immediately upstream of the sequence included in double-stranded part of the dsRNA is AA. This allows the TT or UU overhang in the siRNA to hybridize to the target gene. Although a 3′ TT or UU overhang may also be included at the other end of the siRNA it is not essential for the target sequence downstream of the sequence included in double-stranded part of the siRNA to have AA. In this context, siRNAs which are RNA/DNA chimeras are also contemplated. These chimeras include, for example, the siRNAs comprising a dsRNA with 3′ overhangs of DNA bases (e.g., dTdT), as discussed above, and also dsRNAs which are polynucleotides in which one or more of the RNA bases or ribonucleotides, or even all of the ribonucleotides on an entire strand, are replaced with DNA bases or deoxyribonucleotides.
  • dsRNA may be formed from two separate (sense and antisense) RNA strands that are annealed together by (non-covalent) base pairing. Alternatively, the dsRNA may have a foldback stem-loop or hairpin structure, wherein the two annealed strands of the dsRNA are covalently linked. In this embodiment the sense and antisense stands of the dsRNA are formed from different regions of single polynucleotide molecule that is partially self-complementary. RNAs having this structure are convenient if the dsRNA is to be synthesized by expression in vivo, for example in a host cell or organism, or by in vitro transcription. The precise nature and sequence of the “loop” linking the two RNA strands is generally not material to the invention, except that it should not impair the ability of the double-stranded part of the molecule to mediate RNAi. The features of “hairpin” or “stem-loop” RNAs for use in RNAi are generally known in the art (see for example WO 99/53050, the contents of which are incorporated herein by reference). In other embodiments of the invention, the loop structure may comprise linker sequences or additional sequences as described above. In certain aspects, the Bronze bug sequences disclosed herein and the complements of such sequences may also be used to inhibit expression of Bronze bug nucleic acids via expression of antisense RNA or overexpression of sense RNA, using methods well known in the art. See, e.g., Frizzi et al., Plant Biotech J, (2010) 8:655-677; Brodersen et al., Trends in Genetics, (2008) 22:268-280; and U.S. Pat. No. 5,759,829. Using expression elements, vectors and methods described herein, antisense RNAs or sense RNAs for Bronze bug target genes are expressed in eucalyptus plants. Upon ingestion by Bronze bug pests, the antisense or sense RNAs inhibit expression of the target genes to control pest infestation.
  • Target nucleotide sequences for design the dsRNA constructs are preferably at least 17, preferably at least 18, 19, 20 or 21, more preferably at least 22, 23 or 24 nucleotides in length. Non-limiting examples of preferred target nucleotide sequences are given in the examples.
  • Target sequences may include sequences that are homologous to sequences disclosed herein. Homologues of target genes can be found using methods well known to those of ordinary skill in the art. Preferred homologues are genes comprising a sequence which is at least about 85% or 87.5%, still more preferably about 90%, still more preferably at least about 95% and most preferably at least about 99% or 99.9% identical to a sequence disclosed herein, or the complement thereof. Methods for determining sequence identity are routine in the art and include use of the Blast software and EMBOSS software (The European Molecular Biology Open Software Suite (2000), Rice, P. Longden, I. and Bleasby, A. Trends in Genetics 16, (6) pp 276-277). The term “identity” as used herein refers to the relationship between sequences at the nucleotide level. The expression “% identical” is determined by comparing optimally aligned sequences, e.g., two or more, over a comparison window wherein the portion of the sequence in the comparison window may comprise insertions or deletions as compared to the reference sequence for optimal alignment of the sequences. The reference sequence does not comprise insertions or deletions. The reference window is chosen from between at least 10 contiguous nucleotides to about 50, about 100 or to about 150 nucleotides, preferably between about 50 and 150 nucleotides. “percent identity” is then calculated by determining the number of nucleotides that are identical between the sequences in the window, dividing the number of identical nucleotides by the number of nucleotides in the window and multiplying by 100.
  • The term “selectively hybridizes” includes reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids. Selectively hybridizing sequences typically have about at least 40% sequence identity, preferably 60-90% sequence identity, and most preferably 100% sequence identity (i.e., complementary) with each other.
  • The terms “stringent conditions” or “stringent hybridization conditions” include reference to conditions under which a probe will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which can be up to 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Optimally, the probe is approximately 500 nucleotides in length, but can vary greatly in length from less than 500 nucleotides to equal to the entire length of the target sequence.
  • Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide or Denhardt's. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C. and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C. and a wash in 0.5×to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C.
  • Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, (1984) Anal. Biochem., 138:267-84: Tm=81.5° C.+16.6 (log M)+0.41 (% GC)−0.61 (% form)−500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3 or 4° C. lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9 or 10° C. lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15 or 20° C. lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used.
  • An extensive guide to the hybridization of nucleic acids is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology—-Hybridization with Nucleic Acid Probes, part I, chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assays,” Elsevier, N.Y. (1993); and Current Protocols in Molecular Biology, chapter 2, Ausubel, et al., eds, Greene Publishing and Wiley-Interscience, New York (1995). Unless otherwise stated, in the present application high stringency is defined as hybridization in 4×SSC, 5×Denhardt's (5 g Ficoll, 5 g polyvinypyrrolidone, 5 g bovine serum albumin in 500 ml of water), 0.1 mg/ml boiled salmon sperm DNA, and 25 mM Na phosphate at 65° C. and a wash in 0.1×SSC, 0.1% SDS at 65° C.
  • dsRNA may be expressed by (e.g., transcribed within) a host cell or host organism. The host cell or organism may or may not be a host cell or organism susceptible or vulnerable to infestation by an insect. If the host cell or organism is a host cell or organism susceptible or vulnerable to infestation by an insect, RNAi-mediated gene silencing of one or more target genes in the insect may be used as a mechanism to control growth of the insect in or on the host organism and/or to prevent or reduce insect infestation of the host organism. Expression of the dsRNA within cells of the host organism may thus confer resistance to a particular insect or to a class of insects. In case the dsRNA hits more than one insect target gene, expression of the dsRNA within cells of the host organism may confer resistance to more than one insect or more than one class of insects.
  • In a preferred embodiment the host organism is a plant and the insect is a plant pathogenic insect. In this embodiment the insect is contacted with the dsRNA by expressing the dsRNA in a plant, plant tissue or plant cell that is infested with or susceptible to infestation with, or ingestion by, the plant pathogenic insect. A preferred plant host organism is eucalyptus. Examples of eucalyptus include, without limitation, the following species: E. botryoides, E. bridgesiana, E. camaldulensis, E. cinerea, E. globule, E. grandis, E. gunii, E. nicholii, E. pulverulenta, E. robusta, E. rudis, E. saligna, E. Tereticornis, E. Urophilla, E. viminalis and a cross hybrids of any of the preceding species especially Eucalyptus grandis and Eucalyptus urophylla. A preferred plant pathogenic insect is a Bronze bug, e.g., Bronze bug.
  • The term “plant” encompasses any plant material that it is desired to treat to prevent or reduce insect growth and/or insect infestation. This includes, inter alia, whole plants, seedlings, propagation or reproductive material such as seeds, cuttings, grafts, explants, etc. and also plant cell and tissue cultures. The plant material should express, or have the capability to express, dsRNA corresponding to one or more target genes of the insect.
  • In certain aspects the invention provides a plant, preferably a transgenic plant, or propagation or reproductive material for a (transgenic) plant, or a plant cell culture expressing or capable of expressing at least one dsRNA, wherein the dsRNA comprises annealed complementary strands, one of which has a nucleotide sequence which is complementary to at least part of a target nucleotide sequence of a target gene of an insect, such that the dsRNA is taken up by an insect upon plant-insect interaction, said double stranded RNA being capable of inhibiting the target gene or down-regulating expression of the target gene by RNA interference. The target gene may be any of the target genes herein described, for instance a target gene that is essential for the viability, growth, development or reproduction of the insect.
  • A plant may be provided in a form that is actively expressing (transcribing) a dsRNA in one or more cells, cell types or tissues. Alternatively, a plant may be “capable of expressing”, meaning that it is transformed with a transgene which encodes the desired dsRNA but that the transgene is not active in the plant when (and in the form in which) the plant is supplied. A recombinant DNA construct comprising a nucleotide sequence encoding a dsRNA or dsRNA construct may be thus be operably linked to at least one regulatory sequence. Preferably, the regulatory sequence is selected from the group comprising constitutive promoters or tissue specific promoters as described below.
  • A target gene may be any target gene herein described. Preferably a regulatory element is a regulatory element that is active in a plant cell. More preferably, the regulatory element is originating from a plant. The term “regulatory sequence” is to be taken in a broad context and refers to a regulatory nucleic acid capable of effecting expression of the sequences to which it is operably linked.
  • Encompassed by the aforementioned term are promoters and nucleic acids or synthetic fusion molecules or derivatives thereof which activate or enhance transcription of a nucleic acid, so called activators or enhancers. The term “operably linked” as used herein refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest.
  • By way of example, the transgene nucleotide sequence encoding the dsRNA could be placed under the control of an inducible or growth or developmental stage-specific promoter which permits transcription of the dsRNA to be turned on, by the addition of the inducer for an inducible promoter or when the particular stage of growth or development is reached.
  • Alternatively, the transgene encoding the dsRNA is placed under the control of a strong constitutive promoter such as any selected from the group comprising the CaMV35S promoter, doubled CaMV35S promoter, ubiquitin promoter, actin promoter, rubisco promoter, GOS2 promoter, Figwort mosaic virus (FMV) 34S promoter, cassaya vein mosaic virus (CsVMV) promoter (Verdaguer B. et al, Plant Mol. Biol. 1998 37(6):1055-67).
  • Alternatively, the transgene encoding the dsRNA is placed under the control of a tissue specific promoter such as any selected from the group comprising root specific promoters of genes encoding PsMTA Class III chitinase, photosynthetic tissue-specific promoters such as promoters of cab1 and cab2, rbcS, gapA, gapB and ST-LS1 proteins, JAS promoters, chalcone synthase promoter and promoter of RJ39 from strawberry.
  • A transgene encoding the dsRNA may also be placed under the control of an insect-induced promoter, for instance the potato proteinase inhibitor II (PinII) promoter (Duan X et al, Nat. Biotechnol. 1996, 14(4):494-8)); or a wounding-induced promoter, for instance the jasmonates and ethylene induced promoters, PDF1.2 promoter (Manners J Metal., Plant Mol. Biol. 1998, 38(6):1071-80); or under a defense related promoter, for instance the salicylic acid induced promoters and plant-pathogenesis related protein (PR protein) promoters (PR1 promoter (Cornelissen B J et al., Nucleic Acids Res. 1987, 15(17):6799-811; COMT promoter (Toquin V et. al., Plant Mol. Biol. 2003, 52(3):495-509).
  • When using the methods described herein for developing transgenic plants resistant against insects, it may be beneficial to place the nucleic acid encoding the dsRNA under the control of a tissue-specific promoter. In order to improve the transfer of the dsRNA from the plant cell to the pest, the plants could preferably express the dsRNA in a plant part that is first accessed or damaged by the plant pest. In case of plant pathogenic insects, preferred tissues to express the dsRNA are the leaves, stems, roots, and seeds. Therefore, in the methods disclosed herein, a plant tissue-preferred promoter may be used, such as a leaf-specific promoter, a stem-specific promoter, a phloem-specific promoter, a xylem-specific promoter, a root-specific promoter, or a seed-specific promoter (sucrose transporter gene AtSUC promoter (Baud S et al., Plant J. 2005, 43(6):824-36), wheat high molecular weight glutenin gene promoter (Robert L S et al., Plant Cell. 1989, 1(6):569-78.)).
  • Suitable examples of a root specific promoter are PsMTA (Fordam-Skelton, A. P., et al., 1997 Plant Molecular Biology 34: 659-668.) and the Class III Chitinase promoter. Examples of leaf- and stem-specific or photosynthetic tissue-specific promoters that are also photoactivated are promoters of two chlorophyll binding proteins (cab1 and cab2) from sugar beet (Stahl D. J., et al., 2004 BMC Biotechnology 2004 4:31), ribulose-bisphosphate carboxylase (Rubisco), encoded by rbcS (Nomura M. et al., 2000 Plant Mol. Biol. 44: 99-106), A (gapA) and B (gapB) subunits of chloroplast glyceraldehyde-3-phosphate dehydrogenase (Conley T. R. et al. 1994 Mol. Cell. Biol. 19: 2525-33; Kwon H. B. et al. 1994 Plant Physiol. 105: 357-67), promoter of the Solanum tuberosum gene encoding the leaf and stem specific (ST-LS1) protein (Zaidi M. A. et al., 2005 Transgenic Res. 14:289-98), stem-regulated, defense-inducible genes, such as JAS promoters (patent publication no. 20050034192/US-A1). An example of a flower-specific promoter is for instance, the chalcone synthase promoter (Faktor O. et al. 1996 Plant Mol. Biol. 32: 849) and an example of a fruit-specific promoter is for instance RJ39 from strawberry (WO 98 31812).
  • Other promoters useful for the expression of dsRNA are used and include, but are not limited to, promoters from an RNA Poll, an RNA Poll, an RNA PolIII, T7 RNA polymerase or SP6 RNA polymerase. These promoters are typically used for in vitro-production of dsRNA, which dsRNA is then included in an anti-insecticidal agent, for example, in an anti-insecticidal liquid, spray or powder.
  • The dsRNA or RNA constructs described herein may be generated by the steps of (i) contacting an isolated nucleic acid or a recombinant DNA construct with cell-free components; or (ii) introducing (e.g., by transformation, transfection or injection) an isolated nucleic acid or a recombinant DNA construct into a cell, under conditions that allow transcription of the nucleic acid or recombinant DNA construct to produce the dsRNA or RNA construct.
  • Optionally, one or more transcription termination sequences may also be incorporated in the recombinant construct. The term “transcription termination sequence” encompasses a control sequence at the end of a transcriptional unit, which signals 3′ processing and poly-adenylation of a primary transcript and termination of transcription. Additional regulatory elements, such as transcriptional or translational enhancers, may be incorporated in the expression construct.
  • Recombinant constructs may further include an origin of replication which is required for maintenance and/or replication in a specific cell type. One example is when an expression construct is required to be maintained in a bacterial cell as an episomal genetic element (e.g., plasmid or cosmid molecule) in a cell. Preferred origins of replication include, but are not limited to, fl-ori and colE1 ori.
  • Recombinant construct may optionally include a selectable marker gene. As used herein, the term “selectable marker gene” includes any gene, which confers a phenotype on a cell in which it is expressed to facilitate the identification and/or selection of cells, which are transfected or transformed, with an expression construct of the invention. Examples of suitable selectable markers include resistance genes against ampicillin (Ampr), tetracycline (Tcr), kanamycin (Kanr), phosphinothricin, and chloramphenicol (CAT) gene. Other suitable marker genes provide a metabolic trait, for example manA. Visual marker genes may also be used and include for example beta-glucuronidase (GUS), luciferase and Green Fluorescent Protein (GFP).
  • Plants that have been stably transformed with a transgene encoding the dsRNA may be supplied as seed, reproductive material, propagation material or cell culture material which does not actively express the dsRNA but has the capability to do so. The plant may be provided in a form wherein it is actively expressing (transcribing) the RNA molecule in one or more cells, cell types or tissues. Alternatively, the plant may be “capable of expressing”, meaning that it is transformed with a transgene which encodes the desired RNA molecule but that the transgene is not active in the plant when (and in the form in which) the plant is supplied. Many vectors are available for this purpose, and selection of the appropriate vector will depend mainly on the size of the nucleic acid to be inserted into the vector and the particular host cell to be transformed with the vector.
  • General techniques for expression of exogenous dsRNA in plants for the purposes of RNAi are known in the art (see Baulcombe D, 2004, Nature. 431(7006):356-63. RNA silencing in plants, the contents of which are incorporated herein by reference). More particularly, methods for expression of dsRNA in plants for the purposes of down-regulating gene expression in plant pests such as nematodes or insects are also known in the art. Similar methods can be applied in an analogous manner in order to express dsRNA in plants for the purposes of down-regulating expression of a target gene in a plant pathogenic insect. In order to achieve this effect it is necessary only for the plant to express (transcribe) the dsRNA in a part of the plant which will come into direct contact with the insect, such that the dsRNA can be taken up by the insect. Depending on the nature of the insect and its relationship with the host plant, expression of the dsRNA could occur within a cell or tissue including the vasculature of a plant within which the insect is also present during its life cycle, or the RNA may be secreted into a space between cells, such as the apoplast, that is occupied by the insect during its life cycle. Furthermore, the dsRNA may be located in the plant cell, for example in the cytosol, or in the plant cell organelles such as a chloroplast, mitochondrion, vacuole or endoplastic reticulum. dsRNA may further be expressed in and/or transported to the phloem, e.g., leaf phloem, where it may be taken up by sap sucking pests. See Pitino et al., PLoS ONE, 6(10):e25709 (2011) and Mlotshwa et al., Plant Cell, 14:S289-S301 (2002).
  • During development, Bronze bug larvae are exposed to the extracellular environment including the vasculature and to intracellular contents, due to ingestion (e.g., ingestion of apoplasts) or cell lysis.
  • Alternatively, the dsRNA may be secreted by the plant cell and by the plant to the exterior of the plant. As such, the dsRNA may form a protective layer on the surface of the plant.
  • In a further aspect, the invention also provides combinations of methods and compositions for preventing or protecting plants from pest infestation. For instance, one means provides using the plant transgenic approach combining methods using expression of dsRNA molecules and methods using expression of Bt insecticidal proteins.
  • In a further embodiment, the invention relates to a composition for controlling insect growth and/or preventing or reducing insect infestation, comprising at least a plant part, plant cell, plant tissue or seed comprising at least one dsRNA, wherein said dsRNA comprises annealed complementary strands, one of which has a nucleotide sequence which is complementary to at least part of a nucleotide sequence of an insect target gene. Optionally, the composition further comprises at least one suitable carrier, excipient or diluent. The target gene may be any target gene described herein. Preferably the insect target gene is essential for the viability, growth, development or reproduction of the insect.
  • Whenever the term “a” is used within the context of “a target gene”, this means “at least one” target gene. The same applies for “a” target organism meaning “at least one” target organism, and “a” RNA molecule or host cell meaning “at least one” RNA molecule or host cell.
  • According to one embodiment, the methods of the invention rely on uptake by the insect of dsRNA present outside of the insect (e.g., by feeding) and does not require expression of dsRNA within cells of the insect. In addition, the present invention also encompasses methods as described above wherein the insect is contacted with a composition comprising the dsRNA.
  • The invention further provides a method for down-regulating expression of at least one target gene in a target organism (which is capable of ingesting a plant, plant part, plant cell or seeds) comprising feeding a plant, plant part, plant cell or seed to the target organism which plant, plant part, plant cell or seed expresses dsRNA.
  • In a more preferred aspect, the invention provides a method for down-regulating expression of at least one target gene in a target organism (which is capable of ingesting a host cell, or extracts thereof) comprising feeding a host plant, plant part, plant cell or seed to the target organism which host plant, plant part, plant cell or seed expresses a dsRNA molecule comprising a nucleotide sequence complementary to or representing the RNA equivalent of at least part of the nucleotide sequence of the at least one target gene, whereby the ingestion of the host cell, host plant, plant part, plant cell or seed by the target organism causes and/or leads to down-regulation of expression of the at least one target gene.
  • The invention provides for use of a plant, plant part, plant cell or seed as defined herein for down regulation of expression of an insect target gene. In more detailed terms, the invention provides for use of a host cell as defined herein and/or an RNA molecule comprising a nucleotide sequence that is the RNA complement of or that represents the RNA equivalent of at least part of the nucleotide sequence of a target gene from a target organism, as produced by transcription of a nucleic acid molecule in a plant, plant part, plant cell or seed, for instance in the manufacture of a commodity product, for down regulation of expression of a target gene.
  • According to one embodiment, the methods of the invention rely on a genetically modified organism (GMO) approach wherein the dsRNA is expressed by a cell or an organism infested with or susceptible to infestation by insects. Preferably, said cell is a plant cell or said organism is a plant.
  • For siRNA mediated downregulation of insect genes, dsRNA is introduced and/or expressed in an insect cell, either directly or indirectly. dsRNA can be added to an insect diet artificially or produced by a transgenic source of food such as bacteria and plants [2,8]. Transgenic plants transcribing inverted repeat RNAs comprised of insect gene specific sequences, can process it to dsRNA and later into siRNA (small interfering RNA that are the first product in the silencing pathway). Insects digesting such transgenic plants are affected by the plant synthesized dsRNA and siRNA [5]. This insect control method can be utilized to protect plants efficiently against specific pests [2,8]. It is not required, however, that dsRNA be processed to siRNA in plant material. dsRNA may be ingested by the insect pest and processed to siRNA for the first time within the insect cell.
  • Numerous methods for introducing foreign genes into plants are known and can be used to insert an NT polynucleotide into a plant host, including biological and physical plant transformation protocols. See, e.g., Mild et al., “Procedure for Introducing Foreign DNA into Plants,” in Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson, eds., CRC Press, Inc., Boca Raton, pp. 67-88 (1993). The methods chosen vary with the host plant, and include chemical transfection methods such as calcium phosphate, microorganism-mediated gene transfer such as Agrobacterium (Horsch et al., Science 227:1229-31 (1985)), electroporation, micro-injection, and biolistic bombardment.
  • Expression cassettes and vectors and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are known and available. See, e.g., Gruber et al., “Vectors for Plant Transformation,” in Methods in Plant Molecular Biology and Biotechnology, supra, pp. 89-119.
  • The isolated polynucleotides or polypeptides may be introduced into the plant by one or more techniques typically used for direct delivery into cells. Such protocols may vary depending on the type of organism, cell, plant or plant cell, i.e., monocot or dicot, targeted for gene modification. Suitable methods of transforming plant cells include microinjection (Crossway, et al., (1986) Biotechniques 4:320-334; and U.S. Pat. No. 6,300,543), electroporation (Riggs, et al., (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, direct gene transfer (Paszkowski et al., (1984) EMBO J. 3:2717-2722), and ballistic particle acceleration (see, for example, Sanford, et al., U.S. Pat. No. 4,945,050; WO 91/10725; and McCabe, et al., (1988) Biotechnology 6:923-926). Also see, Tomes, et al., “Direct DNA Transfer into Intact Plant Cells Via Microprojectile Bombardment”. pp. 197-213 in Plant Cell, Tissue and Organ Culture, Fundamental Methods. eds. O. L. Gamborg & G. C. Phillips. Springer-Verlag Berlin Heidelberg N.Y., 1995; U.S. Pat. No. 5,736,369 (meristem); Weissinger, et al., (1988) Ann. Rev. Genet. 22:421-477; Sanford, et al., (1987) Particulate Science and Technology 5:27-37 (onion); Christou, et al., (1988) Plant Physiol. 87:671-674 (soybean); Datta, et al., (1990) Biotechnology 8:736-740 (rice); Klein, et al., (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein, et al., (1988) Biotechnology 6:559-563 (maize); WO 91/10725 (maize); Klein, et al., (1988) Plant Physiol. 91:440-444 (maize); Fromm, et al., (1990) Biotechnology 8:833-839; and Gordon-Kamm, et al., (1990) Plant Cell 2:603-618 (maize); Hooydaas-Van Slogteren & Hooykaas (1984) Nature (London) 311:763-764; Bytebierm, et al., (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet, et al., (1985) In The Experimental Manipulation of Ovule Tissues, ed. G. P. Chapman, et al., pp. 197-209. Longman, N.Y. (pollen); Kaeppler, et al., (1990) Plant Cell Reports 9:415-418; and Kaeppler, et al., (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); U.S. Pat. No. 5,693,512 (sonication); D'Halluin, et al., (1992) Plant Cell 4:1495-1505 (electroporation); Li, et al., (1993) Plant Cell Reports 12:250-255; and Christou and Ford, (1995) Annals of Botany 75:407-413 (rice); Osjoda, et al., (1996) Nature Biotech. 14:745-750; Agrobacterium mediated maize transformation (U.S. Pat. No. 5,981,840); silicon carbide whisker methods (Frame, et al., (1994) Plant J. 6:941-948); laser methods (Guo, et al., (1995) Physiologia Plantarum 93:19-24); sonication methods (Bao, et al., (1997) Ultrasound in Medicine & Biology 23:953-959; Finer and Finer, (2000) Lett Appl Microbiol. 30:406-10; Amoah, et al., (2001) J Exp Bot 52:1135-42); polyethylene glycol methods (Krens, et al., (1982) Nature 296:72-77); protoplasts of monocot and dicot cells can be transformed using electroporation (Fromm, et al., (1985) Proc. Natl. Acad. Sci. USA 82:5824-5828) and microinjection (Crossway, et al., (1986) Mol. Gen. Genet. 202:179-185); all of which are herein incorporated by reference.
  • The most widely utilized method for introducing an expression vector into plants is based on the natural transformation system of Agrobacterium. A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria, which genetically transform plant cells. The Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectively, carry genes responsible for genetic transformation of plants. See, e.g., Kado, (1991) Crit. Rev. Plant Sci. 10:1. Descriptions of the Agrobacterium vector systems and methods for Agrobacterium-mediated gene transfer are provided in Gruber, et al., supra; Mild, et al., supra; and Moloney, et al., (1989) Plant Cell Reports 8:238.
  • Similarly, the gene can be inserted into the T-DNA region of a Ti or Ri plasmid derived from A. tumefaciens or A. rhizogenes, respectively. Thus, expression cassettes can be constructed as above, using these plasmids. Many control sequences are known which when coupled to a heterologous coding sequence and transformed into a host organism show fidelity in gene expression with respect to tissue/organ specificity of the original coding sequence. See, e.g., Benfey and Chua, (1989) Science 244:174-81. Particularly suitable control sequences for use in these plasmids are promoters for constitutive leaf-specific expression of the gene in the various target plants. Other useful control sequences include a promoter and terminator from the nopaline synthase gene (NOS). The NOS promoter and terminator are present in the plasmid pARC2, available from the American Type Culture Collection and designated ATCC 67238. If such a system is used, the virulence (vir) gene from either the Ti or Ri plasmid must also be present, either along with the T-DNA portion, or via a binary system where the vir gene is present on a separate vector. Such systems, vectors for use therein, and methods of transforming plant cells are described in U.S. Pat. No. 4,658,082; U.S. patent application Ser. No. 913,914, filed Oct. 1, 1986, as referenced in U.S. Pat. No. 5,262,306, issued Nov. 16, 1993; and Simpson, et al., (1986) Plant Mol. Biol. 6:403-15m all incorporated by reference in their entirety.
  • Once constructed, these plasmids can be placed into A. rhizogenes or A. tumefaciens and these vectors used to transform cells of plant species, which are ordinarily susceptible to Fusarium or Alternaria infection. The selection of either A. tumefaciens or A. rhizogenes will depend on the plant being transformed thereby. In general A. tumefaciens is the preferred organism for transformation. Most dicotyledonous plants, some gymnosperms, and a few monocotyledonous plants (e.g., certain members of the Liliales and Arales) are susceptible to infection with A. tumefaciens. A. rhizogenes also has a wide host range, embracing most dicots and some gymnosperms, which includes members of the Leguminosae, Compositae, and Chenopodiaceae. Monocot plants can now be transformed with some success. European Patent Application No. 604 662 A1 discloses a method for transforming monocots using Agrobacterium. European Application No. 672 752 A1 discloses a method for transforming monocots with Agrobacterium using the scutellum of immature embryos. Ishida, et al., discuss a method for transforming maize by exposing immature embryos to A. tumefaciens (Nature Biotechnology 14:745-50 (1996)).
  • Once transformed, these cells can be used to regenerate transgenic plants. For example, whole plants can be infected with these vectors by wounding the plant and then introducing the vector into the wound site. Any part of the plant can be wounded, including leaves, stems and roots. Alternatively, plant tissue, in the form of an explant, such as cotyledonary tissue or leaf disks, can be inoculated with these vectors, and cultured under conditions, which promote plant regeneration. Roots or shoots transformed by inoculation of plant tissue with A. rhizogenes or A. tumefaciens, containing the gene coding for the fumonisin degradation enzyme, can be used as a source of plant tissue to regenerate fumonisin-resistant transgenic plants, either via somatic embryogenesis or organogenesis. Examples of such methods for regenerating plant tissue are disclosed in Shahin, (1985) Theor. Appl. Genet. 69:235-40; U.S. Pat. No. 4,658,082; Simpson, et al., supra; and U.S. patent application Nos. 913,913 and 913,914, both filed Oct. 1, 1986, as referenced in U.S. Pat. No. 5,262,306, issued Nov. 16, 1993, the entire disclosures therein incorporated herein by reference.
  • Several methods of plant transformation, collectively referred to as direct gene transfer, have been developed as an alternative to Agrobacterium-mediated transformation.
  • A generally applicable method of plant transformation is microprojectile-mediated transformation, where DNA is carried on the surface of microprojectiles measuring about 1 to 4 μm. The expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m/s which is sufficient to penetrate the plant cell walls and membranes (Sanford, et al., (1987) Part. Sci. Technol. 5:27; Sanford, (1988) Trends Biotech 6:299; Sanford, (1990) Physiol. Plant 79:206; and Klein, et al., (1992) Biotechnology 10:268).
  • Another method for physical delivery of DNA to plants is sonication of target cells as described in Zang, et al., (1991) BioTechnology 9:996. Alternatively, liposome or spheroplast fusions have been used to introduce expression vectors into plants. See, e.g., Deshayes, et al., (1985) EMBO J. 4:2731; and Christou, et al., (1987) Proc. Natl. Acad. Sci. USA 84:3962. Direct uptake of DNA into protoplasts using CaCl2 precipitation, polyvinyl alcohol, or poly-L-ornithine has also been reported. See, e.g., Hain, et al., (1985) Mol. Gen. Genet. 199:161; and Draper, et al., (1982) Plant Cell Physiol. 23:451.
  • Electroporation of protoplasts and whole cells and tissues has also been described. See, e.g., Donn, et al., (1990) Abstracts of the VIIth Int'l. Congress on Plant Cell and Tissue Culture IAPTC, A2-38, p. 53; D'Halluin, et al., (1992) Plant Cell 4:1495-505; and Spencer, et al., (1994) Plant Mol. Biol. 24:51-61.
  • Following stable transformation, plant propagation is exercised. The most common method of plant propagation is by seed. Regeneration by seed propagation, however, has the deficiency that due to heterozygosity there is a lack of uniformity in the crop, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. Basically, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the transformed plant be produced such that the regenerated plant has the identical traits and characteristics of the parent transgenic plant.
  • Transformed plant may be regenerated by micropropagation which provides a rapid, consistent reproduction of the transformed plants. Micropropagation is a process of growing new generation plants from a single piece of tissue that has been excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue expressing the fusion protein. The new generation plants which are produced are genetically identical to, and have all of the characteristics of, the original plant. Micropropagation allows mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars in the preservation of the characteristics of the original transgenic or transformed plant. The advantages of cloning plants are the speed of plant multiplication and the quality and uniformity of plants produced.
  • Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages. Thus, the micropropagation process involves four basic stages: Stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening. During stage one, initial tissue culturing, the tissue culture is established and certified contaminant-free. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the tissue samples grown in stage two are divided and grown into individual plantlets. At stage four, the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that it can be grown in the natural environment.
  • In certain aspects the invention provides methods of producing a plant resistant to a plant pathogenic pest by transforming a plant cell with a recombinant DNA construct or combination of constructs that express a dsRNA; regenerating a plant from the transformed plant cell; and growing the transformed plant cell under conditions suitable for the expression said recombinant DNA construct.
  • The methods of the invention are applicable to Bronze bug species, e.g., Thaumastocoris peregrinus that are susceptible to gene silencing by RNA interference and that are capable of internalizing dsRNA from their immediate environment. The invention is applicable to the insect at any stage in its development. Because insects have a non-living exoskeleton, they cannot grow at a uniform rate and rather grow in stages by periodically shedding their exoskeleton. This process is referred to as molting or ecdysis. The stages between molts are referred to as “instars” and these stages may be targeted according to the invention. Also, insect eggs or live young may also be targeted according to the present invention. All stages in the developmental cycle, which includes metamorphosis in the pterygotes, may be targeted according to the present invention. Thus, individual stages such as larvae, pupae, nymph etc. stages of development may all be targeted.
  • Bronze bug are pests for eucalyptus. The nucleic acids, dsRNAs and methods described herein are thus useful for treating or inhibiting Bronze bug infection and infestation of eucalyptus.
  • EXAMPLES Example 1 Bronze bug Transcriptome Sequencing
  • Bronze bug specimens were collected from infected leaves from eucalyptus from Sao Paulo State, Brazil. Total RNA was obtained from a mixture of nymphs and adults at various developmental stages. Batches of 100 specimens were placed in individual microtubes on ice. The tubes were then sealed and immediately frozen in liquid nitrogen and kept at −80° C. until further treatment. Total RNA was isolated using MasterPure RNA purification kit and protocol (MRC85102, Epicentere Biotechnologies). Total RNA volume was 50 μl. Total RNA was then treated with DNAse to remove residual DNA, followed by isolation of poly A mRNA (MicroPoly(A) Purist, Small scale mRNA Purification kit, AM1919 Ambion). mRNA final volume was 20 μl. The purified mRNA was kept at −80° C. until 454 Sequencing was performed. 454 Sequencing was carried out according to standard protocols to provide transcriptomes of the target pest. Sequences were assembled and results annotated on the basis of sequence alignment with known published hemiptera Pea Aphid Acyrthosiphon pisum (Ap) transcriptomes using the Roche software package and annotated using the Blast2Go program, available at http://www.blast2go.org/.
  • Example 2 Identification of Bronze Bug Target Genes and Sequences
  • Unique, vital Bronze bug genes essential either for cellular processes or proper developmental processes of a specific tissue or entire organism were chosen as targets for gene silencing. Based on published RNAi libraries in Drosophila melanogaster (Dm) [15, 16] a list was generated of 591 genes that were shown to be lethal in RNAi transgenic Dm. This list was further narrowed to genes that are involved in translation, transcription and development. The resulting subset of 141 genes are involved in one or more of the following: protein synthesis and/or metabolism, RNA synthesis and metabolism and cellular processes.
  • BLAST (NCBI) comparisons using 141 genes identified as being lethal when expressed as RNAi in Drosophila were used to identify 128 orthologous sequences Pea Aphid Acyrthosiphon pisum (Ap). Comparisons using the identified Ap sequences were further used to screen the Bronze bug 454 transcriptome library for potential target genes. Potential Bronze bug target genes were limited to Bronze bug 454 transcriptome sequences that included at least 310 bp in a continuous open reading frame or were at least 50% of the full predicted gene length. The screen of the Bronze bug 454 transcriptome identified 28 potential Bronze bug target sequences.
  • The 28 potential Bronze bug targets were further screen to identify sequences that share limited homology to honey bee, Apis mellifera (Ap) sequences. Comparisons were made using a publicly available NCBI B12Seq analysis program (available at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&PROG_DEF=blastn&BLAST_PROG_DEF=megaBlast&SHOW_DEFAULTS=on&BLAST_SPEC=blast2seq&LINK_LOC=align2seq) to identify 100 bp sequences from each Bronze bug target that shared limited (i.e., less than 80%) identity to corresponding Am genes (or, when not possible to identify a 100 bp sequence with less than 80% identity to identify, a shorter fragment of such sequences). The regions identified all exhibited 41-74% identity to the respective honey bee sequences.
  • The respective Bronze bug target genes and the sequences with limited homology to Ap sequences that were identified are set out in SEQ ID NO: 1-59 and 74-87. Table 1 sets out the SEQ ID NOs for the respective Bronze bug target genes and sequences with limited homology identified therein.
  • TABLE 1
    Bronze Bug Target Sequences and Fragments With
    Limited Identity to Honey Bee (Apis mellifera) Sequences
    Bronze Bug
    Sequence
    <80%
    Bronze identical
    Bug to Am
    Gene Dm gene symbol/function Bronze Bug Sequence
    No. (A. mellifera accession no.) Target Gene (% identity)
     2 Aats-trp/Tryptophanyl-tRNA SEQ ID NO: 1 SEQ ID
    synthetase (XM_001123290) NO: 2 (58)
     3 blw/hydrogen-exporting SEQ ID NO: 3 + SEQ ID
    ATPase activity, (XM_392639) SEQ ID NO: 84 NO: 4 (74)
     4 Bur/ubiquitin-specific protease SEQ ID NO: 5 SEQ ID
    activator activity (XM_393336) NO: 6 (57)
     7 Pros28.1A/Proteasome 28kD SEQ ID NO: 7 SEQ ID
    subunit
    1A; ubiquitin- NO: 8 (55)
    dependent protein catabolic
    process (XM_393583)
     8 Prosα3T/Proteasome α3T SEQ ID NO: 9 SEQ ID
    subunit; endopeptidase activity. NO: 10 (52)
    ubiquitin-dependent protein
    catabolic process (XM_397196)
     9 CG2931/nuclear mRNA SEQ ID NO: 11 SEQ ID
    splicing, via spliceosome NO: 12 (58)
    (XM_392161)
    10 CG31524/procollagen-proline 4- SEQ ID NO: 13 SEQ ID
    dioxygenase activity. oxidation- NO: 14 (52)
    reduction process (XM_392392)
    12 CG3590/AMP AMP-lyase; SEQ ID NO: 15 SEQ ID
    purine nucleotide metabolic NO: 16 (59)
    process (XM_393961)
    13 CG5451/nuclear mRNA splicing, SEQ ID NO: 17 SEQ ID
    via spliceosome (XM_393446) NO: 18 (66)
    20 dlg 1/protein binding.anatomical SEQ ID NO: 19 SEQ ID
    structure development NO: 20 (64)
    (XM_003251584)
    24 e(r)/regulation of transcription SEQ ID NO: 21 SEQ ID
    from RNA polymerase II NO: 22 (68)
    promoter (XM_00111990)
    26 ebi/regulation of epidermal SEQ ID NO: 23 + SEQ ID
    growth factor receptor SEQ ID NO: 85 NO: 24 (70)
    signaling pathway; regulation
    of cell cycle (XM_003251282)
    27 EcR/repressing transcription SEQ ID NO: 25 SEQ ID
    factor binding. anatomical NO: 26 (57)
    structure development;
    biological regulation
    (NM_001159355)
    28 Efl alpha48D/translation SEQ ID NO: 27 SEQ ID
    elongation factor activity. NO: 28 (65)
    determination of adult lifespan
    (NM_001014993)
    29 Efl gamma/translation elon- SEQ ID NO: 29 SEQ ID
    gation factor autophagic NO: 30 (62)
    cell death; salivary gland
    cell autophagic cell deat
    (XM_623679)
    30 eIF-2alpha/translational SEQ ID NO: 31 SEQ ID
    initiation (XM_001122232) NO: 32 (41)
    31 eIF3-S8/translational initiation SEQ ID NO: 33 SEQ ID
    (XM_623577) NO: 34 (60)
    32 eIFS/translational initiation SEQ ID NO: 35 SEQ ID
    (XM_392511) NO: 36 (55)
    34 hay/ATP-dependent DNA SEQ ID NO: 37 or SEQ ID
    helicase activity (XM_624122) SEQ ID NO: 87 NO: 38 (67)
    35 Hel25E/RNA helicase activity SEQ ID NO: 39 + SEQ ID
    (XM_624891) SEQ ID NO: 86 NO: 40 (68)
    37 Hr38/ligand-dependent nuclear SEQ ID NO: 41 SEQ ID
    receptor activity NO: 42 (65)
    (NM_001159355)
    40 mask/structural constituent of SEQ ID NO: 43 SEQ ID
    cytoskeleton (XM_393472) NO: 44 (67)
    41 mor/transcription coactivator SEQ ID NO: 45 SEQ ID
    activity (XM_393008) NO: 46 (50)
    47 RpS2/structural constituent of SEQ ID NO: 47 SEQ ID
    ribosome (XM_392843) NO: 48 (61)
    48 RpS5a/(XM_624081) structural SEQ ID NO: 49 SEQ ID
    constituent of ribosome NO: 50 (51)
    53 Trip1/translation initiation factor SEQ ID NO: 51 SEQ ID
    activity (XM_392780) NO: 52 (63)
    54 tws/protein serine/threonine SEQ ID NO: 53 SEQ ID
    phosphatase activity NO: 54 (65)
    (XM_394082)
    55 Ubc-E2H/ubiquitin-protein SEQ ID NO: 55 SEQ ID
    ligase activity (XM_624081) NO: 56 (59)
    56 Uev1A/ubiquitin-conjugating SEQ ID NO: 57 SEQ ID
    enzyme-like (XM_393411) NO: 58 (68)
    57 Vps23/NADH-ubiquinone SEQ ID NO: 74 SEQ ID
    oxidoreductase, 20 Kd subunit NO: 75 (61)
    (XM_392437.4)
    58 Vps28/Vacuolar protein sorting SEQ ID NO: 76 SEQ ID
    28 (XM_392314.4) NO: 77 (59)
    59 Vps22/lsn/Regulation of Notch SEQ ID NO: 78 SEQ ID
    signaling pathway NO: 79 (50)
    (XM_003251158.1)
    60 Vps2/Protein transport SEQ ID NO: 80 SEQ ID
    (XM_625161.3) NO: 81 (70)
    61 Snf7/shrub/ESCRT-III pathway SEQ ID NO: 82 SEQ ID
    (XM_395324.4) NO: 83 (60)
  • The identified Bronze bug genes were divided into the following categories:
  • Proteins Synthesis and Metabolism:
  • SEQ ID NO: 1, 5, 7, 9, 21, 25, 27, 29, 31, 33, 35, 47, 49 and 51, respectively.
  • Cellular Processes:
  • SEQ ID NO: 3+84, 13, 15, 19, 23+85, 41, 43, 53, 55 and 57, respectively.
  • Nucleic Acid Synthesis and Metabolism:
  • SEQ ID NO: 11, 17, 37, 39+86 and 45, respectively.
  • Example 3 Preparation of dsRNA Silencing Constructs
  • A schematic of the structure of dsRNA triple silencing constructs comprising segments from three Bronze bug genes is shown in FIG. 1. Silencing constructs contain two transgenes. A first transgene comprises fragments from each of three Bronze bug genes which are fused and synthesized in inverted repeats, separated by a loop sequence. See FIG. 1A. Transcription of this transgene (initiated at promoter P1 and terminated at T1) produces a hairpin RNA, containing a dsRNA section, formed by annealing of the inverted-repeat sequences of the three Bronze bug genes, and a loop region. See FIG. 1B. A second transgene contains three fused Bronze bug genes, oriented to be transcribed to yield a sense strand with the three gene fragments. See FIGS. 1A and 1C.
  • The following sequences are used to construct three silencing constructs.
  • Silencing Construct #1
  • Silencing Construct #1 is shown schematically in FIG. 2. Respective 100 bp fragments of each of the Bronze bug CG3590 gene (SEQ ID NO: 15), CG5451 gene (SEQ ID NO: 17) and Ef1 gamma gene (SEQ ID NO: 29) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64). Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60). Transcription termination was provided by the AtActin7 Terminator (SEQ ID NO: 62). The select 100 bp of Bronze bug SEQ ID NO: 15, 17 and 29 (respectively, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 30) were synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 61) to NOS Terminator (SEQ ID NO: 63).
  • Transcription of construct 1 would yield two mRNAs: (1) A hairpin RNA (hpRNA) with a stem formed by the reverse complementary sequences of the three Bronze bug 100 bp sequences, to silence the corresponding Bronze bug genes (see FIG. 2B); and (2) sense mRNA of the three, fused Bronze bug genes (see FIG. 2C).
  • The hpRNA formed upon transcription of the hpRNA-forming transgene of Construct #1 has the following sequence (SEQ ID NO: 65):
  • CTCTGCTCGGATGCTCTCCTCATCACTTTGATGAACATTTTGGAAGGGCT
    CGTAGTCTACCCGAAAGTCATTGAAAAGCACATCGGAGAAGAACTTCCTT
    CCGATTCTCAAGGGACAACAGTCAAATCCTCACCGCCTCGTTCGACACGA
    CAATCAAAATTCACGGGTTGAAGTCAGGTAAATCGTTGAAGGAATTCCGC
    GCAAAAGGTCTTCATGAGCTGCAACCTCATCACCGGCATGTACCAGAGAC
    TGGACAAAATGAGGAAAAACGCTTTCGCCTCCGTCATTCTGTTCGGCAAA
    GGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCACA
    ATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCTT
    CGCGCGTTTGCCGAACAGAATGACGGAGGCGAAAGCGTTTTTCCTCATTT
    TGTCCAGTCTCTGGTACATGCCGGTGATGAGGTTGCAGCTCATGAAGACC
    TTTTGCGCGGAATTCCTTCAACGATTTACCTGACTTCAACCCGTGAATTT
    TGATTGTCGTGTCGAACGAGGCGGTGAGGATTTGACTGTTGTCCCTTGAG
    AATCGGAAGGAAGTTCTTCTCCGATGTGCTTTTCAATGACTTTCGGGTAG
    ACTACGAGCCCTTCCAAAATGTTCATCAAAGTGATGAGGAGAGCATCCGA
    GCAGAG
  • The respective hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 607-706: Respective sense and reverse complement sequences of SEQ ID NO: 16, corresponding to nucleotides 244-343 of SEQ ID NO: 15
  • Nucleotides 101-200 and 507-606: Respective sense and reverse complement sequences of SEQ ID NO: 18, corresponding to nucleotides 438-537 of SEQ ID NO: 17
  • Nucleotides 201-300 and 407-506: Respective sense and reverse complement sequences of SEQ ID NO: 30, corresponding to nucleotides 951-1050 of SEQ ID NO: 29
  • Nucleotides 301-406: 106 bp Loop fragment (SEQ ID NO: 64) based on Partial Leptocibe invasa Chitin Synthase intron
  • The sense mRNA transcribed from construct 1 has the following sequence (SEQ ID NO: 66):
  • CTCTGCTCGGATGCTCTCCTCATCACTTTGATGAACATTTTGGAAGGGCT
    CGTAGTCTACCCGAAAGTCATTGAAAAGCACATCGGAGAAGAACTTCCTT
    CCGATTCTCAAGGGACAACAGTCAAATCCTCACCGCCTCGTTCGACACGA
    CAATCAAAATTCACGGGTTGAAGTCAGGTAAATCGTTGAAGGAATTCCGC
    GCAAAAGGTCTTCATGAGCTGCAACCTCATCACCGGCATGTACCAGAGAC
    TGGACAAAATGAGGAAAAACGCTTTCGCCTCCGTCATTCTGTTCGGCAAA
  • Silencing Construct 2
  • Silencing Construct #2 is shown schematically in FIG. 3. Respective 100 bp fragments of each of the Bronze bug eIF3-58 gene (SEQ ID NO: 33), He125E gene (SEQ ID NO: 39+86) and, Uev1A gene (SEQ ID NO: 57) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64). Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60). Transcription termination was provided by the AtActin7 Terminator (SEQ ID NO: 62). The select 100 bp of Bronze bug SEQ ID NO: 33, 39+86 and 57 (respectively, SEQ ID NO: 34, SEQ ID NO: 40 and SEQ ID NO: 59 (corresponding to nucleotides 181-280 with a T253C substitution) were synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 61) to NOS Terminator (SEQ ID NO: 63).
  • Transcription of construct 2 would yield two mRNAs: (1) A hairpin RNA (hpRNA) with a stem formed by the reverse complementary sequences of the three Bronze bug 100 bp sequences, to silence the corresponding Bronze bug genes (see FIG. 3B); and (2) sense mRNA of the three, fused Bronze bug genes (see FIG. 3C). The hpRNA formed upon transcription of the hpRNA-forming transgene of Construct #2 has the following sequence (SEQ ID NO: 67):
  • CGACCCGACTGTCATTCAACAGAGAAAGGGCGAATTGGAACCAGGCACC
    CAAACTAGCATCCAAGTGATGGACAAATTGTGCAAGTACATTTACGACAA
    GTGACATATTGGAGTTCAACCAGGTGGTCATTTTCGTCAAGTCTGTTCAA
    CGGTGTATGGCTCTTGCTCAGCTCTTATGCGACCAAAACTTCCCGGCTGT
    CAATCGCATGTACAGTTTACGAATAGAGTGTGGTCAGAAGTACCCGGAAG
    ACGCTCCCTCGGCCCGATTTATACCTAGAATTAATATGACCTGCGTTAAT
    AGGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCAC
    AATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCT
    TCGCGCGTATTAACGCAGGTCATATTAATTCTAGGTATAAATCGGGCCGA
    GGGAGCGTCTTCCGGGTACTTCTGACCACACTCTATTCGTAAACTGTACA
    TGCGATTGACAGCCGGGAAGTTTTGGTCGCATAAGAGCTGAGCAAGAGCC
    ATACACCGTTGAACAGACTTGACGAAAATGACCACCTGGTTGAACTCCAA
    TATGTCACTTGTCGTAAATGTACTTGCACAATTTGTCCATCACTTGGATG
    CTAGTTTGGGTGCCTGGTTCCAATTCGCCCTTTCTCTGTTGAATGACAGT
    CGGGTCG
  • The respective hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 607-706: Respective sense and reverse complement sequences of SEQ ID NO: 34, corresponding to nucleotides 21-120 of SEQ ID NO: 33
  • Nucleotides 101-200 and 507-606: Respective sense and reverse complement sequences of SEQ ID NO: 40, corresponding to nucleotides 15-114 of SEQ ID NO: 86
  • Nucleotides 201-300 and 407-506: Respective sense and reverse complement sequences of SEQ ID NO: 59, corresponding to nucleotides 181-280 of SEQ ID NO: 57, with a T->C mutation at position 253 of SEQ ID NO: 57, to create an Xba I site.
  • Nucleotides 301-406: 106 bp Loop fragment (SEQ ID NO: 64) based on Partial Leptocibe invasa Chitin Synthase intron
  • The sense mRNA transcribed from construct 2 has the following sequence (SEQ ID NO: 68):
  • CGACCCGACTGTCATTCAACAGAGAAAGGGCGAATTGGAACCAGGCACC
    CAAACTAGCATCCAAGTGATGGACAAATTGTGCAAGTACATTTACGACAA
    GTGACATATTGGAGTTCAACCAGGTGGTCATTTTCGTCAAGTCTGTTCAA
    CGGTGTATGGCTCTTGCTCAGCTCTTATGCGACCAAAACTTCCCGGCTGT
    CAATCGCATGTACAGTTTACGAATAGAGTGTGGTCAGAAGTACCCGGAAG
    ACGCTCCCTCGGCCCGATTTATACCTAGAATTAATATGACCTGCGTTAAT
    A
  • Silencing Construct 3
  • Silencing Construct #3 is shown schematically in FIG. 4. Respective 100 bp fragments of each of the Bronze bug Mor gene (SEQ ID NO: 45), Trip gene (SEQ ID NO: 51) and, tws gene (SEQ ID NO: 53) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64). Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60). Transcription termination was provided by the AtActin7 Terminator (SEQ ID NO: 62). The select 100 bp of Bronze bug SEQ ID NO: 45, 51 and 53 (respectively, SEQ ID NO: 46, SEQ ID NO: 52 and SEQ ID NO: 54) were synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 62) to NOS Terminator (SEQ ID NO: 63).
  • Transcription of construct 3 would yield two mRNAs: (1) A hairpin RNA (hpRNA) with a stem formed by the reverse complementary sequences of the three Bronze bug 100 bp sequences, to silence the corresponding Bronze bug genes (see FIG. 4B); and (2) sense mRNA of the three, fused Bronze bug genes (see FIG. 4C).
  • The hpRNA formed upon transcription of the hpRNA-forming transgene of Construct #3 has the following sequence (SEQ ID NO: 69):
  • AAAAGCGACTGCAGCCAAAGTCAAAGACATAATCAAACGCCACCAGGGA
    ACGGTGGTCGAAAACGAAGAACAGGCGACCCACATCCTTTACCCTATTGT
    GGTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGAC
    GGCACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGA
    CAGATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGC
    TTGGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTAT
    TTGGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCA
    CAATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATC
    TTCGCGCGAAATAAATTGTTGGTGGCGGCCACTGCAATAATGTTCTCGGT
    TGGATGCCAAGCGGTGTGAAGGATCTTCTTCGTAAAATCCAAACAGTCGA
    CCGAAATCTGTCGAATAGCTTTGCTGTGTGGTCACTCGAAGCTGTCACAA
    ACATGGTGCCGTCCCAGTGCATCTGCATGTCGTTGATTGACCCGTTGTGC
    CCGTCAACCACAATAGGGTAAAGGATGTGGGTCGCCTGTTCTTCGTTTTC
    GACCACCGTTCCCTGGTGGCGTTTGATTATGTCTTTGACTTTGGCTGCAG
    TCGCTTTT
  • The respective hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 607-706: Respective sense and reverse complement sequences of SEQ ID NO: 46, corresponding to nucleotides 159-258 of SEQ ID NO: 45
  • Nucleotides 101-200 and 507-606: Respective sense and reverse complement sequences of SEQ ID NO: 52, corresponding to nucleotides 1-100 of SEQ ID NO: 51
  • Nucleotides 201-300 and 407-506: Respective sense and reverse complement sequences of SEQ ID NO: 54, corresponding to nucleotides 753-852 of SEQ ID NO: 53
  • Nucleotides 301-406: 106 bp Loop fragment (SEQ ID NO: 64) based on Partial Leptocibe invasa Chitin Synthase intron
  • The sense mRNA transcribed from construct 3 has the following sequence (SEQ ID NO: 70):
  • AAAAGCGACTGCAGCCAAAGTCAAAGACATAATCAAACGCCACCAGGGA
    ACGGTGGTCGAAAACGAAGAACAGGCGACCCACATCCTTTACCCTATTGT
    GGTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGAC
    GGCACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGA
    CAGATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGC
    TTGGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTAT
    TT
  • Example 4
  • Schematic representations of silencing constructs comprising segments from one and two Bronze bug genes are shown in FIG. 5 and FIG. 6, respectively. Silencing constructs contain two transgenes. A first transgene comprises fragments from each of one (see FIG. 5) or two (FIG. 6) Bronze bug genes which are fused (in the case of constructs containing two Bronze bug genes) and synthesized in inverted repeats, separated by a loop sequence. See FIGS. 5A and 6A. Transcription of this transgene (initiated at promoter P1 and terminated at T1) produces a hairpin RNA, containing a dsRNA section, formed by annealing of the inverted-repeat sequences of the respective Bronze bug genes, and a loop region. See FIGS. 5B and 6B. A second transgene contains the Bronze bug genes, oriented to be transcribed to yield a sense strand with. See FIGS. 5C and 6C.
  • Silencing Construct #4
  • Single gene control sequences are generated using a combination of sequences comprising a first sequence of 100 bp sense-100 bp (approximate) loop-100 bp antisense, where “100 bp sense” and “100 bp antisense” refer to complementary sequences from a target gene, and a second 100-bp sense amplifying sequence. To construct silencing construct #4, 100 bp fragments of the Bronze bug tws gene (SEQ ID NO: 53) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64). Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60). Transcription termination was provided by the AtActin7 Terminator (SEQ ID NO: 62). The select 100 bp of Bronze bug SEQ ID NO: 53 (SEQ ID NO: 54) was synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 61) to NOS Terminator (SEQ ID NO: 63).
  • Transcription of construct 4 would yield two mRNAs: (1) A hairpin RNA (hpRNA) with a stem formed by the reverse complementary sequences of the Bronze bug 100 bp sequences, to silence the corresponding Bronze bug gene (see FIG. 5B); and (2) sense mRNA of the Bronze bug gene (see FIG. 5C).
  • The hpRNA formed upon transcription of the hpRNA-forming transgene of Construct #4 has the following sequence:
  • (SEQ ID NO: 71)
    GATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCTT
    GGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATTT
    GGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCACA
    ATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCTT
    CGCGCGAAATAAATTGTTGGTGGCGGCCACTGCAATAATGTTCTCGGTTG
    GATGCCAAGCGGTGTGAAGGATCTTCTTCGTAAAATCCAAACAGTCGACC
    GAAATC
  • The respective hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 207-306: Respective sense and reverse complement sequences of SEQ ID NO: 54, corresponding to nucleotides 753-852 of SEQ ID NO: 53;
  • Nucleotides 101-206: 106 bp Loop fragment (SEQ ID NO: 61) based on Partial Leptocibe invasa Chitin Synthase intron.
  • The sense mRNA transcribed from construct 4 has the following sequence (SEQ ID NO: 54):
  • GATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCTT
    GGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATTT
  • Silencing Construct #5
  • Two gene control sequences are generated using a combination of sequences comprising a 100 bp sense sequence 1-100 bp sense sequence 2-100 bp (approximate) loop-100 bp antisense sequence 1-,100 bp sense sequence 2 where “100 bp sense” and “100 bp antisense” refer to complementary sequences from a target gene, and a second 100-bp sense amplifying sequence.
  • To construct silencing construct #5, 100 bp fragments of the Bronze bug Trip1 gene (SEQ ID NO: 51) and tws gene (SEQ ID NO: 53) were fused and synthesized in inverted repeats separated by 106 bp of a loop sequence (Loop 1; SEQ ID NO: 64). Transcription initiation was driven by the 35S CaMV promoter (SEQ ID NO: 60). Transcription termination was provided by the AtActin7 Terminator (SEQ ID NO: 61). The select 100 bp of Bronze bug SEQ ID NO: 51 and 53 (SEQ ID NO: 52 and 54, respectively) were synthesized in sense orientation between sgFIMV Promoter (SEQ ID NO: 62) to NOS Terminator (SEQ ID NO: 63).
  • Transcription of construct 5 would yield two mRNAs: (1) A hairpin RNA (hpRNA) with a stem formed by the reverse complementary sequences of the Bronze bug 100 bp sequences, to silence the corresponding Bronze bug genes (see FIG. 6B); and (2) sense mRNA of the Bronze bug gene (see FIG. 6C).
  • The hpRNA formed upon transcription of the hpRNA-forming transgene of Construct #5 has the following sequence:
  • (SEQ ID NO: 72)
    GTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGACG
    GCACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGAC
    AGATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCT
    TGGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATT
    TGGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCAC
    AATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCT
    TCGCGCGAAATAAATTGTTGGTGGCGGCCACTGCAATAATGTTCTCGGTT
    GGATGCCAAGCGGTGTGAAGGATCTTCTTCGTAAAATCCAAACAGTCGAC
    CGAAATCTGTCGAATAGCTTTGCTGTGTGGTCACTCGAAGCTGTCACAAA
    CATGGTGCCGTCCCAGTGCATCTGCATGTCGTTGATTGACCCGTTGTGCC
    CGTCAAC
  • The respective hpRNA sequences correspond to the following elements:
  • Nucleotides 1-100 and 407-506: Respective sense and reverse complement sequences of SEQ ID NO: 52, corresponding to nucleotides 1-100 of SEQ ID NO: 51;
  • Nucleotides 101-200 and 307-406: Respective sense and reverse complement sequences of SEQ ID NO: 54, corresponding to nucleotides 753-852 of SEQ ID NO: 53;
  • Nucleotides 201-306: 106 bp Loop fragment (SEQ ID NO: 64) based on Partial Leptocibe invasa Chitin Synthase intron.
  • The sense mRNA transcribed from construct 5 has the following sequence:
  • (SEQ ID NO: 73)
    GTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGACG
    GCACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGAC
    AGATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCT
    TGGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATT
    T
  • Example 5 Expression of RNAi Constructs in Eucalyptus
  • RNA constructs are transformed into eucalyptus using a protocol essentially described in Prakash et al., In Vitro Cell Dev Biol.-Plant, 2009, 45:429-434. Briefly, shoots of Eucalyptus are propagated in vitro on Murashige and Skoog (MS) basal salt medium consisting of 3% (w/v) sucrose and 0.8% (w/v) agar. All in vitro plant materials are incubated at 25±2° C. under a 16-h photoperiod with cool white fluorescent lamps with an intensity of 30 μEm−2 s−1 . A. tumefaciens strain LBA 4404 harboring a binary vector pBI121 containing nptII gene is used for transformation. Bacterial culture collected at late log phase are pelleted and resuspended in MS basal salt medium. Leaves from in vitro material are collected and used as explants for transformation experiments.
  • Explants are precultured on the MS regeneration medium supplemented with 0.5 mg/l BAP and 0.1 mg/l NAA for 2 d. Precultured leaf explants are gently shaken in the bacterial suspension for 10 min and blotted dry on a sterile filter paper. Explants are then cocultivated in medium under the preculture conditions for 2 d. Following cocultivation, explants are washed in MS liquid medium, blotted dry on a sterile filter paper, and transferred to MS regeneration medium containing 0.5 mg/l BAP and 0.1 mg/l NAA supplemented with 40 mg/l kanamycin and 300 mg/l cefotaxime. After 4-5 weeks of culture, regeneration is observed and explants are transferred to liquid elongation medium (MS medium supplemented with 0.5 mg/l BAP, 40 mg/l kanamycin, and 300 mg/l cefotaxime) on paper bridges. The elongated shoots (1.5-2 cm) are propagated on MS medium with 0.1 mg/l BAP. Leaf segments are regenerated and elongated shoots are analyzed by PCR and western blot. Positive shoots are multiplied to 10 copies on MS medium containing 0.04 mg/L BAP. A few leaves are excised from the shoots and analyzed by RT-PCR.
  • Expression of dsRNAs is measured using RT-PCR. Total RNA from 50 mg fresh transgenic plant tissue was purified using EPICENTRE MasterPure™ Plant RNA Purification Kit (Cat. #MPR09010) following by DNAse treatment with Ambion TURBO DNA-free™ Dnase (Cat. #AM1907). 1 μl of total RNA from each sample is analyzed by RT PCR. RT PCR is performed using Invitrogen SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase kit (Cat. #12574-018). As a control, the Platinum Taq DNA Polymerase kit (Cat. #12574-018 and #10966-018) is used to recognize traces of DNA contaminations. No fragment amplification is expected for this control.
  • To detect expression of RNA from constructs, RT-PCR is prepared using primer pairs that generate fragments indicative of the presence and expression of Bronze bug transgenes.
  • Example 7 Bioassay of Bronze Bug dsRNA Constructs Sup Suckers Artificial Feeding
  • 100 μl of feeding solution (standard diet described in Febvay et al., Canadian Journal of Zoology 66:2449-2453, 1988) is placed between two stretched paraffin membranes on a plastic cap. 10 Bronze bugs are placed on the paraffin membranes and covered with a Petri dish lid that is ventilated by a 1 cm hole covered with a mesh. Feeding solution containing siRNA, and/or dsRNA and/or hpRNA and/or microRNA homologous to one or more of the target genes described above in Table X is provided. RNA concentration can be between 10 ng to 500 ng per microliter. Bronze bugs are incubated for up to 40 days. Data on the number viable and dead bugs data is compiled daily. Candidate lethal sequences and their corresponding lethal target genes are ranked based on live to dead bug ratios data.
  • Example 8 Test of Protective Effect of Bronze Bug dsRNA Constructs
  • Eucalyptus plants are transformed with plasmids comprising construct 1, construct 2 or construct 3 (and transgenic lines are established. Controls lines are established by transforming plants with vector alone, without insertion of Bronze bug nucleic acids or without nucleic acids that could form siRNAs.
  • Transgenic, wt, and control eucalyptus plants are grown in insect proof cages in the greenhouse together with adult Bronze bugs. The insect proof cages keep the inoculums in while preventing outside pests from entering the cage. Following Bronze bug inoculation, the appearance of leaf damage is evaluated. Leaf damage can be seen as bronze-like spots or areas on the upper or lower surface of the leaves. These bronze areas are formed by as direct and/or indirect result of the sap-sucking activities of the Bronze Bugs. Plants are examined to determine number of Bronze bugs number of eggs and clusters of eggs on the plant tissues including leaves, reproductive organs, branches, stems, but predominantly on the leaves, and the number of dead or dysfunctional BB specimens found on or adjacent to the plants. The primary endpoints for a resistant plant can be either lack of symptoms, lack of viable pests on the plant surfaces and/or lack of eggs or egg clusters on the plants or retarded or altered growth development of nymphs. In some cases resistant plants may simply cause the contacting pests to become unviable or sterile without causing pest death. Five independent transformation events of transgenic eucalyptus plants transcribing dsRNA are tested. Ten lines of each transformation event are inoculated with adult Bronze bug in 3 independent repeats. Number of vital Bronze Bugs, their size, eggs, clusters of eggs, nymphs, dead bugs are recorded every day for 40 days after inoculation.
  • Exemplary prophetic result: Transgenic plants transcribing dsRNA targeting BB genes exhibit fewer symptoms, fewer vital Bronze bugs, less eggs and less egg clusters, less newly hatched nymphs, compared to controls. Transgenic plants lines are resistant to BB infection showing less leaf and other tissue damage, compared to control and wt plants that are infected with Bronze bugs.
  • Bioassay: Whole Plant Assay:
  • Five 3 month old transgenic and wt eucalyptus plants of each line were grown in a green house at 24° C., 40—60% RH and 16 hr of light per day. The trees were tested for Bronze bug resistance for a period of 40 days, from tree age of 3 months. Each plant line was maintained in a separate insect proof cage and each plant was inoculated with 50 adult and/or nymphs bugs that were reared in culture.
  • Every day after inoculation the following parameters were tested:
  • 1. Number of live bugs on each plant.
    2. Number of live bugs not on plants.
    3. Number of dead bugs.
    4. Number of deformed, dysfunctional or non-reproductive pests.
    4. Number of eggs laid.
    5. Number of nymph hatched.
    6. Number of defoliated leaves.
    7. Number of discolored leaves.
    8. Number of discolored patches per infected leaf
    9. Number of dead branches.
    10. Number of dead plants.
  • Single Leaf Assay:
  • Five 3 months old transgenic and wt eucalyptus of each line were grown in a green house at 24° C., 40-60% RH and 16 hr of light a day. The trees were tested, from age 3 months, for Bronze bug resistance for a period of 40 days. Each line was contained in a separate insect proof cage and 5 leaves of each plant were covered with clip-on insect cages described by Univ of Arizona Center for Insect Science Center for Education Outreach http://insected.arizona.edu/gg/resource/clip.html. Ten adult bugs were placed inside each leaf clip cage. Clip cages can be clipped over a leaf-feeding insect without disturbing the insect or the plant. These cages provide a simple way to isolate one or more sap-sucking pests or other small insects for investigation and observation.
  • Every day the following observations were made:
      • 1. Percent mortality ((total number of bugs−live bugs)/total number of bugs)×100 was calculated.
      • 2. Extent, number and percentage of discolored leaves was recorded.
      • 3. Number of eggs or egg clusters
    Results: Full Plant Assay:
  • Transgenic eucalyptus will significantly differ from the wt in these parameters:
  • 1. Less vital bugs on the plants.
  • 2. More live bugs off plants.
  • 3. More dead bugs.
  • 4. Fewer eggs and/or egg clusters laid.
  • 5. Fewer nymphs hatched.
  • 6. Less defoliated leaves.
  • 7. Less discolored leaves.
  • 8. Less dead branches
  • 9. Less dead plants.
  • Transgenic trees can have part or all of the above list as a phenotype following Bronze bug infestation.
  • Single Leaf Assay, Predicted Results:
  • Higher mortality rate was observed in the cages set around transgenic leaves compared to wild type starting day 2 and onwards.
  • No discoloration symptoms compared to wild type were visible in the transgenic leaves for the whole infection period.
  • No eggs or egg clusters were found on leaves of transgenic plants compared to wild type.
  • A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.
  • All patents, patent publications and non-patent literature referenced in the specification are hereby incorporated herein by reference in their entireties.
  • REFERENCES
    • 1. Baum J A, et al., Control of coleopteran insect pests through RNA interference, (2007), Nat Biotechnol. 25:1322-6.
    • 2. Frizzi A, et al., Tapping RNA silencing pathways for plant biotechnology, (2010), Plant Biotechnol 8:655-77.
    • 3. Gordon K H, et al., RNAi for insect-proof plants, (2007), Nat Biotechnol 25:1231-2.
    • 4. Huvenne H, et al., Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: a review, (2010), J Insect Physiol 56:227-35.
    • 5. Mao Y B, et al., Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol, (2007), Nat Biotechnol 25:1307-13.
    • 7. Nunes F M, et al., A non-invasive method for silencing gene transcription in honeybees maintained under natural conditions., (2009), Insect Biochem Mol Biol 39:157-60.
    • 8. Price D R, et al.., RNAi-mediated crop protection against insects, (2008), Trends Biotechnol 26:393-400.
    • 10. Tinoco M L, et al., In vivo trans-specific gene silencing in fungal cells by in planta expression of a double-stranded RNA, (2010), BMC Biol 8:27.
    • 11. Hannon, G. J., RNA interference., (2002), Nature 418:244-251
    • 12. Baulcombe, D., RNA silencing in plants, (2004), Nature 431:356-363.
    • 13. Pei Y, et al., On the art of identifying effective and specific siRNAs, (2006), Nature Methods 3(9):670-676.
    • 14. Cullen, B R., Enhancing and confirming the specificity of RNAi experiments, (2006), Nature Methods 3(9):677-681.
    • 15. Chen et. al, New Genes in Drosophila Quickly become essential, Science (2010), 330:1682-5.
    • 16. Dietzl et. al., A Genome Wide Transgenic RNAi Library for Conditional Gene Inactivation in Drosophila. Nature (2007), 448:151-7.
  • SEQUENCES
    SEQ ID NO: 1
    Gene #2
    Aats-trp
    tryptophanyl-tRNA synthetase-like
    GATGTCGTCAACCCTTGGTCCGTTTCAAGTTCCTCGCAGGAAGGGATTGA
    CTACGATAAACTCATAAAGAAGTTTGGCAGCTCCAAAATCGACCGAGAGC
    TGCTCGACCGGTGGGAAAAAGCCACTGGAAAACCAGCCCACCATCTACTC
    CGTCGAGGGATTTTCTTCAGTCATCGCGACGTCCATACAATATTGAATTT
    GGTGGAACAAGGGAAAAAGTTCTATTTGTACACCGGCCGAGGGCCGTCCT
    CCGCTTCAATGCATGTCGGACATTTGGTCCCGTTCGTTTTTACAAAGTGG
    ATTCAAGAAATGTTCAACGTTCCTCTCGTCATTCAATTGACCGACGACGA
    AAAGTTTCTCTGGAAAGACCTATCTGTGGAAGAGGCGAACAAGATGGCCT
    GGGAAAACGCTAAAGACATTATCGCCTGTGGCTTCGACGTCAATAAAACG
    TTTATCTTCTCTGATTTGGACTACATGGGGCAGTGCTCGGAATTCTACAA
    GAATGTGGTCCGGATTCAAAAGTGCGTCACTTTCAATCAAGTTAAAGGCA
    TTTTCGGATTCGGAGACAGTGACGTCATTGGGAAAATTAGTTTTCCGGCC
    ATTCAAGCCGCACCCAGCCTTTCCACGTCGTTTCCATTCATTTTCGGAAA
    GGAGAAAATTCCCTGTTTGATACCTTGTGCCATTGATCAGGATCCTTATT
    TTCGAATGACGAGAGACGTTGCGCCGCGTCTGGGCTTCCCTAAACCAGCC
    CTGCTCCACTCCACTTTTATTCCAGCTCTGCAAGGAGCTCAAACGAAAAT
    GTCGGGCAGCGACGCCAACACCGCTATTTTCCTCACGGATACTCCG
    SEQ ID NO: 2
    Gene #2
    Nucleotides 93-192 of SEQ ID NO: 1
    Aats-trp
    tryptophanyl-tRNA synthetase-like
    CCGAGAGCTGCTCGACCGGTGGGAAAAAGCCACTGGAAAACCAGCCCAC
    CATCTACTCCGTCGAGGGATTTTCTTCAGTCATCGCGACGTCCATACAAT
    A
    SEQ ID NO: 3 + SEQ ID NO: 84
    Gene #3
    Blw
    ATP synthase subunit alpha (partial with gap)
    SEQ ID NO: 3:
    GCCATCGTCGATGTTCCCGTCGGTGACGACATTCTTGGCCGAGTTGTCGA
    CGCCCTTGGAAACCCTATCGATGGCAAGGGCCCTCTTTCTGGTAAATAGA
    GGATGCGAGTTGGTGTCAAAGCCCCGGGTATCATCCCCAGGATCTCGGTC
    CGCGAGCCTATGCAAACCGGAATCAAAGCCGTTGACTCGCTTGTACCCAT
    CGGTCGAGGACAACGGGAGCTCATCATTGGAGAG [gap]
    SEQ ID NO: 84:
    GATGCGGAAGACGAAAAGAAGAAGTTGTACTGTATCTACGTTGCTATTGG
    ACAGAAAAGATCCACTGTCGCGCAAATTGTGAAAAGATTGACCGACACCG
    GGGCCATGAAATACACCATCATTGTCGCTGCGACTGCATCTGACGCCGCA
    CCTCTCCAATACTTGGCTCCCTATTCCGGTTGCGCCATGGGAGAATTTTT
    CAGGGACAGCGGAAAACACGCCCTTATCATTTTCGACGATTTGTCCAAAC
    AGGCCGTCGCTTACCGTCAAATGTCTCTTCTGTTGAGACGTCCACCTGGT
    CGTGAGGCCTACCCTGGAGACGTTTTCTACCTTCACTCTCGTCTATTGGA
    ACGAGCTGCTAAAATGAACGAAACGCAAGGAGGTGGTTCGCTCACCGCTT
    TGCCTGTTATCGAAACTCAGGCCGGTGACGTGTCTGCCTACATTCCGACC
    AATGTTATTTCCATTACGGATGGACAAATTTTCCTTGAAACTGAGTTGTT
    CTACAAAGGTATCCGACCCGCCATTAACGTCGGATTGTCTGTGTCCCGTG
    TAGGTTCTGCCGCCCAAACCAAGGCCATGAAACAGGTGGCCGGTTCCATG
    AAATTGGAGCTTGCTCAGTATCGTGAGGTCGCTGCTTTCGCGCAGTTCGG
    TTCCGACTTGGACGCTGCCACCCAACAACTGCTGAACCGTGGTGTTCGTC
    TTACGGAACTTCTCAAACAAGGACAATACGTTCCCATGGCCATTGAAGAA
    CAGGTCGCTGTCATCTACTGCGGTGTCCGAGGTTTCTTGGACAAATTGGA
    CCCGGCCAAGATCACCCAATTCGAGAAGGAGTTCCTTCAACACATCAAGA
    CTTCTCACAAAGACCTGTTGGCCTCCATCGCCAAAGAGGGAAAGATCAGT
    GACGAAAATGATGCCAAGATGAAGGGCATTGTTACTTCTTTCCTCAGTGG
    CTTCTCCGGCTAG
    SEQ ID NO: 4
    Gene #3
    Nucleotides 50-149 of SEQ ID NO: 84
    Blw
    ATP synthase subunit alpha
    GACAGAAAAGATCCACTGTCGCGCAAATTGTGAAAAGATTGACCGACACC
    GGGGCCATGAAATACACCATCATTGTCGCTGCGACTGCATCTGACGCCGC
    SEQ ID NO: 5
    Gene #4
    Bur
    GMP synthase [glutamine-hydrolyzing]-like
    isoform 1 (partial)
    GAAAGGGACTTCTCCGAAACTCAAGTCCTCGTTAAAATTATTGTTGAGTA
    CGATCAAATGCTGCAGAAGAATCACGCGTTGTTGAATCGAGTGGAAAATG
    CGACGAACGAAGACGAAAGGGTTCAATTGAGGAAGGTGTCGAGCAAGCAG
    CACATGGCCGCAACAGTACTTCCGATCCGGAGTGTAGGAGTTCAGGGAGA
    CTGTCGCAGCTACAGCTACGTCGTTGGGATATCAAGCGAGAAAGACCCGG
    ATTGGGATGACCTCGTCATCCTCTCGCAGCTTATTCCCCGTGTGTGCCAC
    AACGTCAACCGAGTCTGCTACATTGCTGGCGGCCTCGTCAAAGACCCTGT
    TCAGGACATCACTCCGACTTTTCTCACTTCTCCAGTTCTGGCGACGATAC
    GACAAGCAGACCATTTGGCGACTCAGGTCCTCTATAATAGCGATTACATG
    TCTAAAATATCGCAAATGCCCGTGATCCTCCTTCCACTGCATTTTGACCG
    GGACGCCGCTCTCCGAGTCCCATCGTGTCAACGGTCCGTTGTTCTCCGCC
    CATTTATCACGCACGATTTCATGACGGGAATCCCAGCCATCCCGGGATCC
    ACATACCCATTGACATCGTTCAAAAAAATGTTCTCTGAAATCTCCTTAAT
    GCCGGGAATCTCTCGTGTCCTGTACGACCTGACAGCCAAACCACCCGGAA
    CAACTGAATGGGAGTGA
    SEQ ID NO: 6
    Gene #4
    Nucleotides 368-467 of SEQ ID NO: 5
    Bur
    GMP synthase [glutamine-hydrolyzing]-like
    isoform 1 (partial)
    CTTTTCTCACTTCTCCAGTTCTGGCGACGATACGACAAGCAGACCATTTG
    GCGACTCAGGTCCTCTATAATAGCGATTACATGTCTAAAATATCGCAAAT
    SEQ ID NO: 7
    Gene #7
    Pros28.1A
    proteasome subunit alpha type-like (full)
    ATGGGAACTGCGAGGTACGACCGGGCCATCACCGTTTTCTCGCCTGATGG
    GCACCTCCTCCAAGTCGAATACGCCCAAGAGGCCGTCCGAAAAGGATCAA
    CTGCCGTGGGAGTCCGAGGGGAAGACTGCGTCGTTCTCGGAGTTGAAAAG
    AAATCAGTGGCGAAACTCCAAGAGGAAAGAACAGTGAGGAAAGTGTGTCT
    TTTAGACGATCACATTCTCATCGCGTTTGCCGGTCTGACTGCGGATGCTC
    GAATATTAATTAATCGGGCGCAAATAGAGTGTCAATCGCACAAGTTGACT
    GTAGAGGACCCGGTGACGGTTGAGTACATCACACGTTACATAGCAGGGCT
    TAAACAGAAATACACGCAGAGCAATGGCCGGCGACCGTTTGGCATTTCGT
    GCCTTATTGGTGGTTTTGATTTGGACGGGTCACCTCATCTGTTCCAAACG
    GAACCTTCTGGAATATTCTACGAGTGGAAAGCCAATGCCACAGGTCGCGG
    TGCCAAGTCAGTTAAGGAGTTCCTTGAAAAGAATTACGAAACTTCCGACT
    TGAAGACTGAAGACGGTGTCATCAAGTTGGCAGTTCGGGCTCTGCTAGAA
    GTCGTGCAGTCCGGCCGGAAGAATTTGGAAGTCGCTGTGATGCGCCGGAA
    TCAGCCTTTGAGAATGCTGGATCTGGATTCGATCGATCAAATTGTGACTC
    AAGTTGAACAAGAAAAAGAGGAGGAAGCTGAAAAGAAGAAGCAGAAGAAA
    TAA
    SEQ ID NO: 8
    Gene #7
    Nucleotides 498-497 of SEQ ID NO: 7
    Pros28.1A
    proteasome subunit alpha type-like
    CGGTGCCAAGTCAGTTAAGGAGTTCCTTGAAAAGAATTACGAAACTTCCG
    ACTTGAAGACTGAAGACGGTGTCATCAAGTTGGCAGTTCGGGCTCTGCTA
    SEQ ID NO: 9
    Gene #8
    Prosa3T
    proteasome subunit alpha type-like (full)
    ATGGCCCGCCGTTATGACTCGAGAACGACAATATTTTCGCCGGAAGGTCG
    ACTGTACCAAGTTGAGTATGCGATGGAGGCGATAAGTCATGCCGGTACGT
    GTTTGGGCATCCTGGCCAACGACGGTATCATTCTCGTCGCTGAAAAAGAA
    AACCCCAACAAGCTCTTGGATGAGTCCGTGTACTCGGAAAAAATTTTCAA
    GCTTAACGAAAACATGATATGCAGTTTAGCCGGGATCACTTCCGATGCGA
    ACGTCCTCACAAACGAGCTCCGTGTCATCTCCCAACGCTATTTGATCCAG
    TACGGTGAAACGATCCCCTGTGAGCAGCTCGTCTCGTGGCTTTGTGACAT
    TAAACAAGCGTACACTCAATACGGTGGTAAGAGGCCTTTCGGTGTTTCCG
    TCCTGTACATGGGCTGGGACAAACACTACGGCTACCAACTCTATCAATCC
    GATCCGAGCGGTAACTACTCCGGATGGAAAGCCACCTGTATCGGGCAAAA
    CAGTGGAGCAGCCGTTTCCAGCCTTAAAACCGACTATAAAGAAGGTGAAA
    TGACCGTTCAAGACGCTCTAGCTCTCGGAATCAAAGTCTTAAGCAAAACT
    TTAGACACTGCCAAATTAACAACTGATCGCGTGGAAGTTGCAACGCTTCA
    GCGCATCGATGGCAAATGCATCACTCGGATTTTGCCCGCTAGTGAAGTTC
    AAGTACTCATTGACGCATTTGAAAAGTCTGAGGCTGAAGCCGCCGCTCAA
    AGGAGAGAAAGAGCTCCGAATCCTTAA
    SEQ ID NO: 10
    Gene #8
    Nucleotides 673-772 of SEQ ID NO: 9
    Prosa3T
    proteasome subunit alpha type-like
    ACTCGGATTTTGCCCGCTAGTGAAGTTCAAGTACTCATTGACGCATTTGA
    AAAGTCTGAGGCTGAAGCCGCCGCTCAAAGGAGAGAAAGAGCTCCGAATC
    SEQ ID NO: 11
    Gene #9
    CG2931
    RNA-binding protein 42-like (partial)
    ACCGCTGGAGGTCAGACTTGGGAAGACAACACGCTCGCCGAATGGGAAGA
    TGATGATTTCCGGCTTTTTTGTGGAGATTTAGGAAACGATGTCACCGACG
    AAGTCTTAACCCGAGCGTTTTCCAAGTATCCGTCATTTCTCAAAGCTCGA
    GTCGTTCGCGACAAAAGAACAAATAAAACTAAAGGATTTGGTTTCGTCAG
    TTTCAAAGATCCAAACGATTTCATACGAGCAACTAAAGAAATGAATGGCC
    GCTACGTCGGGTCACGTCCCATTAAATTAAGGAAAAGCTCATGGAAAAAC
    AGAACTTTGGATGTCGTCAGAAAGAAGGATAAAGAAAAAGCAGCTCTCAT
    TAGTATGCTCACAGGGAAATGA
    SEQ ID NO: 12
    Gene #9
    Nuclotides 272-371 of SEQ ID NO: 11
    CG2931
    RNA-binding protein 42-like
    TTAAATTAAGGAAAAGCTCATGGAAAAACAGAACTTTGGATGTCGTCAGA
    AAGAAGGATAAAGAAAAAGCAGCTCTCATTAGTATGCTCACAGGGAAATG
    SEQ ID NO: 13
    Gene #10
    CG31524
    prolyl 4-hydroxylase subunit
    alpha-2-like isoform 2 (partial)
    GAAATGTATGAGTTGGCCTGTCGTGGGCTCCTGTCACCGCCACCGTCGCT
    TTGCTCAACTGAAGTGCCGCTACGTTACCAAATCTCCTTTTACAATTTGG
    CTCCATTGAAAGAAGAAGAAGCATATCTGAAACCGAAAATCATACTTTAC
    CGGGAAGTGATGTATCACTCGGAAATTGAAATCATCAAACAAATGGCTCA
    TCCCAGGTTGAAACGAGCGACAGTCCAAAATTACAAAACTGGAGAGTTGG
    AAATCGCCTCATATCGAATATCAAAATCCGCGTGGTTCAATGACAACGAC
    CACGAGGTGATGGCGCGGTTGACGAGGAGAGTCGAGGACATGACGGGCTT
    AACAATGAAATCTGCCGAAGACCTCCAAGTCGTCAATTACGGCATTGGAG
    GCCACTATGAGCCACATTACGATTTTGCCAGAAAAGGAGAAGAAACACAT
    GCGTTCAAGTCTCTCGGAACTGGGAACAGAATCGCTACAGTATTGTTCTA
    TATGAGCGACGTCGCTCAAGGAGGTGCCACCGTGTTCCCCCAGCTAAATC
    TGTCTCTTTGGCCGGAAAAAGGAACTGCTGCGTTTTGGATGAATCTTCTC
    GCCAATGGTGAAGGTGATTACGACACGAGGCATGCAGCATGTCCTGTACT
    AGCAGGCACGAAATGGGTGTCTAACCGGTGGATCCACGAAAGAGAACAAG
    AGTTCAGGAGACCCTGTTCGCTGGATCCCAACGAGTGAATTATTCCCACA
    SEQ ID NO: 14
    Gene #10
    Nucleotides 241-340 of SEQ ID NO: 13
    CG31524
    prolyl 4-hydroxylase subunit
    alpha-2-like isoform 2
    GGAGAGTTGGAAATCGCCTCATATCGAATATCAAAATCCGCGTGGTTCAA
    TGACAACGACCACGAGGTGATGGCGCGGTTGACGAGGAGAGTCGAGGACA
    SEQ ID NO: 15
    Gene #12
    CG3590
    adenylosuccinate lyase-like (partial)
    CTCTGCACAGACCTCAGGCTCCTTGACAAATATGAAAGAGATTGAAGAGC
    CTTTCGAAAAACTCAAATTGGGTCAAGCGCTATGGCGTACAAAAGGAATC
    CAATGAGAAGTGAAAGGTGTTGCGCTTTGGCCCGTCACTTGGTCTCTTTG
    CACTCGAATGCGGCCAACACTGCTGCCGTCCAATGGCTCGAAAGAACCCT
    AGATGACAGCGCCAATCGACGCATCACCCTAGCCGAAGCGTTTCTCTGCT
    CGGATGCTCTCCTCATCACTTTGATGAACATTTTGGAAGGGCTCGTAGTC
    TACCCGAAAGTCATTGAAAAGCACATCGGAGAAGAACTTCCTTTTATGGC
    AACTGAGAACATCATTATGGCCATGGTCAAAGCTGGCGAAGACAGACAAG
    AATGCCATGAGAAAATCCGAGTTTGGGCCCAAGAAGCGGGCACTCAAGTC
    AAAATTTTGGGCCTTAAAAACGATCTAGTGGACCGAATCAAAAAG
    SEQ ID NO: 16
    Gene #12
    Nucleotides 244-343 of SEQ ID NO: 15
    CG3590
    adenylosuccinate lyase-like
    CTCTGCTCGGATGCTCTCCTCATCACTTTGATGAACATTTTGGAAGGGCT
    CGTAGTCTACCCGAAAGTCATTGAAAAGCACATCGGAGAAGAACTTCCTT
    SEQ ID NO: 17
    Gene #13
    CG5451
    WD40 repeat-containing protein
    SMU1-like isoform 1 (partial)
    CAAGCATTGAAGTGGCAACAGCACCAGGGGCTTCTTCCACCAGGTACGAC
    ATCGCTTGTCCGTGGTAAAGCTGCGATAAGAGACCAAGACGATGAAAAGT
    ACCCAACGCAGTTGTCAAAGCAGATCAAGTTCGGTCACAAGTCCCATGTC
    GAATGTGCCACTTTTTCGCCGGACGGGCAATTCCTCGTGTCTGGGAGCGT
    TGACGGTTTCATTGAAGTGTGGAATTTCACGACGGGGAAAATCCGAAAGG
    ATCTCAAGTACCAAGGCCAGGACAATTTCATGATGATGGAAGAAGCCGTT
    TTGGCGCTAGCTTTCAGCCGCGACTCAGAAATGCTTGCGAGCGGTTCCCA
    AGAGGGTAAAATCAAAGTGTGGAAAATCGTGACGGGTCAGTGTCTCCGCA
    AGTATGAAAAAGCCCATTCCAAAGGCGTTACTTGCATCCGATTCTCAAGG
    GACAACAGTCAAATCCTCACCGCCTCGTTCGACACGACAATCAAAATTCA
    CGGGTTGAAGTCAGGTAAATCGTTGAAGGAATTCCGC
    SEQ ID NO: 18
    Gene #13
    Nucleotides 438-537 of SEQ ID NO: 17
    CG5451
    WD40 repeat-containing protein
    SMU1-like isoform 1
    CCGATTCTCAAGGGACAACAGTCAAATCCTCACCGCCTCGTTCGACACGA
    CAATCAAAATTCACGGGTTGAAGTCAGGTAAATCGTTGAAGGAATTCCGC
    SEQ ID NO: 19
    Gene #20
    Dhc64C
    dynein heavy chain, cytoplasmic-like
    (partial)
    CAACGGCTACTGTCATCTTTCCTTTCGAAATTGTTCACTCCGCGAAGCTT
    TGAGTCGGATTTTGCATTGGTTGCCAACGTTGACGGTGCCCAACGGCACA
    TTGTGATGCCGGACGGAACAAGGAGGGATCACTTCCTCCGGTGGATCGAA
    GGGTTGTCCGATCGCCAGACACCCGCGTGGCTCGGTCTTCCAAACAACGC
    CGAGAAAGTCCTATTGACCAATCGAGGAGCCGATTTGGTCATGAAACTGC
    TCAAAATGCAACAATTAGAGGACGAAGACGAGCTCGCCTACACCGAAGAA
    GCCGCCGCCAACAATCCAGACGGCCCTTCGTCCGCTCTCCCTGAAGACGC
    TAGACCAGCCTGGATGCGCACTTTGTACAATTCCGCAGTTTCCTGGCTCG
    AACTCCTCCCCACAAGCCTTCCGACTCTGAAGAGAACTGTGGAAAATATC
    AAAGATCCTCTCTACCGGTACTTCGAAAGGGAGGTGAACGCCATCGCCAA
    ACTCTTACGTGATGTTGTCCACGATTTAACTGACATAGTCGCGATTTGTC
    AAGGTACGAAAAAACAAACAAATTACCATAGAACTATGGTTGGGGAGTTG
    GTTCGAGGAATGCTCCCGGCATCTTGGCGGCGCTACACAGTTCCCCGCGG
    CTGCACAGTAATCCAATGGGTCACCGACTTCAGTAACAGAGTCAAGCAAT
    TGGCCCACATATCCCAATTAGCCTCTCAGAGAGGTCCTTCAGAAATAAAG
    AGTGTCGCTGTATGGCTGGGCGGTCTCACCAACCCCGAGGCTTACGTTAC
    TGCTACGCGTCAGTGCATTGCACAAGCTAACAGTTGGTCTTTGGAGGAGC
    TTGTGCTCGACGTTACGATTTTGGACAGTTCGGGACAAGTTCCTATCGAC
    GGCTCCAGTTTCCCTGTGACTGGGCTGAAGCTTCAAGGAGCTCAATGTAA
    AAACAACCAATTGCAGCTCGCCTCGACTATCATGATGGAACTACCCACAA
    CTCTTCTTCGCTGGACCAGAATCGGTGACTGCACCAGCGACGGCAAGCTT
    TCCCTTCCCGTTTATTTGAATTCAACCCGAAGTGAACTTCTGTTCACGGT
    CGACCTCAACGTTCTTCCGGGCCAAGATCCGCACAGTTTCTACGAAAGAG
    GAGTCGCTTTGCTTGCTTCAACTGCCCTTAATTAA
    SEQ ID NO: 20
    Gene #20
    Nucleotides 146-245 of SEQ ID NO: 19
    Dhc64C
    dynein heavy chain, cytoplasmic-like
    TCGAAGGGTTGTCCGATCGCCAGACACCCGCGTGGCTCGGTCTTCCAAAC
    AACGCCGAGAAAGTCCTATTGACCAATCGAGGAGCCGATTTGGTCATGAA
    SEQ ID NO: 21
    Gene #24
    e(r)
    enhancer of rudimentary (full)
    ATGTCGCACACGATAATGCTCATCCAGCCGGGTACCAAACCTGAGACGAG
    AACCTACTCAGACTACGAATCTGTGAACGAGTGTATGGAAGGTGTGTGCA
    AAATATATGAGGAGCACTTGAAAAGGCAGAACCCGAACACTCCCGCTATC
    ACTTACGACATTAGTCAATTGTTTGACTTCATTGACCAGTTGTGCGATTT
    GTCCTGCCTAGTGTACCAGAAAGGCTCCAACACTTACGCCCCCTACAACA
    AAGACTGGATCAAAGAGAAGATCTACATTCTGCTCCGACGGCAGGCCAAT
    AATCGCCAATAA
    SEQ ID NO: 22
    Gene #24
    Nucleotides 178-277 of SEQ ID NO: 21
    e(r)
    enhancer of rudimentary
    TTCATTGACCAGTTGTGCGATTTGTCCTGCCTAGTGTACCAGAAAGGCTC
    CAACACTTACGCCCCCTACAACAAAGACTGGATCAAAGAGAAGATCTACA
    SEQ ID NO: 23 + SEQ ID NO: 85
    Gene #26
    ebi
    f-box-like/WD repeat-containing
    protein ebi-like (partial/gapped)
    SEQ ID NO: 23:
    GCCCTTGACGTCGACTGGCAAACGAACACGAGTTTTGCCTCGTGCAGTAC
    CGACCAGTGTATCCACGTTTGCAAATTAAATGTTGAAAAACCCATCAAGT
    CCTTCCAAGGGCACACAAATGAAGTCAACGCGATTAAGTGGGATCCG
    [gap]
    SEQ ID NO: 85:
    GGAAATCTGTTGGCGTCCTGCTCTGACGATATGACTCTTAAAATTTGGTC
    GATGAAACAAGACACGTGTGTGTACGACTTGCAAGCTCACAATAAGGAAA
    TTTACACTATCAAGTGGAGCCCAACTGGACCGGGCACACTGAACCCAAAT
    ATGAATCTTATTTTAGCCAGTGCCTCATTCGATTCTACTGTTCGTCTCTG
    GGAAGTGGATCGGGGAGCTTGTATTCACACTTTAACTAAACACACTGAGC
    CCGTGTACAGCGTCGCCTTTTCCCCCGACGGTAAATTCTTGGCTTCTGGA
    AGCTTCGACAAATGCGTTCATATATGGTCAACTCAGTCGGGGCACTTAGT
    TCACAGTTACAAAGGAACGGGTGGGATATTCGAAGTATGTTGGAACTCTC
    GGGGCGATAAAGTCGGAGCTAGTGCATCGGACGGAAGCGTATTTGTTTTG
    GACCTCCGCAAGCTGTGA
    SEQ ID NO: 24
    Gene #26
    Nucleotides 186-285 of SEQ ID NO: 85
    ebi
    f-box-like/WD repeat-containing protein
    ebi-like
    TACTGTTCGTCTCTGGGAAGTGGATCGGGGAGCTTGTATTCACACTTTAA
    CTAAACACACTGAGCCCGTGTACAGCGTCGCCTTTTCCCCCGACGGTAAA
    SEQ ID NO: 25
    Gene #27
    EcR
    ecdysone receptor isoform A (partial)
    ATCAAGCCCGTCAGTCCCGAACAAGAAGAGCTCATACACCGTCTCGTATA
    TTTCCAAAGCGAGTACGAACATCCGTGTGAAGAGGACGTCCGCCGAATAA
    ATGCTCCAAACGACGACGATGAGCCCAACTCAGACTACAGGTTCCGATAC
    TTGGCCGAAATCTCCATACTAACTGTTCAACTTATTGTTGAATTTGCAAA
    AAGACTTCCTGGATTCGACAAACTTTTGAGGGAAGACCAAATCACTTTAC
    TTAAGGCATGTTCAAGCGAAGTGATGATGTTGAGGATGGCTCGGCGGTAC
    GACGCACAGACCGACTCGATCCTCTTCGCGAACAACCAACCCTATACCAG
    AGACTCGTATAATTTAGCAGGCATGGGAGAAATAGTCGAGGATCTGCTCA
    GGTTTTGCCGGCAAATGTACAATATGAAAGTGGACAACGCTGAGTACGCA
    CTTCTCACCGCCATCGTTATATTCTCAGAGAGACCGTCACTTATTGAAGG
    GTGGAAAGTGGAAAAAATCCAGGAAATCTATTTGGAGGGGCTCAAATCCT
    ACGTGGACAACAGGTCGAGGCCTCGATCCCCTACAATATTCGCCAAACTC
    CTCTCGGTCCTGACTGAGCTTCGAACACTCGGAAATCAAAATACGGAGAT
    GTGTTTCTCATTAAAACTTCAAAATAAGAAACTTCCTCCGTTTTTGTCAG
    AAATATGGGACGTA
    SEQ ID NO: 26
    Gene #27
    Nucleotides 65-164 of SEQ ID NO: 25
    EcR
    ecdysone receptor isoform A
    ACGAACATCCGTGTGAAGAGGACGTCCGCCGAATAAATGCTCCAAACGAC
    GACGATGAGCCCAACTCAGACTACAGGTTCCGATACTTGGCCGAAATCTC
    SEQ ID NO: 27
    Gene #28
    Efl alpha48D
    elongation factor 1-alpha-like (partial)
    ATCGTCGTCATCGGCCACGTCGACTCTGGTAAATCGACGACCACCGGGCA
    TTTGATCTACAAATGCGGTGGTATTGACAAACGTACCATTGAGAAGTTCG
    AGAAGGAAGCCCAAGAAATGGGAAAAGGTTCCTTCAAGTACGCTTGGGTT
    TTGGACAAGCTGAAAGCCGAACGTGAGCGTGGTATCACAATTGACATTGC
    GCTCTGGAAGTTCGAAACTGCCAAGTACTACGTTACCATCATTGATGCCC
    CCGGTCACAGGGATTTCATCAAGAACATGATCACCGGAACGTCTCAGGCT
    GATTGTGCTGTTTTGATCGTTGCTGCTGGTACTGGTGAATTCGAGGCGGG
    TATTTCCAAGAACGGACAAACCCGTGAGCACGCTCTCCTCGCTTTCACTC
    TCGGTGTGAAACAGCTCATTGTCGGAGTGAACAAAATGGACTCGACTGAG
    CCCCCGTACAGCGAGAGCCGTTACGAGGAAATCAAGAAAGAGGTGTCTTC
    GTACATCAAGAAAATCGGGTACAACCCAGCGGCTGTCGCTTTCGTTCCCA
    TCTCCGGATGGCACGGTGACAACATGTTGGAGGCGTCCGACAAAATGCCC
    TGGTTCAAGGGATGGAACGTTGAGAGGAAAGAGGGTAAGGCCGACGGAAA
    GTGCCTTATTGAAGCCCTCGACGCCATCCTCCCCCCGTCCCGTCCCACCG
    ACAAGGCCCTTCGACTTCCCCTTCAGGACGTGTACAAAATCGGTGGTATC
    GGAACAGTGCCCGTCGGCCGAGTCGAAACCGGTCTACTGAAACCTGGTAT
    GATCGTTACTTTTGCCCCTGTCAACCTCACGACTGAGGTTAAATCCGTGG
    AGATGCACCACGAAGCCCTCCAAGAGGCTGTGCCCGGAGACAACGTCGGA
    TTCAACGTTAAGAACGTCTCCGTTAAAGAGTTGCGTCGTGGTTTCGTCGC
    CGGCGACTCCAAAAACGCTCCTCCCAAGGCCGCGAGTGACTTCACTGCCC
    AAGTCATCGTTCTCAACCATCCCGGTCAAATCGCCAACGGGTACACTCCC
    GTCTTGGATTGTCACACTGCCCACATCGCGTGTAAATTCAACGAGATCAA
    AGAAAAATGTGACAGACGTACTGGTAAAACCACTGAGCAGAACCCCAAGT
    TCATCAAGTCTGGTGACGCCGCTATTGTCACCCTCATCCCGACTAAGCCC
    ATGTGCGTCGAGTCTTTCCAGGAGTTCCCTCCCCTGGGACGTTTCGCCGT
    GCGTGACATGAGGCAAACCGTCGCTGTCGGCGTCATTAAAAGCGTCACTA
    ATAAAGACGTGACGACTGGTAAAGTGACG
    SEQ ID NO: 28
    Gene #28
    Nucleotides 944-1043 of SEQ ID NO: 27
    Efl alpha48D
    elongation factor 1-alpha-like
    TCGTCGCCGGCGACTCCAAAAACGCTCCTCCCAAGGCCGCGAGTGACTTC
    ACTGCCCAAGTCATCGTTCTCAACCATCCCGGTCAAATCGCCAACGGGTA
    SEQ ID NO: 29
    Gene #29
    Efl gamma (full)
    ATGGCGTCAGGAACTTTGTACACTTACTCGGGAAATTTCCGCGCGTACAA
    AGCCCTCATTGCGGCCGAATACGGGGGCGGTTCGGTCAAAGTGGCACCGG
    ATTTTGTCTTCGGCGAAACGAACAGGACTCCTAATTTTCTCAAGAAATTC
    CCCCTGGGAAAGGTGCCTGCTTTCGAAAGTACCGACGGCACATGTGTCAC
    CGAAAGCAACGCCATAGCCTGGTTCGTTGCCAGTCCAGAATTGAGAGGGA
    AGTCTGACGCGGAAAAAGCTCAAATTGTTCAATGGTTGAGCTACTCAGAC
    TCCGAAGTTCTTCAAGCCACTTGTACTTGGGTCTTCCCCTACCTCGGTAT
    CCTTCCCTTCAACAAATCCGAAGTTCAAAAAGGCGGCAAAGAAGCCCTTC
    AAGCCATTCTGAAATGCCTGAATTCGTATTTGCTCACGAGGACTTATCTA
    GTGGGTGAAGCAATTACTTTGGCCGACATCGTACTCACATGCACGCTTCT
    CCCTGCCTACCAGACTGTCTTAGACCCTAGCTTCAGGAAGGAGTTCCAAA
    ATGTCAACCGGTGGTTCAACACTATCGTCAATCAGCCAAAAGTCAAAAAA
    GTCTTGGGAGATGTCAAACTCTGTGACAAAGAGCCCGTCATCCCTGCTCC
    TGATGGGAAGAAGAAAGAGAAGGCAGAAAAGCCTTCAGGGGACGCTCAAC
    CCAAAAAAGAGAAAAAAGCTGCGAAACCTGCGGAGGAGGAGGAAATGGAC
    GCGGCGGAAGCTGCCCTGGCCGCTGAGCCCAAGTCCAAAGACCCCCTTGA
    CGCACTGCCCAAAGGGACATTCGTCATGGACGACTTCAAACGAGTTTACT
    CCAACGAGGACGTTGATAAGTCCATTCCGTACTTTTGGGAGAAATTCGAC
    AAAGAAAACTACTCGATTTGGTTGGGCGAGTACTTGTACAACGACGAGCT
    GCAAAAGGTCTTCATGAGCTGCAACCTCATCACCGGCATGTACCAGAGAC
    TGGACAAAATGAGGAAAAACGCTTTCGCCTCCGTCATTCTGTTCGGCAAA
    GACAACGACAGCACCATTTCCGGTGTTTGGGTGTGGCGAGGCCAAGATCT
    TGCTTTCAAAATGAGCCCTGACTGGCAAGTGGACTACGAGTCGTACAAAT
    GGTCCAAACTCGACCCGACTAATCAAGAACACAAAAAAATGGTCGATAAT
    TATATGGCGTGGACAGGAACGGACAAACAAGGCCGCCCATTCAATCAAGG
    GAAAATCTTCAAATGA
    SEQ ID NO: 30
    Gene #29
    Nucleotides 951-1050 of SEQ ID NO: 29
    Efl gamma
    GCAAAAGGTCTTCATGAGCTGCAACCTCATCACCGGCATGTACCAGAGAC
    TGGACAAAATGAGGAAAAACGCTTTCGCCTCCGTCATTCTGTTCGGCAAA
    SEQ ID NO: 31
    Gene #30
    eIF-2alpha
    eukaryotic translation initiation factor
    2 subunit 1-like isoform 1 (partial)
    TACATCGATCTCAGCAAAAGAAGAGTTTCGCCTGAGGACGTTGAAAAATG
    CACTGAGAGATTTGCCAAGGCCAAAGCTGTCAACTCAATTTTGAGACACG
    TCGCTGAGCTCCTCCACTACGACGCCGATGAACAGCTGGAGGACCTCTAC
    CAGCGAACGGCGTGGTTTTTCGAAGAGCGAACCAAGAAGAAGTCCTCTGC
    CTACGATTTCTTCAAACAAGCTGTTCTTGACAACTCAATTTTGGCTGAGT
    GCGGACTTGACGAAGCTACTCAGGAAGTCCTTTTGACCAATATCAAGAGG
    AAATTGACGTCGCAGGCCGTCAAAATCAGAGCTGACATCGAAGTAGCTTG
    TTACGGCTACGAAGGGATTGACGCTGTTAAAACTGCACTCAAGGCCGGTT
    TAGCACTCTCCACCGAAGAACTTCCAATCAAAATCAATCTTATTGCTCCT
    CCACTATATGTCATGACGACAGCCACTCCTGAAAAAGCTGATGGGCTCAA
    AGCCCTTCAAAATGCGATCGAAGTCATCGAAAAGGAAATCACCAGTCTTG
    GCGGTGTCTTTCAAGTCGAAATGGGCCCCAAAGTCGTTACAGCGACGGAC
    GAAGCGGAATTGGCTAAACAAATGGAAAGAGCTGAGGCCGAAAATGCCGA
    AGTGGCCGGG
    SEQ ID NO: 32
    Gene #30
    Nucleotides 90-189 of SEQ ID NO: 31
    eIF-2alpha
    eukaryotic translation initiation factor
    2 subunit 1-like isoform 1
    TTTGAGACACGTCGCTGAGCTCCTCCACTACGACGCCGATGAACAGCTGG
    AGGACCTCTACCAGCGAACGGCGTGGTTTTTCGAAGAGCGAACCAAGAAG
    SEQ ID NO: 33
    Gene #31
    eIF3-S8
    eukaryotic translation initiation factor
    3 subunit C-like isoform 1 (partial)
    GAGCACTTGTACTACAAATTCGACCCGACTGTCATTCAACAGAGAAAGGG
    CGAATTGGAACCAGGCACCCAAACTAGCATCCAAGTGATGGACAAATTGT
    GCAAGTACATTTACGACAAGGACCAAACAGATCGGCTGAGAACGAGGGCC
    ATTCTGGCCCACGTGTACCATCACGCGTTGCACGACAATTGGTTCCAAGC
    TCGGGACCTCATCCTCATGTCACATCTTCAAGAAGCCATACAACATTCCG
    ATCCATCTACCCAGATCCTGTACAACCGTACTATGGCCCATTTGGGACTT
    TGCGCCTTCCGCCACGCGAACATCAAAGATGCCCACAATTGCTTAGTGGA
    CTTGATGATGACTGGAAAAACGAAAGAACTTTTGGCCCAGGGACTCATGC
    CGCAGAGGCAGCACGAACGAAGCAAAGAACAAGAAAAAGTTGAAAAACAG
    AGACAAATGCCGTTCCACATGCACATTAACTTGGAGTTGATCGAGTGCGC
    TTATTTAGTGTCAGCTATGCTCATTGAAATTCCTTACATGGCCGCTCATG
    AATTCGATGCACGGAGAAGGATGATCTCCAAAACGTTCTATCAGCAGTTG
    AGAAGCAGCGAACGACAGTCATTGGTCGGTCCTCCAGAAAGTATG
    SEQ ID NO: 34
    Gene #31
    Nucleotides 21-120 of SEQ ID NO: 33
    eIF3-S8
    eukaryotic translation initiation
    factor 3 subunit C-like isoform 1
    CGACCCGACTGTCATTCAACAGAGAAAGGGCGAATTGGAACCAGGCACCC
    AAACTAGCATCCAAGTGATGGACAAATTGTGCAAGTACATTTACGACAAG
    SEQ ID NO: 35
    Gene #32
    eIFS
    eukaryotic translation initiation
    factor 5-like isoforml (partial)
    ATGGGCAGCGTCAACGTGAACCGGTCCGTTTCCGATGCCTTCTATCGGTA
    CAAGATGCCGCGCCTCCTCGCTAAGGTCGAGGGCAAAGGGAACGGCATAA
    AAACGGTCATAGTGAACATGGCAGACGTCGCTAAGGCTCTCGGTCGGCCA
    GCCACCTACCCAACCAAGTACTTCGGATGCGAACTCGGAGCTCAGACTTT
    GGTGGATTTCAAGAACGACAGATTCATCGTGAACGGGTCCCATGACGCGG
    CCAAACTGCAGGACCTCCTCGACGGGTTCATTCGGAAATTCGTGCTCTGC
    CCCGAATGCGACAACCCTGAAACTGATCTTCTCGTCAATTCGAAGAAAGA
    GACGATCAGTCAAGGGTGCAAGGCCTGCGGCTTCCACGGCCTCCTCCAGT
    TCAACCACAAACTGAACATGTACATTATCAAAAATCCACCAAACATGAAT
    CCGGCTACACAGGGCGCTTCTCTGACCGAAGGGAAAAGAGCTCGTCGGTC
    CAAAGCCAAGCAAAACGGCGACGTCACCAACGGAGACCGTTCCGGTTCAC
    CCAAGTCAGAAGACGAGCCCGAGCTCATCGTCGCTCCTACAAAGAACATC
    GAAAATAAAAACGACGACGACCTCCAATGGGCCGTCGACGTCTCCGAAGA
    AGCCGTCCGAGCTCGTCTTCAAGACCTGACCGACGGAGCTAAAAACCTGA
    CCTTAACTGATGATCTTGAGAAACCAGAAAACGAGCGGATGGACATTTTC
    TACGTGATGGTGAAACAGAGGCGGGACACAGGCGATTTGTCGACTCCACT
    CGCCGCCAAGGAGATCCTCGCCGAAGCGGAGCGACTTGAAATCAAAACCA
    AAGCTCCACTTGTCCTCGCTGAGCTTCTTTTTGACGACAAAATCCACGTT
    CAGATCAAGCGCTACCGTTTTTTGTTTCTTCGTTTCACTCATCAAGATAC
    TAAAGCTCAAAAAGCTCTGATTGGAGGCATCGAGCAGATCATTGGTTTGC
    ACAAGGCTTCGCTCCTGCCTAAAGTACCCGCGATCTTGAAACTTTTGTAT
    GACCTGGATATACTGGAGGAAGGTGTGATTCTTCAATGGGGAGAAAAAGC
    GAGTAAAAAATACGTGTCCAAAGAGCTGAGTCAAGAGATACATAGTAAAG
    CCACGCCTTTCTTAACTTGGTTGAAA
    SEQ ID NO: 36
    Gene #32
    Nucleotides 741-840 of SEQ ID NO: 35
    eIF5
    eukaryotic translation initiation
    factor 5-like isoform1
    GGACATTTTCTACGTGATGGTGAAACAGAGGCGGGACACAGGCGATTTGT
    CGACTCCACTCGCCGCCAAGGAGATCCTCGCCGAAGCGGAGCGACTTGAA
    SEQ ID NO: 37
    Gene #34
    hay
    DNA excision repair protein
    haywire-like (partial)
    TATATTTACGGTCCAACTTCTCAGAACGAAAGGATCCAAATTCTACAAAA
    TTTCAAATTCAATCCCAAAGTAAATACGATTTTTGTGAGTAAAGTTGCCG
    ATACGTCGTTTGATCTTCCCGAGGCTAATGTACTGATTCAAATATCCTCT
    CATGGAGGCTCTCGACGTCAAGAAGCTCAGAGATTGGGTAANAATTCTCA
    GAGCCAAAAAAAGGGAGCGATCGCTGAAGAGTATAATGCGTTTTTTCCTA
    CACACTCGTTTCCCAAGACACGATGGAAATGGCGTATTCGCGGAAGCGCC
    AAGCGGTTCCTCGTCAATCAGGGCTACAGTTACAAAGTGGTGACGAAATT
    GGCTGGTATCGACCAAGNTCCTGACATAATGTACAAAACCCGNGACGAG
    SEQ ID NO: 38
    Gene #34
    Nucleotides 300-399 of SEQ ID NO: 87
    hay
    DNA excision repair protein haywire-like
    CAAGCGGTTCCTCGTCAATCAGGGCTACAGTTACAAAGTGGTGACGAAAT
    TGGCTGGTATCGACCAAGATCCTGACATAATGTACAAAACCCGAGACGAG
    SEQ ID NO: 39 + SEQ ID NO: 86
    Gene #35
    Hel25E
    ATP-dependent RNA helicase WM6-like
    (partial/gapped)
    SEQ ID NO: 39:
    GTTCTCGGCATGGACATCCTTTGCCAGGCCAAATCAGGTATGGGAAAAAC
    GGCCGTGTTCGTCCTGGCGACTCTGCAACAAATGGAATTGACCGAAAACC
    AAGTGACGGTCTTGGTCATGTGCCACACGAGGGAACTTGCTTTCCAAATA
    TCCAAAGAGTACGAGCGATTCTCCAAGTACATGCCGCACATTAAGGTGGC
    CGTATTCTTCGGTGGTTTACCCATTGCAAAAGATGAGGAAACTTTGAAAA
    ACAATTGTCCTCACATTGTGGTCGGGACTCCGGGACGGATCCTTGCTCTT
    GTCCGCAATAAAAAATTGAGTTTGAAGAATTTGAAACATTTCATTTTGGA
    TGAATGCGACAAAATGTTGGAGCAACTTGATATGAGACGCGACGTACAGG
    AGATATTTCGACAAACTCCACACAGTAAACAAGTGATGATGTTCAGTGCC
    ACTTTGAGCAAGGACATACGTCCCGTCTGCAAGAAGTTCATGCAAGAACC
    GATGGAAGTCTACGTTGATGACGAGGCCAAACTCACACTTCACGGTCTGC
    AACAACACTACGTTAAATTAAAGGAAAACGAG [gap]
    SEQ ID NO: 86:
    CTTTTTGATTTACTTGACATATTGGAGTTCAACCAGGTGGTCATTTTCGT
    CAAGTCTGTTCAACGGTGTATGGCTCTTGCTCAGCTCTTATGCGACCAAA
    ACTTCCCGGCTGTCGCGATCCACAGAGCCATGAATCAAGAGGAGCGGCTC
    TCGAAATATCAAGAATTTAAAGACTTCCAAAAGAGGATTCTTGTGGCGAC
    CAATCTCTTTGGCCGAGGAATGGACATAGAGAGAGTGAACATTGTTTTCA
    ACTACGACATGCCCGAAGACTCAGACACTTATTTACATCGTGTGGCTCGG
    GCTGGTCGTTTTGGAACTAAGGGTTTGGCCATCACGTTTGCCAGTGACGA
    AAACGACGCCAAAGTTCTCAATCAAGTACAGGACCGATTTGATGTCAACA
    TTACTGAGTTACCTGACGAGATTGATCTGTCATCTTACATTGACGGCCGG
    SEQ ID NO: 40
    Gene #35
    Nucleotides 15-114 of SEQ ID NO: 86
    Hel25E
    ATP-dependent RNA helicase WM6-like
    TGACATATTGGAGTTCAACCAGGTGGTCATTTTCGTCAAGTCTGTTCAAC
    GGTGTATGGCTCTTGCTCAGCTCTTATGCGACCAAAACTTCCCGGCTGTC
    SEQ ID NO: 41
    Gene #37
    Hr38
    ecdysone receptor isoform B1 (partial)
    ATCAAGCCCGTCAGTCCCGAACAAGAAGAGCTCATACACCGTCTCGTATA
    TTTCCAAAGCGAGTACGAACATCCGTGTGAAGAGGACGTCCGCCGAATAA
    ATGCTCCAAACGACGACGATGAGCCCAACTCAGACTACAGGTTCCGATAC
    TTGGCCGAAATCTCCATACTAACTGTTCAACTTATTGTTGAATTTGCAAA
    AAGACTTCCTGGATTCGACAAACTTTTGAGGGAAGACCAAATCACTTTAC
    TTAAGGCATGTTCAAGCGAAGTGATGATGTTGAGGATGGCTCGGCGGTAC
    GACGCACAGACCGACTCGATCCTCTTCGCGAACAACCAACCCTATACCAG
    AGACTCGTATAATTTAGCAGGCATGGGAGAAATAGTCGAGGATCTGCTCA
    GGTTTTGCCGGCAAATGTACAATATGAAAGTGGACAACGCTGAGTACGCA
    CTTCTCACCGCCATCGTTATATTCTCAGAGAGACCGTCACTTATTGAAGG
    GTGGAAAGTGGAAAAAATCCAGGAAATCTATTTGGAGGGGCTCAAATCCT
    ACGTGGACAACAGGTCGAGGCCTCGATCCCCTACAATATTCGCCAAACTC
    CTCTCGGTCCTGACTGAGCTTCGAACACTCGGAAATCAAAATACGGAGAT
    GTGTTTCTCATTAAAACTTCAAAATAAGAAACTTCCTCCGTTTTTGTCAG
    AAATATGGGACGTAAACGTACCTTAG
    SEQ ID NO: 42
    Gene #37
    Nucleotides 559-658 of SEQ ID NO: 41
    Hr38
    ecdysone receptor isoform B1
    AACAGGTCGAGGCCTCGATCCCCTACAATATTCGCCAAACTCCTCTCGGT
    CCTGACTGAGCTTCGAACACTCGGAAATCAAAATACGGAGATGTGTTTCT
    SEQ ID NO: 43
    Gene #40
    mask
    hypothetical protein (partial)
    GAAGTTGTGAGTCTTTTACTGGATCGTCGAGCCAATGTAGAACATCGCGC
    CAAGACTGGTTTGACGCCTTTGATGGAAGCTGCAAGTGGAGGATATGTTG
    AAGTTGGACGAGTCCTGCTTGACAAAGGAGCTGACGTGAACGCACCACCT
    GTTCCTTCGTCCCGGGACACGGCTCTCACCATAGCCGCTGACAAAGGGCA
    TTGCCGTTTTGTTGAACTTCTCCTCAGCAGAAATGCTCAAGTTGAAGTGA
    AAAACAAAAAAGGAAACTCTCCCTTGTGGCTCGCAGCAAATGGAGGTCAC
    CTAACTGTGGTCGAGTACCTGTACAATGCTGGTTCGGACATCGATTCCCA
    AGATAACCGCAAGGTCTCATGTCTGATGGCCGCGTTCCGAAAGGGCCATG
    TAAAAGTGGTCAAATGGATGGTGAACGCTGTCACCCAATTCCCAAGTGAC
    CAAGAAATGACTAGGTACATTGGCACGGTCAATGATAAAGAACTACTTGA
    AAAATGTCAAGAGTGCACGAAAATCATAAGAACCGCCAAAGACCAGCAAG
    CTGCCAAAGCGAATAAAAACGCGACGATCCTCCTTGAAGAACTTTACATG
    GAGAAAACGCGAGAAGAG
    SEQ ID NO: 44
    Gene #40
    Nucleotides 208-307 of SEQ ID NO: 43
    mask
    hypothetical protein
    TTTGTTGAACTTCTCCTCAGCAGAAATGCTCAAGTTGAAGTGAAAAACAA
    AAAAGGAAACTCTCCCTTGTGGCTCGCAGCAAATGGAGGTCACCTAACTG
    SEQ ID NO: 45
    Gene #41
    mor
    SWI/SNF complex subunit SMARCC2-like 
    (partial)
    GTGTTCAAGTATAAAACGGAACAGGGGTGGAGGAGGTTCGACTTCCAGAG
    CCCCAGCCGTATGGACAGAAACGTCGAGATGTTCATGGCCATTGAAAAGG
    CCTTAATTCAAGCCAAATGTTTCACTCTGCCAGTCGTCTACGTCCGGCCC
    GAAGTTGAAAAAGCGACTGCAGCCAAAGTCAAAGACATAATCAAACGCCA
    CCAGGGAACGGTGGTCGAAAACGAAGAACAGGCGACCCACATCCTTTACC
    CTATTGTGGATCCTTTGGATGAGGAATTCGCTCGACCTACCCTGAAAAGG
    GATCGTATGGCTTTGCTCCATTGGTACTATTTCCCGGATTCGCATGATTC
    TTGGGTTGCTTCAGATCTCCCGGTCGATCCACCTGATTCACCCGTTCAAC
    ACACTCTGCCTTGGAGGGTCACCGCGTCTTGGGCCATTGAACTCGAACAG
    TACAACGAATGGATGAACGAAGAAGATTACGAAGTCGACGAAACTGGACG
    GAAAAAAATTCACAGACTTCGTTTATCCGTCGACGATCTCATG
    SEQ ID NO: 46
    Gene #41
    Nucleotides 159-258 of SEQ ID NO: 45
    mor
    SWI/SNF complex subunit SMARCC2-like
    AAAAGCGACTGCAGCCAAAGTCAAAGACATAATCAAACGCCACCAGGGA
    ACGGTGGTCGAAAACGAAGAACAGGCGACCCACATCCTTTACCCTATTGT
    G
    SEQ ID NO: 47
    Gene #47
    RpS2
    40S ribosomal protein S2-like (partial)
    AAGGAAACCGAGAAAGAATGGATGCCTGTCACCAAATTGGGCCGTTTGGT
    CAGAGATGGCAAAATCGGTACTCTTGAGGAGATCTACCTCTACTCCCTTC
    CCATCAAGGAGTATGAAATCATCGACTTTTTCATTGGGCCCAGCCTCAAG
    GATGAAGTGCTGAAGATCATGCCGGTTCAGAAGCAGACTCGAGCCGGGCA
    AAGGACTCGATTCAAGGCGTTTGTTGCCATCGGCGACAGCAACGGTCATA
    TCGGTCTTGGAGTCAAGTGTTCCAAAGAAGTAGCGACCGCCATCCGTGGC
    GCTATCATTCTAGCCAAGTTGTCCGTTGTGCCCGTTCGTCGAGGTTACTG
    GGGAAACAAAATCGGAAAACCCCACACTGTTCCGTGCAAGGTGACCGGTA
    AATGTGGCTCAGTCCAGGTGAGGCTTATCCCGGCCCCAAGAGGAACTGGT
    ATTGTCGGCGCTCCTGTTCCTAAGAAGTTGCTCCAAATGGCAGGAATTGA
    CGATTGTTACACTTCATCCCGTGGCTCCACCGGAACTTTGGGCAATTTTG
    CTAAAGCAACTTACGCGGCTATTGCGAAGACCTACGCGTATTTGACTCCG
    GATCTGTGGAAGGATGAGCCGCTCGGCCGACCCCCATACAGTGAGTTTGC
    GGACCATTTGGACAAAAATCAC
    SEQ ID NO: 48
    Gene #47
    Nucleotides 573-672 of SEQ ID NO: 47
    RpS2
    40S ribosomal protein S2-like
    TGCGAAGACCTACGCGTATTTGACTCCGGATCTGTGGAAGGATGAGCCGC
    TCGGCCGACCCCCATACAGTGAGTTTGCGGACCATTTGGACAAAAATCAC
    SEQ ID NO: 49
    Gene #48
    RpS5a
    40S ribosomal protein S5-like
    isoform 1 (partial)
    ATGGACGAGGACAATTGGGATGTGACCCCTGTCGAGGGTGGCGGAGTCGA
    GGCTTTGGTCCCGGCCCCATCAGCTGAACTTCCTGACATCAAGTTGTTCG
    GCAGGTGGAGCTGCGACGATGTCCAAGTGGCCGATATGTCTCTCCAGGAT
    TACATTGCGGTAAAAGAGAAAAACGCCAAGTATTTGCCTCATTCGGCTGG
    TCGGTTCGCGGCCAAGAGGTTCCGCAAGGCCCAGTGCCCCATCGTCGAGC
    GGTTGACCAATTCGTTAATGATGCACGGGAGAAACAACGCCAAGAAACTG
    ATGGCTGTTCGCATAGTCAAACACGCTTTTGAAATTATTCATCTGCTGAC
    TGGCGAAAACCCGCTGCAAACCCTTGTCAACGCCATCACTCACTCTGGCC
    CACGCGAGGACTCAACTCGTATCGGTCGTGCCGGTACGGTGAGGCGACAA
    GCAGTTGACGTTTCGCCTCTTCGACGAGTCAATCAGGCGATTTGGCTCCT
    CTGTACTGGTGCTCGTGAAGCGGCTTTCCGAAACATTAAAACCATCGCTG
    AGTGTTTAGCTGATGAGCTCATCAACGCCGCTAAGGGATCGTCGAATTCG
    TACGCTATCAAGAAGAAAGACGAACTGGAGCGCGTTGCCAAATCCAACCG
    TTAA
    SEQ ID NO: 50
    Gene #48
    Nucleotides 1-100 of SEQ ID NO: 49
    RpS5a
    40S ribosomal protein S5-like isoform 1
    ATGGACGAGGACAATTGGGATGTGACCCCTGTCGAGGGTGGCGGAGTCGA
    GGCTTTGGTCCCGGCCCCATCAGCTGAACTTCCTGACATCAAGTTGTTCG
    SEQ ID NO: 51
    Gene #53
    Trip1
    eukaryotic translation initiation
    factor 3 subunit 2 beta-like (partial)
    GTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGACGG
    CACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGACA
    CCGAGTCCCTCAGCCATTTGAAAACATACCAGACCGAAAGACCTGTTAAC
    AGCGCCTCGCTTTCCCCTATTATGGACCATGTTGTACTCGGAGGTGGTCA
    AGAAGCGTCTGTTGTCACGACTACATCTACTCGCGTGGGAAAATTCGACG
    CTCGGTTCTACCACGTTGTTTTTGAAGAGGAATTCGGTCGGGTTAAAGGT
    CATTTCGGGCCGATCAACAGTTTGGCGTTTCATCCGGATGGAAAGAGCTT
    TGCAAGTGGAGGTGAAGACGGTTACGTCCGTGTTCAGTCATTCGATCAAT
    CGTACTTTGAATTTAATTTCGAG
    SEQ ID NO: 52
    Gene #53
    Nucleotides 1-100 of SEQ ID NO: 51
    Trip1
    eukaryotic translation initiation
    factor 3 subunit 2 beta-like
    GTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGACGG
    CACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGACA
    SEQ ID NO: 53
    Gene #54
    tws
    protein phosphatase PP2A 55 kDa reg-
    ulatory subunit-like isoform 3 (partial)
    ATAAAACCGATGGAATTAATGGTCGAGGCATCACCTCGGAGAATCTTCGC
    CAACGCCCACACGTACCACATTAATTCAATATCTGTCAACTCGGACCAAG
    AAACGTATCTGTCCGCTGATGACCTCCGAATAAATCTGTGGCATTTGGAA
    ATAACGGATCAGTCCTTCAATATAGTTGACATTAAGCCAGCTAATATGGA
    AGAGCTCACAGAGGTAATCACTGCGGCCGAGTTTCACCCATTAGAGTGTA
    ATCTATTCGTGTATTCATCGAGTAAGGGAACGATACGGTTGTGCGACATG
    AGGCAGGCGGCGCTTTGTGATCGACACACGAAAATTTTTGAAGAACCCGA
    AGACCCAACGAACAGATCGTTTTTCTCTGAAATAATTTCCAGCATTTCGG
    ACGTGAAACTGTCCAATTCCGGGCGGTACATGATCTCTAGGGATTATCTC
    TCGGTGAAAGTCTGGGACCTTCACATGGAGTCGAGGCCTATTGAAAGTTA
    TCCTGTTCACGAGTATTTGAGGTCTAAACTCTGCTCTCTGTACGAGAACG
    ACTGTATCTTCGACAAATTCGAGTGCTGTTGGGCCGGCAACGACCAGTAC
    ATCATGACCGGCTCGTACAATAATTTCTTCCGCATGTTTGATCGGACCTC
    CAAACGCGACGTGACCCTGGAGGCGTCCCGGGACATCGCCAAACCGAAAA
    CCCTTCTGAAACCCCGAAAAGTCTGCACTGGAGGGAAACGGAAAAAAGAT
    GAGATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGC
    TTGGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTAT
    TTCTATTTCAGGATCGATTGTAG
    SEQ ID NO: 54
    Gene #54
    Nucleotides 753-852 of SEQ ID NO: 53
    tws
    protein phosphatase PP2A 55 kDa
    regulatory subunit-like isoform 3
    GATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCTT
    GGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATTT
    SEQ ID NO: 55
    Gene #55
    Ubc-E2H
    ubiquitin-conjugating enzyme E2
    H-like (partial)
    AAAGTGAGAGTCCATCTTCCAGAGCACTATCCGTTCAAAATCTCCATCGA
    TAGGATTATGAATAAAGTTTATCATCCAAATATTGATGAGGTCTCAGGCA
    CCGTGTGTTTGGATGTCATCAATCAGGCTTGGACAGCCTTATACGATCTG
    TCTAACATTTTTGAATCTTTTCTGCCGCAGTTATTGACTTATCCTAATCC
    CATAGATCCTCTGAACGGCGATGCCGCAGCAATGTACCTTCATAAACCTG
    ACGAGTATCGGAAAAAAGTTCACGAATATGTTCGGAAGTACGCCACCGAA
    GAAGCACTTAGAGAACAAGAACAACAAGCAGTTTCTTCAGACAGCGAATC
    CTCAATGTCAGATTTCAGTGAAGATGAGGCGCAAGATATGGAGTTATAA
    SEQ ID NO: 56
    Gene #55
    Nucleotides 267-366 of SEQ ID NO: 55
    Ubc-E2H
    ubiquitin-conjugating enzyme E2 H-like
    AGTTCACGAATATGTTCGGAAGTACGCCACCGAAGAAGCACTTAGAGAAC
    AAGAACAACAAGCAGTTTCTTCAGACAGCGAATCCTCAATGTCAGATTTC
    SEQ ID NO: 57
    Gene #56
    Uev1A
    ubiquitin-conjugating enzyme-like (partial)
    ATGGCCAGTCCTACAGGACGAGTGGTGGTTCCGAGGAACTTCCGCCTCCT
    CGAGGAGCTTGAACAGGGACAGCGCGGAGTGAGCGACGGCACTATATCAT
    GGGGTCTGGAAACCGTCGACGATATGACTCTCACTTATTGGACCGGCGTC
    ATTATCGGCCCACCCCGAACCCCATATGAAAATCGCATGTACAGTTTACG
    AATAGAGTGTGGTCAGAAGTACCCGGAAGACGCTCCCTCGGCCCGATTTA
    TATCTAGAATTAATATGACCTGCGTTAATAGTACTACAGGACAGGTTGAG
    AATAAAAGTGTACCCTTGTTGGCAAGATGGCAAAGGGACTACACCATTAA
    ATCACTCCTTCAGGAGCTTCGTCGTCTGATGACGATAAAAGACAACATGA
    AACTAACACAGCCACCAGAAGGAAGCAATTTTCCCGAGTGGCAGGTTAAA
    SEQ ID NO: 58
    Gene #56
    Nucleotides 181-280 of SEQ ID NO: 57
    Nuc
    Uev1A
    ubiquitin-conjugating enzyme-like
    AATCGCATGTACAGTTTACGAATAGAGTGTGGTCAGAAGTACCCGGAAGA
    CGCTCCCTCGGCCCGATTTATATCTAGAATTAATATGACCTGCGTTAATA
    SEQ ID NO: 59
    Gene #56
    Nucleotides 181-280 of SEQ ID NO: 57
    with T□C mutation at position 253 of
    SEQ ID NO: 57 to create Xba I site Nuc
    Uev1A
    ubiquitin-conjugating enzyme-like
    AATCGCATGTACAGTTTACGAATAGAGTGTGGTCAGAAGTACCCGGAAGA
    CGCTCCCTCGGCCCGATTTATACCTAGAATTAATATGACCTGCGTTAATA
    SEQ ID NO: 60
    P1 - CaMV 35S Promoter & Omega UTR
    AGATTAGCCTTTTCAATTTCAGAAAGAATGCTAACCCACAGATGGTTAGA
    GAGGCTTACGCAGCAGGTCTCATCAAGACGATCTACCCGAGCAATAATCT
    CCAGGAAATCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGAT
    TCAGGACTAACTGCATCAAGAACACAGAGAAAGATATATTTCTCAAGATC
    AGAAGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAG
    GCAAGTAATAGAGATTGGAGTCTCTAAAAAGGTAGTTCCCACTGAATCAA
    AGGCCATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTA
    AAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAA
    GAAAATCTTCGTCAACATGGTGGAGCACGACACACTTGTCTACTCCAAAA
    ATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAA
    CAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTG
    TCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCC
    ATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGT
    GGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGA
    CGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTG
    ACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCT
    ATATAAGGAAGTTCATTTCATTTGGAGAGAACACGGGGGACTCTAGATAT
    TTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTAC
    TATTTACAATTACA
    SEQ ID NO: 61
    sgFIMV Promoter
    TTTACAGTAAGAACTGATAACAAAAATTTTACTTATTTCCTTAGAATTAA
    TCTTAAAGGTGATAGTAAACAAGGACGATTAGTCCGTTGGCAAAATTGGT
    TCAGCAAGTATCAATTTGATGTCGAACATCTTGAAGGTGTAAAAAACGTT
    TTAGCAGATTGCCTCACGAGAGATTTTAATGCTTAAAAACGTAAGCGCTG
    ACGTATGATTTCAAAAAACGCAGCTATAAAAGAAGCCCTCCAGCTTCAAA
    GTTTTCATCAACACAAATTCTAAAAACAAAATTTTTTAGAGAGGGGGAGT
    G
    SEQ ID NO: 62
    AtActin7 Terminator including 3UTR
    GTGTGTCTTGTCTTATCTGGTTCGTGGTGGTGAGTTTGTTACAAAAAAAT
    CTATTTTCCCTAGTTGAGATGGGAATTGAACTATCTGTTGTTATGTGGAT
    TTTATTTTCTTTTTTCTCTTTAGAACCTTATGGTTGTGTCAAGAAGTCTT
    GTGTACTTTAGTTTTATATCTCTGTTTTATCTCTTCTATTTTCTTTAGGA
    TGCTTGTGATGATGCTGTTTTTTTTTGTCCCTAAGCAAAAAAATATCATA
    TTATATTTGGTCCTTGGTTCATTTTTTTGGTTTTTTTTTGTCTTCACATA
    TAAATATTGTTTGAATGTCTTCAATCTTTTATTTGTATGAGACAATTATT
    TAAGTATCGGGTGACAATGCAGCTATTATGTATTGTCGATTGTTATATTG
    GCGCCCAAAATATATACTTAGCCTAAGAATTTGGTAAGTGAGTGGCTTAT
    GTTTTACTCCAGCAAAAATTGTGTGTGTATTACCATTCTGATGCGAAACA
    AGAAAAGAATTTGATCTAAGAAACCAAGTTTATTCACTAGTTAAAAAACA
    AATGACCTAATGTAATCGACTCCACATATCAAAATACGTAAAACAAACAT
    TGTATGTTGACAAAAGGGAAAAGAAATGATTTATTTGGTTAAAAAGAAAG
    CTGGATTCAATTGCAACAGTTTAGTCGAAATCATTTTGAAAGGCTTACAA
    TGGATTGAATGTGAATATTCCATTAAGCCGCTTCTGTCTACACAGAATGT
    TACGCTTGGAGAGCAGCAATCATTTTCACGTTTTTATCTTTTTAGGTGGA
    CATGTATATTATTGGTTACGCCTTTGGAGTTTTTCGAAATTTATTTCTTT
    CAAATCACAAGATGACTAAACATCACAATCTGTTTATCTTCCTAACTAGT
    TAAATTTTTGTCCCCACCATT
    SEQ ID NO: 63
    NOS Terminator
    GATCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGC
    CGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATG
    TAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATG
    ATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATA
    GCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAG
    ATC
    SEQ ID NO: 64
    Loop Sequence
    GGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCACA
    ATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCTT
    CGCGCG
    SEQ ID NO: 65
    Construct 1, hpRNA
    CTCTGCTCGGATGCTCTCCTCATCACTTTGATGAACATTTTGGAAGGGCT
    CGTAGTCTACCCGAAAGTCATTGAAAAGCACATCGGAGAAGAACTTCCTT
    CCGATTCTCAAGGGACAACAGTCAAATCCTCACCGCCTCGTTCGACACGA
    CAATCAAAATTCACGGGTTGAAGTCAGGTAAATCGTTGAAGGAATTCCGC
    GCAAAAGGTCTTCATGAGCTGCAACCTCATCACCGGCATGTACCAGAGAC
    TGGACAAAATGAGGAAAAACGCTTTCGCCTCCGTCATTCTGTTCGGCAAA
    GGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCACA
    ATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCTT
    CGCGCGTTTGCCGAACAGAATGACGGAGGCGAAAGCGTTTTTCCTCATTT
    TGTCCAGTCTCTGGTACATGCCGGTGATGAGGTTGCAGCTCATGAAGACC
    TTTTGCGCGGAATTCCTTCAACGATTTACCTGACTTCAACCCGTGAATTT
    TGATTGTCGTGTCGAACGAGGCGGTGAGGATTTGACTGTTGTCCCTTGAG
    AATCGGAAGGAAGTTCTTCTCCGATGTGCTTTTCAATGACTTTCGGGTAG
    ACTACGAGCCCTTCCAAAATGTTCATCAAAGTGATGAGGAGAGCATCCGA
    GCAGAG
    SEQ ID NO: 66
    Construct 1, sense mRNA
    CTCTGCTCGGATGCTCTCCTCATCACTTTGATGAACATTTTGGAAGGGCT
    CGTAGTCTACCCGAAAGTCATTGAAAAGCACATCGGAGAAGAACTTCCTT
    CCGATTCTCAAGGGACAACAGTCAAATCCTCACCGCCTCGTTCGACACGA
    CAATCAAAATTCACGGGTTGAAGTCAGGTAAATCGTTGAAGGAATTCCGC
    GCAAAAGGTCTTCATGAGCTGCAACCTCATCACCGGCATGTACCAGAGAC
    TGGACAAAATGAGGAAAAACGCTTTCGCCTCCGTCATTCTGTTCGGCAAA
    SEQ ID NO: 67
    Construct 2, hpRNA
    CGACCCGACTGTCATTCAACAGAGAAAGGGCGAATTGGAACCAGGCACCC
    AAACTAGCATCCAAGTGATGGACAAATTGTGCAAGTACATTTACGACAAG
    TGACATATTGGAGTTCAACCAGGTGGTCATTTTCGTCAAGTCTGTTCAAC
    GGTGTATGGCTCTTGCTCAGCTCTTATGCGACCAAAACTTCCCGGCTGTC
    AATCGCATGTACAGTTTACGAATAGAGTGTGGTCAGAAGTACCCGGAAGA
    CGCTCCCTCGGCCCGATTTATACCTAGAATTAATATGACCTGCGTTAATA
    GGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCACA
    ATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCTT
    CGCGCGTATTAACGCAGGTCATATTAATTCTAGGTATAAATCGGGCCGAG
    GGAGCGTCTTCCGGGTACTTCTGACCACACTCTATTCGTAAACTGTACAT
    GCGATTGACAGCCGGGAAGTTTTGGTCGCATAAGAGCTGAGCAAGAGCCA
    TACACCGTTGAACAGACTTGACGAAAATGACCACCTGGTTGAACTCCAAT
    ATGTCACTTGTCGTAAATGTACTTGCACAATTTGTCCATCACTTGGATGC
    TAGTTTGGGTGCCTGGTTCCAATTCGCCCTTTCTCTGTTGAATGACAGTC
    GGGTCG
    SEQ ID NO: 68
    Construct 2, sense mRNA
    CGACCCGACTGTCATTCAACAGAGAAAGGGCGAATTGGAACCAGGCACCC
    AAACTAGCATCCAAGTGATGGACAAATTGTGCAAGTACATTTACGACAAG
    TGACATATTGGAGTTCAACCAGGTGGTCATTTTCGTCAAGTCTGTTCAAC
    GGTGTATGGCTCTTGCTCAGCTCTTATGCGACCAAAACTTCCCGGCTGTC
    AATCGCATGTACAGTTTACGAATAGAGTGTGGTCAGAAGTACCCGGAAGA
    CGCTCCCTCGGCCCGATTTATACCTAGAATTAATATGACCTGCGTTAATA
    SEQ ID NO: 69
    Construct 3, hpRNA
    AAAAGCGACTGCAGCCAAAGTCAAAGACATAATCAAACGCCACCAGGGA
    ACGGTGGTCGAAAACGAAGAACAGGCGACCCACATCCTTTACCCTATTGT
    GGTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGACG
    GCACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGAC
    AGATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCT
    TGGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATT
    TGGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCAC
    AATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCT
    TCGCGCGAAATAAATTGTTGGTGGCGGCCACTGCAATAATGTTCTCGGTT
    GGATGCCAAGCGGTGTGAAGGATCTTCTTCGTAAAATCCAAACAGTCGAC
    CGAAATCTGTCGAATAGCTTTGCTGTGTGGTCACTCGAAGCTGTCACAAA
    CATGGTGCCGTCCCAGTGCATCTGCATGTCGTTGATTGACCCGTTGTGCC
    CGTCAACCACAATAGGGTAAAGGATGTGGGTCGCCTGTTCTTCGTTTTCG
    ACCACCGTTCCCTGGTGGCGTTTGATTATGTCTTTGACTTTGGCTGCAGT
    CGCTTTT
    SEQ ID NO: 70
    Construct 3, sense mRNA
    AAAAGCGACTGCAGCCAAAGTCAAAGACATAATCAAACGCCACCAGGGA
    ACGGTGGTCGAAAACGAAGAACAGGCGACCCACATCCTTTACCCTATTGT
    GGTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGACG
    GCACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGAC
    AGATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCT
    TGGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATT
    T
    SEQ ID NO: 71
    GATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCTT
    GGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATTT
    GGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCACA
    ATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCTT
    CGCGCGAAATAAATTGTTGGTGGCGGCCACTGCAATAATGTTCTCGGTTG
    GATGCCAAGCGGTGTGAAGGATCTTCTTCGTAAAATCCAAACAGTCGACC
    GAAATC
    SEQ ID NO: 72
    GTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGACGG
    CACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGACA
    GATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCTT
    GGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATTT
    GGCTCGAACGAGCCGACTAATTGTCTTTAAACGCGCGATATAAGCGCACA
    ATGCTCGAGAAACGATAAACTCTATCGCTCTGTCGCGTGCGTGGCATCTT
    CGCGCGAAATAAATTGTTGGTGGCGGCCACTGCAATAATGTTCTCGGTTG
    GATGCCAAGCGGTGTGAAGGATCTTCTTCGTAAAATCCAAACAGTCGACC
    GAAATCTGTCGAATAGCTTTGCTGTGTGGTCACTCGAAGCTGTCACAAAC
    ATGGTGCCGTCCCAGTGCATCTGCATGTCGTTGATTGACCCGTTGTGCCC
    GTCAAC
    SEQ ID NO: 73
    GTTGACGGGCACAACGGGTCAATCAACGACATGCAGATGCACTGGGACGG
    CACCATGTTTGTGACAGCTTCGAGTGACCACACAGCAAAGCTATTCGACA
    GATTTCGGTCGACTGTTTGGATTTTACGAAGAAGATCCTTCACACCGCTT
    GGCATCCAACCGAGAACATTATTGCAGTGGCCGCCACCAACAATTTATTT
    SEQ ID NO: 74
    Gene #57
    Vps23
    NADH-ubiquinone oxidoreductase,
    20 Kd subunit (partial)
    GCCCAAGACAAAATCGAACCTGTAAAGAGGAAACCGTATTCACCATTTCC
    TAAGGGTAACAACGCTGCTGAGTTCGCAATGGCTCGTCTGGACGATTTAA
    TCAATTGGGCGAGAAAGGGGTCACTATGGCCTCTGACATTCGGACTGGCT
    TGCTGCGCTGTAGAAATGATGCACTTCGCTGCTCCGCGCTACGACATGGA
    TCGTTACGGAGTAGTATTCAGGGCGTCTCCACGACAGGCTGATGTCATCA
    TCGTCGCTGGTACTTTGACTAATAAAATGGCCCCTGCCTTGAGAAAAGTT
    TATGATCAGATGCCGGAGCCGAGGTGGGTTATATCCATGGGGAGCTGTGC
    TAACGGAGGTGGATACTACCATTACTCCTACTCCGTCGTCAGAGGCTGTG
    ATAGAATTGTACCTGTGGATATATACGTTCCAGGTTGTCCACCCACCGCT
    GAGGCTCTCCTCTATGGGGTTCTTCAACTTCAGAAGAAAATTAAAAGAAG
    TAACCAGATGCAGATGTGGTACAGGAAGTAA
    SEQ ID NO: 75
    Gene #57
    Nucleotides 19-118 of SEQ ID NO: 74
    Vps23
    NADH-ubiquinone oxidoreductase,
    20 Kd subunit
    CCTGTAAAGAGGAAACCGTATTCACCATTTCCTAAGGGTAACAACGCTGC
    TGAGTTCGCAATGGCTCGTCTGGACGATTTAATCAATTGGGCGAGAAAGG
    SEQ ID NO: 76
    Gene #58
    Vps28
    Vacuolar protein sorting 28 (partial)
    CTCGTTGATGAAGTGAAGCTTTTCAGAAATGCAAGGGAAAGAGAAAGGTA
    CGATAACATGGCAGACTTATTCGCTGTCATAAATACGCTTCAGAACCTGG
    AAAAAGCTTACATTCGAGACTGCGTGACGGCTAAAGAGTACACAGCCGCC
    TGCTCCAAACTCCTCGTCCAGTACAAAGCCGCTTTTAAGCAAGTTCAAAA
    TGACGAGTACCCGACCATCGAAGCCTTCGTCGCTAAATACAAATTGGACT
    GTCCTGCGGCGATGGAGAGGATTAAAGAAGATCGACCCATTACTATCAAA
    GATGACAAAGGGAACACGAGTAAATGCATTGCGGACATCGTTTCGCTGTT
    TATCACTTTAATGGATAAACTCAGACTGGAAATGAAAGCGGTTGATGAAC
    TACATCCAGATTTGAGGGATTTGACCGACACAATGAACCGACTCAGCATC
    CTTCCTTCGGACTTTGAAGGGAAGAAAAAAGTCACTGAATGGCTTGGAAC
    ACTCGACTCGATGTCAGCCTCTGACGAGCTGACTGAGCAACAAGTCCGTC
    AATTAATATTTGATTTGGAATCGTCATACAACGCTTTCAACAAGCTCTTG
    CACAATACATAA
    SEQ ID NO: 77
    Gene #58
    Nucleotides 160-259 of SEQ ID NO: 76
    Vps28
    Vacuolar protein sorting 28
    CTCCTCGTCCAGTACAAAGCCGCTTTTAAGCAAGTTCAAAATGACGAGTA
    CCCGACCATCGAAGCCTTCGTCGCTAAATACAAATTGGACTGTCCTGCGG
    SEQ ID NO: 78
    Gene #59
    Vps22/Isn (Partial)
    Regulation of Notch signaling pathway
    GGCGACTTCTACTTTGAACTGAGCATACAAATTGTTGAAGTTTGTCTGGC
    GACGAACGAGAAAAACGGAGGTATCATCGGGTTGAACGAGCTCCGTTTGA
    AACTACTAAAGTCGAGGGGTCGCCACGCCCAAGAGGTGACCCAGGAGGAC
    ATCCTTTGCGCCGCCAAGAAACTCAGTGTGTTTGGAAATGGA
    SEQ ID NO: 79
    Gene #59
    Nucleotides 46-145 of SEQ ID NO: 78
    Vps22/Isn
    Regulation of Notch signaling pathway
    CTGGCGACGAACGAGAAAAACGGAGGTATCATCGGGTTGAACGAGCTCCG
    TTTGAAACTACTAAAGTCGAGGGGTCGCCACGCCCAAGAGGTGACCCAGG
    SEQ ID NO: 80
    Gene #60
    Vps2 (partial)
    Protein transport
    AAACGGGTCACCCCTGAGGAACAGCTGAGGAAGAATCAAAGAGCCCTGA
    ACAGAGCGACGAGAGAACTTGACAGGGAAAAAGCGCGCATGGAAGCGCA
    AGAGAAGAAAACGATCGCAGACATTAAGAAAATGGCTAAACATGGTCAAA
    TGGATTCTGTCACAGTAATGGCCCAAGATCTTGTCCGGACGAGAAGGTAC
    CTAAAAAAATTCATGTTGATGAAAGCCAACATCCAAGCGGTTTCACTCAA
    GATTCAAAGTCTGCGTTCGCAAAACGCGATGGGAGAAGCGATGAGGGGTG
    TGTGCATAGCCATACGAAACATGAACAGACAACTAAACATACCTCGACTC
    CAAAGGATACTCCGGGAGTTTGAAAAACAGTCGGATATAATGGATATGAA
    AGAGGCAATATCAAATGATGCAATTGATGGGGCGATGGAAGATGACGGGG
    ATGAAGAGGAAAGTGATGCTGTAGTTTCGCAAGTGTTGGACGAGCTGGGT
    CTCCAATTGGCTGACCAA
    SEQ ID NO: 81
    Gene #60
    Nucleotides 218-317 of SEQ ID NO: 80
    Vps2
    Protein transport
    TGAAAGCCAACATCCAAGCGGTTTCACTCAAGATTCAAAGTCTGCGTTCG
    CAAAACGCGATGGGAGAAGCGATGAGGGGTGTGTGCATAGCCATACGAAA
    SEQ ID NO: 82
    Gene #61
    Snf7/shrub (partial)
    ESCRT-III pathway
    ATACAGAAACTGAGGGAGATCGAGGACATGCTCATCAAAAAACAAGAACA
    CTTAGAAAGGCAAATCGAGCGAGAATTAGAAGTGGCTAAAAAAAATGGAA
    TGGCCAACAAGCGGGTTTCCCTTCAAGCGTTGAAGAAAAAACGGCGGTAT
    GAGAAACAATTGCAGCAAATTGACGGGACTCTTAGCACGATTGAAATGCA
    AAGGGAGGCTTTGGAGTCGGCCAGCACAAACACCGCTGTCTTCCAAACCA
    TGAAAATGGCAGCGAACTCTTTGAAAACAGCACATTTAAACATGGACGTC
    GACCATGTTCACGACATCATGGATGACATCGCTGAACAGCAAGAACTGGC
    CAAGGAAATAGCCGACGCTATAACCCAACCTTTAGGTTTCAGCGCAGACG
    TG
    SEQ ID NO: 83
    Gene #61
    Nucleotides 210-309 of SEQ ID NO: 80
    Snf7/shrub (partial)
    ESCRT-III pathway
    TTTGGAGTCGGCCAGCACAAACACCGCTGTCTTCCAAACCATGAAAATGG
    CAGCGAACTCTTTGAAAACAGCACATTTAAACATGGACGTCGACCATGTT
    SEQ ID NO: 87
    Gene #34
    hay
    DNA excision repair protein
    haywire-like (partial)
    TATATTTACGGTCCAACTTCTCAGAACGAAAGGATCCAAATTCTACAAAA
    TTTCAAATTCAATCCCAAAGTAAATACGATTTTTGTGAGTAAAGTTGCCG
    ATACGTCGTTTGATCTTCCCGAGGCTAATGTACTGATTCAAATATCCTCT
    CATGGAGGCTCTCGACGTCAAGAAGCTCAGAGATTGGGTAAAAATTCTCA
    GAGCCAAAAAAAGGGAGCGATCGCTGAAGAGTATAATGCGTTTTTTCCTA
    CACACTCGTTTCCCAAGACACGATGGAAATGGCGTATTCGCGGAAGCGCC
    AAGCGGTTCCTCGTCAATCAGGGCTACAGTTACAAAGTGGTGACGAAATT
    GGCTGGTATCGACCAAGATCCTGACATAATGTACAAAACCCGAGACGAG

Claims (48)

1. An isolated small inhibitory ribonucleic acid molecule (dsRNA) that inhibits expression of an essential gene of Bronze bug.
2. The dsRNA of claim 1 comprising a unit of a first strand of nucleotides that is substantially identical to at least 17 contiguous nucleotides from said essential gene, and a second strand nucleotides that is substantially complementary to said first strand of nucleotides.
3. The dsRNA of claim 2 wherein said first and second strands of nucleotides are at least about 25, 35, 50, 70 or 100 nucleotides in length.
4. The dsRNA according to claim 3 wherein over their respective lengths said first and second strands of nucleotides are 70-100% identical to said essential gene.
5. The dsRNA according to claim 4 comprising at least two (2) of said units.
6. The dsRNA of claim 5 wherein said at least two units are derived from different essential genes.
7. The dsRNA of claim 6 wherein said at least two units are derived from a single species.
8. The dsRNA of claim 6 wherein said at least two units are derived from different species.
9. The dsRNA according to claim 8 further comprising a loop region separating said first strand and said second strand nucleotides.
10. A vector comprising an expression control sequence operatively linked to a nucleotide sequence that is a template for one or both strands of claim 9.
11. A host cell comprising the expression vector of claim 10.
12. A plant tissue comprising the dsRNA according to claim 9.
13. A plant tissue comprising the vector of claim 10.
14. A plant tissue comprising the host cell of claim 11.
15. An isolated nucleic acid comprising a sequence that selectively hybridizes under high stringency hybridization conditions to a sequence selected from the group consisting of SEQ ID NO: 33, 1-23, 25-32, 34-59 and 74-86, and complementary sequences thereof.
16. The isolated nucleic acid of claim 15 wherein said nucleic acid is 90-99.99 percent identical to said sequence selected from the group consisting of SEQ ID NO: 1-23, 25-59 and 74-86, and complementary sequences thereof.
17. The isolated nucleic acid according to claim 15 wherein said nucleic acid comprises at least 17 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NO: 1-23, 25-59 and 74-86, and complementary sequences thereof.
18. The isolated nucleic acid of claim 17 wherein said nucleic acid comprises at least 25 contiguous nucleotides of sequence selected from the group consisting of SEQ ID NO: 1-23, 25-59 and 74-86, and complementary sequences thereof.
19. The isolated nucleic acid according to claim 15 wherein said nucleic acid is less than about 80% identical to the honey bee ortholog of said nucleic acid.
20. A vector comprising the isolated nucleic acid according to claim 15 operably linked to an expression control sequence.
21. A host cell comprising the vector of claim 20.
22. A plant tissue comprising the vector of claim 20.
23. The plant tissue of claim 22 wherein said tissue is selected from the group consisting of leaf tissue, veins, petioles, small branches, branches, flowers, trunk, fruits and seeds.
24. An isolated small inhibitory ribonucleic acid molecule (siRNA) that inhibits expression of a Bronze bug nucleic acid molecule encoding a CG 3590, CG 5451, E1gamma, EIF3-S8, He125E, Uev 1A, Mor, Trip 1 or tws gene.
25. An isolated double stranded ribonucleic acid molecule (dsRNA) comprising a unit of a first strand of nucleotides that is substantially identical to at least 17 contiguous nucleotides set forth in SEQ ID NO: 1-23, 25-59 and 74-86 and a second strand of nucleotides that is substantially complementary to said first strand of nucleotides.
26. The isolated dsRNA of claim 25 wherein said first strand of nucleotides is substantially identical to at least 17 contiguous nucleotides set forth in SEQ ID NO: 1-23, 25-59 and 74-86.
27. The dsRNA according to claim 25 wherein said first and second strands of nucleotides are at least about 25, 35, 50, 70 or 100 nucleotides in length.
28. The dsRNA according to claim 25 wherein over their respective lengths said first and second strands of nucleotides are 70-100% identical to 1-23, 25-59 and 74-86.
29. The dsRNA according to claim 25 wherein the sequences of said first and second strands of nucleotides are less than about 80% identical to the sequence of the honey bee ortholog of said first and second strands of nucleotides.
30. The dsRNA according to claim 25 comprising at least two (2) of said units.
31. The dsRNA of claim 30 wherein said at least two units are derived from different sequences selected from the group consisting of SEQ ID NO: 1-23, 25-59 and 74-86.
32. The dsRNA according to claim 25 further comprising a loop region separating said first strand and said second strand nucleotides.
33. A vector comprising an expression control sequence operatively linked to a nucleotide sequence that is a template for one or both strands according to claim 25.
34. A host cell comprising the expression vector of claim 33.
35. The host cell of claim 34 wherein said host is a bacterial cell or a yeast cell.
36. The host cell of claim 35 wherein said host is an Agrobacterium.
37. A plant tissue transformed with the host cell of claim 36.
38. A plant tissue comprising the dsRNA according to claim 25.
39. A method of producing a pest resistant plant comprising expressing a dsRNA according to claim 1 in said plant or to propagation or reproductive material of said plant.
40. The method of claim 39 wherein said plant is Eucalyptus.
41. The method according to claim 39 wherein said pest is a Bronze bug.
42. A method of inhibiting a pest infestation comprising cultivating a plant comprising a dsRNA according to claim 25, to inhibit said infestation.
43. The method of claim 42 wherein said plant is Eucalyptus.
44. The method of claim 43 wherein said pest is Bronze bug.
45. A method of producing a plant resistant to a plant pathogenic pest comprising:
(a) transforming a plant cell with a recombinant DNA construct or combination of constructs that express the dsRNA according to claim 1;
(b) regenerating a plant from the transformed plant cell; and
(c) growing the transformed plant cell under conditions suitable for the transcription of said recombinant DNA construct,
said grown transformed plant thus being resistant to said pest compared to an untransformed plant.
46. The method of claim 45 further comprising transforming said plant cell with a recombinant DNA construct that expresses a single stranded RNA that is complementary to one strand said dsRNA or a fragment thereof.
47. The method according to claim 45 wherein said plant is Eucalyptus.
48. The method of claim 47 wherein said pest is Bronze bug.
US14/395,595 2012-04-20 2013-04-19 Bronze bug control agents Active US10155959B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/395,595 US10155959B2 (en) 2012-04-20 2013-04-19 Bronze bug control agents

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201261636494P 2012-04-20 2012-04-20
US201361787234P 2013-03-15 2013-03-15
PCT/US2013/037323 WO2013158966A1 (en) 2012-04-20 2013-04-19 Bronze bug control agents
US14/395,595 US10155959B2 (en) 2012-04-20 2013-04-19 Bronze bug control agents

Publications (2)

Publication Number Publication Date
US20150082482A1 true US20150082482A1 (en) 2015-03-19
US10155959B2 US10155959B2 (en) 2018-12-18

Family

ID=48183052

Family Applications (1)

Application Number Title Priority Date Filing Date
US14/395,595 Active US10155959B2 (en) 2012-04-20 2013-04-19 Bronze bug control agents

Country Status (6)

Country Link
US (1) US10155959B2 (en)
CN (1) CN104395474A (en)
AR (1) AR090791A1 (en)
BR (1) BR112014025983A2 (en)
UY (1) UY34752A (en)
WO (1) WO2013158966A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108707603B (en) * 2018-04-13 2021-07-20 中山大学 ESCRT-III core subunit Snf7 double-stranded RNA and preparation method and application thereof
US20220225622A1 (en) * 2019-04-24 2022-07-21 University Of Manitoba Flea Beetle-Specific RNAI-Based Pesticides

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040265849A1 (en) * 2002-11-22 2004-12-30 Applera Corporation Genetic polymorphisms associated with Alzheimer's disease, methods of detection and uses thereof

Family Cites Families (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4658082A (en) 1984-07-25 1987-04-14 Atlantic Richfield Company Method for producing intact plants containing foreign DNA
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5453566A (en) 1986-03-28 1995-09-26 Calgene, Inc. Antisense regulation of gene expression in plant/cells
US5262306A (en) 1989-09-26 1993-11-16 Robeson David J Methods for identifying cercosporin-degrading microorganisms
CA2074355C (en) 1990-01-22 2008-10-28 Ronald C. Lundquist Method of producing fertile transgenic corn plants
DE69334225D1 (en) 1992-07-07 2008-07-31 Japan Tobacco Inc METHOD FOR TRANSFORMING A MONOCOTYLEDONE PLANT
PT672752E (en) 1993-09-03 2004-10-29 Japan Tobacco Inc PROCESS OF TRANSFORMATION OF A MONOCOTILEDONEA WITH THE USE OF A SCHOOL OF AN IMATURE EMBRYO
US5736369A (en) 1994-07-29 1998-04-07 Pioneer Hi-Bred International, Inc. Method for producing transgenic cereal plants
US5693512A (en) 1996-03-01 1997-12-02 The Ohio State Research Foundation Method for transforming plant tissue by sonication
AU3495297A (en) 1996-07-08 1998-02-02 Pioneer Hi-Bred International, Inc. Transformation of zygote, egg or sperm cells and recovery of transformed plants from isolated embryo sacs
AU732481B2 (en) 1997-01-21 2001-04-26 Monsanto Company Strawberry promoters and genes
US5981840A (en) 1997-01-24 1999-11-09 Pioneer Hi-Bred International, Inc. Methods for agrobacterium-mediated transformation
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
EP3214177A3 (en) 1998-04-08 2017-11-22 Commonwealth Scientific and Industrial Research Organisation Methods and means for obtaining modified phenotypes
GB9827152D0 (en) 1998-07-03 1999-02-03 Devgen Nv Characterisation of gene function using double stranded rna inhibition
AU2047001A (en) 1999-11-24 2001-06-04 Dna Plant Technology Corporation Methods of inhibiting plant parasitic nematodes and insect pests by expression of nematode and insect specific double-stranded rna in plants
US20030150017A1 (en) 2001-11-07 2003-08-07 Mesa Jose Ramon Botella Method for facilitating pathogen resistance
ATE549397T1 (en) 2003-01-03 2012-03-15 Texas A & M Univ Sys STEM-CONTROLLED PROMOTERS OF PLANT DEFENSE FORCES AND THEIR USE IN TISSUE-SPECIFIC EXPRESSION IN MONOCOTYLEDONE PLANTS
IL157538A0 (en) 2003-08-21 2004-03-28 Bar Ilan Res & Dev Company Ltd Plant resistant to cytoplasm-feeding parasites
GB2422607A (en) 2003-11-10 2006-08-02 Univ Utah Res Found Improved methods and compositions for RNA interference
US20060272049A1 (en) 2003-11-17 2006-11-30 Waterhouse Peter M Insect resistance using inhibition of gene expression
EP1818405B1 (en) * 2004-04-09 2015-06-03 Monsanto Technology, LLC Compositions and methods for control of insect infestations in plants
AU2006292362B2 (en) 2005-09-16 2013-02-14 Monsanto Technology Llc Methods for genetic control of insect infestations in plants and compositions thereof
JP5474356B2 (en) 2006-01-12 2014-04-16 デブジェン エヌブイ Method for controlling pests using RNAi
JP5474355B2 (en) 2006-01-12 2014-04-16 デブジェン エヌブイ Genetically modified plant system method for plant pests using RNAi
WO2010141294A1 (en) * 2009-06-01 2010-12-09 North Carolina State University Insecticidal target genes identified from bug whole body and digestive system transcriptomes
US8907164B2 (en) * 2010-04-19 2014-12-09 The Samuel Roberts Noble Foundations, Inc. Regulating nutrient allocation in plants

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040265849A1 (en) * 2002-11-22 2004-12-30 Applera Corporation Genetic polymorphisms associated with Alzheimer's disease, methods of detection and uses thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Atkinson et al. 2009, Genbank Accession XM_001861358 *
Colliver et al. 1997 Plant Molecular Biology 35:509-522 *
Fourgoux-Nicol et al 1999, Plant Molecular Biology 40 :857-872 *
Thomas et al. 2001, The Plant Journal 25(4):417-425 *
Yibrah et al. 1993 Hereditas 118:273-280 *

Also Published As

Publication number Publication date
US10155959B2 (en) 2018-12-18
BR112014025983A2 (en) 2018-07-03
WO2013158966A1 (en) 2013-10-24
UY34752A (en) 2013-11-29
CN104395474A (en) 2015-03-04
AR090791A1 (en) 2014-12-10

Similar Documents

Publication Publication Date Title
AU2018200332B2 (en) Down-regulating gene expression in insect pests
US20200347400A1 (en) Transgenic plant of the species solanum tuberosum with resistance to phytophthora
Dutta et al. Tomato transgenic plants expressing hairpin construct of a nematode protease gene conferred enhanced resistance to root-knot nematodes
EP3351635B1 (en) Plants resistant to insect pests
EP2734623B1 (en) Plants resistant to insect pests
CN111373044A (en) Methods of modifying the specificity of plant non-coding RNA molecules for silencing gene expression
EP3420809A1 (en) Compositions and methods for controlling insect pests
US9970022B2 (en) Gall wasp control agents
TW201321509A (en) Nucleic acid molecules that target PP1-87B and confer resistance to coleopteran pests
TW201321508A (en) Nucleic acid molecules that target RPA70 and confer resistance to coleopteran pests
JP2018513675A (en) RNA polymerase II33 nucleic acid molecules for controlling pests
US20180037907A1 (en) Glycaspis Brimblecombei Control Agents
US10155959B2 (en) Bronze bug control agents
US20150259701A1 (en) Gall wasp control agents
KR20200070357A (en) Plant resistance
US8569578B1 (en) Generating transgenic potatoes with novel resistance to potato cyst nematodes by silencing nematode parasitism genes of CLE -1 and CLE-4s
US20150259700A1 (en) Transgenic Plants With RNA Interference-Mediated Resistance Against Root-Knot Nematodes
이웅규 Establishment of test systems for evaluating ingestion RNA interference-induced lethality against Tetranychus urticae, a representative sucking pest
US20140047582A1 (en) INTERFERING RNAs THAT PROMOTE ROOT GROWTH

Legal Events

Date Code Title Description
AS Assignment

Owner name: FUTURAGENE ISRAEL LTD., ISRAEL

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:AVISAR, DROR;SIEGEL, DANIEL;SHANI, ZIV;SIGNING DATES FROM 20141124 TO 20141125;REEL/FRAME:034284/0248

AS Assignment

Owner name: FUTURAGENE ISRAEL LTD., ISRAEL

Free format text: CORRECTIVE ASSIGNMENT TO CORRECT THE RECEIVING PARTY'S ADDRESS PREVIOUSLY RECORDED AT REEL: 034284 FRAME: 0248. ASSIGNOR(S) HEREBY CONFIRMS THE ASSIGNMENT;ASSIGNORS:AVISAR, DROR;SIEGEL, DANIEL R.;SHANI, ZIV;SIGNING DATES FROM 20141124 TO 20141125;REEL/FRAME:034782/0558

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4