US20140273278A1 - G-quadruplex binding assays and compounds therefor - Google Patents

G-quadruplex binding assays and compounds therefor Download PDF

Info

Publication number
US20140273278A1
US20140273278A1 US14/215,994 US201414215994A US2014273278A1 US 20140273278 A1 US20140273278 A1 US 20140273278A1 US 201414215994 A US201414215994 A US 201414215994A US 2014273278 A1 US2014273278 A1 US 2014273278A1
Authority
US
United States
Prior art keywords
quadruplex
analog
polynucleotide
nucleobase
isoxanthopterin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/215,994
Inventor
Lesley Davenport
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US14/215,994 priority Critical patent/US20140273278A1/en
Publication of US20140273278A1 publication Critical patent/US20140273278A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/18Type of nucleic acid acting by a non-sequence specific mechanism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes

Definitions

  • the present invention relates to the field of G-quadruplex structures, and more specifically to methods for assaying the binding of compounds to G-quadruplex structures, methods for screening candidate compounds for use as modulators of G-quadruplex activity.
  • the invention relates to methods for screening candidate compounds for telomerase modulating (inhibitory or enhancing) activity, to telomerase modulators (e.g., inhibitors and enhancers) identified by the methods, and to therapeutic applications of the compounds identified by the methods.
  • telomeres are specialized regions of non-coding repeated DNA sequences bound by proteins which form condensed, heterochromatic structures at the ends of chromosomes.
  • telomerase a special enzyme known as telomerase.
  • telomeres With each round of replication, telomeres become progressively shorter, and after approximately 50 cell cycles, the shortened telomeres cease to function, leading to cell death; thus, shortening of telomeres is associated with aging.
  • Another indication that telomere function is associated with cellular longevity comes from the observation that 90% of immortalized tumor cells exhibit enhanced telomerase activity (Hwang, Mech. Ageing Dev.
  • telomeres In addition to protecting chromosomal ends from “erosion” during replication, telomeres also protect chromosomal ends from degradation by nucleases. Interfering with the process of telomere replication by telomerase and thereby diminishing the protective activity of telomeres may be an effective means of speeding up cellular senescence.
  • telomeres contains tandem repeats of simple motifs such as (5′-TTAGGG) n in Homo sapiens and (5′-TTGGGG) n in the ciliate, Tetrahymena (Herbert et al., 1999; Hemann & Greider, 1999), and these DNA sequences are known to adopt an unusual, highly stable structure formed by Hoogsteen base-pairing between guanine residues.
  • 5′-TTAGGG 5′-TTAGGG
  • 5′-TTGGGGGG 5′-TTGGGGGG
  • Tetrahymena Tetrahymena
  • G-quadruplexes are believed to be associated with switch recombination during the differentiation of B lymphocytes, as well as being involved in gene regulation and disease states such as cancer and Werner's syndrome (Simonsson, Biol. Chem., 382, 621-628; 2001). G-quadruplexes are stabilized by physiological concentrations of potassium ions, and have been shown to directly inhibit the activity of telomerase, implicated in tumorigenesis (Davies & Siu, 2000; Elmore & Holt, 2000).
  • compounds which stabilize G-quadruplexes and interfere with telomerase activity may serve useful as antitumor agents by causing telomere instability and combating the uncontrolled cellular proliferation observed in cancer (Riou, PNAS, 99(5):2672-2677; 2002).
  • telomere inhibition can be achieved by several approaches, including altering the enzyme's RNA template or interactions with its reverse transcriptase active site, numerous studies have focused on stabilizing the inhibitory G-quadruplex structure formed by the telomeres.
  • Molecules studied for their ability to stabilize G-quadruplex structures include the classic DNA intercalators ethidium and amido-anthraquinones. These molecules appear to drive the single-strand telomere-quadruplex equilibrium in favor of the folded quadruplex complex.
  • perylene derivatives and tetra-(N-methyl-pyridyl)-porphyrin appear to stack on the exterior of the quadruplex.
  • an elegant time-resolved fluorescence assay using Eu 3+ long-lived fluorophores bound to telomeric fragments targets telomerase activity rather than quadruplex-DNA binding, and involves time-consuming PCR amplification.
  • the present invention provides G-quadruplex analog polynucleotides comprising the structure:
  • each L 1 , L 2 , L 3 , L 4 , L 5 and L 6 is independently selected from the group consisting of a nucleotide, a nucleotide analog, and a nucleotide comprising a 6-methyl-isoxanthopterin nucleobase;
  • q, r, s, t, u and v are each independently 0, 1 or 2, provided that the sum of q+r+s+t+u+v is at least 3;
  • x 1 to 8;
  • said sequence 5′-(L 1 ) q (L 2 ) r (L 3 ) s (L 4 ) t (L 5 ) u (L 6 ) v is an analog of a telomeric repeat sequence
  • said polynucleotide contains at least one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase;
  • said G-quadruplex analog polynucleotide forms or is capable of forming a G-quadruplex structure
  • each 6-methyl-isoxanthopterin nucleobase is located within said G-quadruplex structure
  • the G1 position of said G-quadruplex analog comprises a 6-methyl-isoxanthopterin nucleobase
  • the 6-methyl-isoxanthopterin at said G1 position shows an increase or enhancement in fluorescence upon G-quadruplex formation.
  • q, r, s, t, u and v are each 1.
  • x is from 2 to 6.
  • x is from 3 to 5.
  • x is 4.
  • q, r, s, t, u and v are each 1, and x is 4.
  • the polynucleotide contains one, two three four, five of six 6-methyl-isoxanthopterin nucleobases.
  • the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase.
  • the G-quadruplex analog polynucleotide has the structure 5′-TTAGGG (SEQ ID NO: 1), 5′-TTAGGGTTAGGG (SEQ ID NO:2), 5′-TTAGGGTTAGGGTTAGGG (SEQ ID NO:3), 5′-TTAGGGTTAGGGTTAGGG (SEQ ID NO:4), 5′-TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO:5), 5′-TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO: 7), 5′-TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
  • the G-quadruplex analog polynucleotide comprises any of SEQ ID NOs: 2-8.
  • the G-quadruplex analog polynucleotide comprises any of SEQ ID NOs: 3-5.
  • the G-quadruplex analog polynucleotide comprises SEQ ID NO: 4.
  • the present invention provides a method for identifying a candidate compound as a quadruplex-binding molecule comprising the steps of:
  • the present invention provides a method for identifying a candidate compound as a quadruplex-folding promoting agent, comprising the steps of:
  • the present invention provides a method for identifying a candidate compound as a telomerase inhibitor comprising the steps of:
  • the compound displaying the difference in step (c) is confirmed to be an inhibitor of telomerase, for example by any of the telomerase assays known in the art.
  • the G-quadruplex analog polynucleotide is in its unfolded state.
  • the G-quadruplex analog polynucleotide is in its folded state.
  • the G-quadruplex analog polynucleotides are in their folded state.
  • the difference in the fluorescence property is selected from difference in fluorescence intensity and spectral shift.
  • the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises any of SEQ ID NOs: 2-8, or 3-5, or 4.
  • said G-quadruplex analog comprises a nucleobase sequence that is substantially identical to a human telomeric repeat sequence.
  • the nucleobase sequence of said G-quadruplex analog is substantially identical to a human telomeric repeat sequence.
  • the present invention provides methods for determining the binding affinity of a plurality of candidate compounds for G-quadruplex structures comprising the steps of:
  • the G-quadruplex analogs have the general structure of any of SEQ ID Nos. 2-6 or SEQ ID NOs: 1-14; or Seq ID NOs 3-5 or SEQ ID NOs: 11-13; or SEQ ID NO:4 or SEQ ID NO: 12.
  • the G-quadruplex analogs have the structure any of SEQ ID NOs: 9-16 and one guanine bases of position G1 has been replaced with a 6-methyl-isoxanthopterin nucleobase fluorescent nucleobase.
  • the array is a multiwell plate or a gene chip.
  • the array comprises beads, is on a column or other solution-based solid support matrix.
  • the fluorescence property that is measured is selected from the emission wavelength, excitation wavelength, fluorescence intensity, fluorescence lifetime, fluorescence resonance energy transfer (FRET) or fluorescence anisotropy of the fluorescent moiety.
  • FRET fluorescence resonance energy transfer
  • the fluorescent nucleobase analog is a pteridine analog, preferably 6-methyl-8-(2-deoxy- ⁇ -D-ribofuranosyl) isoxanthopterin (“6-MI”).
  • the present invention provides a fast and sensitive fluorescence assay for screening potential anti-cancer drugs that stabilize the G-quadruplexed state of DNA and thus inhibit telomerase activity.
  • a fast and sensitive fluorescence assay for screening potential anti-cancer drugs that stabilize the G-quadruplexed state of DNA and thus inhibit telomerase activity.
  • Such an intrinsic-fluorescence approach has not previously been employed for studies of quadruplexed DNA structures, and in some embodiments involves the site-specific insertion of one or more fluorescent nucleobase analogs (preferably guanine-analogs) into a human DNA telomeric sequence.
  • FIG. 1 shows quenching of 6MI at position 5 due to quadruplex formation.
  • FIG. 2 shows quenching of 6MI at position 11 due to quadruplex formation.
  • FIG. 3 shows the increase in intrinsic fluorescence intensity of NMM as the concentration of DNA telomeric sequence increases, with measurements carried out in 10 mM cacodylate and 100 mM potassium chloride buffer, and excitation of 410 nm, and emission at 610 nm.
  • FIG. 4 shows the titration of fluorescent telomeric sequence (5 tet) with TMPy, with measurements were carried out in 10 mM cacodylate buffer, and monitoring of the decrease in fluorescence intensity of the 5 tet after the addition of TMPy in M range, where excitation was at 340 nm and emission was recorded at 430 nm.
  • FIG. 5 shows the decrease in fluorescence intensity of 5 tet as the concentration of NMM increases, with excitation set at 340 nm and emission set at 430 nm.
  • FIG. 6 shows the decrease in fluorescence of tet with the increase in Co(III)MPIX concentration.
  • the present invention provides a model DNA complex which is intrinsically fluorescent via the insertion of a fluorescent nucleobase, for example a fluorescent guanine-analog, into an oligonucleotide capable of forming a G-quadruplex structure resembling a telomeric repeat sequence.
  • a fluorescent nucleobase for example a fluorescent guanine-analog
  • the telomeric repeat sequence is a human telomeric repeat sequence.
  • the signal generated by this intrinsically fluorescent nucleobase-substituted quadruplex-DNA forming oligonucleotide sequence is extremely sensitive to the binding of a ligand, and thereby facilitates an effective, rapid means of screening hundreds of potential DNA-quadruplex ligands (or drugs of interest), irrespective of whether these ligands are, themselves, fluorescent. Notably, formation of the quadruplex structure is not affected; because the nucleobase analog is intrinsic to the G-quadruplex, cytotoxicity resulting from the interaction of the ligand with duplex DNA structures is not observed.
  • the present invention provides methods for identifying potential DNA-quadruplex-binding molecules individually, and from libraries of compounds that may act as telomerase inhibitors, by their ability to stabilize formation of the G-quadruplex.
  • the present invention provides methods for determining the binding affinity of a candidate compound for G-quadruplex structures comprising the steps of:
  • the term “candidate compound” is intended to mean a compound, preferably a small molecule (i.e., a molecule having a molecular weight of less than 1000 daltons), that is suspected of possessing the ability to bind to G-quadruplex structures.
  • a small molecule i.e., a molecule having a molecular weight of less than 1000 daltons
  • examples of such compounds are molecules having multiple aromatic, heteroaromatic, alicyclic and heterocyclic ring systems.
  • G-quadruplex analog polynucleotide is intended to mean a polynucleotide analog in accordance with the present invention that possesses the following properties: 1) it is or comprises an analog of a telomeric repeat sequence—i.e., other than for having one or more 6-MI nucleobases substituted for guanine bases, the polynucleotide either has a high degree of homology to, or alternatively is, a telomeric repeat sequence; 2) the polynucleotide contains at least one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase; 3) the G-quadruplex analog polynucleotide forms or is capable of forming a G-quadruplex structure; 4) each 6-methyl-isoxanthopterin nucleobase is located within the G-quadruplex structure; 5) the G1 position of said G-quadruplex analog comprises a 6-methyl-
  • contacting is intended to mean the placing together of the indicated moieties such that a binding reaction can occur.
  • fluorescent nucleobase analog is intended to mean a nucleobase analog that is fluorescent. It is preferred that the fluorescent nucleobase not disrupt the G-quadruplex structure. However, while it is preferred that the fluorescent nucleobase analog participate in nucleobase pairing, such participation is not required. Thus, any of the numerous fluorescent nucleobase analogs known in the art to be useful in duplex or triplex structures can be used in the G-quadruplex analogs of the invention. Examples of such fluorescent nucleobases include 2-amino purine, and pteridine derivatives.
  • fluorescent nucleobase is 6-methyl-8-(2-deoxy-1-D-ribofuranosyl) isoxanthopterin (“6MI”), commercially available form TRI-LINK, San Diego, Calif. Examples of further fluorescent nucleobases will be apparent to those of skill in the art.
  • individual candidate compounds or libraries of candidate compounds are contacted with a G-quadruplex analog under conditions such that binding of the candidate compounds to the G-quadruplex analog can occur.
  • the degree of binding is determined by measuring a difference in a fluorescence property of said G-quadruplex analog; i.e., by measuring a difference in a fluorescence property of the intrinsic fluorescence moiety of the G-quadruplex analog.
  • Any fluorescence property of the fluorescent moiety that changes in response to binding of a candidate compound can be used to determine the binding of the candidate compound to the G-quadruplex analog. Examples of such fluorescence properties include the emission wavelength, excitation wavelength, intensity, anisotropy, FRET and lifetime of the fluorescent moiety.
  • the G-quadruplex analogs of the invention possess at least one intrinsic fluorescent moiety, which is preferably a fluorescent nucleobase analog. In some embodiments, the G-quadruplex analogs contain one, two, three, four, five, six or more intrinsic fluorescent moieties.
  • the G-quadruplex analogs can form G-quadruplex structures.
  • the nucleobase sequence of the G-quadruplex analog is a telomeric repeat sequence.
  • the nucleobase sequence of the G-quadruplex analog has a high degree of homology (for example, greater than 80% or greater than 90% homology) with a human telomeric repeat sequence.
  • the nucleobase sequence of the G-quadruplex analog is identical, or is substantially identical to a telomeric repeat sequence (preferably but not necessarily a human telomeric sequence).
  • the G-quadruplex analog can contain a telomeric repeat sequence, or a sequence substantially identical thereto (for example a sequence identical to a telomeric repeat sequence but for the substitution of one or more fluorescent nucleobase analogs therein) and additional nucleobases.
  • the nucleobase sequence of the G-quadruplex analog is identical to a telomeric repeat sequence but for the substitution of one or more fluorescent nucleobase analogs therein.
  • the G-quadruplex analogs of the invention contain one, two, three, four, five or six fluorescent nucleobase analogs.
  • nucleotide has its accustomed meaning of a monomeric unit of DNA or RNA. See L. Stryer, Biochemistry 4 th edition, W.H Freeman and Co., N.Y. 1995, incorporated herein by reference.
  • nucleotide analog as used herein is intended to mean a moiety that mimics the structure and/or function of naturally occurring nucleotide, typically a nucleotide in which one of the constituent moieties (i.e., the sugar, the internucleoside linkage, or particularly the nucleobase) has been modified or substituted by a different moiety.
  • Myriad nucleotide analogs are known in the art. See for example Antisense Research and Application , Ed. S. T. Crooke and B. Lebleu, CRC Press, 1993, incorporated by reference herein.
  • the G-quadruplex analogs have the structure of any of SEQ ID NOs:1-16, and wherein at least one of said nucleobases of said sequence of any of SEQ ID NOs:1-16 has been replaced with a 6-MI fluorescent nucleobase, at the G-1 position.
  • telomere inhibitory activity of such identified compounds is determined by telomerase assays known in the art.
  • candidate compounds are contacted with an array of G-quadruplex analogs of the invention.
  • an array can be in any of the numerous forms routinely used for high throughput screening. Examples of such arrays are 96-well plates, high density arrays on substrates (e.g., so-called “gene chips”; see for example U.S. Pat. Nos. 5,445,934 and 5,520,270, both to Fodor, and both incorporated by reference herein), and other types of screening methodologies known in the art.
  • the G-quadruplex analogs have the structure of any of SEQ ID NOs: 2-8 and 10-16, and wherein at least one of said nucleobases of said SEQ ID NOs: 2-8 and 10-16 has been replaced with a 6-MIfluorescent nucleobase.
  • the G-quadruplex analogs have the structure of any of SEQ ID NOs: 1-8 and one or more additional guanine bases have been replaced with a 6-MI fluorescent nucleobase.
  • the present invention provides methods for identifying a candidate compound as a telomerase inhibitor comprising the steps of:
  • the candidate compounds identified as having G-quadruplex binding properties can then be assayed for telomerase inhibitory activity by any of the variety of telomerase activity assays known in the art.
  • Synthesis of polynucleotides of the invention can be accomplished by standard methodologies, for example phosphoramidite methodologies. See for example Caruthers U.S. Pat. Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777; 4,973,679; and 5,132,418; and Koster U.S. Pat. No. 4,725,677 and Re. 34,069, each of which is incorporated by reference. See also Oligonucleotides and Analogues A Practical Approach , Eckstein, F. Ed., IRL Press, New York, 1991, also incorporated by reference in its entirety.
  • the G-quadruplex analogs of the invention can contain, in addition to the intrinsic fluorescent moiety, any of a wide variety of known oligonucleotide modifications, including base modifications, backbone modifications, phosphate modifications, sugar modifications, and 2′ modifications.
  • the G-quadruplex structure can contain, for example, modified internucleoside linkages such as phosphodiester, phosphorothioate, phosphorodithioate, and H-phosphonate linkages, naturally occurring pentose sugar components such as ribose and deoxyribose, and their substituted derivatives, as well as other sugars known to substitute therefor in oligonucleotide analogs.
  • the constituent sugars and nucleosidic bases of the G-quadruplex structures of the invention can be naturally occurring or non-naturally occurring.
  • Non-naturally occurring sugars and nucleosidic bases are typically structurally distinguishable from, yet functionally interchangeable with, naturally occurring sugars (e.g. ribose and deoxyribose) and nucleosidic bases (e.g., adenine, guanine, cytosine, thymine).
  • naturally occurring sugars e.g. ribose and deoxyribose
  • nucleosidic bases e.g., adenine, guanine, cytosine, thymine.
  • non-naturally occurring nucleobases and sugars include all such structures which mimic the structure and/or function of naturally occurring species, as is known in the art.
  • the G-quadruplex analogs of the invention demonstrate a decrease in fluorescence intensity on binding with ligands.
  • this parameter is quantified and used in the fast and sensitive binding assays described herein.
  • the methods of the present invention facilitate the screening of large libraries of candidate compounds for G-quadruplex stabilization. Successful candidates can then be assayed independently for telomerase inhibition. Due to the high fluorescence quantum yield of the substituted sequences of the invention, (preferably G1 substituted sequences described herein), the assay can be performed using nanomolar quadruplex concentrations in a suitable array format, for example a “DNA chip” or a 96-well plate, which can be read very quickly using a well known methodologies, for example, a fluorescence plate reader.
  • the assay methods of the invention are discussed herein using 96-well plates as an example of such methodology. However, it will be appreciated that any of the known screening methodologies can be used in accordance with the methods described herein.
  • the assay methods of the invention are performed on high density arrays (“gene chips”) as are known in the art.
  • potential quadruplex-stabilizing molecules are added individually to arrays (e.g., the wells of 96-well plates) and incubated.
  • arrays e.g., the wells of 96-well plates
  • the time of incubation can easily be determined by routine stop-flow measurements.
  • controls are used in the performance of the assays of the invention.
  • binding in the assays of the present invention is determined using the intrinsic fluorescence of the G-quadruplex structure, the disadvantages of the prior assays described above are eliminated.
  • the assays of the invention are much more readily performed using large scale screening techniques, as described above.
  • the G-quadruplex analog polynucleotides of the invention having a 6MI moiety at position G1 shows an enhancement of fluorescence
  • the G-quadruplex analogs tested that have 6-MI at positions other than G1 do not show fluorescence enhancement, and in fact show a decrease in fluorescence (i.e., quenching) upon folding.
  • these structures possess inherently increased sensitivity for assays, including those involving folding, such as determinations of the ability of an endogenous compound to promote quadruplex formation (i.e., folding), and this involving the ability of the candidate compound to bind to and/or stabilize the quadruplex structure.
  • the assays of the invention are especially useful for selecting candidate compounds for potential use as telomerase inhibition, and cancer therapeutics.
  • the G-quadruplex analogs of the invention having 6-MI at position G1 appear to have increased solvent sensitivity, in that the emission spectrum shifts—specifically, the wavelength of the emission max shifts from to more red (i.e., longer) wavelength upon folding, whereas the G-quadruplex analogs tested that have 6-MI at positions other than G1 do not show this of solvent sensitivity.
  • telomeric sequence (TTAGGG) 4 (SEQ ID NO:4) was purchased from Oligos etc, (HPLC purified).ss-DNA (polyA), ds-DNA ⁇ poly (dA)-poly (dT) ⁇ , triplex DNA ⁇ poly (dA)-[poly (dT)2] ⁇ were purchased from Amersham Inc. Fluorescently labeled guanine-telomeric 24-mer sequences 5tet (TTAGGGTTAG F GTTAGGGTTAGGG) (SEQ ID NO: 17) and 11 tet (TTAGGGTTAGGGTTAGGGTTAG F G) (SEQ ID NO: 18) were provided by Dr. Mary Hawkins (NIH/Maryland).
  • Quadruplex were formed by heating the DNA at 90 C for 10 minutes then cooling slowly to room temperature in a buffer containing 100 mM KCL and 10 mM Cacodylate.
  • Porphyrins were purchased from Porphyrin products (Logan, Utah) and were used with no further purification.
  • Fluorescence titrations were performed on a Spex Fluorolog instrument. All fluorescence measurements were carried out in buffer solution containing 10 mM sodium cacodylate and 100 mM KCl. Excitation was set at 340 nm and fluorescence emission was set at 430 nm for 6MI G-quadruplex analogs.
  • 6MI G-quadruplex analogs of the invention Binding of 6MI G-quadruplex analogs of the invention to candidate compounds was determined through measurement of changes in fluorescence intensity. These 6MI analogs were found to display relatively little movement not associated with the motion of the DNA. In the case of conventionally attached probes, flexibility of linker arms allows movement of the fluorophore in ways that are independent of the movement of the DNA being studied. This level of independent motion leads to more complex results. Because of this native-like linkage to DNA, these probes are very closely associated with neighboring bases rendering them extraordinarly sensitive to subtle changes that occur in the DNA structure surrounding them. Changing in base stacking of base pairing in the vicinity of these probes is reflected by distinct changes in fluorescence properties of the pteridine.
  • Pteridine nucleoside analogs have the advantage of that they are quenched when incorporated into an oligonucleotides (sometimes referred to as self-quenching). This feature can be used in many ways to monitor changing in tertiary structure occurring within the DNA as the bases interact with other molecules.
  • the pteridine analog 6MI was used as probes to investigate the interaction between G-quadruplex DNA and porphyrin.
  • the pteridine analogs have the advantage of that they are highly fluorescent and both 3MI and 6MI have structural similarity to guanines (especially 6MI, which is known to be involved in base pairing and expected to form G-quadruplex structures). Also, their fluorescence properties such as excitation and emission maxima differ from that of native DNA and porphyrins.
  • the effect of incorporating pteridine nucleoside analog (6MI) on quadruplex formation was examined by following the melting temperature of the sequence containing the probe at different position, the melting temperature measurement concluded that the incorporation of 6MI as DNA probe has no effect on quadruplex formation; this was demonstrated by recording the melting temperature at 295 nm.
  • the telomeric sequence containing the probe showed high melting temperature (55° C.) similar to that of telomeric sequence without the 6MI probe.
  • the G-quadruplex formation was examined by gel electrophoresis (DNA shadowing) as the sequence containing the probe run as two separate bands (one as single-stranded DNA and the other is quadruplex DNA), especially, in presence of KCl which is known to stabilize G-quadruplex structures.
  • a particular advantage of the methods of the invention is that the candidate compound need not possess any fluorescence properties. By following the decrease in fluorescence intensity of the G-quadruplex analog, one can determine the binding affinity and selectivity of a ligand to DNA.
  • 6MI was incorporated at different positions of a human telomeric sequence. specifically, G5 and G11 were replaced by 6MI (to form tet5 and tet11 respectively), and the interaction of fluorescent porphyrins ( FIG. 4 ) as well as non-fluorescent porphyrins were investigated. An increase of NMM concentration results in drop in fluorescence intensity of tet5.
  • Co(MPIX) is an example of non-fluorescent porphyrin. UV data have shown that Co(MPIX) is an excellent candidate for telomerase inhibition as shown by high quadruplex stabilization effect and relatively high affinity and high selectivity. Binding of Co(MPIX) to quadruplex DNA by fluorescence technique was carried out by using telomeric sequence with 6MI probe in position G5, by following the decrease in fluorescence intensity of pteridine analogs as the concentration of the drug was increased ( FIG. 6 ). The binding constant of Co(MPIX) to quadruplex DNA was found to be higher (10 7 ) than that of NMM to the same telomeric sequence (10 6 ). These results were in agreement with the UV studies.
  • Porphyrins such as Co (III) MPIX and NMM which possess a high specificity for quadruplex over duplex DNA and relatively high binding affinity are predicted to be ideal agents for use in therapeutic approaches aimed to inhibit telomerase activity and thus inhibit the growth of cancer cells.
  • the G-quadruplex analog polynucleotides of the invention having a 6MI moiety at position G1 shows an enhancement of fluorescence
  • the G-quadruplex analogs tested that have 6-MI at positions other than G1 do not show fluorescence enhancement, and in fact show a decrease in fluorescence (i.e., quenching) upon folding.
  • these structures possess inherently increased sensitivity for assays, including those involving folding, such as determinations of the ability of an endogenous compound to promote quadruplex formation (i.e., folding), and those involving the ability of the candidate compound to bind to and/or stabilize the quadruplex structure.
  • the assays of the invention are more sensitive, and are therefore especially useful for selecting candidate compounds for potential use as telomerase inhibition, and cancer therapeutics.
  • the G-quadruplex analogs of the invention having 6-MI at position G1 appear to have increased solvent sensitivity, in that the emission spectrum shifts—specifically, the wavelength of the emission max shifts from to more red (i.e., longer) wavelength upon folding, whereas the G-quadruplex analogs tested that have 6-MI at positions other than G1 do not show this of solvent sensitivity.
  • telomeric sequence (TTAGGG) 4 (SEQ ID NO:4) is purchased from Oligos etc, (HPLC purified).
  • ss-DNA polyA
  • triplex DNA ⁇ poly (dA)-[poly (dT)2] ⁇ is purchased from Amersham Inc.
  • Fluorescently labeled guanine-telomeric 24-mer sequence 1-tet (TTA F GGTTAGGGTTAGGGTTAGGG) (SEQ ID NO: 19) is synthesized by a commercial.
  • Quadruplex were formed by heating the DNA at 90 C for 10 minutes then cooling slowly to room temperature in a buffer containing 100 mM KCL and 10 mM Cacodylate.
  • Porphyrins are purchased from Porphyrin products (Logan, Utah) and are used with no further purification.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides methods for assaying binding of compounds to G-quadruplex structures. Also provided are methods for screening candidate compounds for use as modulators of G-quadruplex activity, and methods for screening candidate compounds for telomerase inhibitory activity. The invention further provides novel compounds useful in the assays of the invention.

Description

    CROSS REFERENCE TO RELATED APPLICATIONS
  • This application is based on and claims priority to U.S. Provisional Application No. 61/792,875, filed on Mar. 15, 2013, the entire contents of which is herein incorporated by reference.
  • FIELD OF THE INVENTION
  • The present invention relates to the field of G-quadruplex structures, and more specifically to methods for assaying the binding of compounds to G-quadruplex structures, methods for screening candidate compounds for use as modulators of G-quadruplex activity. In some embodiments, the invention relates to methods for screening candidate compounds for telomerase modulating (inhibitory or enhancing) activity, to telomerase modulators (e.g., inhibitors and enhancers) identified by the methods, and to therapeutic applications of the compounds identified by the methods.
  • BACKGROUND OF THE INVENTION
  • Telomeres are specialized regions of non-coding repeated DNA sequences bound by proteins which form condensed, heterochromatic structures at the ends of chromosomes. During cell division, the process of DNA replication at the ends of chromosomes is imperfect, and a special enzyme known as telomerase is required to replicate telomeric DNA sequences. With each round of replication, telomeres become progressively shorter, and after approximately 50 cell cycles, the shortened telomeres cease to function, leading to cell death; thus, shortening of telomeres is associated with aging. Another indication that telomere function is associated with cellular longevity comes from the observation that 90% of immortalized tumor cells exhibit enhanced telomerase activity (Hwang, Mech. Ageing Dev. 123(12):1681-94, 2002; Perry & Jenkins, 1999). In addition to protecting chromosomal ends from “erosion” during replication, telomeres also protect chromosomal ends from degradation by nucleases. Interfering with the process of telomere replication by telomerase and thereby diminishing the protective activity of telomeres may be an effective means of speeding up cellular senescence.
  • The DNA found within telomeres contains tandem repeats of simple motifs such as (5′-TTAGGG)n in Homo sapiens and (5′-TTGGGG)n in the ciliate, Tetrahymena (Herbert et al., 1999; Hemann & Greider, 1999), and these DNA sequences are known to adopt an unusual, highly stable structure formed by Hoogsteen base-pairing between guanine residues. These four-stranded guanine-rich DNA molecular structures are known as G-quadruplexes, DNA tetraplexes or G-quartets. G-quadruplexes are believed to be associated with switch recombination during the differentiation of B lymphocytes, as well as being involved in gene regulation and disease states such as cancer and Werner's syndrome (Simonsson, Biol. Chem., 382, 621-628; 2001). G-quadruplexes are stabilized by physiological concentrations of potassium ions, and have been shown to directly inhibit the activity of telomerase, implicated in tumorigenesis (Davies & Siu, 2000; Elmore & Holt, 2000). Thus, compounds which stabilize G-quadruplexes and interfere with telomerase activity may serve useful as antitumor agents by causing telomere instability and combating the uncontrolled cellular proliferation observed in cancer (Riou, PNAS, 99(5):2672-2677; 2002).
  • While inhibition of telomerase activity can be achieved by several approaches, including altering the enzyme's RNA template or interactions with its reverse transcriptase active site, numerous studies have focused on stabilizing the inhibitory G-quadruplex structure formed by the telomeres. Molecules studied for their ability to stabilize G-quadruplex structures include the classic DNA intercalators ethidium and amido-anthraquinones. These molecules appear to drive the single-strand telomere-quadruplex equilibrium in favor of the folded quadruplex complex. In contrast, perylene derivatives and tetra-(N-methyl-pyridyl)-porphyrin appear to stack on the exterior of the quadruplex. In addition, it has been reported that a series of porphyrin derivatives demonstrate selectivity between three possible G-quadruplex types. Thus, identifying and characterizing the stability of the ligand-G-quadruplex complex remains a challenge. In addition, all so-called G-quadruplex promoters thus far reported demonstrate some affinity for duplex-DNA and tend to exhibit cytotoxicity in addition to the desirable telomerase inhibitory properties.
  • Given the link between G-quadruplex stabilization and inhibition of telomerase, and their presumed utility as a means of triggering senescence, it is clear that molecules that G-quadruplex stabilizers are of great potential benefit as therapeutics. To date, however, the search for such molecules has been hampered by the lack of a facile assay of G-quadruplex binding. For example, previous assays for monitoring binding of molecules to quadruplex-DNA have involved titration-NMR methodologies (Fedoroff et al., 1998; Hurley et al., 2000), relatively insensitive UV spectroscopy (Mergny et al., 1998), and time-consuming DNA-polymerase stop-assays (Han et al., 1999). While the NMR approach provides detailed structural information, the large and expensive equipment required does not lend itself to rapid screening of many potential quadruplex-binding molecules. Alternatively, an elegant time-resolved fluorescence assay using Eu3+ long-lived fluorophores bound to telomeric fragments (Bare et al., 1998), targets telomerase activity rather than quadruplex-DNA binding, and involves time-consuming PCR amplification.
  • Consequently, there remains a long felt need for a rapid and facile micro-method for assaying the binding of molecules to G-quadruplex DNA, and methods which facilitate the screening a library of molecules for their ability to bind and stabilize G-quadruplex structures, toward the discovery of potential therapeutics. It is clear that such a rapid and facile micro-method for assaying the binding of molecules to G-quadruplex DNA, and methods for screening molecules for their ability to stabilize the G-quadruples structure would be of great benefit in the discovery of potential therapeutics. This invention is directed to these, as well as other, important ends.
  • SUMMARY OF THE INVENTION
  • In some embodiments, the present invention provides G-quadruplex analog polynucleotides comprising the structure:

  • (5′-(L 1)q(L 2)r(L 3)s(L 4)t(L 5)u(L 6)v)x
  • wherein:
  • each L1, L2, L3, L4, L5 and L6 is independently selected from the group consisting of a nucleotide, a nucleotide analog, and a nucleotide comprising a 6-methyl-isoxanthopterin nucleobase;
  • q, r, s, t, u and v are each independently 0, 1 or 2, provided that the sum of q+r+s+t+u+v is at least 3; and
  • x is 1 to 8;
  • provided that:
  • said sequence 5′-(L1)q(L2)r(L3)s(L4)t(L5)u(L6)v is an analog of a telomeric repeat sequence;
  • said polynucleotide contains at least one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase;
  • said G-quadruplex analog polynucleotide forms or is capable of forming a G-quadruplex structure;
  • each 6-methyl-isoxanthopterin nucleobase is located within said G-quadruplex structure;
  • the G1 position of said G-quadruplex analog comprises a 6-methyl-isoxanthopterin nucleobase; and
  • the 6-methyl-isoxanthopterin at said G1 position shows an increase or enhancement in fluorescence upon G-quadruplex formation.
  • In some embodiments, q, r, s, t, u and v are each 1.
  • In some embodiments, x is from 2 to 6.
  • In some embodiments, x is from 3 to 5.
  • In some embodiments, x is 4.
  • In some embodiments, q, r, s, t, u and v are each 1, and x is 4. In some such embodiments, the polynucleotide contains one, two three four, five of six 6-methyl-isoxanthopterin nucleobases.
  • In some embodiments, the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase.
  • In some embodiments, the G-quadruplex analog polynucleotide has the structure 5′-TTAGGG (SEQ ID NO: 1), 5′-TTAGGGTTAGGG (SEQ ID NO:2), 5′-TTAGGGTTAGGGTTAGGG (SEQ ID NO:3), 5′-TTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO:4), 5′-TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO:5), 5′-TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO:6), 5′-TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO: 7), 5′-TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO: 8), 5′-ATTGGG (SEQ ID NO:9), 5′-ATTGGGATTGGG (SEQ ID NO: 10), 5′-ATTGGGATTGGGATTGGG (SEQ ID NO: 11), 5′-ATTGGGATTGGGATTGGGATTGGG (SEQ ID NO. 12), 5′-ATTGGGATTGGGATTGGGATTGGGATTGGG (SEQ ID NO: 13), 5′-ATTGGGATTGGGATTGGGATTGGGATTGGGATTGGG (SEQ ID NO 14), 5′-ATTGGGATTGGGATTGGGATTGGGATTGGGATTGGGATTGGG (SEQ ID NO: 15), 5′-ATTGGGATTGGGATTGGGATTGGGATTGGGATTGGGATTGGGATTGGG (SEQ ID NO:16) wherein at least one of said nucleobases of each of said SEQ ID NOs: 1-16 has been replaced with a 6-methyl-isoxanthopterin nucleobase.
  • In some embodiments, the G-quadruplex analog polynucleotide comprises any of SEQ ID NOs: 2-8.
  • In some embodiments, the G-quadruplex analog polynucleotide comprises any of SEQ ID NOs: 3-5.
  • In some embodiments, the G-quadruplex analog polynucleotide comprises SEQ ID NO: 4.
  • In some embodiments, the present invention provides a method for identifying a candidate compound as a quadruplex-binding molecule comprising the steps of:
  • a) providing a G-quadruplex analog polynucleotide of claim 1;
    b) contacting said G-quadruplex analog polynucleotide with said candidate compound; and
    c) measuring a difference in a fluorescence property of said G-quadruplex analog upon binding of said compound to said analog;
    wherein said difference in said fluorescence property is indicative of the compound binding to the G-quadruplex analog polynucleotide.
  • In some further embodiments, the present invention provides a method for identifying a candidate compound as a quadruplex-folding promoting agent, comprising the steps of:
  • a) providing a G-quadruplex analog polynucleotide of claim 1 in its unfolded state;
    b) contacting said unfolded G-quadruplex analog polynucleotide with said candidate compound; and
    c) measuring a difference in a fluorescence property of said G-quadruplex analog polynucleotide upon folding into said G-quadruplex conformation.
  • In some further embodiments, the present invention provides a method for identifying a candidate compound as a telomerase inhibitor comprising the steps of:
  • a) providing a G-quadruplex analog polynucleotide of claim 1;
    b) contacting said G-quadruplex analog polynucleotide with said candidate compound;
    c) measuring a difference in a fluorescence property of said G-quadruplex analog upon binding of said compound to said analog; and
    d) assaying said compound for telomerase inhibitory activity.
  • In some embodiments, the compound displaying the difference in step (c) is confirmed to be an inhibitor of telomerase, for example by any of the telomerase assays known in the art.
  • In some embodiments of the G-quadruplex analog polynucleotides described herein, the G-quadruplex analog polynucleotide is in its unfolded state.
  • In some embodiments of the G-quadruplex analog polynucleotides described herein, the G-quadruplex analog polynucleotide is in its folded state.
  • In some embodiments of the arrays comprising G-quadruplex analog polynucleotides described herein, the G-quadruplex analog polynucleotides are in their unfolded state.
  • In some embodiments of the arrays comprising G-quadruplex analog polynucleotides described herein, the G-quadruplex analog polynucleotides are in their folded state.
  • In some embodiments of each of the methods provided herein, the difference in the fluorescence property is selected from difference in fluorescence intensity and spectral shift.
  • In some embodiments of each of the methods and compounds provided herein, the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises any of SEQ ID NOs: 2-8, or 3-5, or 4.
  • In some embodiments, said G-quadruplex analog comprises a nucleobase sequence that is substantially identical to a human telomeric repeat sequence.
  • In some embodiments, the nucleobase sequence of said G-quadruplex analog is substantially identical to a human telomeric repeat sequence.
  • In some embodiments, the present invention provides methods for determining the binding affinity of a plurality of candidate compounds for G-quadruplex structures comprising the steps of:
  • a) providing an array comprising a plurality of sites to which G-quadruplex analogs as described above have been bound;
    b) contacting said G-quadruplex analogs with a plurality of candidate compound; and
    c) measuring a difference in a fluorescence property of one or more of said G-quadruplex analogs.
  • In some embodiments, the G-quadruplex analogs have the structure of any of SEQ ID NOs: 1-8 or of any of SEQ ID NOs: 9-16, and wherein at least one of said nucleobases of said sequence of any of SEQ ID NOs: 1-8 or of any of SEQ ID NOs: 9-16 has been replaced with a 6-methyl-isoxanthopterin nucleobase.
  • In further embodiments, the G-quadruplex analogs have the general structure of any of SEQ ID Nos. 2-6 or SEQ ID NOs: 1-14; or Seq ID NOs 3-5 or SEQ ID NOs: 11-13; or SEQ ID NO:4 or SEQ ID NO: 12.
  • In some embodiments, the G-quadruplex analogs have the structure any of SEQ ID NOs: 9-16 and one guanine bases of position G1 has been replaced with a 6-methyl-isoxanthopterin nucleobase fluorescent nucleobase.
  • In some embodiments of the invention, the array is a multiwell plate or a gene chip. In further embodiments, the array comprises beads, is on a column or other solution-based solid support matrix.
  • In some embodiments of each of the methods of the invention, the fluorescence property that is measured is selected from the emission wavelength, excitation wavelength, fluorescence intensity, fluorescence lifetime, fluorescence resonance energy transfer (FRET) or fluorescence anisotropy of the fluorescent moiety.
  • In some embodiments of each of the foregoing methods and compounds, the fluorescent nucleobase analog is a pteridine analog, preferably 6-methyl-8-(2-deoxy-β-D-ribofuranosyl) isoxanthopterin (“6-MI”).
  • In some embodiments, the present invention provides a fast and sensitive fluorescence assay for screening potential anti-cancer drugs that stabilize the G-quadruplexed state of DNA and thus inhibit telomerase activity. Such an intrinsic-fluorescence approach has not previously been employed for studies of quadruplexed DNA structures, and in some embodiments involves the site-specific insertion of one or more fluorescent nucleobase analogs (preferably guanine-analogs) into a human DNA telomeric sequence.
  • BRIEF DESCRIPTION OF THE FIGURES
  • FIG. 1 shows quenching of 6MI at position 5 due to quadruplex formation.
  • FIG. 2 shows quenching of 6MI at position 11 due to quadruplex formation.
  • FIG. 3 shows the increase in intrinsic fluorescence intensity of NMM as the concentration of DNA telomeric sequence increases, with measurements carried out in 10 mM cacodylate and 100 mM potassium chloride buffer, and excitation of 410 nm, and emission at 610 nm.
  • FIG. 4 shows the titration of fluorescent telomeric sequence (5 tet) with TMPy, with measurements were carried out in 10 mM cacodylate buffer, and monitoring of the decrease in fluorescence intensity of the 5 tet after the addition of TMPy in M range, where excitation was at 340 nm and emission was recorded at 430 nm.
  • FIG. 5 shows the decrease in fluorescence intensity of 5 tet as the concentration of NMM increases, with excitation set at 340 nm and emission set at 430 nm.
  • FIG. 6 shows the decrease in fluorescence of tet with the increase in Co(III)MPIX concentration.
  • DETAILED DESCRIPTION
  • In some embodiments, the present invention provides a model DNA complex which is intrinsically fluorescent via the insertion of a fluorescent nucleobase, for example a fluorescent guanine-analog, into an oligonucleotide capable of forming a G-quadruplex structure resembling a telomeric repeat sequence. In some preferred embodiments, the telomeric repeat sequence is a human telomeric repeat sequence. The signal generated by this intrinsically fluorescent nucleobase-substituted quadruplex-DNA forming oligonucleotide sequence is extremely sensitive to the binding of a ligand, and thereby facilitates an effective, rapid means of screening hundreds of potential DNA-quadruplex ligands (or drugs of interest), irrespective of whether these ligands are, themselves, fluorescent. Notably, formation of the quadruplex structure is not affected; because the nucleobase analog is intrinsic to the G-quadruplex, cytotoxicity resulting from the interaction of the ligand with duplex DNA structures is not observed. Thus, the present invention provides methods for identifying potential DNA-quadruplex-binding molecules individually, and from libraries of compounds that may act as telomerase inhibitors, by their ability to stabilize formation of the G-quadruplex.
  • In some embodiments, the present invention provides methods for determining the binding affinity of a candidate compound for G-quadruplex structures comprising the steps of:
  • a) providing a G-quadruplex analog polynucleotide as described above, containing at least one 6-MI nucleobase that is substituted for the guanine base at the G1 position of the quadruplex-forming polynucleotide (i.e., the first guanine residue residing within the quadruplex structure counting from the 5′-end);
    b) contacting said G-quadruplex analog polynucleotide with said candidate compound; and
    c) measuring a difference in a fluorescence property of said G-quadruplex analog upon binding of said compound to said analog;
    wherein said difference in said fluorescence property is indicative of the compound binding to the G-quadruplex analog polynucleotide.
  • As used herein, the term “candidate compound” is intended to mean a compound, preferably a small molecule (i.e., a molecule having a molecular weight of less than 1000 daltons), that is suspected of possessing the ability to bind to G-quadruplex structures. Examples of such compounds are molecules having multiple aromatic, heteroaromatic, alicyclic and heterocyclic ring systems.
  • As used herein, the term “G-quadruplex analog polynucleotide” (or “G-quadruplex analog”) is intended to mean a polynucleotide analog in accordance with the present invention that possesses the following properties: 1) it is or comprises an analog of a telomeric repeat sequence—i.e., other than for having one or more 6-MI nucleobases substituted for guanine bases, the polynucleotide either has a high degree of homology to, or alternatively is, a telomeric repeat sequence; 2) the polynucleotide contains at least one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase; 3) the G-quadruplex analog polynucleotide forms or is capable of forming a G-quadruplex structure; 4) each 6-methyl-isoxanthopterin nucleobase is located within the G-quadruplex structure; 5) the G1 position of said G-quadruplex analog comprises a 6-methyl-isoxanthopterin nucleobase; and 6) the 6-methyl-isoxanthopterin at the G1 position shows an increase or enhancement in fluorescence upon G-quadruplex formation.
  • As used herein, the term “contacting” is intended to mean the placing together of the indicated moieties such that a binding reaction can occur.
  • As used herein, the term “fluorescent nucleobase analog” is intended to mean a nucleobase analog that is fluorescent. It is preferred that the fluorescent nucleobase not disrupt the G-quadruplex structure. However, while it is preferred that the fluorescent nucleobase analog participate in nucleobase pairing, such participation is not required. Thus, any of the numerous fluorescent nucleobase analogs known in the art to be useful in duplex or triplex structures can be used in the G-quadruplex analogs of the invention. Examples of such fluorescent nucleobases include 2-amino purine, and pteridine derivatives. On particularly preferred fluorescent nucleobase is 6-methyl-8-(2-deoxy-1-D-ribofuranosyl) isoxanthopterin (“6MI”), commercially available form TRI-LINK, San Diego, Calif. Examples of further fluorescent nucleobases will be apparent to those of skill in the art.
  • In accordance with the present invention, individual candidate compounds or libraries of candidate compounds are contacted with a G-quadruplex analog under conditions such that binding of the candidate compounds to the G-quadruplex analog can occur. In some embodiments, the degree of binding is determined by measuring a difference in a fluorescence property of said G-quadruplex analog; i.e., by measuring a difference in a fluorescence property of the intrinsic fluorescence moiety of the G-quadruplex analog. Any fluorescence property of the fluorescent moiety that changes in response to binding of a candidate compound can be used to determine the binding of the candidate compound to the G-quadruplex analog. Examples of such fluorescence properties include the emission wavelength, excitation wavelength, intensity, anisotropy, FRET and lifetime of the fluorescent moiety.
  • The G-quadruplex analogs of the invention possess at least one intrinsic fluorescent moiety, which is preferably a fluorescent nucleobase analog. In some embodiments, the G-quadruplex analogs contain one, two, three, four, five, six or more intrinsic fluorescent moieties.
  • In accordance with the present invention, the G-quadruplex analogs can form G-quadruplex structures. In some embodiments, the nucleobase sequence of the G-quadruplex analog is a telomeric repeat sequence. In some preferred embodiments, the nucleobase sequence of the G-quadruplex analog has a high degree of homology (for example, greater than 80% or greater than 90% homology) with a human telomeric repeat sequence. In some preferred embodiments, the nucleobase sequence of the G-quadruplex analog is identical, or is substantially identical to a telomeric repeat sequence (preferably but not necessarily a human telomeric sequence). In some embodiments, the G-quadruplex analog can contain a telomeric repeat sequence, or a sequence substantially identical thereto (for example a sequence identical to a telomeric repeat sequence but for the substitution of one or more fluorescent nucleobase analogs therein) and additional nucleobases. In some embodiments, the nucleobase sequence of the G-quadruplex analog is identical to a telomeric repeat sequence but for the substitution of one or more fluorescent nucleobase analogs therein. In some embodiments, the G-quadruplex analogs of the invention contain one, two, three, four, five or six fluorescent nucleobase analogs.
  • As used herein, the term “nucleotide” has its accustomed meaning of a monomeric unit of DNA or RNA. See L. Stryer, Biochemistry 4th edition, W.H Freeman and Co., N.Y. 1995, incorporated herein by reference. The term “nucleotide analog” as used herein is intended to mean a moiety that mimics the structure and/or function of naturally occurring nucleotide, typically a nucleotide in which one of the constituent moieties (i.e., the sugar, the internucleoside linkage, or particularly the nucleobase) has been modified or substituted by a different moiety. Myriad nucleotide analogs are known in the art. See for example Antisense Research and Application, Ed. S. T. Crooke and B. Lebleu, CRC Press, 1993, incorporated by reference herein.
  • In some preferred embodiments, the G-quadruplex analogs have the structure of any of SEQ ID NOs:1-16, and wherein at least one of said nucleobases of said sequence of any of SEQ ID NOs:1-16 has been replaced with a 6-MI fluorescent nucleobase, at the G-1 position.
  • In accordance with some preferred embodiments of the invention, large numbers of candidate compounds (e.g., libraries) can be screened to identify compounds that bind G-quadruplex structures. Such compounds are believed to possess telomerase inhibitory activity. In some embodiments, the telomerase inhibitory activity of such identified compounds is determined by telomerase assays known in the art.
  • In some embodiments, candidate compounds are contacted with an array of G-quadruplex analogs of the invention. Such an array can be in any of the numerous forms routinely used for high throughput screening. Examples of such arrays are 96-well plates, high density arrays on substrates (e.g., so-called “gene chips”; see for example U.S. Pat. Nos. 5,445,934 and 5,520,270, both to Fodor, and both incorporated by reference herein), and other types of screening methodologies known in the art.
  • In some embodiments, the G-quadruplex analogs have the structure of any of SEQ ID NOs: 2-8 and 10-16, and wherein at least one of said nucleobases of said SEQ ID NOs: 2-8 and 10-16 has been replaced with a 6-MIfluorescent nucleobase. In further embodiments, the G-quadruplex analogs have the structure of any of SEQ ID NOs: 1-8 and one or more additional guanine bases have been replaced with a 6-MI fluorescent nucleobase.
  • In some embodiments, the present invention provides methods for identifying a candidate compound as a telomerase inhibitor comprising the steps of:
  • a) providing a G-quadruplex analog as described above;
    b) contacting said G-quadruplex analog with said candidate compound; and
    c) measuring a difference in a fluorescence property of said G-quadruplex analog upon binding of said compound to said analog. Optionally, the candidate compounds identified as having G-quadruplex binding properties can then be assayed for telomerase inhibitory activity by any of the variety of telomerase activity assays known in the art.
  • Synthesis of polynucleotides of the invention can be accomplished by standard methodologies, for example phosphoramidite methodologies. See for example Caruthers U.S. Pat. Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777; 4,973,679; and 5,132,418; and Koster U.S. Pat. No. 4,725,677 and Re. 34,069, each of which is incorporated by reference. See also Oligonucleotides and Analogues A Practical Approach, Eckstein, F. Ed., IRL Press, New York, 1991, also incorporated by reference in its entirety.
  • The G-quadruplex analogs of the invention can contain, in addition to the intrinsic fluorescent moiety, any of a wide variety of known oligonucleotide modifications, including base modifications, backbone modifications, phosphate modifications, sugar modifications, and 2′ modifications. Thus, the G-quadruplex structure can contain, for example, modified internucleoside linkages such as phosphodiester, phosphorothioate, phosphorodithioate, and H-phosphonate linkages, naturally occurring pentose sugar components such as ribose and deoxyribose, and their substituted derivatives, as well as other sugars known to substitute therefor in oligonucleotide analogs.
  • The constituent sugars and nucleosidic bases of the G-quadruplex structures of the invention can be naturally occurring or non-naturally occurring. Non-naturally occurring sugars and nucleosidic bases are typically structurally distinguishable from, yet functionally interchangeable with, naturally occurring sugars (e.g. ribose and deoxyribose) and nucleosidic bases (e.g., adenine, guanine, cytosine, thymine). Thus, non-naturally occurring nucleobases and sugars include all such structures which mimic the structure and/or function of naturally occurring species, as is known in the art.
  • As discussed above, the G-quadruplex analogs of the invention, for example pteridine substituted quadruplex forming DNA polynucleotides described herein, demonstrate a decrease in fluorescence intensity on binding with ligands. In accordance with some aspects of the present invention, this parameter is quantified and used in the fast and sensitive binding assays described herein.
  • The present invention provides several advantages over prior assays. For example, the methods of the present invention facilitate the screening of large libraries of candidate compounds for G-quadruplex stabilization. Successful candidates can then be assayed independently for telomerase inhibition. Due to the high fluorescence quantum yield of the substituted sequences of the invention, (preferably G1 substituted sequences described herein), the assay can be performed using nanomolar quadruplex concentrations in a suitable array format, for example a “DNA chip” or a 96-well plate, which can be read very quickly using a well known methodologies, for example, a fluorescence plate reader. The assay methods of the invention are discussed herein using 96-well plates as an example of such methodology. However, it will be appreciated that any of the known screening methodologies can be used in accordance with the methods described herein. In some particularly preferred embodiments, the assay methods of the invention are performed on high density arrays (“gene chips”) as are known in the art.
  • In one embodiment of the assays of the invention, potential quadruplex-stabilizing molecules are added individually to arrays (e.g., the wells of 96-well plates) and incubated. The time of incubation can easily be determined by routine stop-flow measurements. Typically, controls are used in the performance of the assays of the invention.
  • Because binding in the assays of the present invention is determined using the intrinsic fluorescence of the G-quadruplex structure, the disadvantages of the prior assays described above are eliminated. In addition, the assays of the invention are much more readily performed using large scale screening techniques, as described above.
  • It has been surprisingly found that the upon folding of G-quadruplex analog polynucleotides into the quadruplex conformation, the G-quadruplex analog polynucleotides of the invention having a 6MI moiety at position G1 shows an enhancement of fluorescence, while the G-quadruplex analogs tested that have 6-MI at positions other than G1 do not show fluorescence enhancement, and in fact show a decrease in fluorescence (i.e., quenching) upon folding. Accordingly, these structures possess inherently increased sensitivity for assays, including those involving folding, such as determinations of the ability of an endogenous compound to promote quadruplex formation (i.e., folding), and this involving the ability of the candidate compound to bind to and/or stabilize the quadruplex structure.
  • Thus, the assays of the invention are especially useful for selecting candidate compounds for potential use as telomerase inhibition, and cancer therapeutics.
  • In addition, the G-quadruplex analogs of the invention having 6-MI at position G1 appear to have increased solvent sensitivity, in that the emission spectrum shifts—specifically, the wavelength of the emission max shifts from to more red (i.e., longer) wavelength upon folding, whereas the G-quadruplex analogs tested that have 6-MI at positions other than G1 do not show this of solvent sensitivity.
  • The following examples illustrate the invention and are not intended to limit the same. Those skilled in the art will recognize, or be able to ascertain through routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of the present invention.
  • EXAMPLES Materials and Methods Oligonucleotides DNA and Porphyrins:
  • Human telomeric sequence (TTAGGG) 4 (SEQ ID NO:4) was purchased from Oligos etc, (HPLC purified).ss-DNA (polyA), ds-DNA {poly (dA)-poly (dT)}, triplex DNA {poly (dA)-[poly (dT)2]} were purchased from Amersham Inc. Fluorescently labeled guanine-telomeric 24-mer sequences 5tet (TTAGGGTTAGFGTTAGGGTTAGGG) (SEQ ID NO: 17) and 11 tet (TTAGGGTTAGGGTTAGGGTTAGFG) (SEQ ID NO: 18) were provided by Dr. Mary Hawkins (NIH/Maryland). Quadruplex were formed by heating the DNA at 90 C for 10 minutes then cooling slowly to room temperature in a buffer containing 100 mM KCL and 10 mM Cacodylate. Porphyrins were purchased from Porphyrin products (Logan, Utah) and were used with no further purification.
  • Fluorescence Measurements:
  • Fluorescence titrations were performed on a Spex Fluorolog instrument. All fluorescence measurements were carried out in buffer solution containing 10 mM sodium cacodylate and 100 mM KCl. Excitation was set at 340 nm and fluorescence emission was set at 430 nm for 6MI G-quadruplex analogs.
  • Fluorescence Studies:
  • Binding of 6MI G-quadruplex analogs of the invention to candidate compounds was determined through measurement of changes in fluorescence intensity. These 6MI analogs were found to display relatively little movement not associated with the motion of the DNA. In the case of conventionally attached probes, flexibility of linker arms allows movement of the fluorophore in ways that are independent of the movement of the DNA being studied. This level of independent motion leads to more complex results. Because of this native-like linkage to DNA, these probes are very closely associated with neighboring bases rendering them exquisitely sensitive to subtle changes that occur in the DNA structure surrounding them. Changing in base stacking of base pairing in the vicinity of these probes is reflected by distinct changes in fluorescence properties of the pteridine. This sensitivity to neighboring base is not duplicated by conventional linker-attached probes which are more removed from these interactions by the length of the carbon chain connecting them to the DNA. Probes which are differ to nucleosides in size or structure can not be linked to the DNA through a deoxyribose moiety without a linker because they would most likely to disrupt the DNA tertiary structure and therefore not allow native-like interactions.
  • Pteridine nucleoside analogs have the advantage of that they are quenched when incorporated into an oligonucleotides (sometimes referred to as self-quenching). This feature can be used in many ways to monitor changing in tertiary structure occurring within the DNA as the bases interact with other molecules.
  • The pteridine analog 6MI was used as probes to investigate the interaction between G-quadruplex DNA and porphyrin. The pteridine analogs have the advantage of that they are highly fluorescent and both 3MI and 6MI have structural similarity to guanines (especially 6MI, which is known to be involved in base pairing and expected to form G-quadruplex structures). Also, their fluorescence properties such as excitation and emission maxima differ from that of native DNA and porphyrins.
  • G-Quadruplex Formation:
  • The effect of incorporating pteridine nucleoside analog (6MI) on quadruplex formation was examined by following the melting temperature of the sequence containing the probe at different position, the melting temperature measurement concluded that the incorporation of 6MI as DNA probe has no effect on quadruplex formation; this was demonstrated by recording the melting temperature at 295 nm. The telomeric sequence containing the probe showed high melting temperature (55° C.) similar to that of telomeric sequence without the 6MI probe. Also, the G-quadruplex formation was examined by gel electrophoresis (DNA shadowing) as the sequence containing the probe run as two separate bands (one as single-stranded DNA and the other is quadruplex DNA), especially, in presence of KCl which is known to stabilize G-quadruplex structures.
  • Incorporation of 6MI in position G5 formed more stable quadruplex structures compared to incorporating the same probe in the G11 position, as shown by gel electrophoresis and the higher melting temperature of the sequence containing 6MI in G5 position. While not wishing to be bound by any particular theory, it is believed that 6MI cannot form a bond with the guanine bases that is as strong as the guanine-guanine Hoogsteen base pairing. Thus, the G-quadruplex structure will have a free 3′-end when the G11 is substituted by 6MI, while substitution at G5 will be more stable as the G11 can form Guanine-guanine base pairing. This observation was confirmed by monitoring the quenching of the 6MI probe due to the quadruplex structure formation by increasing the KCl concentration to 100 mM and monitoring the fluorescence intensity, sequence with the probe at G5 position showed higher degree of quenching compared to the incorporation of 6MI in G11 position. This high degree of quenching is believed to be due to decrease in distance between the bases and the 6MI probe due to quadruplex formation.
  • In addition to gel electrophoresis and melting temperature experiments, the ability of pteridine analogs to form quadruplex DNA was examined using NMM titration study. It was found that the fluorescence intensity of NMM increases dramatically as the concentration of telomeric sequence with pteridine analogs at different position (tet5 and tet11) increase. This increase in fluorescence intensity confirmed that the presence of pteridine analogs incorporated into DNA sequence have no effect on quadruplex formation (FIG. 3).
  • A particular advantage of the methods of the invention is that the candidate compound need not possess any fluorescence properties. By following the decrease in fluorescence intensity of the G-quadruplex analog, one can determine the binding affinity and selectivity of a ligand to DNA.
  • 6MI was incorporated at different positions of a human telomeric sequence. specifically, G5 and G11 were replaced by 6MI (to form tet5 and tet11 respectively), and the interaction of fluorescent porphyrins (FIG. 4) as well as non-fluorescent porphyrins were investigated. An increase of NMM concentration results in drop in fluorescence intensity of tet5.
  • The decrease in fluorescence intensity of pteridine analogs for both tet 5 and tet 11 was monitored as the concentration of NMM was increased (FIG. 5), and our results showed that NMM bind to both sequences with a slightly preference to tet 5 which have shown to be more stable than tet 11 as noticed from melting temperature and gel electrophoresis experiments.
  • Co(MPIX) is an example of non-fluorescent porphyrin. UV data have shown that Co(MPIX) is an excellent candidate for telomerase inhibition as shown by high quadruplex stabilization effect and relatively high affinity and high selectivity. Binding of Co(MPIX) to quadruplex DNA by fluorescence technique was carried out by using telomeric sequence with 6MI probe in position G5, by following the decrease in fluorescence intensity of pteridine analogs as the concentration of the drug was increased (FIG. 6). The binding constant of Co(MPIX) to quadruplex DNA was found to be higher (107) than that of NMM to the same telomeric sequence (106). These results were in agreement with the UV studies. Porphyrins such as Co (III) MPIX and NMM which possess a high specificity for quadruplex over duplex DNA and relatively high binding affinity are predicted to be ideal agents for use in therapeutic approaches aimed to inhibit telomerase activity and thus inhibit the growth of cancer cells.
  • Example G1-Substituted Compounds
  • It has been surprisingly found that the upon folding of G-quadruplex analog polynucleotides into the quadruplex conformation, the G-quadruplex analog polynucleotides of the invention having a 6MI moiety at position G1 shows an enhancement of fluorescence, while the G-quadruplex analogs tested that have 6-MI at positions other than G1 do not show fluorescence enhancement, and in fact show a decrease in fluorescence (i.e., quenching) upon folding. Accordingly, these structures possess inherently increased sensitivity for assays, including those involving folding, such as determinations of the ability of an endogenous compound to promote quadruplex formation (i.e., folding), and those involving the ability of the candidate compound to bind to and/or stabilize the quadruplex structure.
  • Thus, the assays of the invention are more sensitive, and are therefore especially useful for selecting candidate compounds for potential use as telomerase inhibition, and cancer therapeutics.
  • In addition, the G-quadruplex analogs of the invention having 6-MI at position G1 appear to have increased solvent sensitivity, in that the emission spectrum shifts—specifically, the wavelength of the emission max shifts from to more red (i.e., longer) wavelength upon folding, whereas the G-quadruplex analogs tested that have 6-MI at positions other than G1 do not show this of solvent sensitivity.
  • The experiments above are repeated using the same G-quadruplex analogs described in the Examples above, but with a single 6-MI substitution at G-1.
  • Specifically, human telomeric sequence (TTAGGG) 4 (SEQ ID NO:4) is purchased from Oligos etc, (HPLC purified). ss-DNA (polyA), ds-DNA {poly (dA)-poly (dT)}, triplex DNA {poly (dA)-[poly (dT)2]} is purchased from Amersham Inc. Fluorescently labeled guanine-telomeric 24-mer sequence 1-tet (TTAFGGTTAGGGTTAGGGTTAGGG) (SEQ ID NO: 19) is synthesized by a commercial. Quadruplex were formed by heating the DNA at 90 C for 10 minutes then cooling slowly to room temperature in a buffer containing 100 mM KCL and 10 mM Cacodylate. Porphyrins are purchased from Porphyrin products (Logan, Utah) and are used with no further purification.
  • The examples above are repeated using 1-tet, and the 1-tet analog shows enhanced fluorescence and a red shift of the wavelength of the emission maximum relative to 5tet and 11tet.
  • The reference works, patents, patent applications, and scientific literature, and other printed publications that are mentioned of referred to herein are hereby incorporated by reference in their entirety. In addition, the following references are also incorporated herein by reference in their entirety:
    • Anantha, N. V., Azam, M., & Sheardy, R. D. (1998) Biochemistry 37, 2709-2714.
    • Arthanari, H., Basu, S., Kawano, T. L., & Bolton, P. H. (1998) Nucleic Acids Research 26, 3724-728.
    • Bare, L. A., Trinh, L., Wu, S., & Devlin, J. J. (1998) Drug Development Research 43, 109-116.
    • Davies, A. J. & Siu, L. L. (2000) Cancer Investigation 18, 269-277.
    • Elmore, L. W. & Holt, S. E. (2000) Molecular Carcinogenesis 28,
    • Fedoroff, O. Yu., Salazar, M., Han, H., Chemeris, V. V., Kerwin, S. M., & Hurley, L. H. (1998) Biochemistry 37, 12367-12374.
    • Han, H., Hurley, L. H., & Salazar, M. (1999) Nucleic Acids Research 27, 537-542.
    • Haq, I. L. J. E., Chowdhry, B. Z., & Jenkins, T. C. (1996) Journal of the American Chemical Society 118, 10693-10701.
    • Hemann, M. T. & Greider, C. W. (1999) Nucleic Acids Research 27, 3964-3969.
    • Herbert, B.-S., Pitts, A. E., Baker, S. I., Hamilton, S. E., Wright, W. E., Shay, J. W., & Corey, D. R. (1999) PNAS 96, 14276-14281.
    • Hurley, L. H., Wheelhouse, R. T., Sun, D., Kerwin, S. M., Salazar, M., Fedoroff, Yu. O., Han, F. X., Han, H., Izbicka, E., & Von Hoff, D. D. (2000) Pharmacology and Therapeutics 85, 141-158.
    • Li, Y., Geyer, R., & Sen, D. (1996) Biochemistry 35, 6911-6922.
    • Mergny, J. -L., Phan, A.-T., & Lacroix, L. (1998) FEBS Letters 435, 74-78.
    • Neidler, S., Harrison, R. J., Reszka, A. P., & Read, M. A. (2000) Pharmacology and Therapeutics 85, 133-139.
    • Perry, P. J. & Jenkins, T. C. (1999) Exp. Opin. Invest. Drugs 8, 1981-2008.
    • Voloshchuk, N., Hawkins, M., and Davenport, L. (2000) Biophysical J., 78, 30.
    • Voloshchuk, N., Hawkins, M., and Davenport, L. (2001) Biophysical J., 80, 294a.
  • As those skilled in the art will appreciate, numerous changes and modifications may be made to the preferred embodiments of the invention without departing from the spirit of the invention. It is intended that all such variations fall within the scope of the invention.

Claims (31)

What is claimed is:
1. A G-quadruplex analog polynucleotide comprising the structure:

(5′-(L 1)q(L 2)r(L 3)s(L 4)t(L 5)u(L 6)v)x
wherein:
each L1, L2, L3, L4, L5 and L6 is independently selected from the group consisting of a nucleotide, a nucleotide analog, and a nucleotide comprising a 6-methyl-isoxanthopterin nucleobase;
q, r, s, t, u and v are each independently 0, 1 or 2, provided that the sum of q+r+s+t+u+v is at least 3; and
x is 1 to 8;
provided that:
said sequence 5′-(L1)q(L2)r(L3)s(L4)t(L5)u(L6)v is an analog of a telomeric repeat sequence;
said polynucleotide contains at least one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase;
said G-quadruplex analog polynucleotide forms or is capable of forming a G-quadruplex structure;
each 6-methyl-isoxanthopterin nucleobase is located within said G-quadruplex structure;
the G1 position of said G-quadruplex analog comprises a 6-methyl-isoxanthopterin nucleobase; and
the 6-methyl-isoxanthopterin at said G1 position shows an increase or enhancement in fluorescence upon G-quadruplex formation.
2. The G-quadruplex analog polynucleotide of claim 1 wherein q, r, s, t, u and v are each 1.
3. The G-quadruplex analog polynucleotide of claim 1 wherein x is from 2 to 6.
4. The G-quadruplex analog polynucleotide of claim 3 wherein x is from 3 to 5.
5. The G-quadruplex analog polynucleotide of claim 3 wherein x is 4.
6. The G-quadruplex analog polynucleotide of claim 5 wherein said G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase.
7. The G-quadruplex analog polynucleotide of claim 6, wherein said polynucleotide comprises any of SEQ ID NOs: 2-8.
8. The G-quadruplex analog polynucleotide of claim 6, wherein said polknucleotide comprises any of SEQ ID NOs: 3-5.
9. The G-quadruplex analog polynucleotide of claim 6, wherein said polynucleotide comprises SEQ ID NO: 4.
10. An array comprising the compound of claim 1.
11. An array comprising the compound of claim 7.
12. An array comprising the compound of claim 9.
13. A method for identifying a candidate compound as a quadruplex-binding molecule comprising the steps of:
a. providing a G-quadruplex analog polynucleotide of claim 1;
b. contacting said G-quadruplex analog polynucleotide with said candidate compound; and
c. measuring a difference in a fluorescence property of said G-quadruplex analog upon binding of said compound to said analog;
wherein said difference in said fluorescence property is indicative of the compound binding to the G-quadruplex analog polynucleotide.
14. The method of claim 13, wherein the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises any of SEQ ID NOs: 2-8.
15. The method of claim 13, wherein the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises any of SEQ ID NOs: 3-5.
16. The method of claim 13, wherein the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises SEQ ID NO: 4.
17. The method of claim 13, wherein the difference in the fluorescence property is selected from difference in fluorescence intensity and spectral shift.
18. A method for identifying a candidate compound as a quadruplex-folding promoting agent, comprising the steps of:
a. providing a G-quadruplex analog polynucleotide of claim 1 in its unfolded state;
b. contacting said unfolded G-quadruplex analog polynucleotide with said candidate compound; and
c. measuring a difference in a fluorescence property of said G-quadruplex analog polynucleotide upon folding into said G-quadruplex conformation.
19. The method of claim 18, wherein the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises any of SEQ ID NOs: 2-8.
20. The method of claim 18, wherein the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises any of SEQ ID NOs: 3-5.
21. The method of claim 18, wherein the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises SEQ ID NO: 4.
22. The method of claim 18, wherein the difference in the fluorescence property is selected from difference in fluorescence intensity and spectral shift.
23. A method for identifying a candidate compound as a telomerase inhibitor comprising the steps of:
a. providing a G-quadruplex analog polynucleotide of claim 1;
b. contacting said G-quadruplex analog polynucleotide with said candidate compound;
c. measuring a difference in a fluorescence property of said G-quadruplex analog upon binding of said compound to said analog; and
d. assaying said compound for telomerase inhibitory activity.
24. The method of claim 23, wherein the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises any of SEQ ID NOs: 2-8.
25. The method of claim 23, wherein the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises any of SEQ ID NOs: 3-5.
26. The method of claim 23, wherein the G-quadruplex analog polynucleotide contains one nucleotide comprising a 6-methyl-isoxanthopterin nucleobase, and comprises SEQ ID NO: 4.
27. The method of claim 23, wherein the difference in the fluorescence property is selected from difference in fluorescence intensity and spectral shift.
28. The G-quadruplex analog polynucleotide of claim 1, wherein said G-quadruplex analog polynucleotide is in its unfolded state.
29. The G-quadruplex analog polynucleotide of claim 1, wherein said G-quadruplex analog polynucleotide is in its folded state.
30. The array of claim 10, wherein the G-quadruplex analog polynucleotides of the array are in their unfolded state.
31. The array of claim 10, wherein the G-quadruplex analog polynucleotides of the array are in their folded state.
US14/215,994 2013-03-15 2014-03-17 G-quadruplex binding assays and compounds therefor Abandoned US20140273278A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/215,994 US20140273278A1 (en) 2013-03-15 2014-03-17 G-quadruplex binding assays and compounds therefor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361792875P 2013-03-15 2013-03-15
US14/215,994 US20140273278A1 (en) 2013-03-15 2014-03-17 G-quadruplex binding assays and compounds therefor

Publications (1)

Publication Number Publication Date
US20140273278A1 true US20140273278A1 (en) 2014-09-18

Family

ID=51528874

Family Applications (1)

Application Number Title Priority Date Filing Date
US14/215,994 Abandoned US20140273278A1 (en) 2013-03-15 2014-03-17 G-quadruplex binding assays and compounds therefor

Country Status (1)

Country Link
US (1) US20140273278A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107315928A (en) * 2017-05-02 2017-11-03 同济大学 Label-free DNA molecular device based on tetra- serobilas of Ag NCs and G/NMM systems
CN113913432A (en) * 2021-10-08 2022-01-11 北京农学院 Tetracycline bivalent aptamer sequence and non-enzyme label-free detection method
CN114729359A (en) * 2019-10-30 2022-07-08 蛋白科技先锋公司 Programmed DNA driven self-assembling RNA hydrogels
CN116092575A (en) * 2023-02-03 2023-05-09 中国科学院地理科学与资源研究所 G DNA structure discrimination method based on GMNS rule
WO2024097936A3 (en) * 2022-11-03 2024-08-02 Northern Illinois Research Foundation Dna catalyst compositions and methods of detection using same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040152116A1 (en) * 2003-01-08 2004-08-05 Lesley Davenport G-quadruplex binding assays and compounds therefor

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040152116A1 (en) * 2003-01-08 2004-08-05 Lesley Davenport G-quadruplex binding assays and compounds therefor
US7781163B2 (en) * 2003-01-08 2010-08-24 Lesley Davenport G-quadruplex binding assays and compounds therefor
US20110251107A1 (en) * 2003-01-08 2011-10-13 Lesley Davenport G-quadruplex binding assays and compounds therefor

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107315928A (en) * 2017-05-02 2017-11-03 同济大学 Label-free DNA molecular device based on tetra- serobilas of Ag NCs and G/NMM systems
CN114729359A (en) * 2019-10-30 2022-07-08 蛋白科技先锋公司 Programmed DNA driven self-assembling RNA hydrogels
CN113913432A (en) * 2021-10-08 2022-01-11 北京农学院 Tetracycline bivalent aptamer sequence and non-enzyme label-free detection method
WO2024097936A3 (en) * 2022-11-03 2024-08-02 Northern Illinois Research Foundation Dna catalyst compositions and methods of detection using same
CN116092575A (en) * 2023-02-03 2023-05-09 中国科学院地理科学与资源研究所 G DNA structure discrimination method based on GMNS rule

Similar Documents

Publication Publication Date Title
US9598719B2 (en) G-quadruplex binding assays and compounds therefor
Hurley et al. G-quadruplexes as targets for drug design
US20140273278A1 (en) G-quadruplex binding assays and compounds therefor
De Cian et al. Fluorescence-based melting assays for studying quadruplex ligands
Yu et al. Beads-on-a-string structure of long telomeric DNAs under molecular crowding conditions
Tanpure et al. Fluorescent nucleoside analogs: probes for investigating nucleic acid structure and function
Wang et al. Cyclohexene nucleic acids (CeNA): serum stable oligonucleotides that activate RNase H and increase duplex stability with complementary RNA
Harrison et al. Trisubstituted acridine derivatives as potent and selective telomerase inhibitors
Gaied et al. 8-vinyl-deoxyadenosine, an alternative fluorescent nucleoside analog to 2′-deoxyribosyl-2-aminopurine with improved properties
Sandin et al. Fluorescent properties of DNA base analogue tC upon incorporation into DNA—negligible influence of neighbouring bases on fluorescence quantum yield
Micura et al. Methylation of the nucleobases in RNA oligonucleotides mediates duplex–hairpin conversion
Ma et al. Molecular modeling of drug–DNA interactions: virtual screening to structure-based design
CN1833034B (en) Probes, libraries and kits for analysis of mixtures of nucleic acids and methods for constructing the same
Dioubankova et al. Pyrenemethyl ara‐Uridine‐2′‐carbamate: A Strong Interstrand Excimer in the Major Groove of a DNA Duplex
Randazzo et al. NMR solution structure of a parallel LNA quadruplex
Rankin et al. C 8-Heteroaryl-2′-deoxyguanosine Adducts as Conformational Fluorescent Probes in the Nar I Recognition Sequence
Sproviero et al. Positional impact of fluorescently modified G-tetrads within polymorphic human telomeric G-quadruplex structures
Wahba et al. A single-label phenylpyrrolocytidine provides a molecular beacon-like response reporting HIV-1 RT RNase H activity
Astakhova et al. LNA for optimization of fluorescent oligonucleotide probes: improved spectral properties and target binding
Eason et al. Synthesis and characterization of 8-methoxy-2′-deoxyadenosine-containing oligonucleotides to probe the syn glycosidic conformation of 2′-deoxyadenosine within DNA
Suzuki et al. Synthesis of 8-aza-3, 7-dideaza-2′-deoxyadenosines possessing a new adenosine skeleton as an environmentally sensitive fluorescent nucleoside for monitoring the DNA minor groove
D’Ambrosio et al. Specific binding of telomeric G-quadruplexes by hydrosoluble perylene derivatives inhibits repeat addition processivity of human telomerase
Moorhouse et al. Targeting telomerase and telomeres: a click chemistry approach towards highly selective G-quadruplex ligands
Virgilio et al. The oxidative damage to the human telomere: effects of 5-hydroxymethyl-2′-deoxyuridine on telomeric G-quadruplex structures
Tanpure et al. Synthesis, Photophysical Properties and Incorporation of a Highly Emissive and Environment‐Sensitive Uridine Analogue Based on the Lucifer Chromophore

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION