US20140235505A1 - Rna array compositions and methods - Google Patents

Rna array compositions and methods Download PDF

Info

Publication number
US20140235505A1
US20140235505A1 US14/073,350 US201314073350A US2014235505A1 US 20140235505 A1 US20140235505 A1 US 20140235505A1 US 201314073350 A US201314073350 A US 201314073350A US 2014235505 A1 US2014235505 A1 US 2014235505A1
Authority
US
United States
Prior art keywords
rna
seq
array
template
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/073,350
Inventor
Lloyd Smith
Cheng-Hsien WU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wisconsin Alumni Research Foundation
Original Assignee
Wisconsin Alumni Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wisconsin Alumni Research Foundation filed Critical Wisconsin Alumni Research Foundation
Priority to US14/073,350 priority Critical patent/US20140235505A1/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: WISCONSIN ALUMNI RESEARCH FOUNDATION
Assigned to WISCONSIN ALUMNI RESEARCH FOUNDATION reassignment WISCONSIN ALUMNI RESEARCH FOUNDATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: WU, CHENG-HSIEN, SMITH, LLOYD
Publication of US20140235505A1 publication Critical patent/US20140235505A1/en
Priority to US15/834,138 priority patent/US11041151B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1068Template (nucleic acid) mediated chemical library synthesis, e.g. chemical and enzymatical DNA-templated organic molecule synthesis, libraries prepared by non ribosomal polypeptide synthesis [NRPS], DNA/RNA-polymerase mediated polypeptide synthesis
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J19/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J19/0046Sequential or parallel reactions, e.g. for the synthesis of polypeptides or polynucleotides; Apparatus and devices for combinatorial chemistry or for making molecular arrays
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00277Apparatus
    • B01J2219/00497Features relating to the solid phase supports
    • B01J2219/005Beads
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00277Apparatus
    • B01J2219/00497Features relating to the solid phase supports
    • B01J2219/00527Sheets
    • B01J2219/00529DNA chips
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00585Parallel processes
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00596Solid-phase processes
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00583Features relative to the processes being carried out
    • B01J2219/00603Making arrays on substantially continuous surfaces
    • B01J2219/00605Making arrays on substantially continuous surfaces the compounds being directly bound or immobilised to solid supports
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00709Type of synthesis
    • B01J2219/00711Light-directed synthesis
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01JCHEMICAL OR PHYSICAL PROCESSES, e.g. CATALYSIS OR COLLOID CHEMISTRY; THEIR RELEVANT APPARATUS
    • B01J2219/00Chemical, physical or physico-chemical processes in general; Their relevant apparatus
    • B01J2219/00274Sequential or parallel reactions; Apparatus and devices for combinatorial chemistry or for making arrays; Chemical library technology
    • B01J2219/00718Type of compounds synthesised
    • B01J2219/0072Organic compounds
    • B01J2219/00722Nucleotides
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/14Solid phase synthesis, i.e. wherein one or more library building blocks are bound to a solid support during library creation; Particular methods of cleavage from the solid support
    • C40B50/18Solid phase synthesis, i.e. wherein one or more library building blocks are bound to a solid support during library creation; Particular methods of cleavage from the solid support using a particular method of attachment to the solid support

Definitions

  • RNA arrays have been commercially available worldwide for more than a decade, but high density RNA microarrays do not exist yet due to the difficulty of equivalent high density RNA synthesis methods.
  • the development of RNA arrays, and especially high density RNA arrays would enable a number important new applications including, for example, fabrication of RNA aptamer arrays; identification of RNA sequences that produce fluorescence from non-fluorescent small molecules; identification and characterization of novel ribozymes and RNA-binding proteins.
  • RNA arrays and methods for generating them.
  • RNA and template array compositions and methods for generating such compositions are based on the finding that DNA arrays can serve as a template for RNA-polymerase-based synthesis of complementary RNA arrays.
  • RNA array comprising RNAs that are covalently linked at their 5′ ends to a solid support.
  • the covalently linked RNAs represent at least 10 unique RNA sequences and have a feature density of at least 20 features/cm 2 .
  • the RNAs comprise at least about 20 unique RNA sequences. In other embodiments the RNAs represent at least about 50 unique RNA sequences.
  • the length of the at least ten unique RNA sequences is about 20 bases to about 50 bases. In some embodiments the density of single-stranded RNAs in the RNA array is about 200 features/cm 2 .
  • the RNAs in the RNA array comprise modified ribonucleotides.
  • the modified ribonucleotides are RNase resistant (e.g., 2′-fluoro ribonucleotides or 2′-methoxyribonucleotides).
  • a template array comprising: (i) an array of single-stranded template DNA oligonucleotides linked at their 3′ ends to a solid support, comprising a consensus sequence, and capped by a protecting group at their 5′ ends; and (ii) single-stranded RNA primers that are covalently linked at their 5′ ends to the solid support, and that are complementary to the consensus sequence, wherein the single-stranded RNA primers hybridize to the single-stranded template DNA oligonucleotides.
  • the single-stranded RNA primers have a length of about 4 bases to about 20 bases. In one embodiment, the single-stranded RNA primers have a length of about 13 bases.
  • the single-stranded template DNA oligonucleotides or single-stranded RNA primers are covalently linked to the solid support through a polyethylene glycol spacer.
  • the protecting group to be added to the 5′ end of the single-stranded template DNA oligonucleotides is an acetyl group or a phenoxyacetyl group.
  • a kit in some embodiments includes the above-mentioned template array and any of (i) an RNA polymerase; (ii) ribonucleoside triphosphates; and (iii) a DNase.
  • the ribonucleoside triphosphates to be included in the kit are modified ribonucleoside triphosphates.
  • the included modified ribonucleoside triphosphates are modified ribonucleosides (e.g., 2′-fluoro ribonucleosides, 2′-methoxy ribonucleosides, 2′-amino ribonucleosides, 5-bromouridine-5′-triphosphate, 4-thiouridine-5′-triphosphate, 6-thioguanosine-5′-triphosphate).
  • modified ribonucleosides e.g., 2′-fluoro ribonucleosides, 2′-methoxy ribonucleosides, 2′-amino ribonucleosides, 5-bromouridine-5′-triphosphate, 4-thiouridine-5′-triphosphate, 6-thioguanosine-5′-triphosphate.
  • a method for generating a template array which includes the steps of: (i) providing a solid support comprising a layer of protected deoxyribonucleosides that comprise a 5′-photolabile protecting group and are covalently linked at their 3′ end to a spacer layer bound to the solid support; (ii) irradiating the layer of protected deoxyribonucleosides with ultraviolet energy sufficient to deprotect about half of the protected deoxyribonucleosides; (iii) coupling the deprotected deoxyribonucleosides with a ribonucleoside phosphoramidite comprising a 5′ acid-labile protecting group; (iv) irradiating the remaining protected deoxyribonucleosides with ultraviolet irradiation sufficient to deprotect all of the remaining protected deoxyribonucleoside phosphoramidites; (v) extending the deprotected deoxyribonucleosides, at one or more locations
  • RNA primers comprising a sequence that is complementary to a sequence at the 3′ end of the template DNA strands to obtain a template array.
  • the 5′ acid-labile protecting group in step (iii) includes a 4,4′-dimethoxytrityl (DMT) group.
  • DMT 4,4′-dimethoxytrityl
  • the protecting group coupled to the 5′-ends of the template DNA strands in step (vi) is a phenoxyacetyl group or an acetyl group.
  • RNase-resistant modified ribonucleoside phosphoramidites are used in the extension of the deprotected ribonucleosides to obtain RNase-resistant RNA primers in step (viii).
  • the RNase-resistant modified ribonucleoside phosphoramidites are 2′-fluoro ribonucleoside phosphoramidites or 2′-methoxy ribonucleoside phosphoramidites.
  • RNA array comprising the steps of (i) providing a template array of (a) single-stranded template DNAs linked at their 3′ ends to a solid support and comprising a consensus sequence; and (b) single-stranded RNA primers that are covalently linked at their 5′ ends to the solid support, and that are complementary to the consensus sequence of the single-stranded template DNAs; (ii) hybridizing the single-stranded RNA primers with the single-stranded template DNAs; (iii) extending the hybridized RNA primers along the single-stranded template DNAs using an RNA polymerase and ribonucleoside triphosphates to obtain double-stranded DNA-RNA hybrids; and (iv) exposing the DNA-RNA hybrids to a DNase enzyme to remove the template DNAs from the DNA-RNA hybrids to obtain an RNA array.
  • RNA polymerase in step (iii) is T7 RNA polymerase or T3 RNA polymerase.
  • the ribonucleoside triphosphates used in step (iii) are modified ribonucleoside triphosphates.
  • the modified ribonucleoside triphosphates are RNase-resistant modified ribonucleoside triphosphates.
  • the RNase-resistant modified ribonucleoside triphosphates to be used are 2′-fluoro ribonucleoside triphosphates or 2′-methoxy ribonucleoside triphosphates.
  • the method can also include a step of synthesizing the single-stranded RNA primers in the array prior to step (i).
  • the single-stranded template DNAs represent at least 20 unique sequences. In other embodiments the single-stranded template DNAs represent at least 50 unique sequences.
  • RNA bead pool comprising: (i) providing beads comprising 5′-linked RNA primers comprising a consensus sequence; (ii) hybridizing the 5′-linked RNA primers with DNA oligonucleotides comprising a unique template sequence and a sequence complementary to the consensus sequence, wherein the DNA oligonucleotides are provided in solution; (iii) extending the hybridized RNA primers along the single-stranded template DNAs using an RNA polymerase and ribonucleoside triphosphates to obtain double-stranded DNA-RNA hybrids; and contacting the DNA-RNA hybrids with a DNase to remove the template DNAs from the DNA-RNA hybrids to obtain an RNA bead pool.
  • FIG. 1 shows a schematic overview of an exemplary embodiment of an RNA array synthesis method starting from a solid support coated with a PEG 2000 spacer layer linked to photolabile NPPOC-protected, deoxyribonucleosides at their 3′ end.
  • UV light irradiation is controlled so as to deprotect about half of the 3′-linked deoxyribonucleosides.
  • the deprotected deoxyribonucleosides are then coupled to an acid-labile DMT-protected ribonucleoside phosphoramidite. UV light irradiation is then used to deprotect the remaining NPPOC-protected deoxyribonucleosides.
  • photolithographic 3′ to 5′ synthesis is used to generate an array of template DNA oligonucleotides, comprising an initial consensus sequence of approximately 12 bases that is common to most or all positions and a downstream sequence that is unique for each position or subsets of positions in the array.
  • template DNA oligonucleotide synthesis is completed, the DNA oligonucleotides are capped by acetylation at their 5′ ends.
  • the DMT-protected ribonucleoside phosphoramidites are then deprotected by acid treatment.
  • RNA polymerase synthesis with 2-methoxy ribonucleoside phosphoramidites, is then used to generate a 5′-linked RNA primer comprising a sequence that is complementary to the template DNA consensus sequence mentioned above.
  • Hybridization of the synthesized RNA primers with the consensus sequence in the template DNA oligonucleotides is then used to generate a cRNA copy of each unique template DNA oligonucleotide sequence using T7 RNA polymerase or in some cases, T3 RNA polymerase, in the presence of ribonucleoside triphosphates, or in some cases, RNase-resistant ribonucleoside triphosphates.
  • T7 RNA polymerase or in some cases, T3 RNA polymerase, in the presence of ribonucleoside triphosphates, or in some cases, RNase-resistant ribonucleoside triphosphates.
  • FIG. 2 (A) shows a schematic illustration of how 5′-fluorescent labeled IGFBP1 DNA probe amplicons are generated to test an RNA array.
  • IGFBP1 amplicons After generation of IGFBP1 amplicons, these double-stranded products were partially digested with T7 exonuclease to yield double-stranded products with single-stranded overhangs capable of hybridizing with RNAs present in the RNA array.
  • the ability of the fluorescently labeled, exonuclease-digested probe to hybridize with RNAs on the array depends on the amount of sequence overlap between the single-stranded probe overhang and the RNA in question.
  • (B) Shows an RNA array fluorescent hybridization signal consistent with the 5′ to 3′ tiled pattern of the RNAs in the array, where stronger hybridization signal indicates more complementary overlap with the single-stranded overhang in the DNA probe, and less or no signal where less or no overlap occurred.
  • FIG. 3 Top panels are images of fluorescent DNA probes hybridized to an RNA array enzymatically synthesized using unmodified ribonucleosides (top left panel), and the same type of RNA array after RNase A treatment (top right panel), which resulted in complete degradation of the RNA array as indicated by the total loss of hybridization signal.
  • bottom panels are images of 2′-fluoro RNA arrays that were enzymatically synthesized using a 2′-fluorine-modified nucleoside triphosphate mix (left bottom panel) and the same type of RNA array and 2′-fluoro RNA array after RNase A treatment (bottom right panel), which shows only a partial loss of hybridization signal indicating that 2′-fluoro RNA arrays are relatively resistant to RNase.
  • FIG. 4 shows a fluorescence image of a patterned array of DNAs, RNAs, and modified RNAs after various treatment conditions and hybridization to complementary probe sequences labeled with distinct fluorophores.
  • the dimensions of the “Badger Chemist” array are about 6 mm ⁇ 5 mm, which consists of the “body”, the “sweater/flask” and the “lab coat” sequences (Table 3).
  • the natural RNA and 2′-fluoro RNA array were treated with DNase I and RNase A, sequentially, while the DNA array was treated with RNase A and then DNase I.
  • the arrays were visualized by hybridization with their DNA complements labeled with FAM (sweater/flask), Texas Red (body), and Cy5 (lab coat).
  • FIG. 5 shows a fluorescence image of a patterned array of DNAs, RNAs, and modified RNAs before and after DNase treatment, and followed by hybridization to complementary probe sequences labeled with distinct fluorophores.
  • A The schematic diagram of 10-23 DNAZyme cleavage test on RNA array.
  • B The dimensions of “Badger Chemist” array are about 6 mm ⁇ 5 mm, which consists of the “body,” the “sweater/flask” and the “lab coat” sequences (Table 3).
  • the arrays were visualized by hybridization with the three corresponding oligodeoxynucleotide complements, tagged respectively with the fluorophores fluorescein (sweater/flask), Texas Red (body), and Cy 5 (lab coat).
  • the “lab coat” sequences were intact on the DNA array, whereas 70% were cleaved on the natural RNA array and 55% were cleaved on the 2′-fluoro RNA array. It is noted there were fewer cleavage events on the 2′-fluoro RNA array than on the natural RNA array.
  • FIG. 6 shows a fluorescence image of a 24-2-min RNA aptamer array.
  • the array was incubated with the chromophore 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI) (24-2), which fluoresces upon binding to the RNA aptamer sequence. After incubation with DFHBI, the array was visualized using a GeneTac UC 4 ⁇ 4 microarray scanner with a 488 nm blue excitation laser and a 512 nm emission filter.
  • DFHBI 3,5-difluoro-4-hydroxybenzylidene imidazolinone
  • RNA array compositions and methods for generating such compositions are based on the finding that DNA arrays, e.g., high density DNA arrays can serve as templates for RNA-polymerase-based synthesis of a complementary RNA array.
  • RNA arrays can be envisioned, including, but not limited to, deciphering the binding specificities of RNA-binding proteins, as a tool to aid in the engineering of sequence-specific RNA-binding proteins, for screening and characterizing RNA-based therapeutics, for fabricating tiling arrays of RNA viral genomes, for fabricating miRNA arrays, engineering ribozyme arrays, discovering new ribozymes, studying ribozyme function, engineering artificial siRNAs and miRNAs, fabricating mRNA tiling arrays, and searching for miRNA “sponges” (molecules that bind to and inactivate miRNAs).
  • RNase-resistant refers to a modified RNA having reduction in susceptibility to RNase degradation or the ability of a modified ribonucleoside to confer a reduction in susceptibility of an RNA to RNase degradation by at least 10%.
  • generating a template array starts from a solid support material such as amorphous carbon, glassy carbon, polymer or silanized glass that is coated with a layer of spacer material (e.g., PEG 2000 or PEG 4500) covalently linked to deoxyribonucleoside phosphoramidites (“bridging moieties”) protected by a photolabile protecting group, e.g., 3′-nitrophenylpropyloxycarbonyl (NPPOC).
  • the solid support material is provided in the form of silica beads in the size range of 1 to 10 microns.
  • the NPPOC-protected spacer layer is then irradiated with a suitable amount of deprotecting dose of UV light (e.g., 0.5 joule on amorphous carbon on gold, 0.75 joule on glassy carbon at about 365 nm in the working examples provided herein) to remove about half of the NPPOC protecting groups on the spacer layer, which deprotects hydroxyl groups on half of the deoxyribonucleosides covalently linked to the spacer layer.
  • the deoxyribonucleosides with deprotected, free hydroxyl groups are then coupled with an acid-labile protecting group such as 4,4′-dimethoxytrityl (DMT)-protected ribonucleoside phosphoramidites.
  • a suitable amount of deprotecting dose of UV light e.g., 0.5 joule on amorphous carbon on gold, 0.75 joule on glassy carbon at about 365 nm in the working examples provided herein
  • the initial 8 to about 15 deoxynucleotides (e.g., 9, 10, 11, 12, 13, or 14 deoxynucleotides) attained by photolithographic DNA synthesis encompass a “consensus” sequence that is common to the single-stranded template DNAs to be synthesized.
  • the consensus sequence is 3′-CCTGTGCCGCTT-5 (SEQ ID NO:1).
  • RNA primer complementary consensus sequence After photolithographic synthesis of the template DNA strands, these are protected “capped” by a phenoxyacetyl group or an acetyl group at the 5′ end to block undesired further synthesis. Finally, the acid-labile DMT protecting groups on the 5′-linked, protected ribonucleoside phosphoramidites are removed by acid treatment (e.g., with 2% trichloroacetic acid or 3% dichloroacetic acid in dichloromethane) to expose 3′ hydroxyl groups of the 5′-linked ribonucleosides for chemical synthesis of an RNA primer complementary consensus sequence.
  • the template array can be used to generate an RNA array, as described below.
  • the spacer layer, deoxyribonucleoside or ribonucleoside is protected with an acid-labile protecting group, such as 4,4′-DMT rather than a photolabile protecting group.
  • an acid-labile protecting group such as 4,4′-DMT rather than a photolabile protecting group.
  • partial deprotection of the layer is achieved by treatment with a dilute solution of dichloro- or trichloroacetic acid, reduced exposure time to the acid, or both (e.g., with 2% trichloroacetic acid or 3% dichloroacetic acid in dichloromethane for 50 seconds or more).
  • the deoxyribonucleosides with deprotected, free hydroxyl groups are then coupled with a photolabile protecting group such as NPPOC.
  • a higher concentration of the deprotecting acid is used to remove all of the remaining acid-labile protecting groups from the spacer layer, which allows the light-directed 3′ to 5′ photolithographic synthesis of DNA arrays starting from the newly deprotected deoxyribonucleoside phosphoramidites.
  • photolithographic synthesis of the template DNA strands these are protected “capped” by a phenoxyacetyl group or an acetyl group at the 5′ end to block undesired further synthesis.
  • the photolabile NPPOC protecting groups on the 5′-linked, protected ribonucleoside phosphoramidites are removed by irradiation with UV light to expose 3′ hydroxyl groups of the 5′-linked ribonucleosides for chemical synthesis of an RNA primer complementary consensus sequence.
  • the length of the template DNA strands ranges from about 20 bases to about 80 bases, e.g., about 25 bases, 27 bases, 28 bases, 29 bases, 35 bases, 40 bases, 60 bases, 70 bases, or another length from about 20 bases to about 80 bases.
  • the template DNA strands to be synthesized can be synthesized to obtain a range of template DNA strand densities ranging from about 20 to about 1,000,000 features/cm 2 , e.g., about 25, 30, 40, 50, 60, 65, 70, 75, 80, 100, 120, 150, 200, 300, 500, 750, 1,000, 2,000, 2,500, 3,000, 3,500, 3,750, 4,200, 4,500, 5,000, 6,000, 6,500, 7,000, 7,500, 8,000, 9,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another feature density from about 20 features/cm 2 to about 1,000,000 features/cm 2 .
  • the template DNA strands to be synthesized represent at least 20 unique sequences to about 1,000,000 unique sequences, e.g., 30, 50, 100, 130, 145, 148, 150, 155, 160, 200, 500, 1,000, 1,500, 2,000, 3,000, 5,000, 10,000, 15,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another number of unique sequences.
  • the template DNA oligonucleotide sequences comprise a series of subsequences that are shifted relative to each other by a single terminal nucleotide, where the template DNA oligonucleotide sequences, in aggregate, cover a longer contiguous sequence, e.g., a genomic DNA sequence, a cDNA sequence, a vector sequence etc.
  • the template DNA oligonucleotides are synthesized in a tiling pattern that covers a source sequence, e.g., a genomic promoter sequence, in order in the 5′ to 3′ direction.
  • the RNA primer sequences generated in the template array are approximately the same size as the template consensus sequence in the range of about 4 ribonucleotides to about 20 ribonucleotides, e.g., about 5 ribonucleotides, 6 ribonucleotides, 7 ribonucleotides, 8 ribonucleotides, 9 ribonucleotides, 10 ribonucleotides, 11 ribonucleotides, 12 ribonucleotides, 13 ribonucleotides, 14 ribonucleotides, 16 ribonucleotides, 18 ribonucleotides, 18 ribonucleotides, or another length from about 4 ribonucleotides to about 20 ribonucleotides.
  • the RNA primer sequence comprises the complementary consensus sequence: 5′-GGACACGGCGAA-3′ (SEQ ID NO:2).
  • the ribonucleoside phosphoramidites used to extend the 5′-linked ribonucleosides are RNase-resistant modified ribonucleosides.
  • RNase-resistant modified ribonucleosides include, but are not limited to, 2-fluoro ribonucleosides, 2-amino ribonucleosides and 2-methoxy ribonucleosides.
  • RNA arrays including high density RNA arrays
  • a method to generate an RNA array starts from a template array, which comprises an array of: (a) single-stranded template DNAs linked at their 3′ ends to a solid support and comprising a consensus sequence; and (b) single-stranded RNA primers that are covalently linked at their 5′ ends to the solid support, and that are complementary to the consensus sequence of the single-stranded template DNAs.
  • the template RNA array is then incubated under hybridization conditions permissive for the 5′-covalently linked single-stranded RNA primers to hybridize with the complementary consensus sequence of the 3′-covalently linked single-stranded template DNAs.
  • RNA primers are then extended 5′ to 3′ along the single-stranded template DNAs using an RNA polymerase and ribonucleoside triphosphates to obtain double-stranded DNA-RNA hybrids.
  • DNase treatment is used to eliminate template oligonucleotides within the DNA-RNA hybrids and unhybridized template DNA oligonucleotides, thereby yielding an RNA array.
  • RNA primers having a consensus sequence
  • RNA primers are synthesized on a spacer layer first, to obtain a layer of 5′-linked RNA primers bound to a solid support surface.
  • template DNA oligonucleotides comprising a consensus sequence at the 3′ end, and a unique sequence at a 5′ position relative to the consensus sequence, are added, in solution, to the 5′-linked RNA primer layer and hybridized.
  • the hybridized RNA primers are then extended by an RNA polymerase to generate cRNA copies of the template DNA oligonucleotides.
  • the DNA oligonucleotides are then removed by DNase digestion to obtain a cRNA array.
  • the unique cRNA sequence at each position is then “decoded” by sequential hybridization decoding as described in, e.g., Gunderson et al (2004), Genome Research, 14:870-877.
  • RNA primers are 5′-linked primers on the surface of beads and comprising a consensus sequence.
  • a pool of template DNA oligonucleotides comprising a sequence complementary to the consensus sequence in the bead-bound primers and a unique sequence are then hybridized with the bead-bound RNA primers.
  • an RNA polymerase is used to extend the hybridized bead-bound RNA primers to make bead-bound cRNAs of the template DNA oligonucleotides.
  • the DNA is then removed to obtain a pool of bead-bound cRNAs (an “RNA bead pool”).
  • RNA bead pools can be combined to obtain an RNA bead array, where each RNA bead pool within the array represents a unique RNA sequence.
  • the RNA polymerase used to extend the RNA primer is a T7 RNA polymerase or a T3 RNA polymerase. In one embodiment, the RNA polymerase to be used is T7 RNA polymerase.
  • the ribonucleoside triphosphates to be used are modified ribonucleoside triphosphates. In one embodiment, the modified ribonucleoside triphosphates to be used in the method are RNase-resistant modified ribonucleoside triphosphates. Examples of suitable RNase-resistant modified ribonucleoside triphosphates include, but are not limited to, 2′-fluoro ribonucleosides and 2′-methoxy ribonucleosides.
  • the modified ribonucleoside triphosphates are fluorescent modified ribonucleoside triphosphates.
  • modified ribonucleosides can be substituted for 1, 2, 3, or all four of the possible ribonucleoside types (A, U, G, C).
  • both modified and unmodified ribonucleosides are used for RNA synthesis with an RNA polymerase.
  • the proportion of modified ribonucleotide used during RNA-polymerase-mediated RNA synthesis can range from 0 to 100%, e.g., from 5%, 10%, 20%, 30%, 50%, 60%, 70%, 90%, or another proportion of ribonucleosides to be used for RNA synthesis with an RNA polymerase.
  • RNA arrays including high density RNA arrays
  • array templates Described herein are RNA arrays (including high density RNA arrays) and array templates.
  • the RNA arrays described herein comprise RNAs linked at their 5′ ends to a solid support.
  • the RNAs included in the high density array represent at least 20 unique RNA sequences and have a density of at least about 20 features/cm 2 .
  • the RNAs are covalently linked at their 5′ ends to the solid support, indirectly, through a bridging moiety and a spacer covalently bound to the surface of the solid support.
  • the spacer can be a polyethylene glycol with a molecular weight of about 2000 daltons (PEG 2000) or 4500 daltons (PEG 4500).
  • the bridging moiety in some embodiments is a photolabile or acid-labile protected deoxynucleoside phosphoramidite covalently linked to a 3′ hydroxyl group of the spacer.
  • the 5′ ends of the RNAs in the high density RNA array encompass a sequence of about 8 to about 15 ribonucleotides (e.g., 9, 10, 12, 14 or another number of ribonucleotides from about 8 to about 15 ribonucleotides), which are termed an “RNA primer complementary consensus sequence,” herein.
  • the RNA primer complementary consensus sequence comprises one or more 2′-methoxy ribonucleoside triphosphates, which are introduced during photolithographic synthesis of the RNA primer consensus sequence.
  • the RNAs covalently linked to the solid support comprise one or more modified ribonucleotides.
  • the modified ribonucleotides confer resistance to ribonuclease.
  • modified ribonucleotides that confer resistance to ribonucleases include, but are not limited to, 2′-methoxy ribonucleoside triphosphates, 2′-fluoro ribonucleoside triphosphates, 2′-amino ribonucleosides, 5-bromouridine-5′-triphosphates, 4-thiouridine-5′-triphosphates and 6-thioguanosine-5′-triphosphates.
  • modified nucleotides include fluorescently modified ribonucleoside triphosphates (e.g., Cy5-ribonucleoside triphosphates) or hapten-modified ribonucleoside triphosphates (e.g., biotin-, or aminoallyl-modified ribonucleoside triphosphates) as known and used in the art.
  • fluorescently modified ribonucleoside triphosphates e.g., Cy5-ribonucleoside triphosphates
  • hapten-modified ribonucleoside triphosphates e.g., biotin-, or aminoallyl-modified ribonucleoside triphosphates
  • 100% of the constituent ribonucleotides in the RNAs of the high density RNA arrays are modified ribonucleotides.
  • the proportion of modified ribonucleotides in the RNAs ranges from about 5% to about 95% of the ribonucleotides in the array RNAs, e.g., about 7%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 75%, or another proportion of the modified ribonucleotides ranging from about 5% to about 95% of the ribonucleotides.
  • modified ribonucleotides are included in the array RNAs, 1, 2, 3, or all 4 of the ribonucleotides (i.e., A, U, G, or C) may include modified ribonucleotides.
  • the RNA arrays disclosed herein will represent at least 20 unique RNA sequences to about 1,000,000 unique RNA sequences, e.g., 30, 50, 100, 130, 145, 148, 150, 155, 160, 200, 500, 1,000, 1,500, 2,000, 3,000, 5,000, 10,000, 15,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another number of unique RNA sequences from at least 20 unique RNA sequences to about 1,000,000 unique RNA sequences.
  • the number of unique RNA sequences is about 50 to about 1,000 unique RNA sequences.
  • the number of unique RNA sequences is about 10 to about 200 unique RNA sequences.
  • the number of unique RNA sequences is about 100,000 sequences.
  • the length of the RNAs included in the disclosed RNA arrays ranges from at least about 20 ribonucleotides to about 80 ribonucleotides, e.g., about 25 ribonucleotides, 27 ribonucleotides, 28 ribonucleotides, 29 ribonucleotides, 35 ribonucleotides, 40 ribonucleotides, 60 ribonucleotides, 70 ribonucleotides, or another length from about 20 ribonucleotides to about 80 ribonucleotides.
  • the RNA arrays provided herein comprise a feature density of about 20 features/cm 2 to about 1,000,000 features/cm 2 , e.g., about 25, 30, 40, 50, 60, 65, 70, 75, 80, 100, 120, 150, 200, 300, 500, 750, 1,000, 2,000, 2,500, 3,000, 3,500, 3,750, 4,200, 4,500, 5,000, 6,000, 6,500, 7,000, 7,500, 8,000, 9,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another feature density from about 20 features/cm 2 to about 1,000,000 features/cm 2 .
  • the disclosed RNA arrays have a feature density of about 50,000 features/cm 2 to about 1,000,000 features/cm 2 .
  • Suitable solid support materials for RNA arrays include, but are not limited to, amorphous carbon, glassy carbon, and polymer or silanized glass. In some embodiments the solid support material used for RNA arrays is amorphous carbon.
  • a template array comprises an array of (i) single-stranded template oligonucleotides linked at their 3′ end to a solid support, comprising a consensus sequence, and capped by a protecting group (e.g., an phenoxyacetyl group) group at their 5′ end; and (ii) single-stranded RNA primers that are covalently linked at their 5′ end to the solid support, and that are complementary to the consensus sequence, wherein the single-stranded RNA primers hybridize to the single-stranded template DNAs.
  • a protecting group e.g., an phenoxyacetyl group
  • the 5′ ends of the RNAs in the template array encompass a sequence of about 4 to about 20 ribonucleotides (e.g., 5, 6, 8, 9, 10, 12, 14, 16, 17, 18, or another number of ribonucleotides from about 4 to about 20 ribonucleotides), which are termed an “RNA primer complementary consensus sequence,” herein.
  • the RNA primer complementary consensus sequence comprises one or more modified ribonucleotides (e.g., RNase-resistant ribonucleotides such as 2′-methoxy ribonucleotides or 2′-fluoro ribonucleotides), or mixtures of unmodified and modified ribonucleotides, which are introduced during synthesis of the RNA primer consensus sequence.
  • modified ribonucleotides e.g., RNase-resistant ribonucleotides such as 2′-methoxy ribonucleotides or 2′-fluoro ribonucleotides
  • mixtures of unmodified and modified ribonucleotides which are introduced during synthesis of the RNA primer consensus sequence.
  • single-stranded template DNA oligonucleotides and single-stranded RNA primers are linked at their 3′ and 5′ ends, respectively, to a bridging moiety (e.g., a deoxynucleotide), which in turn is linked to a spacer such as PEG 2000 or PEG 4500.
  • the spacer provides a means of linking the single-stranded template DNA oligonucleotides and RNA primers to a solid support for the template array.
  • Suitable solid support materials for template arrays include any materials compatible with RNA arrays, as described herein.
  • the template arrays provided herein comprise a feature density of about 20 features/cm 2 to about 1,000,000 features cm 2 , e.g., about 25, 30, 40, 50, 60, 65, 70, 75, 80, 100, 120, 150, 200, 300, 500, 750, 1,000, 2,000, 2,500, 3,000, 3,500, 3,750, 4,200, 4,500, 5,000, 6,000, 6,500, 7,000, 7,500, 8,000, 9,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another feature density from about 20 features/cm 2 to about 1,000,000 features/cm 2 .
  • the disclosed RNA arrays have a feature density of about 5,000 features/cm 2 to about 1,000,000 features/cm 2 .
  • template DNAs and RNA primers in the above-mentioned are in situ synthesized, in a base-by-base manner, using maskless array synthesizer (MAS) technology, as described in, e.g., Phillips et al (2008), Nucleic Acids Res, 36(1).
  • MAS maskless array synthesizer
  • kits that include a template array as described herein and any of (i) an RNA polymerase; (ii) ribonucleoside triphosphates; and (iii) a DNase.
  • the kit contains a template array and ribonucleoside triphosphates.
  • the ribonucleoside triphosphates included in the kit are modified ribonucleoside triphosphates that are RNase-resistant.
  • modified RNase-resistant nucleotides include, but are not limited, to 2′-methoxy ribonucleoside triphosphates, 2′-fluororibonucleoside triphosphates, 2′-amino ribonucleosides, 5-bromouridine-5′-triphosphates, 4-thiouridine-5′-triphosphates, and 6-thioguanosine-5′-triphosphates.
  • the template array kit includes a template array and an RNA polymerase suitable for catalyzing primer-dependent biosynthesis of RNA using a DNA template. Examples of suitable RNA polymerases include, but are not limited to T7 RNA polymerase and T3 RNA polymerase.
  • the template array kit contains a template array and a DNase, e.g., DNase I, T7 exonuclease, or Rec J exonuclease.
  • kits disclosed herein comprise a template array, an RNA polymerase, ribonucleoside triphosphates, and a DNase.
  • any of the above-mentioned kits will also include instructions for generating an RNA array from the included template array using an RNA polymerase, ribonucleoside triphosphates, and a DNase according to the methods disclosed herein.
  • IGFPBP1 Mouse Insulin-Like Growth Factor Binding Protein-1
  • FIG. 1A depicts the process of fabricating a high density DNA template array to be employed for enzymatic synthesis of a high density RNA array.
  • light-directed photolithographic synthesis of DNA arrays is performed on a carbon surface that is functionalized with hydroxyl groups.
  • a quarter of the full deprotecting dose of UV light (365 nm) is used to remove half of the photolabile protecting groups (3′-nitrophenylpropyloxycarbonyl, NPPOC) on the first layer of deoxyribonucleosides, which is covalently coupled to polyethylene glycol 2000 spacers on the carbon surface.
  • deoxyribonucleosides with free hydroxyl groups are then coupled with acid-labile DMT (4,4′-dimethoxytrityl) protected ribonucleoside phosphoramidites.
  • a full dose of UV light is used to remove all of the photolabile protecting groups on the first layer and enables the light-directed photolithographic synthesis of DNA arrays using the method described in Wu et al supra.
  • the 5′ ends of DNA oligonucleotides on the surface are then capped by acetylation to block undesired synthesis from the termini.
  • Each element of the DNA arrays includes a consensus DNA sequence at the 3′ end, which later serves as a complement to the 2′-methoxy RNA primer.
  • the acid-labile DMT protecting groups on the first layer are removed with dichloroacetic acid to reveal 3′ hydroxyl groups of the ribonucleosides for the chemical synthesis of 2′-methoxy RNA primer, that includes the consensus sequence, in the 5′ to 3′ direction, which is then extended enzymatically by T7 RNA polymerase in a subsequent step.
  • FIG. 1B lays out the process of enzymatic synthesis of a high density RNA array.
  • the oligonucleotide array was denatured and reannealed for RNA extension by T7 or T3 RNA polymerase).
  • Either unmodified or fluorinated ribonucleoside triphosphates can be used for the synthesis of unmodified or 2′-fluorine-modified RNA oligonucleotides for better resistance to RNase.
  • DNA endonuclease e.g., DNase I, is then used to remove the DNA template from the array to yield the final high density RNA array.
  • RNA tiling array was fabricated to characterize the products of a T7 exonuclease (a 5′ dsDNA exonuclease) digestion reaction.
  • the RNA tiling array allowed us to optimize the generation of single-stranded DNA for sequence-specific capture on the RNA array.
  • the DNA fragment corresponding to positions ⁇ 205 to ⁇ 25 of the mouse IGFBP1 promoter was amplified by PCR from NIH 3T3 (mouse embryonic fibroblast cell line) genomic DNA (purchased from New England Biolabs, MA, USA):
  • the primer sequences used to amplify the IGFBP1 promoter amplicon are: 5′-TTA GCT CCT GTC CCA GTC CAT-3′ (SEQ ID NO:4) and 5′-TAT GAA GGG CTG GCT GTG C-3′ (SEQ ID NO:5).
  • a 5′ phosphorothioate protected oligonucleotide with 6-carboxyfluorescein (FAM) tag (5′-T*/iFluorT/A GCT CCT GTC CCA GTC CAT-3′) (SEQ ID NO:6) was used to produce a 180 bp fluorescently tagged IGFBP1 promoter DNA amplicon
  • a DNA template array was generated by first synthesizing a template consensus sequence (5′-TTCGCCGTGTCC-3′) (SEQ ID NO:1) in array format.
  • the template consensus sequence which is complementary to an RNA primer consensus sequence, was synthesized from 3′ to 5′ at all positions on the array prior to the synthesis of the sequences in Table 1 at various positions from 3′ to 5′ using 5′-NPPOC-protected deoxyribonucleoside phosphoramidites. Afterwards, the position-specific sequences were also synthesized 3′ to 5′.
  • RNA polymerase extension reaction The sequences listed in Table 1 served as the DNA templates for an RNA polymerase extension reaction to produce the RNA array that could be used to capture IGFBP1 promoter DNA.
  • DNA quality control probe 1 (DNA QC1) is the complementary sequence to the fluorescently labeled ssDNA called “ApoE” for quality control purposes.
  • DNA quality probe 2 (DNA QC2) is the complementary sequence to the fluorescently labeled ssDNA called “w1282” for quality control purposes.
  • DNA quality probe 3 (DNA QC3) is the same probe sequence as the fluorescently labeled ssDNA called “ApoE” for quality control purposes.
  • DNA quality probe 4 (DNA QC4) is the same probe sequence as the fluorescently labeled ssDNA called “w1282” for quality control purposes.
  • the fluorescently labeled “ApoE” ssDNA is capturable to QC1 but not QC3 in the template array.
  • the fluorescently labeled “w1282” ssDNA is capturable to QC2 but not QC4 in the “template DNA array.
  • RNA primer consensus sequence (5′-GGACACGGCGAA-3′) (SEQ ID NO:2) was synthesized in close proximity to positions occupied by the previously synthesized DNA template sequences.
  • the RNA primer consensus sequence was synthesized from 5′ to 3′ using 3′-O-DMT-protected 2′-OMe-ribonucleoside phosphoramidites at multiple locations within the array.
  • the newly synthesized RNA primers then hybridized to the DNA template consensus sequence, and served to prime RNA synthesis with T7 RNA polymerase and a DNA sequence template, as shown in FIG. 1 .
  • DNA endonuclease e.g., DNase I, was then used to remove the DNA template from the array to yield the final high density RNA array.
  • the RNA sequences synthesized in array format are shown in Table 2.
  • RNA quality control probe 1 is the same probe sequence as the fluorescently labeled ssDNA called “ApoE” for quality control purposes.
  • RNA quality control probe 2 is the same probe sequence as the fluorescently labeled ssDNA called “w1282” for quality control purposes.
  • RNA quality control probe 3 is the complementary sequence to the fluorescently labeled ssDNA called “ApoE” for quality control purposes.
  • RNA quality control probe 4 (RNA QC4) is the complementary sequence to the fluorescently labeled ssDNA called “w1282” for quality control purposes.
  • the fluorescently labeled “ApoE” ssDNA is capturable to QC3 but not QC 1 in the “tiling RNA array.”
  • the fluorescently labeled “w1282” ssDNA is capturable to QC4 but not QC2 in the “tiling RNA array.”
  • IGFBP1 promoter tiling RNA array oligo- nucleotide sequences TABLE 2 IGFBP1 promoter tiling RNA array oligo- nucleotide sequences. (Note: The oligo- nucleotides were sequentially arranged on the tiling array in a clockwise order beginning at the center.
  • RNA QC1 GCCGAUGACCUGCAAGAGU (SEQ ID NO: 169)
  • RNA QC2 AUAACUUUGCAACAGUGG (SEQ ID NO: 170)
  • RNA QC3 ACUCUUGCAGGUCAUCGGC (SEQ ID NO: 171)
  • the oligonucleotides were sequentially arranged on the tiling array in a clockwise order beginning at the center ( FIG. 2 ).
  • the duplicate was arranged into the tiling array afterward.
  • T7 exonuclease In order to generate a probe to test the presence of RNA sequences in the array, two units of T7 exonuclease were used to digest 100 ng of one end FAM-labeled and 5′ phosphorothioate-protected IGFBP1 DNA for 1 min at room temperature. T7 exonuclease digestion was stopped by addition of EDTA to a final concentration of 25 mM. The product was applied onto the RNA array for hybridization at 37° C. for 1 hr.
  • the fluorescence signal that is observed arises from a sequence-specific capture of partial duplex DNA that was fluorescently tagged (6-carboxyfluorescein, FAM) and protected by phosphorothioate DNA bases at its 5′ end ( FIG. 2A ). Fluorescence signal from each array element provides a measurement of the amount of digested duplex capturable by specific complementary oligonucleotides and was expected to vary with the degree of digestion.
  • FAM fluorescently tagged (6-carboxyfluorescein, FAM) and protected by phosphorothioate DNA bases at its 5′ end
  • Fluorescence signal from each array element provides a measurement of the amount of digested duplex capturable by specific complementary oligonucleotides and was expected to vary with the degree of digestion.
  • the target DNA was captured in a sequence-specific manner. It is noted that the digestion activity of T7 exonuclease is similar to the activity of Exonuclease 3 (3′ DNA exonuclease) that was reported previously Wu et al (2011), PLoS One 6, e26217. The result suggests the desired RNA sequences were synthesized accurately on the surface and are accessible for sequence-specific capture of nucleic acids.
  • RNA oligonucleotides can be copied from high density DNA microarray templates simultaneously with this method.
  • the enzymatically synthesized RNAs on the surface are free from undesired chemical modifications that are inevitable during chemical syntheses resulting from long time exposures to strong acidic and oxidizing reagents.
  • this method is not constrained by the relatively lower coupling yield of RNA phosphoramidites (compared to DNA), and the laborious process for chemical RNA synthesis.
  • modified ribonucleoside triphosphates e.g., 2′-fluorine-CTP or 2′-fluorine-UTP
  • 2′-fluorine-CTP or 2′-fluorine-UTP can be used to fabricate desired RNA arrays for various applications.
  • High density RNA arrays provide a new avenue for high throughput RNA biomolecular interaction analyses and RNA research.
  • RNA Arrays Synthesized with 2′-Fluoro Ribonucleosides are RNase-Resistant
  • RNA arrays In order to determine if RNA arrays could be generated that were RNase resistant, an RNA array and a 2′-fluoro-RNA array were enzymatically synthesized as described previously using natural nucleoside triphosphates (i.e., adenosine triphosphate [ATP], guanosine triphosphate [GTP], cytidine triphosphate [CTP], and uridine triphosphate [UTP] and 2′ fluorine modified nucleoside triphosphate mix (i.e.
  • natural nucleoside triphosphates i.e., adenosine triphosphate [ATP], guanosine triphosphate [GTP], cytidine triphosphate [CTP], and uridine triphosphate [UTP]
  • 2′ fluorine modified nucleoside triphosphate mix i.e.
  • RNA arrays were then treated with DNase I (20 units) at 37° C. for four hours to eliminate template DNA oligonucleotides, followed by RNase A treatment (>4 units) at 37° C. for 30 minutes. The arrays were then hybridized with their fluorescently labeled cDNAs. As shown in FIG.
  • the RNA arrays generated with unmodified ribonucleotides showed persistent hybridization signal after DNase I treatment, indicating hybridization of the cDNA probe to the RNA array.
  • RNase A treatment a complete loss of hybridization signal was observed indicating complete degradation of the RNA array.
  • the 2′-fluoro-RNA arrays showed hybridization signal after DNase treatment and RNase A treatment.
  • RNA polymerase to copy surface-attached DNA molecules on a high-density DNA array into their RNA complements ( FIG. 1 ).
  • the surface is first partially deprotected (e.g. light is used to effect removal of 50% of the NPPOC photolabile protecting groups covering the surface), an array of the DNA complements to the eventual desired RNA sequences is synthesized by standard light-directed synthesis on the exposed sites, and the remaining surface sites are then deprotected, followed by synthesis of RNA primer sequences.
  • RNA:DNA duplexes RNA:DNA duplexes.
  • the DNAs are removed with DNase I, leaving behind the desired single stranded RNAs.
  • the strategy is compatible with either natural unmodified ribonucleoside triphosphates (rNTPs), or alternatively, 2′ fluoro-modified (2′F) rNTPs may be included in the polymerase extension reaction to impart nuclease resistance and other desirable characteristics to the synthesized RNAs.
  • Standard glass slides coated with 50 ⁇ chromium and 1,000 ⁇ of gold were extensively rinsed with hexane and ethanol and dried under a nitrogen stream.
  • a 7.5 nm layer of amorphous carbon was then DC magnetron sputtered on the gold surface (Denton Vacuum, NJ, USA).
  • the carbon-on-gold surface was hydrogen-terminated in a 13.56 MHz inductively coupled hydrogen plasma for 12 minutes (30 Torr H 2 , room temperature).
  • 40 ⁇ A of 9-Decene-1-ol (Sigma Aldrich, MO, USA) was placed directly onto the newly hydrogen-terminated surface and covered with a quartz coverslip.
  • the 5′-DMT-protected polyethyleneglycol 2000 phosphoramidite underwent two 900 sec coupling steps in a row. While the NPPOC protecting groups were removed by exposure to UV light, all the DMT protecting groups were removed by flowing through a deblocking mix (3% dichloroacetic acid in toluene). The light dose to remove full or a half of the photolabile NPPOC (nitrophenylpropyloxycarbonyl) protecting groups was determined prior to DNA template array fabrication. A series of incremental doses of 365 nm light (Joule/cm 2 ) was used for a 30 nt quality control (QC) oligonucleotide synthesis.
  • QC quality control
  • the optimal dose was chosen to yield the highest level of fluorescence (for a full deprotection) or a half of it (for a half deprotection) from hybridization of a fluorescently tagged QC complement.
  • a total dose of 3 Joule/cm 2 365 nm light was used to remove all NPPOCs during each cycle.
  • a total dose of 0.32 Joule/cm 2 365 nm light was used to remove a half of NPPOCs for RNA primer synthesis.
  • the exposed hydroxyl moieties were reacted with the DMT-protected phosphoramidite nucleosides at the first base of the RNA primer.
  • the other half of the NPPOC protecting groups were removed by a full dose of UV light prior to the light-directed oligonucleotide synthesis on the surface.
  • RNA primer sequence was synthesized using a standard nucleic acid synthesis protocol.
  • DCI Activator (0.25 M dicyanoimidazole in acetonitrile) and all NPPOC (3′-nitrophenylpropyloxycarbonyl) protected phosphoramidite nucleosides [5′-NPPOC-dAdenosine (tac) 3′- ⁇ -cyanoethylphosphoramidite (NPPOC-dA), 5′-NPPOC-dThymidine 3′- ⁇ -cyanoethylphosphoramidite (NPPOC-dT), 5′-NPPOC-dCytidine (ib) 3′- ⁇ -cyanoethylphosphoramidite (NPPOC-dC), 5′-NPPOC-dGuanosine (ipac) 3′- ⁇ -cyanoethylphosphoramidite (NPPOC-dG)], N-methylimidazole, acetonitrile, and tetrahydrofuran (THF) were purchased from Sigma Aldrich (MO, USA).
  • Capping reagent A (THF/PAc2O) and deblocking mix were purchased from Glen Research (VA, USA).
  • Oxidation solution 0.2 M iodine/pyridine/H 2 O/THF
  • acetonitrile anhydrous 5′-DMT-polyethyleneglycol 2000 phosphoramidite, all 3′-DMT-5′-cyanoethylphosphoramite 2′-O-methyl or 2′-fluoro nucleosides were purchased from ChemGenes (MA, USA).
  • Capping reagent B (6.5% 2-dimethylaminopyridine, 2% N-methylimidazole and 10% 2,6-lutidine in THF) and exposure solvent (1% imidazole in DMSO) were mixed in-house Anhydrous reagents were kept over molecular sieves (AldraSORBTM water trapping packets, Sigma Aldrich).
  • a gasket, Gene Frame—1 ⁇ 1 cm internal (Abgene, Epsom, UK), was attached so that it surrounds the DNA features.
  • a 50 ⁇ l annealing buffer consisting of 4 ⁇ SSPE buffer (Sigma Aldrich), 1 ⁇ RNasecureTM reagent (Ambion, TX, USA), 9% polyethylene glycol 6000, was applied onto the array and incubated at 60° C. for 20 min, then slowly cooled down to 37° C. for 4 hr. The prolonged incubation time allows the RNA primers to anneal adequately to their DNA complements.
  • the polyethylene glycol accelerated RNA:DNA hybridization while RNasecureTM was included to irreversibly inactivate possible RNases on the surface.
  • RNA extension reaction The surface was rinsed with 1 ⁇ transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl 2 , 10 mM DTT, 20 mM NaCl, 2 mM spermidine) prior to RNA extension reaction.
  • 1 ⁇ transcription buffer 40 mM Tris-HCl, pH 7.9, 6 mM MgCl 2 , 10 mM DTT, 20 mM NaCl, 2 mM spermidine
  • 2′-fluoro RNA extension a mutant T7 RNA polymerase was used while wild-type T7 RNA polymerase was used for natural RNA extension.
  • a 50 ⁇ A RNA extension reaction mixture was added to the surface and incubated at 37° C. for 6-8 h in a humid chamber.
  • a natural RNA extension reaction mixture consists of 40 mM Tris-HCl, pH 7.9, 6 mM MgCl 2 , 10 mM DTT, 20 mM NaCl, 2 mM spermidine, 0.5 mM each NTP, 2 U/ ⁇ l T7 RNA polymerase (Thermo Scientific, USA), and 1 U/ ⁇ l RNase inhibitor (New England Biolabs, USA).
  • a 2′-fluoro RNA extension reaction mixture consists of 40 mM Tris-HCl, pH 7.9, 2 mM MgCl 2 , 2 mM MnCl 2 , 10 mM DTT, 20 mM NaCl, 0.05% Triton X-100, 012 mg/ ⁇ l BSA, 2 mM spermidine, 0.5 mM adenosine triphosphate, 0.5 mM guanosine triphosphate, 0.5 mM 2′-fluoro-uridine triphosphate (TriLink, CA, USA), 0.5 mM 2′-fluoro-cytidine triphosphate (TriLink), 0.015 U/ ⁇ l pyrophosphatase, 2 U/ ⁇ l T7 R&DNA polymerase (Epicentre, WI, USA) and 1 U/ ⁇ l RNase inhibitor (New England Biolabs, USA).
  • the fluorescein labeled DNA fragment corresponding to positions ⁇ 205 to ⁇ 25 of the mouse IGFBP1 promoter was amplified by PCR from NIH 3T3 (mouse embryonic fibroblast cell line) genomic DNA (NEB, MA, USA) using the primers (5′-T*T*A GC/iFluorT/ CCT GTC CCA GTC CAT-3′ (SEQ ID NO:4) and 5′-TAT GAA GGG CTG GCT GTG C-3′ (SEQ ID NO:5).
  • [*] represents a phosphorothioate DNA base and [/iFluorT/] represents a fluorescein-labeled thymidine.
  • T7 exonuclease T7 Gene 6 Exonuclease; Affymetrix, CA, USA
  • the reaction buffer was exchanged to 1 ⁇ SSPE buffer at a concentration of 0.2 ⁇ M before application to the RNA arrays.
  • the hybridization reaction was performed in a humid chamber at 25° C. for 30 min, followed by a thorough rinse and incubation with 1 ⁇ SSPE buffer at 37° C. for 15 min to remove nonspecifically bound DNA. Fluorescence images were obtained with a 488 nm laser and 512 nm filter using a GeneTac UC 4 ⁇ 4 microarray scanner (Genomic Solutions, MI, USA). Table 1 contains the probe sequences synthesized on the surface.
  • Each of the tiling arrays was composed of 332 features with each feature measuring 280 ⁇ m ⁇ 280 ⁇ m, and separated by 140 ⁇ m gaps.
  • DNase I Turbo DNase; Ambion
  • RNase A bonuclease A; Sigma Aldrich
  • All arrays were first hybridized with a mixture of three fluorescently labeled DNA probes and visualized using a GeneTac UC 4 ⁇ 4 microarray scanner.
  • the hybridization reaction mixture consisted of 0.2 ⁇ M of each probe in 4 ⁇ SSPE buffer and was incubated in a humid chamber at 37° C. for 30 min, followed by a thorough rinse and incubation with 1 ⁇ SSPE buffer at 37° C. for 15 min to remove nonspecifically bound DNA.
  • Table 3 contains the sequences of a “Badger Chemist” array, as well as the fluorescently labeled detection probes.
  • the RNA and 2′-fluoro RNA arrays were first treated with a total of 2.5 units of DNase I at 37° C. for 7 hr and then a total of 1 ⁇ g of RNase A. Conversely, the DNA arrays were first treated with RNase A and then with DNase I. The arrays were heat treated at 75° C. for 10 min before again being subjected to fluorescence imaging.
  • RNA array Sequences Name Sequence (3′ to 5′) Name Sequence (5′ to 3′) body TGAGAACGTCCAGTAGCCG body ACUCUUGCAGGUCAUCGGC (SEQ ID NO: 10) (SEQ ID NO: 171) lab coat GATTGTCCACTCAAGACT lab coat CUAACAGGUGAGUUCUGA (SEQ ID NO: 330) (SEQ ID NO: 331) sweater/flask GGTGACAACGTTTCAATA sweater/flask CCACUGUUGCAAAGUUAU (SEQ ID NO: 11) (SEQ ID NO: 172)
  • the sequence initiated from the surface for the Badger Chemist template DNA array is 3′-T/PEG2K/A GCC TGT GCC GCT T-5′ (SEQ ID NO:332); and the sequence initiated from the surface for the Badger Chemist RNA tiling array is 5′-T/PEG2K/A fCmG mG mAfCmAfC mGmGfC mGmAmA-3,′ which served as an RNA primer for extension reaction. Italic letters represent RNA bases./PEG2K/ represents a polyethylene glycol linker of an approximate molecular weight of 2,000 Da. mG and mA are 2′-methoxy RNA bases. fC is a 2′-fluoro RNA base.
  • RNA array consisting of the 24-2-min sequence (5′-mGmAfC mGfCmG mAfCfC mGmAmA AUG GUG AAG GAC GGG UCC AGU GCU UCG GCA CUG UUG AGU AGA GUG UGA GCU CCG UAA CUG GUC GCG UC-3′ (SEQ ID NO:333) in the pattern of the University Wisconsin logo was used for a functional assay.
  • [m] represents a “2′-methoxy” RNA base
  • [f] represents “2′-fluoro” RNA base.
  • the underscored sequence is the RNA primer sequence synthesized using DMT-protected phosphoramidite nucleosides. The array was heat denatured at 75° C.
  • Table 3 contains the sequences of a “Badger Chemist” array.
  • the 10-23 DNAZyme (5′-TCA GAA CTC AGG CTA GCT ACA ACG ACT GTT AGT TC-3′) (SEQ ID NO:334) is designed to cleave the “lab coat” RNA sequence in the “Badger Chemist” array).
  • the underscored sequences are the substrate-binding domains.
  • the arrays were first annealed with the 10-23 DNAzyme at a final concentration of 1 ⁇ M in a 50 ⁇ l annealing buffer (5 mM Tris, pH 7.5, 15 mM NaCl, 0.1 mM EDTA).
  • the surface was incubated on a heating block at 95° C. for 3 min following by chilling on ice.
  • the cleavage reaction was initiated by addition of 10 ⁇ cleavage buffer followed by 10 ⁇ Mn 2+ to give a final incubation condition of 50 mM Tris, pH 7.5, 10 mM MnCl 2 , and 150 mM NaCl.
  • the sample was placed in a humid chamber at 37° C. for 5 hr for DNAZyme cleavage and immersed in 8 M urea solution to stop the reaction. Both before and after DNAZyme treatment, the arrays were hybridized with a mixture of three fluorescently labeled DNA probes and visualized using a GeneTac UC 4 ⁇ 4 microarray scanner.
  • FIG. 4 shows the results of nuclease digestion experiments on DNA, RNA, and 2′F RNA arrays. Each array contains three 30-32mer sequences corresponding to the body, sweater/flask, or lab coat of a “Badger Chemist” (Table 3).
  • the arrays were visualized after nuclease treatment by hybridizing them with a mixture of the three corresponding oligodeoxynucleotide complements, tagged respectively with the fluorophores fluorescein (sweater and bag), Texas Red (head; hands; and feet), and Cy 5 (labcoat), followed by washing and fluorescence imaging. It is evident from the figure that while the DNA arrays are completely destroyed by DNase treatment but impervious to RNase treatment, the RNA arrays show the opposite result, in that they are completely destroyed by RNase treatment but impervious to DNase treatment. As expected, the 2′F RNA arrays are resistant to both DNase and RNase treatment. These results confirm in each case the nature of the nucleic acid comprising the array elements. In addition, the experiments also show that for each array, the nucleic acid molecules on the surface hybridize specifically to fluorescently tagged solution complements, as illustrated by the correct localization of the green, yellow, and red features in the image.
  • Example 1 The hybridization and exonuclease sensitivity results presented in Example 1 above and in this example provide strong evidence that the normal and modified RNA arrays have the correct nucleic acid compositions, and exhibit normal base-pairing functionality.
  • the 10-23 DNAzyme (having RNase activity), first described by Joyce and colleagues in 1997 (Santoro et al, 1997, Proc Natl Acad Sci USA. 94(9):4262-4266), consists of a catalytic core of 15 deoxynucleotides flanked by substrate-binding domains. Any RNA substrate that is accessible to Watson-Crick pairing with the 10-23 DNAzyme substrate-binding domains can be cleaved at the phosphodiester linkage between purine and pyrimidine nucleobases that separate the complementary regions on the substrate ( FIG. 5A ).
  • the arrays were incubated with the 10-23 DNAzyme in a Mn +2 containing buffer for 5 hr at 37° C. As shown in FIG. 5B , the “lab coat” sequences remained intact on the DNA array, whereas 70% were cleaved on the RNA array and 55% were cleaved on the 2′-fluoro RNA array. These results show that the surface-bound natural and modified RNA molecules are recognized as RNA by the DNAzyme.
  • RNA arrays One important application of RNA arrays is likely to be their use for the discovery, characterization, and evolution of aptamer sequences.
  • aptamer refers to nucleic acid molecules that fold into conformations that impart them with specific binding affinity for a molecular target.
  • nucleic acid aptamers can be composed of either DNA or RNA
  • RNA aptamers have the intriguing advantage of being possible to generate in vivo, and in fact naturally occurring RNA aptamers known as “riboswitches” have been described and shown to play critical roles in gene regulation. We wished to determine if the surface-bound RNAs in RNA arrays were able to fold properly to yield functional aptamer sequences.
  • RNA array consisting of the 24-2-min aptamer sequence in the pattern of the University of Wisconsin logo.
  • the array was incubated with DFHBI followed by fluorescence imaging.
  • the fluorescence image in FIG. 6 shows a pattern of green fluorescence corresponding to the logo, demonstrating that the aptamer sequences are properly folded and functional. This result suggests the possibility of synthesizing hundreds of thousands of variant 24-2 sequences on the array, and screening them all in parallel to identify aptamers with improved fluorescence characteristics such as increased brightness or red-shifted fluorescence emission.
  • RNA arrays we have described a novel strategy for the fabrication of high-density RNA arrays.
  • the fidelity and functionality of the RNA elements is demonstrated in hybridization, DNAzyme cleavage, nuclease digestion, and RNA aptamer binding experiments.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Described herein are RNA arrays, and compositions and methods for generating RNA arrays, particularly high density RNA arrays. The disclosed methods for generating RNA arrays utilize template DNA arrays and RNA polymerase to generate RNA arrays. In some embodiments, the disclosed methods use an RNA polymerase and modified ribonucleosides to generate modified RNA arrays for various applications, e.g. RNA arrays having higher nuclease resistance, more conformationally stable RNA arrays, and higher binding affinity RNA aptamer arrays. In some embodiments, the disclosed methods are used to generate RNA bead arrays.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This patent application claims priority to U.S. Provisional Patent Application Ser. No. 61/723,011, filed on Nov. 6, 2012, which is incorporated by reference herein in its entirety.
  • STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
  • This invention was made with government support under DK093467 and HG004952 awarded by the National Institutes of Health. The government has certain rights in the invention.
  • BACKGROUND
  • High density DNA microarrays have been commercially available worldwide for more than a decade, but high density RNA microarrays do not exist yet due to the difficulty of equivalent high density RNA synthesis methods. The development of RNA arrays, and especially high density RNA arrays would enable a number important new applications including, for example, fabrication of RNA aptamer arrays; identification of RNA sequences that produce fluorescence from non-fluorescent small molecules; identification and characterization of novel ribozymes and RNA-binding proteins. Thus, there is an ongoing need for high density RNA arrays and methods for generating them.
  • BRIEF SUMMARY
  • Described herein are RNA and template array compositions and methods for generating such compositions. The methods and compositions are based on the finding that DNA arrays can serve as a template for RNA-polymerase-based synthesis of complementary RNA arrays.
  • Accordingly, in one aspect described herein is an RNA array comprising RNAs that are covalently linked at their 5′ ends to a solid support.
  • In some embodiments, the covalently linked RNAs represent at least 10 unique RNA sequences and have a feature density of at least 20 features/cm2.
  • In some embodiments the RNAs comprise at least about 20 unique RNA sequences. In other embodiments the RNAs represent at least about 50 unique RNA sequences.
  • In some embodiments the length of the at least ten unique RNA sequences is about 20 bases to about 50 bases. In some embodiments the density of single-stranded RNAs in the RNA array is about 200 features/cm2.
  • In some embodiments the RNAs in the RNA array comprise modified ribonucleotides. In one embodiment the modified ribonucleotides are RNase resistant (e.g., 2′-fluoro ribonucleotides or 2′-methoxyribonucleotides).
  • In another aspect provided herein is a template array comprising: (i) an array of single-stranded template DNA oligonucleotides linked at their 3′ ends to a solid support, comprising a consensus sequence, and capped by a protecting group at their 5′ ends; and (ii) single-stranded RNA primers that are covalently linked at their 5′ ends to the solid support, and that are complementary to the consensus sequence, wherein the single-stranded RNA primers hybridize to the single-stranded template DNA oligonucleotides.
  • In some embodiments the single-stranded RNA primers have a length of about 4 bases to about 20 bases. In one embodiment, the single-stranded RNA primers have a length of about 13 bases.
  • In some embodiments the single-stranded template DNA oligonucleotides or single-stranded RNA primers are covalently linked to the solid support through a polyethylene glycol spacer.
  • In some embodiments the protecting group to be added to the 5′ end of the single-stranded template DNA oligonucleotides is an acetyl group or a phenoxyacetyl group.
  • In some embodiments a kit is provided that includes the above-mentioned template array and any of (i) an RNA polymerase; (ii) ribonucleoside triphosphates; and (iii) a DNase. In some embodiments the ribonucleoside triphosphates to be included in the kit are modified ribonucleoside triphosphates. In some embodiments, the included modified ribonucleoside triphosphates are modified ribonucleosides (e.g., 2′-fluoro ribonucleosides, 2′-methoxy ribonucleosides, 2′-amino ribonucleosides, 5-bromouridine-5′-triphosphate, 4-thiouridine-5′-triphosphate, 6-thioguanosine-5′-triphosphate).
  • In a further aspect disclosed herein is a method for generating a template array, which includes the steps of: (i) providing a solid support comprising a layer of protected deoxyribonucleosides that comprise a 5′-photolabile protecting group and are covalently linked at their 3′ end to a spacer layer bound to the solid support; (ii) irradiating the layer of protected deoxyribonucleosides with ultraviolet energy sufficient to deprotect about half of the protected deoxyribonucleosides; (iii) coupling the deprotected deoxyribonucleosides with a ribonucleoside phosphoramidite comprising a 5′ acid-labile protecting group; (iv) irradiating the remaining protected deoxyribonucleosides with ultraviolet irradiation sufficient to deprotect all of the remaining protected deoxyribonucleoside phosphoramidites; (v) extending the deprotected deoxyribonucleosides, at one or more locations, by light-directed 3′ to 5′ photolithographic synthesis to generate template DNA oligonucleotides;
  • (vi) coupling a protecting group to the 5′ ends of the template DNA oligonucleotides;
  • (vii) removing the 5′ acid-labile protecting groups on the protected ribonucleosides by acid treatment; and
  • (viii) extending the deprotected ribonucleosides, at one or more locations, by 5′ to 3′ chemical synthesis of RNA primers comprising a sequence that is complementary to a sequence at the 3′ end of the template DNA strands to obtain a template array.
  • In some embodiments of the above-mentioned method, the 5′ acid-labile protecting group in step (iii) includes a 4,4′-dimethoxytrityl (DMT) group.
  • In some embodiments the protecting group coupled to the 5′-ends of the template DNA strands in step (vi) is a phenoxyacetyl group or an acetyl group.
  • In some embodiments RNase-resistant modified ribonucleoside phosphoramidites are used in the extension of the deprotected ribonucleosides to obtain RNase-resistant RNA primers in step (viii). In some embodiments, where RNase-resistant modified ribonucleoside phosphoramidites are used, the RNase-resistant modified ribonucleoside phosphoramidites are 2′-fluoro ribonucleoside phosphoramidites or 2′-methoxy ribonucleoside phosphoramidites.
  • In a further aspect described herein is a method for generating an RNA array, comprising the steps of (i) providing a template array of (a) single-stranded template DNAs linked at their 3′ ends to a solid support and comprising a consensus sequence; and (b) single-stranded RNA primers that are covalently linked at their 5′ ends to the solid support, and that are complementary to the consensus sequence of the single-stranded template DNAs; (ii) hybridizing the single-stranded RNA primers with the single-stranded template DNAs; (iii) extending the hybridized RNA primers along the single-stranded template DNAs using an RNA polymerase and ribonucleoside triphosphates to obtain double-stranded DNA-RNA hybrids; and (iv) exposing the DNA-RNA hybrids to a DNase enzyme to remove the template DNAs from the DNA-RNA hybrids to obtain an RNA array.
  • In some embodiments the RNA polymerase in step (iii) is T7 RNA polymerase or T3 RNA polymerase.
  • In some embodiments the ribonucleoside triphosphates used in step (iii) are modified ribonucleoside triphosphates. In one embodiment, the modified ribonucleoside triphosphates are RNase-resistant modified ribonucleoside triphosphates. In some embodiments the RNase-resistant modified ribonucleoside triphosphates to be used are 2′-fluoro ribonucleoside triphosphates or 2′-methoxy ribonucleoside triphosphates.
  • In some embodiments the method can also include a step of synthesizing the single-stranded RNA primers in the array prior to step (i).
  • In some embodiments the single-stranded template DNAs represent at least 20 unique sequences. In other embodiments the single-stranded template DNAs represent at least 50 unique sequences.
  • In yet another aspect provided herein is a method to generate an RNA bead pool, comprising: (i) providing beads comprising 5′-linked RNA primers comprising a consensus sequence; (ii) hybridizing the 5′-linked RNA primers with DNA oligonucleotides comprising a unique template sequence and a sequence complementary to the consensus sequence, wherein the DNA oligonucleotides are provided in solution; (iii) extending the hybridized RNA primers along the single-stranded template DNAs using an RNA polymerase and ribonucleoside triphosphates to obtain double-stranded DNA-RNA hybrids; and contacting the DNA-RNA hybrids with a DNase to remove the template DNAs from the DNA-RNA hybrids to obtain an RNA bead pool.
  • INCORPORATION BY REFERENCE
  • All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, and patent application was specifically and individually indicated to be incorporated by reference.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. The present invention will be better understood and features, aspects and advantages other than those set forth above will become apparent when consideration is given to the following detailed description thereof. Such detailed description makes reference to the following drawings, wherein:
  • FIG. 1 shows a schematic overview of an exemplary embodiment of an RNA array synthesis method starting from a solid support coated with a PEG 2000 spacer layer linked to photolabile NPPOC-protected, deoxyribonucleosides at their 3′ end. UV light irradiation is controlled so as to deprotect about half of the 3′-linked deoxyribonucleosides. The deprotected deoxyribonucleosides are then coupled to an acid-labile DMT-protected ribonucleoside phosphoramidite. UV light irradiation is then used to deprotect the remaining NPPOC-protected deoxyribonucleosides. Following this deprotection step, photolithographic 3′ to 5′ synthesis is used to generate an array of template DNA oligonucleotides, comprising an initial consensus sequence of approximately 12 bases that is common to most or all positions and a downstream sequence that is unique for each position or subsets of positions in the array. After template DNA oligonucleotide synthesis is completed, the DNA oligonucleotides are capped by acetylation at their 5′ ends. The DMT-protected ribonucleoside phosphoramidites are then deprotected by acid treatment. Chemical synthesis, with 2-methoxy ribonucleoside phosphoramidites, is then used to generate a 5′-linked RNA primer comprising a sequence that is complementary to the template DNA consensus sequence mentioned above. Hybridization of the synthesized RNA primers with the consensus sequence in the template DNA oligonucleotides is then used to generate a cRNA copy of each unique template DNA oligonucleotide sequence using T7 RNA polymerase or in some cases, T3 RNA polymerase, in the presence of ribonucleoside triphosphates, or in some cases, RNase-resistant ribonucleoside triphosphates. After RNA polymerase synthesis of RNAs is complete, template DNA is eliminated from the array by digestion with DNase leaving behind an RNA array ready for use.
  • FIG. 2 (A) shows a schematic illustration of how 5′-fluorescent labeled IGFBP1 DNA probe amplicons are generated to test an RNA array. After generation of IGFBP1 amplicons, these double-stranded products were partially digested with T7 exonuclease to yield double-stranded products with single-stranded overhangs capable of hybridizing with RNAs present in the RNA array. As shown, the ability of the fluorescently labeled, exonuclease-digested probe to hybridize with RNAs on the array depends on the amount of sequence overlap between the single-stranded probe overhang and the RNA in question. (B) Shows an RNA array fluorescent hybridization signal consistent with the 5′ to 3′ tiled pattern of the RNAs in the array, where stronger hybridization signal indicates more complementary overlap with the single-stranded overhang in the DNA probe, and less or no signal where less or no overlap occurred.
  • FIG. 3. Top panels are images of fluorescent DNA probes hybridized to an RNA array enzymatically synthesized using unmodified ribonucleosides (top left panel), and the same type of RNA array after RNase A treatment (top right panel), which resulted in complete degradation of the RNA array as indicated by the total loss of hybridization signal. In the bottom panels are images of 2′-fluoro RNA arrays that were enzymatically synthesized using a 2′-fluorine-modified nucleoside triphosphate mix (left bottom panel) and the same type of RNA array and 2′-fluoro RNA array after RNase A treatment (bottom right panel), which shows only a partial loss of hybridization signal indicating that 2′-fluoro RNA arrays are relatively resistant to RNase.
  • FIG. 4 shows a fluorescence image of a patterned array of DNAs, RNAs, and modified RNAs after various treatment conditions and hybridization to complementary probe sequences labeled with distinct fluorophores. The dimensions of the “Badger Chemist” array are about 6 mm×5 mm, which consists of the “body”, the “sweater/flask” and the “lab coat” sequences (Table 3). The natural RNA and 2′-fluoro RNA array were treated with DNase I and RNase A, sequentially, while the DNA array was treated with RNase A and then DNase I. The arrays were visualized by hybridization with their DNA complements labeled with FAM (sweater/flask), Texas Red (body), and Cy5 (lab coat).
  • FIG. 5 shows a fluorescence image of a patterned array of DNAs, RNAs, and modified RNAs before and after DNase treatment, and followed by hybridization to complementary probe sequences labeled with distinct fluorophores. (A) The schematic diagram of 10-23 DNAZyme cleavage test on RNA array. B) The dimensions of “Badger Chemist” array are about 6 mm×5 mm, which consists of the “body,” the “sweater/flask” and the “lab coat” sequences (Table 3). The arrays were visualized by hybridization with the three corresponding oligodeoxynucleotide complements, tagged respectively with the fluorophores fluorescein (sweater/flask), Texas Red (body), and Cy 5 (lab coat). The “lab coat” sequences were intact on the DNA array, whereas 70% were cleaved on the natural RNA array and 55% were cleaved on the 2′-fluoro RNA array. It is noted there were fewer cleavage events on the 2′-fluoro RNA array than on the natural RNA array. Although the purine nucleobases, which participated in cleavage events, were not 2′-fluoro modified, we speculate the halogenated groups in the ribose rings of pyrimidine nucleobases would interfere with RNA:DNA duplex formation and result in different efficiency. This is the first report showing the different cleavage activities of 10-23 DNAzyme on natural RNA and 2′-fluoro RNA molecules.
  • FIG. 6 shows a fluorescence image of a 24-2-min RNA aptamer array. The array was incubated with the chromophore 3,5-difluoro-4-hydroxybenzylidene imidazolinone (DFHBI) (24-2), which fluoresces upon binding to the RNA aptamer sequence. After incubation with DFHBI, the array was visualized using a GeneTac UC 4×4 microarray scanner with a 488 nm blue excitation laser and a 512 nm emission filter.
  • DETAILED DESCRIPTION
  • Described herein are RNA array compositions and methods for generating such compositions. The methods and compositions are based on the finding that DNA arrays, e.g., high density DNA arrays can serve as templates for RNA-polymerase-based synthesis of a complementary RNA array. Many possible applications for RNA arrays can be envisioned, including, but not limited to, deciphering the binding specificities of RNA-binding proteins, as a tool to aid in the engineering of sequence-specific RNA-binding proteins, for screening and characterizing RNA-based therapeutics, for fabricating tiling arrays of RNA viral genomes, for fabricating miRNA arrays, engineering ribozyme arrays, discovering new ribozymes, studying ribozyme function, engineering artificial siRNAs and miRNAs, fabricating mRNA tiling arrays, and searching for miRNA “sponges” (molecules that bind to and inactivate miRNAs).
  • It is to be understood that this invention is not limited to the particular methodology, protocols, materials, and reagents described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.
  • It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. As well, the terms “a” (or “an”), “one or more” and “at least one” can be used interchangeably herein. It is also to be noted that the terms “comprising”, “including”, and “having” can be used interchangeably.
  • Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications and patents specifically mentioned herein are incorporated by reference for all purposes including describing and disclosing the chemicals, cell lines, vectors, animals, instruments, statistical analysis and methodologies which are reported in the publications which might be used in connection with the invention. All references cited in this specification are to be taken as indicative of the level of skill in the art. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
  • The practice of the present invention will employ, unless otherwise indicated, conventional techniques of medicinal chemistry, pharmacology, organic chemistry, analytical chemistry, molecular biology, microbiology, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature.
  • I. DEFINITIONS
  • In describing the embodiments and claiming the invention, the following terminology will be used in accordance with the definitions set out below.
  • As used herein, “about” means within 5% of a stated range within the relevant parameter.
  • As used herein, “RNase-resistant” refers to a modified RNA having reduction in susceptibility to RNase degradation or the ability of a modified ribonucleoside to confer a reduction in susceptibility of an RNA to RNase degradation by at least 10%.
  • II. Methods
  • Disclosed herein are methods for generating a template array and for generating RNA arrays using such template arrays.
  • In an exemplary embodiment, generating a template array starts from a solid support material such as amorphous carbon, glassy carbon, polymer or silanized glass that is coated with a layer of spacer material (e.g., PEG 2000 or PEG 4500) covalently linked to deoxyribonucleoside phosphoramidites (“bridging moieties”) protected by a photolabile protecting group, e.g., 3′-nitrophenylpropyloxycarbonyl (NPPOC). In other embodiments, the solid support material is provided in the form of silica beads in the size range of 1 to 10 microns. The NPPOC-protected spacer layer is then irradiated with a suitable amount of deprotecting dose of UV light (e.g., 0.5 joule on amorphous carbon on gold, 0.75 joule on glassy carbon at about 365 nm in the working examples provided herein) to remove about half of the NPPOC protecting groups on the spacer layer, which deprotects hydroxyl groups on half of the deoxyribonucleosides covalently linked to the spacer layer. The deoxyribonucleosides with deprotected, free hydroxyl groups are then coupled with an acid-labile protecting group such as 4,4′-dimethoxytrityl (DMT)-protected ribonucleoside phosphoramidites. Afterwards, a full dose of UV light is used to remove all of the remaining photolabile protecting groups from the spacer layer, which allows the light-directed 3′ to 5′ photolithographic synthesis of DNA arrays starting from the newly deprotected deoxyribonucleoside phosphoramidites. Methods for 3′ to 5′ photolithographic synthesis of DNA oligonucleotide arrays are known in the art, as described in, e.g., Wu et at (2012), Angewandte Chimie Int Ed Engl 51(19):4628-4632. The initial 8 to about 15 deoxynucleotides (e.g., 9, 10, 11, 12, 13, or 14 deoxynucleotides) attained by photolithographic DNA synthesis encompass a “consensus” sequence that is common to the single-stranded template DNAs to be synthesized. For example, in one embodiment, the consensus sequence is 3′-CCTGTGCCGCTT-5 (SEQ ID NO:1). After 3′ to 5′ photolithographic synthesis of the consensus sequence, a variety of positionally-determined template sequences are synthesized in a desired pattern in the length range of about 20 deoxyribonucleotides to about 80 deoxyribonucleotides. After photolithographic synthesis of the template DNA strands, these are protected “capped” by a phenoxyacetyl group or an acetyl group at the 5′ end to block undesired further synthesis. Finally, the acid-labile DMT protecting groups on the 5′-linked, protected ribonucleoside phosphoramidites are removed by acid treatment (e.g., with 2% trichloroacetic acid or 3% dichloroacetic acid in dichloromethane) to expose 3′ hydroxyl groups of the 5′-linked ribonucleosides for chemical synthesis of an RNA primer complementary consensus sequence. The template array can be used to generate an RNA array, as described below.
  • In some embodiments, the spacer layer, deoxyribonucleoside or ribonucleoside is protected with an acid-labile protecting group, such as 4,4′-DMT rather than a photolabile protecting group. In this case, partial deprotection of the layer is achieved by treatment with a dilute solution of dichloro- or trichloroacetic acid, reduced exposure time to the acid, or both (e.g., with 2% trichloroacetic acid or 3% dichloroacetic acid in dichloromethane for 50 seconds or more). The deoxyribonucleosides with deprotected, free hydroxyl groups are then coupled with a photolabile protecting group such as NPPOC. Afterwards, a higher concentration of the deprotecting acid is used to remove all of the remaining acid-labile protecting groups from the spacer layer, which allows the light-directed 3′ to 5′ photolithographic synthesis of DNA arrays starting from the newly deprotected deoxyribonucleoside phosphoramidites. After photolithographic synthesis of the template DNA strands, these are protected “capped” by a phenoxyacetyl group or an acetyl group at the 5′ end to block undesired further synthesis. Finally, the photolabile NPPOC protecting groups on the 5′-linked, protected ribonucleoside phosphoramidites are removed by irradiation with UV light to expose 3′ hydroxyl groups of the 5′-linked ribonucleosides for chemical synthesis of an RNA primer complementary consensus sequence.
  • In some embodiments the length of the template DNA strands ranges from about 20 bases to about 80 bases, e.g., about 25 bases, 27 bases, 28 bases, 29 bases, 35 bases, 40 bases, 60 bases, 70 bases, or another length from about 20 bases to about 80 bases.
  • In some embodiments the template DNA strands to be synthesized can be synthesized to obtain a range of template DNA strand densities ranging from about 20 to about 1,000,000 features/cm2, e.g., about 25, 30, 40, 50, 60, 65, 70, 75, 80, 100, 120, 150, 200, 300, 500, 750, 1,000, 2,000, 2,500, 3,000, 3,500, 3,750, 4,200, 4,500, 5,000, 6,000, 6,500, 7,000, 7,500, 8,000, 9,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another feature density from about 20 features/cm2 to about 1,000,000 features/cm2.
  • In various embodiments the template DNA strands to be synthesized represent at least 20 unique sequences to about 1,000,000 unique sequences, e.g., 30, 50, 100, 130, 145, 148, 150, 155, 160, 200, 500, 1,000, 1,500, 2,000, 3,000, 5,000, 10,000, 15,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another number of unique sequences. In some embodiments the template DNA oligonucleotide sequences comprise a series of subsequences that are shifted relative to each other by a single terminal nucleotide, where the template DNA oligonucleotide sequences, in aggregate, cover a longer contiguous sequence, e.g., a genomic DNA sequence, a cDNA sequence, a vector sequence etc. In one embodiment, the template DNA oligonucleotides are synthesized in a tiling pattern that covers a source sequence, e.g., a genomic promoter sequence, in order in the 5′ to 3′ direction.
  • In various embodiments the RNA primer sequences generated in the template array are approximately the same size as the template consensus sequence in the range of about 4 ribonucleotides to about 20 ribonucleotides, e.g., about 5 ribonucleotides, 6 ribonucleotides, 7 ribonucleotides, 8 ribonucleotides, 9 ribonucleotides, 10 ribonucleotides, 11 ribonucleotides, 12 ribonucleotides, 13 ribonucleotides, 14 ribonucleotides, 16 ribonucleotides, 18 ribonucleotides, 18 ribonucleotides, or another length from about 4 ribonucleotides to about 20 ribonucleotides. In an exemplary embodiment, the RNA primer sequence comprises the complementary consensus sequence: 5′-GGACACGGCGAA-3′ (SEQ ID NO:2).
  • In some embodiments the ribonucleoside phosphoramidites used to extend the 5′-linked ribonucleosides are RNase-resistant modified ribonucleosides. Examples of RNase-resistant modified ribonucleosides include, but are not limited to, 2-fluoro ribonucleosides, 2-amino ribonucleosides and 2-methoxy ribonucleosides.
  • Also described herein are methods to generate RNA arrays (including high density RNA arrays) from the above-described template arrays.
  • In some embodiments a method to generate an RNA array starts from a template array, which comprises an array of: (a) single-stranded template DNAs linked at their 3′ ends to a solid support and comprising a consensus sequence; and (b) single-stranded RNA primers that are covalently linked at their 5′ ends to the solid support, and that are complementary to the consensus sequence of the single-stranded template DNAs. The template RNA array is then incubated under hybridization conditions permissive for the 5′-covalently linked single-stranded RNA primers to hybridize with the complementary consensus sequence of the 3′-covalently linked single-stranded template DNAs. Suitable hybridization conditions are well known in the art, as described in, e.g., Tsai et al (2005), Molecular Biotechnology, 29(3):221-224. The hybridized RNA primers are then extended 5′ to 3′ along the single-stranded template DNAs using an RNA polymerase and ribonucleoside triphosphates to obtain double-stranded DNA-RNA hybrids. Afterwards, DNase treatment is used to eliminate template oligonucleotides within the DNA-RNA hybrids and unhybridized template DNA oligonucleotides, thereby yielding an RNA array.
  • In some embodiments, RNA primers, having a consensus sequence, are synthesized on a spacer layer first, to obtain a layer of 5′-linked RNA primers bound to a solid support surface. Afterwards, template DNA oligonucleotides comprising a consensus sequence at the 3′ end, and a unique sequence at a 5′ position relative to the consensus sequence, are added, in solution, to the 5′-linked RNA primer layer and hybridized. The hybridized RNA primers are then extended by an RNA polymerase to generate cRNA copies of the template DNA oligonucleotides. The DNA oligonucleotides are then removed by DNase digestion to obtain a cRNA array. In such embodiments, the unique cRNA sequence at each position is then “decoded” by sequential hybridization decoding as described in, e.g., Gunderson et al (2004), Genome Research, 14:870-877.
  • In some embodiments, RNA primers are 5′-linked primers on the surface of beads and comprising a consensus sequence. For individual pools of RNA-primer bound beads, a pool of template DNA oligonucleotides comprising a sequence complementary to the consensus sequence in the bead-bound primers and a unique sequence are then hybridized with the bead-bound RNA primers. Afterwards, an RNA polymerase is used to extend the hybridized bead-bound RNA primers to make bead-bound cRNAs of the template DNA oligonucleotides. The DNA is then removed to obtain a pool of bead-bound cRNAs (an “RNA bead pool”). One of ordinary skill in the art will appreciate that by using any of a number of known coding schemes (e.g., color-based or size based), RNA bead pools can be combined to obtain an RNA bead array, where each RNA bead pool within the array represents a unique RNA sequence.
  • In some embodiments the RNA polymerase used to extend the RNA primer is a T7 RNA polymerase or a T3 RNA polymerase. In one embodiment, the RNA polymerase to be used is T7 RNA polymerase. In some embodiments the ribonucleoside triphosphates to be used are modified ribonucleoside triphosphates. In one embodiment, the modified ribonucleoside triphosphates to be used in the method are RNase-resistant modified ribonucleoside triphosphates. Examples of suitable RNase-resistant modified ribonucleoside triphosphates include, but are not limited to, 2′-fluoro ribonucleosides and 2′-methoxy ribonucleosides. In some embodiments the modified ribonucleoside triphosphates are fluorescent modified ribonucleoside triphosphates. In cases where modified ribonucleosides are used for synthesis of array RNAs, modified ribonucleotides can be substituted for 1, 2, 3, or all four of the possible ribonucleoside types (A, U, G, C). In some embodiments for a given type of ribonucleoside, both modified and unmodified ribonucleosides are used for RNA synthesis with an RNA polymerase. The proportion of modified ribonucleotide used during RNA-polymerase-mediated RNA synthesis can range from 0 to 100%, e.g., from 5%, 10%, 20%, 30%, 50%, 60%, 70%, 90%, or another proportion of ribonucleosides to be used for RNA synthesis with an RNA polymerase.
  • III. COMPOSITIONS
  • Described herein are RNA arrays (including high density RNA arrays) and array templates.
  • RNA Arrays
  • In some embodiments the RNA arrays described herein comprise RNAs linked at their 5′ ends to a solid support. In some embodiments, the RNAs included in the high density array represent at least 20 unique RNA sequences and have a density of at least about 20 features/cm2.
  • In some embodiments the RNAs are covalently linked at their 5′ ends to the solid support, indirectly, through a bridging moiety and a spacer covalently bound to the surface of the solid support. For example, the spacer can be a polyethylene glycol with a molecular weight of about 2000 daltons (PEG 2000) or 4500 daltons (PEG 4500). The bridging moiety, in some embodiments is a photolabile or acid-labile protected deoxynucleoside phosphoramidite covalently linked to a 3′ hydroxyl group of the spacer.
  • In some embodiments the 5′ ends of the RNAs in the high density RNA array encompass a sequence of about 8 to about 15 ribonucleotides (e.g., 9, 10, 12, 14 or another number of ribonucleotides from about 8 to about 15 ribonucleotides), which are termed an “RNA primer complementary consensus sequence,” herein. Typically, the RNA primer complementary consensus sequence comprises one or more 2′-methoxy ribonucleoside triphosphates, which are introduced during photolithographic synthesis of the RNA primer consensus sequence. While not wishing to be bound by theory, it is believed that the incorporation of 2-methoxyribonucleoside triphosphates facilitates hybridization by the RNA primer consensus sequence to its complement during synthesis of the high density RNA array, as described herein, and also confers RNase resistance.
  • In some embodiments the RNAs covalently linked to the solid support, comprise one or more modified ribonucleotides. In some embodiments the modified ribonucleotides confer resistance to ribonuclease. Examples of modified ribonucleotides that confer resistance to ribonucleases include, but are not limited to, 2′-methoxy ribonucleoside triphosphates, 2′-fluoro ribonucleoside triphosphates, 2′-amino ribonucleosides, 5-bromouridine-5′-triphosphates, 4-thiouridine-5′-triphosphates and 6-thioguanosine-5′-triphosphates. In other embodiments modified nucleotides include fluorescently modified ribonucleoside triphosphates (e.g., Cy5-ribonucleoside triphosphates) or hapten-modified ribonucleoside triphosphates (e.g., biotin-, or aminoallyl-modified ribonucleoside triphosphates) as known and used in the art. In some embodiments 100% of the constituent ribonucleotides in the RNAs of the high density RNA arrays are modified ribonucleotides. In other embodiments the proportion of modified ribonucleotides in the RNAs ranges from about 5% to about 95% of the ribonucleotides in the array RNAs, e.g., about 7%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 75%, or another proportion of the modified ribonucleotides ranging from about 5% to about 95% of the ribonucleotides. Where modified ribonucleotides are included in the array RNAs, 1, 2, 3, or all 4 of the ribonucleotides (i.e., A, U, G, or C) may include modified ribonucleotides.
  • Typically, the RNA arrays disclosed herein will represent at least 20 unique RNA sequences to about 1,000,000 unique RNA sequences, e.g., 30, 50, 100, 130, 145, 148, 150, 155, 160, 200, 500, 1,000, 1,500, 2,000, 3,000, 5,000, 10,000, 15,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another number of unique RNA sequences from at least 20 unique RNA sequences to about 1,000,000 unique RNA sequences. In one embodiment, the number of unique RNA sequences is about 50 to about 1,000 unique RNA sequences. In another embodiment, the number of unique RNA sequences is about 10 to about 200 unique RNA sequences. In another embodiment, the number of unique RNA sequences is about 100,000 sequences.
  • In various embodiments the length of the RNAs included in the disclosed RNA arrays ranges from at least about 20 ribonucleotides to about 80 ribonucleotides, e.g., about 25 ribonucleotides, 27 ribonucleotides, 28 ribonucleotides, 29 ribonucleotides, 35 ribonucleotides, 40 ribonucleotides, 60 ribonucleotides, 70 ribonucleotides, or another length from about 20 ribonucleotides to about 80 ribonucleotides.
  • In some embodiments the RNA arrays provided herein comprise a feature density of about 20 features/cm2 to about 1,000,000 features/cm2, e.g., about 25, 30, 40, 50, 60, 65, 70, 75, 80, 100, 120, 150, 200, 300, 500, 750, 1,000, 2,000, 2,500, 3,000, 3,500, 3,750, 4,200, 4,500, 5,000, 6,000, 6,500, 7,000, 7,500, 8,000, 9,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another feature density from about 20 features/cm2 to about 1,000,000 features/cm2. In some embodiments the disclosed RNA arrays have a feature density of about 50,000 features/cm2 to about 1,000,000 features/cm2.
  • Suitable solid support materials for RNA arrays include, but are not limited to, amorphous carbon, glassy carbon, and polymer or silanized glass. In some embodiments the solid support material used for RNA arrays is amorphous carbon.
  • Template Arrays
  • Also disclosed herein are template arrays that are useful intermediate compositions for generating the RNA arrays described herein. In some embodiments a template array comprises an array of (i) single-stranded template oligonucleotides linked at their 3′ end to a solid support, comprising a consensus sequence, and capped by a protecting group (e.g., an phenoxyacetyl group) group at their 5′ end; and (ii) single-stranded RNA primers that are covalently linked at their 5′ end to the solid support, and that are complementary to the consensus sequence, wherein the single-stranded RNA primers hybridize to the single-stranded template DNAs.
  • In some embodiments of the template array, the 5′ ends of the RNAs in the template array encompass a sequence of about 4 to about 20 ribonucleotides (e.g., 5, 6, 8, 9, 10, 12, 14, 16, 17, 18, or another number of ribonucleotides from about 4 to about 20 ribonucleotides), which are termed an “RNA primer complementary consensus sequence,” herein. Typically, the RNA primer complementary consensus sequence comprises one or more modified ribonucleotides (e.g., RNase-resistant ribonucleotides such as 2′-methoxy ribonucleotides or 2′-fluoro ribonucleotides), or mixtures of unmodified and modified ribonucleotides, which are introduced during synthesis of the RNA primer consensus sequence.
  • In various embodiments single-stranded template DNA oligonucleotides and single-stranded RNA primers are linked at their 3′ and 5′ ends, respectively, to a bridging moiety (e.g., a deoxynucleotide), which in turn is linked to a spacer such as PEG 2000 or PEG 4500. The spacer provides a means of linking the single-stranded template DNA oligonucleotides and RNA primers to a solid support for the template array. Suitable solid support materials for template arrays include any materials compatible with RNA arrays, as described herein.
  • In some embodiments the template arrays provided herein comprise a feature density of about 20 features/cm2 to about 1,000,000 features cm2, e.g., about 25, 30, 40, 50, 60, 65, 70, 75, 80, 100, 120, 150, 200, 300, 500, 750, 1,000, 2,000, 2,500, 3,000, 3,500, 3,750, 4,200, 4,500, 5,000, 6,000, 6,500, 7,000, 7,500, 8,000, 9,000, 20,000, 50,000, 100,000, 200,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, or another feature density from about 20 features/cm2 to about 1,000,000 features/cm2. In some embodiments the disclosed RNA arrays have a feature density of about 5,000 features/cm2 to about 1,000,000 features/cm2.
  • In various embodiments template DNAs and RNA primers in the above-mentioned are in situ synthesized, in a base-by-base manner, using maskless array synthesizer (MAS) technology, as described in, e.g., Phillips et al (2008), Nucleic Acids Res, 36(1).
  • Kits
  • Also disclosed herein are kits that include a template array as described herein and any of (i) an RNA polymerase; (ii) ribonucleoside triphosphates; and (iii) a DNase. For example, in some cases the kit contains a template array and ribonucleoside triphosphates. In some embodiments the ribonucleoside triphosphates included in the kit are modified ribonucleoside triphosphates that are RNase-resistant. Such modified RNase-resistant nucleotides include, but are not limited, to 2′-methoxy ribonucleoside triphosphates, 2′-fluororibonucleoside triphosphates, 2′-amino ribonucleosides, 5-bromouridine-5′-triphosphates, 4-thiouridine-5′-triphosphates, and 6-thioguanosine-5′-triphosphates. In other embodiments the template array kit includes a template array and an RNA polymerase suitable for catalyzing primer-dependent biosynthesis of RNA using a DNA template. Examples of suitable RNA polymerases include, but are not limited to T7 RNA polymerase and T3 RNA polymerase. In some embodiments the template array kit contains a template array and a DNase, e.g., DNase I, T7 exonuclease, or Rec J exonuclease.
  • In one embodiment, the kits disclosed herein comprise a template array, an RNA polymerase, ribonucleoside triphosphates, and a DNase.
  • Optionally, any of the above-mentioned kits will also include instructions for generating an RNA array from the included template array using an RNA polymerase, ribonucleoside triphosphates, and a DNase according to the methods disclosed herein.
  • EXAMPLES Example 1 Generation of an RNA Array from a Mouse Insulin-Like Growth Factor Binding Protein-1 (IGFPBP1) Promoter DNA Template
  • In contrast to high density DNA microarrays that have been commercially available worldwide for more than a decade, a high density RNA microarray has not been generated until now due to the difficulty of synthesis. Hundred bases-long DNA microarrays have been made, owing to the mature state of the art for DNA synthesis and phosphoramidite chemistry, with high fidelity having been reported. We describe here an enzymatic method to fabricate high density RNA arrays by taking advantage of the high quality and length of DNA arrays.
  • FIG. 1A depicts the process of fabricating a high density DNA template array to be employed for enzymatic synthesis of a high density RNA array. In an exemplary procedure, light-directed photolithographic synthesis of DNA arrays is performed on a carbon surface that is functionalized with hydroxyl groups. A quarter of the full deprotecting dose of UV light (365 nm) is used to remove half of the photolabile protecting groups (3′-nitrophenylpropyloxycarbonyl, NPPOC) on the first layer of deoxyribonucleosides, which is covalently coupled to polyethylene glycol 2000 spacers on the carbon surface. The deoxyribonucleosides with free hydroxyl groups are then coupled with acid-labile DMT (4,4′-dimethoxytrityl) protected ribonucleoside phosphoramidites. A full dose of UV light is used to remove all of the photolabile protecting groups on the first layer and enables the light-directed photolithographic synthesis of DNA arrays using the method described in Wu et al supra. The 5′ ends of DNA oligonucleotides on the surface are then capped by acetylation to block undesired synthesis from the termini. Each element of the DNA arrays includes a consensus DNA sequence at the 3′ end, which later serves as a complement to the 2′-methoxy RNA primer. Finally, the acid-labile DMT protecting groups on the first layer are removed with dichloroacetic acid to reveal 3′ hydroxyl groups of the ribonucleosides for the chemical synthesis of 2′-methoxy RNA primer, that includes the consensus sequence, in the 5′ to 3′ direction, which is then extended enzymatically by T7 RNA polymerase in a subsequent step.
  • FIG. 1B lays out the process of enzymatic synthesis of a high density RNA array. The oligonucleotide array was denatured and reannealed for RNA extension by T7 or T3 RNA polymerase). Either unmodified or fluorinated ribonucleoside triphosphates can be used for the synthesis of unmodified or 2′-fluorine-modified RNA oligonucleotides for better resistance to RNase. DNA endonuclease, e.g., DNase I, is then used to remove the DNA template from the array to yield the final high density RNA array.
  • To demonstrate proof of concept, an RNA tiling array was fabricated to characterize the products of a T7 exonuclease (a 5′ dsDNA exonuclease) digestion reaction. The RNA tiling array allowed us to optimize the generation of single-stranded DNA for sequence-specific capture on the RNA array. We fabricated an RNA tiling array containing all possible 20mer complements, thereby spanning the entire 180 base long IGFBP1 promoter DNA in 161 single-base increments (see Text 1 for the target sequence, Table 1 for design of the “DNA template array”, and Table 2 for the copied “tiling RNA array”).
  • The DNA fragment corresponding to positions −205 to −25 of the mouse IGFBP1 promoter was amplified by PCR from NIH 3T3 (mouse embryonic fibroblast cell line) genomic DNA (purchased from New England Biolabs, MA, USA):
  • Figure US20140235505A1-20140821-C00001
  • The primer sequences used to amplify the IGFBP1 promoter amplicon are: 5′-TTA GCT CCT GTC CCA GTC CAT-3′ (SEQ ID NO:4) and 5′-TAT GAA GGG CTG GCT GTG C-3′ (SEQ ID NO:5). A 5′ phosphorothioate protected oligonucleotide with 6-carboxyfluorescein (FAM) tag (5′-T*/iFluorT/A GCT CCT GTC CCA GTC CAT-3′) (SEQ ID NO:6) was used to produce a 180 bp fluorescently tagged IGFBP1 promoter DNA amplicon
  • A DNA template array was generated by first synthesizing a template consensus sequence (5′-TTCGCCGTGTCC-3′) (SEQ ID NO:1) in array format. The template consensus sequence, which is complementary to an RNA primer consensus sequence, was synthesized from 3′ to 5′ at all positions on the array prior to the synthesis of the sequences in Table 1 at various positions from 3′ to 5′ using 5′-NPPOC-protected deoxyribonucleoside phosphoramidites. Afterwards, the position-specific sequences were also synthesized 3′ to 5′. So, for example, at locations in the array, where the sequence position is listed as “1-20” in Table 1, the actual complete sequence at those locations on the array, is ‘: 3′-CCTGTGCCGCTT-ACCTGACCCTGTCCTCGATT-5′ (SEQ ID NO:7) (where the underlining indicates the complement of the RNA consensus sequence).
  • The sequences listed in Table 1 served as the DNA templates for an RNA polymerase extension reaction to produce the RNA array that could be used to capture IGFBP1 promoter DNA.
  • DNA quality control probe 1 (DNA QC1) is the complementary sequence to the fluorescently labeled ssDNA called “ApoE” for quality control purposes. DNA quality probe 2 (DNA QC2) is the complementary sequence to the fluorescently labeled ssDNA called “w1282” for quality control purposes. DNA quality probe 3 (DNA QC3) is the same probe sequence as the fluorescently labeled ssDNA called “ApoE” for quality control purposes. DNA quality probe 4 (DNA QC4) is the same probe sequence as the fluorescently labeled ssDNA called “w1282” for quality control purposes.
  • The fluorescently labeled “ApoE” ssDNA is capturable to QC1 but not QC3 in the template array. The fluorescently labeled “w1282” ssDNA is capturable to QC2 but not QC4 in the “template DNA array.
  • TABLE 1
    IGFBP1 promoter template DNA array
    oligonucleotide sequences.
    Name/Position
    DNA Sequence (3′->5′)
    Blank
    DNA QC1 CGGCTACTGGACGTTCTCA
    (SEQ ID NO: 8)
    DNA QC2 TATTGAAACGTTGTCACC
    (SEQ ID NO: 9)
    DNA QC3 TGAGAACGTCCAGTAGCCG
    (SEQ ID NO: 10)
    DNA QC4 GGTGACAACGTTTCAATA
    (SEQ ID NO: 11)
    161 to 180 3′-ATACTTCCCGACCGACACGC-5′
    (SEQ ID NO: 12)
    160 to 179 TACTTCCCGACCGACACGCC
    (SEQ ID NO: 13)
    159 to 178 ACTTCCCGACCGACACGCCG
    (SEQ ID NO: 14)
    158 to 177 CTTCCCGACCGACACGCCGT
    (SEQ ID NO: 15)
    157 to 176 TTCCCGACCGACACGCCGTG
    (SEQ ID NO: 16)
    156 to 175 TCCCGACCGACACGCCGTGT
    (SEQ ID NO: 17)
    155 to 174 CCCGACCGACACGCCGTGTC
    (SEQ ID NO: 18)
    154 to 173 CCGACCGACACGCCGTGTCC
    (SEQ ID NO: 19)
    153 to 172 CGACCGACACGCCGTGTCCA
    (SEQ ID NO: 20)
    152 to 171 GACCGACACGCCGTGTCCAA
    (SEQ ID NO: 21)
    151 to 170 ACCGACACGCCGTGTCCAAT
    (SEQ ID NO: 22)
    150 to 169 CCGACACGCCGTGTCCAATT
    (SEQ ID NO: 23)
    149 to 168 CGACACGCCGTGTCCAATTA
    (SEQ ID NO: 24)
    148 to 167 GACACGCCGTGTCCAATTAC
    (SEQ ID NO: 25)
    147 to 166 ACACGCCGTGTCCAATTACT
    (SEQ ID NO: 26)
    146 to 165 CACGCCGTGTCCAATTACTA
    (SEQ ID NO: 27)
    145 to 164 ACGCCGTGTCCAATTACTAA
    (SEQ ID NO: 28)
    144 to 163 CGCCGTGTCCAATTACTAAC
    (SEQ ID NO: 29)
    143 to 162 GCCGTGTCCAATTACTAACA
    (SEQ ID NO: 30)
    142 to 161 CCGTGTCCAATTACTAACAG
    (SEQ ID NO: 31)
    141 to 160 CGTGTCCAATTACTAACAGT
    (SEQ ID NO: 32)
    140 to 159 GTGTCCAATTACTAACAGTC
    (SEQ ID NO: 33)
    139 to 158 TGTCCAATTACTAACAGTCC
    (SEQ ID NO: 34)
    138 to 157 GTCCAATTACTAACAGTCCC
    (SEQ ID NO: 35)
    137 to 156 TCCAATTACTAACAGTCCCG
    (SEQ ID NO: 36)
    136 to 155 CCAATTACTAACAGTCCCGT
    (SEQ ID NO: 37)
    135 to 154 CAATTACTAACAGTCCCGTC
    (SEQ ID NO: 38)
    134 to 153 AATTACTAACAGTCCCGTCG
    (SEQ ID NO: 39)
    133 to 152 ATTACTAACAGTCCCGTCGC
    (SEQ ID NO: 40)
    132 to 151 TTACTAACAGTCCCGTCGCA
    (SEQ ID NO: 41)
    131 to 150 TACTAACAGTCCCGTCGCAC
    (SEQ ID NO: 42)
    130 to 149 ACTAACAGTCCCGTCGCACG
    (SEQ ID NO: 43)
    129 to 148 CTAACAGTCCCGTCGCACGA
    (SEQ ID NO: 44)
    128 to 147 TAACAGTCCCGTCGCACGAT
    (SEQ ID NO: 45)
    127 to 146 AACAGTCCCGTCGCACGATC
    (SEQ ID NO: 46)
    126 to 145 ACAGTCCCGTCGCACGATCC
    (SEQ ID NO: 47)
    125 to 144 CAGTCCCGTCGCACGATCCT
    (SEQ ID NO: 48)
    124 to 143 AGTCCCGTCGCACGATCCTG
    (SEQ ID NO: 49)
    123 to 142 GTCCCGTCGCACGATCCTGG
    (SEQ ID NO: 50)
    122 to 141 TCCCGTCGCACGATCCTGGG
    (SEQ ID NO: 51)
    121 to 140 CCCGTCGCACGATCCTGGGG
    (SEQ ID NO: 52)
    120 to 139 CCGTCGCACGATCCTGGGGT
    (SEQ ID NO: 53)
    119 to 138 CGTCGCACGATCCTGGGGTC
    (SEQ ID NO: 54)
    118 to 137 GTCGCACGATCCTGGGGTCA
    (SEQ ID NO: 55)
    117 to 136 TCGCACGATCCTGGGGTCAC
    (SEQ ID NO: 56)
    116 to 135 CGCACGATCCTGGGGTCACA
    (SEQ ID NO: 57)
    115 to 134 GCACGATCCTGGGGTCACAA
    (SEQ ID NO: 58)
    114 to 133 CACGATCCTGGGGTCACAAG
    (SEQ ID NO: 59)
    113 to 132 ACGATCCTGGGGTCACAAGT
    (SEQ ID NO: 60)
    112 to 131 CGATCCTGGGGTCACAAGTT
    (SEQ ID NO: 61)
    111 to 130 GATCCTGGGGTCACAAGTTT
    (SEQ ID NO: 62)
    110 to 129 ATCCTGGGGTCACAAGTTTT
    (SEQ ID NO: 63)
    109 to 128 TCCTGGGGTCACAAGTTTTA
    (SEQ ID NO: 64)
    108 to 127 CCTGGGGTCACAAGTTTTAT
    (SEQ ID NO: 65)
    107 to 126 CTGGGGTCACAAGTTTTATT
    (SEQ ID NO: 66)
    106 to 125 TGGGGTCACAAGTTTTATTC
    (SEQ ID NO: 67)
    105 to1 24 GGGGTCACAAGTTTTATTCA
    (SEQ ID NO: 68)
    104 to 123 GGGTCACAAGTTTTATTCAA
    (SEQ ID NO: 69)
    103 to 122 GGTCACAAGTTTTATTCAAA
    (SEQ ID NO: 70)
    102 to 121 GTCACAAGTTTTATTCAAAC
    (SEQ ID NO: 71)
    101 to 120 TCACAAGTTTTATTCAAACA
    (SEQ ID NO: 72)
    100 to 119 CACAAGTTTTATTCAAACAA
    (SEQ ID NO: 73)
     99 to 118 ACAAGTTTTATTCAAACAAA
    (SEQ ID NO: 74)
     98 to 117 CAAGTTTTATTCAAACAAAA
    (SEQ ID NO: 75)
     97 to 116 AAGTTTTATTCAAACAAAAC
    (SEQ ID NO: 76)
     96 to 115 AGTTTTATTCAAACAAAACG
    (SEQ ID NO: 77)
     95 to 114 GTTTTATTCAAACAAAACGA
    (SEQ ID NO: 78)
     94 to 113 TTTTATTCAAACAAAACGAA
    (SEQ ID NO: 79)
     93 to 112 TTTATTCAAACAAAACGAAC
    (SEQ ID NO: 80)
     92 to 111 TTATTCAAACAAAACGAACA
    (SEQ ID NO: 81)
     91 to 110 TATTCAAACAAAACGAACAC
    (SEQ ID NO: 82)
     90 to 109 ATTCAAACAAAACGAACACT
    (SEQ ID NO: 83)
     89 to 108 TTCAAACAAAACGAACACTC
    (SEQ ID NO: 84)
     88 to 107 TCAAACAAAACGAACACTCG
    (SEQ ID NO: 85)
     87 to 106 CAAACAAAACGAACACTCGA
    (SEQ ID NO: 86)
     86 to 105 AAACAAAACGAACACTCGAG
    (SEQ ID NO: 87)
     85 to 104 AACAAAACGAACACTCGAGA
    (SEQ ID NO: 88)
     84 to 103 ACAAAACGAACACTCGAGAT
    (SEQ ID NO: 89)
    Sequence (3′-->5′)
     83 to 102 CAAAACGAAC
    ACTCGAGATG
    (SEQ ID NO: 90)
     82 to 101 AAAACGAACA
    CTCGAGATGT
    (SEQ ID NO: 91)
     81 to 100 AAACGAACAC
    TCGAGATGTG
    (SEQ ID NO: 92)
     80 to 99 AACGAACACT
    CGAGATGTGT
    (SEQ ID NO: 93)
     79 to 98 ACGAACACTC
    GAGATGTGTT
    (SEQ ID NO: 94)
     78 to 97 CGAACACTCG
    AGATGTGTTT
    (SEQ ID NO: 95)
     77 to 96 GAACACTCGA
    GATGTGTTTG
    (SEQ ID NO: 96)
     76 to 95 AACACTCGAG
    ATGTGTTTGG
    (SEQ ID NO: 97)
     75 to 94 ACACTCGAGA
    TGTGTTTGGC
    (SEQ ID NO: 98)
     74 to 93 CACTCGAGAT
    GTGTTTGGCA
    (SEQ ID NO: 99)
     73 to 92 ACTCGAGATG
    TGTTTGGCAC
    (SEQ ID NO: 100)
     72 to 91 CTCGAGATGT
    GTTTGGCACC
    (SEQ ID NO: 101)
     71 to 90 TCGAGATGTG
    TTTGGCACCC
    (SEQ ID NO: 102)
     70 to 89 CGAGATGTGT
    TTGGCACCCA
    (SEQ ID NO: 103)
     69 to 88 GAGATGTGTTT
    GGCACCCAC
    (SEQ ID NO: 104)
     68 to 87 AGATGTGTTTG
    GCACCCACC
    (SEQ ID NO: 105)
     67 to 86 GATGTGTTTGG
    CACCCACCT
    (SEQ ID NO: 106)
     66 to 85 ATGTGTTTGGC
    ACCCACCTT
    (SEQ ID NO: 107)
     65 to 84 TGTGTTTGGCA
    CCCACCTTC
    (SEQ ID NO: 108)
     64 to 83 GTGTTTGGCAC
    CCACCTTCC
    (SEQ ID NO: 109)
     63 to 82 TGTTTGGCACC
    CACCTTCCC
    (SEQ ID NO: 110)
     62 to 81 GTTTGGCACCC
    ACCTTCCCC
    (SEQ ID NO: 111)
     61 to 80 TTTGGCACCCA
    CCTTCCCCC
    (SEQ ID NO: 112)
     60 to 79 TTGGCACCCA
    CCTTCCCCCA
    (SEQ ID NO: 113)
     59 to 78 TGGCACCCAC
    CTTCCCCCAT
    (SEQ ID NO: 114)
     58 to 77 GGCACCCACC
    TTCCCCCATT
    (SEQ ID NO: 115)
     57 to 76 GCACCCACCTT
    CCCCCATTT
    (SEQ ID NO: 116)
     56 to 75 CACCCACCTTC
    CCCCATTTC
    (SEQ ID NO: 117)
     55 to 74 ACCCACCTTCC
    CCCATTTCC
    (SEQ ID NO: 118)
     54 to 73 CCCACCTTCCC
    CCATTTCCC
    (SEQ ID NO: 119)
     53 to 72 CCACCTTCCCC
    CATTTCCCT
    (SEQ ID NO: 120)
     52 to 71 CACCTTCCCCC
    ATTTCCCTA
    (SEQ ID NO: 121)
     51 to 70 ACCTTCCCCCA
    TTTCCCTAG
    (SEQ ID NO: 122)
     50 to 69 CCTTCCCCCAT
    TTCCCTAGT
    (SEQ ID NO: 123)
     49 to 68 CTTCCCCCATT
    TCCCTAGTC
     48 to 67 TTCCCCCATTT
    CCCTAGTCC
    (SEQ ID NO: 124)
     47 to 66 TCCCCCATTTC
    CCTAGTCCA
    (SEQ ID NO: 125)
     46 to 65 CCCCCATTTCC
    CTAGTCCAA
    (SEQ ID NO: 126)
     45 to 64 CCCCATTTCCC
    TAGTCCAAA
    (SEQ ID NO: 127)
     44 to 63 CCCATTTCCCT
    AGTCCAAAA
    (SEQ ID NO: 128)
     43 to 62 CCATTTCCCTA
    GTCCAAAAG
     42 to 61 CATTTCCCTAG
    TCCAAAAGA
    (SEQ ID NO: 129)
     41 to 60 ATTTCCCTAGT
    CCAAAAGAT
    (SEQ ID NO: 130)
     40 to 59 TTTCCCTAGTC
    CAAAAGATG
     39 to 58 TTCCCTAGTCC
    AAAAGATGA
    (SEQ ID NO: 131)
     38 to 57 TCCCTAGTCCA
    AAAGATGAT
    (SEQ ID NO: 132)
     37 to 56 CCCTAGTCCA
    AAAGATGATA
    (SEQ ID NO: 133)
     36 to 55 CCTAGTCCAA
    AAGATGATAC
    (SEQ ID NO: 134)
     35 to 54 CTAGTCCAAA
    AGATGATACA
     34 to 53 TAGTCCAAAA
    GATGATACAA
    (SEQ ID NO: 135)
     33 to 52 AGTCCAAAAG
    ATGATACAAA
    (SEQ ID NO: 136)
     32 to 51 GTCCAAAAGA
    TGATACAAAC
    (SEQ ID NO: 137)
     31 to 50 TCCAAAAGAT
    GATACAAACA
    (SEQ ID NO: 138)
     30 to 49 CCAAAAGATG
    ATACAAACAG
    (SEQ ID NO: 139)
     29 to 48 CAAAAGATGA
    TACAAACAGG
    (SEQ ID NO: 140)
     28 to 47 AAAAGATGAT
    ACAAACAGGG
    (SEQ ID NO: 141)
     27 to 46 AAAGATGATA
    CAAACAGGGC
    (SEQ ID NO: 142)
     26 to 45 AAGATGATAC
    AAACAGGGCA
    (SEQ ID NO: 143)
     25 to 44 AGATGATACA
    AACAGGGCAC
    (SEQ ID NO: 144)
     24 to 43 GATGATACAA
    ACAGGGCACC
    (SEQ ID NO: 145)
     23 to 42 ATGATACAAA
    CAGGGCACCA
    (SEQ ID NO: 146)
     22 to 41 TGATACAAAC
    AGGGCACCAC
    (SEQ ID NO: 147)
     21 to 40 GATACAAACA
    GGGCACCACT
    (SEQ ID NO: 148)
     20 to 39 ATACAAACAG
    GGCACCACTA
    (SEQ ID NO: 149)
     19 to 38 TACAAACAGG
    GCACCACTAC
    (SEQ ID NO: 150)
     18 to 37 ACAAACAGGG
    CACCACTACC
    (SEQ ID NO: 151)
     17 to 36 CAAACAGGGC
    ACCACTACCT
    (SEQ ID NO: 152)
     16 to 35 AAACAGGGCA
    CCACTACCTG
    (SEQ ID NO: 153)
     15 to 34 AACAGGGCAC
    CACTACCTGA
    (SEQ ID NO: 154)
     14 to 33 ACAGGGCACC
    ACTACCTGAC
    (SEQ ID NO: 155)
     13 to 32 CAGGGCACCA
    CTACCTGACC
    (SEQ ID NO: 156)
     12 to 31 AGGGCACCAC
    TACCTGACCC
    (SEQ ID NO: 157)
     11 to 30 GGGCACCACT
    ACCTGACCCT
    (SEQ ID NO: 158)
     10 to 29 GGCACCACTA
    CCTGACCCTG
    (SEQ ID NO: 159)
      9 to 28 GCACCACTAC
    CTGACCCTGT
    (SEQ ID NO: 160)
      8 to 27 CACCACTACCT
    GACCCTGTC
    (SEQ ID NO: 161)
      7 to 26 ACCACTACCT
    GACCCTGTCC
    (SEQ ID NO: 162)
      6 to 25 CCACTACCTG
    ACCCTGTCCT
    (SEQ ID NO: 163)
      5 to 24 CACTACCTGA
    CCCTGTCCTC
    (SEQ ID NO: 164)
      4 to 23 ACTACCTGAC
    CCTGTCCTCG
    (SEQ ID NO: 165)
      3 to 22 CTACCTGACCC
    TGTCCTCGA
    (SEQ ID NO: 166)
      2 to 21 TACCTGACCCT
    GTCCTCGAT
    (SEQ ID NO: 167)
      1 to 20 ACCTGACCCT
    GTCCTCGATT
    (SEQ ID NO: 168)
  • After completion of the DNA template sequence array, the RNA primer consensus sequence (5′-GGACACGGCGAA-3′) (SEQ ID NO:2) was synthesized in close proximity to positions occupied by the previously synthesized DNA template sequences. The RNA primer consensus sequence was synthesized from 5′ to 3′ using 3′-O-DMT-protected 2′-OMe-ribonucleoside phosphoramidites at multiple locations within the array. The newly synthesized RNA primers then hybridized to the DNA template consensus sequence, and served to prime RNA synthesis with T7 RNA polymerase and a DNA sequence template, as shown in FIG. 1. DNA endonuclease, e.g., DNase I, was then used to remove the DNA template from the array to yield the final high density RNA array. The RNA sequences synthesized in array format are shown in Table 2.
  • The sequences listed below are the RNA sequences enzymatically synthesized on the RNA array. RNA quality control probe 1 (RNA QC1) is the same probe sequence as the fluorescently labeled ssDNA called “ApoE” for quality control purposes. RNA quality control probe 2 (RNA QC2) is the same probe sequence as the fluorescently labeled ssDNA called “w1282” for quality control purposes. RNA quality control probe 3 (RNA QC3) is the complementary sequence to the fluorescently labeled ssDNA called “ApoE” for quality control purposes. RNA quality control probe 4 (RNA QC4) is the complementary sequence to the fluorescently labeled ssDNA called “w1282” for quality control purposes.
  • The fluorescently labeled “ApoE” ssDNA is capturable to QC3 but not QC 1 in the “tiling RNA array.” The fluorescently labeled “w1282” ssDNA is capturable to QC4 but not QC2 in the “tiling RNA array.”
  • TABLE 2
    IGFBP1 promoter tiling RNA array oligo-
    nucleotide sequences. (Note: The oligo-
    nucleotides were sequentially arranged
    on the tiling array in a clockwise order
    beginning at the center. The duplicate
    was arranged into the tiling array
    afterward.)
    Name/Position RNA Sequence (5′-->3′)
    Blank
    RNA QC1 GCCGAUGACCUGCAAGAGU
    (SEQ ID NO: 169)
    RNA QC2 AUAACUUUGCAACAGUGG
    (SEQ ID NO: 170)
    RNA QC3 ACUCUUGCAGGUCAUCGGC
    (SEQ ID NO: 171)
    RNA QC4 CCACUGUUGCAAAGUUAU
    (SEQ ID NO: 172)
    180 to 161 UAUGAAGGGCUGGCUGUGCG
    (SEQ ID NO: 173)
    179 to 160 AUGAAGGGCUGGCUGUGCGG
    (SEQ ID NO: 174)
    178 to 159 UGAAGGGCUGGCUGUGCGGC
    (SEQ ID NO: 175)
    177 to 158 GAAGGGCUGGCUGUGCGGCA
    (SEQ ID NO: 176)
    176 to 157 AAGGGCUGGCUGUGCGGCAC
    (SEQ ID NO: 177)
    175 to 156 AGGGCUGGCUGUGCGGCACA
    (SEQ ID NO: 178)
    174 to 155 GGGCUGGCUGUGCGGCACAG
    (SEQ ID NO: 179)
    173 to 154 GGCUGGCUGUGCGGCACAGG
    (SEQ ID NO: 180)
    172 to 153 GCUGGCUGUGCGGCACAGGU
    (SEQ ID NO: 181)
    171 to 152 CUGGCUGUGCGGCACAGGUU
    (SEQ ID NO: 182)
    170 to 151 UGGCUGUGCGGCACAGGUUA
    (SEQ ID NO: 183)
    169 to 150 GGCUGUGCGGCACAGGUUAA
    (SEQ ID NO: 184)
    168 to 149 GCUGUGCGGCACAGGUUAAU
    (SEQ ID NO: 185)
    167 to 148 CUGUGCGGCACAGGUUAAUG
    (SEQ ID NO: 186)
    166 to 147 UGUGCGGCACAGGUUAAUGA
    (SEQ ID NO: 187)
    165 to 146 GUGCGGCACAGGUUAAUGAU
    (SEQ ID NO: 188)
    164 to 145 UGCGGCACAGGUUAAUGAUU
    (SEQ ID NO: 189)
    163 to 144 GCGGCACAGGUUAAUGAUUG
    (SEQ ID NO: 190)
    162 to 143 CGGCACAGGUUAAUGAUUGU
    (SEQ ID NO: 191)
    161 to 142 GGCACAGGUUAAUGAUUGUC
    (SEQ ID NO: 192)
    160 to 141 GCACAGGUUAAUGAUUGUCA
    (SEQ ID NO: 193)
    159 to 140 CACAGGUUAAUGAUUGUCAG
    (SEQ ID NO: 194)
    158 to 139 ACAGGUUAAUGAUUGUCAGG
    (SEQ ID NO: 195)
    157 to 138 CAGGUUAAUGAUUGUCAGGG
    (SEQ ID NO: 196)
    156 to 137 AGGUUAAUGAUUGUCAGGGC
    (SEQ ID NO: 197)
    155 to 136 GGUUAAUGAUUGUCAGGGCA
    (SEQ ID NO: 198)
    154 to 135 GUUAAUGAUUGUCAGGGCAG
    (SEQ ID NO: 199)
    153 to 134 UUAAUGAUUGUCAGGGCAGC
    (SEQ ID NO: 200)
    152 to 133 UAAUGAUUGUCAGGGCAGCG
    (SEQ ID NO: 201)
    151 to 132 AAUGAUUGUCAGGGCAGCGU
    (SEQ ID NO: 202)
    150 to 131 AUGAUUGUCAGGGCAGCGUG
    (SEQ ID NO: 203)
    149 to 130 UGAUUGUCAGGGCAGCGUGC
    (SEQ ID NO: 204)
    148 to 129 GAUUGUCAGGGCAGCGUGCU
    (SEQ ID NO: 205)
    147 to 128 AUUGUCAGGGCAGCGUGCUA
    (SEQ ID NO: 206)
    146 to 127 UUGUCAGGGCAGCGUGCUAG
    (SEQ ID NO: 207)
    145 to 126 UGUCAGGGCAGCGUGCUAGG
    (SEQ ID NO: 208)
    144 to 125 GUCAGGGCAGCGUGCUAGGA
    (SEQ ID NO: 209)
    143 to 124 UCAGGGCAGCGUGCUAGGAC
    (SEQ ID NO: 210)
    142 to 123 CAGGGCAGCGUGCUAGGACC
    (SEQ ID NO: 211)
    141 to 122 AGGGCAGCGUGCUAGGACCC
    (SEQ ID NO: 212)
    140 to 121 GGGCAGCGUGCUAGGACCCC
    (SEQ ID NO: 213)
    139 to 120 GGCAGCGUGCUAGGACCCCA
    (SEQ ID NO: 214)
    138 to 119 GCAGCGUGCUAGGACCCCAG
    (SEQ ID NO: 215)
    137 to 118 CAGCGUGCUAGGACCCCAGU
    (SEQ ID NO: 216)
    136 to 117 AGCGUGCUAGGACCCCAGUG
    (SEQ ID NO: 217)
    135 to 116 GCGUGCUAGGACCCCAGUGU
    (SEQ ID NO: 218)
    134 to 115 CGUGCUAGGACCCCAGUGUU
    (SEQ ID NO: 219)
    133 to 114 GUGCUAGGACCCCAGUGUUC
    (SEQ ID NO: 220)
    132 to 113 UGCUAGGACCCCAGUGUUCA
    (SEQ ID NO: 221)
    131 to 112 GCUAGGACCCCAGUGUUCAA
    (SEQ ID NO: 222)
    130 to 111 CUAGGACCCCAGUGUUCAAA
    (SEQ ID NO: 223)
    129 to 110 UAGGACCCCAGUGUUCAAAA
    (SEQ ID NO: 224)
    128 to 109 AGGACCCCAGUGUUCAAAAU
    (SEQ ID NO: 225)
    127 to 108 GGACCCCAGUGUUCAAAAUA
    (SEQ ID NO: 226)
    126 to 107 GACCCCAGUGUUCAAAAUAA
    (SEQ ID NO: 227)
    125 to 106 ACCCCAGUGUUCAAAAUAAG
    (SEQ ID NO: 228)
    124 to 105 CCCCAGUGUUCAAAAUAAGU
    (SEQ ID NO: 229)
    123 to 104 CCCAGUGUUCAAAAUAAGUU
    (SEQ ID NO: 230)
    122 to 103 CCAGUGUUCAAAAUAAGUUU
    (SEQ ID NO: 231)
    121 to 102 CAGUGUUCAAAAUAAGUUUG
    (SEQ ID NO: 232)
    120 to 101 AGUGUUCAAAAUAAGUUUGU
    (SEQ ID NO: 233)
    119 to 100 GUGUUCAAAAUAAGUUUGUU
    (SEQ ID NO: 234)
    118 to 99 UGUUCAAAAUAAGUUUGUUU
    (SEQ ID NO: 235)
    117 to 98 GUUCAAAAUAAGUUUGUUUU
    (SEQ ID NO: 236)
    116 to 97 UUCAAAAUAAGUUUGUUUUG
    (SEQ ID NO: 237)
    115 to 96 UCAAAAUAAGUUUGUUUUGC
    (SEQ ID NO: 238)
    114 to 95 CAAAAUAAGUUUGUUUUGCU
    (SEQ ID NO: 239)
    113 to 94 AAAAUAAGUUUGUUUUGCUU
    (SEQ ID NO: 240)
    112 to 93 AAAUAAGUUUGUUUUGCUUG
    (SEQ ID NO: 241)
    111 to 92 AAUAAGUUUGUUUUGCUUGU
    (SEQ ID NO: 252)
    110 to 91 AUAAGUUUGUUUUGCUUGUG
    (SEQ ID NO: 243)
    109 to 90 UAAGUUUGUUUUGCUUGUGA
    (SEQ ID NO: 244)
    108 to 89 AAGUUUGUUUUGCUUGUGAG
    (SEQ ID NO: 245)
    107 to 88 AGUUUGUUUUGCUUGUGAGC
    (SEQ ID NO: 246)
    106 to 87 GUUUGUUUUGCUUGUGAGCU
    (SEQ ID NO: 247)
    105 to 86 UUUGUUUUGCUUGUGAGCUC
    (SEQ ID NO: 248)
    104 to 85 UUGUUUUGCUUGUGAGCUCU
    (SEQ ID NO: 249)
    103 to 84 UGUUUUGCUUGUGAGCUCUA
    (SEQ ID NO: 250)
    102 to 83 GUUUUGCUUGUGAG
    CUCUAC
    (SEQ ID NO: 250)
    101 to 82 UUUUGCUUGUGAGC
    UCUACA
    (SEQ ID NO: 252)
    100 to 81 UUUGCUUGUGAGCU
    CUACAC
    (SEQ ID NO: 253)
     99 to 80 UUGCUUGUGAGCUC
    UACACA
    (SEQ ID NO: 254)
     98 to 79 UGCUUGUGAGCUCU
    ACACAA
     97 to 78 GCUUGUGAGCUCUAC
    ACAAA
    (SEQ ID NO: 255)
     96 to 77 CUUGUGAGCUCUACA
    CAAAC
    (SEQ ID NO: 256)
     95 to 76 UUGUGAGCUCUACAC
    AAACC
    (SEQ ID NO: 257)
     94 to 75 UGUGAGCUCUACACA
    AACCG
    (SEQ ID NO: 258)
     93 to 74 GUGAGCUCUACACAA
    ACCGU
    (SEQ ID NO: 259)
     92 to 73 UGAGCUCUACACAAA
    CCGUG
     91 to 72 GAGCUCUACACAAAC
    CGUGG
    (SEQ ID NO: 260)
     90 to 71 AGCUCUACACAAACC
    GUGGG
    (SEQ ID NO: 261)
     89 to 70 GCUCUACACAAACCG
    UGGGU
    (SEQ ID NO: 262)
     88 to 69 CUCUACACAAACCGU
    GGGUG
    (SEQ ID NO: 263)
     87 to 68 UCUACACAAACCGUG
    GGUGG
    (SEQ ID NO: 264)
     86 to 67 CUACACAAACCGUGG
    GUGGA
    (SEQ ID NO: 265)
     85 to 66 UACACAAACCGUGGG
    UGGAA
    (SEQ ID NO: 266)
     84 to 65 ACACAAACCGUGGGU
    GGAAG
    (SEQ ID NO: 267)
     83 to 64 CACAAACCGUGGGUG
    GAAGG
    (SEQ ID NO: 268)
     82 to 63 ACAAACCGUGGGUG
    GAAGGG
    (SEQ ID NO: 269)
     81 to 62 CAAACCGUGGGUGG
    AAGGGG
    (SEQ ID NO: 270)
     80 to 61 AAACCGUGGGUGGA
    AGGGGG
    (SEQ ID NO: 271)
     79 to 60 AACCGUGGGUGGAA
    GGGGGU
    (SEQ ID NO: 272)
     78 to 59 ACCGUGGGUGGAAG
    GGGGUA
    (SEQ ID NO: 273)
     77 to 58 CCGUGGGUGGAAGG
    GGGUAA
    (SEQ ID NO: 274)
     76 to 57 CGUGGGUGGAAGGG
    GGUAAA
    (SEQ ID NO: 275)
     75 to 56 GUGGGUGGAAGGGG
    GUAAAG
    (SEQ ID NO: 276)
     74 to 55 UGGGUGGAAGGGGG
    UAAAGG
    (SEQ ID NO: 277)
     73 to 54 GGGUGGAAGGGGGU
    AAAGGG
    (SEQ ID NO: 278)
     72 to 53 GGUGGAAGGGGGUA
    AAGGGA
     71 to 52 GUGGAAGGGGGUAA
    AGGGAU
    (SEQ ID NO: 279)
     70 to 51 UGGAAGGGGGUAAA
    GGGAUC
    (SEQ ID NO: 280)
     69 to 50 GGAAGGGGGUAAAG
    GGAUCA
    (SEQ ID NO: 281)
     68 to 49 GAAGGGGGUAAAGG
    GAUCAG
    (SEQ ID NO: 282)
     67 to 48 AAGGGGGUAAAGGG
    AUCAGG
    (SEQ ID NO: 283)
     66 to 47 AGGGGGUAAAGGGA
    UCAGGU
    (SEQ ID NO: 284)
     65 to 46 GGGGGUAAAGGGAU
    CAGGUU
    (SEQ ID NO: 285)
     64 to 45 GGGGUAAAGGGAUC
    AGGUUU
    (SEQ ID NO: 286)
     63 to 44 GGGUAAAGGGAUCA
    GGUUUU
    (SEQ ID NO: 287)
     62 to 43 GGUAAAGGGAUCAG
    GUUUUC
    (SEQ ID NO: 288)
     61 to 42 GUAAAGGGAUCAGG
    UUUUCU
    (SEQ ID NO: 289)
     60 to 41 UAAAGGGAUCAGGU
    UUUCUA
    (SEQ ID NO: 290)
     59 to 40 AAAGGGAUCAGGUU
    UUCUAC
    (SEQ ID NO: 291)
     58 to 39 AAGGGAUCAGGUUU
    UCUACU
    (SEQ ID NO: 292)
     57 to 38 AGGGAUCAGGUUUU
    CUACUA
    (SEQ ID NO: 293)
     56 to 37 GGGAUCAGGUUUUC
    UACUAU
    (SEQ ID NO: 294)
     55 to 36 GGAUCAGGUUUUCU
    ACUAUG
    (SEQ ID NO: 295)
     54 to 35 GAUCAGGUUUUCUA
    CUAUGU
    (SEQ ID NO: 296)
     53 to 34 AUCAGGUUUUCUAC
    UAUGUU
    (SEQ ID NO: 297)
     52 to 33 UCAGGUUUUCUACU
    AUGUUU
    (SEQ ID NO: 298)
     51 to 32 CAGGUUUUCUACUA
    UGUUUG
    (SEQ ID NO: 299)
     50 to 31 AGGUUUUCUACUAU
    GUUUGU
     49 to 30 GGUUUUCUACUAUG
    UUUGUC
    (SEQ ID NO: 300)
     48 to 29 GUUUUCUACUAUGU
    UUGUCC
    (SEQ ID NO: 301)
     47 to 28 UUUUCUACUAUGUU
    UGUCCC
    (SEQ ID NO: 302)
     46 to 27 UUUCUACUAUGUUU
    GUCCCG
    (SEQ ID NO: 303)
     45 to 26 UUCUACUAUGUUUG
    UCCCGU
    (SEQ ID NO: 304)
     44 to 25 UCUACUAUGUUUGU
    CCCGUG
    (SEQ ID NO: 305)
     43 to 24 CUACUAUGUUUGUCC
    CGUGG
    (SEQ ID NO: 306)
     42 to 23 UACUAUGUUUGUCCC
    GUGGU
    (SEQ ID NO: 307)
     41 to 22 ACUAUGUUUGUCCCG
    UGGUG
    (SEQ ID NO: 308)
     40 to 21 CUAUGUUUGUCCCGU
    GGUGA
    (SEQ ID NO: 309)
     39 to 20 UAUGUUUGUCCCGU
    GGUGAU
    (SEQ ID NO: 310)
     38 to 19 AUGUUUGUCCCGUG
    GUGAUG
    (SEQ ID NO: 311)
     37 to 18 UGUUUGUCCCGUGG
    UGAUGG
    (SEQ ID NO: 312)
     36 to 17 GUUUGUCCCGUGGU
    GAUGGA
    (SEQ ID NO: 313)
     35 to 16 UUUGUCCCGUGGUG
    AUGGAC
    (SEQ ID NO: 314)
     34 to 15 UUGUCCCGUGGUGA
    UGGACU
    (SEQ ID NO: 315)
     33 to 14 UGUCCCGUGGUGAU
    GGACUG
    (SEQ ID NO: 316)
     32 to 13 GUCCCGUGGUGAUG
    GACUGG
    (SEQ ID NO: 317)
     31 to 12 UCCCGUGGUGAUGG
    ACUGGG
    (SEQ ID NO: 318)
     30 to 11 CCCGUGGUGAUGGAC
    UGGGA
    (SEQ ID NO: 319)
     29 to 10 CCGUGGUGAUGGAC
    UGGGAC
    (SEQ ID NO: 320)
     28 to 9 CGUGGUGAUGGACU
    GGGACA
    (SEQ ID NO: 321)
     27 to 8 GUGGUGAUGGACUG
    GGACAG
    (SEQ ID NO: 322)
     26 to 7 UGGUGAUGGACUGG
    GACAGG
    (SEQ ID NO: 323)
     25 to 6 GGUGAUGGACUGGG
    ACAGGA
    (SEQ ID NO: 324)
     24 to 5 GUGAUGGACUGGGA
    CAGGAG
    (SEQ ID NO: 325)
     23 to 4 UGAUGGACUGGGAC
    AGGAGC
    (SEQ ID NO: 326)
     22 to 3 GAUGGACUGGGACA
    GGAGCU
    (SEQ ID NO: 327)
     21 to 2 AUGGACUGGGACAG
    GAGCUA
    (SEQ ID NO: 328)
     20 to 1 UGGACUGGGACAGG
    AGCUAA
    (SEQ ID NO: 329)
  • The oligonucleotides were sequentially arranged on the tiling array in a clockwise order beginning at the center (FIG. 2). The duplicate was arranged into the tiling array afterward.
  • In order to generate a probe to test the presence of RNA sequences in the array, two units of T7 exonuclease were used to digest 100 ng of one end FAM-labeled and 5′ phosphorothioate-protected IGFBP1 DNA for 1 min at room temperature. T7 exonuclease digestion was stopped by addition of EDTA to a final concentration of 25 mM. The product was applied onto the RNA array for hybridization at 37° C. for 1 hr.
  • The fluorescence signal that is observed arises from a sequence-specific capture of partial duplex DNA that was fluorescently tagged (6-carboxyfluorescein, FAM) and protected by phosphorothioate DNA bases at its 5′ end (FIG. 2A). Fluorescence signal from each array element provides a measurement of the amount of digested duplex capturable by specific complementary oligonucleotides and was expected to vary with the degree of digestion. We profiled the digestion characteristics of T7 exonuclease on FAM labeled 180 bp long IGFBP1 DNA in a control condition (2 units of T7 exonuclease on 100 ng IGFBP1 DNA at room temperature for 1 min) by using the RNA tiling arrays (FIG. 2B). The target DNA was captured in a sequence-specific manner. It is noted that the digestion activity of T7 exonuclease is similar to the activity of Exonuclease 3 (3′ DNA exonuclease) that was reported previously Wu et al (2011), PLoS One 6, e26217. The result suggests the desired RNA sequences were synthesized accurately on the surface and are accessible for sequence-specific capture of nucleic acids.
  • In summary, we demonstrated here a strategy for making high density RNA arrays by taking advantage of well-developed DNA array technology. Using this method, millions of RNA oligonucleotides can be copied from high density DNA microarray templates simultaneously with this method. The enzymatically synthesized RNAs on the surface are free from undesired chemical modifications that are inevitable during chemical syntheses resulting from long time exposures to strong acidic and oxidizing reagents. Also, this method is not constrained by the relatively lower coupling yield of RNA phosphoramidites (compared to DNA), and the laborious process for chemical RNA synthesis. Furthermore, modified ribonucleoside triphosphates (e.g., 2′-fluorine-CTP or 2′-fluorine-UTP) can be used to fabricate desired RNA arrays for various applications. High density RNA arrays provide a new avenue for high throughput RNA biomolecular interaction analyses and RNA research.
  • Example 2 RNA Arrays Synthesized with 2′-Fluoro Ribonucleosides are RNase-Resistant
  • In order to determine if RNA arrays could be generated that were RNase resistant, an RNA array and a 2′-fluoro-RNA array were enzymatically synthesized as described previously using natural nucleoside triphosphates (i.e., adenosine triphosphate [ATP], guanosine triphosphate [GTP], cytidine triphosphate [CTP], and uridine triphosphate [UTP] and 2′ fluorine modified nucleoside triphosphate mix (i.e. adenosine triphosphate [ATP], guanosine triphosphate [GTP], 2′-fluoro-2′ deoxycytidine triphosphate [2′-F-dCTP], 2′-fluoro-2′ deoxyuridine triphosphate [2′-F-dUTP]), respectively. Both RNA arrays were then treated with DNase I (20 units) at 37° C. for four hours to eliminate template DNA oligonucleotides, followed by RNase A treatment (>4 units) at 37° C. for 30 minutes. The arrays were then hybridized with their fluorescently labeled cDNAs. As shown in FIG. 3, the RNA arrays generated with unmodified ribonucleotides (upper panels) showed persistent hybridization signal after DNase I treatment, indicating hybridization of the cDNA probe to the RNA array. However, after RNase A treatment, a complete loss of hybridization signal was observed indicating complete degradation of the RNA array. In contrast, the 2′-fluoro-RNA arrays, showed hybridization signal after DNase treatment and RNase A treatment. These data show that the use of RNase-resistant ribonucleosides such as 2′-fluoro ribonucleotides is useful in generating RNase-resistant RNA arrays.
  • Example 3 Generation of Patterned RNA Arrays Having Functional Properties
  • We describe here a simple yet powerful new strategy for the enzymatic synthesis of high-density RNA arrays. The key idea is to use RNA polymerase to copy surface-attached DNA molecules on a high-density DNA array into their RNA complements (FIG. 1). The surface is first partially deprotected (e.g. light is used to effect removal of 50% of the NPPOC photolabile protecting groups covering the surface), an array of the DNA complements to the eventual desired RNA sequences is synthesized by standard light-directed synthesis on the exposed sites, and the remaining surface sites are then deprotected, followed by synthesis of RNA primer sequences. These primer sequences on the second group of sites are hybridized to their complements on the first group, whereupon they may be extended with T7 RNA polymerase to yield RNA:DNA duplexes. The DNAs are removed with DNase I, leaving behind the desired single stranded RNAs. The strategy is compatible with either natural unmodified ribonucleoside triphosphates (rNTPs), or alternatively, 2′ fluoro-modified (2′F) rNTPs may be included in the polymerase extension reaction to impart nuclease resistance and other desirable characteristics to the synthesized RNAs. We note that the use of a very long, flexible, hydrophilic spacer (we employed a PEG 2000 moiety) between the substrate and the oligonucleotides is critical—this is not surprising, as it is necessary for the DNA complement and RNA primer sequences to anneal while both are still attached to the surface. A second key to this strategy is the ability to fabricate two different nucleic acid sequences within individual DNA features—in this case, both a primer sequence, and a template sequence.
  • Methods Array Substrate Preparation
  • Standard glass slides coated with 50 Å chromium and 1,000 Å of gold (EMF corp., NY, USA) were extensively rinsed with hexane and ethanol and dried under a nitrogen stream. A 7.5 nm layer of amorphous carbon was then DC magnetron sputtered on the gold surface (Denton Vacuum, NJ, USA). The carbon-on-gold surface was hydrogen-terminated in a 13.56 MHz inductively coupled hydrogen plasma for 12 minutes (30 Torr H2, room temperature). Next, 40 μA of 9-Decene-1-ol (Sigma Aldrich, MO, USA) was placed directly onto the newly hydrogen-terminated surface and covered with a quartz coverslip. The surfaces were irradiated under nitrogen purge with a low-pressure mercury vapor quartz grid lamp (X=254 nm, 0.35 mW/cm2) for 16 h. After the photoreaction, the surfaces were rinsed extensively with ethanol and deionized water and dried under a nitrogen stream.
  • In Situ Oligonucleotide Array Synthesis
  • Light-directed photolithographic synthesis of DNA template arrays was performed on a 9-Decen-1-ol modified carbon-on-gold surface with a digital micromirror-based Maskless Array Synthesis (MAS) system connected to an ABI Expedite™ 8909 Nucleic Acid Synthesis System (Applied Biosystems, CA, USA) as described previously. All the 5′-NPPOC-protected phosphoramidite nucleosides underwent a single 80 sec coupling step. All the 3′-dimethoxytrityl (DMT)-protected phosphoramidite nucleosides underwent a single 360 sec coupling step. The 5′-DMT-protected polyethyleneglycol 2000 phosphoramidite underwent two 900 sec coupling steps in a row. While the NPPOC protecting groups were removed by exposure to UV light, all the DMT protecting groups were removed by flowing through a deblocking mix (3% dichloroacetic acid in toluene). The light dose to remove full or a half of the photolabile NPPOC (nitrophenylpropyloxycarbonyl) protecting groups was determined prior to DNA template array fabrication. A series of incremental doses of 365 nm light (Joule/cm2) was used for a 30 nt quality control (QC) oligonucleotide synthesis. The optimal dose was chosen to yield the highest level of fluorescence (for a full deprotection) or a half of it (for a half deprotection) from hybridization of a fluorescently tagged QC complement. A total dose of 3 Joule/cm2 365 nm light was used to remove all NPPOCs during each cycle. A total dose of 0.32 Joule/cm2 365 nm light was used to remove a half of NPPOCs for RNA primer synthesis. After half-deprotection of the first layer of NPPOC-protected phosphoramidite nucleosides, the exposed hydroxyl moieties were reacted with the DMT-protected phosphoramidite nucleosides at the first base of the RNA primer. Afterward, the other half of the NPPOC protecting groups were removed by a full dose of UV light prior to the light-directed oligonucleotide synthesis on the surface. After the light-directed oligonucleotide synthesis of DNA template was completed, the 5′ end of the oligodeoxyribonucleotides were capped three times with a 1:1 v/v mixture of capping reagents A and B (A:B solution; see below) for 90 sec (˜320 μl). The DMT protecting groups on the first base of RNA primer were removed using a deblocking mix, and the RNA primer sequence was synthesized using a standard nucleic acid synthesis protocol. DCI Activator (0.25 M dicyanoimidazole in acetonitrile) and all NPPOC (3′-nitrophenylpropyloxycarbonyl) protected phosphoramidite nucleosides [5′-NPPOC-dAdenosine (tac) 3′-β-cyanoethylphosphoramidite (NPPOC-dA), 5′-NPPOC-dThymidine 3′-β-cyanoethylphosphoramidite (NPPOC-dT), 5′-NPPOC-dCytidine (ib) 3′-β-cyanoethylphosphoramidite (NPPOC-dC), 5′-NPPOC-dGuanosine (ipac) 3′-β-cyanoethylphosphoramidite (NPPOC-dG)], N-methylimidazole, acetonitrile, and tetrahydrofuran (THF) were purchased from Sigma Aldrich (MO, USA). Capping reagent A (THF/PAc2O) and deblocking mix were purchased from Glen Research (VA, USA). Oxidation solution (0.02 M iodine/pyridine/H2O/THF), acetonitrile anhydrous, 5′-DMT-polyethyleneglycol 2000 phosphoramidite, all 3′-DMT-5′-cyanoethylphosphoramite 2′-O-methyl or 2′-fluoro nucleosides were purchased from ChemGenes (MA, USA). Capping reagent B (6.5% 2-dimethylaminopyridine, 2% N-methylimidazole and 10% 2,6-lutidine in THF) and exposure solvent (1% imidazole in DMSO) were mixed in-house Anhydrous reagents were kept over molecular sieves (AldraSORB™ water trapping packets, Sigma Aldrich).
  • Enzymatic Fabrication of RNA Arrays
  • A gasket, Gene Frame—1×1 cm internal (Abgene, Epsom, UK), was attached so that it surrounds the DNA features. A 50 μl annealing buffer consisting of 4×SSPE buffer (Sigma Aldrich), 1× RNasecure™ reagent (Ambion, TX, USA), 9% polyethylene glycol 6000, was applied onto the array and incubated at 60° C. for 20 min, then slowly cooled down to 37° C. for 4 hr. The prolonged incubation time allows the RNA primers to anneal adequately to their DNA complements. The polyethylene glycol accelerated RNA:DNA hybridization while RNasecure™ was included to irreversibly inactivate possible RNases on the surface. The surface was rinsed with 1× transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 10 mM DTT, 20 mM NaCl, 2 mM spermidine) prior to RNA extension reaction. For 2′-fluoro RNA extension, a mutant T7 RNA polymerase was used while wild-type T7 RNA polymerase was used for natural RNA extension. A 50 μA RNA extension reaction mixture was added to the surface and incubated at 37° C. for 6-8 h in a humid chamber. A natural RNA extension reaction mixture consists of 40 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 10 mM DTT, 20 mM NaCl, 2 mM spermidine, 0.5 mM each NTP, 2 U/μl T7 RNA polymerase (Thermo Scientific, USA), and 1 U/μl RNase inhibitor (New England Biolabs, USA). A 2′-fluoro RNA extension reaction mixture consists of 40 mM Tris-HCl, pH 7.9, 2 mM MgCl2, 2 mM MnCl2, 10 mM DTT, 20 mM NaCl, 0.05% Triton X-100, 012 mg/μl BSA, 2 mM spermidine, 0.5 mM adenosine triphosphate, 0.5 mM guanosine triphosphate, 0.5 mM 2′-fluoro-uridine triphosphate (TriLink, CA, USA), 0.5 mM 2′-fluoro-cytidine triphosphate (TriLink), 0.015 U/μl pyrophosphatase, 2 U/μl T7 R&DNA polymerase (Epicentre, WI, USA) and 1 U/μl RNase inhibitor (New England Biolabs, USA). After extension reaction, CaCl2 was added to a final concentration of 0.5 mM, and Turbo DNase (Ambion, TX, USA) was added to a final concentration of 0.1 U/μl. The reaction mixture was incubated at 37° C. for another 6˜8 h to completely remove the DNA templates in a humid chamber. The resulting array was immersed in TE buffer, pH 7.0 at 75° C. for 10 min to inactivate DNase I and T7 RNA polymerase. The array was rinsed extensively with TE buffer and deionized water and dried under a nitrogen stream.
  • Capture and Detection of Fluorescently Labeled DNA on High Density RNA Arrays
  • The fluorescein labeled DNA fragment corresponding to positions −205 to −25 of the mouse IGFBP1 promoter was amplified by PCR from NIH 3T3 (mouse embryonic fibroblast cell line) genomic DNA (NEB, MA, USA) using the primers (5′-T*T*A GC/iFluorT/ CCT GTC CCA GTC CAT-3′ (SEQ ID NO:4) and 5′-TAT GAA GGG CTG GCT GTG C-3′ (SEQ ID NO:5). [*] represents a phosphorothioate DNA base and [/iFluorT/] represents a fluorescein-labeled thymidine. All primers were custom synthesized by IDT (Integrated DNA Technologies, IA, USA). AmpliTaq DNA polymerase (Applied Biosystems, CA, USA) was used in the PCR reaction. The PCR cycling consisted of 3 min at 94° C.; then 40 cycles of 30 sec at 95° C., 30 sec at 59° C., and 30 sec at 72° C.; and final elongation 6 min at 72° C. The amplicon was purified using the Promega Wizard SV Gel and PCR Clean-up System (Promega, WI, USA). A total of 720 ng of purified PCR amplicion was partially digested with 15 units of T7 exonuclease (T7 Gene 6 Exonuclease; Affymetrix, CA, USA) at 25° C. for 1 min and right away quenched with EDTA at a final concentration of 25 mM.
  • Following inactivation of the T7 exonuclease at 75° C. for 10 min, the reaction buffer was exchanged to 1×SSPE buffer at a concentration of 0.2 μM before application to the RNA arrays. The hybridization reaction was performed in a humid chamber at 25° C. for 30 min, followed by a thorough rinse and incubation with 1×SSPE buffer at 37° C. for 15 min to remove nonspecifically bound DNA. Fluorescence images were obtained with a 488 nm laser and 512 nm filter using a GeneTac UC 4×4 microarray scanner (Genomic Solutions, MI, USA). Table 1 contains the probe sequences synthesized on the surface. Each of the tiling arrays was composed of 332 features with each feature measuring 280 μm×280 μm, and separated by 140 μm gaps.
  • Nuclease Susceptibility Test
  • DNase I (Turbo DNase; Ambion) and RNase A (Ribonuclease A; Sigma Aldrich) were used to interrogate the nature of DNA, RNA and 2′-fluoro RNA “Badger Chemist” arrays. All arrays were first hybridized with a mixture of three fluorescently labeled DNA probes and visualized using a GeneTac UC 4×4 microarray scanner. The hybridization reaction mixture consisted of 0.2 μM of each probe in 4×SSPE buffer and was incubated in a humid chamber at 37° C. for 30 min, followed by a thorough rinse and incubation with 1× SSPE buffer at 37° C. for 15 min to remove nonspecifically bound DNA. Table 3 contains the sequences of a “Badger Chemist” array, as well as the fluorescently labeled detection probes. The RNA and 2′-fluoro RNA arrays were first treated with a total of 2.5 units of DNase I at 37° C. for 7 hr and then a total of 1 μg of RNase A. Conversely, the DNA arrays were first treated with RNase A and then with DNase I. The arrays were heat treated at 75° C. for 10 min before again being subjected to fluorescence imaging.
  • TABLE 3
    Badger Chemist DNA and RNA Array Sequences (see FIG. 4)
    Badger Chemist DNA Expected Badger Chemist
    template array sequences RNA array Sequences
    Name Sequence (3′ to 5′) Name Sequence (5′ to 3′)
    body TGAGAACGTCCAGTAGCCG body ACUCUUGCAGGUCAUCGGC
    (SEQ ID NO: 10) (SEQ ID NO: 171)
    lab coat GATTGTCCACTCAAGACT lab coat CUAACAGGUGAGUUCUGA
    (SEQ ID NO: 330) (SEQ ID NO: 331)
    sweater/flask GGTGACAACGTTTCAATA sweater/flask CCACUGUUGCAAAGUUAU
    (SEQ ID NO: 11) (SEQ ID NO: 172)
  • The sequence initiated from the surface for the Badger Chemist template DNA array is 3′-T/PEG2K/A GCC TGT GCC GCT T-5′ (SEQ ID NO:332); and the sequence initiated from the surface for the Badger Chemist RNA tiling array is 5′-T/PEG2K/A fCmG mG mAfCmAfC mGmGfC mGmAmA-3,′ which served as an RNA primer for extension reaction. Italic letters represent RNA bases./PEG2K/ represents a polyethylene glycol linker of an approximate molecular weight of 2,000 Da. mG and mA are 2′-methoxy RNA bases. fC is a 2′-fluoro RNA base.
  • 24-2-min aptamer binding assay
  • An RNA array consisting of the 24-2-min sequence (5′-mGmAfC mGfCmG mAfCfC mGmAmA AUG GUG AAG GAC GGG UCC AGU GCU UCG GCA CUG UUG AGU AGA GUG UGA GCU CCG UAA CUG GUC GCG UC-3′ (SEQ ID NO:333) in the pattern of the University Wisconsin logo was used for a functional assay. [m] represents a “2′-methoxy” RNA base, while [f] represents “2′-fluoro” RNA base. The underscored sequence is the RNA primer sequence synthesized using DMT-protected phosphoramidite nucleosides. The array was heat denatured at 75° C. for 5 min and quickly chilled on ice in a binding buffer containing 40 mM HEPES pH 7.4, 125 mM KCl, 5 mM MgCl2, and 5% DMSO. The array was then incubated with DFHBI at a final concentration of 20 μM for 30 min at room temperature. The image was visualized under a 488 nm laser with a 512 nm filter using a GeneTac UC 4×4 microarray scanner.
  • Cleavage Tests with 10-23 DNAZyme
  • Table 3 contains the sequences of a “Badger Chemist” array. The 10-23 DNAZyme (5′-TCA GAA CTC AGG CTA GCT ACA ACG ACT GTT AGT TC-3′) (SEQ ID NO:334) is designed to cleave the “lab coat” RNA sequence in the “Badger Chemist” array). The underscored sequences are the substrate-binding domains. The arrays were first annealed with the 10-23 DNAzyme at a final concentration of 1 μM in a 50 μl annealing buffer (5 mM Tris, pH 7.5, 15 mM NaCl, 0.1 mM EDTA). After application of the mixture to the array, the surface was incubated on a heating block at 95° C. for 3 min following by chilling on ice. The cleavage reaction was initiated by addition of 10× cleavage buffer followed by 10×Mn2+ to give a final incubation condition of 50 mM Tris, pH 7.5, 10 mM MnCl2, and 150 mM NaCl. The sample was placed in a humid chamber at 37° C. for 5 hr for DNAZyme cleavage and immersed in 8 M urea solution to stop the reaction. Both before and after DNAZyme treatment, the arrays were hybridized with a mixture of three fluorescently labeled DNA probes and visualized using a GeneTac UC 4×4 microarray scanner.
  • Several approaches were employed to evaluate the fidelity and utility of the arrays: these include nuclease sensitivity, DNA hybridization, DNAzyme cleavage, and RNA aptamer binding experiments. FIG. 4 shows the results of nuclease digestion experiments on DNA, RNA, and 2′F RNA arrays. Each array contains three 30-32mer sequences corresponding to the body, sweater/flask, or lab coat of a “Badger Chemist” (Table 3). The arrays were visualized after nuclease treatment by hybridizing them with a mixture of the three corresponding oligodeoxynucleotide complements, tagged respectively with the fluorophores fluorescein (sweater and bag), Texas Red (head; hands; and feet), and Cy 5 (labcoat), followed by washing and fluorescence imaging. It is evident from the figure that while the DNA arrays are completely destroyed by DNase treatment but impervious to RNase treatment, the RNA arrays show the opposite result, in that they are completely destroyed by RNase treatment but impervious to DNase treatment. As expected, the 2′F RNA arrays are resistant to both DNase and RNase treatment. These results confirm in each case the nature of the nucleic acid comprising the array elements. In addition, the experiments also show that for each array, the nucleic acid molecules on the surface hybridize specifically to fluorescently tagged solution complements, as illustrated by the correct localization of the green, yellow, and red features in the image.
  • The hybridization and exonuclease sensitivity results presented in Example 1 above and in this example provide strong evidence that the normal and modified RNA arrays have the correct nucleic acid compositions, and exhibit normal base-pairing functionality. We sought to further confirm the functionality of the sequences with two additional experiments: the ability of the RNA sequences to serve as substrates for a RNA-specific DNAzyme, and their ability to fold correctly into RNA aptamers and exhibit specific binding to a target molecule.
  • The 10-23 DNAzyme (having RNase activity), first described by Joyce and colleagues in 1997 (Santoro et al, 1997, Proc Natl Acad Sci USA. 94(9):4262-4266), consists of a catalytic core of 15 deoxynucleotides flanked by substrate-binding domains. Any RNA substrate that is accessible to Watson-Crick pairing with the 10-23 DNAzyme substrate-binding domains can be cleaved at the phosphodiester linkage between purine and pyrimidine nucleobases that separate the complementary regions on the substrate (FIG. 5A). We designed a 10-23 DNAzyme to cleave the RNA sequences on the “Badger Chemist” array that correspond to the lab coat. The arrays were incubated with the 10-23 DNAzyme in a Mn+2 containing buffer for 5 hr at 37° C. As shown in FIG. 5B, the “lab coat” sequences remained intact on the DNA array, whereas 70% were cleaved on the RNA array and 55% were cleaved on the 2′-fluoro RNA array. These results show that the surface-bound natural and modified RNA molecules are recognized as RNA by the DNAzyme.
  • One important application of RNA arrays is likely to be their use for the discovery, characterization, and evolution of aptamer sequences. The term “aptamer” refers to nucleic acid molecules that fold into conformations that impart them with specific binding affinity for a molecular target. Although nucleic acid aptamers can be composed of either DNA or RNA, RNA aptamers have the intriguing advantage of being possible to generate in vivo, and in fact naturally occurring RNA aptamers known as “riboswitches” have been described and shown to play critical roles in gene regulation. We wished to determine if the surface-bound RNAs in RNA arrays were able to fold properly to yield functional aptamer sequences. We chose to evaluate the “24-2” aptamer recently developed by Jaffrey and co-workers (Paige et al 2011, Science: 333:642-646). This aptamer imparts fluorescent properties similar to those of green fluorescent protein (GFP) to RNA molecules. It does this by binding the chromophore DFHBI (3,5-difluoro-4-hydroxybenzylidene imidazolinone); although in solution this chromophore is non-fluorescent, when immobilized by binding to the 24-2 aptamer its dihedral freedom is restricted and it becomes fluorescent. As described by Jaffrey and colleagues, if the aptamer sequence is fused with a naturally occurring RNA of interest, addition of DFHBI renders it visible by fluorescence imaging, making it possible to visualize the tagged RNA molecules in living cells. “24-2 min” is a shorter version of the original 24-2 aptamer.
  • We fabricated an RNA array consisting of the 24-2-min aptamer sequence in the pattern of the University of Wisconsin logo. The array was incubated with DFHBI followed by fluorescence imaging. The fluorescence image in FIG. 6 shows a pattern of green fluorescence corresponding to the logo, demonstrating that the aptamer sequences are properly folded and functional. This result suggests the possibility of synthesizing hundreds of thousands of variant 24-2 sequences on the array, and screening them all in parallel to identify aptamers with improved fluorescence characteristics such as increased brightness or red-shifted fluorescence emission.
  • In summary, we have described a novel strategy for the fabrication of high-density RNA arrays. The fidelity and functionality of the RNA elements is demonstrated in hybridization, DNAzyme cleavage, nuclease digestion, and RNA aptamer binding experiments.

Claims (25)

What is claimed is:
1. An RNA array comprising RNAs that (i) are covalently linked at their 5′ ends to a solid support; (ii) represent at least 10 unique RNA sequences; and (iii) have a feature density of at least 20 features/cm2.
2. The RNA array of claim 1, wherein the at least ten unique RNA sequences comprise at least 50 unique RNA sequences.
3. The RNA array of claim 1, wherein the length of the at least ten unique sequences is about 20 to about 50 bases long.
4. The RNA array of claim 1, wherein the density of single-stranded RNAs is about 200 features/cm.
5. The RNA array of claim 1, wherein the RNAs comprise modified ribonucleotides.
6. The RNA array of claim 5, wherein the modified ribonucleotides are RNase resistant.
7. A template array comprising an array of (i) single-stranded template DNA oligonucleotides linked at their 3′ ends to a solid support, comprising a consensus sequence, and capped by a protecting group at their 5′ end; and (ii) single-stranded RNA primers that are covalently linked at their 5′ ends to the solid support, and that are complementary to the consensus sequence, wherein the single-stranded RNA primers hybridize to the single-stranded template DNA oligonucleotides.
8. The template array of claim 7, wherein the single-stranded template DNA oligonucleotides are about 20 bases in length.
9. The template array of claim 7, wherein the single-stranded RNA primers are about 4 bases to about 20 bases long.
10. The template array of claim 7, wherein the single-stranded template DNA oligonucleotides or single-stranded RNA primers are covalently linked to the solid support through a polyethylene glycol spacer.
11. The template array of claim 7, wherein the protecting group is an acetyl group or phenoxyacetyl group.
12. A kit comprising the template array of claim 7, and any of (i) an RNA polymerase; (ii) ribonucleoside triphosphates; and (iii) a DNase.
13. The kit of claim 12, wherein the ribonucleoside triphosphates are modified ribonucleoside triphosphates that are RNase-resistant.
14. A method for generating a template array, comprising
(i) providing a solid support comprising a layer of protected deoxyribonucleosides that comprise a 5′-photolabile protecting group and are covalently linked at their 3′ end to a spacer layer bound to the solid support;
(ii) irradiating the layer of protected deoxyribonucleosides with ultraviolet energy sufficient to deprotect about half of the protected deoxyribonucleosides;
(iii) coupling the deprotected deoxyribonucleosides with a ribonucleoside phosphoramidite comprising a 5′ acid-labile protecting group;
(iv) irradiating the remaining protected deoxyribonucleosides with ultraviolet irradiation sufficient to deprotect all of the remaining protected deoxyribonucleosides;
(v) extending the deprotected deoxyribonucleosides, at one or more locations, by light-directed 3′ to 5′ photolithographic synthesis to generate template DNA oligonucleotides of the deprotected deoxyribonucleosides;
(vi) coupling a protecting group to the 5′ ends of the template DNA oligonucleotides;
(vii) removing the 5′ acid-labile protecting group on the protected ribonucleosides by acid treatment; and
(viii) extending the deprotected ribonucleosides at one or more locations, by 5′ to 3′ chemical synthesis of RNA primers comprising a sequence that is complementary to a sequence at the 3′ end of the template DNA strands to obtain a template array.
15. The method of claim 14, wherein in step (iii) the 5′ acid-labile protecting group comprises a 4,4′-dimethoxytrityl (DMT) group.
16. The method of claim 14, wherein in step (vi) the protecting group coupled to the 5′-ends of the template DNA strands is an acetyl group or phenoxyacetyl group.
17. The method of claim 14, wherein in step (viii) RNase-resistant modified ribonucleoside phosphoramidites are used in the extension of the deprotected phosphoramidites to obtain RNase-resistant RNA primers.
18. The method of claim 17, wherein the RNase-resistant modified ribonucleoside phosphoramidites are 2′-fluoro ribonucleoside phosphoramidites or 2′-methoxy ribonucleoside phosphoramidites.
19. A method for generating an RNA array, comprising
(i) providing: a template array of (a) single-stranded template DNAs linked at their 3′ end to a solid support and comprising a consensus sequence; and (b) single-stranded RNA primers that are covalently linked at their 5′ end to the solid support, and that are complementary to the consensus sequence of the single-stranded template DNAs;
(ii) hybridizing the single-stranded RNA primers with the single-stranded template DNAs;
(iii) extending the hybridized RNA primers along the single-stranded template DNAs using an RNA polymerase and ribonucleoside triphosphates to obtain double-stranded DNA-RNA hybrids; and
(iv) contacting the DNA-RNA hybrids with a DNase to remove the template DNAs from the DNA-RNA hybrids to obtain an RNA array.
20. The method of claim 19, wherein the RNA polymerase in step (iii) is T7 RNA polymerase.
21. The method of claim 19, wherein the ribonucleoside triphosphates are modified ribonucleoside triphosphates.
22. The method of claim 21, wherein the modified ribonucleoside triphosphates are RNase resistant modified ribonucleoside triphosphates.
23. The method of claim 19, further comprising synthesizing the single-stranded RNA primers in the array prior to step (i).
24. The method of claim 19, wherein the single-stranded template DNAs represent at least 50 unique sequences.
25. A method to generate an RNA bead pool, comprising:
(i) providing beads comprising 5′linked RNA primers comprising a consensus sequence;
(ii) hybridizing the 5′-linked RNA primers with DNA oligonucleotides comprising a unique template sequence and a sequence complementary to the consensus sequence, wherein the DNA oligonucleotides are provided in solution;
(iii) extending the hybridized RNA primers along the single-stranded template DNAs using an RNA polymerase and ribonucleoside triphosphates to obtain double-stranded DNA-RNA hybrids; and
(iv) contacting the DNA-RNA hybrids with a DNase to remove the template DNAs from the DNA-RNA hybrids to obtain an RNA bead pool.
US14/073,350 2012-11-06 2013-11-06 Rna array compositions and methods Abandoned US20140235505A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US14/073,350 US20140235505A1 (en) 2012-11-06 2013-11-06 Rna array compositions and methods
US15/834,138 US11041151B2 (en) 2012-11-06 2017-12-07 RNA array compositions and methods

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261723011P 2012-11-06 2012-11-06
US14/073,350 US20140235505A1 (en) 2012-11-06 2013-11-06 Rna array compositions and methods

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/834,138 Division US11041151B2 (en) 2012-11-06 2017-12-07 RNA array compositions and methods

Publications (1)

Publication Number Publication Date
US20140235505A1 true US20140235505A1 (en) 2014-08-21

Family

ID=51351629

Family Applications (2)

Application Number Title Priority Date Filing Date
US14/073,350 Abandoned US20140235505A1 (en) 2012-11-06 2013-11-06 Rna array compositions and methods
US15/834,138 Active 2035-08-04 US11041151B2 (en) 2012-11-06 2017-12-07 RNA array compositions and methods

Family Applications After (1)

Application Number Title Priority Date Filing Date
US15/834,138 Active 2035-08-04 US11041151B2 (en) 2012-11-06 2017-12-07 RNA array compositions and methods

Country Status (1)

Country Link
US (2) US20140235505A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016057951A2 (en) 2014-10-09 2016-04-14 Life Technologies Corporation Crispr oligonucleotides and gene editing
WO2017184799A1 (en) 2016-04-21 2017-10-26 Life Technologies Corporation Gene editing reagents with reduced toxicity
US20210213414A1 (en) * 2018-05-15 2021-07-15 Biocopy Gmbh Microarray transformer

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020081588A1 (en) * 1998-06-24 2002-06-27 Therasense, Inc. Multi-sensor array for electrochemical recognition of nucleotide sequences and methods
US20060035231A1 (en) * 2002-09-02 2006-02-16 Marinus Gerardus Van Beuningen Novel integrated microarray analysis

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020081588A1 (en) * 1998-06-24 2002-06-27 Therasense, Inc. Multi-sensor array for electrochemical recognition of nucleotide sequences and methods
US20060035231A1 (en) * 2002-09-02 2006-02-16 Marinus Gerardus Van Beuningen Novel integrated microarray analysis

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Chelliserrykattil et al. (Nat. Biotech., 2004, 22(9):1155-1160) *
Meis et al. (EPICENTRE Forum, 2002, vol. 9(1)) *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016057951A2 (en) 2014-10-09 2016-04-14 Life Technologies Corporation Crispr oligonucleotides and gene editing
EP3998344A1 (en) 2014-10-09 2022-05-18 Life Technologies Corporation Crispr oligonucleotides and gene editing
WO2017184799A1 (en) 2016-04-21 2017-10-26 Life Technologies Corporation Gene editing reagents with reduced toxicity
US20210213414A1 (en) * 2018-05-15 2021-07-15 Biocopy Gmbh Microarray transformer

Also Published As

Publication number Publication date
US11041151B2 (en) 2021-06-22
US20180112211A1 (en) 2018-04-26

Similar Documents

Publication Publication Date Title
US8986958B2 (en) Methods for generating target specific probes for solution based capture
US8383344B2 (en) Methods for quantification of microRNAs and small interfering RNAs
US7939258B2 (en) Nucleic acid amplification procedure using RNA and DNA composite primers
US9175325B2 (en) Global amplification using a randomly primed composite primer
EP1390537B1 (en) Methods and compositions for amplification of rna sequences
EP3737755B1 (en) Method for template-free geometric enzymatic nucleic acid synthesis
US20070031942A1 (en) Making nucleic acid sequences in parallel and use
AU2003213696B2 (en) Method of error reduction in nucleic acid populations
JP2013518598A (en) Isothermal amplification of nucleic acids using primers containing randomized sequences and specific primers and uses thereof
US11041151B2 (en) RNA array compositions and methods
CN110382710B (en) Method for constructing copies of nucleic acid molecules
AU2016102398A4 (en) Method for enriching target nucleic acid sequence from nucleic acid sample
CN109072225A (en) For detecting the method and system of target nucleic acid
TW201840855A (en) Compositions and methods for template-free enzymatic nucleic acid synthesis
US20220145346A1 (en) Compositions and methods for template-free geometric enzymatic nucleic acid synthesis
EP3798319A1 (en) An improved diagnostic and/or sequencing method and kit
EP3828283A1 (en) An improved sequencing method and kit
AU2002303118A1 (en) Methods and compositions for amplification of RNA sequences

Legal Events

Date Code Title Description
AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:WISCONSIN ALUMNI RESEARCH FOUNDATION;REEL/FRAME:031600/0629

Effective date: 20131107

AS Assignment

Owner name: WISCONSIN ALUMNI RESEARCH FOUNDATION, WISCONSIN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SMITH, LLOYD;WU, CHENG-HSIEN;SIGNING DATES FROM 20131107 TO 20131113;REEL/FRAME:031728/0937

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION