US20140234231A1 - Alpha-glucanase and oral care composition containing the same - Google Patents

Alpha-glucanase and oral care composition containing the same Download PDF

Info

Publication number
US20140234231A1
US20140234231A1 US14/192,372 US201414192372A US2014234231A1 US 20140234231 A1 US20140234231 A1 US 20140234231A1 US 201414192372 A US201414192372 A US 201414192372A US 2014234231 A1 US2014234231 A1 US 2014234231A1
Authority
US
United States
Prior art keywords
glucanase
amino acid
seq
oral care
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/192,372
Inventor
Steven Kim
Suzanne Lantz
Michael Pepsin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Danisco US Inc
Original Assignee
Danisco US Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Danisco US Inc filed Critical Danisco US Inc
Priority to US14/192,372 priority Critical patent/US20140234231A1/en
Assigned to DANISCO US INC. reassignment DANISCO US INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KIM, STEVEN, LANTZ, SUZANNE, PEPSIN, MICHAEL
Publication of US20140234231A1 publication Critical patent/US20140234231A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64Proteins; Peptides; Derivatives or degradation products thereof
    • A61K8/66Enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q11/00Preparations for care of the teeth, of the oral cavity or of dentures; Dentifrices, e.g. toothpastes; Mouth rinses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01059Glucan endo-1,3-alpha-glucosidase (3.2.1.59)

Definitions

  • sequence listing submitted via EFS in compliance with 37 C.F.R. ⁇ 1.52(e), is incorporated herein by reference.
  • the sequence listing text file submitted via EFS contains the file “31149US-D1_SequenceListing.txt” created on Feb. 21, 2014, which is 53,951 bytes in size.
  • Dental plaque is a mixture of bacteria, epithelial cells, leukocytes, macrophages, and other oral exudate.
  • the bacteria produce highly branched polysaccharides, which, together with micro-organisms from the oral cavity, form an adhesive matrix for the continued proliferation of dental plaque.
  • calcified plaque As dental plaque continues to accumulate, rock-hard white or yellowish deposits arise. These deposits are called calcified plaque, calculus, or tartar, and are formed in the saliva from plaque and minerals, e.g., calcium.
  • an isolated ⁇ -glucanase comprising an amino acid sequence that is (a) at least 99% identical to the mature Hypocrea tawa ⁇ -glucanase (amino acid residues 38-635 of SEQ ID NO: 1); or (b) at least 85% identical to the mature Trichoderma konilangbra ⁇ -glucanase (amino acid residues 38-627 of SEQ ID NO: 3).
  • an isolated polynucleotide encoding a subject ⁇ -glucanase, and recombinant nucleic acid containing the isolated polynucleotide is provided.
  • a vector and a host cell containing the recombinant nucleic acid are also provided.
  • a cell culture in another aspect, contains a growth medium and a population of the above-described host cells.
  • the cell culture may be used to produce a subject ⁇ -glucanase by maintaining the cell culture under conditions suitable for production of the isolated ⁇ -glucanase. If the ⁇ -glucanase is secreted, it may be harvested from the growth medium.
  • a method of producing protein comprising maintaining the culture of cells described above under conditions suitable for production of the isolated ⁇ -glucanase. In some embodiments, the method further comprises harvesting the ⁇ -glucanase from the growth medium.
  • a method comprising receiving an isolated ⁇ -glucanase selected from the following: (a) ⁇ -glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa ⁇ -glucanase (amino acid residues 38-635 of SEQ ID NO: 1); (b) ⁇ -glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei ⁇ -glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or (c) ⁇ -glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra ⁇ -glucanase (amino acid residues 38-627 of SEQ ID NO: 3); and admixing the isolated ⁇ -glucanase with an orally acceptable excipient to make an oral care composition.
  • the ⁇ -glucanase is not identical to Trichoderma reesei ⁇ -glucanase (amino acid residues 38-622 of SEQ ID NO: 2).
  • the method further comprises packaging the oral care composition.
  • an oral care composition comprising (a) an orally acceptable excipient; and (b) an isolated ⁇ -glucanase.
  • an oral care composition comprising: an orally acceptable excipient and an isolated ⁇ -glucanase selected from the following: (a) ⁇ -glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa ⁇ -glucanase (amino acid residues 38-635 of SEQ ID NO: 1); (b) ⁇ -glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei ⁇ -glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or (c) ⁇ -glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra ⁇ -glucanase (amino acid residues 38-627 of SEQ ID NO: 3).
  • the ⁇ -glucanase is not identical to Trichoderma reesei ⁇ -glucanas
  • the ⁇ -glucanase is present in the composition at a concentration of 0.0001% to 5% by weight of the composition.
  • the oral care composition further comprises a second enzyme.
  • the second enzyme is a deaminase, esterase, glycosidase, lipase, oxidase, peroxidase, protease, urease or cellulase.
  • the composition is formulated as a toothpaste, although other oral care formulations are envisioned.
  • the composition comprises at least one of a thickener, a surfactant, a humectant, and an abrasive, for example.
  • a method in which the isolated ⁇ -glucanase is received, and then admixing with an orally acceptable excipient to make an oral care composition is provided.
  • the oral care composition may be packaged.
  • a method comprising contacting a subject oral care composition with a tooth under conditions suitable for activity of the ⁇ -glucanase is provided.
  • the contacting may be performed using, e.g., a toothbrush.
  • the method results in prevention and/or reduction in dental plaque.
  • FIG. 1 shows an amino acid sequence alignment of ⁇ -glucanases from Hypocrea tawa (SEQ ID NO: 1), Trichoderma reesei (SEQ ID NO: 2); Trichoderma konilangbra (SEQ ID NO: 3) and T. harzianum (SEQ ID NO: 4), and a consensus sequence (SEQ ID NO: 5) based on the alignment.
  • Various features of the ⁇ -glucanases are indicated, such as the signal sequence, the catalytic domain, the linker domain, and the glucan-binding domain.
  • FIG. 2 is a table that summarizes the results of HPLC analysis of the insoluble glucan hydrolysates obtained following overnight incubation with various cell-free culture solutions.
  • FIG. 3 shows the activity of supernatants from cultures of T. reesei expressing the putative alph ⁇ -1,3-glucanases from T. reesei, H. tawa , and T. konilangbra at pH 4.5 and at pH 6.0.
  • the native alpha-glucanases were not deleted from the host strain.
  • the glucan hydrolysis reactions were loaded based on culture volume, not protein content.
  • ⁇ -glucanase refers to an enzyme that hydrolyses 1,3- ⁇ -D-glucosidic linkages in a polysaccharide.
  • the ⁇ -glucanases s described herein have an activity described as EC 3.2.1.59, according to IUBMB enzyme nomenclature, and can hydrolyse insoluble glucan.
  • the systematic name for an ⁇ -glucanase is 1,3(1,3;1,4)- ⁇ -D-glucan 3-glucanohydrolase.
  • This enzyme may be referred to as 1,3- ⁇ -glucanase in certain publications. Note that the present enzymes may have other activities in addition to 1,3- ⁇ -D-glucosidic activity, including but not limited to 1,2- ⁇ -D-glucosidic activity.
  • oral care composition refers to an admixture of ingredients, which in the ordinary course of usage is not intentionally swallowed for purposes of systemic administration of particular therapeutic agents, but is rather retained in the oral cavity for a time sufficient to contact dental surfaces and/or oral tissues for purposes of delivering a beneficial agent to the oral activity.
  • An oral composition may be in the form of toothpaste, dentifrice, tooth powder, tooth gel, subgingival gel, mouthrinse, denture product, mouthspray, lozenge, oral tablet, chewing gum, or the like.
  • the oral composition may also be incorporated onto strips or films for direct application or attachment to oral surfaces.
  • dentrifice refers to paste, gel, solid or liquid oral care composition formulation.
  • dentrifices are toothpaste, tooth gel, and tooth powder.
  • a dentrifice may be a single phase composition or may be a combination of two or more separate compositions.
  • a dentrifice may be in any desired form, such as deep striped, surface striped, multilayered, having the gel surrounding the paste, or any combination thereof.
  • Each composition in a dentrifice comprising two or more separate compositions may be contained in a physically separated compartment of a dispenser and dispensed side-by-side.
  • orally acceptable carrier refers to a safe and effective material for use in an oral care composition.
  • materials include fluoride ion sources, anticalculus agents, buffers, abrasive polishing materials, peroxide sources, alkali metal bicarbonate salts, thickening materials, humectants, water, surfactants, titanium dioxide, flavor system, sweetening agents, xylitol, coloring agents, and mixtures thereof.
  • teeth As used herein, the terms “tooth” or “teeth” refers to natural teeth as well as artificial teeth or dental prosthesis.
  • enamel refers to the part of a tooth that is normally visible and is composed of mostly minerals, including hydroxylapatite. Enamel encompasses naturally-occurring enamels in teeth of humans and animals as well as enamel-like substance used to replace damaged or missing teeth parts, including resins and porcelains used for such purposes.
  • tartar and “calculus” are used interchangeably to refer to mineralized dental plaque deposits.
  • glycocalyx refers to extracellular polymeric material produced by some bacteria, epithelial cells, and other cells, which forms a coating on the surface of teeth and serves as a matrix for the attachment of plaque.
  • plaque refers to a biofilm that forms on the surface of a tooth (or of teeth).
  • the microorganisms that form the biofilm are mostly bacteria, including but not limited to Streptococcus mutans, Streptococcus anaerobes, Fusobacterium spp., and Actinobacteria spp. Plaque may form on, be supported by, or be part of a glycocalyx.
  • microorganisms present in dental plaque are all naturally present in the oral cavity, and are normally harmless. However, failure to remove plaque by regular tooth brushing means that they are allowed to build up in a thick layer. Those microorganisms nearest the tooth surface convert to anaerobic respiration; it is in this state that they start to produce acids.
  • the term “recombinant” refers to a polynucleotide or polypeptide that does not occur in, is not secreted by, or has an altered expression pattern in, a wild type host cell.
  • Recombinant polypeptides and polynucleotides have respective sequences that are different from the wild-type sequence, have different temporal or spacial expression patterns from wild type polypeptides and polynucleotides, and/or are expressed at different levels than wild type polypeptides and polynucleotides.
  • a recombinant molecule may contain two or more naturally-occurring sequences that are linked together in a way that does not occur naturally.
  • a recombinant cell contains a recombinant polynucleotide or a recombinant polypeptide.
  • heterologous refers to elements that are not normally associated with each other. For example, if a host cell produces a heterologous protein, that protein is not normally produced in that host cell. Likewise, a promoter that is operably linked to a heterologous coding sequence is a promoter that is operably linked to a coding sequence that it is not usually operably linked to in a wild-type host cell.
  • polypeptide As used herein, the terms “protein” and “polypeptide” are used interchangeably to refer to a chain of amino acids linked by peptide bonds. Unless otherwise specified polypeptides are written in the standard N-terminal to C-terminal direction.
  • a “signal sequence” is a sequence of amino acids present at the N-terminal portion of a protein which facilitates the secretion of the mature form of the protein from the cell.
  • the definition of a signal sequence is a functional one, although the structures of many signal sequence are known.
  • the mature form of the extracellular protein lacks the signal sequence, which is cleaved off during the secretion process.
  • coding sequence is a DNA segment that encodes a polypeptide.
  • nucleic acid encompasses DNA, RNA, hybrids, and synthetic or chemically-modified nucleic acids, whether single-stranded or double-stranded.
  • nucleic acid and polynucleotide are used interchangeably to refer to a chain of nucleosides linked by phosphodiester, sulfodiester, or similar bonds. Unless otherwise specified polynucleotides are written in the standard 5′ to 3′ direction.
  • a “vector” refers to a polynucleotide designed to introduce nucleic acids into one or more host cells.
  • Vectors can autonomously replicate in different host cells and include: cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes and the like.
  • an “expression vector” refers to a DNA construct comprising a protein-coding region that is operably linked to a suitable control sequence capable of effecting expression of the protein in a suitable host cell.
  • control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription to produce mRNA, a sequence encoding suitable ribosome binding sites on the mRNA, and enhancers and other sequences which control the termination of transcription and translation.
  • a “promoter” is a regulatory sequence that initiates transcription of a downstream nucleic acid.
  • operably linked refers to an arrangement of elements that allows the elements to function in a described or apparent manner.
  • a promoter is operably linked to a coding sequence if it controls the transcription of the sequence.
  • selectable/selectable marker refers to a protein capable of expression in a host that allows for ease of selection of those cells containing an introduced nucleic acid or vector.
  • selectable markers include, but are not limited to, proteins that confer resistance to antimicrobials (e.g., hygromycin, bleomycin, or chloramphenicol) and/or genes that confer a metabolic advantage, such as a nutritional advantage on the host cell.
  • derived from encompasses the terms “originated from,” “obtained” or “obtainable from,” and “isolated from”.
  • non-pathogenic organism is an organism that is not pathogenic (i.e., disease or disorder-causing) to humans.
  • the terms “recovered,” “isolated,” and “separated” refer to a protein, cell, nucleic acid or amino acid that is removed from at least one component with which it is naturally associated.
  • the terms “transformed,” “stably transformed,” and “transgenic,” used in reference to a cell means that the cell has a non-native (e.g., heterologous) nucleic acid sequence integrated into its genome or as an episomal plasmid that is maintained over multiple generations.
  • expression refers to the process by which a polypeptide is produced based on the nucleic acid sequence of a gene.
  • the process includes both transcription and translation.
  • the term “introduced” in the context of inserting a nucleic acid sequence into a cell means “transfection,” or “transformation,” or “transduction,” and includes reference to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell wherein the nucleic acid sequence may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
  • the genome of the cell e.g., chromosome, plasmid, plastid, or mitochondrial DNA
  • transiently expressed e.g., transfected mRNA
  • the term “compatible” means that the components of a specified composition are capable of being commingled (admixed) without interaction in a manner which would substantially reduce the stability and/or efficacy of a component in the composition.
  • the term “lozenge” includes but is not limited to: breath mints, troches, pastilles, microcapsules, and fast-dissolving solid forms including freeze dried forms (cakes, wafers, thin films, tablets) and compressed tablets.
  • fast-dissolving solid form means that a solid dosage form dissolves in less than about 60 seconds, less than about 15 seconds, or less than about 5 seconds, after placing the solid dosage form in the oral cavity or a container containing dental prosthetics.
  • compositions and methods relating to polypeptides having ⁇ -glucanase activity are useful for reducing or preventing the formation of plaque, and for reducing or preventing the underlying physiological conditions that promote the formation of plaque.
  • the ⁇ -glucanase comprises an amino acid sequence that is at least 98% identical to (e.g., at least 99% or 99.5% identical to) the amino acid sequence of the mature Hypocrea tawa ⁇ -glucanase (amino acid residues 38-635 of SEQ ID NO: 1).
  • the ⁇ -glucanase comprises the amino acid sequence of the mature H. tawa ⁇ -glucanase (amino acid residues 38-635 of SEQ ID NO: 1).
  • the ⁇ -glucanase comprises an amino acid sequence that is at least 85% identical to (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to) the amino acid sequence of the mature Trichoderma konilangbra ⁇ -glucanase (amino acids 38-627 of SEQ ID NO: 3).
  • the ⁇ -glucanase comprises the amino acid sequence of the mature T. konilangbra ⁇ -glucanase (amino acids 38-627 of SEQ ID NO: 3).
  • the ⁇ -glucanase comprises an amino acid sequence that is at least 85% identical to (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to) the amino acid sequence of the mature Trichoderma reesei ⁇ -glucanase (amino acids 38-622 of SEQ ID NO: 2).
  • the ⁇ -glucanase comprises an amino acid sequence that is not identical to the amino acid sequence of the mature T. reesei ⁇ -glucanase (amino acids 38-622 of SEQ ID NO: 2).
  • the ⁇ -glucanase is similar to but not identical to a wild type ⁇ -glucanase.
  • the ⁇ -glucanase has an amino acid sequence that is at least 98% identical to, but not identical to, the mature H. tawa ⁇ -glucanase (amino acid residues 38-635 of SEQ ID NO: 1).
  • the ⁇ -glucanase may have an amino acid sequence that at least 85% identical to, but not identical to, the mature T. reesei or T. konilangbra ⁇ -glucanase (amino acids 38-622 of SEQ ID NO: 2 or amino acids 38-627 of SEQ ID NO: 3, respectively).
  • amino acid sequences for over 50 different ⁇ -glucanases are known and have been deposited in NCBI's Genbank database, including those from Aspergillus niger (accession no.: XP — 001390909.1; GID: 145236523), Penicillium purpurogenum (accession no.: AAF27912.1; GID: 6752866), Emericella nidulans (accession no.: CAC48025.1; GID: 15072711) and Cryptococcus neoformans (accession no.: AAW47079.1; GID: 57230770).
  • Genbank accessions are incorporated by reference in their entirety, including the nucleic acid and protein sequences therein and the annotation of those sequences, as of the earliest filing date of this patent application.
  • An entry describing a domain that is conserved in ⁇ -glucanases has been deposited as pfam03659 in NCBI's conserveed Domain Database (Marchler-Bauer et al. CDD: a conserved domain database for interactive domain family analysis. (2007) Nucleic Acids Res. 35:D237-40).
  • the sequence of a ⁇ -glucanase from S. pombe as well as a discussion of the structure of ⁇ -glucanases is found in Fuglsang et al. ((2000) J. Biol. Chem. 275:2009-18).
  • Guidance for which amino acids can be changed to produce an active variant of the wild-type ⁇ -glucanases of H. tawa, T. reesei and T. konilangbra that retains ⁇ -glucanase activity can be obtained, for example, by aligning the amino acid sequences of those ⁇ -glucanase proteins, identifying amino acids that are at identical positions in the proteins but are different between the proteins, and transferring those amino acids from one protein to the other. Exemplary sequence alignments are shown in FIG. 1 , and in Fuglsang et al. (supra).
  • a variant polypeptide may include conservative amino acid substitutions that preserve the general charge, hydrophobicity/hydrophilicity, and/or steric bulk of the amino acid being substituted, while imparting other beneficial biochemical properties on the polypeptide.
  • conservative substitutions include those between the following groups: Gly/Ala, Val/Ile/Leu, Lys/Arg, Asn/Gln, Glu/Asp, Ser/Cys/Thr and Phe/Trp/Tyr. These and other conservative substitutions are shown in the Table, below.
  • the isolated polynucleotide encoding an ⁇ -glucanas as described, and a recombinant nucleic acid containing the isolated polynucleotide. Given that the genetic code is known, such a polynucleotide can be readily designed based on the amino acid sequence.
  • the isolated polynucleotide has a nucleotide sequence that is at least 70% identical to (e.g., at least 80% identical to, at least 90% identical to, at least 95% identical to, at least 98% identical to), or may hybridize under stringent conditions to, the nucleotide sequence of a wild type H.
  • the coding sequence of the ⁇ -glucanase is codon optimized for expression of the ⁇ -glucanase in the host cell used.
  • an expression vector and a host cell containing the recombinant nucleic acid are also provided.
  • the host cell is bacterial (e.g., a Bacillus sp. or Streptomyces sp. host cell) or filamentous fungal host cell that, in certain cases, may be non-pathogenic, i.e., non-pathogenic to humans.
  • the cells may be filamentous fungal cells of a strain that has a history of use for production of proteins that has GRAS status, i.e., a Generally Recognized as Safe, by the FDA.
  • the subject fungal cell may be a cell of the following species: Trichoderma , (e.g., Trichoderma reesei (previously classified as T. longibrachiatum and currently also known as Hypocrea jecorina), Trichoderma viride, Trichoderma koningii , and Trichoderma harzianum )); Penicillium spp., Humicola spp. (e.g., Humicola insolens and Humicola grisea); Chrysosporium spp. (e.g., C. lucknowense ), Gliocladium spp., Aspergillus spp.
  • Trichoderma e.g., Trichoderma reesei (previously classified as T. longibrachiatum and currently also known as Hypocrea jecorina), Trichoderma viride, Trichoderma koningii , and Trichoderma harzianum )
  • Penicillium spp.
  • the above described nucleic acid may be present in the nuclear genome of the host cell or may be present in a plasmid that replicates in the host cell, for example, a transient expression vector, a shuttle vector, an artificial chromosome, and the like.
  • the ⁇ -glucanase may be produced by expressing a fusion protein containing a signal sequence operably linked to the ⁇ -glucanase in a fungal host cell.
  • the ⁇ -glucanase may be secreted into culture medium, where it can be harvested.
  • the signal sequence of the fusion protein may be any signal sequence that facilitates protein secretion from the host cell.
  • the signal sequence employed may be endogenous or non-endogenous to the host cell and, in certain embodiments, may be a signal sequence of a protein that is known to be highly secreted from a Trichoderma sp. or Aspergillus sp. host cell.
  • Such signal sequence include, but are not limited to: the signal sequence of cellobiohydrolase I, cellobiohydrolase II, endoglucanases I, endoglucanases II, endoglucanases III, ⁇ -amylase, aspartyl proteases, glucoamylase, mannanase, glycosidase and barley endopeptidase B (see, e.g., Saarelainen (1997) Appl. Environ. Microbiol. 63:4938-40).
  • an ⁇ -glucanase may be secreted using its own (i.e., the endogenous) signal sequence.
  • an ⁇ -glucanase is produced by introducing a nucleic acid into a host cell, which nucleic acid comprises a signal sequence-encoding portion operably linked to a ⁇ -glucanase-encoding portion, where translation of the nucleic acid produces a fusion protein comprising an ⁇ -glucanase portion having an N-terminal signal sequence for secretion of the ⁇ -glucanase portion from the host cell.
  • the fusion protein may further contain, in addition to a signal sequence, a carrier protein that is a portion of a protein that is endogenous to and highly secreted by the host cell.
  • Suitable carrier proteins include those of T. reesei mannanase I (Man5A, or MANI), T. reesei cellobiohydrolase II (Ce16A, or CBHII) (see, e.g., Paloheimo et al. (2003) Appl. Environ. Microbiol. 69:7073-82), or T. reesei cellobiohydrolase I (CBHI).
  • the carrier protein is a truncated T.
  • a nucleic acid encoding a fusion protein containing, from amino-terminus to carboxy-terminus, a signal sequence, a carrier protein and a subject ⁇ -glucanase in operable linkage may therefore be employed.
  • the nucleic acid may further contain other elements that are necessary for expression of the ⁇ -glucanase in the host cell.
  • the nucleic acid may contain a promoter for transcription of the coding sequence, and a transcriptional terminator.
  • Exemplary promoters that may be employed in T. reesei include the T. reesei cbh1, cbh2, egl1, egl2, eg5, xln1 and xln2 promoters, or a hybrid or truncated version thereof.
  • the promoter may be a T. reesei cbh1 promoter.
  • Suitable terminators include the T.
  • the promoter and/or terminator may be native or non-endogenous to the Trichoderma sp. host cell.
  • a culture of host cells i.e., a composition containing a population of host cells and growth media
  • the growth medium of the culture may contain the ⁇ -glucanase described above.
  • the cell culture may contain growth medium and a population of the above-described cells.
  • the cell culture may be used to produce a subject ⁇ -glucanase by maintaining the cell culture under conditions suitable for production of the isolated ⁇ -glucanase. If the ⁇ -glucanase is secreted, it may be harvested from the growth medium.
  • Methods of expressing proteins in filamentous fungi including methods in which cells are engineered to produce secreted protein include those described in U.S. Pat. Nos. 6,022,725 and 6,268,328, and in published U.S. Pat. App. Nos. 20060041113, 20060040353, 20060040353, and 20050208623, which are incorporated herein by reference.
  • general methods for the transformation of Aspergillus strains are disclosed in Cao et al. (2000) Protein Sci. 9:991-1001) and Yelton et al. (1984) Proc. Natl. Acad. Sci. USA 81:1470-74) and general methods for the transformation of Trichoderma strains are disclosed in Nevalainen et al.
  • the ⁇ -glucanase may be recovered by any convenient method, e.g., by precipitation, centrifugation, affinity, filtration or any other method known in the art.
  • affinity chromatography Tit al. (1984) FEBS Lett. 16:215
  • ion-exchange chromatographic methods Goyal et al. (1991) Biores. Technol. 36:37; Fliess et al. (1983) Eur. J. Appl. Microbiol. Biotechnol. 17:314; Bhikhabhai et al. (1984) J. Appl. Biochem. 6:336; and Ellouz et al.
  • Chromatography 396:307 including ion-exchange using materials with high resolution power (Medve et al. (1998) J. Chromatography A. 808153; hydrophobic interaction chromatography (Tomaz and Queiroz (1999) J. Chromatography A. 865:123; two-phase partitioning (Brumbauer et al. (1999) Bioseparation 7:287); ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; or gel filtration using, e.g., Sephadex G-75, may be employed.
  • the ⁇ -glucanase may be used without purification from the other components of the culture medium.
  • the culture medium may simply be concentrated, for example, and then used without further purification of the protein from the components of the growth medium, or used without any further modification.
  • An orally acceptable carrier may comprise one or more compatible solid or liquid filler diluents or encapsulating substances, which are suitable for topical oral administration.
  • Suitable carriers or excipients include the usual and conventional components of dentifrices (including non-abrasive gels and gels for subgingival application), mouth rinses, mouth sprays, chewing gums, and lozenges (including breath mints) as more fully described hereinafter.
  • the present oral care compositions in aqueous form may optimally have a pH ranging from about 4.0 to about 10.0, e.g., from about 5.0 to about 8.0.
  • the carrier is selected based on the manner in which the way the composition is to be introduced into the oral cavity. For example, if a toothpaste (including tooth gels, etc.) is to be used, then a “toothpaste carrier” may be chosen (comprising e.g., abrasive materials, surfactants, binders, humectants, flavoring and sweetening agents, etc.) as disclosed in e.g., U.S. Pat. No. 3,988,433, to Benedict.
  • a mouthrinse carrier may be chosen (comprising e.g., water, flavoring and sweetening agents, etc.), as disclosed in e.g., U.S. Pat. No. 3,988,433 to Benedict. If a mouth spray is to be used, then a “mouth spray carrier” may be chosen or if a lozenge is to be used, then a “lozenge carrier” may be chosen (e.g., a candy base). If a chewing gum is to be used, a “chewing gum carrier” may be chosen (comprising e.g., gum base, flavoring and sweetening agents).
  • a “sachet carrier” may be chosen (e.g., sachet bag, flavoring and sweetening agents). If a subgingival gel is to be used (for delivery of actives into the periodontal pockets or around the periodontal pockets), then a “subgingival gel carrier” may be chosen.
  • a “sachet carrier” e.g., sachet bag, flavoring and sweetening agents.
  • a subgingival gel carrier” may be chosen.
  • Other useful carriers suitable for the preparation of compositions of the present invention are well known in the art. Their selection may depend on secondary considerations like taste, cost, shelf stability, the desire for a sugar or salt-free composition, and the like.
  • the composition may be in the form of a non-abrasive gel, e.g., a subgingival gel, which may be aqueous or non-aqueous.
  • Aqueous gels generally include a thickening agent (from about 0.1% to about 20%), a humectant (from about 10% to about 55%), a flavoring agent (from about 0.04% to about 2%), a sweetening agent (from about 0.1% to about 3%), a coloring agent (from about 0.01% to about 0.5%), and the balance water.
  • the composition may comprise an anticaries agent (from about 0.05% to about 0.3% as fluoride ion), and an anticalculus agent (from about 0.1% to about 13%).
  • Such toothpaste or tooth gel may also include one or more of an anticaries agent (from about 0.05% to about 0.3% as fluoride ion), and an anticalculus agent (from about 0.1% to about 13%). Tooth powder may contain substantially all non-liquid components.
  • Glycerin 14.0 Polyethylene Glycol 300 4.5 Silica 21.5 Tetrasodium Pyrophosphate 4.5 Water 23.5 Xanthan Gum 0.3 Carboxymethyl Cellulose 0.5 Sodium Fluoride 0.2 Flavor 1.0 Sodium Lauryl Sulfate (27.9% Solution) 4.5 Sodium Saccharin 0.4 Titanium Dioxide 0.4 Sodium Bicarbonate 0.9 Sodium Carbonate, Anhydrous 1.4 Poloxamer 407 1.8 Xylitol 10.0 Propylene Glycol 10.6 TOTAL 100.00
  • the composition may be dental solutions including irrigation fluids.
  • Components of such dental solutions generally include one or more of water (from about 90% to about 99%), preservative (from about 0.01% to about 0.5%), thickening agent (from 0% to about 5%), flavoring agent (from about 0.04% to about 2%), sweetening agent (from about 0.1% to about 3%), and surfactant (from 0% to about 5%).
  • Chewing gum compositions typically include one or more of a gum base (from about 50% to about 99%), a flavoring agent (from about 0.4% to about 2%) and a sweetening agent (from about 0.01% to about 20%).
  • Lozenges may include discoid-shaped solids comprising a therapeutic agent in a flavored base.
  • the base may be a hard sugar candy, glycerinated gelatin or combination of sugar with sufficient mucilage to give it form. These dosage forms are generally well known in the art.
  • the invention provides a dental implement impregnated with the composition provided herein.
  • the dental implement may comprise an implement for contact with teeth and other tissues in the oral cavity, the implement being impregnated with a composition comprising an oxidase with polyethyleneimine or sorbitol.
  • the dental implement may be in the form of impregnated fibers including dental floss or tape, chips, strips, films, toothpicks, and polymer fibers.
  • Dental abrasives include many different materials. The material selected may be compatible within the composition of interest and may not excessively abrade dentin. Suitable abrasives may include, for example, silicas including gels and precipitates, insoluble sodium polymetaphosphate, hydrated alumina, calcium carbonate, dicalcium orthophosphate dihydrate, calcium pyrophosphate, tricalcium phosphate, calcium polymetaphosphate, and resinous abrasive materials such as particulate condensation products of urea and formaldehyde.
  • silicas including gels and precipitates, insoluble sodium polymetaphosphate, hydrated alumina, calcium carbonate, dicalcium orthophosphate dihydrate, calcium pyrophosphate, tricalcium phosphate, calcium polymetaphosphate, and resinous abrasive materials such as particulate condensation products of urea and formaldehyde.
  • abrasives for use in the compositions is a particulate thermo-setting polymerized resin.
  • Suitable resins include, for example, melamines, phenolics, ureas, melamine-ureas, melamine-formaldehydes, urea-formaldehyde, melamine-urea-formaldehydes, cross-linked epoxides, and cross-linked polyesters.
  • Silica dental abrasives of various types may be selected because of their benefits dental cleaning and polishing performance without unduly abrading tooth enamel or dentine.
  • the silica abrasive polishing materials, as well as other abrasives may have an average particle size ranging between about 0.1 to about 30 microns, or from about 1 to about 15 microns.
  • the abrasive can be precipitated silica or silica gels such as the silica xerogels.
  • abrasives may also be used.
  • the total amount of abrasive in dentifrice compositions may range from about 6% to about 70% by weight. Toothpastes may contain from about 10% to about 50% of abrasives, by weight of the composition.
  • Solution, mouth spray, mouthwash and non-abrasive gel compositions may contain no abrasive.
  • the present compsotions may also contain a surfactant, e.g., a sarcosinate surfactant, isethionate surfactant or taurate surfactant.
  • a surfactant e.g., a sarcosinate surfactant, isethionate surfactant or taurate surfactant.
  • the composition may contain alkali metal or ammonium salts of these surfactants.
  • the composition may contain sodium and potassium salts of the following: lauroyl sarcosinate, myristoyl sarcosinate, palmitoyl sarcosinate, stearoyl sarcosinate and oleoyl sarcosinate.
  • Other suitable compatible surfactants may be used in place of or in combination with these surfactants.
  • Suitable anionic surfactants include the water-soluble salts of alkyl sulfates having from 10 to 18 carbon atoms in the alkyl radical and the water-soluble salts of sulfonated monoglycerides of fatty acids having from 10 to 18 carbon atoms.
  • Sodium lauryl sulfate and sodium coconut monoglyceride sulfonates are examples of anionic surfactants of this type. Mixtures of anionic surfactants may also be utilized.
  • Suitable cationic surfactants include derivatives of aliphatic quaternary ammonium compounds having one long alkyl chain containing from about 8 to 18 carbon atoms such as lauryl trimethylammonium chloride; cetyl pyridinium chloride; cetyl trimethylammonium bromide; di-isobutylphenoxyethyl-dimethylbenzylammonium chloride; coconut alkyltrimethylammonium nitrite; cetyl pyridinium fluoride; etc.
  • surfactant compounds may be the quaternary ammonium fluorides with detergent properties.
  • Some cationic surfactants may act as germicides in the composition.
  • Suitable nonionic surfactants include compounds produced by the condensation of alkylene oxide groups (hydrophilic in nature) with an organic hydrophobic compound which may be aliphatic or alkylaromatic in nature. Examples include the Pluronics, polyethylene oxide condensates of alkyl phenols, products derived from the condensation of ethylene oxide with the reaction product of propylene oxide and ethylene diamine, ethylene oxide condensates of aliphatic alcohols, long chain tertiary amine oxides, long chain tertiary phosphine oxides, long chain dialkyl sulfoxides and mixtures of such materials.
  • Suitable zwitterionic synthetic surfactants include derivatives of aliphatic quaternary ammonium, phosphonium, and sulfonium compounds, in which the aliphatic radicals can be straight chain or branched, and wherein one of the aliphatic substituents contains from about 8 to 18 carbon atoms and one contains an anionic water-solubilizing group, e.g., carboxy, sulfonate, sulfate, phosphate or phosphonate.
  • Suitable betaine surfactants include decyl betaine or 2-(N-decyl-N,N-dimethylammonio)acetate, coco betaine or 2-(N-coco-N,N-dimethyl ammonio)acetate, myristyl betaine, palmityl betaine, lauryl betaine, cetyl betaine, cetyl betaine, stearyl betaine, etc.
  • Amidobetaines are exemplified by cocoamidoethyl betaine, cocoamidopropyl betaine, lauramidopropyl betaine and the like.
  • the betaines in the composition are cocoamidopropyl betaine or lauramidopropyl betaine.
  • Surfactants may be present at a concentration in the range of about 0.1% to about 2.5%, from about 0.3% to about 2.5%, or from about 0.5% to about 2.0% by weight of the total composition.
  • compositions may also include an anti-plaque agent, such as a synthetic anionic polymer, e.g., polyacrylate or copolymers of maleic anhydride or acid and methyl vinyl ether as well as polyamino propane sulfonic acid (AMPS), zinc citrate trihydrate, polypeptides (such as polyaspartic and polyglutamic acids), and mixtures thereof.
  • an anti-plaque agent such as a synthetic anionic polymer, e.g., polyacrylate or copolymers of maleic anhydride or acid and methyl vinyl ether as well as polyamino propane sulfonic acid (AMPS), zinc citrate trihydrate, polypeptides (such as polyaspartic and polyglutamic acids), and mixtures thereof.
  • compositions may include a chelating agent.
  • Chelating agents include tartaric acid and pharmaceutically-acceptable salts thereof, citric acid and alkali metal citrates and mixtures thereof. Chelating agents may complex calcium found in the cell walls of the bacteria. Chelating agents may also disrupt plaque by removing calcium from the calcium bridges which help hold this biomass intact. A chelating agent that may result in tooth demineralization should not be used.
  • alkali metal citrates e.g., sodium and potassium citrate
  • chelating agents include a citric acid/alkali metal citrate combination.
  • alkali metal salts of tartaric acid may be used.
  • Other agents include disodium tartrate, dipotassium tartrate, sodium potassium tartrate, sodium hydrogen tartrate and potassium hydrogen tartrate.
  • the tartaric acid salt chelating agent may be used alone or in combination with other optional chelating agents. In certain embodiments, these chelating agents have a calcium binding constant of about 10 1 to 10 5 to provide improved cleaning with reduced plaque formation.
  • composition contain 1:4 to 4:1 copolymers of maleic anhydride or acid with another polymerizable ethylenically unsaturated monomer, such as methyl vinyl ether (methoxyethylene) having an average molecular weight (AMW) of about 30,000 to about 1,000,000.
  • AMW average molecular weight
  • operative polymeric polycarboxylates may include those such as the 1:1 copolymers of maleic anhydride with ethyl acrylate, hydroxyethyl methacrylate, N-vinyl-2-pyrrolidone, or ethylene, and 1:1 copolymers of acrylic acid with methyl or hydroxyethyl methacrylate, methyl or ethyl acrylate, isobutyl vinyl ether or N-vinyl-2-pyrrolidone.
  • Additional operative polymeric polycarboxylates may be copolymers of maleic anhydride with styrene, isobutylene or ethyl vinyl ether, polyacrylic, polyitaconic and polymaleic acids, and sulfoacrylic oligomers of AMW as low as 1,000.
  • the amounts of chelating agent may be about 0.1% to about 2.5%, about 0.5% to about 2.5%, or from about 1.0% to about 2.5%.
  • a water-soluble fluoride compound may be present in an oral care composition in an amount sufficient to give a fluoride ion concentration in the composition at 25° C., from about 0.0025% to about 5.0% by weight, or about 0.005% to about 2.0% by weight.
  • fluoride ion-yielding materials may be employed as sources of soluble fluoride in the present compositions.
  • Representative fluoride ion sources may include stannous fluoride, sodium fluoride, potassium fluoride, sodium monofluorophosphate and many others.
  • the subject composition contain stannous fluoride and sodium fluoride, as well as mixtures thereof.
  • a teeth whitening agent and/or teeth color-modifying substance may also be present in the oral care compositions. These substances are suitable for modifying the color of the teeth. These substances may comprise particles that when applied on the tooth surface modify that surface in terms of absorption and, or reflection of light. Such particles may provide an appearance benefit when a film containing such particles is applied over the surfaces of a tooth or teeth.
  • Particles include pigments and colorants routinely used in the cosmetic arts. There are no specific limitations as to the pigment and, or colorant used in the present composition. Pigments and colorants include inorganic white pigments, inorganic colored pigments, pearling agents, filler powders and the like.
  • Specific examples may be selected from the group consisting of talc, mica, magnesium carbonate, calcium carbonate, magnesium silicate, aluminum magnesium silicate, silica, titanium dioxide, zinc oxide, red iron oxide, brown iron oxide, yellow iron oxide, black iron oxide, ferric ammonium ferrocyanide, manganese violet, ultramarine, nylon powder, polyethylene powder, methacrylate powder, polystyrene powder, silk powder, crystalline cellulose, starch, titanated mica, iron oxide titanated mica, bismuth oxychloride, and mixtures thereof.
  • titanium dioxide, bismuth oxychloride, zinc oxide, or mixtures thereof are used.
  • the pigments may be used as opacifiers and colorants. These pigments may be used as treated particles, or as the raw pigments themselves. Typical pigment levels may be selected for the particular impact that is desired by the consumer. For example, for teeth that are particularly dark or stained one may use pigments in sufficient amount to lighten the teeth. On the other hand, where individual teeth or spots on the teeth are lighter than other teeth, pigments to darken the teeth may be useful.
  • the levels of pigments and colorants may be used in the range of about 0.05% to about 20%, from about 0.10% to about 15%, or from about 0.25% to about 10% of the composition.
  • some thickening material may provide a consistency of the composition, active release characteristics upon use, shelf stability, and stability of the composition, etc.
  • Thickening agents include carboxyvinyl polymers, carrageenan, hydroxyethyl cellulose, laponite and water soluble salts of cellulose ethers such as sodium carboxymethylcellulose and sodium carboxymethyl hydroxyethyl cellulose.
  • Natural gums such as gum karaya, xanthan gum, gum arabic, and gum tragacanth, may also be used.
  • Colloidal magnesium aluminum silicate or finely divided silica may be used as part of the thickening agent to further improve texture.
  • Thickening or gelling agents may include a class of homopolymers of acrylic acid crosslinked with an alkyl ether of pentaerythritol or an alkyl ether of sucrose, or carbomers, or mixtures thereof.
  • Copolymers of lactide and glycolide monomers having a molecular weight in the range of from about 1,000 to about 120,000 (number average), may be used in the subject composition such as a “subgingival gel.”
  • Thickening agents may be used in an amount from about 0.1% to about 15%, about 2% to about 10%, or from about 4% to about 8%, by weight of the total toothpaste or gel composition. Higher concentrations may be used for chewing gums, lozenges (including breath mints), sachets, non-abrasive gels and subgingival gels.
  • topical, oral carrier of the subject composition may include a humectant.
  • the humectant may serve to keep the subject compositions from hardening upon exposure to air, to give compositions a moist feel to the mouth, and, for particular humectants, to impart desirable sweetness of flavor to toothpaste compositions.
  • the humectant on a pure humectant basis, may comprise from about 0% to about 70%, or about 5% to about 25%, by weight of the compositions herein.
  • Suitable humectants for use in compositions of the subject invention include edible polyhydric alcohols such as glycerin, sorbitol, xylitol, butylene glycol, polyethylene glycol, and propylene glycol. In certain cases, the humectant is sorbitol and/or glycerin.
  • Flavoring agents may also be added to the compositions. Suitable flavoring agents include oil of wintergreen, oil of peppermint, oil of spearmint, clove bud oil, menthol, anethole, methyl salicylate, eucalyptol, cassia, 1-menthyl acetate, sage, eugenol, parsley oil, oxanone, alpha-irisone, marjoram, lemon, orange, propenyl guaethol, cinnamon, vanillin, thymol, linalool, cinnamaldehyde glycerol acetal known as CGA, and mixtures thereof. Flavoring agents may be used in the compositions at levels of from about 0.001% to about 5%, by weight of the composition.
  • Suitable sweetening agents include sucrose, glucose, saccharin, dextrose, levulose, lactose, mannitol, sorbitol, fructose, maltose, xylitol, saccharin salts, thaumatin, aspartame, D-tryptophan, dihydrochalcones, acesulfame, cyclamate salts, sodium cyclamate or sodium saccharin, and mixtures thereof.
  • a composition may contain from about 0.1% to about 10% of these agents, or from about 0.1% to about 1%, by weight of the composition.
  • coolants In addition to flavoring and sweetening agents, coolants, salivating agents, warming agents, and numbing agents may be used as optional ingredients in the subject composition. These agents may be present in the compositions at a level of from about 0.001% to about 10%, or from about 0.1% to about 1%, by weight of the composition.
  • the coolant may be any of a wide variety of materials. Included among such materials are carboxamides, menthol, ketals, diols, and mixtures thereof.
  • Exemplary coolants are paramenthan carboxyamide agents such as N-ethyl-p-menthan-3-carboxamide, N,2,3-trimethyl-2-isopropylbutanamide, and mixtures thereof.
  • Other coolants may be selected from the group consisting of menthol, 3-1-menthoxypropane-1,2-diol, menthone glycerol acetal, and menthyl lactate.
  • menthol and menthyl include dextro- and levorotatory isomers of these compounds and racemic mixtures, thereof.
  • Warming agents include capsicum and nicotinate esters, such as benzyl nicotinate.
  • Numbing agents may include benzocaine, lidocaine, clove bud oil, and ethanol.
  • compositions may also include an alkali metal bicarbonate salt.
  • Alkali metal bicarbonate salts may be soluble in water and unless stabilized, may release carbon dioxide in an aqueous system.
  • Sodium bicarbonate, also known as baking soda, may be present as the alkali metal bicarbonate salt.
  • the composition contains from about 0.5% to about 30%, about 0.5% to about 15%, or from about 0.5% to about 5% of an alkali metal bicarbonate salt.
  • Water employed in the preparation of the oral care compositions may be of low ion content and free of organic impurities, and may be present in an amount of about 5% to about 70%, or from about 20% to about 50%, by weight, of an aqueous composition. These amounts of water may include free water that is added, plus water that is introduced with other agents or carriers.
  • Poloxamers may be employed in the compositions.
  • the poloxamer may be classified as a nonionic surfactant. It may function as an emulsifying agent, binder, or stabilizer, or perform a related function. Poloxamers include difunctional block-polymers terminating in primary hydroxyl groups with molecular weights ranging from 1,000 to above 15,000.
  • emulsifying agents that may be used in the compositions include polymeric emulsifiers.
  • Predominantly high molecular weight polyacrylic acid polymers may be useful as emulsifiers.
  • Titanium dioxide may also be added to the composition. Titanium dioxide is a white powder which may add opacity to the compositions. Titanium dioxide may comprise from about 0.25% to about 5% by weight of the composition.
  • the pH of the composition is preferably adjusted through the use of one or more buffering agents.
  • Buffering agents refer to agents that can be used to adjust the pH of the compositions in a range of about pH 4.0 to about pH 10.0.
  • Buffering agents include monosodium phosphate, trisodium phosphate, sodium hydroxide, sodium carbonate, sodium acid pyrophosphate, citric acid, and sodium citrate.
  • Buffering agents may be administered at a level of from about 0.5% to about 10%, by weight of the present compositions.
  • the pH of dentifrice compositions may be measured from a 3:1 aqueous slurry of dentifrice, e.g., 3 parts water to 1 part dentifrice.
  • dimethicone copolyols selected from alkyl- and alkoxy-dimethicone copolyols, such as C 12 to C 20 alkyl dimethicone copolyols and mixtures thereof.
  • the compositions contain cetyl dimethicone copolyol.
  • the dimethicone copolyol may be present in a level of from about 0.01% to about 25%, about 0.1% to about 5%, or from about 0.5% to about 1.5% by weight.
  • the dimethicone copolyols may aid in providing positive tooth feel benefits.
  • the present oral care composition may also include other active agents, such as antimicrobial agents.
  • active agents such as antimicrobial agents.
  • water insoluble non-cationic antimicrobial agents such as halogenated diphenyl ethers, phenolic compounds including phenol and its homologs, mono and poly-alkyl and aromatic halophenols, resorcinol and its derivatives, bisphenolic compounds and halogenated salicylanilides, benzoic esters, and halogenated carbanilides.
  • Water soluble antimicrobials include quaternary ammonium salts and bis-biquamide salts, among others.
  • An additional water soluble antimicrobial agent is triclosan monophosphate.
  • Quaternary ammonium agents include those in which one or two of the substitutes on the quaternary nitrogen has a carbon chain length (typically alkyl group) from about 8 to about 20, or from about 10 to about 18 carbon atoms while the remaining substitutes (typically alkyl or benzyl group) have a lower number of carbon atoms, such as from about 1 to about 7 carbon atoms, such as methyl or ethyl groups.
  • Other compounds are bis[4-(R-amino)-1-pyridinium]alkanes.
  • Other antimicrobials such as copper bisglycinate, copper glycinate, zinc citrate, and zinc lactate, may also be included.
  • the present oral care compositions may also contain one or more other enzymes that have carbohydrate hydrolysis, antimicrobial, or teeth whitening activity.
  • enzymes include, but are not limited to, a deaminase, an esterase, a glycosidase, glucanhydrolase, a dextrinase, an amylase, a transglucosidase, a cellulase, a hemicellulase, a lipase, an oxidase, a peroxidase, a protease, and a urease.
  • compositions and method is a method of contacting a tooth surface with a composition comprising an alpha-glucanase to reduce or prevent tooth decay, or to reduce or prevent the underlying causes of tooth decay.
  • the method involves contacting a tooth surface with a composition comprising an alpha-glucanase to hydrolyze a glycocalyx present on the tooth surface.
  • a composition comprising an alpha-glucanase to hydrolyze a glycocalyx present on the tooth surface.
  • the 1,3- ⁇ -D-glucosidase activity of the alpha-glucanase, and/or other activities of the alpha-glucanase hydrolizes polysaccharides, glucans, mannans, and/or adhesive molecules produced by plaque bacteria, thereby decreasing the ability of plaque to adhere to the tooth surface, reducing plaque formation or reducing the levels of existing plaque.
  • Such polysaccharides, glucans, mannans, and/or adhesive molecules may be present in what is conventionally referred to as the glycocalyx.
  • the method involves contacting a tooth surface with a composition comprising an alpha-glucanase to dewater the tooth surface by disrupting the polysaccharides, glucans, mannans, and/or adhesive molecules produced by bacteria in the mouth, thereby reducing film formation or bacterial adhesion, and/or preventing the accumulation of bacterial acids and other substances that damage the tooth surface.
  • the method may include contacting the tooth surface with one or more alpha-glucanases, which may be formulated as described, above.
  • the methods may include contacting the tooth surface with an additional enzyme, which may be present in the same formulation or a different formulation.
  • the enzyme is a deaminase, an esterase, a glycosidase, glucanhydrolase, a dextrinase, an amylase, a transglucosidase, a cellulase, a hemicellulase, a lipase, an oxidase, a peroxidase, a protease, and a urease.
  • the additional enzyme may also be an additional alpha-glucanase.
  • compositions and methods can be adapted for the prevention or removal of biofilims in a large number of other situtations, for example, in cooling water equipment, in drinking water equipment, in food products and food handling equipment, on (or in) medical implants, in paper and textile manufacturing and processing, in oil refinery and mining equipment, on the hulls of ships and boats, in chemical manufacturing, in swimming pools, aquariums, and ponds, and the like.
  • alpha glucanases can be used to disrupt polysaccharide components present in the biofilm, thereby reducing the attachment and/or adhesion of microorganism to surfaces.
  • the disruption of such polysaccharides also results in dewatering, which reduces or prevents the formation of a microenvironment suitable for the growth and propagation of microorganism on a surface.
  • Trichoderma reesei Trichoderma konilangbra
  • Trichoderma harzianum Trichoderma harzianum
  • Supernatants were harvested by sterile filtration, concentrated, and desalted for glucan (and dextran) hydrolysis activity screening.
  • the desalted culture supernatants (5% by volume) were added to 0.2% washed insoluble glucan in 100 mM phosphate buffer, pH 6.3 (or 100 mM acetate buffer, pH 4.5). The reaction mixtures were incubated overnight at 37-40 C.°.
  • the mixtures were visually inspected for solubilization of the insoluble glucan, and the supernatants were analyzed by HPLC for soluble hydrolysis products.
  • HPLC analysis the reaction supernatant was diluted 10-fold into 10 mM NaOH, and 10 ⁇ l was then injected into an Agilent 1100 HPLC equipped with electrochemical detection. Mono- and disaccharides were eluted with a NaOH/sodium acetate gradient on a PA1 anion exchange column. The components of unknown mixtures were identified based on previously run standards.
  • the supernatants from the Trichoderma reesei, Trichoderma konilangbra , and Hypocrea tawa resulted in the most solubilization of glucan (see, e.g., FIG. 2 ).
  • the ⁇ -1,3-glucanases of H. tawa, T. reesei , and T. konilangbra were selected for cloning, expression, and characterization. Putative T. reesei ⁇ -1,3-glucanase sequences were identified in the genome sequence (JGI) by homology.
  • T. reesei, T. konilangbra , and H. tawa were prepared by adding 30 mL of sterile YEG broth to three 250 mL baffled Erlenmeyer shaking flasks in the biological hood. A 1 ⁇ 1 inch square was cut and removed from each respective fungal culture plate using a sterile plastic loop and placed into the appropriate culture flask. The inoculated flasks were then placed into the 28° C. shaking incubator to grow overnight.
  • the T. reesei, T. konilangbra, H. tawa cultures were removed from the shaking incubator and the contents of each flask were poured into separate sterile 50 mL Sarstedt tubes.
  • the Sarstedt tubes were placed in a table-top centrifuge and spun at 4,500 rpm for 10 minutes to pellet the fungal mycelia. The supernatants were discarded and a large loopful of each mycelial sample was transferred to a separate tube containing lysing matrix (FastDNA).
  • Genomic DNA was extracted from the harvested mycelia using the FastDNA kit (Qbiogene), according to the manufacturer's protocol for algae, fungi and yeast.
  • the homogenization time (Mini BeadBeater-8) was 25 seconds. The amount and quality of genomic DNA extracted was determined by gel electrophoresis.
  • Putative ⁇ -1,3 glucanase genes were identified in the T. reesei genome (JGI) by homology. PCR primers for T. reesei were designed based on the putative homolog DNA sequences. Degenerate PCR primers were designed for T. konilangbra or H. tawa based on the putative T. reesei protein sequences and other published ⁇ -1,3 glucanase protein sequences.
  • the PCR conditions used to amplify the putative ⁇ -1,3 glucanase from genomic DNA extracted from T. reesei strain RL-P37 were as follows: 1. 94° C. for 2 minutes, 2. 94° C. for 30 seconds, 3. 56° C. for 30 seconds, 4. 72° C. for 3 minutes, 5. return to step 2 for 24 cycles, 6. 4° C. indefinitely.
  • Reaction samples contained 2 ⁇ L of RL-P37 genomic DNA, 10 ⁇ L of the 10 ⁇ buffer, 2 ⁇ L 10 mM dNTPs mixture, 1 ⁇ L primers SK592 and SK593 at 20 ⁇ M, 1 ⁇ L of the Pfu Ultra and 83 ⁇ L distilled water.
  • TP1S CCCCCTGGCCAAGTATGTGT
  • TP2A GTACGCAAAGTTGAGCTGCT
  • TP3S AGCACATCGCTGATGGATAT
  • TP3A AAGTATACGTTGCTTCCGGC
  • TP4S CTGACGATCGGACTRCACGT
  • TP4A GGTTGTCGACGTAGAGCTGT H .
  • HP2A ACGATCGGCAGAGTCATAGG (SEQ ID NO: 21)
  • HP3S ATCGGATTGCATGTCACGAC (SEQ ID NO: 22)
  • HP3A TACATCCAGACCGTCACCAG (SEQ ID NO: 23)
  • HP4S ACGTTTGCTCTTGCGGTATC (SEQ ID NO: 24)
  • HP4A TCATTATCCCAGGCCTAAAA
  • PCR products were inserted into cloning vectors using the Invitrogen Zero Blunt® TOPO® PCR Cloning Kit, according to the manufacturer's specifications.
  • the vector was then transformed into One®Shot Top 10 chemically competent E. coli cells (Invitrogen), according to the manufacturer's recommendation and then spread onto LB plates containing 50 ppm of Kanamycin. These plates were incubated in the 37° C. incubator overnight.
  • Tubes were microcentrifuged at maximum speed for 5 minutes, after which 20 ⁇ L of the top aqueous layer was removed and placed into a clean PCR tubes. 1 ⁇ L of RNase 2 mg/mL was then added, and samples were mixed and incubated at 37° C. for 30 minutes. The entire sample volume was then run on a gel to determine the presence of the insert in the TOPO® vector based on difference in size to an empty vector. Once the transformant colonies had been identified, those clones was scraped from the plate, and used to inoculate separate 15 mL tubes containing 5 ml of LB/Kanamycin medium (0.0001%). The cultures were placed in the 37° C. shaking incubator overnight.
  • Fresh genomic DNA was prepared for this amplification.
  • Cultures of T. konilangbra and H. tawa were prepared by inoculating 30 mL of YEG broth with a 1 square inch section of the appropriate sporulated fungal plate culture in 250 mL baffled Erlenmeyer flasks. The flasks were incubated in the 28° C. shaking incubator overnight. The cultures were harvested by centrifugation in 50 mL Sarstedt tubes at 4,500 rpm for 10 minutes. The supernatant was discarded and the mycelia were stored overnight in a ⁇ 80° C. freezer. The frozen mycelia were then placed into a coffee grinder along with a few pieces of dry ice. The grinder was run until the entire mixture had a powder-like consistency.
  • the powder was then air dried and transferred to a sterile 50 mL Sarstedt tube containing 10 mL of Easy-DNATM Kit Solution A (Invitrogen) and the manufacturer's protocol was followed.
  • the concentration of the genomic DNA collected from the extraction was measured using the NanoDrop spectrophotometer.
  • the LA PCR In vitro Cloning Kit cassettes were chosen based on the absence of a particular restriction site within the known DNA sequences, and the manufacturer's instructions were followed.
  • 1 ⁇ L of the ligation DNA sample was diluted in 33.5 ⁇ L of sterilized distilled water. Different primers were used depending on the sample and the end fragment desired.
  • primers HP4A and TP3A were used for H. tawa and T. konilangbra respectively, while for the 3′ ends primers HP4S and TP3S were used for H. tawa and T. konilangbra .
  • the PCR mixture was prepared by adding 34.5 ⁇ L diluted ligation DNA solution, 5 ⁇ L of 10 ⁇ LA Buffer II (Mg +2 ), 8 ⁇ L dNTPs mixture, 1 ⁇ L cassette primer 1, 1 ⁇ L specific primer I (depending on sample and end fragment), and 0.5 ⁇ L TaKaRa LA Taq.
  • the PCR tubes were then placed in a thermocycler following the listed protocol: 1. 94° C. for 10 minutes, 2. 94° C. for 30 seconds, 3. 55° C. for 30 seconds, 4. 72° C. for 4 minutes, return to step 2. 30 times, 4° C. indefinitely.
  • a second PCR reaction was prepared by taking 1 ⁇ L of the first PCR reaction and diluting the sample in sterilized distilled water to a dilution factor of 1/10,000.
  • a second set of primers nested within the first amplified region were used to amplify the fragment isolated in the first PCR reaction.
  • Primers HP3A and TP4A were used to amplify toward the 5′ end of H. tawa and T. konilangbra respectively, while primers HP3S and TP4S were used to amplify toward the 3′ end.
  • the diluted DNA was added to the PCR reaction containing 33.5 ⁇ L distilled sterilized water, 5 ⁇ L 10 ⁇ LA Buffer II (Mg +2 ), 8 ⁇ L dNTPs mixture, 1 ⁇ L of cassette primer 2, 1 ⁇ L of specific primer 2 (dependent on sample and fragment end), 0.5 ⁇ L, TaKaRa LA Taq, and mixed thoroughly before the PCR run.
  • the PCR protocol was the same as the first reaction, without the initial 94° C. for 10 minutes. After the reaction was complete, the sample was run by gel electrophoresis to determine size and number of fragments isolated. If a single band was present, the sample was purified and sent for sequencing. If no fragment was isolated, a third PCR reaction was performed using the previous protocol for a nested PCR reaction. After running the amplified fragments by gel electrophoresis, the brightest band was excised, purified, and sent for sequencing.
  • Sequences were obtained and analyzed using the Vector NTI suite, including Align X, and ContigExpress. Each respective end fragment sequence was aligned to the previously obtained fragments of H. tawa and T. konilangbra to obtain the entire gene sequence. Nucleotide alignments with T. harzianum and T. reesei sequences revealed the translation start and stop points of the gene of interest in both H. tawa and T. konilangbra . After the entire gene sequence was identified, specific primers were designed to amplify the entire gene from the genomic DNA. Primers were designed as described earlier, with the exception of adding CACC nucleotide sequence before the translational starting point, for GATEWAY® cloning (Invitrogen).
  • T . konilangbra (SEQ ID NO: 25)
  • T1FS caccatgctaggcattctccg (SEQ ID NO: 26)
  • T1FA tcagcagtattggcatgccg H .
  • tawa (SEQ ID NO: 27)
  • H1FS CACCATGTTGGGCGTTTTTCG (SEQ ID NO: 28)
  • H1FA CTAGCAGTATTGRCATGCCG
  • the PCR protocol was followed as previously described with the exception of altering the annealing temperature to 55° C. After a single band was isolated and viewed through gel electrophoresis, the amplified fragment was purified as described earlier and used in the pENTR/D TOPO® (Invitrogen) transformation, according to the manufacturer's instructions. Chemically competent E. coli were then transformed as previously described, and transferred to LB plates containing 50 ppm of kanamycin. Following 37° C. incubation overnight, transformants containing the plasmid and insert were selected after crude DNA extraction and plasmid size analysis, as previously described.
  • the selected transformants were scraped from the plate and used to inoculate a fresh 15 mL tube containing 5 ml of LB/Kanamycin medium (0.0001%). Cultures were placed in the 37° C. shaking incubator overnight. Cells were harvested by centrifugation and the plasmid DNA extracted as previously described. Plasmid DNA was digested to confirm the presence of the insert sequence, and then submitted for sequencing.
  • the LR Clonase reaction (Gateway Cloning, Invitrogen) was used, according to manufacturer's instructions, to directionally transfer the insert from the pENTR/D vector into the destination vector.
  • the destination vector is designed for expression of a gene of interest, in T. reesei , under control of the CBH1 promoter and terminator, with A. niger acetamidase for selection.
  • a T. reesei spore suspension was spread onto the center ⁇ 6 cm diameter of an acetamidase transformation plate (150 ⁇ L of a 5 ⁇ 10 7 -5 ⁇ 10 8 spore/mL suspension). The plate was then air dried in a biological hood.
  • the stopping screens (BioRad 165-2336) and the macrocarrier holders (BioRad 1652322) were soaked in 70% ethanol and air dried.
  • DriRite desiccant was placed in small Petri dishes (6 cm Pyrex) and overlaid with Whatman filter paper.
  • the macrocarrier holder containing the macrocarrier (BioRad 165-2335) was placed flatly on top of the filter paper and the Petri dish lid replaced.
  • a tungsten particle suspension was prepared by adding 60 mg tungsten M-10 particles (microcarrier, 0.7 micron, BioRad #1652266) to an Eppendorf tube. 1 mL ethanol (100%) was added. The tungsten was vortexed in the ethanol solution and allowed to soak for 15 minutes. The Eppendorf tube was microfuged briefly at maximum speed to pellet the tungsten. The ethanol was decanted and washed three times with sterile distilled water. After the water wash was decanted the third time, the tungsten was resuspended in 1 mL of sterile 50% glycerol.
  • the transformation reaction was prepared by adding 25 ⁇ L suspended tungsten to a 1.5 mL Eppendorf tube for each transformation. Subsequent additions were made in order, 2 ⁇ L DNA pTrex3g expression vectors, 25 ⁇ L 2.5M CaCl 2 , 10 ⁇ L 0.1M spermidine. The reaction was vortexed continuously for 5-10 minutes, keeping the tungsten suspended. The Eppendorf tube was the microfuged briefly and decanted. The tungsten pellet was washed with 200 ⁇ L of 70% ethanol, microfuged briefly to pellet and decanted. The pellet was washed with 200 ⁇ L of 100% ethanol, microfuged briefly to pellet, and decanted.
  • the tungsten pellet was resuspended in 24 ⁇ L 100% ethanol.
  • the Eppendorf tube was placed in an ultrasonic water bath for 15 seconds and 8 ⁇ L aliquots were transferred onto the center of the desiccated macrocarriers.
  • the macrocarriers were left to dry in the desiccated Petri dishes.
  • a Helium tank was turned on to 1500 psi. 1100 psi rupture discs (BioRad 165-2329) were used in the Model PDS-1000/He Biolistic Particle Delivery System (BioRad).
  • Modified amdS Biolistic agar (MABA) per liter Part I make in 500 ml dH 2 O 1000x salts 1 ml Noble agar 20 g pH to 6.0, autoclave Part II, make in 500 ml dH 2 O Acetamide 0.6 g CsCl 1.68 g Glucose 20 g KH 2 PO 4 15 g MgSO 4 •7H 2 O 0.6 g CaCl 2 •2H 2 O 0.6 g pH to 4.5, 0.2 micron filter sterilize; leave in 50° C. oven to warm, add to agar, mix, pour plates. Stored at room temperature.
  • MABA Modified amdS Biolistic agar
  • a 1 cm 2 agar plug was used to inoculate Proflo seed media. Cultures were incubated at 28° C., with 200 rpm shaking. On the second day, a 10% transfer was aseptically made into Production media. The cultures were incubated at 28° C., with 200 rpm shaking. On the third day, cultures were harvested by centrifugation. Supernatants were sterile-filtered (0.2 ⁇ m PES) and stored at 4° C. Analysis by SDS-PAGE identified clones expressing the respective alpha-glucanase genes.
  • the culture supernatant plus sucrose was sealed, mixed, and stored at 37° C. incubator for 24-48 hrs (static). A fluffy precipitate formed and was harvested by centrifugation (10,000 rpm, 15 minutes). The supernatant was decanted, leaving the precipitate, which was washed with dI water three times, lastly in a tared Eppendorf tube. The glucan was dried in a SpeedVac, and the Eppendorf weight was recorded after drying.
  • Transformed T. reesei culture supernatants, buffer and insoluble glucan were distributed into a round-bottom 96-well plate in the amounts listed below. Two types of buffers (pH 4.5 and pH 6.0) were used to compare activity levels. After the samples were distributed, the 96-well plate was sealed and placed into a shaking 37° C. incubator overnight.
  • PAHBAH p-hydroxybenzoic acid hydrazide
  • PAHBAH p-hydroxybenzoic acid hydrazide

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Birds (AREA)
  • Oral & Maxillofacial Surgery (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Cosmetics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Isolated α-glucanases from Hypocrea tawa, Trichoderma reesei, and Trichoderma konilangbra are described, as well as oral care compositions containing the same. The oral care composition may be employed to prevent or reduce dental plaque.

Description

    PRIORITY
  • The present application is a divisional of U.S. patent application Ser. No. 12/937,362, filed May 26, 2011, now U.S. Pat. No. 8,709,386, which is a U.S. National Phase Application of International Application No. PCT/US2009/040013, filed Apr. 9, 2009, which claims priority to U.S. Provisional Application Ser. No. 61/044,316, filed on Apr. 11, 2008, which are incorporated by reference in their its entirety.
  • SEQUENCE LISTING
  • The sequence listing submitted via EFS, in compliance with 37 C.F.R. §1.52(e), is incorporated herein by reference. The sequence listing text file submitted via EFS contains the file “31149US-D1_SequenceListing.txt” created on Feb. 21, 2014, which is 53,951 bytes in size.
  • BACKGROUND
  • The formation of dental plaque leads to dental caries, gingival inflammation, periodontal disease, and eventually tooth loss. Dental plaque is a mixture of bacteria, epithelial cells, leukocytes, macrophages, and other oral exudate. The bacteria produce highly branched polysaccharides, which, together with micro-organisms from the oral cavity, form an adhesive matrix for the continued proliferation of dental plaque.
  • As dental plaque continues to accumulate, rock-hard white or yellowish deposits arise. These deposits are called calcified plaque, calculus, or tartar, and are formed in the saliva from plaque and minerals, e.g., calcium.
  • There is an ongoing need for new ways to prevent and/or reduce dental plaque and associated tooth decay.
  • SUMMARY
  • In one aspect, an isolated α-glucanase is provided, comprising an amino acid sequence that is (a) at least 99% identical to the mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); or (b) at least 85% identical to the mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3).
  • In another aspect, an isolated polynucleotide encoding a subject α-glucanase, and recombinant nucleic acid containing the isolated polynucleotide is provided. A vector and a host cell containing the recombinant nucleic acid are also provided.
  • In another aspect, a cell culture is provided. In some embodiments, the cell culture contains a growth medium and a population of the above-described host cells. The cell culture may be used to produce a subject α-glucanase by maintaining the cell culture under conditions suitable for production of the isolated α-glucanase. If the α-glucanase is secreted, it may be harvested from the growth medium.
  • In another aspect, a method of producing protein is provided, comprising maintaining the culture of cells described above under conditions suitable for production of the isolated α-glucanase. In some embodiments, the method further comprises harvesting the α-glucanase from the growth medium.
  • In another aspect, a method is provided, comprising receiving an isolated α-glucanase selected from the following: (a) α-glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); (b) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or (c) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3); and admixing the isolated α-glucanase with an orally acceptable excipient to make an oral care composition. In some embodiments, the α-glucanase is not identical to Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2). In some embodiments, the method further comprises packaging the oral care composition.
  • In another aspect, an oral care composition is provided, comprising (a) an orally acceptable excipient; and (b) an isolated α-glucanase.
  • In a related aspect, an oral care composition is provided, comprising: an orally acceptable excipient and an isolated α-glucanase selected from the following: (a) α-glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); (b) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or (c) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3). In some embodiments, the α-glucanase is not identical to Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2).
  • In some embodiments, the α-glucanase is present in the composition at a concentration of 0.0001% to 5% by weight of the composition.
  • In some embodiments, the oral care composition further comprises a second enzyme. In particular embodiments, the second enzyme is a deaminase, esterase, glycosidase, lipase, oxidase, peroxidase, protease, urease or cellulase.
  • In some embodiments, the composition is formulated as a toothpaste, although other oral care formulations are envisioned. In some embodiments, the composition comprises at least one of a thickener, a surfactant, a humectant, and an abrasive, for example.
  • In another aspect, a method is provided, in which the isolated α-glucanase is received, and then admixing with an orally acceptable excipient to make an oral care composition is provided. The oral care composition may be packaged.
  • In yet another aspect, a method comprising contacting a subject oral care composition with a tooth under conditions suitable for activity of the α-glucanase is provided. The contacting may be performed using, e.g., a toothbrush. In particular cases, the method results in prevention and/or reduction in dental plaque.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 shows an amino acid sequence alignment of α-glucanases from Hypocrea tawa (SEQ ID NO: 1), Trichoderma reesei (SEQ ID NO: 2); Trichoderma konilangbra (SEQ ID NO: 3) and T. harzianum (SEQ ID NO: 4), and a consensus sequence (SEQ ID NO: 5) based on the alignment. Various features of the α-glucanases are indicated, such as the signal sequence, the catalytic domain, the linker domain, and the glucan-binding domain.
  • FIG. 2 is a table that summarizes the results of HPLC analysis of the insoluble glucan hydrolysates obtained following overnight incubation with various cell-free culture solutions.
  • FIG. 3 shows the activity of supernatants from cultures of T. reesei expressing the putative alphα-1,3-glucanases from T. reesei, H. tawa, and T. konilangbra at pH 4.5 and at pH 6.0. The native alpha-glucanases were not deleted from the host strain. The glucan hydrolysis reactions were loaded based on culture volume, not protein content.
  • DEFINITIONS
  • Unless defined otherwise herein, all technical and scientific terms should be given their ordinary meaning as used in the art. The following terms are defined for clarity. Other definitions may appear elsewhere in the specification.
  • As used herein, the term “α-glucanase” refers to an enzyme that hydrolyses 1,3-α-D-glucosidic linkages in a polysaccharide. The α-glucanases s described herein have an activity described as EC 3.2.1.59, according to IUBMB enzyme nomenclature, and can hydrolyse insoluble glucan. The systematic name for an α-glucanase is 1,3(1,3;1,4)-α-D-glucan 3-glucanohydrolase. This enzyme may be referred to as 1,3-α-glucanase in certain publications. Note that the present enzymes may have other activities in addition to 1,3-α-D-glucosidic activity, including but not limited to 1,2-α-D-glucosidic activity.
  • As used herein, the term “oral care composition” refers to an admixture of ingredients, which in the ordinary course of usage is not intentionally swallowed for purposes of systemic administration of particular therapeutic agents, but is rather retained in the oral cavity for a time sufficient to contact dental surfaces and/or oral tissues for purposes of delivering a beneficial agent to the oral activity. An oral composition may be in the form of toothpaste, dentifrice, tooth powder, tooth gel, subgingival gel, mouthrinse, denture product, mouthspray, lozenge, oral tablet, chewing gum, or the like. The oral composition may also be incorporated onto strips or films for direct application or attachment to oral surfaces.
  • Unless otherwise specified, the term “dentrifice” refers to paste, gel, solid or liquid oral care composition formulation. Examples of dentrifices are toothpaste, tooth gel, and tooth powder. A dentrifice may be a single phase composition or may be a combination of two or more separate compositions. A dentrifice may be in any desired form, such as deep striped, surface striped, multilayered, having the gel surrounding the paste, or any combination thereof. Each composition in a dentrifice comprising two or more separate compositions may be contained in a physically separated compartment of a dispenser and dispensed side-by-side.
  • As used herein, the term “orally acceptable carrier” refers to a safe and effective material for use in an oral care composition. Such materials include fluoride ion sources, anticalculus agents, buffers, abrasive polishing materials, peroxide sources, alkali metal bicarbonate salts, thickening materials, humectants, water, surfactants, titanium dioxide, flavor system, sweetening agents, xylitol, coloring agents, and mixtures thereof.
  • As used herein, the terms “tooth” or “teeth” refers to natural teeth as well as artificial teeth or dental prosthesis.
  • As used herein, the term “enamel” refers to the part of a tooth that is normally visible and is composed of mostly minerals, including hydroxylapatite. Enamel encompasses naturally-occurring enamels in teeth of humans and animals as well as enamel-like substance used to replace damaged or missing teeth parts, including resins and porcelains used for such purposes.
  • As used herein, the terms “tartar” and “calculus” are used interchangeably to refer to mineralized dental plaque deposits.
  • As used herein, the term “glycocalyx” refers to extracellular polymeric material produced by some bacteria, epithelial cells, and other cells, which forms a coating on the surface of teeth and serves as a matrix for the attachment of plaque.
  • As used herein, the term “plaque” refers to a biofilm that forms on the surface of a tooth (or of teeth). The microorganisms that form the biofilm are mostly bacteria, including but not limited to Streptococcus mutans, Streptococcus anaerobes, Fusobacterium spp., and Actinobacteria spp. Plaque may form on, be supported by, or be part of a glycocalyx.
  • The microorganisms present in dental plaque are all naturally present in the oral cavity, and are normally harmless. However, failure to remove plaque by regular tooth brushing means that they are allowed to build up in a thick layer. Those microorganisms nearest the tooth surface convert to anaerobic respiration; it is in this state that they start to produce acids.
  • As used herein, the term “recombinant” refers to a polynucleotide or polypeptide that does not occur in, is not secreted by, or has an altered expression pattern in, a wild type host cell. Recombinant polypeptides and polynucleotides have respective sequences that are different from the wild-type sequence, have different temporal or spacial expression patterns from wild type polypeptides and polynucleotides, and/or are expressed at different levels than wild type polypeptides and polynucleotides. A recombinant molecule may contain two or more naturally-occurring sequences that are linked together in a way that does not occur naturally. A recombinant cell contains a recombinant polynucleotide or a recombinant polypeptide.
  • As used herein, the term “heterologous” refers to elements that are not normally associated with each other. For example, if a host cell produces a heterologous protein, that protein is not normally produced in that host cell. Likewise, a promoter that is operably linked to a heterologous coding sequence is a promoter that is operably linked to a coding sequence that it is not usually operably linked to in a wild-type host cell. The term “homologous”, with reference to a polynucleotide or protein, refers to a polynucleotide or protein that occurs naturally in a host cell.
  • As used herein, the terms “protein” and “polypeptide” are used interchangeably to refer to a chain of amino acids linked by peptide bonds. Unless otherwise specified polypeptides are written in the standard N-terminal to C-terminal direction.
  • As used herein, a “signal sequence” is a sequence of amino acids present at the N-terminal portion of a protein which facilitates the secretion of the mature form of the protein from the cell. The definition of a signal sequence is a functional one, although the structures of many signal sequence are known. The mature form of the extracellular protein lacks the signal sequence, which is cleaved off during the secretion process.
  • As used herein, a “coding sequence” is a DNA segment that encodes a polypeptide.
  • As used herein, the term “nucleic acid” encompasses DNA, RNA, hybrids, and synthetic or chemically-modified nucleic acids, whether single-stranded or double-stranded. The terms “nucleic acid” and “polynucleotide” are used interchangeably to refer to a chain of nucleosides linked by phosphodiester, sulfodiester, or similar bonds. Unless otherwise specified polynucleotides are written in the standard 5′ to 3′ direction.
  • As used herein, a “vector” refers to a polynucleotide designed to introduce nucleic acids into one or more host cells. Vectors can autonomously replicate in different host cells and include: cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes and the like.
  • As used herein, an “expression vector” refers to a DNA construct comprising a protein-coding region that is operably linked to a suitable control sequence capable of effecting expression of the protein in a suitable host cell. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription to produce mRNA, a sequence encoding suitable ribosome binding sites on the mRNA, and enhancers and other sequences which control the termination of transcription and translation.
  • As used herein, a “promoter” is a regulatory sequence that initiates transcription of a downstream nucleic acid.
  • As used herein, the term “operably linked” refers to an arrangement of elements that allows the elements to function in a described or apparent manner. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence.
  • As used herein, the term “selective/selectable marker” refers to a protein capable of expression in a host that allows for ease of selection of those cells containing an introduced nucleic acid or vector. Examples of selectable markers include, but are not limited to, proteins that confer resistance to antimicrobials (e.g., hygromycin, bleomycin, or chloramphenicol) and/or genes that confer a metabolic advantage, such as a nutritional advantage on the host cell.
  • As used herein, the term “derived from” encompasses the terms “originated from,” “obtained” or “obtainable from,” and “isolated from”.
  • As used herein, a “non-pathogenic” organism is an organism that is not pathogenic (i.e., disease or disorder-causing) to humans.
  • As used herein, the terms “recovered,” “isolated,” and “separated” refer to a protein, cell, nucleic acid or amino acid that is removed from at least one component with which it is naturally associated.
  • As used herein, the terms “transformed,” “stably transformed,” and “transgenic,” used in reference to a cell, means that the cell has a non-native (e.g., heterologous) nucleic acid sequence integrated into its genome or as an episomal plasmid that is maintained over multiple generations.
  • As used herein, the term “expression” refers to the process by which a polypeptide is produced based on the nucleic acid sequence of a gene. The process includes both transcription and translation.
  • As used herein, the term “introduced” in the context of inserting a nucleic acid sequence into a cell, means “transfection,” or “transformation,” or “transduction,” and includes reference to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell wherein the nucleic acid sequence may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
  • As used herein, the term “compatible” means that the components of a specified composition are capable of being commingled (admixed) without interaction in a manner which would substantially reduce the stability and/or efficacy of a component in the composition.
  • As used herein, the term “lozenge” includes but is not limited to: breath mints, troches, pastilles, microcapsules, and fast-dissolving solid forms including freeze dried forms (cakes, wafers, thin films, tablets) and compressed tablets.
  • As used herein, the term “fast-dissolving solid form” means that a solid dosage form dissolves in less than about 60 seconds, less than about 15 seconds, or less than about 5 seconds, after placing the solid dosage form in the oral cavity or a container containing dental prosthetics.
  • Numeric ranges are inclusive of the numbers defining the range. All percentages and ratios used herein are by weight of the specific oral composition and not of the overall oral formulation that is delivered, unless otherwise specified. The singular articles “a,” an,” and the,” include the plural unless otherwise specified or apparent from context.
  • Headings are provided for ease of reading and should not be construed as limitations. The description included under one heading generally applies to the document as a whole, unless otherwise specified or apparent from context.
  • Exemplary material and methods are described, although other methods and materials may result in similar or equivalent results. All patents and publications, including all sequences disclosed within such patents and publications, are expressly incorporated by reference.
  • DETAILED DESCRIPTION
  • Described are compositions and methods relating to polypeptides having α-glucanase activity. The compositions and methods are useful for reducing or preventing the formation of plaque, and for reducing or preventing the underlying physiological conditions that promote the formation of plaque.
  • A. Polypeptides, Polynucleotides, and Host Cells
  • One aspect of the present compositions and methods relates to an isolated α-glucanase. In some embodiments, the α-glucanase comprises an amino acid sequence that is at least 98% identical to (e.g., at least 99% or 99.5% identical to) the amino acid sequence of the mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1). In particular embodiments, the α-glucanase comprises the amino acid sequence of the mature H. tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1).
  • In some embodiments, the α-glucanase comprises an amino acid sequence that is at least 85% identical to (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to) the amino acid sequence of the mature Trichoderma konilangbra α-glucanase (amino acids 38-627 of SEQ ID NO: 3). In particular embodiments, the α-glucanase comprises the amino acid sequence of the mature T. konilangbra α-glucanase (amino acids 38-627 of SEQ ID NO: 3).
  • In some embodiments, the α-glucanase comprises an amino acid sequence that is at least 85% identical to (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to) the amino acid sequence of the mature Trichoderma reesei α-glucanase (amino acids 38-622 of SEQ ID NO: 2). In particular embodiments, the α-glucanase comprises an amino acid sequence that is not identical to the amino acid sequence of the mature T. reesei α-glucanase (amino acids 38-622 of SEQ ID NO: 2).
  • In some embodiments, the α-glucanase is similar to but not identical to a wild type α-glucanase. For example, in some embodiments, the α-glucanase has an amino acid sequence that is at least 98% identical to, but not identical to, the mature H. tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1). Likewise, in certain embodiments, the α-glucanase may have an amino acid sequence that at least 85% identical to, but not identical to, the mature T. reesei or T. konilangbra α-glucanase (amino acids 38-622 of SEQ ID NO: 2 or amino acids 38-627 of SEQ ID NO: 3, respectively).
  • The amino acid sequences for over 50 different α-glucanases are known and have been deposited in NCBI's Genbank database, including those from Aspergillus niger (accession no.: XP001390909.1; GID: 145236523), Penicillium purpurogenum (accession no.: AAF27912.1; GID: 6752866), Emericella nidulans (accession no.: CAC48025.1; GID: 15072711) and Cryptococcus neoformans (accession no.: AAW47079.1; GID: 57230770). These Genbank accessions are incorporated by reference in their entirety, including the nucleic acid and protein sequences therein and the annotation of those sequences, as of the earliest filing date of this patent application. An entry describing a domain that is conserved in α-glucanases has been deposited as pfam03659 in NCBI's Conserved Domain Database (Marchler-Bauer et al. CDD: a conserved domain database for interactive domain family analysis. (2007) Nucleic Acids Res. 35:D237-40). The sequence of a α-glucanase from S. pombe, as well as a discussion of the structure of α-glucanases is found in Fuglsang et al. ((2000) J. Biol. Chem. 275:2009-18).
  • Guidance for which amino acids can be changed to produce an active variant of the wild-type α-glucanases of H. tawa, T. reesei and T. konilangbra that retains α-glucanase activity can be obtained, for example, by aligning the amino acid sequences of those α-glucanase proteins, identifying amino acids that are at identical positions in the proteins but are different between the proteins, and transferring those amino acids from one protein to the other. Exemplary sequence alignments are shown in FIG. 1, and in Fuglsang et al. (supra).
  • A variant polypeptide may include conservative amino acid substitutions that preserve the general charge, hydrophobicity/hydrophilicity, and/or steric bulk of the amino acid being substituted, while imparting other beneficial biochemical properties on the polypeptide. Non-limiting examples of conservative substitutions include those between the following groups: Gly/Ala, Val/Ile/Leu, Lys/Arg, Asn/Gln, Glu/Asp, Ser/Cys/Thr and Phe/Trp/Tyr. These and other conservative substitutions are shown in the Table, below.
  • Original
    Amino Acid Code Conservative Substitution
    Alanine A D-Ala, Gly, beta-Ala, L-Cys, D-Cys
    Arginine R D-Arg, Lys, D-Lys, homo-Arg, D-homo-Arg,
    Met, Ile, D-Met, D-Ile, Orn, D-Orn
    Asparagine N D-Asn, Asp, D-Asp, Glu, D-Glu, Gln, D-Gln
    Aspartic Acid D D-Asp, D-Asn, Asn, Glu, D-Glu, Gln, D-Gln
    Cysteine C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr
    Glutamine Q D-Gln, Asn, D-Asn, Glu, D-Glu, Asp, D-Asp
    Glutamic Acid E D-Glu, D-Asp, Asp, Asn, D-Asn, Gln, D-Gln
    Glycine G Ala, D-Ala, Pro, D-Pro, b-Ala, Acp
    Isoleucine I D-Ile, Val, D-Val, Leu, D-Leu, Met, D-Met
    Leucine L D-Leu, Val, D-Val, Leu, D-Leu, Met, D-Met
    Lysine K D-Lys, Arg, D-Arg, homo-Arg, D-homo-Arg,
    Met, D-Met, Ile, D-Ile, Orn, D-Orn
    Methionine M D-Met, S-Me-Cys, Ile, D-Ile, Leu, D-Leu, Val,
    D-Val
    Phenylalanine F D-Phe, Tyr, D-Thr, L-Dopa, His, D-His, Trp, D-
    Trp, Trans-3,4, or 5-phenylproline, cis-3,4,
    or 5-phenylproline
    Proline P D-Pro, L-I-thioazolidine-4-carboxylic acid, D-or
    L-1-oxazolidine-4-carboxylic acid
    Serine S D-Ser, Thr, D-Thr, allo-Thr, Met, D-Met,
    Met(O), D-Met(O), L-Cys, D-Cys
    Threonine T D-Thr, Ser, D-Ser, allo-Thr, Met,
    D-Met, Met(O), D-Met(O), Val, D-Val
    Tyrosine Y D-Tyr, Phe, D-Phe, L-Dopa, His, D-His
    Valine V D-Val, Leu, D-Leu, Ile, D-Ile, Met, D-Met
  • Alternatively, the amino acid substitutions are not conservative and change the general charge, hydrophobicity/hydrophilicity, and/or steric bulk of the amino acid being substituted.
  • Assays for evaluating α-glucanase activity are described in a variety of publications, including: Fuglsang et al. (supra), Inoue et al. ((1988) Carbohydr. Res. 182:277-86), Ait-Lahsen et al. ((2001) Appl. Environ. Microbiol. 67:5833-9), and Sumitomo et al. ((2007) Biochim. Biophys. Acta. 1770:716-24).
  • Also provided is an isolated polynucleotide encoding an α-glucanas as described, and a recombinant nucleic acid containing the isolated polynucleotide. Given that the genetic code is known, such a polynucleotide can be readily designed based on the amino acid sequence. In one embodiment, the isolated polynucleotide has a nucleotide sequence that is at least 70% identical to (e.g., at least 80% identical to, at least 90% identical to, at least 95% identical to, at least 98% identical to), or may hybridize under stringent conditions to, the nucleotide sequence of a wild type H. tawa α-glucanase gene or coding sequence (e.g., SEQ ID NOs: 29 and 30, respectively), a wild type T. reesei α-glucanase gene or coding sequence (e.g., SEQ ID NOs: 31 and 32, respectively), or a wild type T. konilangbra α-glucanase gene or coding sequence (e.g., SEQ ID NOs: 33 and 34, respectively). In certain embodiments, the coding sequence of the α-glucanase is codon optimized for expression of the α-glucanase in the host cell used. Since codon usage tables listing the usage of each codon in many host cells, including Trichoderma reesei and various other yeast and bacterial host cells are known in the art (see, e.g., Nakamura et al. (2000) Nucl. Acids Res. 28:292) or readily derivable, such nucleic acids can be readily designed given the amino acid sequence of a α-glucanase to be expressed.
  • An expression vector and a host cell containing the recombinant nucleic acid are also provided. In certain embodiments, the host cell is bacterial (e.g., a Bacillus sp. or Streptomyces sp. host cell) or filamentous fungal host cell that, in certain cases, may be non-pathogenic, i.e., non-pathogenic to humans. In particular embodiments, the cells may be filamentous fungal cells of a strain that has a history of use for production of proteins that has GRAS status, i.e., a Generally Recognized as Safe, by the FDA.
  • In particular embodiments, the subject fungal cell may be a cell of the following species: Trichoderma, (e.g., Trichoderma reesei (previously classified as T. longibrachiatum and currently also known as Hypocrea jecorina), Trichoderma viride, Trichoderma koningii, and Trichoderma harzianum)); Penicillium spp., Humicola spp. (e.g., Humicola insolens and Humicola grisea); Chrysosporium spp. (e.g., C. lucknowense), Gliocladium spp., Aspergillus spp. (e.g., Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus kawachi, Aspergillus aculeatus, Aspergillus japonicus, Aspergillus sojae, and Aspergillus awamori), Fusarium spp., Neurospora spp., Hypocrea spp., or Emericella spp. (see, also, Innis et al. (1985) Science 228:21-26), among others. In some embodiments, subject fungal cells may be strains of Aspergillus niger which include ATCC 22342, ATCC 44733, ATCC 14331 and strains derived therefrom. In some embodiments, a host cell may be one wherein native genes have been deleted or inactivated. For example, genes corresponding to protease genes or genes corresponding to cellulase genes may be deleted or inactivated.
  • The above described nucleic acid may be present in the nuclear genome of the host cell or may be present in a plasmid that replicates in the host cell, for example, a transient expression vector, a shuttle vector, an artificial chromosome, and the like.
  • In particular embodiments, the α-glucanase may be produced by expressing a fusion protein containing a signal sequence operably linked to the α-glucanase in a fungal host cell. In such embodiments, the α-glucanase may be secreted into culture medium, where it can be harvested. The signal sequence of the fusion protein may be any signal sequence that facilitates protein secretion from the host cell. The signal sequence employed may be endogenous or non-endogenous to the host cell and, in certain embodiments, may be a signal sequence of a protein that is known to be highly secreted from a Trichoderma sp. or Aspergillus sp. host cell. Such signal sequence include, but are not limited to: the signal sequence of cellobiohydrolase I, cellobiohydrolase II, endoglucanases I, endoglucanases II, endoglucanases III, α-amylase, aspartyl proteases, glucoamylase, mannanase, glycosidase and barley endopeptidase B (see, e.g., Saarelainen (1997) Appl. Environ. Microbiol. 63:4938-40). In a particular embodiment, an α-glucanase may be secreted using its own (i.e., the endogenous) signal sequence.
  • It follows that in some embodiments an α-glucanase is produced by introducing a nucleic acid into a host cell, which nucleic acid comprises a signal sequence-encoding portion operably linked to a α-glucanase-encoding portion, where translation of the nucleic acid produces a fusion protein comprising an α-glucanase portion having an N-terminal signal sequence for secretion of the α-glucanase portion from the host cell.
  • In particular embodiments, the fusion protein may further contain, in addition to a signal sequence, a carrier protein that is a portion of a protein that is endogenous to and highly secreted by the host cell. Suitable carrier proteins include those of T. reesei mannanase I (Man5A, or MANI), T. reesei cellobiohydrolase II (Ce16A, or CBHII) (see, e.g., Paloheimo et al. (2003) Appl. Environ. Microbiol. 69:7073-82), or T. reesei cellobiohydrolase I (CBHI). In one embodiment, the carrier protein is a truncated T. reesei CBH1 protein that includes the CBH1 core region and part of the CBH1 linker region. A nucleic acid encoding a fusion protein containing, from amino-terminus to carboxy-terminus, a signal sequence, a carrier protein and a subject α-glucanase in operable linkage may therefore be employed.
  • In addition to a coding sequence, the nucleic acid may further contain other elements that are necessary for expression of the α-glucanase in the host cell. For example, the nucleic acid may contain a promoter for transcription of the coding sequence, and a transcriptional terminator. Exemplary promoters that may be employed in T. reesei include the T. reesei cbh1, cbh2, egl1, egl2, eg5, xln1 and xln2 promoters, or a hybrid or truncated version thereof. For example, the promoter may be a T. reesei cbh1 promoter. Suitable terminators include the T. reesei cbh1, cbh2, egl1, egl2, eg5, xln1 and xln2 terminators, and many others, including, for example, the terminators from A. niger or A. awamori glucoamylase genes (Nunberg et al. (1984) Mol Cell Biol. 4:2306-15); Boel et al. (1984) EMBO J. 3:1097-102; and Boel et al. (1984) EMBO J. 3:1581-85), Aspergillus nidulans anthranilate synthase genes, Aspergillus oryzae TAKA amylase genes, or A. nidulans trpC (Punt et al. (1987) Gene 56:117-24). The promoter and/or terminator may be native or non-endogenous to the Trichoderma sp. host cell.
  • A culture of host cells (i.e., a composition containing a population of host cells and growth media) is also provided. The growth medium of the culture may contain the α-glucanase described above. In certain embodiments, the cell culture may contain growth medium and a population of the above-described cells. The cell culture may be used to produce a subject α-glucanase by maintaining the cell culture under conditions suitable for production of the isolated α-glucanase. If the α-glucanase is secreted, it may be harvested from the growth medium.
  • Methods of expressing proteins in filamentous fungi, including methods in which cells are engineered to produce secreted protein include those described in U.S. Pat. Nos. 6,022,725 and 6,268,328, and in published U.S. Pat. App. Nos. 20060041113, 20060040353, 20060040353, and 20050208623, which are incorporated herein by reference. In addition, general methods for the transformation of Aspergillus strains are disclosed in Cao et al. (2000) Protein Sci. 9:991-1001) and Yelton et al. (1984) Proc. Natl. Acad. Sci. USA 81:1470-74) and general methods for the transformation of Trichoderma strains are disclosed in Nevalainen et al. (1992) “The Molecular Biology of Trichoderma and its Application to the Expression of Both Homologous and Heterologous Genes” in Molecular Industrial Mycology, Eds. Leong and Berka, Marcel Dekker Inc., NY, pp 129-48).
  • If it is secreted in to culture medium, the α-glucanase may be recovered by any convenient method, e.g., by precipitation, centrifugation, affinity, filtration or any other method known in the art. For example, affinity chromatography (Tilbeurgh et al. (1984) FEBS Lett. 16:215); ion-exchange chromatographic methods (Goyal et al. (1991) Biores. Technol. 36:37; Fliess et al. (1983) Eur. J. Appl. Microbiol. Biotechnol. 17:314; Bhikhabhai et al. (1984) J. Appl. Biochem. 6:336; and Ellouz et al. (1987) Chromatography 396:307), including ion-exchange using materials with high resolution power (Medve et al. (1998) J. Chromatography A. 808153; hydrophobic interaction chromatography (Tomaz and Queiroz (1999) J. Chromatography A. 865:123; two-phase partitioning (Brumbauer et al. (1999) Bioseparation 7:287); ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; or gel filtration using, e.g., Sephadex G-75, may be employed. In particular embodiments, the α-glucanase may be used without purification from the other components of the culture medium. In these embodiments, the culture medium may simply be concentrated, for example, and then used without further purification of the protein from the components of the growth medium, or used without any further modification.
  • B. Oral Care Compositions
  • An aspect of the present compositions and methods relates to an oral care composition. The oral care composition contains one or more of the described α-glucanases and an orally acceptable carrier. Each of the one or more α-glucanases may be present in the composition at a concentration in the range of 0.0001% to 5% (e.g., 0.0001% to 0.0005%, 0.0005% to 0.001%, 0.001% to 0.005%, 0.005% to 0.01%, 0.01% to 0.05%, 0.05% to 0.1%, 0.1% to 0.5%, 0.5% to 1%, or 1% to 5%) by weight, although concentrations outside of this range are envisioned. The oral care composition may be made by a method that includes admixing the α-glucanase with an orally acceptable excipient. In certain cases, this method may further include packinging the oral care composition.
  • The oral care composition may be in the form of, e.g., a dentifrice, toothpaste, tooth powder, topical oral gel, mouthrinse, denture product, mouthspray, lozenge, oral tablet, or chewing gum. The oral composition may also be incorporated onto strips, films, floss, or tape for direct application or attachment to oral surfaces.
  • An orally acceptable carrier may comprise one or more compatible solid or liquid filler diluents or encapsulating substances, which are suitable for topical oral administration. Suitable carriers or excipients include the usual and conventional components of dentifrices (including non-abrasive gels and gels for subgingival application), mouth rinses, mouth sprays, chewing gums, and lozenges (including breath mints) as more fully described hereinafter. The present oral care compositions in aqueous form may optimally have a pH ranging from about 4.0 to about 10.0, e.g., from about 5.0 to about 8.0.
  • In some embodiments, the carrier is selected based on the manner in which the way the composition is to be introduced into the oral cavity. For example, if a toothpaste (including tooth gels, etc.) is to be used, then a “toothpaste carrier” may be chosen (comprising e.g., abrasive materials, surfactants, binders, humectants, flavoring and sweetening agents, etc.) as disclosed in e.g., U.S. Pat. No. 3,988,433, to Benedict. If a mouthrinse is to be used, then a “mouthrinse carrier” may be chosen (comprising e.g., water, flavoring and sweetening agents, etc.), as disclosed in e.g., U.S. Pat. No. 3,988,433 to Benedict. If a mouth spray is to be used, then a “mouth spray carrier” may be chosen or if a lozenge is to be used, then a “lozenge carrier” may be chosen (e.g., a candy base). If a chewing gum is to be used, a “chewing gum carrier” may be chosen (comprising e.g., gum base, flavoring and sweetening agents). If a sachet is to be used, then a “sachet carrier” may be chosen (e.g., sachet bag, flavoring and sweetening agents). If a subgingival gel is to be used (for delivery of actives into the periodontal pockets or around the periodontal pockets), then a “subgingival gel carrier” may be chosen. Other useful carriers suitable for the preparation of compositions of the present invention are well known in the art. Their selection may depend on secondary considerations like taste, cost, shelf stability, the desire for a sugar or salt-free composition, and the like.
  • In some embodiments, the composition may be in the form of a non-abrasive gel, e.g., a subgingival gel, which may be aqueous or non-aqueous. Aqueous gels generally include a thickening agent (from about 0.1% to about 20%), a humectant (from about 10% to about 55%), a flavoring agent (from about 0.04% to about 2%), a sweetening agent (from about 0.1% to about 3%), a coloring agent (from about 0.01% to about 0.5%), and the balance water. In certain cases, the composition may comprise an anticaries agent (from about 0.05% to about 0.3% as fluoride ion), and an anticalculus agent (from about 0.1% to about 13%).
  • In other embodiments, the composition may also be in the form of a dentifrice, such as a toothpaste, tooth gel or tooth powder. Components of such toothpaste and tooth gels may include one or more of a dental abrasive (from about 5% to about 50%), a surfactant (from about 0.5% to about 10%), a thickening agent (from about 0.1% to about 5%), a humectant (from about 10% to about 55%), a flavoring agent (from about 0.04% to about 2%), a sweetening agent (from about 0.1% to about 3%), a coloring agent (from about 0.01% to about 0.5%) and water (from about 2% to about 45%). Such toothpaste or tooth gel may also include one or more of an anticaries agent (from about 0.05% to about 0.3% as fluoride ion), and an anticalculus agent (from about 0.1% to about 13%). Tooth powder may contain substantially all non-liquid components.
  • One exemplary dentifrice composition is described in U.S. Pat. No. 6,238,648, and has the following formulation (w/w):
  • Glycerin 14.0
    Polyethylene Glycol 300 4.5
    Silica 21.5
    Tetrasodium Pyrophosphate 4.5
    Water 23.5
    Xanthan Gum 0.3
    Carboxymethyl Cellulose 0.5
    Sodium Fluoride 0.2
    Flavor 1.0
    Sodium Lauryl Sulfate (27.9% Solution) 4.5
    Sodium Saccharin 0.4
    Titanium Dioxide 0.4
    Sodium Bicarbonate 0.9
    Sodium Carbonate, Anhydrous 1.4
    Poloxamer 407 1.8
    Xylitol 10.0
    Propylene Glycol 10.6
    TOTAL 100.00
  • Another exemplary dentifrice composition is described in U.S. Pat. No. 5,578,295, and has the following formulation (w/w):
  • Triclosan diphosphate 1
    Sorbitol 33
    Saccharin 0.46
    Silica 22
    NaF 0.243
    Glycerin 9
    NaOH (50%) 0.2
    Carbopol 0.2
    Keltrol 0.6
    TiO.sub.2 0.5
    Sodium alkyl sulphate (28% soln.) 4
    PEG 6
    3 FD&C Blue #1 (1% soln) 0.05
    Flavor 1.1
    Water q.s.
  • In some embodiments, the composition is a mouthwash, including mouth spray. Components of such mouthwashes and mouth sprays typically include one or more of water (from about 45% to about 95%), ethanol (from about 0% to about 25%), a humectant (from about 0% to about 50%), a surfactant (from about 0.01% to about 7%), a flavoring agent (from about 0.04% to about 2%), a sweetening agent (from about 0.1% to about 3%), and a coloring agent (from about 0.001% to about 0.5%). Such mouthwashes and mouth sprays may also include one or more of an anticaries agent (from about 0.05% to about 0.3% as fluoride ion), and an anticalculus agent (from about 0.1% to about 3%).
  • In certain embodiments, the composition may be dental solutions including irrigation fluids. Components of such dental solutions generally include one or more of water (from about 90% to about 99%), preservative (from about 0.01% to about 0.5%), thickening agent (from 0% to about 5%), flavoring agent (from about 0.04% to about 2%), sweetening agent (from about 0.1% to about 3%), and surfactant (from 0% to about 5%).
  • Chewing gum compositions typically include one or more of a gum base (from about 50% to about 99%), a flavoring agent (from about 0.4% to about 2%) and a sweetening agent (from about 0.01% to about 20%).
  • Lozenges may include discoid-shaped solids comprising a therapeutic agent in a flavored base. The base may be a hard sugar candy, glycerinated gelatin or combination of sugar with sufficient mucilage to give it form. These dosage forms are generally well known in the art.
  • In another embodiment, the invention provides a dental implement impregnated with the composition provided herein. The dental implement may comprise an implement for contact with teeth and other tissues in the oral cavity, the implement being impregnated with a composition comprising an oxidase with polyethyleneimine or sorbitol. The dental implement may be in the form of impregnated fibers including dental floss or tape, chips, strips, films, toothpicks, and polymer fibers.
  • Exemplary materials that may be present in an orally acceptable carrier are described below.
  • Abrasives
  • Dental abrasives include many different materials. The material selected may be compatible within the composition of interest and may not excessively abrade dentin. Suitable abrasives may include, for example, silicas including gels and precipitates, insoluble sodium polymetaphosphate, hydrated alumina, calcium carbonate, dicalcium orthophosphate dihydrate, calcium pyrophosphate, tricalcium phosphate, calcium polymetaphosphate, and resinous abrasive materials such as particulate condensation products of urea and formaldehyde.
  • One class of abrasives for use in the compositions is a particulate thermo-setting polymerized resin. Suitable resins include, for example, melamines, phenolics, ureas, melamine-ureas, melamine-formaldehydes, urea-formaldehyde, melamine-urea-formaldehydes, cross-linked epoxides, and cross-linked polyesters.
  • Silica dental abrasives of various types may be selected because of their benefits dental cleaning and polishing performance without unduly abrading tooth enamel or dentine. The silica abrasive polishing materials, as well as other abrasives, may have an average particle size ranging between about 0.1 to about 30 microns, or from about 1 to about 15 microns. The abrasive can be precipitated silica or silica gels such as the silica xerogels.
  • Mixtures of abrasives may also be used. The total amount of abrasive in dentifrice compositions may range from about 6% to about 70% by weight. Toothpastes may contain from about 10% to about 50% of abrasives, by weight of the composition. Solution, mouth spray, mouthwash and non-abrasive gel compositions may contain no abrasive.
  • Surfactants
  • The present compsotions may also contain a surfactant, e.g., a sarcosinate surfactant, isethionate surfactant or taurate surfactant. In certain embodiments, the composition may contain alkali metal or ammonium salts of these surfactants. In certain cases, the composition may contain sodium and potassium salts of the following: lauroyl sarcosinate, myristoyl sarcosinate, palmitoyl sarcosinate, stearoyl sarcosinate and oleoyl sarcosinate. Other suitable compatible surfactants may be used in place of or in combination with these surfactants.
  • Suitable anionic surfactants include the water-soluble salts of alkyl sulfates having from 10 to 18 carbon atoms in the alkyl radical and the water-soluble salts of sulfonated monoglycerides of fatty acids having from 10 to 18 carbon atoms. Sodium lauryl sulfate and sodium coconut monoglyceride sulfonates are examples of anionic surfactants of this type. Mixtures of anionic surfactants may also be utilized.
  • Suitable cationic surfactants include derivatives of aliphatic quaternary ammonium compounds having one long alkyl chain containing from about 8 to 18 carbon atoms such as lauryl trimethylammonium chloride; cetyl pyridinium chloride; cetyl trimethylammonium bromide; di-isobutylphenoxyethyl-dimethylbenzylammonium chloride; coconut alkyltrimethylammonium nitrite; cetyl pyridinium fluoride; etc. In certain cases, surfactant compounds may be the quaternary ammonium fluorides with detergent properties. Some cationic surfactants may act as germicides in the composition.
  • Suitable nonionic surfactants include compounds produced by the condensation of alkylene oxide groups (hydrophilic in nature) with an organic hydrophobic compound which may be aliphatic or alkylaromatic in nature. Examples include the Pluronics, polyethylene oxide condensates of alkyl phenols, products derived from the condensation of ethylene oxide with the reaction product of propylene oxide and ethylene diamine, ethylene oxide condensates of aliphatic alcohols, long chain tertiary amine oxides, long chain tertiary phosphine oxides, long chain dialkyl sulfoxides and mixtures of such materials.
  • Suitable zwitterionic synthetic surfactants include derivatives of aliphatic quaternary ammonium, phosphonium, and sulfonium compounds, in which the aliphatic radicals can be straight chain or branched, and wherein one of the aliphatic substituents contains from about 8 to 18 carbon atoms and one contains an anionic water-solubilizing group, e.g., carboxy, sulfonate, sulfate, phosphate or phosphonate.
  • Suitable betaine surfactants include decyl betaine or 2-(N-decyl-N,N-dimethylammonio)acetate, coco betaine or 2-(N-coco-N,N-dimethyl ammonio)acetate, myristyl betaine, palmityl betaine, lauryl betaine, cetyl betaine, cetyl betaine, stearyl betaine, etc. Amidobetaines are exemplified by cocoamidoethyl betaine, cocoamidopropyl betaine, lauramidopropyl betaine and the like. In certain embodiments, the betaines in the composition are cocoamidopropyl betaine or lauramidopropyl betaine.
  • Surfactants may be present at a concentration in the range of about 0.1% to about 2.5%, from about 0.3% to about 2.5%, or from about 0.5% to about 2.0% by weight of the total composition.
  • Anti-Plaque Agent
  • The compositions may also include an anti-plaque agent, such as a synthetic anionic polymer, e.g., polyacrylate or copolymers of maleic anhydride or acid and methyl vinyl ether as well as polyamino propane sulfonic acid (AMPS), zinc citrate trihydrate, polypeptides (such as polyaspartic and polyglutamic acids), and mixtures thereof.
  • Chelating Agents
  • The compositions may include a chelating agent. Chelating agents include tartaric acid and pharmaceutically-acceptable salts thereof, citric acid and alkali metal citrates and mixtures thereof. Chelating agents may complex calcium found in the cell walls of the bacteria. Chelating agents may also disrupt plaque by removing calcium from the calcium bridges which help hold this biomass intact. A chelating agent that may result in tooth demineralization should not be used.
  • In some embodiments, alkali metal citrates (e.g., sodium and potassium citrate) are present in the compositions. In certain cases, chelating agents include a citric acid/alkali metal citrate combination. In other cases, alkali metal salts of tartaric acid may be used. Other agents include disodium tartrate, dipotassium tartrate, sodium potassium tartrate, sodium hydrogen tartrate and potassium hydrogen tartrate. The tartaric acid salt chelating agent may be used alone or in combination with other optional chelating agents. In certain embodiments, these chelating agents have a calcium binding constant of about 101 to 105 to provide improved cleaning with reduced plaque formation.
  • Another group of chelating agents is the anionic polymeric polycarboxylates. Such materials are well known in the art, being employed in the form of their free acids, partially or fully neutralized water soluble alkali metal (e.g. potassium and preferably sodium) or ammonium salts. In certain cases, composition contain 1:4 to 4:1 copolymers of maleic anhydride or acid with another polymerizable ethylenically unsaturated monomer, such as methyl vinyl ether (methoxyethylene) having an average molecular weight (AMW) of about 30,000 to about 1,000,000.
  • Other operative polymeric polycarboxylates may include those such as the 1:1 copolymers of maleic anhydride with ethyl acrylate, hydroxyethyl methacrylate, N-vinyl-2-pyrrolidone, or ethylene, and 1:1 copolymers of acrylic acid with methyl or hydroxyethyl methacrylate, methyl or ethyl acrylate, isobutyl vinyl ether or N-vinyl-2-pyrrolidone.
  • Additional operative polymeric polycarboxylates may be copolymers of maleic anhydride with styrene, isobutylene or ethyl vinyl ether, polyacrylic, polyitaconic and polymaleic acids, and sulfoacrylic oligomers of AMW as low as 1,000.
  • The amounts of chelating agent may be about 0.1% to about 2.5%, about 0.5% to about 2.5%, or from about 1.0% to about 2.5%.
  • Fluoride Source
  • In certain embodiments, a water-soluble fluoride compound may be present in an oral care composition in an amount sufficient to give a fluoride ion concentration in the composition at 25° C., from about 0.0025% to about 5.0% by weight, or about 0.005% to about 2.0% by weight. A wide variety of fluoride ion-yielding materials may be employed as sources of soluble fluoride in the present compositions. Representative fluoride ion sources may include stannous fluoride, sodium fluoride, potassium fluoride, sodium monofluorophosphate and many others. In certain cases, the subject composition contain stannous fluoride and sodium fluoride, as well as mixtures thereof.
  • Teeth Whitening Actives and Teeth Color Modifying Substances
  • A teeth whitening agent and/or teeth color-modifying substance may also be present in the oral care compositions. These substances are suitable for modifying the color of the teeth. These substances may comprise particles that when applied on the tooth surface modify that surface in terms of absorption and, or reflection of light. Such particles may provide an appearance benefit when a film containing such particles is applied over the surfaces of a tooth or teeth.
  • Particles include pigments and colorants routinely used in the cosmetic arts. There are no specific limitations as to the pigment and, or colorant used in the present composition. Pigments and colorants include inorganic white pigments, inorganic colored pigments, pearling agents, filler powders and the like. Specific examples may be selected from the group consisting of talc, mica, magnesium carbonate, calcium carbonate, magnesium silicate, aluminum magnesium silicate, silica, titanium dioxide, zinc oxide, red iron oxide, brown iron oxide, yellow iron oxide, black iron oxide, ferric ammonium ferrocyanide, manganese violet, ultramarine, nylon powder, polyethylene powder, methacrylate powder, polystyrene powder, silk powder, crystalline cellulose, starch, titanated mica, iron oxide titanated mica, bismuth oxychloride, and mixtures thereof. In certain embodiments, titanium dioxide, bismuth oxychloride, zinc oxide, or mixtures thereof are used.
  • The pigments may be used as opacifiers and colorants. These pigments may be used as treated particles, or as the raw pigments themselves. Typical pigment levels may be selected for the particular impact that is desired by the consumer. For example, for teeth that are particularly dark or stained one may use pigments in sufficient amount to lighten the teeth. On the other hand, where individual teeth or spots on the teeth are lighter than other teeth, pigments to darken the teeth may be useful. The levels of pigments and colorants may be used in the range of about 0.05% to about 20%, from about 0.10% to about 15%, or from about 0.25% to about 10% of the composition.
  • Thickening Agents
  • In certain embodiments, such as toothpaste or gels, some thickening material may provide a consistency of the composition, active release characteristics upon use, shelf stability, and stability of the composition, etc. Thickening agents include carboxyvinyl polymers, carrageenan, hydroxyethyl cellulose, laponite and water soluble salts of cellulose ethers such as sodium carboxymethylcellulose and sodium carboxymethyl hydroxyethyl cellulose. Natural gums, such as gum karaya, xanthan gum, gum arabic, and gum tragacanth, may also be used. Colloidal magnesium aluminum silicate or finely divided silica may be used as part of the thickening agent to further improve texture.
  • Thickening or gelling agents may include a class of homopolymers of acrylic acid crosslinked with an alkyl ether of pentaerythritol or an alkyl ether of sucrose, or carbomers, or mixtures thereof.
  • Copolymers of lactide and glycolide monomers having a molecular weight in the range of from about 1,000 to about 120,000 (number average), may be used in the subject composition such as a “subgingival gel.”
  • Thickening agents may be used in an amount from about 0.1% to about 15%, about 2% to about 10%, or from about 4% to about 8%, by weight of the total toothpaste or gel composition. Higher concentrations may be used for chewing gums, lozenges (including breath mints), sachets, non-abrasive gels and subgingival gels.
  • Humectants
  • In certain embodiments, topical, oral carrier of the subject composition may include a humectant. The humectant may serve to keep the subject compositions from hardening upon exposure to air, to give compositions a moist feel to the mouth, and, for particular humectants, to impart desirable sweetness of flavor to toothpaste compositions. The humectant, on a pure humectant basis, may comprise from about 0% to about 70%, or about 5% to about 25%, by weight of the compositions herein. Suitable humectants for use in compositions of the subject invention include edible polyhydric alcohols such as glycerin, sorbitol, xylitol, butylene glycol, polyethylene glycol, and propylene glycol. In certain cases, the humectant is sorbitol and/or glycerin.
  • Flavoring and Sweetening Agents
  • Flavoring agents may also be added to the compositions. Suitable flavoring agents include oil of wintergreen, oil of peppermint, oil of spearmint, clove bud oil, menthol, anethole, methyl salicylate, eucalyptol, cassia, 1-menthyl acetate, sage, eugenol, parsley oil, oxanone, alpha-irisone, marjoram, lemon, orange, propenyl guaethol, cinnamon, vanillin, thymol, linalool, cinnamaldehyde glycerol acetal known as CGA, and mixtures thereof. Flavoring agents may be used in the compositions at levels of from about 0.001% to about 5%, by weight of the composition.
  • Suitable sweetening agents include sucrose, glucose, saccharin, dextrose, levulose, lactose, mannitol, sorbitol, fructose, maltose, xylitol, saccharin salts, thaumatin, aspartame, D-tryptophan, dihydrochalcones, acesulfame, cyclamate salts, sodium cyclamate or sodium saccharin, and mixtures thereof. A composition may contain from about 0.1% to about 10% of these agents, or from about 0.1% to about 1%, by weight of the composition.
  • In addition to flavoring and sweetening agents, coolants, salivating agents, warming agents, and numbing agents may be used as optional ingredients in the subject composition. These agents may be present in the compositions at a level of from about 0.001% to about 10%, or from about 0.1% to about 1%, by weight of the composition.
  • The coolant may be any of a wide variety of materials. Included among such materials are carboxamides, menthol, ketals, diols, and mixtures thereof. Exemplary coolants are paramenthan carboxyamide agents such as N-ethyl-p-menthan-3-carboxamide, N,2,3-trimethyl-2-isopropylbutanamide, and mixtures thereof. Other coolants may be selected from the group consisting of menthol, 3-1-menthoxypropane-1,2-diol, menthone glycerol acetal, and menthyl lactate. The terms menthol and menthyl include dextro- and levorotatory isomers of these compounds and racemic mixtures, thereof.
  • Warming agents include capsicum and nicotinate esters, such as benzyl nicotinate. Numbing agents may include benzocaine, lidocaine, clove bud oil, and ethanol.
  • Alkali Metal Bicarbonate Salt
  • The compositions may also include an alkali metal bicarbonate salt. Alkali metal bicarbonate salts may be soluble in water and unless stabilized, may release carbon dioxide in an aqueous system. Sodium bicarbonate, also known as baking soda, may be present as the alkali metal bicarbonate salt. In certain embodiments, the composition contains from about 0.5% to about 30%, about 0.5% to about 15%, or from about 0.5% to about 5% of an alkali metal bicarbonate salt.
  • Miscellaneous Carriers
  • Water employed in the preparation of the oral care compositions may be of low ion content and free of organic impurities, and may be present in an amount of about 5% to about 70%, or from about 20% to about 50%, by weight, of an aqueous composition. These amounts of water may include free water that is added, plus water that is introduced with other agents or carriers.
  • Poloxamers may be employed in the compositions. The poloxamer may be classified as a nonionic surfactant. It may function as an emulsifying agent, binder, or stabilizer, or perform a related function. Poloxamers include difunctional block-polymers terminating in primary hydroxyl groups with molecular weights ranging from 1,000 to above 15,000.
  • Other emulsifying agents that may be used in the compositions include polymeric emulsifiers. Predominantly high molecular weight polyacrylic acid polymers may be useful as emulsifiers.
  • Titanium dioxide may also be added to the composition. Titanium dioxide is a white powder which may add opacity to the compositions. Titanium dioxide may comprise from about 0.25% to about 5% by weight of the composition.
  • The pH of the composition is preferably adjusted through the use of one or more buffering agents. Buffering agents refer to agents that can be used to adjust the pH of the compositions in a range of about pH 4.0 to about pH 10.0. Buffering agents include monosodium phosphate, trisodium phosphate, sodium hydroxide, sodium carbonate, sodium acid pyrophosphate, citric acid, and sodium citrate. Buffering agents may be administered at a level of from about 0.5% to about 10%, by weight of the present compositions. In certain embodiments, the pH of dentifrice compositions may be measured from a 3:1 aqueous slurry of dentifrice, e.g., 3 parts water to 1 part dentifrice.
  • Other agents that may be used in the present compositions include dimethicone copolyols selected from alkyl- and alkoxy-dimethicone copolyols, such as C12 to C20 alkyl dimethicone copolyols and mixtures thereof. In certain cases, the compositions contain cetyl dimethicone copolyol. The dimethicone copolyol may be present in a level of from about 0.01% to about 25%, about 0.1% to about 5%, or from about 0.5% to about 1.5% by weight. The dimethicone copolyols may aid in providing positive tooth feel benefits.
  • Other Active Agents
  • The present oral care composition may also include other active agents, such as antimicrobial agents. Included among such agents are water insoluble non-cationic antimicrobial agents such as halogenated diphenyl ethers, phenolic compounds including phenol and its homologs, mono and poly-alkyl and aromatic halophenols, resorcinol and its derivatives, bisphenolic compounds and halogenated salicylanilides, benzoic esters, and halogenated carbanilides. Water soluble antimicrobials include quaternary ammonium salts and bis-biquamide salts, among others. An additional water soluble antimicrobial agent is triclosan monophosphate. Quaternary ammonium agents include those in which one or two of the substitutes on the quaternary nitrogen has a carbon chain length (typically alkyl group) from about 8 to about 20, or from about 10 to about 18 carbon atoms while the remaining substitutes (typically alkyl or benzyl group) have a lower number of carbon atoms, such as from about 1 to about 7 carbon atoms, such as methyl or ethyl groups. Dodecyl trimethyl ammonium bromide, tetradecylpyridinium chloride, domiphen bromide, N-tetradecyl-4-ethyl pyridinium chloride, dodecyl dimethyl (2-phenoxyethyl)ammonium bromide, benzyl dimethylstearyl ammonium chloride, cetyl pyridinium chloride, quaternized 5-amino-1,3-bis(2-ethyl-hexyl)-5-methyl-hexahydropyrimidine, benzalkonium chloride, benzethonium chloride and methyl benzethonium chloride are exemplary of quaternary ammonium antibacterial agents. Other compounds are bis[4-(R-amino)-1-pyridinium]alkanes. Other antimicrobials, such as copper bisglycinate, copper glycinate, zinc citrate, and zinc lactate, may also be included.
  • In addition to an α-glucanase, the present oral care compositions may also contain one or more other enzymes that have carbohydrate hydrolysis, antimicrobial, or teeth whitening activity. Such enzymes include, but are not limited to, a deaminase, an esterase, a glycosidase, glucanhydrolase, a dextrinase, an amylase, a transglucosidase, a cellulase, a hemicellulase, a lipase, an oxidase, a peroxidase, a protease, and a urease.
  • C. Method of Use
  • Another aspect of the present compositions and method is a method of contacting a tooth surface with a composition comprising an alpha-glucanase to reduce or prevent tooth decay, or to reduce or prevent the underlying causes of tooth decay.
  • In some embodiments, the method involves contacting a tooth surface with a composition comprising an alpha-glucanase to hydrolyze a glycocalyx present on the tooth surface. According to this embodiment, the 1,3-α-D-glucosidase activity of the alpha-glucanase, and/or other activities of the alpha-glucanase, hydrolizes polysaccharides, glucans, mannans, and/or adhesive molecules produced by plaque bacteria, thereby decreasing the ability of plaque to adhere to the tooth surface, reducing plaque formation or reducing the levels of existing plaque. Such polysaccharides, glucans, mannans, and/or adhesive molecules may be present in what is conventionally referred to as the glycocalyx.
  • In some embodiments, the method involves contacting a tooth surface with a composition comprising an alpha-glucanase to dewater the tooth surface by disrupting the polysaccharides, glucans, mannans, and/or adhesive molecules produced by bacteria in the mouth, thereby reducing film formation or bacterial adhesion, and/or preventing the accumulation of bacterial acids and other substances that damage the tooth surface.
  • The method may include contacting the tooth surface with one or more alpha-glucanases, which may be formulated as described, above. The methods may include contacting the tooth surface with an additional enzyme, which may be present in the same formulation or a different formulation. In some embodiments, the enzyme is a deaminase, an esterase, a glycosidase, glucanhydrolase, a dextrinase, an amylase, a transglucosidase, a cellulase, a hemicellulase, a lipase, an oxidase, a peroxidase, a protease, and a urease. The additional enzyme may also be an additional alpha-glucanase.
  • Tooth and other personal care compositions and their mechanisms of action are described in detail in Lad. R. (ed.) “Biotechnology in Personal Care”, Cosmetic Science and Technology Series, Vol. 29, Taylor and Francis Group, New York, N.Y., USA, 2006. This reference is indicative of the state of the art, as is incorporated herein.
  • In addition to oral care applications, the present compositions and methods can be adapted for the prevention or removal of biofilims in a large number of other situtations, for example, in cooling water equipment, in drinking water equipment, in food products and food handling equipment, on (or in) medical implants, in paper and textile manufacturing and processing, in oil refinery and mining equipment, on the hulls of ships and boats, in chemical manufacturing, in swimming pools, aquariums, and ponds, and the like. In such cases, alpha glucanases can be used to disrupt polysaccharide components present in the biofilm, thereby reducing the attachment and/or adhesion of microorganism to surfaces. The disruption of such polysaccharides also results in dewatering, which reduces or prevents the formation of a microenvironment suitable for the growth and propagation of microorganism on a surface.
  • Other aspects and embodiments of the present compositions and methods will be apparent to the skilled person in view of the disclosure.
  • EXPERIMENTAL
  • The following examples are offered to illustrate the present compositions and methods, and advantages thereof, and should not be construed as limiting their scope.
  • Example 1 Identification of Candidate Fungal α-1,3-glucanases (EC 3.2.1.59)
  • Several candidate fungi, including Hypocrea tawa, Trichoderma reesei, Trichoderma konilangbra, and Trichoderma harzianum were grown in culture in defined media with 15% maltose (28° C., 7 days, 150 rpm agitation). Supernatants were harvested by sterile filtration, concentrated, and desalted for glucan (and dextran) hydrolysis activity screening. The desalted culture supernatants (5% by volume) were added to 0.2% washed insoluble glucan in 100 mM phosphate buffer, pH 6.3 (or 100 mM acetate buffer, pH 4.5). The reaction mixtures were incubated overnight at 37-40 C.°. The mixtures were visually inspected for solubilization of the insoluble glucan, and the supernatants were analyzed by HPLC for soluble hydrolysis products. For HPLC analysis, the reaction supernatant was diluted 10-fold into 10 mM NaOH, and 10 μl was then injected into an Agilent 1100 HPLC equipped with electrochemical detection. Mono- and disaccharides were eluted with a NaOH/sodium acetate gradient on a PA1 anion exchange column. The components of unknown mixtures were identified based on previously run standards. The supernatants from the Trichoderma reesei, Trichoderma konilangbra, and Hypocrea tawa resulted in the most solubilization of glucan (see, e.g., FIG. 2). The α-1,3-glucanases of H. tawa, T. reesei, and T. konilangbra were selected for cloning, expression, and characterization. Putative T. reesei α-1,3-glucanase sequences were identified in the genome sequence (JGI) by homology.
  • Example 2 Isolation of Genomic DNA
  • Fungal cultures of T. reesei, T. konilangbra, and H. tawa were prepared by adding 30 mL of sterile YEG broth to three 250 mL baffled Erlenmeyer shaking flasks in the biological hood. A 1×1 inch square was cut and removed from each respective fungal culture plate using a sterile plastic loop and placed into the appropriate culture flask. The inoculated flasks were then placed into the 28° C. shaking incubator to grow overnight.
  • The T. reesei, T. konilangbra, H. tawa cultures were removed from the shaking incubator and the contents of each flask were poured into separate sterile 50 mL Sarstedt tubes. The Sarstedt tubes were placed in a table-top centrifuge and spun at 4,500 rpm for 10 minutes to pellet the fungal mycelia. The supernatants were discarded and a large loopful of each mycelial sample was transferred to a separate tube containing lysing matrix (FastDNA). Genomic DNA was extracted from the harvested mycelia using the FastDNA kit (Qbiogene), according to the manufacturer's protocol for algae, fungi and yeast. The homogenization time (Mini BeadBeater-8) was 25 seconds. The amount and quality of genomic DNA extracted was determined by gel electrophoresis.
  • Example 3 Obtaining alpha-glucanase polypeptides by PCR
  • A. T. reesei
  • Putative α-1,3 glucanase genes were identified in the T. reesei genome (JGI) by homology. PCR primers for T. reesei were designed based on the putative homolog DNA sequences. Degenerate PCR primers were designed for T. konilangbra or H. tawa based on the putative T. reesei protein sequences and other published α-1,3 glucanase protein sequences.
  • T. reesei specific PCR primers:
    (SEQ ID NO: 6)
    SK592: 5′-CACCATGTTTGGTCTTGTCCGC 
    (SEQ ID NO: 7)
    SK593: 5′-TCAGCAGTACTGGCATGCTG 
  • The PCR conditions used to amplify the putative α-1,3 glucanase from genomic DNA extracted from T. reesei strain RL-P37 were as follows: 1. 94° C. for 2 minutes, 2. 94° C. for 30 seconds, 3. 56° C. for 30 seconds, 4. 72° C. for 3 minutes, 5. return to step 2 for 24 cycles, 6. 4° C. indefinitely. Reaction samples contained 2 μL of RL-P37 genomic DNA, 10 μL of the 10× buffer, 2 μL 10 mM dNTPs mixture, 1 μL primers SK592 and SK593 at 20 μM, 1 μL of the Pfu Ultra and 83 μL distilled water.
  • B. T. konilangbra and H. tawa
  • Initial PCR reactions used degenerate primers designed from protein alignments of several homologous sequences. A primary set of degenerate primers, designed to anneal near the 5′ and 3′ ends, were used in the first PCR reaction to amplify similar sequences to that of an α-1,3 glucanase.
  • Degenerate Primers for Initial Cloning:
  • H. tawa and T. konilangbra:
    (SEQ ID NO: 8)
    MA1F: GTNTTYTGYCAYTTYATGAT
    (SEQ ID NO: 9)
    MA2F: GTNTTYTGYCAYTTYATGATHGGNAT
    (SEQ ID NO: 10)
    MA4F: GAYTAYGAYGAYGAYATGCARCG
    (SEQ ID NO: 11)
    MA5F: GTRCAYTTRCAIGGICCIGGIGGRCARTANCC
    (SEQ ID NO: 12)
    MA6R: YTCICCIGGNAGNGGRCANCCRTT
    (SEQ ID NO: 13)
    MA7R: RCARTAYTGRCAIGCYGTYGGYGGRCARTA
  • The products of these PCR reactions were then used in a nested PCR, using primers designed to attach within the product of the initial PCR fragment, under the same amplification conditions.
  • Specific Primers for Initial Cloning:
  • T. konilangbra:
    (SEQ ID NO: 14)
    TP1S: CCCCCTGGCCAAGTATGTGT 
    (SEQ ID NO: 15)
    TP2A: GTACGCAAAGTTGAGCTGCT 
    (SEQ ID NO: 16)
    TP3S: AGCACATCGCTGATGGATAT 
    (SEQ ID NO: 17)
    TP3A: AAGTATACGTTGCTTCCGGC 
    (SEQ ID NO: 18)
    TP4S: CTGACGATCGGACTRCACGT 
    (SEQ ID NO: 19)
    TP4A: GGTTGTCGACGTAGAGCTGT 
    H. tawa:
    (SEQ ID NO: 20)
    HP2A: ACGATCGGCAGAGTCATAGG
    (SEQ ID NO: 21)
    HP3S: ATCGGATTGCATGTCACGAC 
    (SEQ ID NO: 22)
    HP3A: TACATCCAGACCGTCACCAG
    (SEQ ID NO: 23)
    HP4S: ACGTTTGCTCTTGCGGTATC 
    (SEQ ID NO: 24)
    HP4A: TCATTATCCCAGGCCTAAAA 
  • Gel electrophoresis of the PCR products was used to determine whether fragments of expected size were amplified. Single nested PCR products of the expected size were purified using the QIAquick PCR purification kit (Qiagen). In addition, expected size products were excised and extracted from agarose gels containing multiple product bands and purified using the QIAquick Gel Extraction kit (Qiagen).
  • Example 4 Transformation/Isolate Screening/Plasmid Extraction
  • PCR products were inserted into cloning vectors using the Invitrogen Zero Blunt® TOPO® PCR Cloning Kit, according to the manufacturer's specifications. The vector was then transformed into One®Shot Top 10 chemically competent E. coli cells (Invitrogen), according to the manufacturer's recommendation and then spread onto LB plates containing 50 ppm of Kanamycin. These plates were incubated in the 37° C. incubator overnight.
  • To select transformants that contained the vector and DNA insert, colonies were selected from the plate for crude plasmid extraction. 50 μL of DNA Extraction Solution (100 mM NaCl, 10 mM EDTA, 2 mM Tris pH 7) was added to clean 1.5 mL Eppendorf tubes. In the biological hood, 7-10 individual colonies of each TOPO® transformation clone were numbered, picked and resuspended in the extraction solution. In the chemical hood, 50 μL of Phenol: Chloroform: Isoamyl alcohol was added to each sample and vortexed thoroughly. Tubes were microcentrifuged at maximum speed for 5 minutes, after which 20 μL of the top aqueous layer was removed and placed into a clean PCR tubes. 1 μL of RNase 2 mg/mL was then added, and samples were mixed and incubated at 37° C. for 30 minutes. The entire sample volume was then run on a gel to determine the presence of the insert in the TOPO® vector based on difference in size to an empty vector. Once the transformant colonies had been identified, those clones was scraped from the plate, and used to inoculate separate 15 mL tubes containing 5 ml of LB/Kanamycin medium (0.0001%). The cultures were placed in the 37° C. shaking incubator overnight.
  • Samples were removed from the incubator and centrifuged for 6 minutes at 6,000 rpm using the Sorval centrifuge. The QIAprep Spin Miniprep kit (Qiagen) and protocol were used to isolate the plasmid DNA, which was then digested to confirm the presence of the insert. The restriction enzyme used was dependent on the sites present in and around the insert sequence. Gel electrophoresis was used to determine fragment size. Appropriate DNA samples were submitted for sequencing (Sequetech, Mountain View, Calif.).
  • Example 5 Cloning the 3′ and 5′ Ends
  • All DNA fragments were sequenced. Sequences were aligned and compared to determine nucleotide and amino acid identities using Align X and ContigExpress® (Vector NTI® suite, Invitrogen). Specific primers were designed to amplify the 3′ and 5′ portions of each incomplete fragment from H. tawa and T. konilangbra by extending outward from the known sequence. At least three specific primers, each nested within the amplified product of the previous primer set, were designed for each template. Amplification of the 5′ and 3′ sequences was performed using the nested primer sets with the LA PCR In vitro Cloning Kit (TaKaRa BIO Inc.).
  • Fresh genomic DNA was prepared for this amplification. Cultures of T. konilangbra and H. tawa were prepared by inoculating 30 mL of YEG broth with a 1 square inch section of the appropriate sporulated fungal plate culture in 250 mL baffled Erlenmeyer flasks. The flasks were incubated in the 28° C. shaking incubator overnight. The cultures were harvested by centrifugation in 50 mL Sarstedt tubes at 4,500 rpm for 10 minutes. The supernatant was discarded and the mycelia were stored overnight in a −80° C. freezer. The frozen mycelia were then placed into a coffee grinder along with a few pieces of dry ice. The grinder was run until the entire mixture had a powder-like consistency. The powder was then air dried and transferred to a sterile 50 mL Sarstedt tube containing 10 mL of Easy-DNA™ Kit Solution A (Invitrogen) and the manufacturer's protocol was followed. The concentration of the genomic DNA collected from the extraction was measured using the NanoDrop spectrophotometer.
  • The LA PCR In vitro Cloning Kit cassettes were chosen based on the absence of a particular restriction site within the known DNA sequences, and the manufacturer's instructions were followed. For first PCR run, 1 μL of the ligation DNA sample was diluted in 33.5 μL of sterilized distilled water. Different primers were used depending on the sample and the end fragment desired. For the 5′ ends, primers HP4A and TP3A were used for H. tawa and T. konilangbra respectively, while for the 3′ ends primers HP4S and TP3S were used for H. tawa and T. konilangbra. The PCR mixture was prepared by adding 34.5 μL diluted ligation DNA solution, 5 μL of 10× LA Buffer II (Mg+2), 8 μL dNTPs mixture, 1 μL cassette primer 1, 1 μL specific primer I (depending on sample and end fragment), and 0.5 μL TaKaRa LA Taq. The PCR tubes were then placed in a thermocycler following the listed protocol: 1. 94° C. for 10 minutes, 2. 94° C. for 30 seconds, 3. 55° C. for 30 seconds, 4. 72° C. for 4 minutes, return to step 2. 30 times, 4° C. indefinitely.
  • A second PCR reaction was prepared by taking 1 μL of the first PCR reaction and diluting the sample in sterilized distilled water to a dilution factor of 1/10,000. A second set of primers nested within the first amplified region were used to amplify the fragment isolated in the first PCR reaction. Primers HP3A and TP4A were used to amplify toward the 5′ end of H. tawa and T. konilangbra respectively, while primers HP3S and TP4S were used to amplify toward the 3′ end. The diluted DNA was added to the PCR reaction containing 33.5 μL distilled sterilized water, 5 μL 10× LA Buffer II (Mg+2), 8 μL dNTPs mixture, 1 μL of cassette primer 2, 1 μL of specific primer 2 (dependent on sample and fragment end), 0.5 μL, TaKaRa LA Taq, and mixed thoroughly before the PCR run. The PCR protocol was the same as the first reaction, without the initial 94° C. for 10 minutes. After the reaction was complete, the sample was run by gel electrophoresis to determine size and number of fragments isolated. If a single band was present, the sample was purified and sent for sequencing. If no fragment was isolated, a third PCR reaction was performed using the previous protocol for a nested PCR reaction. After running the amplified fragments by gel electrophoresis, the brightest band was excised, purified, and sent for sequencing.
  • Example 6 Analysis of Sequence Alignments
  • Sequences were obtained and analyzed using the Vector NTI suite, including Align X, and ContigExpress. Each respective end fragment sequence was aligned to the previously obtained fragments of H. tawa and T. konilangbra to obtain the entire gene sequence. Nucleotide alignments with T. harzianum and T. reesei sequences revealed the translation start and stop points of the gene of interest in both H. tawa and T. konilangbra. After the entire gene sequence was identified, specific primers were designed to amplify the entire gene from the genomic DNA. Primers were designed as described earlier, with the exception of adding CACC nucleotide sequence before the translational starting point, for GATEWAY® cloning (Invitrogen).
  • Primers for Final Cloning:
  • T. konilangbra:
    (SEQ ID NO: 25)
    T1FS: caccatgctaggcattctccg
    (SEQ ID NO: 26)
    T1FA: tcagcagtattggcatgccg
    H. tawa:
    (SEQ ID NO: 27)
    H1FS: CACCATGTTGGGCGTTTTTCG
    (SEQ ID NO: 28)
    H1FA: CTAGCAGTATTGRCATGCCG
  • The PCR protocol was followed as previously described with the exception of altering the annealing temperature to 55° C. After a single band was isolated and viewed through gel electrophoresis, the amplified fragment was purified as described earlier and used in the pENTR/D TOPO® (Invitrogen) transformation, according to the manufacturer's instructions. Chemically competent E. coli were then transformed as previously described, and transferred to LB plates containing 50 ppm of kanamycin. Following 37° C. incubation overnight, transformants containing the plasmid and insert were selected after crude DNA extraction and plasmid size analysis, as previously described. The selected transformants were scraped from the plate and used to inoculate a fresh 15 mL tube containing 5 ml of LB/Kanamycin medium (0.0001%). Cultures were placed in the 37° C. shaking incubator overnight. Cells were harvested by centrifugation and the plasmid DNA extracted as previously described. Plasmid DNA was digested to confirm the presence of the insert sequence, and then submitted for sequencing. The LR Clonase reaction (Gateway Cloning, Invitrogen) was used, according to manufacturer's instructions, to directionally transfer the insert from the pENTR/D vector into the destination vector. The destination vector is designed for expression of a gene of interest, in T. reesei, under control of the CBH1 promoter and terminator, with A. niger acetamidase for selection.
  • Example 7 Biolistic Transformation
  • A T. reesei spore suspension was spread onto the center ˜6 cm diameter of an acetamidase transformation plate (150 μL of a 5×107-5×108 spore/mL suspension). The plate was then air dried in a biological hood. The stopping screens (BioRad 165-2336) and the macrocarrier holders (BioRad 1652322) were soaked in 70% ethanol and air dried. DriRite desiccant was placed in small Petri dishes (6 cm Pyrex) and overlaid with Whatman filter paper. The macrocarrier holder containing the macrocarrier (BioRad 165-2335) was placed flatly on top of the filter paper and the Petri dish lid replaced.
  • A tungsten particle suspension was prepared by adding 60 mg tungsten M-10 particles (microcarrier, 0.7 micron, BioRad #1652266) to an Eppendorf tube. 1 mL ethanol (100%) was added. The tungsten was vortexed in the ethanol solution and allowed to soak for 15 minutes. The Eppendorf tube was microfuged briefly at maximum speed to pellet the tungsten. The ethanol was decanted and washed three times with sterile distilled water. After the water wash was decanted the third time, the tungsten was resuspended in 1 mL of sterile 50% glycerol.
  • The transformation reaction was prepared by adding 25 μL suspended tungsten to a 1.5 mL Eppendorf tube for each transformation. Subsequent additions were made in order, 2 μL DNA pTrex3g expression vectors, 25 μL 2.5M CaCl2, 10 μL 0.1M spermidine. The reaction was vortexed continuously for 5-10 minutes, keeping the tungsten suspended. The Eppendorf tube was the microfuged briefly and decanted. The tungsten pellet was washed with 200 μL of 70% ethanol, microfuged briefly to pellet and decanted. The pellet was washed with 200 μL of 100% ethanol, microfuged briefly to pellet, and decanted. The tungsten pellet was resuspended in 24 μL 100% ethanol. The Eppendorf tube was placed in an ultrasonic water bath for 15 seconds and 8 μL aliquots were transferred onto the center of the desiccated macrocarriers. The macrocarriers were left to dry in the desiccated Petri dishes.
  • A Helium tank was turned on to 1500 psi. 1100 psi rupture discs (BioRad 165-2329) were used in the Model PDS-1000/He Biolistic Particle Delivery System (BioRad).
  • When the tungsten solution was dry, a stopping screen and the macrocarrier holder were inserted into the PDS-1000. An acetamidase plate, containing the target T. reesei spores, was placed 6 cm below the stopping screen. A vacuum of 29 inches Hg was pulled on the chamber and held. The He Biolistic Particle Delivery System was fired. The chamber was vented and the acetamidase plate removed for incubation at 28° C. until colonies appeared (5 days).
  • Modified amdS Biolistic agar (MABA) per liter
    Part I, make in 500 ml dH2O
    1000x salts 1 ml
    Noble agar 20 g
    pH to 6.0, autoclave
    Part II, make in 500 ml dH2O
    Acetamide 0.6 g
    CsCl 1.68 g
    Glucose 20 g
    KH2PO4 15 g
    MgSO4•7H2O 0.6 g
    CaCl2•2H2O 0.6 g
    pH to 4.5, 0.2 micron filter sterilize;
    leave in 50° C. oven to warm, add to agar,
    mix, pour plates. Stored at room temperature.
  • 1000x Salts per liter
    FeSO4•7H2O 5 g
    MnSO4•H2O 1.6 g
    ZnSO4•7H2O 1.4 g
    CoCl2•6H2O 1 g
    Bring up to 1 L dH2O.
    0.2 micron filter sterilize
  • Example 8 Expression of α-1,3 glucanases by T. reesei Transformants
  • A 1 cm2 agar plug was used to inoculate Proflo seed media. Cultures were incubated at 28° C., with 200 rpm shaking. On the second day, a 10% transfer was aseptically made into Production media. The cultures were incubated at 28° C., with 200 rpm shaking. On the third day, cultures were harvested by centrifugation. Supernatants were sterile-filtered (0.2 μm PES) and stored at 4° C. Analysis by SDS-PAGE identified clones expressing the respective alpha-glucanase genes.
  • Example 9 Preparation of Insoluble Glucan Substrate
  • Four sterile flasks containing BHI (brain heart infusion) broth were inoculated with Streptococcus sobrinus (ATCC 27607), from a BHI plate. The cultures were incubated at 37° C. for 24 hrs, static, after which they were visibly turbid. The supernatants (containing the S. sobrinus glucosyltransferases) were harvested by centrifugation (15 minutes, 10,000 rpm). The supernatants were pooled and sterile-filtered (0.22 μm) to remove any remaining cells. Aseptically, sucrose was added to a final concentration of 5%, which induces the glucosyltransferases to produce glucan polymer. The culture supernatant plus sucrose was sealed, mixed, and stored at 37° C. incubator for 24-48 hrs (static). A fluffy precipitate formed and was harvested by centrifugation (10,000 rpm, 15 minutes). The supernatant was decanted, leaving the precipitate, which was washed with dI water three times, lastly in a tared Eppendorf tube. The glucan was dried in a SpeedVac, and the Eppendorf weight was recorded after drying.
  • Example 10 PAHBAH Reducing Sugars Assay to Measure the Activity of Cloned Alpha-Glucanases
  • Transformed T. reesei culture supernatants, buffer and insoluble glucan were distributed into a round-bottom 96-well plate in the amounts listed below. Two types of buffers (pH 4.5 and pH 6.0) were used to compare activity levels. After the samples were distributed, the 96-well plate was sealed and placed into a shaking 37° C. incubator overnight.
  • Glucan Hydrolysis Mixture:
  • 50 μL culture supernatant
    50 μL of a 28 mg/mL glucan solution
    5 μL 1M Citrate buffer (pH 4.5 or 6.0)
    105 μL
  • PAHBAH solution:
  • 0.5 g Sodium potassium tartrate
    0.15 g p-hydroxybenzoic acid hydrazide (PAHBAH)
    10 mL 2% NaOH
  • Following incubation, 150 μL, of freshly made PAHBAH (p-hydroxybenzoic acid hydrazide) reagent was transferred into 0.2 mL PCR tubes along with 20 μL of each hydrolysis mixture. These tubes were then lightly mixed and placed into a thermocycler, where they were heated to 99° C. for 30 minutes. The PCR tubes were removed and 150 μL, of each sample was transferred to a fresh 96-well plate. The absorbance of each sample was measured at 410 nm. Results of this assay are shown in FIG. 3.

Claims (22)

1. An isolated α-glucanase comprising an amino acid sequence that is:
a) at least 99% identical to the mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); or
b) at least 85% identical to the mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3).
2. An isolated polynucleotide encoding an isolated α-glucanase of claim 1.
3. A recombinant nucleic acid comprising the isolated polynucleotide of claim 2.
4. A vector comprising the recombinant nucleic acid of claim 3.
5. A host cell comprising the recombinant nucleic acid of claim 3.
6. A cell culture comprising:
a) growth medium; and
b) a population of cells of claim 5.
7. A method of producing protein comprising:
maintaining the culture of cells of claim 6 under conditions suitable for production of said isolated α-glucanase.
8. The method of claim 7, further comprising harvesting said α-glucanase from said growth medium.
9. A method comprising
receiving an isolated α-glucanase selected from the following:
a) α-glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1);
b) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or
c) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3); and
admixing said isolated α-glucanase with an orally acceptable excipient to make an oral care composition.
10. The method of claim 9, further comprising:
packaging said oral care composition.
11. The method of claim 1, wherein the α-glucanase is not identical to Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2).
12. An oral care composition comprising:
a) an orally acceptable excipient; and
b) an isolated α-glucanase of claim 1.
13. An oral care composition comprising:
an orally acceptable excipient; and
an isolated α-glucanase selected from the following:
a) α-glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1);
b) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or
c) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3).
14. The composition of claim 13, wherein the α-glucanase is not identical to Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2).
15. The oral care composition of claim 12, wherein said α-glucanase is present in said composition at a concentration of 0.0001% to 5% by weight of said composition.
16. The oral care composition of claim 12, further comprising a second enzyme.
17. The oral care composition of claim 16, wherein said second enzyme is a deaminase, esterase, glycosidase, lipase, oxidase, peroxidase, protease, urease or cellulase.
18. The oral care composition of claim 12, wherein said composition is formulated as a toothpaste.
19. The oral care composition of claim 12, wherein said composition comprises at least one of a thickener, a surfactant, a humectant, and an abrasive.
20. A method comprising:
contacting the oral care composition of claim 12 with a tooth under conditions suitable for activity of said α-glucanase.
21. The method of claim 20, wherein said contacting is performed using a toothbrush.
22. The method of claim 20, wherein said method results in prevention and/or reduction in dental plaque.
US14/192,372 2008-04-11 2014-02-27 Alpha-glucanase and oral care composition containing the same Abandoned US20140234231A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/192,372 US20140234231A1 (en) 2008-04-11 2014-02-27 Alpha-glucanase and oral care composition containing the same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US4431608P 2008-04-11 2008-04-11
PCT/US2009/040013 WO2009126773A1 (en) 2008-04-11 2009-04-09 Alpha-glucanase and oral care composition containing the same
US93736211A 2011-05-26 2011-05-26
US14/192,372 US20140234231A1 (en) 2008-04-11 2014-02-27 Alpha-glucanase and oral care composition containing the same

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US12/937,362 Division US8709386B2 (en) 2008-04-11 2009-04-09 Method of making and using an alpha-glucanase composition to reduce or remove biofilm
PCT/US2009/040013 Division WO2009126773A1 (en) 2008-04-11 2009-04-09 Alpha-glucanase and oral care composition containing the same

Publications (1)

Publication Number Publication Date
US20140234231A1 true US20140234231A1 (en) 2014-08-21

Family

ID=40765534

Family Applications (2)

Application Number Title Priority Date Filing Date
US12/937,362 Expired - Fee Related US8709386B2 (en) 2008-04-11 2009-04-09 Method of making and using an alpha-glucanase composition to reduce or remove biofilm
US14/192,372 Abandoned US20140234231A1 (en) 2008-04-11 2014-02-27 Alpha-glucanase and oral care composition containing the same

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US12/937,362 Expired - Fee Related US8709386B2 (en) 2008-04-11 2009-04-09 Method of making and using an alpha-glucanase composition to reduce or remove biofilm

Country Status (7)

Country Link
US (2) US8709386B2 (en)
EP (3) EP2280686B1 (en)
JP (1) JP2011516083A (en)
CN (1) CN101998849A (en)
CA (1) CA2721074A1 (en)
DK (1) DK2280686T3 (en)
WO (1) WO2009126773A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017010833A1 (en) * 2015-07-15 2017-01-19 주식회사 제노포커스 Novel alpha-1,3-glucanase

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102015028A (en) * 2008-04-22 2011-04-13 丹尼斯科美国公司 Oral care composition containing oxidase enzyme
EP2793834B1 (en) * 2011-12-21 2016-12-14 Colgate-Palmolive Company Oral care compositions
WO2015183724A1 (en) 2014-05-29 2015-12-03 E. I. Du Pont De Nemours And Company Enzymatic synthesis of soluble glucan fiber
US20180049457A1 (en) 2014-05-29 2018-02-22 E I Du Pont De Nemours And Company Enzymatic synthesis of soluble glucan fiber
BR112016027839A2 (en) 2014-05-29 2017-10-31 Du Pont fiber and carbohydrate compositions, foodstuff, fiber composition production methods, mixed carbohydrate composition making, reduction in the glycemic index of food or beverages, and inhibition of blood sugar elevation, cosmetic composition, use of fiber composition and product
WO2015183714A1 (en) 2014-05-29 2015-12-03 E. I. Du Pont De Nemours And Company Enzymatic synthesis of soluble glucan fiber
JP2017524711A (en) * 2014-08-15 2017-08-31 ザ プロクター アンド ギャンブル カンパニー Oral care compositions and regimens
JP6997706B2 (en) 2015-11-13 2022-01-18 ニュートリション・アンド・バイオサイエンシーズ・ユーエスエー・フォー,インコーポレイテッド Glucan fiber composition for use in laundry care and textile care
WO2017083228A1 (en) 2015-11-13 2017-05-18 E. I. Du Pont De Nemours And Company Glucan fiber compositions for use in laundry care and fabric care
JP2019504932A (en) 2015-11-13 2019-02-21 イー・アイ・デュポン・ドウ・ヌムール・アンド・カンパニーE.I.Du Pont De Nemours And Company Glucan fiber composition for use in laundry and textile care
WO2020099491A1 (en) * 2018-11-14 2020-05-22 Novozymes A/S Oral care composition comprising a polypeptide having dnase activity
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
CN114209818A (en) * 2021-12-21 2022-03-22 苏杰 Composition containing hydrolase and polyglutamic acid for preventing and removing periodontal biofilm
WO2024003143A1 (en) * 2022-06-30 2024-01-04 Novozymes A/S Mutanases and oral care compositions comprising same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020085980A1 (en) * 1996-10-25 2002-07-04 Novozymes A/S Oral care product comprising a mutan binding domain

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB1373487A (en) 1970-10-26 1974-11-13 Guggenheim B Enzymes their preparation and uses
US3988433A (en) 1973-08-10 1976-10-26 The Procter & Gamble Company Oral compositions for preventing or removing stains from teeth
EP1225227B1 (en) 1990-12-10 2009-02-18 Genencor International, Inc. Improved saccharification of cellulose by cloning and amplification of the beta-glucosidase gene of trichoderma reesei
US5578295A (en) 1995-04-28 1996-11-26 The Procter & Gamble Company Oral care compositions comprising certain substituted diphenyl ethers
EP0954570A1 (en) * 1996-06-28 1999-11-10 Novo Nordisk A/S A recombinant enzyme with mutanase activity
US6268328B1 (en) 1998-12-18 2001-07-31 Genencor International, Inc. Variant EGIII-like cellulase compositions
US6238648B1 (en) 1999-03-25 2001-05-29 The Procter & Gamble Company Anti-caries oral care compositions and their methods of use
ES2163988B1 (en) 1999-07-31 2003-04-01 Newbiotechnic Sa PROTEIN WITH ANTIFUNGIC ACTIVITY.
AU6537500A (en) 1999-08-13 2001-03-13 Institute Of Grassland & Environmental Research Phytase enzymes, nucleic acids encoding phytase enzymes and vectors and host cells incorporating same
US7795002B2 (en) 2000-06-28 2010-09-14 Glycofi, Inc. Production of galactosylated glycoproteins in lower eukaryotes
AU2004293789B2 (en) 2003-11-21 2009-07-23 Genencor International, Inc. Expression of granular starch hydrolyzing enzymes in trichoderma and process for producing glucose from granular starch substrates
US7662918B2 (en) 2005-03-03 2010-02-16 Simpson Biotech Co., Ltd. Recombinant protein comprising starch binding domain and use thereof
US9682256B2 (en) * 2006-07-14 2017-06-20 Colgate-Palmolive Company Methods of making compositions comprising films

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020085980A1 (en) * 1996-10-25 2002-07-04 Novozymes A/S Oral care product comprising a mutan binding domain

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017010833A1 (en) * 2015-07-15 2017-01-19 주식회사 제노포커스 Novel alpha-1,3-glucanase
US10472616B2 (en) 2015-07-15 2019-11-12 Genofocus Co., Ltd. Genes encoding alpha-1,3-glucanase and methods of using the same

Also Published As

Publication number Publication date
EP2644187B1 (en) 2015-09-09
US8709386B2 (en) 2014-04-29
JP2011516083A (en) 2011-05-26
EP2644187A1 (en) 2013-10-02
EP2641589A1 (en) 2013-09-25
EP2280686A1 (en) 2011-02-09
EP2280686B1 (en) 2014-11-26
WO2009126773A1 (en) 2009-10-15
CN101998849A (en) 2011-03-30
US20110223117A1 (en) 2011-09-15
DK2280686T3 (en) 2015-01-26
CA2721074A1 (en) 2009-10-15

Similar Documents

Publication Publication Date Title
US8709386B2 (en) Method of making and using an alpha-glucanase composition to reduce or remove biofilm
EP1501472B1 (en) Oral care compositions comprising dicarboxy functionalized polyorganosiloxanes
EP2793834B1 (en) Oral care compositions
JPH11512092A (en) Use of mutant subtilisin protease in cosmetic products
CZ20033403A3 (en) Abrasive preparations for tooth cleaning
AU719536B2 (en) A recombinant enzyme with dextranase activitiy
CA2496800C (en) Antiplaque enzyme containing dual component composition
US20110236859A1 (en) Oral care composition containing oxidase enzyme
SG173537A1 (en) Dentifrice compositions and methods for treating and preventing damage to tooth surfaces
EP1001736A1 (en) STARCH BINDING DOMAINS (SBDs) FOR ORAL CARE PRODUCTS
CN115298306A (en) Transglutaminase variants
AU734737B2 (en) Plaque-inhibiting oral compositions
NZ212257A (en) Stable foamable dentifrice containing dextranase
CA2550013C (en) Bactericide against streptococcus mutans and streptococcus sobrinus
CA2875084A1 (en) Dentifrice compositions and methods for treating and preventing damage to tooth surfaces
SG190632A1 (en) Dentifrice compositions and methods for treating and preventing damage to tooth surfaces

Legal Events

Date Code Title Description
AS Assignment

Owner name: DANISCO US INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KIM, STEVEN;LANTZ, SUZANNE;PEPSIN, MICHAEL;SIGNING DATES FROM 20110523 TO 20110524;REEL/FRAME:033069/0980

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION