US20140147495A1 - MicroRNA-Based Methods and Compositions For the Diagnosis, Prognosis and Treatment of Breast Cancer - Google Patents

MicroRNA-Based Methods and Compositions For the Diagnosis, Prognosis and Treatment of Breast Cancer Download PDF

Info

Publication number
US20140147495A1
US20140147495A1 US14/145,364 US201314145364A US2014147495A1 US 20140147495 A1 US20140147495 A1 US 20140147495A1 US 201314145364 A US201314145364 A US 201314145364A US 2014147495 A1 US2014147495 A1 US 2014147495A1
Authority
US
United States
Prior art keywords
mir
gene product
breast cancer
subject
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/145,364
Inventor
Carlo M. Croce
George A. Calin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ohio State University Research Foundation
Original Assignee
Ohio State University Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ohio State University Research Foundation filed Critical Ohio State University Research Foundation
Priority to US14/145,364 priority Critical patent/US20140147495A1/en
Assigned to THE OHIO STATE UNIVERSITY reassignment THE OHIO STATE UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CROCE, CARLO M., CALIN, GEORGE A.
Assigned to THE OHIO STATE UNIVERSITY RESEARCH FOUNDATION reassignment THE OHIO STATE UNIVERSITY RESEARCH FOUNDATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: THE OHIO STATE UNIVERSITY
Publication of US20140147495A1 publication Critical patent/US20140147495A1/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: OHIO STATE UNIVERSITY
Priority to US15/155,479 priority patent/US20160251659A1/en
Assigned to NATIONAL INSTITUTES OF HEALTH reassignment NATIONAL INSTITUTES OF HEALTH CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: THE OHIO UNIVERSITY
Assigned to NATIONAL INSTITUTES OF HEALTH reassignment NATIONAL INSTITUTES OF HEALTH CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: THE OHIO STATE UNIVERSITY
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

Definitions

  • breast cancer is a significant health problem for women in the United States and throughout the world. Although advances have been made in the detection and treatment of the disease, breast cancer remains the second leading cause of cancer-related deaths in women, affecting more than 180,000 women in the United States each year. For women in North America, the life-time odds of getting breast cancer are now one in eight.
  • BRCA1 and BRCA2 were important steps in identifying key genetic factors involved in breast cancer, it has become clear that mutations in BRCA1 and BRCA2 account for only a fraction of inherited susceptibility to breast cancer. In spite of considerable research into therapies for breast cancer, breast cancer remains difficult to diagnose and treat effectively, and the high mortality observed in breast cancer patients indicates that improvements are needed in the diagnosis, treatment and prevention of the disease.
  • MicroRNAs are a class of small, non-coding RNAs that control gene expression by hybridizing to and triggering either translational repression or, less frequently, degradation of a messenger RNA (mRNA) target.
  • miRNAs messenger RNA
  • the discovery and study of miRNAs has revealed miRNA-mediated gene regulatory mechanisms that play important roles in organismal development and various cellular processes, such as cell differentiation, cell growth and cell death. Recent studies suggest that aberrant expression of particular miRNAs may be involved in human diseases, such as neurological disorders and cancer. In particular, misexpression of miR-16-1 and/or miR-15a has been found in human chronic lymphocytic leukemias.
  • microRNA microarrays containing all known human microRNAs has permitted a simultaneous analysis of the expression of every miRNA in a sample. These microRNA microarrays have not only been used to confirm that miR-16-1 is deregulated in human CLL cells, but also to generate miRNA expression signatures that are associated with well-defined clinico-pathological features of human CLL.
  • microRNA microarrays to identify a group of microRNAs, which are differentially-expressed between normal cells and breast cancer cells (for example, an expression signature or expression profile), may help pinpoint specific miRNAs that are involved in breast cancer. Furthermore, the identification of putative targets of these miRNAs may help to unravel their pathogenic role.
  • the present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of breast cancer.
  • the present invention is based, in part, on the identification of a breast cancer-specific signature of miRNAs that are differentially-expressed in breast cancer cells, relative to normal control cells.
  • embodiments of the invention encompass methods of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising measuring the level of at least one miR gene product in a test sample from the subject and comparing the level of the miR gene product in the test sample to the level of a corresponding miR gene product in a control sample.
  • An alteration for example, an increase, a decrease
  • the at least one miR gene product is selected from the group consisting of miR-125b-1, miR125b-2, miR-145, miR-21, miR-155, miR-10b and combinations thereof.
  • the level of the at least one miR gene product can be measured using a variety of techniques that are well known to those of skill in the art. In one embodiment, the level of the at least one miR gene product is measured using Northern blot analysis. In another embodiment, the level of the at least one miR gene product is measured by reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray that comprises miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample.
  • the microarray comprises miRNA-specific probe oligonucleotides for a substantial portion of the human miRNome.
  • the microarray comprises miRNA-specific probe oligonucleotides for one or more miRNAs selected from the group consisting of miR-145, miR-21, miR-155, miR-10b, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, miR-213, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, let-7i (let-7d-v2), miR-101-1, miR-122a, miR-128b, miR-136, miR-143, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-205, miR-206, miR-210 and
  • Embodiments of the invention also provide methods of diagnosing a breast cancer associated with one or more prognostic markers, comprising measuring the level of at least one miR gene product in a breast cancer test sample from a subject and comparing the level of the at least one miR gene product in the breast cancer test sample to the level of a corresponding miR gene product in a control sample.
  • the breast cancer can be associated with one or more adverse prognostic markers associated with breast cancer, such as, but not limited to, estrogen receptor expression, progesterone receptor expression, positive lymph node metastasis, high proliferative index, detectable p53 expression, advanced tumor stage, and high vascular invasion.
  • the level of the at least one miR gene product is measured by reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray that comprises miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample.
  • An alteration in the signal of at least one miRNA in the test sample relative to the control sample is indicative of the subject either having, or being at risk for developing, a breast cancer associated with the one or more prognostic markers.
  • the microarray comprises at least one miRNA-specific probe oligonucleotide for a miRNA selected from the group consisting of miR-26a, miR-26b, miR-102 (miR-29b), miR-30a-5p, miR-30b, miR-30c, miR-30d, miR-185, miR-191, miR-206, miR-212, let-7c, miR-9-2, miR-15-a, miR-21, miR-30a-s, miR-133a-1, miR-137, miR-153-2, miR-154, miR-181a, miR-203, miR-213, let-7f-1, let-7a-3, let-7a-2, miR-9-3, miR-10b, miR-27a, miR-29a, miR-123, miR-205, let-7d, miR-145, miR-16a, miR-128b and combinations thereof.
  • miRNA-specific probe oligonucleotide for a miRNA selected from the
  • Embodiments of the invention also encompass methods of treating breast cancer in a subject, wherein at least one miR gene product is de-regulated (for example, down-regulated, up-regulated) in the cancer cells of the subject.
  • the method comprises administering an effective amount of the at least one isolated miR gene product, such that proliferation of cancer cells in the subject is inhibited.
  • the method comprises administering an effective amount of the at least one isolated miR gene product, provided that the miR gene is not miR-15a or miR-16-1, such that proliferation of cancer cells in the subject is inhibited.
  • the method comprises administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene, such that proliferation of breast cancer cells is inhibited.
  • the invention provides methods of treating breast cancer in a subject, comprising determining the amount of at least one miR gene product in breast cancer cells from the subject, relative to control cells. If expression of the miR gene product is deregulated in breast cancer cells, the methods further comprise altering the amount of the at least one miR gene product expressed in the breast cancer cells. If the amount of the miR gene product expressed in the cancer cells is less than the amount of the miR gene product expressed in control cells, the method comprises administering an effective amount of at least one isolated miR gene product. In one embodiment, the miR gene product is not miR-15a or miR-16-1.
  • the method comprises administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene.
  • the miR gene product is not miR-15a or miR-16-1.
  • the invention further provides pharmaceutical compositions for treating breast cancer.
  • the pharmaceutical compositions comprise at least one isolated miR gene product and a pharmaceutically-acceptable carrier.
  • the at least one miR gene product corresponds to a miR gene product that has a decreased level of expression in breast cancer cells relative to suitable control cells.
  • the isolated miR gene product is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
  • the pharmaceutical compositions of the invention comprise at least one miR expression inhibition compound.
  • the at least one miR expression inhibition compound is specific for a miR gene whose expression is greater in breast cancer cells than control cells.
  • the miR expression inhibition compound is specific for one or more miR gene products selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
  • Embodiments of the invention also encompass methods of identifying an anti-breast cancer agent, comprising providing a test agent to a cell and measuring the level of at least one miR gene product in the cell.
  • the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with decreased expression levels in breast cancer cells. An increase in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent.
  • the at least one miR gene product associated with decreased expression levels in breast cancer cells is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
  • the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with increased expression levels in breast cancer cells. A decrease in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent.
  • At least one miR gene product associated with increased expression levels in breast cancer cells is selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
  • FIG. 1 depicts a tree generated by cluster analysis showing a separation of breast cancer from normal tissues on the basis of differential microRNA expression (P ⁇ 0.05).
  • the bar at the bottom of the figure indicates the group of cancer (red) or normal breast tissues (yellow).
  • FIG. 2 is a graph depicting the probability (0.0 to 1.0) of each sample being a cancerous or normal tissue based on PAM analysis. All breast cancer and normal tissues were correctly predicted by the miR signature shown in Table 2.
  • FIG. 3A is a Northern blot depicting the expression level of miR-125b, using a miR-125b complementary probe, in a normal sample, as well as several tumor samples from breast cancer patients (P). The U6 probe was used for normalization of expression levels for each sample.
  • FIG. 3B is a Northern blot depicting the expression level of miR-145, using a miR-145 complementary probe, in a normal sample, as well as several tumor samples from breast cancer patients (P). The U6 probe was used for normalization of expression levels for each sample.
  • FIG. 3C is a Northern blot depicting the expression level of miR-21, using a miR-21 complementary probe, in a normal sample, as well as several tumor samples from breast cancer patients (labeled as numbered patients). The U6 probe was used for normalization of expression levels for each sample.
  • FIG. 3D is a Northern blot depicting the expression levels of microRNAs miR-125b, miR-145 and miR-21 in various breast cancer cell lines. The expression level of each microRNA was also determined in a sample from normal tissues. The U6 probe was used for normalization of expression levels for each sample.
  • FIG. 4A is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence (ER+) or absence (ER ⁇ ) of estrogen receptor.
  • FIG. 4B is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence (PR+) or absence (PR ⁇ ) of progesterone receptor.
  • FIG. 4C is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with stage 1 (pT1) or stage 2 or 3 (pT2-3) tumors.
  • FIG. 4D is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence (pN0) or absence (pN10+) of lymph node metastasis.
  • FIG. 4E is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence or absence of vascular invasion.
  • FIG. 4F is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with a high (MIB-1>30) or low (MIB-1 ⁇ 20) proliferative index (PI).
  • FIG. 4G is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with positive (p53+) or negative (p53 ⁇ ) immunostaining of p53.
  • the present invention is based, in part, on the identification of particular miRNAs whose expression is altered in breast cancer cells relative to normal control cells, and microRNAs whose expression is altered in breast cancer cells associated with particular prognostic features, relative to breast cancer cells lacking such features.
  • a “miR gene product,” “microRNA,” “miR,” or “miRNA” refers to the unprocessed or processed RNA transcript from an miR gene. As the miR gene products are not translated into protein, the term “miR gene products” does not include proteins.
  • the unprocessed miR gene transcript is also called an “miR precursor,” and typically comprises an RNA transcript of about 70-100 nucleotides in length.
  • the miR precursor can be processed by digestion with an RNAse (for example, Dicer, Argonaut, or RNAse III, for example, E. coli RNAse III)) into an active 19-25 nucleotide RNA molecule. This active 19-25 nucleotide RNA molecule is also called the “processed” miR gene transcript or “mature” miRNA.
  • the active 19-25 nucleotide RNA molecule can be obtained from the miR precursor through natural processing routes (for example, using intact cells or cell lysates) or by synthetic processing routes (for example, using isolated processing enzymes, such as isolated Dicer, Argonaut, or RNAase III). It is understood that the active 19-25 nucleotide RNA molecule can also be produced directly by biological or chemical synthesis, without having been processed from the miR precursor.
  • sequences of 187 miR gene products are provided in Table 1. All nucleic acid sequences herein are given in the 5′ to 3′ direction. In addition, genes are represented by italics, and gene products are represented by normal type; for example, mir-17 is the gene and miR-17 is the gene product.
  • the present invention encompasses methods of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising measuring the level of at least one miR gene product in a test sample from the subject and comparing the level of the miR gene product in the test sample to the level of a corresponding miR gene product in a control sample.
  • a “subject” can be any mammal that has, or is suspected of having, breast cancer.
  • the subject is a human who has, or is suspected of having, breast cancer.
  • the breast cancer can be any form of breast cancer and may be associated with one or more prognostic markers or features, including, but not limited to, estrogen receptor expression, progesterone receptor expression, lymph node metastasis, high proliferative index, detectable p53 expression, advanced tumor stage, and high vascular invasion.
  • the prognostic marker can be associated with an adverse or negative prognosis, or it may be associated with a good or positive prognosis.
  • the level of at least one miR gene product can be measured in cells of a biological sample obtained from the subject.
  • a tissue sample can be removed from a subject suspected of having breast cancer associated with by conventional biopsy techniques.
  • a blood sample can be removed from the subject, and white blood cells can be isolated for DNA extraction by standard techniques.
  • the blood or tissue sample is preferably obtained from the subject prior to initiation of radiotherapy, chemotherapy or other therapeutic treatment.
  • a corresponding control tissue or blood sample can be obtained from unaffected tissues of the subject, from a normal human individual or population of normal individuals, or from cultured cells corresponding to the majority of cells in the subject's sample.
  • the control tissue or blood sample is then processed along with the sample from the subject, so that the levels of miR gene product produced from a given miR gene in cells from the subject's sample can be compared to the corresponding miR gene product levels from cells of the control sample.
  • an alteration i.e., an increase or decrease
  • the level of the at least one miR gene product in the test sample is greater than the level of the corresponding miR gene product in the control sample (i.e., expression of the miR gene product is “up-regulated”).
  • expression of a miR gene product is “up-regulated” when the amount of miR gene product in a cell or tissue sample from a subject is greater than the amount the same gene product in a control cell or tissue sample.
  • the level of the at least one miR gene product in the test sample is less than the level of the corresponding miR gene product in the control sample (i.e., expression of the miR gene product is “down-regulated”).
  • expression of a miR gene is “down-regulated” when the amount of miR gene product produced from that gene in a cell or tissue sample from a subject is less than the amount produced from the same gene in a control cell or tissue sample.
  • the relative miR gene expression in the control and normal samples can be determined with respect to one or more RNA expression standards.
  • the standards can comprise, for example, a zero miR gene expression level, the miR gene expression level in a standard cell line, or the average level of miR gene expression previously obtained for a population of normal human controls.
  • the level of a miR gene product in a sample can be measured using any technique that is suitable for detecting RNA expression levels in a biological sample. Suitable techniques for determining RNA expression levels in cells from a biological sample (for example, Northern blot analysis, RT-PCR, in situ hybridization) are well known to those of skill in the art.
  • the level of at least one miR gene product is detected using Northern blot analysis. For example, total cellular RNA can be purified from cells by homogenization in the presence of nucleic acid extraction buffer, followed by centrifugation. Nucleic acids are precipitated, and DNA is removed by treatment with DNase and precipitation.
  • RNA molecules are then separated by gel electrophoresis on agarose gels according to standard techniques, and transferred to nitrocellulose filters.
  • the RNA is then immobilized on the filters by heating. Detection and quantification of specific RNA is accomplished using appropriately labeled DNA or RNA probes complementary to the RNA in question. See, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapter 7, the entire disclosure of which is incorporated by reference.
  • Suitable probes for Northern blot hybridization of a given miR gene product can be produced from the nucleic acid sequences provided in Table 1. Methods for preparation of labeled DNA and RNA probes, and the conditions for hybridization thereof to target nucleotide sequences, are described in Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapters 10 and 11, the disclosures of which are incorporated herein by reference.
  • the nucleic acid probe can be labeled with, for example, a radionuclide, such as 3 H, 32 P, 33 P, 14 C, or 35 S; a heavy metal; or a ligand capable of functioning as a specific binding pair member for a labeled ligand (for example, biotin, avidin or an antibody), a fluorescent molecule, a chemiluminescent molecule, an enzyme or the like.
  • a radionuclide such as 3 H, 32 P, 33 P, 14 C, or 35 S
  • a heavy metal or a ligand capable of functioning as a specific binding pair member for a labeled ligand (for example, biotin, avidin or an antibody), a fluorescent molecule, a chemiluminescent molecule, an enzyme or the like.
  • Probes can be labeled to high specific activity by either the nick translation method of Rigby et al. (1977), J. Mol. Biol. 113:237-251 or by the random priming method of Fienberg et al. (1983), Anal. Biochem. 132:6-13, the entire disclosures of which are incorporated herein by reference.
  • the latter is the method of choice for synthesizing 32 P-labeled probes of high specific activity from single-stranded DNA or from RNA templates. For example, by replacing preexisting nucleotides with highly radioactive nucleotides according to the nick translation method, it is possible to prepare 32 P-labeled nucleic acid probes with a specific activity well in excess of 10 8 cpm/microgram.
  • Autoradiographic detection of hybridization can then be performed by exposing hybridized filters to photographic film. Densitometric scanning of the photographic films exposed by the hybridized filters provides an accurate measurement of miR gene transcript levels. Using another approach, miR gene transcript levels can be quantified by computerized imaging systems, such the Molecular Dynamics 400-B 2D Phosphorimager available from Amersham Biosciences, Piscataway, N.J.
  • the random-primer method can be used to incorporate an analogue, for example, the dTTP analogue 5-(N—(N-biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine triphosphate, into the probe molecule.
  • analogue for example, the dTTP analogue 5-(N—(N-biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine triphosphate
  • the biotinylated probe oligonucleotide can be detected by reaction with biotin-binding proteins, such as avidin, streptavidin, and antibodies (for example, anti-biotin antibodies) coupled to fluorescent dyes or enzymes that produce color reactions.
  • determining the levels of RNA transcripts can be accomplished using the technique of in situ hybridization.
  • This technique requires fewer cells than the Northern blotting technique, and involves depositing whole cells onto a microscope cover slip and probing the nucleic acid content of the cell with a solution containing radioactive or otherwise labeled nucleic acid (for example, cDNA or RNA) probes.
  • This technique is particularly well-suited for analyzing tissue biopsy samples from subjects.
  • the practice of the in situ hybridization technique is described in more detail in U.S. Pat. No. 5,427,916, the entire disclosure of which is incorporated herein by reference.
  • Suitable probes for in situ hybridization of a given miR gene product can be produced from the nucleic acid sequences provided in Table 1, as described above.
  • the relative number of miR gene transcripts in cells can also be determined by reverse transcription of miR gene transcripts, followed by amplification of the reverse-transcribed transcripts by polymerase chain reaction (RT-PCR).
  • the levels of miR gene transcripts can be quantified in comparison with an internal standard, for example, the level of mRNA from a “housekeeping” gene present in the same sample.
  • a suitable “housekeeping” gene for use as an internal standard includes, for example, myosin or glyceraldehyde-3-phosphate dehydrogenase (G3PDH).
  • G3PDH glyceraldehyde-3-phosphate dehydrogenase
  • an oligolibrary in microchip format (i.e., a microarray), may be constructed containing a set of probe oligodeoxynucleotides that are specific for a set of miR genes.
  • a microarray the expression level of multiple microRNAs in a biological sample can be determined by reverse transcribing the RNAs to generate a set of target oligodeoxynucleotides, and hybridizing them to probe oligodeoxynucleotides on the microarray to generate a hybridization, or expression, profile.
  • the hybridization profile of the test sample can then be compared to that of a control sample to determine which microRNAs have an altered expression level in breast cancer cells.
  • probe oligonucleotide or “probe oligodeoxynucleotide” refers to an oligonucleotide that is capable of hybridizing to a target oligonucleotide.
  • Target oligonucleotide or “target oligodeoxynucleotide” refers to a molecule to be detected (for example, via hybridization).
  • miR-specific probe oligonucleotide” or “probe oligonucleotide specific for a miR” is meant a probe oligonucleotide that has a sequence selected to hybridize to a specific miR gene product, or to a reverse transcript of the specific miR gene product.
  • an “expression profile” or “hybridization profile” of a particular sample is essentially a fingerprint of the state of the sample; while two states may have any particular gene similarly expressed, the evaluation of a number of genes simultaneously allows the generation of a gene expression profile that is unique to the state of the cell. That is, normal tissue may be distinguished from breast cancer tissue, and within breast cancer tissue, different prognosis states (good or poor long term survival prospects, for example) may be determined. By comparing expression profiles of breast cancer tissue in different states, information regarding which genes are important (including both up- and down-regulation of genes) in each of these states is obtained.
  • sequences that are differentially expressed in breast cancer tissue or normal breast tissue allows the use of this information in a number of ways. For example, a particular treatment regime may be evaluated (for example, to determine whether a chemotherapeutic drug act to improve the long-term prognosis in a particular patient). Similarly, diagnosis may be done or confirmed by comparing patient samples with the known expression profiles. Furthermore, these gene expression profiles (or individual genes) allow screening of drug candidates that suppress the breast cancer expression profile or convert a poor prognosis profile to a better prognosis profile.
  • the invention provides methods of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligo-deoxynucleotides, hybridizing the target oligo-deoxynucleotides to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample, wherein an alteration in the signal of at least one miRNA is indicative of the subject either having, or being at risk for developing, breast cancer.
  • the microarray comprises miRNA-specific probe oligonucleotides for a substantial portion of the human miRNome.
  • the microarray comprises miRNA-specific probe oligo-nucleotides for one or more miRNAs selected from the group consisting of miR-125b, miR-145, miR-21, miR-155, miR-10b, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, miR-213, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, let-7i (let-7d-v2), miR-101-1, miR-122a, miR-128b, miR-136, miR-143, miR-
  • the microarray can be prepared from gene-specific oligonucleotide probes generated from known miRNA sequences.
  • the array may contain two different oligonucleotide probes for each miRNA, one containing the active, mature sequence and the other being specific for the precursor of the miRNA.
  • the array may also contain controls, such as one or more mouse sequences differing from human orthologs by only a few bases, which can serve as controls for hybridization stringency conditions.
  • tRNAs from both species may also be printed on the microchip, providing an internal, relatively stable, positive control for specific hybridization.
  • One or more appropriate controls for non-specific hybridization may also be included on the microchip. For this purpose, sequences are selected based upon the absence of any homology with any known miRNAs.
  • the microarray may be fabricated using techniques known in the art. For example, probe oligonucleotides of an appropriate length, for example, 40 nucleotides, are 5′-amine modified at position C6 and printed using commercially available microarray systems, for example, the GeneMachine OmniGridTM 100 Microarrayer and Amersham CodeLinkTM activated slides. Labeled cDNA oligomer corresponding to the target RNAs is prepared by reverse transcribing the target RNA with labeled primer. Following first strand synthesis, the RNA/DNA hybrids are denatured to degrade the RNA templates.
  • the labeled target cDNAs thus prepared are then hybridized to the microarray chip under hybridizing conditions, for example, 6 ⁇ SSPE/30% formamide at 25° C. for 18 hours, followed by washing in 0.75 ⁇ TNT at 37° C. for 40 minutes. At positions on the array where the immobilized probe DNA recognizes a complementary target cDNA in the sample, hybridization occurs.
  • the labeled target cDNA marks the exact position on the array where binding occurs, allowing automatic detection and quantification.
  • the output consists of a list of hybridization events, indicating the relative abundance of specific cDNA sequences, and therefore the relative abundance of the corresponding complementary miRs, in the patient sample.
  • the labeled cDNA oligomer is a biotin-labeled cDNA, prepared from a biotin-labeled primer.
  • the microarray is then processed by direct detection of the biotin-containing transcripts using, for example, Streptavidin-Alexa647 conjugate, and scanned utilizing conventional scanning methods. Image intensities of each spot on the array are proportional to the abundance of the corresponding miR in the patient sample.
  • the use of the array has several advantages for miRNA expression detection.
  • the relatively limited number of miRNAs allows the construction of a common microarray for several species, with distinct oligonucleotide probes for each. Such a tool would allow for analysis of trans-species expression for each known miR under various conditions.
  • a microchip containing miRNA-specific probe oligonucleotides corresponding to a substantial portion of the miRNome, preferably the entire miRNome may be employed to carry out miR gene expression profiling, for analysis of miR expression patterns. Distinct miR signatures can be associated with established disease markers, or directly with a disease state.
  • total RNA from a sample from a subject suspected of having a cancer is quantitatively reverse transcribed to provide a set of labeled target oligodeoxynucleotides complementary to the RNA in the sample.
  • the target oligodeoxynucleotides are then hybridized to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the sample.
  • the result is a hybridization profile for the sample representing the expression pattern of miRNA in the sample.
  • the hybridization profile comprises the signal from the binding of the target oligodeoxynucleotides from the sample to the miRNA-specific probe oligonucleotides in the microarray.
  • the profile may be recorded as the presence or absence of binding (signal vs. zero signal). More preferably, the profile recorded includes the intensity of the signal from each hybridization. The profile is compared to the hybridization profile generated from a normal, noncancerous, control sample. An alteration in the signal is indicative of the presence of the cancer in the subject.
  • the invention also provides methods of diagnosing a breast cancer associated with one or more prognostic markers, comprising measuring the level of at least one miR gene product in a breast cancer test sample from a subject and comparing the level of the at least one miR gene product in the breast cancer test sample to the level of a corresponding miR gene product in a control sample.
  • An alteration for example, an increase, a decrease
  • in the signal of at least one miRNA in the test sample relative to the control sample is indicative of the subject either having, or being at risk for developing, breast cancer associated with the one or more prognostic markers.
  • the breast cancer can be associated with one or more prognostic markers or features, including, a marker associated with an adverse (negative) prognosis, or a marker associated with a good (positive) prognosis.
  • the breast cancer that is diagnosed using the methods described herein is associated with one or more adverse prognostic features selected from the group consisting of estrogen receptor expression, progesterone receptor expression, positive lymph node metastasis, high proliferative index, detectable p53 expression, advanced tumor stage, and high vascular invasion.
  • Particular microRNAs whose expression is altered in breast cancer cells associated with each of these prognostic markers are described herein (see, for example, Example 3 and FIG. 4 ).
  • the level of the at least one miR gene product is measured by reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray that comprises miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample.
  • alterations in the level of one or more miR gene products in cells can result in the deregulation of one or more intended targets for these miRs, which can lead to the formation of breast cancer. Therefore, altering the level of the miR gene product (for example, by decreasing the level of a miR that is up-regulated in breast cancer cells and/or by increasing the level of a miR that is down-regulated in cancer cells) may successfully treat the breast cancer. Examples of putative gene targets for miRNAs that are deregulated in breast cancer tissues are described herein (see, for example, Example 2 and Table 4).
  • the present invention encompasses methods of treating breast cancer in a subject, wherein at least one miR gene product is de-regulated (for example, down-regulated or up-regulated) in the cancer cells of the subject.
  • the method comprises administering an effective amount of the at least one isolated miR gene product, provided that the miR gene is not miR15 or miR16, such that proliferation of cancer cells in the subject is inhibited.
  • the method comprises administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene, referred to herein as miR gene expression inhibition compounds, such that proliferation of breast cancer cells is inhibited.
  • treat refers to ameliorating symptoms associated with a disease or condition, for example, breast cancer, including preventing or delaying the onset of the disease symptoms, and/or lessening the severity or frequency of symptoms of the disease or condition.
  • subject and “individual” are defined herein to include animals, such as mammals, including but not limited to, primates, cows, sheep, goats, horses, dogs, cats, rabbits, guinea pigs, rats, mice or other bovine, ovine, equine, canine, feline, rodent, or murine species.
  • the animal is a human.
  • an “effective amount” of an isolated miR gene product is an amount sufficient to inhibit proliferation of a cancer cell in a subject suffering from breast cancer.
  • an effective amount of an miR gene product to be administered to a given subject by taking into account factors, such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
  • an effective amount of an isolated miR gene product can be based on the approximate weight of a tumor mass to be treated.
  • the approximate weight of a tumor mass can be determined by calculating the approximate volume of the mass, wherein one cubic centimeter of volume is roughly equivalent to one gram.
  • An effective amount of the isolated miR gene product based on the weight of a tumor mass can be in the range of about 10-500 micrograms/gram of tumor mass.
  • the tumor mass can be at least about 10 micrograms/gram of tumor mass, at least about 60 micrograms/gram of tumor mass or at least about 100 micrograms/gram of tumor mass.
  • an effective amount of an isolated miR gene product can also be based on the approximate or estimated body weight of a subject to be treated. Preferably, such effective amounts are administered parenterally or enterally, as described herein.
  • an effective amount of the isolated miR gene product is administered to a subject can range from about 5-3000 micrograms/kg of body weight, from about 700-1000 micrograms/kg of body weight, or greater than about 1000 micrograms/kg of body weight.
  • a miR gene product can be administered to the subject once (for example, as a single injection or deposition).
  • a miR gene product can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more particularly from about seven to about ten days.
  • a miR gene product is administered once a day for seven days.
  • a dosage regimen comprises multiple administrations, it is understood that the effective amount of the miR gene product administered to the subject can comprise the total amount of gene product administered over the entire dosage regimen.
  • an “isolated” miR gene product is one which is synthesized, or altered or removed from the natural state through human intervention.
  • a synthetic miR gene product, or a miR gene product partially or completely separated from the coexisting materials of its natural state is considered to be “isolated.”
  • An isolated miR gene product can exist in substantially-purified form, or can exist in a cell into which the miR gene product has been delivered.
  • a miR gene product which is deliberately delivered to, or expressed in, a cell is considered an “isolated” miR gene product.
  • a miR gene product produced inside a cell from a miR precursor molecule is also considered to be “isolated” molecule.
  • Isolated miR gene products can be obtained using a number of standard techniques.
  • the miR gene products can be chemically synthesized or recombinantly produced using methods known in the art.
  • miR gene products are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
  • RNA molecules or synthesis reagents include, for example, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., U.S.A.), Pierce Chemical (part of Perbio Science, Rockford, Ill., U.S.A.), Glen Research (Sterling, Va., U.S.A.), ChemGenes (Ashland, Mass., U.S.A.) and Cruachem (Glasgow, UK).
  • the miR gene products can be expressed from recombinant circular or linear DNA plasmids using any suitable promoter.
  • suitable promoters for expressing RNA from a plasmid include, for example, the U6 or H1 RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art.
  • the recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the miR gene products in cancer cells.
  • the miR gene products that are expressed from recombinant plasmids can be isolated from cultured cell expression systems by standard techniques.
  • the miR gene products which are expressed from recombinant plasmids can also be delivered to, and expressed directly in, the cancer cells.
  • the use of recombinant plasmids to deliver the miR gene products to cancer cells is discussed in more detail below.
  • the miR gene products can be expressed from a separate recombinant plasmid, or they can be expressed from the same recombinant plasmid.
  • the miR gene products are expressed as RNA precursor molecules from a single plasmid, and the precursor molecules are processed into the functional miR gene product by a suitable processing system, including, but not limited to, processing systems extant within a cancer cell.
  • suitable processing systems include, for example, the in vitro Drosophila cell lysate system (for example, as described in U.S. Published Patent Application No. 2002/0086356 to Tuschl et al., the entire disclosure of which are incorporated herein by reference) and the E. coli RNAse III system (for example, as described in U.S. Published Patent Application No. 2004/0014113 to Yang et al., the entire disclosure of which are incorporated herein by reference).
  • plasmids suitable for expressing the miR gene products are within the skill in the art. See, for example, Zeng et al. (2002), Molecular Cell 9:1327-1333; Tuschl (2002), Nat. Biotechnol, 20:446-448; Brummelkamp et al. (2002), Science 296:550-553; Miyagishi et al. (2002), Nat. Biotechnol. 20:497-500; Paddison et al. (2002), Genes Dev. 16:948-958; Lee et al. (2002), Nat. Biotechnol. 20:500-505; and Paul et al. (2002), Nat. Biotechnol. 20:505-508, the entire disclosures of which are incorporated herein by reference.
  • a plasmid expressing the miR gene products comprises a sequence encoding a miR precursor RNA under the control of the CMV intermediate-early promoter.
  • “under the control” of a promoter means that the nucleic acid sequences encoding the miR gene product are located 3′ of the promoter, so that the promoter can initiate transcription of the miR gene product coding sequences.
  • the miR gene products can also be expressed from recombinant viral vectors. It is contemplated that the miR gene products can be expressed from two separate recombinant viral vectors, or from the same viral vector.
  • the RNA expressed from the recombinant viral vectors can either be isolated from cultured cell expression systems by standard techniques, or can be expressed directly in cancer cells. The use of recombinant viral vectors to deliver the miR gene products to cancer cells is discussed in more detail below.
  • the recombinant viral vectors of the invention comprise sequences encoding the miR gene products and any suitable promoter for expressing the RNA sequences.
  • suitable promoters include, for example, the U6 or H1 RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art.
  • the recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the miR gene products in a cancer cell.
  • Any viral vector capable of accepting the coding sequences for the miR gene products can be used; for example, vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (for example, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like.
  • AV adenovirus
  • AAV adeno-associated virus
  • retroviruses for example, lentiviruses (LV), Rhabdoviruses, murine leukemia virus
  • herpes virus and the like.
  • the tropism of the viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.
  • lentiviral vectors of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like.
  • AAV vectors of the invention can be made to target different cells by engineering the vectors to express different capsid protein serotypes.
  • an AAV vector expressing a serotype 2 capsid on a serotype 2 genome is called AAV 2/2.
  • This serotype 2 capsid gene in the AAV 2/2 vector can be replaced by a serotype 5 capsid gene to produce an AAV 2/5 vector.
  • AAV vectors that express different capsid protein serotypes are within the skill in the art; see, for example, Rabinowitz, J. E., et al. (2002), J. Virol. 76:791-801, the entire disclosure of which is incorporated herein by reference.
  • recombinant viral vectors suitable for use in the invention methods for inserting nucleic acid sequences for expressing RNA into the vector, methods of delivering the viral vector to the cells of interest, and recovery of the expressed RNA products are within the skill in the art. See, for example, Dornburg (1995), Gene Therap. 2:301-310; Eglitis (1988), Biotechniques 6:608-614; Miller (1990), Hum. Gene Therap. 1:5-14; and Anderson (1998), Nature 392:25-30, the entire disclosures of which are incorporated herein by reference.
  • Particularly suitable viral vectors are those derived from AV and AAV.
  • a suitable AV vector for expressing the miR gene products, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells are described in Xia et al. (2002), Nat. Biotech. 20:1006-1010, the entire disclosure of which is incorporated herein by reference.
  • Suitable AAV vectors for expressing the miR gene products, methods for constructing the recombinant AAV vector, and methods for delivering the vectors into target cells are described in Samulski et al. (1987), J. Virol. 61:3096-3101; Fisher et al. (1996), J.
  • the miR gene products are expressed from a single recombinant AAV vector comprising the CMV intermediate early promoter.
  • a recombinant AAV viral vector of the invention comprises a nucleic acid sequence encoding a miR precursor RNA in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter.
  • operable connection with a polyT termination sequence means that the nucleic acid sequences encoding the sense or antisense strands are immediately adjacent to the polyT termination signal in the 5′ direction.
  • the polyT termination signals act to terminate transcription.
  • an effective amount of at least one compound which inhibits miR expression can also be administered to the subject.
  • “inhibiting miR expression” means that the production of the active, mature form of miR gene product after treatment is less than the amount produced prior to treatment.
  • One skilled in the art can readily determine whether miR expression has been inhibited in a cancer cell, using for example the techniques for determining miR transcript level discussed above for the diagnostic method Inhibition can occur at the level of gene expression (such as, by inhibiting transcription of a miR gene encoding the miR gene product) or at the level of processing (such as, by inhibiting processing of a miR precursor into a mature, active miR).
  • an “effective amount” of a compound that inhibits miR expression is an amount sufficient to inhibit proliferation of a cancer cell in a subject suffering from a cancer associated with a cancer-associated chromosomal feature.
  • an effective amount of an miR expression-inhibiting compound to be administered to a given subject by taking into account factors, such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
  • an effective amount of the expression-inhibiting compound can be based on the approximate weight of a tumor mass to be treated.
  • the approximate weight of a tumor mass can be determined by calculating the approximate volume of the mass, wherein one cubic centimeter of volume is roughly equivalent to one gram.
  • An effective amount based on the weight of a tumor mass can be between about 10-500 micrograms/gram of tumor mass, at least about 10 micrograms/gram of tumor mass, at least about 60 micrograms/gram of tumor mass, and at least about 100 micrograms/gram of tumor mass.
  • an effective amount of a compound that inhibits miR expression can also be based on the approximate or estimated body weight of a subject to be treated. Such effective amounts are administered parenterally or enterally, among others, as described herein.
  • an effective amount of the expression-inhibiting compound administered to a subject can range from about 5-3000 micrograms/kg of body weight, from about 700-1000 micrograms/kg of body weight, or it can be greater than about 1000 micrograms/kg of body weight.
  • an expression-inhibiting compound can be administered to the subject once (for example, as a single injection or deposition).
  • an expression-inhibiting compound can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days.
  • an expression-inhibiting compound is administered once a day for seven days.
  • the effective amount of the expression-inhibiting compound administered to the subject can comprise the total amount of compound administered over the entire dosage regimen.
  • Suitable compounds for inhibiting miR gene expression include double-stranded RNA (such as short- or small-interfering RNA or “siRNA”), antisense nucleic acids, and enzymatic RNA molecules, such as ribozymes. Each of these compounds can be targeted to a given miR gene product and destroy or induce the destruction of the target miR gene product.
  • siRNA short- or small-interfering RNA or “siRNA”
  • antisense nucleic acids such as antisense nucleic acids
  • enzymatic RNA molecules such as ribozymes.
  • expression of a given miR gene can be inhibited by inducing RNA interference of the miR gene with an isolated double-stranded RNA (“dsRNA”) molecule which has at least 90%, for example at least 95%, at least 98%, at least 99% or 100%, sequence homology with at least a portion of the miR gene product.
  • dsRNA isolated double-stranded RNA
  • the dsRNA molecule is a “short or small interfering RNA” or “siRNA.”
  • siRNA useful in the present methods comprise short double-stranded RNA from about 17 nucleotides to about 29 nucleotides in length, preferably from about 19 to about 25 nucleotides in length.
  • the siRNA comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (hereinafter “base-paired”).
  • the sense strand comprises a nucleic acid sequence which is substantially identical to a nucleic acid sequence contained within the target miR gene product.
  • a nucleic acid sequence in a siRNA which is “substantially identical” to a target sequence contained within the target mRNA is a nucleic acid sequence that is identical to the target sequence, or that differs from the target sequence by one or two nucleotides.
  • the sense and antisense strands of the siRNA can comprise two complementary, single-stranded RNA molecules, or can comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded “hairpin” area.
  • the siRNA can also be altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, or modifications that make the siRNA resistant to nuclease digestion, or the substitution of one or more nucleotides in the siRNA with deoxyribonucleotides.
  • the siRNA can also comprise a 3′ overhang.
  • a “3′ overhang” refers to at least one unpaired nucleotide extending from the 3′-end of a duplexed RNA strand.
  • the siRNA comprises at least one 3′ overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxyribonucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length.
  • the 3′ overhang is present on both strands of the siRNA, and is 2 nucleotides in length.
  • each strand of the siRNA can comprise 3′ overhangs of dithymidylic acid (“TT”) or diuridylic acid (“uu”).
  • the siRNA can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated miR gene products.
  • Exemplary methods for producing and testing dsRNA or siRNA molecules are described in U.S. Published Patent Application No. 2002/0173478 to Gewirtz and in U.S. Pat. No. 7,148,342 to Reich et al., the entire disclosures of which are incorporated herein by reference.
  • an “antisense nucleic acid” refers to a nucleic acid molecule that binds to target RNA by means of RNA-RNA or RNA-DNA or RNA-peptide nucleic acid interactions, which alters the activity of the target RNA.
  • Antisense nucleic acids suitable for use in the present methods are single-stranded nucleic acids (for example, RNA, DNA, RNA-DNA chimeras, PNA) that generally comprise a nucleic acid sequence complementary to a contiguous nucleic acid sequence in an miR gene product.
  • the antisense nucleic acid can comprise a nucleic acid sequence that is 50-100% complementary, 75-100% complementary, or 95-100% complementary to a contiguous nucleic acid sequence in an miR gene product. Nucleic acid sequences for the miR gene products are provided in Table 1. Without wishing to be bound by any theory, it is believed that the antisense nucleic acids activate RNase H or another cellular nuclease that digests the miR gene product/antisense nucleic acid duplex.
  • Antisense nucleic acids can also contain modifications to the nucleic acid backbone or to the sugar and base moieties (or their equivalent) to enhance target specificity, nuclease resistance, delivery or other properties related to efficacy of the molecule.
  • modifications include cholesterol moieties, duplex intercalators, such as acridine, or one or more nuclease-resistant groups.
  • Antisense nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated miR gene products. Exemplary methods for producing and testing are within the skill in the art; see, for example, Stein and Cheng (1993), Science 261:1004 and U.S. Pat. No. 5,849,902 to Woolf et al., the entire disclosures of which are incorporated herein by reference.
  • an “enzymatic nucleic acid” refers to a nucleic acid comprising a substrate binding region that has complementarity to a contiguous nucleic acid sequence of an miR gene product, and which is able to specifically cleave the miR gene product.
  • the enzymatic nucleic acid substrate binding region can be, for example, 50-100% complementary, 75-100% complementary, or 95-100% complementary to a contiguous nucleic acid sequence in a miR gene product.
  • the enzymatic nucleic acids can also comprise modifications at the base, sugar, and/or phosphate groups.
  • An exemplary enzymatic nucleic acid for use in the present methods is a ribozyme.
  • the enzymatic nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated miR gene products.
  • exemplary methods for producing and testing dsRNA or siRNA molecules are described in Werner and Uhlenbeck (1995), Nucl. Acids Res. 23:2092-96; Hammann et al. (1999), Antisense and Nucleic Acid Drug Dev. 9:25-31; and U.S. Pat. No. 4,987,071 to Cech et al, the entire disclosures of which are incorporated herein by reference.
  • Administration of at least one miR gene product, or at least one compound for inhibiting miR expression will inhibit the proliferation of cancer cells in a subject who has a cancer associated with a cancer-associated chromosomal feature.
  • to “inhibit the proliferation of a cancer cell” means to kill the cell, or permanently or temporarily arrest or slow the growth of the cell.
  • Inhibition of cancer cell proliferation can be inferred if the number of such cells in the subject remains constant or decreases after administration of the miR gene products or miR gene expression-inhibiting compounds.
  • An inhibition of cancer cell proliferation can also be inferred if the absolute number of such cells increases, but the rate of tumor growth decreases.
  • the number of cancer cells in a subject's body can be determined by direct measurement, or by estimation from the size of primary or metastatic tumor masses.
  • the number of cancer cells in a subject can be measured by immunohistological methods, flow cytometry, or other techniques designed to detect characteristic surface markers of cancer cells.
  • the size of a tumor mass can be ascertained by direct visual observation, or by diagnostic imaging methods, such as X-ray, magnetic resonance imaging, ultrasound, and scintigraphy. Diagnostic imaging methods used to ascertain size of the tumor mass can be employed with or without contrast agents, as is known in the art.
  • the size of a tumor mass can also be ascertained by physical means, such as palpation of the tissue mass or measurement of the tissue mass with a measuring instrument, such as a caliper.
  • the miR gene products or miR gene expression-inhibiting compounds can be administered to a subject by any means suitable for delivering these compounds to cancer cells of the subject.
  • the miR gene products or miR expression inhibiting compounds can be administered by methods suitable to transfect cells of the subject with these compounds, or with nucleic acids comprising sequences encoding these compounds.
  • the cells are transfected with a plasmid or viral vector comprising sequences encoding at least one miR gene product or miR gene expression inhibiting compound.
  • Transfection methods for eukaryotic cells include, for example, direct injection of the nucleic acid into the nucleus or pronucleus of a cell; electroporation; liposome transfer or transfer mediated by lipophilic materials; receptor-mediated nucleic acid delivery, bioballistic or particle acceleration; calcium phosphate precipitation, and transfection mediated by viral vectors.
  • cells can be transfected with a liposomal transfer compound, such as, DOTAP (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate, Boehringer-Mannheim) or an equivalent, such as LIPOFECTIN.
  • DOTAP N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate, Boehringer-Mannheim
  • LIPOFECTIN LIPOFECTIN
  • a miR gene product or miR gene expression inhibiting compound can also be administered to a subject by any suitable enteral or parenteral administration route.
  • Suitable enteral administration routes for the present methods include, for example, oral, rectal, or intranasal delivery.
  • Suitable parenteral administration routes include, for example, intravascular administration (for example, intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); pen- and intra-tissue injection (for example, peri-tumoral and intra-tumoral injection, intra-retinal injection, or subretinal injection); subcutaneous injection or deposition, including subcutaneous infusion (such as by osmotic pumps); direct application to the tissue of interest, for example by a catheter or other placement device (for example, a retinal pellet or a suppository or an implant comprising a porous, non-porous, or gelatinous material); and inhalation.
  • a miR gene product or miR gene product expression inhibiting compound can be administered to the subject either as naked RNA, in combination with a delivery reagent, or as a nucleic acid (for example, a recombinant plasmid or viral vector) comprising sequences that express the miR gene product or expression inhibiting compound.
  • Suitable delivery reagents include, for example, the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (for example, polylysine), and liposomes.
  • Recombinant plasmids and viral vectors comprising sequences that express the miR gene products or miR gene expression inhibiting compounds, and techniques for delivering such plasmids and vectors to cancer cells, are discussed herein.
  • liposomes are used to deliver a miR gene product or miR gene expression-inhibiting compound (or nucleic acids comprising sequences encoding them) to a subject.
  • Liposomes can also increase the blood half-life of the gene products or nucleic acids.
  • Suitable liposomes for use in the invention can be formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors, such as the desired liposome size and half-life of the liposomes in the blood stream.
  • a variety of methods are known for preparing liposomes, for example, as described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9:467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire disclosures of which are incorporated herein by reference.
  • the liposomes for use in the present methods can comprise a ligand molecule that targets the liposome to cancer cells.
  • Ligands which bind to receptors prevalent in cancer cells such as monoclonal antibodies that bind to tumor cell antigens, are preferred.
  • the liposomes for use in the present methods can also be modified so as to avoid clearance by the mononuclear macrophage system (“MMS”) and reticuloendothelial system (“RES”).
  • MMS mononuclear macrophage system
  • RES reticuloendothelial system
  • opsonization-inhibition moieties on the surface or incorporated into the liposome structure.
  • a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand.
  • Opsonization-inhibiting moieties for use in preparing the liposomes of the invention are typically large hydrophilic polymers that are bound to the liposome membrane.
  • an opsonization inhibiting moiety is “bound” to a liposome membrane when it is chemically or physically attached to the membrane, for example, by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids.
  • These opsonization-inhibiting hydrophilic polymers form a protective surface layer that significantly decreases the uptake of the liposomes by the MMS and RES; for example, as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is incorporated herein by reference.
  • Opsonization inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons.
  • Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; for example, methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers, such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, for example, polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM1.
  • PEG polyethylene glycol
  • PPG polypropylene glycol
  • synthetic polymers such as polyacrylamide or poly N-vinyl pyrroli
  • Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable.
  • the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide.
  • the opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, for example, galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, for example, reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.
  • the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called “PEGylated liposomes.”
  • the opsonization inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques.
  • an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane.
  • a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH 3 and a solvent mixture, such as tetrahydrofuran and water in a 30:12 ratio at 60° C.
  • Liposomes modified with opsonization-inhibition moieties remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called “stealth” liposomes. Stealth liposomes are known to accumulate in tissues fed by porous or “leaky” microvasculature. Thus, tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see Gabizon, et al. (1988), Proc. Natl. Acad. Sci., U.S.A., 18:6949-53.
  • liposomes that are modified with opsonization-inhibition moieties are particularly suited to deliver the miR gene products or miR gene expression inhibition compounds (or nucleic acids comprising sequences encoding them) to tumor cells.
  • the miR gene products or miR gene expression inhibition compounds can be formulated as pharmaceutical compositions, sometimes called “medicaments,” prior to administering them to a subject, according to techniques known in the art. Accordingly, the invention encompasses pharmaceutical compositions for treating breast cancer.
  • the pharmaceutical compositions comprise at least one isolated miR gene product and a pharmaceutically-acceptable carrier.
  • the at least one miR gene product corresponds to a miR gene product that has a decreased level of expression in breast cancer cells relative to suitable control cells.
  • the isolated miR gene product is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
  • the pharmaceutical compositions of the invention comprise at least one miR expression inhibition compound.
  • the at least one miR gene expression inhibition compound is specific for a miR gene whose expression is greater in breast cancer cells than control cells.
  • the miR gene expression inhibition compound is specific for one or more miR gene products selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
  • compositions of the present invention are characterized as being at least sterile and pyrogen-free.
  • pharmaceutical formulations include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is incorporated herein by reference.
  • the present pharmaceutical formulations comprise at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) (for example, 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a pharmaceutically-acceptable carrier.
  • the pharmaceutical formulations of the invention can also comprise at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) which are encapsulated by liposomes and a pharmaceutically-acceptable carrier.
  • the pharmaceutical compositions comprise a miR gene or gene product that is not miR-15, miR-16, miR-143 and/or miR-145.
  • Especially suitable pharmaceutically-acceptable carriers are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
  • the pharmaceutical compositions of the invention comprise at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) which is resistant to degradation by nucleases.
  • nucleic acids which are nuclease resistant, for example by incorporating one or more ribonucleotides that are modified at the 2′-position into the miR gene products.
  • Suitable 2′-modified ribonucleotides include those modified at the 2′-position with fluoro, amino, alkyl, alkoxy, and O-allyl.
  • compositions of the invention can also comprise conventional pharmaceutical excipients and/or additives.
  • Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents.
  • Suitable additives include, for example, physiologically biocompatible buffers (for example, tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (such as, for example, calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate).
  • Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
  • conventional nontoxic solid pharmaceutically-acceptable carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25%-75%, of the at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them).
  • a pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20% by weight, preferably 1%-10% by weight, of the at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) encapsulated in a liposome as described above, and a propellant.
  • a carrier can also be included as desired; for example, lecithin for intranasal delivery.
  • the invention also encompasses methods of identifying an anti-breast cancer agent, comprising providing a test agent to a cell and measuring the level of at least one miR gene product in the cell.
  • the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with decreased expression levels in breast cancer cells. An increase in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent.
  • At least one miR gene product associated with decreased expression levels in breast cancer cells is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
  • the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with increased expression levels in breast cancer cells. A decrease in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent.
  • At least one miR gene product associated with increased expression levels in breast cancer cells is selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
  • Suitable agents include, but are not limited to drugs (for example, small molecules, peptides), and biological macromolecules (for example, proteins, nucleic acids).
  • the agent can be produced recombinantly, synthetically, or it may be isolated (i.e., purified) from a natural source.
  • Various methods for providing such agents to a cell are well known in the art, and several of such methods are described hereinabove.
  • Methods for detecting the expression of at least one miR gene product for example, Northern blotting, in situ hybridization, RT-PCR, expression profiling are also well known in the art. Several of these methods are also described hereinabove.
  • RNAs from primary tumors were obtained from 76 samples collected at the University of Ferrara (Italy), Istituto Nazionale dei Tumori, Milano (Italy) and Thomas Jefferson University (Philadelphia, Pa.). Clinico-pathological information was available for 58 tumor samples. RNA from normal samples consisted of 6 pools of RNA from 5 normal breast tissues each, as well as RNA from 4 additional single breast tissues.
  • RNAs were also obtained from the following cell lines: Hs578-T, MCF7, T47D, BT20, SK-BR-3, HBL100, HCC2218, MDA-MB-175, MDA-MB-231, MDA-MB-361, MDA-MB-435, MDA-MB-436, MDA-MB-453 and MDAMB-468.
  • RNA isolation was performed with Trizol Reagent (Invitrogen) according to the manufacturer's instructions.
  • RNA labeling and hybridization on microRNA microarray chips was performed as previously described (Liu, C.-G., et al., Proc. Natl. Acad. Sci. U.S.A. 101:9740-9744 (2004)). Briefly, 5 ⁇ g of RNA from each sample was labeled with biotin during reverse transcription using random hexamers. Hybridization was carried out on a miRNA microarray chip (KCl version 1.0), which contains 368 probes, including 245 human and mouse miRNA genes, in triplicate. Hybridization signals were detected by binding of biotin to a Streptavidin-Alexa647 conjugate using a Perkin-Elmer ScanArray XL5K. Scanner images were quantified by the Quantarray software (Perkin Elmer).
  • RNA samples (10 ⁇ g each) were electrophoresed on 15% acrylamide, 7 M urea Criterion pre-casted gels (Bio-Rad) and transferred onto Hybond-N+ membrane (Amersham Pharmacia Biotech). The hybridization was performed at 37° C. in 7% sodium dodecyl sulfate (SDS)/0.2M Na 2 PO 4 (pH 7.0) for 16 hours. Membranes were washed twice at 42° C.
  • Oligonucleotide probes were complementary to the sequence of the corresponding mature microRNA (see Sanger miR Registry): miR-21 5′-TCA ACA TCA GTC TGA TAA GCT A-3′ (SEQ ID NO:287); miR-125b1: 5′-TCA CAA GTT AGG GTC TCA GGG A-3′ (SEQ ID NO:288); miR-145: 5′-AAG GGA TTC CTG GGA AAA CTG GAC-3′ (SEQ ID NO:289).
  • An oligonucleotide that was complementary to the U6 RNA (5′-GCA GGG GCC ATG CTA ATC TTC TCT GTA TCG-3′ (SEQ ID NO:290) was used for normalizing expression levels.
  • a microRNA microarray (Liu, C.-G., et al., Proc. Natl. Acad. Sci. U.S.A. 101:9740-9744 (2004)) was used to generate microRNA expression profiles for 10 normal and 76 neoplastic breast tissues. Each tumor sample was derived from a single specimen, while 6 of the 10 normal samples consisted of pools of RNA made from five different normal breast tissues. Hence, 34 normal breast samples were actually examined in the study.
  • Prediction strengths are calculated as negative natural log of the probability to predict the observed number of samples, in one of the two classes, by chance. The higher is the score, the best is the prediction strength.
  • c Centroid scores for the two classes of the Prediction Analysis of Microarrays (Tibshirani, R., et al. Proc. Natl. Acad. Sci. U.S.A. 99:6567-6572 (2002)).
  • miRNAs whose expression is significantly (p ⁇ 0.05) deregulated according to the microarray analysis, a set of 15 miRNAs were able to correctly predict the nature of the sample analyzed (i.e., normal vs. tumor) with 100% accuracy.
  • miR-10b, miR-125b, miR145, miR-21 and miR-155 were the most consistently deregulated miRNAs in breast cancer samples.
  • miR-10b, miR-125b and miR-145 were down-regulated, while the remaining two, miR-21 and miR-155, were up-regulated, suggesting that they might act as tumor suppressor genes or oncogenes, respectively.
  • oncogenes were identified as targets of miR-10b (for example, FLT1, the v-crk homolog, the growth factor BDNF and the transducing factor SHC1), miR-125b (for example, YES, ETS1, TEL, AKT3, the growth factor receptor FGFR2 and members of the mitogen-activated signal transduction pathway VTS58635, MAP3K10, MAP3K11, MAPK14), and miR-145 (for example, MYCN, FOS, YES and FLI1, integration site of Friend leukemia virus, cell cycle promoters, such as cyclins D2 and L1, MAPK transduction proteins, such as MAP3K3 and MAP4K4).
  • the proto-oncogene, YES, and the core-binding transcription factor, CBFB were determined to be potential targets of both miR-125 and miR-145
  • TGFB tumor suppressor gene
  • potential targets included the tumor suppressor genes, SOCS1 and APC, and the kinase, WEE1, which blocks the activity of Cdc2 and prevents entry into mitosis.
  • the hypoxia inducible factor, HIF1A was also a predicted target of miR-155.
  • the tripartite motif-containing protein TRIM2 the proto-oncogene, SKI, and the RAS homologs, RAB6A and RAB6C, were found as potential targets of both miR-21 and miR-155.
  • miR-21 NM_014319 miR-21 NM_014319 MAN1 integral inner nuclear P + T integral to membrane
  • the Eureka Menarini computerized image analysis system was used. For each tumor section, at least 20 microscopic fields of invasive carcinoma were measured using a 40 ⁇ objective. The following cut-off values were employed: 10% of positive nuclear area for ER, PR, c-erbB2 and p53, 13% of nuclei expressing Mib1 was introduced to discriminate cases with high and low proliferative activity.
  • miR-145 and miR-21 two miRNAs whose expression could differentiate cancer or normal tissues, were also differentially-expressed in cancers with a different proliferation index or different tumor stage.
  • miR-145 is progressively down-regulated from normal breast to cancers with a high proliferation index.
  • miR-21 is progressively up-regulated from normal breast to cancers with high tumor stage.
  • miR-9-3 Another miRNA potentially involved in cancer progression is miR-9-3.
  • miR-9-3 was downregulated in breast cancers with either high vascular invasion or lymph node metastasis, suggesting that its down-regulation was acquired during the course of tumor progression and, in particular, during the acquisition of metastatic potential.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of breast cancer. The invention also provides methods of identifying anti-breast cancer agents.

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application is a divisional application claiming the benefit of U.S. application Ser. No. 12/012,235, now U.S. Pat. No. ______, issued ______, 2014, which entered the National Phase on Jan. 31, 2008, from the International PCT Application No. US06/029889, filed Jul. 31, 2006, which claims the benefit of U.S. Provisional Application No. 60/704,464, filed Aug. 1, 2005. The disclosures of each of the aforementioned applications are incorporated herein by reference for all purposes.
    • GOVERNMENT SUPPORT
  • This invention was supported by a grant under Program Project Grant P01CA76259, P01CA81534, and P30CA56036 from the National Cancer Institute. The Government has certain rights in this invention.
    • BACKGROUND OF THE INVENTION
  • Breast cancer is a significant health problem for women in the United States and throughout the world. Although advances have been made in the detection and treatment of the disease, breast cancer remains the second leading cause of cancer-related deaths in women, affecting more than 180,000 women in the United States each year. For women in North America, the life-time odds of getting breast cancer are now one in eight.
  • No universally successful method for the treatment or prevention of breast cancer is currently available. Management of breast cancer currently relies on a combination of early diagnosis (for example, through routine breast screening procedures) and aggressive treatment, which may include one or more of a variety of treatments, such as surgery, radiotherapy, chemotherapy and hormone therapy. The course of treatment for a particular breast cancer is often selected based on a variety of prognostic parameters including an analysis of specific tumor markers.
  • Although the discovery of BRCA1 and BRCA2 were important steps in identifying key genetic factors involved in breast cancer, it has become clear that mutations in BRCA1 and BRCA2 account for only a fraction of inherited susceptibility to breast cancer. In spite of considerable research into therapies for breast cancer, breast cancer remains difficult to diagnose and treat effectively, and the high mortality observed in breast cancer patients indicates that improvements are needed in the diagnosis, treatment and prevention of the disease.
  • MicroRNAs are a class of small, non-coding RNAs that control gene expression by hybridizing to and triggering either translational repression or, less frequently, degradation of a messenger RNA (mRNA) target. The discovery and study of miRNAs has revealed miRNA-mediated gene regulatory mechanisms that play important roles in organismal development and various cellular processes, such as cell differentiation, cell growth and cell death. Recent studies suggest that aberrant expression of particular miRNAs may be involved in human diseases, such as neurological disorders and cancer. In particular, misexpression of miR-16-1 and/or miR-15a has been found in human chronic lymphocytic leukemias.
  • The development and use of microarrays containing all known human microRNAs has permitted a simultaneous analysis of the expression of every miRNA in a sample. These microRNA microarrays have not only been used to confirm that miR-16-1 is deregulated in human CLL cells, but also to generate miRNA expression signatures that are associated with well-defined clinico-pathological features of human CLL.
  • The use of microRNA microarrays to identify a group of microRNAs, which are differentially-expressed between normal cells and breast cancer cells (for example, an expression signature or expression profile), may help pinpoint specific miRNAs that are involved in breast cancer. Furthermore, the identification of putative targets of these miRNAs may help to unravel their pathogenic role. The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of breast cancer.
    • SUMMARY OF THE INVENTION
  • The present invention is based, in part, on the identification of a breast cancer-specific signature of miRNAs that are differentially-expressed in breast cancer cells, relative to normal control cells.
  • Accordingly, embodiments of the invention encompass methods of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising measuring the level of at least one miR gene product in a test sample from the subject and comparing the level of the miR gene product in the test sample to the level of a corresponding miR gene product in a control sample. An alteration (for example, an increase, a decrease) in the level of the miR gene product in the test sample, relative to the level of a corresponding miR gene product in a control sample, is indicative of the subject either having, or being at risk for developing, breast cancer. In certain embodiments, the at least one miR gene product is selected from the group consisting of miR-125b-1, miR125b-2, miR-145, miR-21, miR-155, miR-10b and combinations thereof.
  • The level of the at least one miR gene product can be measured using a variety of techniques that are well known to those of skill in the art. In one embodiment, the level of the at least one miR gene product is measured using Northern blot analysis. In another embodiment, the level of the at least one miR gene product is measured by reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray that comprises miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample. An alteration in the signal of at least one miRNA in the test sample relative to the control sample is indicative of the subject either having, or being at risk for developing, breast cancer. In a particular embodiment, the microarray comprises miRNA-specific probe oligonucleotides for a substantial portion of the human miRNome. In a further embodiment, the microarray comprises miRNA-specific probe oligonucleotides for one or more miRNAs selected from the group consisting of miR-145, miR-21, miR-155, miR-10b, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, miR-213, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, let-7i (let-7d-v2), miR-101-1, miR-122a, miR-128b, miR-136, miR-143, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-205, miR-206, miR-210 and combinations thereof.
  • Embodiments of the invention also provide methods of diagnosing a breast cancer associated with one or more prognostic markers, comprising measuring the level of at least one miR gene product in a breast cancer test sample from a subject and comparing the level of the at least one miR gene product in the breast cancer test sample to the level of a corresponding miR gene product in a control sample. The breast cancer can be associated with one or more adverse prognostic markers associated with breast cancer, such as, but not limited to, estrogen receptor expression, progesterone receptor expression, positive lymph node metastasis, high proliferative index, detectable p53 expression, advanced tumor stage, and high vascular invasion. In one embodiment, the level of the at least one miR gene product is measured by reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray that comprises miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample. An alteration in the signal of at least one miRNA in the test sample relative to the control sample is indicative of the subject either having, or being at risk for developing, a breast cancer associated with the one or more prognostic markers. In a particular embodiment, the microarray comprises at least one miRNA-specific probe oligonucleotide for a miRNA selected from the group consisting of miR-26a, miR-26b, miR-102 (miR-29b), miR-30a-5p, miR-30b, miR-30c, miR-30d, miR-185, miR-191, miR-206, miR-212, let-7c, miR-9-2, miR-15-a, miR-21, miR-30a-s, miR-133a-1, miR-137, miR-153-2, miR-154, miR-181a, miR-203, miR-213, let-7f-1, let-7a-3, let-7a-2, miR-9-3, miR-10b, miR-27a, miR-29a, miR-123, miR-205, let-7d, miR-145, miR-16a, miR-128b and combinations thereof.
  • Embodiments of the invention also encompass methods of treating breast cancer in a subject, wherein at least one miR gene product is de-regulated (for example, down-regulated, up-regulated) in the cancer cells of the subject. When the at least one isolated miR gene product is down-regulated in the breast cancer cells, the method comprises administering an effective amount of the at least one isolated miR gene product, such that proliferation of cancer cells in the subject is inhibited. In one embodiment, the method comprises administering an effective amount of the at least one isolated miR gene product, provided that the miR gene is not miR-15a or miR-16-1, such that proliferation of cancer cells in the subject is inhibited. When the at least one isolated miR gene product is up-regulated in the cancer cells, the method comprises administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene, such that proliferation of breast cancer cells is inhibited.
  • In related embodiments, the invention provides methods of treating breast cancer in a subject, comprising determining the amount of at least one miR gene product in breast cancer cells from the subject, relative to control cells. If expression of the miR gene product is deregulated in breast cancer cells, the methods further comprise altering the amount of the at least one miR gene product expressed in the breast cancer cells. If the amount of the miR gene product expressed in the cancer cells is less than the amount of the miR gene product expressed in control cells, the method comprises administering an effective amount of at least one isolated miR gene product. In one embodiment, the miR gene product is not miR-15a or miR-16-1. If the amount of the miR gene product expressed in the cancer cells is greater than the amount of the miR gene product expressed in control cells, the method comprises administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene. In one embodiment, the miR gene product is not miR-15a or miR-16-1.
  • The invention further provides pharmaceutical compositions for treating breast cancer. In one embodiment, the pharmaceutical compositions comprise at least one isolated miR gene product and a pharmaceutically-acceptable carrier. In a particular embodiment, the at least one miR gene product corresponds to a miR gene product that has a decreased level of expression in breast cancer cells relative to suitable control cells. In certain embodiments the isolated miR gene product is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
  • In another embodiment, the pharmaceutical compositions of the invention comprise at least one miR expression inhibition compound. In a particular embodiment, the at least one miR expression inhibition compound is specific for a miR gene whose expression is greater in breast cancer cells than control cells. In certain embodiments, the miR expression inhibition compound is specific for one or more miR gene products selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
  • Embodiments of the invention also encompass methods of identifying an anti-breast cancer agent, comprising providing a test agent to a cell and measuring the level of at least one miR gene product in the cell. In one embodiment, the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with decreased expression levels in breast cancer cells. An increase in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent. In a particular embodiment, the at least one miR gene product associated with decreased expression levels in breast cancer cells is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
  • In other embodiments the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with increased expression levels in breast cancer cells. A decrease in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent. In a particular embodiment, at least one miR gene product associated with increased expression levels in breast cancer cells is selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
  • FIG. 1 depicts a tree generated by cluster analysis showing a separation of breast cancer from normal tissues on the basis of differential microRNA expression (P<0.05). The bar at the bottom of the figure indicates the group of cancer (red) or normal breast tissues (yellow).
  • FIG. 2 is a graph depicting the probability (0.0 to 1.0) of each sample being a cancerous or normal tissue based on PAM analysis. All breast cancer and normal tissues were correctly predicted by the miR signature shown in Table 2.
  • FIG. 3A is a Northern blot depicting the expression level of miR-125b, using a miR-125b complementary probe, in a normal sample, as well as several tumor samples from breast cancer patients (P). The U6 probe was used for normalization of expression levels for each sample.
  • FIG. 3B is a Northern blot depicting the expression level of miR-145, using a miR-145 complementary probe, in a normal sample, as well as several tumor samples from breast cancer patients (P). The U6 probe was used for normalization of expression levels for each sample.
  • FIG. 3C is a Northern blot depicting the expression level of miR-21, using a miR-21 complementary probe, in a normal sample, as well as several tumor samples from breast cancer patients (labeled as numbered patients). The U6 probe was used for normalization of expression levels for each sample.
  • FIG. 3D is a Northern blot depicting the expression levels of microRNAs miR-125b, miR-145 and miR-21 in various breast cancer cell lines. The expression level of each microRNA was also determined in a sample from normal tissues. The U6 probe was used for normalization of expression levels for each sample.
  • FIG. 4A is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence (ER+) or absence (ER−) of estrogen receptor.
  • FIG. 4B is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence (PR+) or absence (PR−) of progesterone receptor.
  • FIG. 4C is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with stage 1 (pT1) or stage 2 or 3 (pT2-3) tumors.
  • FIG. 4D is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence (pN0) or absence (pN10+) of lymph node metastasis.
  • FIG. 4E is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence or absence of vascular invasion.
  • FIG. 4F is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with a high (MIB-1>30) or low (MIB-1<20) proliferative index (PI).
  • FIG. 4G is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with positive (p53+) or negative (p53−) immunostaining of p53.
    •  DETAILED DESCRIPTION OF THE INVENTION
  • The present invention is based, in part, on the identification of particular miRNAs whose expression is altered in breast cancer cells relative to normal control cells, and microRNAs whose expression is altered in breast cancer cells associated with particular prognostic features, relative to breast cancer cells lacking such features.
  • As used herein interchangeably, a “miR gene product,” “microRNA,” “miR,” or “miRNA” refers to the unprocessed or processed RNA transcript from an miR gene. As the miR gene products are not translated into protein, the term “miR gene products” does not include proteins. The unprocessed miR gene transcript is also called an “miR precursor,” and typically comprises an RNA transcript of about 70-100 nucleotides in length. The miR precursor can be processed by digestion with an RNAse (for example, Dicer, Argonaut, or RNAse III, for example, E. coli RNAse III)) into an active 19-25 nucleotide RNA molecule. This active 19-25 nucleotide RNA molecule is also called the “processed” miR gene transcript or “mature” miRNA.
  • The active 19-25 nucleotide RNA molecule can be obtained from the miR precursor through natural processing routes (for example, using intact cells or cell lysates) or by synthetic processing routes (for example, using isolated processing enzymes, such as isolated Dicer, Argonaut, or RNAase III). It is understood that the active 19-25 nucleotide RNA molecule can also be produced directly by biological or chemical synthesis, without having been processed from the miR precursor.
  • The sequences of 187 miR gene products are provided in Table 1. All nucleic acid sequences herein are given in the 5′ to 3′ direction. In addition, genes are represented by italics, and gene products are represented by normal type; for example, mir-17 is the gene and miR-17 is the gene product.
  • The present invention encompasses methods of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising measuring the level of at least one miR gene product in a test sample from the subject and comparing the level of the miR gene product in the test sample to the level of a corresponding miR gene product in a control sample. As used herein, a “subject” can be any mammal that has, or is suspected of having, breast cancer. In a particular embodiment, the subject is a human who has, or is suspected of having, breast cancer.
  • The breast cancer can be any form of breast cancer and may be associated with one or more prognostic markers or features, including, but not limited to, estrogen receptor expression, progesterone receptor expression, lymph node metastasis, high proliferative index, detectable p53 expression, advanced tumor stage, and high vascular invasion. The prognostic marker can be associated with an adverse or negative prognosis, or it may be associated with a good or positive prognosis.
  • TABLE 1
    Human miR Gene Product Sequences
    SEQ ID
    Name Precursor Sequence (5′ to 3′)* NO.
    hsa-let-7a-1-prec CACTGTGGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACT 1
    GGGAGATAACTATACAATCTACTGTCTTTCCTAACGTG
    hsa-let-7a-2-prec AGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACATCAAGGGAGATAACTG 2
    TACAGCCTCCTAGCTTTCCT
    hsa-let-7a-3-prec GGGTGAGGTAGTAGGTTGTATAGTTTGGGGCTCTGCCCTGCTATGGGATAAC 3
    TATACAATCTACTGTCTTTCCT
    hsa-let-7a-4-prec GTGACTGCATGCTCCCAGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACA 4
    CAAGGGAGATAACTGTACAGCCTCCTAGCTTTCCTTGGGTCTTGCACTAAAC
    AAC
    hsa-let-7b-prec GGCGGGGTGAGGTAGTAGGTTGTGTGGTTTCAGGGCAGTGATGTTGCCCCTC 5
    GGAAGATAACTATACAACCTACTGCCTTCCCTG
    hsa-let-7c-prec GCATCCGGGTTGAGGTAGTAGGTTGTATGGTTTAGAGTTACACCCTGGGAGT 6
    TAACTGTACAACCTTCTAGCTTTCCTTGGAGC
    hsa-let-7d-prec CCTAGGAAGAGGTAGTAGGTTGCATAGTTTTAGGGCAGGGATTTTGCCCACA 7
    AGGAGGTAACTATACGACCTGCTGCCTTTCTTAGG
    hsa-let-7d-v1- CTAGGAAGAGGTAGTAGTTTGCATAGTTTTAGGGCAAAGATTTTGCCCACAA 8
    prec GTAGTTAGCTATACGACCTGCAGCCTTTTGTAG
    hsa-let-7d-v2- CTGGCTGAGGTAGTAGTTTGTGCTGTTGGTCGGGTTGTGACATTGCCCGCTGT 9
    prec GGAGATAACTGCGCAAGCTACTGCCTTGCTAG
    hsa-let-7e-prec CCCGGGCTGAGGTAGGAGGTTGTATAGTTGAGGAGGACACCCAAGGAGATC 10
    ACTATACGGCCTCCTAGCTTTCCCCAGG
    hsa-let-7f-1-prec TCAGAGTGAGGTAGTAGATTGTATAGTTGTGGGGTAGTGATTTTACCCTGTT 11
    CAGGAGATAACTATACAATCTATTGCCTTCCCTGA
    hsa-let-7f-2-prec CTGTGGGATGAGGTAGTAGATTGTATAGTTGTGGGGTAGTGATTTTACCCTG 12
    TTCAGGAGATAACTATACAATCTATTGCCTTCCCTGA
    hsa-let-7f-2-prec CTGTGGGATGAGGTAGTAGATTGTATAGTTTTAGGGTCATACCCCATCTTGG 13
    AGATAACTATACAGTCTACTGTCTTTCCCACGG
    hsa-let-7g-prec TTGCCTGATTCCAGGCTGAGGTAGTAGTTTGTACAGTTTGAGGGTCTATGAT 14
    ACCACCCGGTACAGGAGATAACTGTACAGGCCACTGCCTTGCCAGGAACAG
    CGCGC
    hsa-let-7i-prec CTGGCTGAGGTAGTAGTTTGTGCTGTTGGTCGGGTTGTGACATTGCCCGCTGT 15
    GGAGATAACTGCGCAAGCTACTGCCTTGCTAG
    hsa-mir-001b-1- ACCTACTCAGAGTACATACTTCTTTATGTACCCATATGAACATACAATGCTAT 16
    prec GGAATGTAAAGAAGTATGTATTTTTGGTAGGC
    hsa-mir-001b-1- CAGCTAACAACTTAGTAATACCTACTCAGAGTACATACTTCTTTATGTACCCA 17
    prec TATGAACATACAATGCTATGGAATGTAAAGAAGTATGTATTTTTGGTAGGCA
    ATA
    hsa-mir-001b-2- GCCTGCTTGGGAAACATACTTCTTTATATGCCCATATGGACCTGCTAAGCTAT 18
    prec GGAATGTAAAGAAGTATGTATCTCAGGCCGGG
    hsa-mir-001b- TGGGAAACATACTTCTTTATATGCCCATATGGACCTGCTAAGCTATGGAATG 19
    prec TAAAGAAGTATGTATCTCA
    hsa-mir-001d- ACCTACTCAGAGTACATACTTCTTTATGTACCCATATGAACATACAATGCTAT 20
    prec GGAATGTAAAGAAGTATGTATTTTTGGTAGGC
    hsa-mir-007-1 TGGATGTTGGCCTAGTTCTGTGTGGAAGACTAGTGATTTTGTTGTTTTTAGAT 21
    AACTAAATCGACAACAAATCACAGTCTGCCATATGGCACAGGCCATGCCTCT
    ACA
    hsa-mir-007-1- TTGGATGTTGGCCTAGTTCTGTGTGGAAGACTAGTGATTTTGTTGTTTTTAGA 22
    prec TAACTAAATCGACAACAAATCACAGTCTGCCATATGGCACAGGCCATGCCTC
    TACAG
    hsa-mir-007-2 CTGGATACAGAGTGGACCGGCTGGCCCCATCTGGAAGACTAGTGATTTTGTT 23
    GTTGTCTTACTGCGCTCAACAACAAATCCCAGTCTACCTAATGGTGCCAGCC
    ATCGCA
    hsa-mir-007-2- CTGGATACAGAGTGGACCGGCTGGCCCCATCTGGAAGACTAGTGATTTTGTT 24
    prec GTTGTCTTACTGCGCTCAACAACAAATCCCAGTCTACCTAATGGTGCCAGCC
    ATCGCA
    hsa-mir-007-3 AGATTAGAGTGGCTGTGGTCTAGTGCTGTGTGGAAGACTAGTGATTTTGTTG 25
    TTCTGATGTACTACGACAACAAGTCACAGCCGGCCTCATAGCGCAGACTCCC
    TTCGAC
    hsa-mir-007-3- AGATTAGAGTGGCTGTGGTCTAGTGCTGTGTGGAAGACTAGTGATTTTGTTG 26
    prec TTCTGATGTACTACGACAACAAGTCACAGCCGGCCTCATAGCGCAGACTCCC
    TTCGAC
    hsa-mir-009-1 CGGGGTTGGTTGTTATCTTTGGTTATCTAGCTGTATGAGTGGTGTGGAGTCTT 27
    CATAAAGCTAGATAACCGAAAGTAAAAATAACCCCA
    hsa-mir-009-2 GGAAGCGAGTTGTTATCTTTGGTTATCTAGCTGTATGAGTGTATTGGTCTTCA 28
    TAAAGCTAGATAACCGAAAGTAAAAACTCCTTCA
    hsa-mir-009-3 GGAGGCCCGTTTCTCTCTTTGGTTATCTAGCTGTATGAGTGCCACAGAGCCGT 29
    CATAAAGCTAGATAACCGAAAGTAGAAATGATTCTCA
    hsa-mir-010a- GATCTGTCTGTCTTCTGTATATACCCTGTAGATCCGAATTTGTGTAAGGAATT 30
    prec TTGTGGTCACAAATTCGTATCTAGGGGAATATGTAGTTGACATAAACACTCC
    GCTCT
    hsa-mir-010b- CCAGAGGTTGTAACGTTGTCTATATATACCCTGTAGAACCGAATTTGTGTGG 31
    prec TATCCGTATAGTCACAGATTCGATTCTAGGGGAATATATGGTCGATGCAAAA
    ACTTCA
    hsa-mir-015a-2- GCGCGAATGTGTGTTTAAAAAAAATAAAACCTTGGAGTAAAGTAGCAGCAC 32
    prec ATAATGGTTTGTGGATTTTGAAAAGGTGCAGGCCATATTGTGCTGCCTCAAA
    AATAC
    hsa-mir-015a- CCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGATTTTGAAAAGGTGCA 33
    prec GGCCATATTGTGCTGCCTCAAAAATACAAGG
    hsa-mir-015b- CTGTAGCAGCACATCATGGTTTACATGCTACAGTCAAGATGCGAATCATTAT 34
    prec TTGCTGCTCTAG
    hsa-mir-015b- TTGAGGCCTTAAAGTACTGTAGCAGCACATCATGGTTTACATGCTACAGTCA 35
    prec AGATGCGAATCATTATTTGCTGCTCTAGAAATTTAAGGAAATTCAT
    hsa-mir-016a- GTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGATTCTAAAATTA 36
    chr13 TCTCCAGTATTAACTGTGCTGCTGAAGTAAGGTTGAC
    hsa-mir-016b- GTTCCACTCTAGCAGCACGTAAATATTGGCGTAGTGAAATATATATTAAACA 37
    chr3 CCAATATTACTGTGCTGCTTTAGTGTGAC
    hsa-mir-016- GCAGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGATTCTAAAATTATCTC 38
    prec-13 CAGTATTAACTGTGCTGCTGAAGTAAGGT
    hsa-mit-017-prec GTCAGAATAATGTCAAAGTGCTTACAGTGCAGGTAGTGATATGTGCATCTAC 39
    TGCAGTGAAGGCACTTGTAGCATTATGGTGAC
    hsa-mir-018-prec TGTTCTAAGGTGCATCTAGTGCAGATAGTGAAGTAGATTAGCATCTACTGCC 40
    CTAAGTGCTCCTTCTGGCA
    hsa-mir-018- TTTTTGTTCTAAGGTGCATCTAGTGCAGATAGTGAAGTAGATTAGCATCTACT 41
    prec-13 GCCCTAAGTGCTCCTTCTGGCATAAGAA
    hsa-mir-019a- GCAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAAGAATGTAGTTGTG 42
    prec CAAATCTATGCAAAACTGATGGTGGCCTGC
    hsa-mir-019a- CAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAAGAATGTAGTTGTGC 43
    prec-13 AAATCTATGCAAAACTGATGGTGGCCTG
    hsa-mir-019b-1- CACTGTTCTATGGTTAGTTTTGCAGGTTTGCATCCAGCTGTGTGATATTCTGC 44
    prec TGTGCAAATCCATGCAAAACTGACTGTGGTAGTG
    hsa-mir-019b-2- ACATTGCTACTTACAATTAGTTTTGCAGGTTTGCATTTCAGCGTATATATGTA 45
    prec TATGTGGCTGTGCAAATCCATGCAAAACTGATTGTGATAATGT
    hsa-mir-019b- TTCTATGGTTAGTTTTGCAGGTTTGCATCCAGCTGTGTGATATTCTGCTGTGC 46
    prec-13 AAATCCATGCAAAACTGACTGTGGTAG
    hsa-mir-019b- TTACAATTAGTTTTGCAGGTTTGCATTTCAGCGTATATATGTATATGTGGCTG 47
    prec--X TGCAAATCCATGCAAAACTGATTGTGAT
    hsa-mir-020-prec GTAGCACTAAAGTGCTTATAGTGCAGGTAGTGTTTAGTTATCTACTGCATTAT 48
    GAGCACTTAAAGTACTGC
    hsa-mir-021-prec TGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACC 49
    AGTCGATGGGCTGTCTGACA
    hsa-mir-021- ACCTTGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAA 50
    prec-17 CACCAGTCGATGGGCTGTCTGACATTTTG
    hsa-mir-022-prec GGCTGAGCCGCAGTAGTTCTTCAGTGGCAAGCTTTATGTCCTGACCCAGCTA 51
    AAGCTGCCAGTTGAAGAACTGTTGCCCTCTGCC
    hsa-mir-023a- GGCCGGCTGGGGTTCCTGGGGATGGGATTTGCTTCCTGTCACAAATCACATT 52
    prec GCCAGGGATTTCCAACCGACC
    hsa-mir-023b- CTCAGGTGCTCTGGCTGCTTGGGTTCCTGGCATGCTGATTTGTGACTTAAGAT 53
    prec TAAAATCACATTGCCAGGGATTACCACGCAACCACGACCTTGGC
    hsa-mir-023- CCACGGCCGGCTGGGGTTCCTGGGGATGGGATTTGCTTCCTGTCACAAATCA 54
    prec-19 CATTGCCAGGGATTTCCAACCGACCCTGA
    hsa-mir-024-1- CTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTACACACTGGCTCAGTT 55
    prec CAGCAGGAACAGGAG
    hsa-mir-024-2- CTCTGCCTCCCGTGCCTACTGAGCTGAAACACAGTTGGTTTGTGTACACTGGC 56
    prec TCAGTTCAGCAGGAACAGGG
    hsa-mir-024- CCCTGGGCTCTGCCTCCCGTGCCTACTGAGCTGAAACACAGTTGGTTTGTGTA 57
    prec-19 CACTGGCTCAGTTCAGCAGGAACAGGGG
    hsa-mir-024- CCCTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTACACACTGGCTCAG 58
    prec-9 TTCAGCAGGAACAGCATC
    hsa-mir-025-prec GGCCAGTGTTGAGAGGCGGAGACTTGGGCAATTGCTGGACGCTGCCCTGGG 59
    CATTGCACTTGTCTCGGTCTGACAGTGCCGGCC
    hsa-mir-026a- AGGCCGTGGCCTCGTTCAAGTAATCCAGGATAGGCTGTGCAGGTCCCAATGG 60
    prec CCTATCTTGGTTACTTGCACGGGGACGCGGGCCT
    hsa-mir-026b- CCGGGACCCAGTTCAAGTAATTCAGGATAGGTTGTGTGCTGTCCAGCCTGTT 61
    prec CTCCATTACTTGGCTCGGGGACCGG
    hsa-mir-027a- CTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTCCACACCAASGTCGTGTT 62
    prec CACAGTGGCTAAGTTCCGCCCCCCAG
    hsa-mir-027b- AGGTGCAGAGCTTAGCTGATTGGTGAACAGTGATTGGTTTCCGCTTTGTTCA 63
    prec CAGTGGCTAAGTTCTGCACCT
    hsa-mir-027b- ACCTCTCTAACAAGGTGCAGAGCTTAGCTGATTGGTGAACAGTGATTGGTTT 64
    prec CCGCTTTGTTCACAGTGGCTAAGTTCTGCACCTGAAGAGAAGGTG
    hsa-mir-027- CCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTCCACACCAAGTCGTGT 65
    prec-19 TCACAGTGGCTAAGTTCCGCCCCCCAGG
    hsa-mir-028-prec GGTCCTTGCCCTCAAGGAGCTCACAGTCTATTGAGTTACCTTTCTGACTTTCC 66
    CACTAGATTGTGAGCTCCTGGAGGGCAGGCACT
    hsa-mir-029a-2 CCTTCTGTGACCCCTTAGAGGATGACTGATTTCTTTTGGTGTTCAGAGTCAAT 67
    ATAATTTTCTAGCACCATCTGAAATCGGTTATAATGATTGGGGAAGAGCACC
    ATG
    hsa-mir-029a- ATGACTGATTTCTTTTGGTGTTCAGAGTCAATATAATTTTCTAGCACCATCTG 68
    prec AAATCGGTTAT
    hsa-mir-029c- ACCACTGGCCCATCTCTTACACAGGCTGACCGATTTCTCCTGGTGTTCAGAGT 69
    prec CTGTTTTTGTCTAGCACCATTTGAAATCGGTTATGATGTAGGGGGAAAAGCA
    GCAGC
    hsa-mir-030a- GCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCA 70
    prec GTCGGATGTTTGCAGCTGC
    hsa-mir-030b- ATGTAAACATCCTACACTCAGCTGTAATACATGGATTGGCTGGGAGGTGGAT 71
    prec GTTTACGT
    hsa-mir-030b- ACCAAGTTTCAGTTCATGTAAACATCCTACACTCAGCTGTAATACATGGATT 72
    prec GGCTGGGAGGTGGATGTTTACTTCAGCTGACTTGGA
    hsa-mir-030c- AGATACTGTAAACATCCTACACTCTCAGCTGTGGAAAGTAAGAAAGCTGGG 73
    prec AGAAGGCTGTTTACTCTTTCT
    hsa-mir-030d- GTTGTTGTAAACATCCCCGACTGGAAGCTGTAAGACACAGCTAAGCTTTCAG 74
    prec TCAGATGTTTGCTGCTAC
    hsa-mir-031-prec GGAGAGGAGGCAAGATGCTGGCATAGCTGTTGAACTGGGAACCTGCTATGC 75
    CAACATATTGCCATCTTTCC
    hsa-mir-032-prec GGAGATATTGCACATTACTAAGTTGCATGTTGTCACGGCCTCAATGCAATTT 76
    AGTGTGTGTGATATTTTC
    hsa-mir-033b- GGGGGCCGAGAGAGGCGGGCGGCCCCGCGGTGCATTGCTGTTGCATTGCAC 77
    prec GTGTGTGAGGCGGGTGCAGTGCCTCGGCAGTGCAGCCCGGAGCCGGCCCCT
    GGCACCAC
    hsa-mir-033-prec CTGTGGTGCATTGTAGTTGCATTGCATGTTCTGGTGGTACCCATGCAATGTTT 78
    CCACAGTGCATCACAG
    hsa-mir-034-prec GGCCAGCTGTGAGTGTTTCTTTGGCAGTGTCTTAGCTGGTTGTTGTGAGCAAT 79
    AGTAAGGAAGCAATCAGCAAGTATACTGCCCTAGAAGTGCTGCACGTTGTG
    GGGCCC
    hsa-mir-091- TCAGAATAATGTCAAAGTGCTTACAGTGCAGGTAGTGATATGTGCATCTACT 80
    prec-13 GCAGTGAAGGCACTTGTAGCATTATGGTGA
    hsa-mir-092- CTTTCTACACAGGTTGGGATCGGTTGCAATGCTGTGTTTCTGTATGGTATTGC 81
    prec-13 = 092-1 ACTTGTCCCGGCCTGTTGAGTTTGG
    hsa-mir-092- TCATCCCTGGGTGGGGATTTGTTGCATTACTTGTGTTCTATATAAAGTATTGC 82
    prec-X = 092-2 ACTTGTCCCGGCCTGTGGAAGA
    hsa-mir-093- CTGGGGGCTCCAAAGTGCTGTTCGTGCAGGTAGTGTGATTACCCAACCTACT 83
    prec-7.1 = 093-1 GCTGAGCTAGCACTTCCCGAGCCCCCGG
    hsa-mir-093- CTGGGGGCTCCAAAGTGCTGTTCGTGCAGGTAGTGTGATTACCCAACCTACT 84
    prec-7.2 = 093-2 GCTGAGCTAGCACTTCCCGAGCCCCCGG
    hsa-mir-095- AACACAGTGGGCACTCAATAAATGTCTGTTGAATTGAAATGCGTTACATTCA 85
    prec-4 ACGGGTATTTATTGAGCACCCACTCTGTG
    hsa-mir-096- TGGCCGATTTTGGCACTAGCACATTTTTGCTTGTGTCTCTCCGCTCTGAGCAA 86
    prec-7 TCATGTGCAGTGCCAATATGGGAAA
    hsa-mir-098- GTGAGGTAGTAAGTTGTATTGTTGTGGGGTAGGGATATTAGGCCCCAATTAG 87
    prec-X AAGATAACTATACAACTTACTACTTTCC
    hsa-mir-099b- GGCACCCACCCGTAGAACCGACCTTGCGGGGCCTTCGCCGCACACAAGCTCG 88
    prec-19 TGTCTGTGGGTCCGTGTC
    hsa-mir-099- CCCATTGGCATAAACCCGTAGATCCGATCTTGTGGTGAAGTGGACCGCACAA 89
    prec-21 GCTCGCTTCTATGGGTCTGTGTCAGTGTG
    hsa-mir-100-1/2- AAGAGAGAAGATATTGAGGCCTGTTGCCACAAACCCGTAGATCCGAACTTGT 90
    prec GGTATTAGTCCGCACAAGCTTGTATCTATAGGTATGTGTCTGTTAGGCAATCT
    CAC
    hsa-mir-100- CCTGTTGCCACAAACCCGTAGATCCGAACTTGTGGTATTAGTCCGCACAAGC 91
    prec-11 TTGTATCTATAGGTATGTGTCTGTTAGG
    hsa-mir-101-1/2- AGGCTGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTATTCTAAAGGTA 92
    prec CAGTACTGTGATAACTGAAGGATGGCAGCCATCTTACCTTCCATCAGAGGAG
    CCTCAC
    hsa-mir-101-prec TCAGTTATCACAGTGCTGATGCTGTCCATTCTAAAGGTACAGTACTGTGATA 93
    ACTGA
    hsa-mir-101- TGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTATTCTAAAGGTACAGTA 94
    prec-1 CTGTGATAACTGAAGGATGGCA
    hsa-mir-101- TGTCCTTTTTCGGTTATCATGGTACCGATGCTGTATATCTGAAAGGTACAGTA 95
    prec-9 CTGTGATAACTGAAGAATGGTG
    hsa-mir-102- CTTCTGGAAGCTGGTTTCACATGGTGGCTTAGATTTTTCCATCTTTGTATCTA 96
    prec-1 GCACCATTTGAAATCAGTGTTTTAGGAG
    hsa-mir-102- CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 97
    prec-7.1 CACCATTTGAAATCAGTGTTCTTGGGGG
    hsa-mir-102- CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 98
    prec-7.2 CACCATTTGAAATCAGTGTTCTTGGGGG
    hsa-mir-103-2- TTGTGCTTTCAGCTTCTTTACAGTGCTGCCTTGTAGCATTCAGGTCAAGCAAC 99
    prec ATTGTACAGGGCTATGAAAGAACCA
    hsa-mir-103- TTGTGCTTTCAGCTTCTTTACAGTGCTGCCTTGTAGCATTCAGGTCAAGCAAC 100
    prec-20 ATTGTACAGGGCTATGAAAGAACCA
    hsa-mir-103- TACTGCCCTCGGCTTCTTTACAGTGCTGCCTTGTTGCATATGGATCAAGCAGC 101
    prec-5 = 103-1 ATTGTACAGGGCTATGAAGGCATTG
    hsa-mir-104- AAATGTCAGACAGCCCATCGACTGGTGTTGCCATGAGATTCAACAGTCAACA 102
    prec-17 TCAGTCTGATAAGCTACCCGACAAGG
    hsa-mir-105- TGTGCATCGTGGTCAAATGCTCAGACTCCTGTGGTGGCTGCTCATGCACCAC 103
    prec-X.1 = 105-1 GGATGTTTGAGCATGTGCTACGGTGTCTA
    hsa-mir-105- TGTGCATCGTGGTCAAATGCTCAGACTCCTGTGGTGGCTGCTCATGCACCAC 104
    prec-X.2 = 105-2 GGATGTTTGAGCATGTGCTACGGTGTCTA
    hsa-mir-106- CCTTGGCCATGTAAAAGTGCTTACAGTGCAGGTAGCTTTTTGAGATCTACTG 105
    prec-X CAATGTAAGCACTTCTTACATTACCATGG
    hsa-mir-107- CTCTCTGCTTTCAGCTTCTTTACAGTGTTGCCTTGTGGCATGGAGTTCAAGCA 106
    prec-10 GCATTGTACAGGGCTATCAAAGCACAGA
    hsa-mir-122a- CCTTAGCAGAGCTGTGGAGTGTGACAATGGTGTTTGTGTCTAAACTATCAAA 107
    prec CGCCATTATCACACTAAATAGCTACTGCTAGGC
    hsa-mir-122a- AGCTGTGGAGTGTGACAATGGTGTTTGTGTCCAAACTATCAAACGCCATTAT 108
    prec CACACTAAATAGCT
    hsa-mir-123-prec ACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAA 109
    TAATGCGC
    hsa-mir-124a-1- tccttcctCAGGAGAAAGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAA 110
    prec TGTCCATACAATTAAGGCACGCGGTGAATGCCAAGAATGGGGCT
    hsa-mir-124a-1- AGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAATGTCCATACAATT 111
    prec AAGGCACGCGGTGAATGCCAAGAATGGGGCTG
    hsa-mir-124a-2- ATCAAGATTAGAGGCTCTGCTCTCCGTGTTCACAGCGGACCTTGATTTAATGT 112
    prec CATACAATTAAGGCACGCGGTGAATGCCAAGAGCGGAGCCTACGGCTGCAC
    TTGAAG
    hsa-mir-124a-3- CCCGCCCCAGCCCTGAGGGCCCCTCTGCGTGTTCACAGCGGACCTTGATTTA 113
    prec ATGTCTATACAATTAAGGCACGCGGTGAATGCCAAGAGAGGCGCCTCCGCC
    GCTCCTT
    hsa-mir-124a-3- TGAGGGCCCCTCTGCGTGTTCACAGCGGACCTTGATTTAATGTCTATACAATT 114
    prec AAGGCACGCGGTGAATGCCAAGAGAGGCGCCTCC
    hsa-mir-124a- CTCTGCGTGTTCACAGCGGACCTTGATTTAATGTCTATACAATTAAGGCACG 115
    prec CGGTGAATGCCAAGAG
    hsa-mir-124b- CTCTCCGTGTTCACAGCGGACCTTGATTTAATGTCATACAATTAAGGCACGC 116
    prec GGTGAATGCCAAGAG
    hsa-mir-125a- TGCCAGTCTCTAGGTCCCTGAGACCCTTTAACCTGTGAGGACATCCAGGGTC 117
    prec ACAGGTGAGGTTCTTGGGAGCCTGGCGTCTGGCC
    hsa-mir-125a- GGTCCCTGAGACCCTTTAACCTGTGAGGACATCCAGGGTCACAGGTGAGGTT 118
    prec CTTGGGAGCCTGG
    hsa-mir-125b-1 ACATTGTTGCGCTCCTCTCAGTCCCTGAGACCCTAACTTGTGATGTTTACCGT 119
    TTAAATCCACGGGTTAGGCTCTTGGGAGCTGCGAGTCGTGCTTTTGCATCCTG
    GA
    hsa-mir-125b-1 TGCGCTCCTCTCAGTCCCTGAGACCCTAACTTGTGATGTTTACCGTTTAAATC 120
    CACGGGTTAGGCTCTTGGGAGCTGCGAGTCGTGCT
    hsa-mir-125b-2- ACCAGACTTTTCCTAGTCCCTGAGACCCTAACTTGTGAGGTATTTTAGTAACA 121
    prec TCACAAGTCAGGCTCTTGGGACCTAGGCGGAGGGGA
    hsa-mir-125b-2- CCTAGTCCCTGAGACCCTAACTTGTGAGGTATTTTAGTAACATCACAAGTCA 122
    prec GGCTCTTGGGACCTAGGC
    hsa-mir-126-prec CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACT 123
    CGTACCGTGAGTAATAATGCGCCGTCCACGGCA
    hsa-mir-126-prec ACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAA 124
    TAATGCGC
    hsa-mir-127-prec TGTGATCACTGTCTCCAGCCTGCTGAAGCTCAGAGGGCTCTGATTCAGAAAG 125
    ATCATCGGATCCGTCTGAGCTTGGCTGGTCGGAAGTCTCATCATC
    hsa-mir-127-prec CCAGCCTGCTGAAGCTCAGAGGGCTCTGATTCAGAAAGATCATCGGATCCGT 126
    CTGAGCTTGGCTGGTCGG
    hsa-mir-128a- TGAGCTGTTGGATTCGGGGCCGTAGCACTGTCTGAGAGGTTTACATTTCTCA 127
    prec CAGTGAACCGGTCTCTTTTTCAGCTGCTTC
    hsa-mir-128b- GCCCGGCAGCCACTGTGCAGTGGGAAGGGGGGCCGATACACTGTACGAGAG 128
    prec TGAGTAGCAGGTCTCACAGTGAACCGGTCTCTTTCCCTACTGTGTCACACTCC
    TAATGG
    hsa-mir-128-prec GTTGGATTCGGGGCCGTAGCACTGTCTGAGAGGTTTACATTTCTCACAGTGA 129
    ACCGGTCTCTTTTTCAGC
    hsa-mir-129-prec TGGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAACAGTAGTCAGGAAGC 130
    CCTTACCCCAAAAAGTATCTA
    hsa-mir-130a- TGCTGCTGGCCAGAGCTCTTTTCACATTGTGCTACTGTCTGCACCTGTCACTA 131
    prec GCAGTGCAATGTTAAAAGGGCATTGGCCGTGTAGTG
    hsa-mir-131-1- gccaggaggcggGGTTGGTTGTTATCTTTGGTTATCTAGCTGTATGAGTGGTGTGG 132
    prec AGTCTTCATAAAGCTAGATAACCGAAAGTAAAAATAACCCCATACACTGCGC
    AG
    hsa-mir-131-3- CACGGCGCGGCAGCGGCACTGGCTAAGGGAGGCCCGTTTCTCTCTTTGGTTA 133
    prec TCTAGCTGTATGAGTGCCACAGAGCCGTCATAAAGCTAGATAACCGAAAGTA
    GAAATG
    hsa-mir-131-prec GTTGTTATCTTTGGTTATCTAGCTGTATGAGTGTATTGGTCTTCATAAAGCTA 134
    GATAACCGAAAGTAAAAAC
    hsa-mir-132-prec CCGCCCCCGCGTCTCCAGGGCAACCGTGGCTTTCGATTGTTACTGTGGGAAC 135
    TGGAGGTAACAGTCTACAGCCATGGTCGCCCCGCAGCACGCCCACGCGC
    hsa-mir-132-prec GGGCAACCGTGGCTTTCGATTGTTACTGTGGGAACTGGAGGTAACAGTCTAC 136
    AGCCATGGTCGCCC
    hsa-mir-133a-1 ACAATGCTTTGCTAGAGCTGGTAAAATGGAACCAAATCGCCTCTTCAATGGA 137
    TTTGGTCCCCTTCAACCAGCTGTAGCTATGCATTGA
    hsa-mir-133a-2 GGGAGCCAAATGCTTTGCTAGAGCTGGTAAAATGGAACCAAATCGACTGTCC 138
    AATGGATTTGGTCCCCTTCAACCAGCTGTAGCTGTGCATTGATGGCGCCG
    hsa-mir-133-prec GCTAGAGCTGGTAAAATGGAACCAAATCGCCTCTTCAATGGATTTGGTCCCC 139
    TTCAACCAGCTGTAGC
    hsa-mir-134-prec CAGGGTGTGTGACTGGTTGACCAGAGGGGCATGCACTGTGTTCACCCTGTGG 140
    GCCACCTAGTCACCAACCCTC
    hsa-mir-134-prec AGGGTGTGTGACTGGTTGACCAGAGGGGCATGCACTGTGTTCACCCTGTGGG 141
    CCACCTAGTCACCAACCCT
    hsa-mir-135-1- AGGCCTCGCTGTTCTCTATGGCTTTTTATTCCTATGTGATTCTACTGCTCACTC 142
    prec ATATAGGGATTGGAGCCGTGGCGCACGGCGGGGACA
    hsa-mir-135-2- AGATAAATTCACTCTAGTGCTTTATGGCTTTTTATTCCTATGTGATAGTAATA 143
    prec AAGTCTCATGTAGGGATGGAAGCCATGAAATACATTGTGAAAAATCA
    hsa-mir-135-prec CTATGGCTTTTTATTCCTATGTGATTCTACTGCTCACTCATATAGGGATTGGA 144
    GCCGTGG
    hsa-mir-136-prec TGAGCCCTCGGAGGACTCCATTTGTTTTGATGATGGATTCTTATGCTCCATCA 145
    TCGTCTCAAATGAGTCTTCAGAGGGTTCT
    hsa-mir-136-prec GAGGACTCCATTTGTTTTGATGATGGATTCTTATGCTCCATCATCGTCTCAAA 146
    TGAGTCTTC
    hsa-mir-137-prec CTTCGGTGACGGGTATTCTTGGGTGGATAATACGGATTACGTTGTTATTGCTT 147
    AAGAATACGCGTAGTCGAGG
    hsa-mir-138-1- CCCTGGCATGGTGTGGTGGGGCAGCTGGTGTTGTGAATCAGGCCGTTGCCAA 148
    prec TCAGAGAACGGCTACTTCACAACACCAGGGCCACACCACACTACAGG
    hsa-mir-138-2- CGTTGCTGCAGCTGGTGTTGTGAATCAGGCCGACGAGCAGCGCATCCTCTTA 149
    prec CCCGGCTATTTCACGACACCAGGGTTGCATCA
    hsa-mir-138-prec CAGCTGGTGTTGTGAATCAGGCCGACGAGCAGCGCATCCTCTTACCCGGCTA 150
    TTTCACGACACCAGGGTTG
    hsa-mir-139-prec GTGTATTCTACAGTGCACGTGTCTCCAGTGTGGCTCGGAGGCTGGAGACGCG 151
    GCCCTGTTGGAGTAAC
    hsa-mir-140 TGTGTCTCTCTCTGTGTCCTGCCAGTGGTTTTACCCTATGGTAGGTTACGTCA 152
    TGCTGTTCTACCACAGGGTAGAACCACGGACAGGATACCGGGGCACC
    hsa-mir-140as- TCCTGCCAGTGGTTTTACCCTATGGTAGGTTACGTCATGCTGTTCTACCACAG 153
    prec GGTAGAACCACGGACAGGA
    hsa-mir-140s- CCTGCCAGTGGTTTTACCCTATGGTAGGTTACGTCATGCTGTTCTACCACAGG 154
    prec GTAGAACCACGGACAGG
    hsa-mir-141-prec CGGCCGGCCCTGGGTCCATCTTCCAGTACAGTGTTGGATGGTCTAATTGTGA 155
    AGCTCCTAACACTGTCTGGTAAAGATGGCTCCCGGGTGGGTTC
    hsa-mir-141-prec GGGTCCATCTTCCAGTACAGTGTTGGATGGTCTAATTGTGAAGCTCCTAACA 156
    CTGTCTGGTAAAGATGGCCC
    hsa-mir-142as- ACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTGTAGTGTTTCCT 157
    prec ACTTTATGGATG
    hsa-mir-142-prec GACAGTGCAGTCACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGG 158
    TGTAGTGTTTCCTACTTTATGGATGAGTGTACTGTG
    hsa-mir-142s- ACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTGTAGTGTTTCCT 159
    prec ACTTTATGGATG
    hsa-mir-143-prec GCGCAGCGCCCTGTCTCCCAGCCTGAGGTGCAGTGCTGCATCTCTGGTCAGT 160
    TGGGAGTCTGAGATGAAGCACTGTAGCTCAGGAAGAGAGAAGTTGTTCTGC
    AGC
    hsa-mir-143-prec CCTGAGGTGCAGTGCTGCATCTCTGGTCAGTTGGGAGTCTGAGATGAAGCAC 161
    TGTAGCTCAGG
    hsa-mir-144-prec TGGGGCCCTGGCTGGGATATCATCATATACTGTAAGTTTGCGATGAGACACT 162
    ACAGTATAGATGATGTACTAGTCCGGGCACCCCC
    hsa-mir-144-prec GGCTGGGATATCATCATATACTGTAAGTTTGCGATGAGACACTACAGTATAG 163
    ATGATGTACTAGTC
    hsa-mir-145-prec CACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGG 164
    GGATTCCTGGAAATACTGTTCTTGAGGTCATGGTT
    hsa-mir-145-prec CTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGGGGATTCCT 165
    GGAAATACTGTTCTTGAG
    hsa-mir-146-prec CCGATGTGTATCCTCAGCTTTGAGAACTGAATTCCATGGGTTGTGTCAGTGTC 166
    AGACCTCTGAAATTCAGTTCTTCAGCTGGGATATCTCTGTCATCGT
    hsa-mir-146-prec AGCTTTGAGAACTGAATTCCATGGGTTGTGTCAGTGTCAGACCTGTGAAATT 167
    CAGTTCTTCAGCT
    hsa-mir-147-prec AATCTAAAGACAACATTTCTGCACACACACCAGACTATGGAAGCCAGTGTGT 168
    GGAAATGCTTCTGCTAGATT
    hsa-mir-148-prec GAGGCAAAGTTCTGAGACACTCCGACTCTGAGTATGATAGAAGTCAGTGCAC 169
    TACAGAACTTTGTCTC
    hsa-mir-149-prec GCCGGCGCCCGAGCTCTGGCTCCGTGTCTTCACTCCCGTGCTTGTCCGAGGA 170
    GGGAGGGAGGGACGGGGGCTGTGCTGGGGCAGCTGGA
    hsa-mir-149-prec GCTCTGGCTCCGTGTCTTCACTCCCGTGCTTGTCCGAGGAGGGAGGGAGGGA 171
    C
    hsa-mir-150-prec CTCCCCATGGCCCTGTCTCCCAACCCTTGTACCAGTGCTGGGCTCAGACCCTG 172
    GTACAGGCCTGGGGGACAGGGACCTGGGGAC
    hsa-mir-150-prec CCCTGTCTCCCAACCCTTGTACCAGTGCTGGGCTCAGACCCTGGTACAGGCC 173
    TGGGGGACAGGG
    hsa-mir-151-prec CCTGCCCTCGAGGAGCTCACAGTCTAGTATGTCTCATCCCCTACTAGACTGA 174
    AGCTCCTTGAGGACAGG
    hsa-mir-152-prec TGTCCCCCCCGGCCCAGGTTCTGTGATACACTCCGACTCGGGCTCTGGAGCA 175
    GTCAGTGCATGACAGAACTTGGGCCCGGAAGGACC
    hsa-mir-152-prec GGCCCAGGTTCTGTGATACACTCCGACTCGGGCTCTGGAGCAGTCAGTGCAT 176
    GACAGAACTTGGGCCCCGG
    hsa-mir-153-1- CTCACAGCTGCCAGTGTCATTTTTGTGATCTGCAGCTAGTATTCTCACTCCAG 177
    prec TTGCATAGTCACAAAAGTGATCATTGGCAGGTGTGGC
    hsa-mir-153-1- tctctctctccctcACAGCTGCCAGTGTCATTGTCACAAAAGTGATCATTGGCAGGTG 178
    prec TGGCTGCTGCATG
    hsa-mir-153-2- AGCGGTGGCCAGTGTCATTTTTGTGATGTTGCAGCTAGTAATATGAGCCCAG 179
    prec TTGCATAGTCACAAAAGTGATCATTGGAAACTGTG
    hsa-mir-153-2- CAGTGTCATTTTTGTGATGTTGCAGCTAGTAATATGAGCCCAGTTGCATAGTC 180
    prec ACAAAAGTGATCATTG
    hsa-mir-154-prec GTGGTACTTGAAGATAGGTTATCCGTGTTGCCTTCGCTTTATTTGTGACGAAT 181
    CATACACGGTTGACCTATTTTTCAGTACCAA
    hsa-mir-154-prec GAAGATAGGTTATCCGTGTTGCCTTCGCTTTATTTGTGACGAATCATACACGG 182
    TTGACCTATTTTT
    hsa-mir-155-prec CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATAT 183
    TAGCATTAACAG
    hsa-mir-16-2- CAATGTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGATTCTAAA 184
    prec ATTATCTCCAGTATTAACTGTGCTGCTGAAGTAAGGTTGACCATACTCTACA
    GTTG
    hsa-mir-181a- AGAAGGGCTATCAGGCCAGCCTTCAGAGGACTCCAAGGAACATTCAACGCT 185
    prec GTCGGTGAGTTTGGGATTTGAAAAAACCACTGACCGTTGACTGTACCTTGGG
    GTCCTTA
    hsa-mir-181b- TGAGTTTTGAGGTTGCTTCAGTGAACATTCAACGCTGTCGGTGAGTTTGGAA 186
    prec TTAAAATCAAAACCATCGACCGTTGATTGTACCCTATGGCTAACCATCATCT
    ACTCCA
    hsa-mir-181c- CGGAAAATTTGCCAAGGGTTTGGGGGAACATTCAACCTGTCGGTGAGTTTGG 187
    prec GCAGCTCAGGCAAACCATCGACCGTTGAGTGGACCCTGAGGCCTGGAATTGC
    CATCCT
    hsa-mir-182-as- GAGCTGCTTGCCTCCCCCCGTTTTTGGCAATGGTAGAACTCACACTGGTGAG 188
    prec GTAACAGGATCCGGTGGTTCTAGACTTGCCAACTATGGGGCGAGGACTCAGC
    CGGCAC
    hsa-mir-182-prec TTTTTGGCAATGGTAGAACTCACACTGGTGAGGTAACAGGATCCGGTGGTTC 189
    TAGACTTGCCAACTATGG
    hsa-mir-183-prec CCGCAGAGTGTGACTCCTGTTCTGTGTATGGCACTGGTAGAATTCACTGTGA 190
    ACAGTCTCAGTCAGTGAATTACCGAAGGGCCATAAACAGAGCAGAGACAGA
    TCCACGA
    hsa-mir-184-prec CCAGTCACGTCCCCTTATCACTTTTCCAGCCCAGCTTTGTGACTGTAAGTGTT 191
    GGACGGAGAACTGATAAGGGTAGGTGATTGA
    hsa-mir-184-prec CCTTATCACTTTTCCAGCCCAGCTTTGTGACTGTAAGTGTTGGACGGAGAACT 192
    GATAAGGGTAGG
    hsa-mir-185-prec AGGGGGCGAGGGATTGGAGAGAAAGGCAGTTCCTGATGGTCCCCTCCCCAG 193
    GGGCTGGCTTTCCTCTGGTCCTTCCCTCCCA
    hsa-mir-185-prec AGGGATTGGAGAGAAAGGCAGTTCCTGATGGTCCCCTCCCCAGGGGCTGGCT 194
    TTCCTCTGGTCCTT
    hsa-mir-186-prec TGCTTGTAACTTTCCAAAGAATTCTCCTTTTGGGCTTTCTGGTTTTATTTTAAG 195
    CCCAAAGGTGAATTTTTTGGGAAGTTTGAGCT
    hsa-mir-186-prec ACTTTCCAAAGAATTCTCCTTTTGGGCTTTCTGGTTTTATTTTAAGCCCAAAG 196
    GTGAATTTTTTGGGAAGT
    hsa-mir-187-prec GGTCGGGCTCACCATGACACAGTGTGAGACTCGGGCTACAACACAGGACCC 197
    GGGGCGCTGCTCTGACCCCTCGTGTCTTGTGTTGCAGCCGGAGGGACGCAGG
    TCCGCA
    hsa-mir-188-prec TGCTCCCTCTCTCACATCCCTTGCATGGTGGAGGGTGAGCTTTCTGAAAACCC 198
    CTCCCACATGCAGGGTTTGCAGGATGGCGAGCC
    hsa-mir-188-prec TCTCACATCCCTTGCATGGTGGAGGGTGAGCTTTCTGAAAACCCCTCCCACA 199
    TGCAGGGTTTGCAGGA
    hsa-mir-189-prec CTGTCGATTGGACCCGCCCTCCGGTGCCTACTGAGCTGATATCAGTTCTCATT 200
    TTACACACTGGCTCAGTTCAGCAGGAACAGGAGTCGAGCCCTTGAGCAA
    hsa-mir-189-prec CTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTACACACTGGCTCAGTT 201
    CAGCAGGAACAGGAG
    hsa-mir-190-prec TGCAGGCCTCTGTGTGATATGTTTGATATATTAGGTTGTTATTTAATCCAACT 202
    ATATATCAAACATATTCCTACAGTGTCTTGCC
    hsa-mir-190-prec CTGTGTGATATGTTTGATATATTAGGTTGTTATTTAATCCAACTATATATCAA 203
    ACATATTCCTACAG
    hsa-mir-191-prec CGGCTGGACAGCGGGCAACGGAATCCCAAAAGCAGCTGTTGTCTCCAGAGC 204
    ATTCCAGCTGCGCTTGGATTTCGTCCCCTGCTCTCCTGCCT
    hsa-mir-191-prec AGCGGGCAACGGAATCCCAAAAGCAGCTGTTGTCTCCAGAGCATTCCAGCTG 205
    CGCTTGGATTTCGTCCCCTGCT
    hsa-mir-192-2/3 CCGAGACCGAGTGCACAGGGCTCTGACCTATGAATTGACAGCCAGTGCTCTC 206
    GTCTCCCCTCTGGCTGCCAATTCCATAGGTCACAGGTATGTTCGCCTCAATGC
    CAG
    hsa-mir-192-prec GCCGAGACCGAGTGCACAGGGCTCTGACCTATGAATTGACAGCCAGTGCTCT 207
    CGTCTCCCCTCTGGCTGCCAATTCCATAGGTCACAGGTATGTTCGCCTCAATG
    CCAGC
    hsa-mir-193-prec CGAGGATGGGAGCTGAGGGCTGGGTCTTTGCGGGCGAGATGAGGGTGTCGG 208
    ATCAACTGGCCTACAAAGTCCCAGTTCTCGGCCCCCG
    hsa-mir-193-prec GCTGGGTCTTTGCGGGCGAGATGAGGGTGTCGGATCAACTGGCCTACAAAGT 209
    CCCAGT
    hsa-mir-194-prec ATGGTGTTATCAAGTGTAACAGCAACTCCATGTGGACTGTGTACCAATTTCC 210
    AGTGGAGATGCTGTTACTTTTGATGGTTACCAA
    hsa-mir-194-prec GTGTAACAGCAACTCCATGTGGACTGTGTACCAATTTCCAGTGGAGATGCTG 211
    TTACTTTTGAT
    hsa-mir-195-prec AGCTTCCCTGGCTCTAGCAGCACAGAAATATTGGCACAGGGAAGCGAGTCTG 212
    CCAATATTGGCTGTGCTGCTCCAGGCAGGGTGGTG
    hsa-mir-195-prec TAGCAGCACAGAAATATTGGCACAGGGAAGCGAGTCTGCCAATATTGGCTG 213
    TGCTGCT
    hsa-mir-196-1- CTAGAGCTTGAATTGGAACTGCTGAGTGAATTAGGTAGTTTCATGTTGTTGG 214
    prec GCCTGGGTTTCTGAACACAACAACATTAAACCACCCGATTCACGGCAGTTAC
    TGCTCC
    hsa-mir-196-1- GTGAATTAGGTAGTTTCATGTTGTTGGGCCTGGGTTTCTGAACACAACAACA 215
    prec TTAAACCACCCGATTCAC
    hsa-mir-196-2- TGCTCGCTCAGCTGATCTGTGGCTTAGGTAGTTTCATGTTGTTGGGATTGAGT 216
    prec TTTGAACTCGGCAACAAGAAACTGCCTGAGTTACATCAGTCGGTTTTCGTCG
    AGGGC
    hsa-mir-196-prec GTGAATTAGGTAGTTTCATGTTGTTGGGCCTGGGTTTCTGAACACAACAACA 217
    TTAAACCACCCGATTCAC
    hsa-mir-197-prec GGCTGTGCCGGGTAGAGAGGGCAGTGGGAGGTAAGAGCTCTTCACCCTTCA 218
    CCACCTTCTCCACCCAGCATGGCC
    hsa-mir-198-prec TCATTGGTCCAGAGGGGAGATAGGTTCCTGTGATTTTTCCTTCTTCTCTATAG 219
    AATAAATGA
    hsa-mir-199a-1- GCCAACCCAGTGTTCAGACTACCTGTTCAGGAGGCTCTCAATGTGTACAGTA 220
    prec GTCTGCACATTGGTTAGGC
    hsa-mir-199a-2- AGGAAGCTTCTGGAGATCCTGCTCCGTCGCCCCAGTGTTCAGACTACCTGTT 221
    prec CAGGACAATGCCGTTGTACAGTAGTCTGCACATTGGTTAGACTGGGCAAGGG
    AGAGCA
    hsa-mir-199b- CCAGAGGACACCTCCACTCCGTCTACCCAGTGTTTAGACTATCTGTTCAGGA 222
    prec CTCCCAAATTGTACAGTAGTCTGCACATTGGTTAGGCTGGGCTGGGTTAGAC
    CCTCGG
    hsa-mir-199s- GCCAACCCAGTGTTCAGACTACCTGTTCAGGAGGCTCTCAATGTGTACAGTA 223
    prec GTCTGCACATTGGTTAGGC
    hsa-mir-200a- GCCGTGGCCATCTTACTGGGCAGCATTGGATGGAGTCAGGTCTCTAATACTG 224
    prec CCTGGTAATGATGACGGC
    hsa-mir-200b- CCAGCTCGGGCAGCCGTGGCCATCTTACTGGGCAGCATTGGATGGAGTCAGG 225
    prec TCTCTAATACTGCCTGGTAATGATGACGGCGGAGCCCTGCACG
    hsa-mir-202-prec GTTCCTTTTTCCTATGCATATACTTCTTTGAGGATCTGGCCTAAAGAGGTATA 226
    GGGCATGGGAAGATGGAGC
    hsa-mir-203-prec GTGTTGGGGACTCGCGCGCTGGGTCCAGTGGTTCTTAACAGTTCAACAGTTC 227
    TGTAGCGCAATTGTGAAATGTTTAGGACCACTAGACCCGGCGGGCGCGGCG
    ACAGCGA
    hsa-mir-204-prec GGCTACAGTCTTTCTTCATGTGACTCGTGGACTTCCCTTTGTCATCCTATGCC 228
    TGAGAATATATGAAGGAGGCTGGGAAGGCAAAGGGACGTTCAATTGTCATC
    ACTGGC
    hsa-mir-205-prec AAAGATCCTCAGACAATCCATGTGCTTCTCTTGTCCTTCATTCCACCGGAGTC 229
    TGTCTCATACCCAACCAGATTTCAGTGGAGTGAAGTTCAGGAGGCATGGAGC
    TGACA
    hsa-mir-206-prec TGCTTCCCGAGGCCACATGCTTCTTTATATCCCCATATGGATTACTTTGCTAT 230
    GGAATGTAAGGAAGTGTGTGGTTTCGGCAAGTG
    hsa-mir-206-prec AGGCCACATGCTTCTTTATATCCCCATATGGATTACTTTGCTATGGAATGTAA 231
    GGAAGTGTGTGGTTTT
    hsa-mir-208-prec TGACGGGCGAGCTTTTGGCCCGGGTTATACCTGATGCTCACGTATAAGACGA 232
    GCAAAAAGCTTGTTGGTCA
    hsa-mir-210-prec ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGC 233
    TGCCCCAGACCCACTGTGCGTGTGACAGCGGCTGATCTGTGCCTGGGCAGCG
    CGACCC
    hsa-mir-211-prec TCACCTGGCCATGTGACTTGTGGGCTTCCCTTTGTCATCCTTCGCCTAGGGCT 234
    CTGAGCAGGGCAGGGACAGCAAAGGGGTGCTCAGTTGTCACTTCCCACAGC
    ACGGAG
    hsa-mir-212-prec CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCTTGGCTCTAGACTGCTTAC 235
    TGCCCGGGCCGCCCTCAGTAACAGTCTCCAGTCACGGCCACCGACGCCTGGC
    CCCGCC
    hsa-mir-213-prec CCTGTGCAGAGATTATTTTTTAAAAGGTCACAATCAACATTCATTGCTGTCGG 236
    TGGGTTGAACTGTGTGGACAAGCTCACTGAACAATGAATGCAACTGTGGCCC
    CGCTT
    hsa-mir-213- GAGTTTTGAGGTTGCTTCAGTGAACATTCAACGCTGTCGGTGAGTTTGGAAT 237
    prec-LIM TAAAATCAAAACCATCGACCGTTGATTGTACCCTATGGCTAACCATCATCTA
    CTCC
    hsa-mir-214-prec GGCCTGGCTGGACAGAGTTGTCATGTGTCTGCCTGTCTACACTTGCTGTGCA 238
    GAACATCCGCTCACCTGTACAGCAGGCACAGACAGGCAGTCACATGACAAC
    CCAGCCT
    hsa-mir-215-prec ATCATTCAGAAATGGTATACAGGAAAATGACCTATGAATTGACAGACAATAT 239
    AGCTGAGTTTGTCTGTCATTTCTTTAGGCCAATATTCTGTATGACTGTGCTAC
    TTCAA
    hsa-mir-216-prec GATGGCTGTGAGTTGGCTTAATCTCAGCTGGCAACTGTGAGATGTTCATACA 240
    ATCCCTCACAGTGGTCTCTGGGATTATGCTAAACAGAGCAATTTCCTAGCCC
    TCACGA
    hsa-mir-217-prec AGTATAATTATTACATAGTTTTTGATGTCGCAGATACTGCATCAGGAACTGA 241
    TTGGATAAGAATCAGTCACCATCAGTTCCTAATGCATTGCCTTCAGCATCTA
    AACAAG
    hsa-mir-218-1- GTGATAATGTAGCGAGATTTTCTGTTGTGCTTGATCTAACCATGTGGTTGCGA 242
    prec GGTATGAGTAAAACATGGTTCCGTCAAGCACCATGGAACGTCACGCAGCTTT
    CTACA
    hsa-mir-218-2- GACCAGTCGCTGCGGGGCTTTCCTTTGTGCTTGATCTAACCATGTGGTGGAA 243
    prec CGATGGAAACGGAACATGGTTCTGTCAAGCACCGCGGAAAGCACCGTGCTC
    TCCTGCA
    hsa-mir-219-prec CCGCCCCGGGCCGCGGCTCCTGATTGTCCAAACGCAATTCTCGAGTCTATGG 244
    CTCCGGCCGAGAGTTGAGTCTGGACGTCCCGAGCCGCCGCCCCCAAACCTCG
    AGCGGG
    hsa-mir-220-prec GACAGTGTGGCATTGTAGGGCTCCACACCGTATCTGACACTTTGGGCGAGGG 245
    CACCATGCTGAAGGTGTTCATGATGCGGTCTGGGAACTCCTCACGGATCTTA
    CTGATG
    hsa-mir-221-prec TGAACATCCAGGTCTGGGGCATGAACCTGGCATACAATGTAGATTTCTGTGT 246
    TCGTTAGGCAACAGCTACATTGTCTGCTGGGTTTCAGGCTACCTGGAAACAT
    GTTCTC
    hsa-mir-222-prec GCTGCTGGAAGGTGTAGGTACCCTCAATGGCTCAGTAGCCAGTGTAGATCCT 247
    GTCTTTCGTAATCAGCAGCTACATCTGGCTACTGGGTCTCTGATGGCATCTTC
    TAGCT
    hsa-mir-223-prec CCTGGCCTCCTGCAGTGCCACGCTCCGTGTATTTGACAAGCTGAGTTGGACA 248
    CTCCATGTGGTAGAGTGTCAGTTTGTCAAATACCCCAAGTGCGGCACATGCT
    TACCAG
    hsa-mir-224-prec GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGATTGTGCATTGTTTCA 249
    AAATGGTGCCCTAGTGACTACAAAGCCC
    hsA-mir-29b- CTTCTGGAAGCTGGTTTCACATGGTGGCTTAGATTTTTCCATCTTTGTATCTA 250
    1 = 102-prec1 GCACCATTTGAAATCAGTGTTTTAGGAG
    hsA-mir-29b- CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 251
    2 = 102prec7.1 = CACCATTTGAAATCAGTGTTCTTGGGGG
    7.2
    hsA-mir-29b- CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 252
    3 = 102prec7.1 = CACCATTTGAAATCAGTGTTCTTGGGGG
    7.2
    hsa-mir- GTGAGCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGC 253
    30* = mir-097- TTTCAGTCGGATGTTTGCAGCTGCCTACT
    prec-6
    mir-033b ACCAAGTTTCAGTTCATGTAAACATCCTACACTCAGCTGTAATACATGGATT 254
    GGCTGGGAGGTGGATGTTTACTTCAGCTGACTTGGA
    mir-101- TGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTATTCTAAAGGTACAGTA 255
    precursor-9 = mir- CTGTGATAACTGAAGGATGGCA
    101-3
    mir-108-1-small ACACTGCAAGAACAATAAGGATTTTTAGGGGCATTATGACTGAGTCAGAAA 256
    ACACAGCTGCCCCTGAAAGTCCCTCATTTTTCTTGCTGT
    mir-108-2-small ACTGCAAGAGCAATAAGGATTTTTAGGGGCATTATGATAGTGGAATGGAAA 257
    CACATCTGCCCCCAAAAGTCCCTCATTTT
    mir-123-prec = CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACT 258
    mir-126-prec CGTACCGTGAGTAATAATGCGCCGTCCACGGCA
    mir-123-prec = ACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAA 259
    mir-126-prec TAATGCGC
    mir-129-1-prec TGGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAACAGTAGTCAGGAAGC 260
    CCTTACCCCAAAAAGTATCTA
    mir-129-small- TGCCCTTCGCGAATCTTTTTGCGGTCTGGGCTTGCTGTACATAACTCAATAGC 261
    2 = 129b? CGGAAGCCCTTACCCCAAAAAGCATTTGCGGAGGGCG
    mir-133b-small GCCCCCTGCTCTGGCTGGTCAAACGGAACCAAGTCCGTCTTCCTGAGAGGTT 262
    TGGTCCCCTTCAACCAGCTACAGCAGGG
    mir-135-small-2 AGATAAATTCACTCTAGTGCTTTATGGCTTTTTATTCCTATGTGATAGTAATA 263
    AAGTCTCATGTAGGGATGGAAGCCATGAAATACATTGTGAAAAATCA
    mir-148b-small AAGCACGATTAGCATTTGAGGTGAAGTTCTGTTATACACTCAGGCTGTGGCT 264
    CTCTGAAAGTCAGTGCAT
    mir-151-prec CCTGTCCTCAAGGAGCTTCAGTCTAGTAGGGGATGAGACATACTAGACTGTG 265
    AGCTCCTCGAGGGCAGG
    mir-155- CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATAT 266
    prec(BIC) TAGCATTAACAG
    mir-156 = mir- CCTAACACTGTCTGGTAAAGATGGCTCCCGGGTGGGTTCTCTCGGCAGTAAC 267
    157 = overlap CTTCAGGGAGCCCTGAAGACCATGGAGGAC
    mir-141
    mir-158-small = GCCGAGACCGAGTGCACAGGGCT AGTGCTCT 268
    mir-192 CGTCTCCCCTCTGGCTGCCAATTCCATAGGTCACAGGTATGTTCGCCTCAATG
    CCAGC
    mir-159-1-small TCCCGCCCCCTGTAACAGCAACTCCATGTGGAAGTGCCCACTGGTTCCAGTG 269
    GGGCTGCTGTTATCTGGGGCGAGGGCCA
    mir-161-small AAAGCTGGGTTGAGAGGGCGAAAAAGGATGAGGTGACTGGTCTGGGCTACG 270
    CTATGCTGCGGCGCTCGGG
    mir-163-1b- CATTGGCCTCCTAAGCCAGGGATTGTGGGTTCGAGTCCCACCCGGGGTAAAG 271
    small AAAGGCCGAATT
    mir-163-3-small CCTAAGCCAGGGATTGTGGGTTCGAGTCCCACCTGGGGTAGAGGTGAAAGTT 272
    CCTTTTACGGAATTTTTT
    mir-175- GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGATTGTGCATTGTTTCA 273
    small = mir-224 AAATGGTGCCCTAGTGACTACAAAGCCC
    mir-177- small ACGCAAGTGTCCTAAGGTGAGCTCAGGGAGCACAGAAACCTCCAGTGGAAC 274
    AGAAGGGCAAAAGCTCATT
    mir-180- small CATGTGTCACTTTCAGGTGGAGTTTCAAGAGTCCCTTCCTGGTTCACCGTCTC 275
    CTTTGCTCTTCCACAAC
    mir-187-prec GGTCGGGCTCACCATGACACAGTGTGAGACTCGGGCTACAACACAGGACCC 276
    GGGGCGCTGCTCTGACCCCTCGTGTCTTGTGTTGCAGCCGGAGGGACGCAGG
    TCCGCA
    mir-188-prec TGCTCCCTCTCTCACATCCCTTGCATGGTGGAGGGTGAGCTTTCTGAAAACCC 277
    CTCCCACATGCAGGGTTTGCAGGATGGCGAGCC
    mir-190-prec TGCAGGCCTCTGTGTGATATGTTTGATATATTAGGTTGTTATTTAATCCAACT 278
    ATATATCAAACATATTCCTACAGTGTCTTGCC
    mir-197-2 GTGCATGTGTATGTATGTGTGCATGTGCATGTGTATGTGTATGAGTGCATGC 279
    GTGTGTGC
    mir-197-prec GGCTGTGCCGGGTAGAGAGGGCAGTGGGAGGTAAGAGCTCTTCACCCTTCA 280
    CCACCTTCTCCACCCAGCATGGCC
    mir-202-prec GTTCCTTTTTCCTATGCATATACTTCTTTGAGGATCTGGCCTAAAGAGGTATA 281
    GGGCATGGGAAGATGGAGC
    mir-294-1 CAATCTTCCTTTATCATGGTATTGATTTTTCAGTGCTTCCCTTTTGTGTGAGAG 282
    (chr16) AAGATA
    mir-hes1 ATGGAGCTGCTCACCCTGTGGGCCTCAAATGTGGAGGAACTATTCTGATGTC 283
    CAAGTGGAAAGTGCTGCGACATTTGAGCGTCACCGGTGACGCCCATATCA
    mir-hes2 GCATCCCCTCAGCCTGTGGCACTCAAACTGTGGGGGCACTTTCTGCTCTCTGG 284
    TGAAAGTGCCGCCATCTTTTGAGTGTTACCGCTTGAGAAGACTCAACC
    mir-hes3 CGAGGAGCTCATACTGGGATACTCAAAATGGGGGCGCTTTCCTTTTTGTCTG 285
    TTACTGGGAAGTGCTTCGATTTTGGGGTGTCCCTGTTTGAGTAGGGCATC
    hsa-mir-29b-1 CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 286
    CACCATTTGAAATCAGTGTTCTTGGGGG
    *An underlined sequence within a precursor sequence represents a processed miR transcript. All sequences are human.
  • The level of at least one miR gene product can be measured in cells of a biological sample obtained from the subject. For example, a tissue sample can be removed from a subject suspected of having breast cancer associated with by conventional biopsy techniques. In another example, a blood sample can be removed from the subject, and white blood cells can be isolated for DNA extraction by standard techniques. The blood or tissue sample is preferably obtained from the subject prior to initiation of radiotherapy, chemotherapy or other therapeutic treatment. A corresponding control tissue or blood sample can be obtained from unaffected tissues of the subject, from a normal human individual or population of normal individuals, or from cultured cells corresponding to the majority of cells in the subject's sample. The control tissue or blood sample is then processed along with the sample from the subject, so that the levels of miR gene product produced from a given miR gene in cells from the subject's sample can be compared to the corresponding miR gene product levels from cells of the control sample.
  • An alteration (i.e., an increase or decrease) in the level of a miR gene product in the sample obtained from the subject, relative to the level of a corresponding miR gene product in a control sample, is indicative of the presence of breast cancer in the subject. In one embodiment, the level of the at least one miR gene product in the test sample is greater than the level of the corresponding miR gene product in the control sample (i.e., expression of the miR gene product is “up-regulated”). As used herein, expression of a miR gene product is “up-regulated” when the amount of miR gene product in a cell or tissue sample from a subject is greater than the amount the same gene product in a control cell or tissue sample. In another embodiment, the level of the at least one miR gene product in the test sample is less than the level of the corresponding miR gene product in the control sample (i.e., expression of the miR gene product is “down-regulated”). As used herein, expression of a miR gene is “down-regulated” when the amount of miR gene product produced from that gene in a cell or tissue sample from a subject is less than the amount produced from the same gene in a control cell or tissue sample. The relative miR gene expression in the control and normal samples can be determined with respect to one or more RNA expression standards. The standards can comprise, for example, a zero miR gene expression level, the miR gene expression level in a standard cell line, or the average level of miR gene expression previously obtained for a population of normal human controls.
  • The level of a miR gene product in a sample can be measured using any technique that is suitable for detecting RNA expression levels in a biological sample. Suitable techniques for determining RNA expression levels in cells from a biological sample (for example, Northern blot analysis, RT-PCR, in situ hybridization) are well known to those of skill in the art. In a particular embodiment, the level of at least one miR gene product is detected using Northern blot analysis. For example, total cellular RNA can be purified from cells by homogenization in the presence of nucleic acid extraction buffer, followed by centrifugation. Nucleic acids are precipitated, and DNA is removed by treatment with DNase and precipitation. The RNA molecules are then separated by gel electrophoresis on agarose gels according to standard techniques, and transferred to nitrocellulose filters. The RNA is then immobilized on the filters by heating. Detection and quantification of specific RNA is accomplished using appropriately labeled DNA or RNA probes complementary to the RNA in question. See, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapter 7, the entire disclosure of which is incorporated by reference.
  • Suitable probes for Northern blot hybridization of a given miR gene product can be produced from the nucleic acid sequences provided in Table 1. Methods for preparation of labeled DNA and RNA probes, and the conditions for hybridization thereof to target nucleotide sequences, are described in Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapters 10 and 11, the disclosures of which are incorporated herein by reference.
  • For example, the nucleic acid probe can be labeled with, for example, a radionuclide, such as 3H, 32P, 33P, 14C, or 35S; a heavy metal; or a ligand capable of functioning as a specific binding pair member for a labeled ligand (for example, biotin, avidin or an antibody), a fluorescent molecule, a chemiluminescent molecule, an enzyme or the like.
  • Probes can be labeled to high specific activity by either the nick translation method of Rigby et al. (1977), J. Mol. Biol. 113:237-251 or by the random priming method of Fienberg et al. (1983), Anal. Biochem. 132:6-13, the entire disclosures of which are incorporated herein by reference. The latter is the method of choice for synthesizing 32P-labeled probes of high specific activity from single-stranded DNA or from RNA templates. For example, by replacing preexisting nucleotides with highly radioactive nucleotides according to the nick translation method, it is possible to prepare 32P-labeled nucleic acid probes with a specific activity well in excess of 108 cpm/microgram. Autoradiographic detection of hybridization can then be performed by exposing hybridized filters to photographic film. Densitometric scanning of the photographic films exposed by the hybridized filters provides an accurate measurement of miR gene transcript levels. Using another approach, miR gene transcript levels can be quantified by computerized imaging systems, such the Molecular Dynamics 400-B 2D Phosphorimager available from Amersham Biosciences, Piscataway, N.J.
  • Where radionuclide labeling of DNA or RNA probes is not practical, the random-primer method can be used to incorporate an analogue, for example, the dTTP analogue 5-(N—(N-biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine triphosphate, into the probe molecule. The biotinylated probe oligonucleotide can be detected by reaction with biotin-binding proteins, such as avidin, streptavidin, and antibodies (for example, anti-biotin antibodies) coupled to fluorescent dyes or enzymes that produce color reactions.
  • In addition to Northern and other RNA hybridization techniques, determining the levels of RNA transcripts can be accomplished using the technique of in situ hybridization. This technique requires fewer cells than the Northern blotting technique, and involves depositing whole cells onto a microscope cover slip and probing the nucleic acid content of the cell with a solution containing radioactive or otherwise labeled nucleic acid (for example, cDNA or RNA) probes. This technique is particularly well-suited for analyzing tissue biopsy samples from subjects. The practice of the in situ hybridization technique is described in more detail in U.S. Pat. No. 5,427,916, the entire disclosure of which is incorporated herein by reference. Suitable probes for in situ hybridization of a given miR gene product can be produced from the nucleic acid sequences provided in Table 1, as described above.
  • The relative number of miR gene transcripts in cells can also be determined by reverse transcription of miR gene transcripts, followed by amplification of the reverse-transcribed transcripts by polymerase chain reaction (RT-PCR). The levels of miR gene transcripts can be quantified in comparison with an internal standard, for example, the level of mRNA from a “housekeeping” gene present in the same sample. A suitable “housekeeping” gene for use as an internal standard includes, for example, myosin or glyceraldehyde-3-phosphate dehydrogenase (G3PDH). The methods for quantitative RT-PCR and variations thereof are within the skill in the art.
  • In some instances, it may be desirable to simultaneously determine the expression level of a plurality of different miR gene products in a sample. In other instances, it may be desirable to determine the expression level of the transcripts of all known miR genes correlated with a cancer. Assessing cancer-specific expression levels for hundreds of miR genes is time consuming and requires a large amount of total RNA (at least 20 μg for each Northern blot) and autoradiographic techniques that require radioactive isotopes.
  • To overcome these limitations, an oligolibrary, in microchip format (i.e., a microarray), may be constructed containing a set of probe oligodeoxynucleotides that are specific for a set of miR genes. Using such a microarray, the expression level of multiple microRNAs in a biological sample can be determined by reverse transcribing the RNAs to generate a set of target oligodeoxynucleotides, and hybridizing them to probe oligodeoxynucleotides on the microarray to generate a hybridization, or expression, profile. The hybridization profile of the test sample can then be compared to that of a control sample to determine which microRNAs have an altered expression level in breast cancer cells. As used herein, “probe oligonucleotide” or “probe oligodeoxynucleotide” refers to an oligonucleotide that is capable of hybridizing to a target oligonucleotide. “Target oligonucleotide” or “target oligodeoxynucleotide” refers to a molecule to be detected (for example, via hybridization). By “miR-specific probe oligonucleotide” or “probe oligonucleotide specific for a miR” is meant a probe oligonucleotide that has a sequence selected to hybridize to a specific miR gene product, or to a reverse transcript of the specific miR gene product.
  • An “expression profile” or “hybridization profile” of a particular sample is essentially a fingerprint of the state of the sample; while two states may have any particular gene similarly expressed, the evaluation of a number of genes simultaneously allows the generation of a gene expression profile that is unique to the state of the cell. That is, normal tissue may be distinguished from breast cancer tissue, and within breast cancer tissue, different prognosis states (good or poor long term survival prospects, for example) may be determined. By comparing expression profiles of breast cancer tissue in different states, information regarding which genes are important (including both up- and down-regulation of genes) in each of these states is obtained. The identification of sequences that are differentially expressed in breast cancer tissue or normal breast tissue, as well as differential expression resulting in different prognostic outcomes, allows the use of this information in a number of ways. For example, a particular treatment regime may be evaluated (for example, to determine whether a chemotherapeutic drug act to improve the long-term prognosis in a particular patient). Similarly, diagnosis may be done or confirmed by comparing patient samples with the known expression profiles. Furthermore, these gene expression profiles (or individual genes) allow screening of drug candidates that suppress the breast cancer expression profile or convert a poor prognosis profile to a better prognosis profile.
  • Accordingly, the invention provides methods of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligo-deoxynucleotides, hybridizing the target oligo-deoxynucleotides to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample, wherein an alteration in the signal of at least one miRNA is indicative of the subject either having, or being at risk for developing, breast cancer. In one embodiment, the microarray comprises miRNA-specific probe oligonucleotides for a substantial portion of the human miRNome. In a particular embodiment, the microarray comprises miRNA-specific probe oligo-nucleotides for one or more miRNAs selected from the group consisting of miR-125b, miR-145, miR-21, miR-155, miR-10b, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, miR-213, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, let-7i (let-7d-v2), miR-101-1, miR-122a, miR-128b, miR-136, miR-143, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210 and combinations thereof. In a further embodiment, the at least one miR gene product is selected from the group consisting of miR-125b, miR-145, miR-21, miR-155, miR-10b and combinations thereof.
  • The microarray can be prepared from gene-specific oligonucleotide probes generated from known miRNA sequences. The array may contain two different oligonucleotide probes for each miRNA, one containing the active, mature sequence and the other being specific for the precursor of the miRNA. The array may also contain controls, such as one or more mouse sequences differing from human orthologs by only a few bases, which can serve as controls for hybridization stringency conditions. tRNAs from both species may also be printed on the microchip, providing an internal, relatively stable, positive control for specific hybridization. One or more appropriate controls for non-specific hybridization may also be included on the microchip. For this purpose, sequences are selected based upon the absence of any homology with any known miRNAs.
  • The microarray may be fabricated using techniques known in the art. For example, probe oligonucleotides of an appropriate length, for example, 40 nucleotides, are 5′-amine modified at position C6 and printed using commercially available microarray systems, for example, the GeneMachine OmniGrid™ 100 Microarrayer and Amersham CodeLink™ activated slides. Labeled cDNA oligomer corresponding to the target RNAs is prepared by reverse transcribing the target RNA with labeled primer. Following first strand synthesis, the RNA/DNA hybrids are denatured to degrade the RNA templates. The labeled target cDNAs thus prepared are then hybridized to the microarray chip under hybridizing conditions, for example, 6×SSPE/30% formamide at 25° C. for 18 hours, followed by washing in 0.75×TNT at 37° C. for 40 minutes. At positions on the array where the immobilized probe DNA recognizes a complementary target cDNA in the sample, hybridization occurs. The labeled target cDNA marks the exact position on the array where binding occurs, allowing automatic detection and quantification. The output consists of a list of hybridization events, indicating the relative abundance of specific cDNA sequences, and therefore the relative abundance of the corresponding complementary miRs, in the patient sample. According to one embodiment, the labeled cDNA oligomer is a biotin-labeled cDNA, prepared from a biotin-labeled primer. The microarray is then processed by direct detection of the biotin-containing transcripts using, for example, Streptavidin-Alexa647 conjugate, and scanned utilizing conventional scanning methods. Image intensities of each spot on the array are proportional to the abundance of the corresponding miR in the patient sample.
  • The use of the array has several advantages for miRNA expression detection. First, the global expression of several hundred genes can be identified in the same sample at one time point. Second, through careful design of the oligonucleotide probes, expression of both mature and precursor molecules can be identified. Third, in comparison with Northern blot analysis, the chip requires a small amount of RNA, and provides reproducible results using 2.5 μg of total RNA. The relatively limited number of miRNAs (a few hundred per species) allows the construction of a common microarray for several species, with distinct oligonucleotide probes for each. Such a tool would allow for analysis of trans-species expression for each known miR under various conditions.
  • In addition to use for quantitative expression level assays of specific miRs, a microchip containing miRNA-specific probe oligonucleotides corresponding to a substantial portion of the miRNome, preferably the entire miRNome, may be employed to carry out miR gene expression profiling, for analysis of miR expression patterns. Distinct miR signatures can be associated with established disease markers, or directly with a disease state.
  • According to the expression profiling methods described herein, total RNA from a sample from a subject suspected of having a cancer (such as breast cancer) is quantitatively reverse transcribed to provide a set of labeled target oligodeoxynucleotides complementary to the RNA in the sample. The target oligodeoxynucleotides are then hybridized to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the sample. The result is a hybridization profile for the sample representing the expression pattern of miRNA in the sample. The hybridization profile comprises the signal from the binding of the target oligodeoxynucleotides from the sample to the miRNA-specific probe oligonucleotides in the microarray. The profile may be recorded as the presence or absence of binding (signal vs. zero signal). More preferably, the profile recorded includes the intensity of the signal from each hybridization. The profile is compared to the hybridization profile generated from a normal, noncancerous, control sample. An alteration in the signal is indicative of the presence of the cancer in the subject.
  • Other techniques for measuring miR gene expression are also within the skill in the art, and include various techniques for measuring rates of RNA transcription and degradation.
  • The invention also provides methods of diagnosing a breast cancer associated with one or more prognostic markers, comprising measuring the level of at least one miR gene product in a breast cancer test sample from a subject and comparing the level of the at least one miR gene product in the breast cancer test sample to the level of a corresponding miR gene product in a control sample. An alteration (for example, an increase, a decrease) in the signal of at least one miRNA in the test sample relative to the control sample is indicative of the subject either having, or being at risk for developing, breast cancer associated with the one or more prognostic markers.
  • The breast cancer can be associated with one or more prognostic markers or features, including, a marker associated with an adverse (negative) prognosis, or a marker associated with a good (positive) prognosis. In certain embodiments, the breast cancer that is diagnosed using the methods described herein is associated with one or more adverse prognostic features selected from the group consisting of estrogen receptor expression, progesterone receptor expression, positive lymph node metastasis, high proliferative index, detectable p53 expression, advanced tumor stage, and high vascular invasion. Particular microRNAs whose expression is altered in breast cancer cells associated with each of these prognostic markers are described herein (see, for example, Example 3 and FIG. 4). In one embodiment, the level of the at least one miR gene product is measured by reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray that comprises miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample.
  • Without wishing to be bound by any one theory, it is believed that alterations in the level of one or more miR gene products in cells can result in the deregulation of one or more intended targets for these miRs, which can lead to the formation of breast cancer. Therefore, altering the level of the miR gene product (for example, by decreasing the level of a miR that is up-regulated in breast cancer cells and/or by increasing the level of a miR that is down-regulated in cancer cells) may successfully treat the breast cancer. Examples of putative gene targets for miRNAs that are deregulated in breast cancer tissues are described herein (see, for example, Example 2 and Table 4).
  • Accordingly, the present invention encompasses methods of treating breast cancer in a subject, wherein at least one miR gene product is de-regulated (for example, down-regulated or up-regulated) in the cancer cells of the subject. When the at least one isolated miR gene product is down-regulated in the breast cancer cells, the method comprises administering an effective amount of the at least one isolated miR gene product, provided that the miR gene is not miR15 or miR16, such that proliferation of cancer cells in the subject is inhibited. When the at least one isolated miR gene product is up-regulated in the cancer cells, the method comprises administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene, referred to herein as miR gene expression inhibition compounds, such that proliferation of breast cancer cells is inhibited.
  • The terms “treat”, “treating” and “treatment”, as used herein, refer to ameliorating symptoms associated with a disease or condition, for example, breast cancer, including preventing or delaying the onset of the disease symptoms, and/or lessening the severity or frequency of symptoms of the disease or condition. The terms “subject” and “individual” are defined herein to include animals, such as mammals, including but not limited to, primates, cows, sheep, goats, horses, dogs, cats, rabbits, guinea pigs, rats, mice or other bovine, ovine, equine, canine, feline, rodent, or murine species. In a preferred embodiment, the animal is a human.
  • As used herein, an “effective amount” of an isolated miR gene product is an amount sufficient to inhibit proliferation of a cancer cell in a subject suffering from breast cancer. One skilled in the art can readily determine an effective amount of an miR gene product to be administered to a given subject, by taking into account factors, such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
  • For example, an effective amount of an isolated miR gene product can be based on the approximate weight of a tumor mass to be treated. The approximate weight of a tumor mass can be determined by calculating the approximate volume of the mass, wherein one cubic centimeter of volume is roughly equivalent to one gram. An effective amount of the isolated miR gene product based on the weight of a tumor mass can be in the range of about 10-500 micrograms/gram of tumor mass. In certain embodiments, the tumor mass can be at least about 10 micrograms/gram of tumor mass, at least about 60 micrograms/gram of tumor mass or at least about 100 micrograms/gram of tumor mass.
  • An effective amount of an isolated miR gene product can also be based on the approximate or estimated body weight of a subject to be treated. Preferably, such effective amounts are administered parenterally or enterally, as described herein. For example, an effective amount of the isolated miR gene product is administered to a subject can range from about 5-3000 micrograms/kg of body weight, from about 700-1000 micrograms/kg of body weight, or greater than about 1000 micrograms/kg of body weight.
  • One skilled in the art can also readily determine an appropriate dosage regimen for the administration of an isolated miR gene product to a given subject. For example, a miR gene product can be administered to the subject once (for example, as a single injection or deposition). Alternatively, a miR gene product can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more particularly from about seven to about ten days. In a particular dosage regimen, a miR gene product is administered once a day for seven days. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of the miR gene product administered to the subject can comprise the total amount of gene product administered over the entire dosage regimen.
  • As used herein, an “isolated” miR gene product is one which is synthesized, or altered or removed from the natural state through human intervention. For example, a synthetic miR gene product, or a miR gene product partially or completely separated from the coexisting materials of its natural state, is considered to be “isolated.” An isolated miR gene product can exist in substantially-purified form, or can exist in a cell into which the miR gene product has been delivered. Thus, a miR gene product which is deliberately delivered to, or expressed in, a cell is considered an “isolated” miR gene product. A miR gene product produced inside a cell from a miR precursor molecule is also considered to be “isolated” molecule.
  • Isolated miR gene products can be obtained using a number of standard techniques. For example, the miR gene products can be chemically synthesized or recombinantly produced using methods known in the art. In one embodiment, miR gene products are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic RNA molecules or synthesis reagents include, for example, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., U.S.A.), Pierce Chemical (part of Perbio Science, Rockford, Ill., U.S.A.), Glen Research (Sterling, Va., U.S.A.), ChemGenes (Ashland, Mass., U.S.A.) and Cruachem (Glasgow, UK).
  • Alternatively, the miR gene products can be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing RNA from a plasmid include, for example, the U6 or H1 RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the miR gene products in cancer cells.
  • The miR gene products that are expressed from recombinant plasmids can be isolated from cultured cell expression systems by standard techniques. The miR gene products which are expressed from recombinant plasmids can also be delivered to, and expressed directly in, the cancer cells. The use of recombinant plasmids to deliver the miR gene products to cancer cells is discussed in more detail below.
  • The miR gene products can be expressed from a separate recombinant plasmid, or they can be expressed from the same recombinant plasmid. In one embodiment, the miR gene products are expressed as RNA precursor molecules from a single plasmid, and the precursor molecules are processed into the functional miR gene product by a suitable processing system, including, but not limited to, processing systems extant within a cancer cell. Other suitable processing systems include, for example, the in vitro Drosophila cell lysate system (for example, as described in U.S. Published Patent Application No. 2002/0086356 to Tuschl et al., the entire disclosure of which are incorporated herein by reference) and the E. coli RNAse III system (for example, as described in U.S. Published Patent Application No. 2004/0014113 to Yang et al., the entire disclosure of which are incorporated herein by reference).
  • Selection of plasmids suitable for expressing the miR gene products, methods for inserting nucleic acid sequences into the plasmid to express the gene products, and methods of delivering the recombinant plasmid to the cells of interest are within the skill in the art. See, for example, Zeng et al. (2002), Molecular Cell 9:1327-1333; Tuschl (2002), Nat. Biotechnol, 20:446-448; Brummelkamp et al. (2002), Science 296:550-553; Miyagishi et al. (2002), Nat. Biotechnol. 20:497-500; Paddison et al. (2002), Genes Dev. 16:948-958; Lee et al. (2002), Nat. Biotechnol. 20:500-505; and Paul et al. (2002), Nat. Biotechnol. 20:505-508, the entire disclosures of which are incorporated herein by reference.
  • In one embodiment, a plasmid expressing the miR gene products comprises a sequence encoding a miR precursor RNA under the control of the CMV intermediate-early promoter. As used herein, “under the control” of a promoter means that the nucleic acid sequences encoding the miR gene product are located 3′ of the promoter, so that the promoter can initiate transcription of the miR gene product coding sequences.
  • The miR gene products can also be expressed from recombinant viral vectors. It is contemplated that the miR gene products can be expressed from two separate recombinant viral vectors, or from the same viral vector. The RNA expressed from the recombinant viral vectors can either be isolated from cultured cell expression systems by standard techniques, or can be expressed directly in cancer cells. The use of recombinant viral vectors to deliver the miR gene products to cancer cells is discussed in more detail below.
  • The recombinant viral vectors of the invention comprise sequences encoding the miR gene products and any suitable promoter for expressing the RNA sequences. Suitable promoters include, for example, the U6 or H1 RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the miR gene products in a cancer cell.
  • Any viral vector capable of accepting the coding sequences for the miR gene products can be used; for example, vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (for example, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of the viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.
  • For example, lentiviral vectors of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors of the invention can be made to target different cells by engineering the vectors to express different capsid protein serotypes. For example, an AAV vector expressing a serotype 2 capsid on a serotype 2 genome is called AAV 2/2. This serotype 2 capsid gene in the AAV 2/2 vector can be replaced by a serotype 5 capsid gene to produce an AAV 2/5 vector. Techniques for constructing AAV vectors that express different capsid protein serotypes are within the skill in the art; see, for example, Rabinowitz, J. E., et al. (2002), J. Virol. 76:791-801, the entire disclosure of which is incorporated herein by reference.
  • Selection of recombinant viral vectors suitable for use in the invention, methods for inserting nucleic acid sequences for expressing RNA into the vector, methods of delivering the viral vector to the cells of interest, and recovery of the expressed RNA products are within the skill in the art. See, for example, Dornburg (1995), Gene Therap. 2:301-310; Eglitis (1988), Biotechniques 6:608-614; Miller (1990), Hum. Gene Therap. 1:5-14; and Anderson (1998), Nature 392:25-30, the entire disclosures of which are incorporated herein by reference.
  • Particularly suitable viral vectors are those derived from AV and AAV. A suitable AV vector for expressing the miR gene products, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia et al. (2002), Nat. Biotech. 20:1006-1010, the entire disclosure of which is incorporated herein by reference. Suitable AAV vectors for expressing the miR gene products, methods for constructing the recombinant AAV vector, and methods for delivering the vectors into target cells are described in Samulski et al. (1987), J. Virol. 61:3096-3101; Fisher et al. (1996), J. Virol., 70:520-532; Samulski et al. (1989), J. Virol. 63:3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are incorporated herein by reference. In one embodiment, the miR gene products are expressed from a single recombinant AAV vector comprising the CMV intermediate early promoter.
  • In a certain embodiment, a recombinant AAV viral vector of the invention comprises a nucleic acid sequence encoding a miR precursor RNA in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter. As used herein, “in operable connection with a polyT termination sequence” means that the nucleic acid sequences encoding the sense or antisense strands are immediately adjacent to the polyT termination signal in the 5′ direction. During transcription of the miR sequences from the vector, the polyT termination signals act to terminate transcription.
  • In other embodiments of the treatment methods of the invention, an effective amount of at least one compound which inhibits miR expression can also be administered to the subject. As used herein, “inhibiting miR expression” means that the production of the active, mature form of miR gene product after treatment is less than the amount produced prior to treatment. One skilled in the art can readily determine whether miR expression has been inhibited in a cancer cell, using for example the techniques for determining miR transcript level discussed above for the diagnostic method Inhibition can occur at the level of gene expression (such as, by inhibiting transcription of a miR gene encoding the miR gene product) or at the level of processing (such as, by inhibiting processing of a miR precursor into a mature, active miR).
  • As used herein, an “effective amount” of a compound that inhibits miR expression is an amount sufficient to inhibit proliferation of a cancer cell in a subject suffering from a cancer associated with a cancer-associated chromosomal feature. One skilled in the art can readily determine an effective amount of an miR expression-inhibiting compound to be administered to a given subject, by taking into account factors, such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.
  • For example, an effective amount of the expression-inhibiting compound can be based on the approximate weight of a tumor mass to be treated. The approximate weight of a tumor mass can be determined by calculating the approximate volume of the mass, wherein one cubic centimeter of volume is roughly equivalent to one gram. An effective amount based on the weight of a tumor mass can be between about 10-500 micrograms/gram of tumor mass, at least about 10 micrograms/gram of tumor mass, at least about 60 micrograms/gram of tumor mass, and at least about 100 micrograms/gram of tumor mass.
  • An effective amount of a compound that inhibits miR expression can also be based on the approximate or estimated body weight of a subject to be treated. Such effective amounts are administered parenterally or enterally, among others, as described herein. For example, an effective amount of the expression-inhibiting compound administered to a subject can range from about 5-3000 micrograms/kg of body weight, from about 700-1000 micrograms/kg of body weight, or it can be greater than about 1000 micrograms/kg of body weight.
  • One skilled in the art can also readily determine an appropriate dosage regimen for administering a compound that inhibits miR expression to a given subject. For example, an expression-inhibiting compound can be administered to the subject once (for example, as a single injection or deposition). Alternatively, an expression-inhibiting compound can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days. In a particular dosage regimen, an expression-inhibiting compound is administered once a day for seven days. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of the expression-inhibiting compound administered to the subject can comprise the total amount of compound administered over the entire dosage regimen.
  • Suitable compounds for inhibiting miR gene expression include double-stranded RNA (such as short- or small-interfering RNA or “siRNA”), antisense nucleic acids, and enzymatic RNA molecules, such as ribozymes. Each of these compounds can be targeted to a given miR gene product and destroy or induce the destruction of the target miR gene product.
  • For example, expression of a given miR gene can be inhibited by inducing RNA interference of the miR gene with an isolated double-stranded RNA (“dsRNA”) molecule which has at least 90%, for example at least 95%, at least 98%, at least 99% or 100%, sequence homology with at least a portion of the miR gene product. In a particular embodiment, the dsRNA molecule is a “short or small interfering RNA” or “siRNA.”
  • siRNA useful in the present methods comprise short double-stranded RNA from about 17 nucleotides to about 29 nucleotides in length, preferably from about 19 to about 25 nucleotides in length. The siRNA comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (hereinafter “base-paired”). The sense strand comprises a nucleic acid sequence which is substantially identical to a nucleic acid sequence contained within the target miR gene product.
  • As used herein, a nucleic acid sequence in a siRNA which is “substantially identical” to a target sequence contained within the target mRNA is a nucleic acid sequence that is identical to the target sequence, or that differs from the target sequence by one or two nucleotides. The sense and antisense strands of the siRNA can comprise two complementary, single-stranded RNA molecules, or can comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded “hairpin” area.
  • The siRNA can also be altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, or modifications that make the siRNA resistant to nuclease digestion, or the substitution of one or more nucleotides in the siRNA with deoxyribonucleotides.
  • One or both strands of the siRNA can also comprise a 3′ overhang. As used herein, a “3′ overhang” refers to at least one unpaired nucleotide extending from the 3′-end of a duplexed RNA strand. Thus, in certain embodiments, the siRNA comprises at least one 3′ overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxyribonucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length. In a particular embodiment, the 3′ overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA can comprise 3′ overhangs of dithymidylic acid (“TT”) or diuridylic acid (“uu”).
  • The siRNA can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated miR gene products. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in U.S. Published Patent Application No. 2002/0173478 to Gewirtz and in U.S. Pat. No. 7,148,342 to Reich et al., the entire disclosures of which are incorporated herein by reference.
  • Expression of a given miR gene can also be inhibited by an antisense nucleic acid. As used herein, an “antisense nucleic acid” refers to a nucleic acid molecule that binds to target RNA by means of RNA-RNA or RNA-DNA or RNA-peptide nucleic acid interactions, which alters the activity of the target RNA. Antisense nucleic acids suitable for use in the present methods are single-stranded nucleic acids (for example, RNA, DNA, RNA-DNA chimeras, PNA) that generally comprise a nucleic acid sequence complementary to a contiguous nucleic acid sequence in an miR gene product. The antisense nucleic acid can comprise a nucleic acid sequence that is 50-100% complementary, 75-100% complementary, or 95-100% complementary to a contiguous nucleic acid sequence in an miR gene product. Nucleic acid sequences for the miR gene products are provided in Table 1. Without wishing to be bound by any theory, it is believed that the antisense nucleic acids activate RNase H or another cellular nuclease that digests the miR gene product/antisense nucleic acid duplex.
  • Antisense nucleic acids can also contain modifications to the nucleic acid backbone or to the sugar and base moieties (or their equivalent) to enhance target specificity, nuclease resistance, delivery or other properties related to efficacy of the molecule. Such modifications include cholesterol moieties, duplex intercalators, such as acridine, or one or more nuclease-resistant groups.
  • Antisense nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated miR gene products. Exemplary methods for producing and testing are within the skill in the art; see, for example, Stein and Cheng (1993), Science 261:1004 and U.S. Pat. No. 5,849,902 to Woolf et al., the entire disclosures of which are incorporated herein by reference.
  • Expression of a given miR gene can also be inhibited by an enzymatic nucleic acid. As used herein, an “enzymatic nucleic acid” refers to a nucleic acid comprising a substrate binding region that has complementarity to a contiguous nucleic acid sequence of an miR gene product, and which is able to specifically cleave the miR gene product. The enzymatic nucleic acid substrate binding region can be, for example, 50-100% complementary, 75-100% complementary, or 95-100% complementary to a contiguous nucleic acid sequence in a miR gene product. The enzymatic nucleic acids can also comprise modifications at the base, sugar, and/or phosphate groups. An exemplary enzymatic nucleic acid for use in the present methods is a ribozyme.
  • The enzymatic nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated miR gene products. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in Werner and Uhlenbeck (1995), Nucl. Acids Res. 23:2092-96; Hammann et al. (1999), Antisense and Nucleic Acid Drug Dev. 9:25-31; and U.S. Pat. No. 4,987,071 to Cech et al, the entire disclosures of which are incorporated herein by reference.
  • Administration of at least one miR gene product, or at least one compound for inhibiting miR expression, will inhibit the proliferation of cancer cells in a subject who has a cancer associated with a cancer-associated chromosomal feature. As used herein, to “inhibit the proliferation of a cancer cell” means to kill the cell, or permanently or temporarily arrest or slow the growth of the cell. Inhibition of cancer cell proliferation can be inferred if the number of such cells in the subject remains constant or decreases after administration of the miR gene products or miR gene expression-inhibiting compounds. An inhibition of cancer cell proliferation can also be inferred if the absolute number of such cells increases, but the rate of tumor growth decreases.
  • The number of cancer cells in a subject's body can be determined by direct measurement, or by estimation from the size of primary or metastatic tumor masses. For example, the number of cancer cells in a subject can be measured by immunohistological methods, flow cytometry, or other techniques designed to detect characteristic surface markers of cancer cells.
  • The size of a tumor mass can be ascertained by direct visual observation, or by diagnostic imaging methods, such as X-ray, magnetic resonance imaging, ultrasound, and scintigraphy. Diagnostic imaging methods used to ascertain size of the tumor mass can be employed with or without contrast agents, as is known in the art. The size of a tumor mass can also be ascertained by physical means, such as palpation of the tissue mass or measurement of the tissue mass with a measuring instrument, such as a caliper.
  • The miR gene products or miR gene expression-inhibiting compounds can be administered to a subject by any means suitable for delivering these compounds to cancer cells of the subject. For example, the miR gene products or miR expression inhibiting compounds can be administered by methods suitable to transfect cells of the subject with these compounds, or with nucleic acids comprising sequences encoding these compounds. In one embodiment, the cells are transfected with a plasmid or viral vector comprising sequences encoding at least one miR gene product or miR gene expression inhibiting compound.
  • Transfection methods for eukaryotic cells are well known in the art, and include, for example, direct injection of the nucleic acid into the nucleus or pronucleus of a cell; electroporation; liposome transfer or transfer mediated by lipophilic materials; receptor-mediated nucleic acid delivery, bioballistic or particle acceleration; calcium phosphate precipitation, and transfection mediated by viral vectors.
  • For example, cells can be transfected with a liposomal transfer compound, such as, DOTAP (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate, Boehringer-Mannheim) or an equivalent, such as LIPOFECTIN. The amount of nucleic acid used is not critical to the practice of the invention; acceptable results may be achieved with 0.1-100 micrograms of nucleic acid/105 cells. For example, a ratio of about 0.5 micrograms of plasmid vector in 3 micrograms of DOTAP per 105 cells can be used.
  • A miR gene product or miR gene expression inhibiting compound can also be administered to a subject by any suitable enteral or parenteral administration route. Suitable enteral administration routes for the present methods include, for example, oral, rectal, or intranasal delivery. Suitable parenteral administration routes include, for example, intravascular administration (for example, intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); pen- and intra-tissue injection (for example, peri-tumoral and intra-tumoral injection, intra-retinal injection, or subretinal injection); subcutaneous injection or deposition, including subcutaneous infusion (such as by osmotic pumps); direct application to the tissue of interest, for example by a catheter or other placement device (for example, a retinal pellet or a suppository or an implant comprising a porous, non-porous, or gelatinous material); and inhalation. Particularly suitable administration routes are injection, infusion and direct injection into the tumor.
  • In the present methods, a miR gene product or miR gene product expression inhibiting compound can be administered to the subject either as naked RNA, in combination with a delivery reagent, or as a nucleic acid (for example, a recombinant plasmid or viral vector) comprising sequences that express the miR gene product or expression inhibiting compound. Suitable delivery reagents include, for example, the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (for example, polylysine), and liposomes.
  • Recombinant plasmids and viral vectors comprising sequences that express the miR gene products or miR gene expression inhibiting compounds, and techniques for delivering such plasmids and vectors to cancer cells, are discussed herein.
  • In a particular embodiment, liposomes are used to deliver a miR gene product or miR gene expression-inhibiting compound (or nucleic acids comprising sequences encoding them) to a subject. Liposomes can also increase the blood half-life of the gene products or nucleic acids. Suitable liposomes for use in the invention can be formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors, such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example, as described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9:467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire disclosures of which are incorporated herein by reference.
  • The liposomes for use in the present methods can comprise a ligand molecule that targets the liposome to cancer cells. Ligands which bind to receptors prevalent in cancer cells, such as monoclonal antibodies that bind to tumor cell antigens, are preferred.
  • The liposomes for use in the present methods can also be modified so as to avoid clearance by the mononuclear macrophage system (“MMS”) and reticuloendothelial system (“RES”). Such modified liposomes have opsonization-inhibition moieties on the surface or incorporated into the liposome structure. In a particularly preferred embodiment, a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand.
  • Opsonization-inhibiting moieties for use in preparing the liposomes of the invention are typically large hydrophilic polymers that are bound to the liposome membrane. As used herein, an opsonization inhibiting moiety is “bound” to a liposome membrane when it is chemically or physically attached to the membrane, for example, by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids. These opsonization-inhibiting hydrophilic polymers form a protective surface layer that significantly decreases the uptake of the liposomes by the MMS and RES; for example, as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is incorporated herein by reference.
  • Opsonization inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons. Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; for example, methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers, such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, for example, polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable. In addition, the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide. The opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, for example, galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, for example, reacted with derivatives of carbonic acids with resultant linking of carboxylic groups. Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called “PEGylated liposomes.”
  • The opsonization inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane. Similarly, a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH3 and a solvent mixture, such as tetrahydrofuran and water in a 30:12 ratio at 60° C.
  • Liposomes modified with opsonization-inhibition moieties remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called “stealth” liposomes. Stealth liposomes are known to accumulate in tissues fed by porous or “leaky” microvasculature. Thus, tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see Gabizon, et al. (1988), Proc. Natl. Acad. Sci., U.S.A., 18:6949-53. In addition, the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation of the liposomes in the liver and spleen. Thus, liposomes that are modified with opsonization-inhibition moieties are particularly suited to deliver the miR gene products or miR gene expression inhibition compounds (or nucleic acids comprising sequences encoding them) to tumor cells.
  • The miR gene products or miR gene expression inhibition compounds can be formulated as pharmaceutical compositions, sometimes called “medicaments,” prior to administering them to a subject, according to techniques known in the art. Accordingly, the invention encompasses pharmaceutical compositions for treating breast cancer. In one embodiment, the pharmaceutical compositions comprise at least one isolated miR gene product and a pharmaceutically-acceptable carrier. In a particular embodiment, the at least one miR gene product corresponds to a miR gene product that has a decreased level of expression in breast cancer cells relative to suitable control cells. In certain embodiments the isolated miR gene product is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
  • In other embodiments, the pharmaceutical compositions of the invention comprise at least one miR expression inhibition compound. In a particular embodiment, the at least one miR gene expression inhibition compound is specific for a miR gene whose expression is greater in breast cancer cells than control cells. In certain embodiments, the miR gene expression inhibition compound is specific for one or more miR gene products selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
  • Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, “pharmaceutical formulations” include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is incorporated herein by reference.
  • The present pharmaceutical formulations comprise at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) (for example, 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a pharmaceutically-acceptable carrier. The pharmaceutical formulations of the invention can also comprise at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) which are encapsulated by liposomes and a pharmaceutically-acceptable carrier. In one embodiment, the pharmaceutical compositions comprise a miR gene or gene product that is not miR-15, miR-16, miR-143 and/or miR-145.
  • Especially suitable pharmaceutically-acceptable carriers are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
  • In a particular embodiment, the pharmaceutical compositions of the invention comprise at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) which is resistant to degradation by nucleases. One skilled in the art can readily synthesize nucleic acids which are nuclease resistant, for example by incorporating one or more ribonucleotides that are modified at the 2′-position into the miR gene products. Suitable 2′-modified ribonucleotides include those modified at the 2′-position with fluoro, amino, alkyl, alkoxy, and O-allyl.
  • Pharmaceutical compositions of the invention can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include, for example, physiologically biocompatible buffers (for example, tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (such as, for example, calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
  • For solid pharmaceutical compositions of the invention, conventional nontoxic solid pharmaceutically-acceptable carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • For example, a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25%-75%, of the at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them). A pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20% by weight, preferably 1%-10% by weight, of the at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) encapsulated in a liposome as described above, and a propellant. A carrier can also be included as desired; for example, lecithin for intranasal delivery.
  • The invention also encompasses methods of identifying an anti-breast cancer agent, comprising providing a test agent to a cell and measuring the level of at least one miR gene product in the cell. In one embodiment, the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with decreased expression levels in breast cancer cells. An increase in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent. In a particular embodiment, at least one miR gene product associated with decreased expression levels in breast cancer cells is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
  • In other embodiments the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with increased expression levels in breast cancer cells. A decrease in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent. In a particular embodiment, at least one miR gene product associated with increased expression levels in breast cancer cells is selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
  • Suitable agents include, but are not limited to drugs (for example, small molecules, peptides), and biological macromolecules (for example, proteins, nucleic acids). The agent can be produced recombinantly, synthetically, or it may be isolated (i.e., purified) from a natural source. Various methods for providing such agents to a cell (for example, transfection) are well known in the art, and several of such methods are described hereinabove. Methods for detecting the expression of at least one miR gene product (for example, Northern blotting, in situ hybridization, RT-PCR, expression profiling) are also well known in the art. Several of these methods are also described hereinabove.
  • The invention will now be illustrated by the following non-limiting examples.
    • Example 1 Identification of a microRNA Expression Signature that Discriminates Breast Cancer Tissues from Normal Tissues
  • Materials and Methods
  • Breast Cancer Samples and Cell Lines.
  • RNAs from primary tumors were obtained from 76 samples collected at the University of Ferrara (Italy), Istituto Nazionale dei Tumori, Milano (Italy) and Thomas Jefferson University (Philadelphia, Pa.). Clinico-pathological information was available for 58 tumor samples. RNA from normal samples consisted of 6 pools of RNA from 5 normal breast tissues each, as well as RNA from 4 additional single breast tissues. Breast cancer RNAs were also obtained from the following cell lines: Hs578-T, MCF7, T47D, BT20, SK-BR-3, HBL100, HCC2218, MDA-MB-175, MDA-MB-231, MDA-MB-361, MDA-MB-435, MDA-MB-436, MDA-MB-453 and MDAMB-468.
  • miRNA Microarray.
  • Total RNA isolation was performed with Trizol Reagent (Invitrogen) according to the manufacturer's instructions. RNA labeling and hybridization on microRNA microarray chips was performed as previously described (Liu, C.-G., et al., Proc. Natl. Acad. Sci. U.S.A. 101:9740-9744 (2004)). Briefly, 5 μg of RNA from each sample was labeled with biotin during reverse transcription using random hexamers. Hybridization was carried out on a miRNA microarray chip (KCl version 1.0), which contains 368 probes, including 245 human and mouse miRNA genes, in triplicate. Hybridization signals were detected by binding of biotin to a Streptavidin-Alexa647 conjugate using a Perkin-Elmer ScanArray XL5K. Scanner images were quantified by the Quantarray software (Perkin Elmer).
  • Statistical and bioinformatic analysis of microarray data. Raw data were normalized and analyzed using the GeneSpring® software, version 7.2 (SiliconGenetics, Redwood City, Calif.). Expression data were median centered. Statistical comparisons were performed by ANOVA (Analysis of Variance), using the Benjamini and Hochberg correction for reduction of false positives. Prognostic miRNAs for tumor or normal class prediction were determined using both the PAM software (Prediction Analysis of Microarrays) (Tibshirani, R., et al. Proc. Natl. Acad. Sci. U.S.A. 99:6567-6572 (2002)) and the Support Vector Machine (Furey, T. S., et al. Bioinformatics 16: 906-914 (2000)) software. Both algorithms were used for Cross-validation and Test-set prediction. All data were submitted using MIAMExpress to the Array Express database.
  • Northern Blotting.
  • Northern blot analysis was performed as previously described (Calin, G. A., et al., Proc. Natl. Acad. Sci. U.S.A. 99:15524-29 (2002)). RNA samples (10 μg each) were electrophoresed on 15% acrylamide, 7 M urea Criterion pre-casted gels (Bio-Rad) and transferred onto Hybond-N+ membrane (Amersham Pharmacia Biotech). The hybridization was performed at 37° C. in 7% sodium dodecyl sulfate (SDS)/0.2M Na2PO4 (pH 7.0) for 16 hours. Membranes were washed twice at 42° C. with 2× standard saline phosphate (0.18 M NaCl/10 mM phosphate, pH 7.4), supplemented with 1 mM EDTA (SSPE) and 0.1% SDS, and twice with 0.5×SSPE/0.1% SDS. Oligonucleotide probes were complementary to the sequence of the corresponding mature microRNA (see Sanger miR Registry): miR-21 5′-TCA ACA TCA GTC TGA TAA GCT A-3′ (SEQ ID NO:287); miR-125b1: 5′-TCA CAA GTT AGG GTC TCA GGG A-3′ (SEQ ID NO:288); miR-145: 5′-AAG GGA TTC CTG GGA AAA CTG GAC-3′ (SEQ ID NO:289). An oligonucleotide that was complementary to the U6 RNA (5′-GCA GGG GCC ATG CTA ATC TTC TCT GTA TCG-3′ (SEQ ID NO:290)) was used for normalizing expression levels. 200 ng of each probe was end labeled with 100 mCi [gamma-32P]-ATP using a polynucleotide kinase (Roche). Northern Blots were stripped in a boiling 0.1% SDS solution for 10 minutes before re-hybridization.
  • Results
  • A microRNA microarray (Liu, C.-G., et al., Proc. Natl. Acad. Sci. U.S.A. 101:9740-9744 (2004)) was used to generate microRNA expression profiles for 10 normal and 76 neoplastic breast tissues. Each tumor sample was derived from a single specimen, while 6 of the 10 normal samples consisted of pools of RNA made from five different normal breast tissues. Hence, 34 normal breast samples were actually examined in the study.
  • To identify miRNAs that were differentially-expressed between normal and tumor samples, and, therefore, can be used to distinguish normal from cancerous breast tissues, analyses of variance and class prediction statistical tools were utilized. Results of the ANOVA analysis on normalized data generated a profile of differentially-expressed miRNAs (p<0.05) between normal and cancerous breast tissues (Table 2). Cluster analysis, based on differentially-expressed miRNA, generated a tree having a clear distinction between normal and cancer tissues (FIG. 1A).
  • To accurately identify a set of predictive miRNAs capable of differentiating normal from breast cancer tissues, we used Support Vector Machine (GeneSpring software) and PAM (Prediction Analysis of Microarrays). Results from the two class prediction analyses largely overlapped (Table 3 and FIG. 1B). Among the miRNAs listed in Table 3, 11 of 15 have an ANOVA p-value of less than 0.05. To confirm the results obtained by microarray analysis, we performed Northern blot analysis to assess expression levels for a subset of microRNAs, namely, mir-125b, mir-145 and mir-21, that were differentially-expressed in normal and cancerous breast tissues. Northern blot analysis confirmed results obtained by microarray analysis. In many cases, expression differences appeared stronger than those anticipated by the microarray studies (FIG. 1C).
  • TABLE 2
    miRNAs differentially-expressed between breast carcinoma and normal breast tissue.
    Breast Cancer Normal Breast
    Median Range Median Range
    P-value Normalized Min Max Normalized Min Max
    let-7a-2 1.94E−02 1.67 0.96 - 6.21 2.30 1.34 - 5.00
    let-7a-3 4.19E−02 1.28 0.81 - 3.79 1.58 1.02 - 2.91
    let-7d (= 7d-v1) 4.81E−03 0.90 0.59 - 1.54 1.01 0.83 - 1.25
    let-7f-2 6.57E−03 0.84 0.61 - 1.58 0.92 0.76 - 1.03
    let-7f (= let-7d-v2) 3.38E−02 2.05 1.02 - 7.49 1.53 1.01 - 3.47
    mir-009-1 (mir-131-1) 9.12E−03 1.38 0.69 - 4.18 1.01 0.81 - 2.44
    mir-010b 4.49E−02 1.11 0.69 - 4.78 1.70 0.96 - 8.32
    mir-021 4.67E−03 1.67 0.66 - 28.43 1.08 0.80 - 2.31
    mir-034 (=mir-17D) 1.06E−02 1.87 0.70 - 8.40 1.09 0.65 - 3.17
    mir-101-1 4.15E−03 0.83 0.52 - 1.28 0.90 0.77 - 1.05
    mir-122a 3.43E−03 2.21 0.93 - 8.08 1.48 1.06 - 3.67
    mir-125a 3.28E−03 1.20 0.69 - 2.35 1.73 1.21 - 3.34
    mir-125b-1 2.85E−02 1.30 0.55 - 8.85 2.87 1.45 - 18.38
    mir-125b-2 2.33E−02 1.26 0.69 - 8.29 2.83 1.40 - 18.78
    mir-126b 1.60E−02 1.12 0.68 - 7.34 1.02 0.89 - 1.27
    mir-136 2.42E−03 1.32 0.74 - 10.28 1.06 0.76 - 1.47
    mir-143 7.11E−03 0.87 0.68 - 1.33 0.98 0.81 - 1.17
    mir-145 4.02E−03 1.52 0.92 - 8.46 3.61 1.65 - 14.45
    mir-149 2.75E−02 1.11 0.53 - 1.73 1.03 0.83 - 1.22
    mir-155(BIC) 1.24E−03 1.75 0.95 - 11.45 1.37 1.11 - 1.88
    mir-191 4.28E−02 5.17 1.03 - 37.81 3.12 1.45 - 14.58
    mir-196-1 1.07E−02 1.20 0.57 - 3.95 0.95 0.66 - 1.75
    mir-196-2 1.16E−03 1.46 0.57 - 5.55 1.04 0.79 - 1.80
    mir-202 1.25E−02 1.05 0.71 - 2.03 0.89 0.65 - 1.20
    mir-203 4.08E−07 1.12 0.50 - 5.89 0.86 0.71 - 1.04
    mir-204 2.15E−03 0.78 0.48 - 1.04 0.89 0.72 - 1.08
    mir-206 1.42E−02 2.55 1.22 - 8.42 1.95 1.34 - 3.22
    mir-210 6.40E−13 1.60 0.98 - 12.13 1.12 0.97 - 1.29
    mir-213 1.08E−02 3.72 1.42 - 40.83 2.47 1.35 - 5.91
  • TABLE 3
    Normal and tumor breast tissues class predictor microRNAs
    Median expression ANOVAa SVM prediction PAM scorec
    miRNA name Cancer Normal Probability strengthb Cancer Normal Chromos map
    mir-009-1 1.36 1.01 0.0091 8.05 0.011 −0.102 1q22
    mir-010b 1.11 1.70 0.0449 8.70 −0.032 0.299 2q31
    mir-021 1.67 1.08 0.0047 10.20 0.025 −0.235 17q23.2
    mir-034 1.67 1.09 0.0108 8.05 0.011 −0.106 1p36.22
    mir-102 (mir-29b) 1.36 1.14 >0.10 8.92 0.000 −0.004 1q32.2-32.3
    mir-123 (mir-126) 0.92 1.13 0.0940 9.13 −0.015 0.138 9q34
    mir-125a 1.20 1.73 0.0033 8.99 −0.040 0.381 19q13.4
    mir-125b-1 1.30 2.87 0.0265 14.78 −0.096 0.915 11q24.1
    mir-125b-2 1.26 2.63 0.0233 17.62 −0.106 1.006 21q11.2
    mir-140-as 0.93 1.10 0.0695 11.01 −0.005 0.050 16q22.1
    mir-145 1.52 3.61 0.0040 12.93 −0.158 1.502 5q32-33
    mir-155(BIC) 1.75 1.37 0.0012 10.92 0.003 −0.030 21q21
    mir-194 0.96 1.09 >0.10 11.12 −0.025 0.234 1q41
    mir-204 0.78 0.89 0.0022 8.10 −0.015 0.144 9q21.1
    mir-213 3.72 2.47 0.0108 9.44 0.023 −0.220 1q31.3-q32.1
    aAnalysis of Variance (Welch t-test in Genespring software package) as calculated in Table 2.
    bSupport Vector Machine prediction analysis tool (from Genespring 7.2 software package).

    Prediction strengths are calculated as negative natural log of the probability to predict the observed number of samples, in one of the two classes, by chance. The higher is the score, the best is the prediction strength.
    c—Centroid scores for the two classes of the Prediction Analysis of Microarrays (Tibshirani, R., et al. Proc. Natl. Acad. Sci. U.S.A. 99:6567-6572 (2002)).
  • Of the 29 miRNAs whose expression is significantly (p<0.05) deregulated according to the microarray analysis, a set of 15 miRNAs were able to correctly predict the nature of the sample analyzed (i.e., normal vs. tumor) with 100% accuracy. Among the differentially-expressed miRNAs, miR-10b, miR-125b, miR145, miR-21 and miR-155 were the most consistently deregulated miRNAs in breast cancer samples. Three of these, namely, miR-10b, miR-125b and miR-145, were down-regulated, while the remaining two, miR-21 and miR-155, were up-regulated, suggesting that they might act as tumor suppressor genes or oncogenes, respectively.
    • Example 2 Determination of Putative Gene Targets of miRNAs that are Deregulated in Breast Cancer Tissues
  • At present, the lack of knowledge about bona fide miRNA gene targets hampers a full understanding of which biological functions are deregulated in cancers characterized by aberrant miRNA expression. To identify putative targets of the most significantly de-regulated miRNAs from our study: miR-10b, miR125b, miR-145, miR-21 and miR-155 (see Example 1), we utilized multiple computational approaches. In particular, the analysis was performed using three algorithms, miRanda, TargetScan and PicTar, which are used to predict human miRNA gene targets (Enright, A. J., et al. Genome Biol. 5:R1 (2003); Lewis, B. P. et al., Cell 115:787-798 (2003); Krek, A., et al., Nat. Genet. 37:495-500 (2005)). The results obtained using each of the three algorithms were cross-referenced with one another to validate putative targets, and only targets that were identified by at least 2 of the 3 algorithms were considered. Results of this analysis are presented in Table 4.
  • Several genes with potential oncogenic functions were identified as putative targets of miRNAs that are down-regulated in breast cancer samples. Notably, oncogenes were identified as targets of miR-10b (for example, FLT1, the v-crk homolog, the growth factor BDNF and the transducing factor SHC1), miR-125b (for example, YES, ETS1, TEL, AKT3, the growth factor receptor FGFR2 and members of the mitogen-activated signal transduction pathway VTS58635, MAP3K10, MAP3K11, MAPK14), and miR-145 (for example, MYCN, FOS, YES and FLI1, integration site of Friend leukemia virus, cell cycle promoters, such as cyclins D2 and L1, MAPK transduction proteins, such as MAP3K3 and MAP4K4). The proto-oncogene, YES, and the core-binding transcription factor, CBFB, were determined to be potential targets of both miR-125 and miR-145.
  • Consistent with these findings, multiple tumor suppressor genes were identified as targets of miR-21 and miR-155, miRNAs that are up-regulated in breast cancer cells. For miR-21, the TGFB gene was predicted as target by all three methods. For miR-155, potential targets included the tumor suppressor genes, SOCS1 and APC, and the kinase, WEE1, which blocks the activity of Cdc2 and prevents entry into mitosis. The hypoxia inducible factor, HIF1A, was also a predicted target of miR-155. Notably, the tripartite motif-containing protein TRIM2, the proto-oncogene, SKI, and the RAS homologs, RAB6A and RAB6C, were found as potential targets of both miR-21 and miR-155.
  • TABLE 4
    Putative gene targets of differentially-expressed miRNA identified by at least two prediction methods
    Gene Prediction
    miRNA Genbank Symbol Gene Name algorithm Gene Ontology condensed
    miR- AL117516 38596 strand-exchange protein 1 P + T exonuclease activity|nucleus
    10b
    miR- NM_004915 ABCG1 ATP-binding cassette, P + T ATP binding|ATPase activity|ATPase activity,
    10b sub-family G (WHITE), coupled to transmembrane movement of
    member 1 substances|L-tryptophan transporter
    activity|cholesterol homeostasis|cholesterol
    metabolism|detection of hormone stimulus|integral to
    plasma membrane|lipid
    transport|membrane|membrane fraction|permease
    activity|protein dimerization activity|purine nucleotide
    transporter activity|response to organic substance
    miR- NM_001148 ANK2 ankyrin 2, neuronal P + T actin
    10b cytoskeleton|membrane|metabolism|oxidoreductase
    activity|protein binding|signal transduction|structural
    constituent of cytoskeleton
    miR- NM_020987 ANK3 ankyrin 3, node of P + T Golgi apparatus|cytoskeletal
    10b Ranvier (ankyrin G) anchoring|cytoskeleton|cytoskeleton|endoplasmic
    reticulum|protein binding|protein targeting|signal
    transduction|structural constituent of cytoskeleton
    miR- NM_016376 ANKHZN ANKHZN protein P + T endocytosis|endosome membrane|membrane|protein
    10b binding|zinc ion binding
    miR- NM_006380 APPBP2 amyloid beta precursor P + T binding|cytoplasm|intracellular protein
    10b protein (cytoplasmic transport|membrane|microtubule associated
    tail) binding protein 2 complex|microtubule motor activity|nucleus
    miR- NM_006321 ARIH2 ariadne homolog 2 P + T development|nucleic acid binding|nucleus|protein
    10b (Drosophila) ubiquitination|ubiquitin ligase complex|ubiquitin-
    protein ligase activity|zinc ion binding
    miR- NM_001668 ARNT aryl hydrocarbon P + T aryl hydrocarbon receptor nuclear translocator
    10b receptor nuclear activity|nucleus|nucleus|protein-nucleus import,
    translocator translocation|receptor activity|regulation of
    transcription, DNA-dependent|signal transducer
    activity|signal transduction|transcription coactivator
    activity|transcription factor activity|transcription
    factor activity
    miR- AI829840 ASXL1 ESTs, Weakly similar P + T nucleus|regulation of transcription, DNA-
    10b to SFRB_HUMAN dependent|transcription
    Splicing factor
    arginine/serine-rich 11
    (Arginine-rich 54 kDa
    nuclear protein) (P54)
    [H. sapiens]
    miR- NM_021813 BACH2 BTB and CNC P + T DNA binding|nucleus|protein binding|regulation of
    10b homology 1, basic transcription, DNA-dependent|transcription
    leucine zipper
    transcription factor 2
    miR- NM_013450 BAZ2B bromodomain adjacent P + T DNA binding|nucleus|regulation of transcription,
    10b to zinc finger domain, DNA-dependent|transcription
    2B
    miR- NM_001706 BCL6 B-cell CLL/lymphoma P + T inflammatory response|mediator complex|negative
    10b 6 (zinc finger protein regulation of transcription from RNA polymerase II
    51) promoter|nucleus|positive regulation of cell
    proliferation|protein binding|regulation of
    transcription, DNA-
    dependent|transcription|transcription factor
    activity|zinc ion binding
    miR- NM_001709 BDNF brain-derived P + T growth factor activity|growth factor
    10b neurotrophic factor activity|neurogenesis
    miR- NM_006624 BS69 adenovirus 5 E1A P + T DNA binding|cell cycle|cell proliferation|negative
    10b binding protein regulation of cell cycle|negative regulation of
    transcription from RNA polymerase II
    promoter|nucleus|regulation of transcription, DNA-
    dependent|transcription
    miR- AF101784 BTRC beta-transducin repeat P + T Wnt receptor signaling pathway|endoplasmic
    10b containing reticulum|ligase activity|signal transduction|ubiquitin
    conjugating enzyme activity|ubiquitin cycle|ubiquitin-
    dependent protein catabolism
    miR- NM_005808 C3orf8 HYA22 protein P + T biological_process unknown|molecular_function
    10b unknown|nucleus
    miR- BF111268 CAMK2G calcium/calmodulin- P + T ATP binding|ATP binding|calcium- and calmodulin-
    10b dependent protein dependent protein kinase activity|calcium-dependent
    kinase (CaM kinase) II protein serine/threonine phosphatase
    gamma activity|calmodulin binding|cellular_component
    unknown|insulin secretion|kinase activity|protein
    amino acid phosphorylation|protein amino acid
    phosphorylation|protein serine/threonine kinase
    activity|protein-tyrosine kinase activity|signal
    transduction|transferase activity
    miR- NM_020184 CNNM4 cyclin M4 P + T
    10b
    miR- NM_022730 COPS7B COP9 constitutive P + T signalosome complex
    10b photomorphogenic
    homolog subunit 7B
    (Arabidopsis)
    miR- NM_016823 CRK v-crk sarcoma virus P + T SH3/SH2 adaptor activity|actin cytoskeleton
    10b CT10 oncogene organization and biogenesis|cell
    homolog (avian) motility|cytoplasm|intracellular signaling
    cascade|nucleus|regulation of transcription from RNA
    polymerase II promoter
    miR- NM_020248 CTNNBIP1 catenin, beta interacting P + T Wnt receptor signaling pathway|beta-catenin
    10b protein 1 binding|cell
    proliferation|development|nucleus|regulation of
    transcription, DNA-dependent|signal transduction
    miR- NM_018959 DAZAP1 DAZ associated protein 1 P + T RNA binding|cell differentiation|nucleotide
    10b binding|nucleus|spermatogenesis
    miR- AL136828 DKFZP434K0427 hypothetical protein P + T cation transport|cation transporter activity
    10b DKFZp434K0427
    miR- R20763 DKFZp547J036 ELAV (embryonic P + T
    10b lethal, abnormal vision,
    Drosophila)-like 3 (Hu
    antigen C)
    miR- AF009204 DLGAP2 discs, large P + T cell-cell signaling|membrane|nerve-nerve synaptic
    10b (Drosophila) homolog- transmission|neurofilament|protein binding
    associated protein 2
    miR- NM_001949 E2F3 E2F transcription factor 3 P + T nucleus|protein binding|regulation of cell
    10b cycle|regulation of transcription, DNA-
    dependent|transcription|transcription factor
    activity|transcription factor complex|transcription
    initiation from RNA polymerase II promoter
    miR- NM_022659 EBF2 early B-cell factor 2 P + T DNA binding|development|nucleus|regulation of
    10b transcription, DNA-dependent|transcription
    miR- NM_004432 ELAVL2 ELAV (embryonic P + T RNA binding|mRNA 3′-UTR binding|nucleotide
    10b lethal, abnormal vision, binding|regulation of transcription, DNA-dependent
    Drosophila)-like 2 (Hu
    antigen B)
    miR- NM_001420 ELAVL3 ELAV (embryonic P + T RNA binding|cell differentiation|mRNA 3′-UTR
    10b lethal, abnormal vision, binding|neurogenesis|nucleotide binding
    Drosophila)-like 3 (Hu
    antigen C)
    miR- NM_004438 EPHA4 EphA4 P + T ATP binding|ephrin receptor activity|integral to
    10b plasma membrane|membrane|protein amino acid
    phosphorylation|receptor activity|signal
    transduction|transferase activity|transmembrane
    receptor protein tyrosine kinase signaling pathway
    miR- AL035703 EPHA8; EphA8 P + T
    10b EEK;
    HEK3;
    Hek3;
    KIAA1459
    miR- NM_004468 FHL3 four and a half LIM P + T muscle development|zinc ion binding
    10b domains 3
    miR- NM_024679 FLJ11939 hypothetical protein P + T
    10b FLJ11939
    miR- AI742838 FLJ32122 hypothetical protein P + T GTP binding|GTPase binding|guanyl-nucleotide
    10b FLJ32122 exchange factor activity
    miR- AL040935 FLJ33957 hypothetical protein P + T protein binding
    10b FLJ33957
    miR- AA058828 FLT1 ESTs P + T ATP binding|angiogenesis|cell
    10b differentiation|extracellular space|integral to plasma
    membrane|membrane|positive regulation of cell
    proliferation|pregnancy|protein amino acid
    phosphorylation|receptor activity|transferase
    activity|transmembrane receptor protein tyrosine
    kinase signaling pathway|vascular endothelial growth
    factor receptor activity
    miR- NM_004860 FXR2 fragile X mental P + T RNA binding|cytoplasm|cytosolic large ribosomal
    10b retardation, autosomal subunit (sensu Eukaryota)|nucleus
    homolog 2
    miR- NM_020474 GALNT1 UDP-N-acetyl-alpha-D- P + T Golgi apparatus|O-linked glycosylation|integral to
    10b galactosamine:polypeptide membrane|manganese ion binding|polypeptide N-
    N- acetylgalactosaminyltransferase activity|sugar
    acetylgalactosaminyl- binding|transferase activity, transferring glycosyl
    transferase 1 groups
    (GalNAc-T1)
    miR- D87811 GATA6 GATA binding protein 6 P + T muscle development|nucleus|positive regulation of
    10b transcription|regulation of transcription, DNA-
    dependent|transcription|transcription factor
    activity|transcriptional activator activity|zinc ion
    binding
    miR- NM_000840 GRM3 glutamate receptor, P + T G-protein coupled receptor protein signaling
    10b metabotropic 3 pathway|integral to plasma
    membrane|membrane|metabotropic glutamate,
    GABA-B-like receptor activity|negative regulation of
    adenylate cyclase activity|receptor activity|signal
    transduction|synaptic transmission
    miR- NM_005316 GTF2H1 general transcription P + T DNA repair|[RNA-polymerase]-subunit kinase
    10b factor IIH, polypeptide activity|general RNA polymerase II transcription
    1, 62 kDa factor activity|nucleus|regulation of cyclin dependent
    protein kinase activity|regulation of transcription,
    DNA-dependent|transcription|transcription factor
    TFIIH complex|transcription from RNA polymerase
    II promoter
    miR- AF232772 HAS3 hyaluronan synthase 3 P + T carbohydrate metabolism|hyaluronan synthase
    10b activity|integral to plasma membrane|transferase
    activity, transferring glycosyl groups
    miR- AL023584 HIVEP2 human P + T
    10b immunodeficiency virus
    type I enhancer binding
    protein 2
    miR- S79910 HOXA1 homeo box A1 P + T RNA polymerase II transcription factor
    10b activity|development|nucleus|regulation of
    transcription, DNA-dependent|transcription factor
    activity
    miR- NM_030661 HOXA3 homeo box A3 P + T development|nucleus|regulation of transcription,
    10b DNA-dependent|transcription factor activity
    miR- AW299531 HOXD10 homeo box D10 P + T RNA polymerase II transcription factor
    10b activity|development|nucleus|regulation of
    transcription, DNA-dependent|transcription factor
    activity
    miR- BF031714 HYA22 HYA22 protein P + T
    10b
    miR- NM_001546 ID4 inhibitor of DNA P + T nucleus|regulation of transcription from RNA
    10b binding 4, dominant polymerase II promoter|transcription corepressor
    negative helix-loop- activity
    helix protein
    miR- NM_014333 IGSF4 immunoglobulin P + T
    10b superfamily, member 4
    miR- NM_014271 IL1RAPL1 interleukin 1 receptor P + T integral to membrane|learning and/or
    10b accessory protein-like 1 memory|membrane|signal
    transduction|transmembrane receptor activity
    miR- D87450 KIAA0261 KIAA0261 protein P + T
    10b
    miR- AL117518 KIAA0978 KIAA0978 protein P + T nucleus|regulation of transcription, DNA-
    10b dependent|transcription
    miR- AK025960 KIAA1255 KIAA1255 protein P + T endocytosis|endosome membrane|membrane|protein
    10b binding|zinc ion binding
    miR- AB037797 KIAA1376 KIAA1376 protein P + T
    10b
    miR- NM_004795 KL klotho P + T beta-glucosidase activity|carbohydrate
    10b metabolism|extracellular space|glucosidase
    activity|integral to membrane|integral to plasma
    membrane|membrane fraction|signal transducer
    activity|soluble fraction
    miR- NM_015995 KLF13 Kruppel-like factor 13 P + T DNA binding|RNA polymerase II transcription factor
    10b activity|nucleus|regulation of transcription, DNA-
    dependent|transcription|transcription from RNA
    polymerase II promoter|zinc ion binding
    miR- NM_004235 KLF4 Kruppel-like factor 4 P + T mesodermal cell fate determination|negative
    10b (gut) regulation of cell proliferation|negative regulation of
    transcription, DNA-dependent|negative regulation of
    transcription, DNA-dependent|nucleic acid
    binding|nucleus|transcription|transcription factor
    activity|transcription factor activity|transcriptional
    activator activity|transcriptional activator
    activity|transcriptional repressor
    activity|transcriptional repressor activity|zinc ion
    binding|zinc ion binding
    miR- AW511293 LOC144455 hypothetical protein P + T regulation of cell cycle|regulation of transcription,
    10b BC016658 DNA-dependent|transcription factor
    activity|transcription factor complex
    miR- NM_014921 LPHN1 lectomedin-2 P + T G-protein coupled receptor activity|integral to
    10b membrane|latrotoxin receptor
    activity|membrane|neuropeptide signaling
    pathway|receptor activity|signal transduction|sugar
    binding
    miR- NM_012325 MAPRE1 microtubule-associated P + T cell proliferation|cytokinesis|microtubule
    10b protein, RP/EB family, binding|mitosis|protein C-terminus binding|regulation
    member 1 of cell cycle
    miR- AA824369 MGC4643 hypothetical protein P + T Wnt receptor signaling pathway|endoplasmic
    10b MGC4643 reticulum|ligase activity|signal transduction|ubiquitin
    conjugating enzyme activity|ubiquitin cycle|ubiquitin-
    dependent protein catabolism
    miR- NM_021090 MTMR3 myotubularin related P + T cytoplasm|hydrolase activity|inositol or
    10b protein 3 phosphatidylinositol phosphatase
    activity|membrane|membrane fraction|phospholipid
    dephosphorylation|protein amino acid
    dephosphorylation|protein serine/threonine
    phosphatase activity|protein tyrosine phosphatase
    activity|protein tyrosine/serine/threonine phosphatase
    activity|zinc ion binding
    miR- AI498126 NAC1 transcriptional repressor P + T protein binding
    10b NAC1
    miR- AF128458 NCOA6 nuclear receptor P + T DNA recombination|DNA repair|DNA
    10b coactivator 6 replication|brain development|chromatin
    binding|embryonic development (sensu
    Mammalia)|estrogen receptor binding|estrogen
    receptor signaling pathway|glucocorticoid receptor
    signaling pathway|heart development|ligand-
    dependent nuclear receptor transcription coactivator
    activity|myeloid blood cell
    differentiation|nucleus|nucleus|positive regulation of
    transcription from RNA polymerase II
    promoter|protein binding|regulation of transcription,
    DNA-dependent|response to hormone
    stimulus|retinoid X receptor binding|thyroid hormone
    receptor binding|transcription|transcription factor
    complex|transcription initiation from RNA
    polymerase II promoter|transcriptional activator
    activity
    miR- NM_006312 NCOR2 nuclear receptor co- P + T DNA binding|nucleus|regulation of transcription,
    10b repressor 2 DNA-dependent|transcription corepressor activity
    miR- NM_006599 NFAT5 nuclear factor of P + T RNA polymerase II transcription factor
    10b activated T-cells 5, activity|excretion|nucleus|regulation of transcription,
    tonicity-responsive DNA-dependent|signal transduction|transcription
    factor activity|transcription from RNA polymerase II
    promoter
    miR- NM_006981 NR4A3 nuclear receptor M + P + T binding|nucleus|nucleus|regulation of transcription,
    10b subfamily 4, group A, DNA-dependent|steroid hormone receptor
    member 3 activity|steroid hormone receptor activity|thyroid
    hormone receptor activity|transcription|transcription
    factor activity
    miR- NM_003822 NR5A2 nuclear receptor P + T RNA polymerase II transcription factor activity,
    10b subfamily 5, group A, enhancer
    member 2 binding|morphogenesis|nucleus|nucleus|regulation of
    transcription, DNA-dependent|steroid hormone
    receptor activity|transcription|transcription factor
    activity|transcription from RNA polymerase II
    promoter
    miR- AA295257 NRP2 neuropilin 2 P + T angiogenesis|axon guidance|cell adhesion|cell
    10b adhesion|cell differentiation|electron transport|electron
    transporter activity|integral to membrane|integral to
    membrane|membrane|membrane
    fraction|neurogenesis|receptor activity|semaphorin
    receptor activity|vascular endothelial growth factor
    receptor activity|vascular endothelial growth factor
    receptor activity
    miR- NM_000430 PAFAH1B1 platelet-activating P + T astral microtubule|cell cortex|cell cycle|cell
    10b factor acetylhydrolase, differentiation|cell
    isoform Ib, alpha motility|cytokinesis|cytoskeleton|dynein
    subunit 45 kDa binding|establishment of mitotic spindle
    orientation|kinetochore|lipid metabolism|microtubule
    associated complex|microtubule-based
    process|mitosis|neurogenesis|nuclear membrane|signal
    transduction
    miR- NM_013382 POMT2 putative protein O- P + T O-linked glycosylation|dolichyl-phosphate-mannose-
    10b mannosyltransferase protein mannosyltransferase activity|endoplasmic
    reticulum|integral to membrane|magnesium ion
    binding|membrane|transferase activity, transferring
    glycosyl groups
    miR- BF337790 PURB purine-rich element P + T
    10b binding protein B
    miR- AI302106 RAP2A RAP2A, member of P + T GTP binding|GTPase activity|membrane|signal
    10b RAS oncogene family transduction|small GTPase mediated signal
    transduction
    miR- NM_002886 RAP2B RAP2B, member of P + T GTP binding|protein transport|small GTPase mediated
    10b RAS oncogene family signal transduction
    miR- NM_014781 RB1CC1 RB1-inducible coiled- P + T kinase activity
    10b coil 1
    miR- NM_012234 RYBP RING1 and YY1 P + T development|negative regulation of transcription from
    10b binding protein RNA polymerase II promoter|nucleus|transcription
    corepressor activity
    miR- NM_005506 SCARB2 scavenger receptor class P + T cell adhesion|integral to plasma membrane|lysosomal
    10b B, member 2 membrane|membrane fraction|receptor activity
    miR- AF225986 SCN3A sodium channel, P + T cation channel activity|cation transport|integral to
    10b voltage-gated, type III, membrane|membrane|sodium ion transport|voltage-
    alpha polypeptide gated sodium channel activity|voltage-gated sodium
    channel complex
    miR- NM_002997 SDC1 syndecan 1 P + T cytoskeletal protein binding|integral to plasma
    10b membrane|membrane
    miR- NM_006924 SFRS1 splicing factor, P + T RNA binding|mRNA splice site selection|nuclear
    10b arginine/serine-rich 1 mRNA splicing, via spliceosome|nucleotide
    (splicing factor 2, binding|nucleus
    alternate splicing factor)
    miR- AI809967 SHC1 SHC (Src homology 2 P + T activation of MAPK|activation of MAPK|intracellular
    10b domain containing) signaling cascade|phospholipid binding|phospholipid
    transforming protein 1 binding|plasma membrane|plasma membrane|positive
    regulation of cell proliferation|positive regulation of
    cell proliferation|positive regulation of
    mitosis|positive regulation of mitosis|regulation of cell
    growth|regulation of epidermal growth factor receptor
    activity|transmembrane receptor protein tyrosine
    kinase adaptor protein activity|transmembrane
    receptor protein tyrosine kinase adaptor protein
    activity
    miR- NM_018976 SLC38A solute carrier family 38, P + T amino acid transport|amino acid-polyamine
    10b member 2 transporter activity|integral to
    membrane|membrane|oxygen transport|oxygen
    transporter activity|transport
    miR- NM_003794 SNX4 sorting nexin 4 P + T endocytosis|intracellular signaling cascade|protein
    10b transport
    miR- NM_003103 SON SON DNA binding P + T DNA binding|DNA binding|anti-apoptosis|double-
    10b protein stranded RNA binding|intracellular|nucleic acid
    binding|nucleus
    miR- Z48199 syndecan-1 P + T
    10b
    miR- NM_003222 TFAP2C transcription factor AP- P + T cell-cell signaling|nucleus|regulation of transcription
    10b 2 gamma (activating from RNA polymerase II
    enhancer binding promoter|transcription|transcription factor activity
    protein 2 gamma)
    miR- NM_003275 TMOD1 tropomodulin P + T actin binding|cytoskeleton|cytoskeleton organization
    10b and biogenesis|tropomyosin binding
    miR- NM_003367 USF2 upstream transcription P + T RNA polymerase II transcription factor
    10b factor 2, c-fos activity|nucleus|regulation of transcription, DNA-
    interacting dependent|transcription|transcription factor activity
    miR- N62196 ZNF367 zinc finger protein 367 P + T nucleic acid binding|nucleus|zinc ion binding
    10b
    miR- AI948503 ABCC4 ATP-binding cassette, P + T 15-hydroxyprostaglandin dehydrogenase (NAD+)
    125b sub-family C activity|ATP binding|ATPase activity|ATPase
    (CFTR/MRP), member 4 activity, coupled to transmembrane movement of
    substances|chloride channel activity|integral to
    membrane|ion transport|membrane
    miR- AL534702 ABHD3 abhydrolase domain M + P + T
    125b containing 3
    miR- AL527773 ABR active BCR-related P + T GTPase activator activity|guanyl-nucleotide exchange
    125b gene factor activity|small GTPase mediated signal
    transduction
    miR- NM_020039 ACCN2 amiloride-sensitive P + T amiloride-sensitive sodium channel activity|integral to
    125b cation channel 2, plasma membrane|ion channel activity|ion
    neuronal transport|membrane|response to pH|signal
    transduction|sodium ion transport
    miR- NM_003816 ADAM9 a disintegrin and P + T SH3 domain binding|integral to plasma
    125b metalloproteinase membrane|integrin binding|metalloendopeptidase
    domain 9 (meltrin activity|protein binding|protein kinase binding|protein
    gamma) kinase cascade|proteolysis and peptidolysis|zinc ion
    binding
    miR- L05500 ADCY1 adenylate cyclase 1 P + T cAMP biosynthesis|calcium- and calmodulin-
    125b (brain) responsive adenylate cyclase activity|calmodulin
    binding|integral to membrane|intracellular signaling
    cascade|magnesium ion binding
    miR- NM_017488 ADD2 adducin 2 (beta) P + T actin binding|actin cytoskeleton|calmodulin
    125b binding|membrane
    miR- NM_003488 AKAP1 A kinase (PRKA) P + T RNA binding|integral to
    125b anchor protein 1 membrane|mitochondrion|outer membrane
    miR- NM_005465 AKT3 v-akt murine thymoma P + T ATP binding|protein amino acid
    125b viral oncogene homolog phosphorylation|protein serine/threonine kinase
    3 (protein kinase B, activity|signal transduction|transferase activity
    gamma)
    miR- NM_001150 ANPEP alanyl (membrane) P + T aminopeptidase activity|angiogenesis|cell
    125b aminopeptidase differentiation|integral to plasma
    (aminopeptidase N, membrane|membrane alanyl aminopeptidase
    aminopeptidase M, activity|metallopeptidase activity|proteolysis and
    microsomal peptidolysis|receptor activity|zinc ion binding
    aminopeptidase, CD13,
    p150)
    miR- AF193759 APBA2BP amyloid beta (A4) M + P + T Golgi cis cisterna|Golgi cis cisterna|antibiotic
    125b precursor protein- biosynthesis|calcium ion
    binding, family A, binding|cytoplasm|cytoplasm|endoplasmic reticulum
    member 2 binding membrane|endoplasmic reticulum
    protein membrane|nucleus|oxidoreductase activity|protein
    binding|protein binding|protein binding|protein
    metabolism|protein metabolism|protein
    secretion|protein secretion|regulation of amyloid
    precursor protein biosynthesis
    miR- NM_000038 APC adenomatosis polyposis P + T Wnt receptor signaling pathway|beta-catenin
    125b coli binding|cell adhesion|microtubule binding|negative
    regulation of cell cycle|protein complex
    assembly|signal transduction
    miR- NM_001655 ARCN1 archain 1 P + T COPI vesicle coat|Golgi apparatus|clathrin vesicle
    125b coat|intra-Golgi transport|intracellular protein
    transport|intracellular protein
    transport|membrane|retrograde transport, Golgi to
    ER|transport
    miR- BC001719 ASB6 ankyrin repeat and M + P intracellular signaling cascade
    125b SOCS box-containing 6
    miR- AI478147 ATP10D ATPase, Class V, type P + T ATP binding|ATPase activity|cation
    125b 10D transport|hydrolase activity|integral to
    membrane|magnesium ion
    binding|membrane|phospholipid-translocating ATPase
    activity
    miR- NM_012069 ATP1B4 ATPase, (Na+)/K+ P + T hydrogen ion transporter activity|integral to plasma
    125b transporting, beta 4 membrane|ion transport|membrane|potassium ion
    polypeptide transport|proton transport|sodium ion
    transport|sodium:potassium-exchanging ATPase
    activity
    miR- NM_005176 ATP5G2 ATP synthase, H+ M + P + T ATP synthesis coupled proton transport|hydrogen-
    125b transporting, transporting ATP synthase activity, rotational
    mitochondrial F0 mechanism|hydrogen-transporting ATPase activity,
    complex, subunit c rotational mechanismlion transport|lipid
    (subunit 9), isoform 2 binding|membrane|membrane
    fraction|mitochondrion|proton transport|proton-
    transporting ATP synthase complex (sensu
    Eukaryota)|proton-transporting two-sector ATPase
    complex|transporter activity
    miR- NM_001702 BAI1 brain-specific M + P + T G-protein coupled receptor
    125b angiogenesis inhibitor 1 activity|axonogenesis|brain-specific angiogenesis
    inhibitor activity|cell adhesion|integral to plasma
    membrane|intercellular junction|negative regulation of
    cell proliferation|neuropeptide signaling
    pathway|peripheral nervous system
    development|plasma membrane|protein
    binding|receptor activity|signal transduction
    miR- NM_001188 BAK1 BCL2-antagonist/killer 1 M + T apoptotic mitochondrial changes|induction of
    125b apoptosis|integral to membrane|protein
    heterodimerization activity|regulation of apoptosis
    miR- NM_013449 BAZ2A bromodomain adjacent P + T DNA binding|chromatin remodeling|nucleolus
    125b to zinc finger domain, organizer complex|nucleus|regulation of transcription,
    2A DNA-dependent|transcription|transcription regulator
    activity
    miR- NM_004634 BRPF1 bromodomain and PHD M + P + T DNA binding|nucleus|nucleus|regulation of
    125b finger containing, 1 transcription, DNA-dependent|transcription|zinc ion
    binding
    miR- NM_003458 BSN bassoon (presynaptic P + T cytoskeleton|metal ion binding|nucleus|structural
    125b cytomatrix protein) constituent of cytoskeleton|synapse|synaptic
    transmission|synaptosome
    miR- NM_018108 C14orf130 hypothetical protein P + T ubiquitin cycle|ubiquitin-protein ligase activity
    125b FLJ10483
    miR- AA025877 C20orf136 chromosome 20 open P + T
    125b reading frame 136
    miR- AB054985 CACNB1 calcium channel, M + P + T calcium ion transport|ion transport|membrane
    125b voltage-dependent, beta fraction|muscle contraction|voltage-gated calcium
    1 subunit channel activity|voltage-gated calcium channel
    complex
    miR- NM_001224 CASP2 caspase 2, apoptosis- P + T anti-apoptosis|apoptotic program|caspase
    125b related cysteine activity|caspase activity|caspase activity|cysteine-type
    protease (neural peptidase activity|enzyme binding|intracellular|protein
    precursor cell binding|proteolysis and peptidolysis|proteolysis and
    expressed, peptidolysis|regulation of apoptosis
    developmentally down-
    regulated 2)
    miR- NM_001755 CBFB core-binding factor, M + P + T RNA polymerase II transcription factor
    125b beta subunit activity|nucleus|transcription coactivator
    activity|transcription factor activity|transcription from
    RNA polymerase II promoter
    miR- AV648364 CBX7 ESTs, Highly similar to P + T chromatin|chromatin assembly or
    125b potassium voltage-gated disassembly|chromatin binding|chromatin
    channel, Isk-related modification|nucleus|regulation of transcription,
    subfamily, gene 4; DNA-dependent|transcription
    potassium voltage-gated
    channel-like protein,
    Isk-related subfamily
    [Homo sapiens]
    [H. sapiens]
    miR- NM_001408 CELSR2 cadherin, EGF LAG M + P + T G-protein coupled receptor activity|calcium ion
    125b seven-pass G-type binding|cell adhesion|development|homophilic cell
    receptor 2 (flamingo adhesion|integral to
    homolog, Drosophila) membrane|membrane|neuropeptide signaling
    pathway|receptor activity|signal
    transduction|structural molecule activity
    miR- NM_015955 CGI-27 C21orf19-like protein P + T
    125b
    miR- AF263462 CGN cingulin P + T actin binding|biological_process unknown|motor
    125b activity|myosin|protein binding|tight junction
    miR- AF064491 CLIM2 LIM domain binding 1 P + T LIM domain
    125b binding|development|development|negative regulation
    of transcription, DNA-dependent|nucleus|transcription
    cofactor activity|transcriptional repressor activity
    miR- AU152178 CMG2 capillary P + T integral to membrane|receptor activity
    125b morphogenesis protein 2
    miR- NM_004073 CNK cytokine-inducible P + T ATP binding|protein amino acid
    125b kinase phosphorylation|protein binding|protein
    serine/threonine kinase activity|regulation of cell
    cycle|transferase activity
    miR- NM_020348 CNNM1 cyclin M1 M + P + T fatty acid biosynthesis
    125b
    miR- NM_022730 COPS7B COP9 constitutive M + P + T signalosome complex
    125b photomorphogenic
    homolog subunit 7B
    (Arabidopsis)
    miR- NM_003389 CORO2A coronin, actin binding P + T actin binding|glutamate-ammonia ligase
    125b protein, 2A activity|glutamine biosynthesis|intracellular signaling
    cascade|nitrogen compound metabolism|protein
    binding
    miR- BF939649 CORO2B coronin, actin binding P + T actin binding|actin cytoskeleton|actin cytoskeleton
    125b protein, 2B organization and biogenesis|membrane
    miR- NM_007007 CPSF6 cleavage and P + T RNA binding|mRNA processing|nucleic acid
    125b polyadenylation binding|nucleotide binding|nucleus
    specific factor 6, 68 kDa
    miR- NM_004386 CSPG3 chondroitin sulfate P + T calcium ion binding|cell adhesion|cell
    125b proteoglycan 3 motility|hyaluronic acid binding|sugar binding
    (neurocan)
    miR- NM_004393 DAG1 dystroglycan 1 M + P + T actin cytoskeleton|calcium ion binding|extracellular
    125b (dystrophin-associated matrix (sensu Metazoa)|integral to plasma
    glycoprotein 1) membrane|laminin receptor activity|membrane
    fraction|muscle contraction|plasma membrane|protein
    binding|protein complex assembly
    miR- NM_014764 DAZAP2 DAZ associated protein 2 P + T
    125b
    miR- NM_030927 DC- tetraspanin similar to P + T integral to membrane
    125b TM4F2 TM4SF9
    miR- NM_004082 DCTN1 dynactin 1 (p150, glued M + P + T cytoplasm|cytoskeleton|dynein complex|mitosis|motor
    125b homolog, Drosophila) activity|neurogenesis
    miR- NM_030621 DICER1 Dicer1, Dcr-1 homolog P + T ATP binding|ATP-dependent helicase activity|RNA
    125b (Drosophila) interference, targeting of mRNA for destruction|RNA
    processing|double-stranded RNA
    binding|endonuclease activity|hydrolase
    activity|intracellular|ribonuclease III activity
    miR- U53506 DIO2 deiodinase, P + T integral to membrane|membrane|selenium
    125b iodothyronine, type II binding|selenocysteine incorporation|thyroid hormone
    generation|thyroxine 5′-deiodinase activity|thyroxine
    5′-deiodinase activity
    miR- AL136139 dJ761I2.1 P + T
    125b
    miR- AL357503 dJ899C14.1 Q9H4T4 like P + T
    125b
    miR- AL117482 DKFZP434C131 DKFZP434C131 P + T ATP binding|protein amino acid
    125b protein phosphorylation|protein serine/threonine kinase
    activity|protein-tyrosine kinase activity|transferase
    activity
    miR- AK023580 DKFZP434H0820 hypothetical protein P + T
    125b DKFZp434H0820
    miR- T16388 DKFZp564A176 hypothetical protein P + T development|integral to membrane|membrane|receptor
    125b DKFZp564A176 activity|semaphorin receptor activity
    miR- AL137517 DKFZp564O1278 hypothetical protein P + T integral to membrane
    125b DKFZp564O1278
    miR- BE781961 DKFZp762A2013 hypothetical protein P + T electron transport|electron transporter activity
    125b DKFZp762A2013
    miR- AB036931 DLL4 delta-like 4 M + P + T Notch binding|Notch signaling pathway|cell
    125b (Drosophila) differentiation|circulation|integral to
    membrane|membrane|signal transduction
    miR- NM_012266 DNAJB5 DnaJ (Hsp40) homolog, P + T heat shock protein binding|protein folding|response to
    125b subfamily B, member 5 unfolded protein|unfolded protein binding
    miR- NM_005740 DNAL4 dynein, axonemal, light P + T ATPase activity, coupled|axonemal dynein
    125b polypeptide 4 complex|microtubule motor activity|microtubule-
    based movement
    miR- BF593175 DOCK3 dedicator of cyto- P + T GTP binding|GTPase binding|guanyl-nucleotide
    125b kinesis 3 exchange factor activity
    miR- NM_006426 DPYSL4 dihydropyrimidinase- P + T hydrolase activity|neurogenesis
    125b like 4
    miR- NM_006465 DRIL2 dead ringer P + T DNA binding|biological_process unknown|nucleus
    125b (Drosophila)-like 2
    (bright and dead ringer)
    miR- BC005047 DUSP6 dual specificity P + T MAP kinase phosphatase activity|cytoplasm|hydrolase
    125b phosphatase 6 activity|inactivation of MAPK|protein amino acid
    dephosphorylation|protein serine/threonine
    phosphatase activity|protein tyrosine phosphatase
    activity|regulation of cell cycle|soluble fraction
    miR- NM_004423 DVL3 dishevelled, dsh P + T development|frizzled signaling pathway|heart
    125b homolog 3 (Drosophila) development|intracellular|intracellular signaling
    cascade|kinase activity|neurogenesis|protein
    binding|signal transducer activity
    miR- NM_001949 E2F3 E2F transcription factor 3 P + T nucleus|protein binding|regulation of cell
    125b cycle|regulation of transcription, DNA-
    dependent|transcription|transcription factor
    activity|transcription factor complex|transcription
    initiation from RNA polymerase II promoter
    miR- AU149385 EAF1 Homo sapiens cDNA P + T
    125b FLJ13155 fis, clone
    NT2RP3003433,
    mRNA sequence
    miR- NM_014674 EDEM KIAA0212 gene P + T ER-associated protein catabolism|GTP binding|N-
    125b product linked glycosylation|calcium ion binding|endoplasmic
    reticulum|integral to endoplasmic reticulum
    membrane|integral to membrane|mannosyl-
    oligosaccharide 1,2-alpha-mannosidase
    activity|membrane|protein binding|response to
    unfolded protein
    miR- NM_001955 EDN1 endothelin 1 M + P + T cell-cell signaling|extracellular space|hormone
    125b activity|pathogenesis|positive regulation of cell
    proliferation|regulation of blood pressure|regulation of
    vasoconstriction|signal transduction|soluble fraction
    miR- AI832074 EIF2C2 eukaryotic translation M + P cellular_component unknown|protein
    125b initiation factor 2C, 2 biosynthesis|translation initiation factor activity
    miR- AB044548 EIF4EBP1 eukaryotic translation P + T eukaryotic initiation factor 4E binding|negative
    125b initiation factor 4E regulation of protein biosynthesis|negative regulation
    binding protein 1 of translational initiation|regulation of translation
    miR- NM_020390 EIF5A2 eukaryotic translation P + T DNA binding|protein biosynthesis|translation
    125b initiation factor 5A2 initiation factor activity|translational initiation
    miR- NM_004438 EPHA4 EphA4 P + T ATP binding|ephrin receptor activity|integral to
    125b plasma membrane|membrane|protein amino acid
    phosphorylation|receptor activity|signal
    transduction|transferase activity|transmembrane
    receptor protein tyrosine kinase signaling pathway
    miR- NM_004451 ESRRA estrogen-related P + T nucleus|regulation of transcription, DNA-
    125b receptor alpha dependent|steroid binding|steroid hormone receptor
    activity|transcription|transcription factor activity
    miR- NM_004907 ETR101 immediate early protein P + T
    125b
    miR- NM_005238 ETS1 v-ets erythroblastosis P + T RNA polymerase II transcription factor
    125b virus E26 oncogene activity|immune response|negative regulation of cell
    homolog 1 (avian) proliferation|nucleus|regulation of transcription,
    DNA-dependent|transcription|transcription factor
    activity|transcription from RNA polymerase II
    promoter
    miR- NM_001987 ETV6 ets variant gene 6 (TEL P + T nucleus|regulation of transcription, DNA-
    125b oncogene) dependent|transcription|transcription factor activity
    miR- NM_022763 FAD104 FAD104 P + T
    125b
    miR- AF308300 FAPP2 phosphoinositol 4- P + T
    125b phosphate adaptor
    protein-2
    miR- NM_022976 FGFR2 fibroblast growth factor M + P + T ATP binding|cell growth|fibroblast growth factor
    125b receptor 2 (bacteria- receptor activity|heparin binding|integral to
    expressed kinase, membrane|membrane|protein amino acid
    keratinocyte growth phosphorylation|protein amino acid
    factor receptor, phosphorylation|protein serine/threonine kinase
    craniofacial dysostosis activity|protein-tyrosine kinase activity|protein-
    1, Crouzon syndrome, tyrosine kinase activity|receptor activity|transferase
    Pfeiffer syndrome, activity
    Jackson-Weiss
    syndrome)
    miR- NM_004470 FKBP2 FK506 binding protein P + T FK506 binding|endoplasmic reticulum|isomerase
    125b 2, 13 kDa activity|peptidyl-prolyl cis-trans isomerase
    activity|protein folding
    miR- AL160175 FKHL18 forkhead-like 18 P + T
    125b (Drosophila)
    miR- BF515132 FLJ00024 hypothetical protein P + T
    125b FLJ00024
    miR- BC002945 FLJ10101 hypothetical protein M + P GTP binding|protein transport|small GTPase mediated
    125b FLJ10101 signal transduction
    miR- NM_018243 FLJ10849 hypothetical protein P + T GTP binding|cell cycle|cytokinesis
    125b FLJ10849
    miR- NM_019084 FLJ10895 hypothetical protein P + T nucleus|regulation of cell cycle
    125b FLJ10895
    miR- NM_018320 FLJ11099 hypothetical protein P + T protein ubiquitination|ubiquitin ligase
    125b FLJ11099 complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR- NM_018375 FLJ11274 hypothetical protein M + P + T membrane|metal ion transport|metal ion transporter
    125b FLJ11274 activity
    miR- NM_024954 FLJ11807 hypothetical protein P + T protein modification
    125b FLJ11807
    miR- BF434995 FLJ14708 hypothetical protein P + T
    125b FLJ14708
    miR- NM_018992 FLJ20040 hypothetical protein P + T membrane|potassium ion transport|protein
    125b FLJ20040 binding|voltage-gated potassium channel
    activity|voltage-gated potassium channel complex
    miR- NM_017911 FLJ20635 hypothetical protein P + T
    125b FLJ20635
    miR- NM_017936 FLJ2070 hypothetical protein M + P + T ATP synthesis coupled proton
    125b FLJ20707 transport|cytoplasm|hydrogen-transporting ATP
    synthase activity, rotational mechanism|hydrogen-
    transporting ATPase activity, rotational
    mechanism|membrane|phosphate transport|proton-
    transporting two-sector ATPase complex
    miR- NM_024789 FLJ22529 hypothetical protein P + T
    125b FLJ22529
    miR- AA721230 FLJ25604 hypothetical protein P + T guanyl-nucleotide exchange factor activity|small
    125b FLJ25604 GTPase mediated signal transduction
    miR- AI677701 FLJ30829 hypothetical protein P + T nucleic acid binding|nucleotide binding
    125b FLJ30829
    miR- NM_004475 FLOT2 flotillin 2 M + P + T cell adhesion|epidermis development|flotillin
    125b complex|integral to membrane|plasma
    membrane|protein binding
    miR- AA830884 FMR1 fragile X mental M + T mRNA binding|mRNA processing|mRNA-nucleus
    125b retardation 1 export|nucleoplasm|polysome|ribosome|soluble
    fraction|transport
    miR- AF305083 FUT4 fucosyltransferase 4 P + T Golgi apparatus|L-fucose catabolism|alpha(1,3)-
    125b (alpha (1,3) fucosyltransferase activity|carbohydrate
    fucosyltransferase, metabolism|integral to
    myeloid-specific) membrane|membrane|membrane fraction|protein
    amino acid glycosylation|transferase activity,
    transferring glycosyl groups
    miR- X92762 G4.5 tafazzin M + P + T acyltransferase activity|heart development|integral to
    125b (cardiomyopathy, membrane|metabolism|muscle contraction|muscle
    dilated 3A (X-linked); development
    endocardial
    fibroelastosis 2; Barth
    syndrome)
    miR- NM_012296 GAB2 GRB2-associated P + T
    125b binding protein 2
    miR- NM_015044 GGA2 golgi associated, M + T ADP-ribosylation factor binding|Golgi stack|Golgi
    125b gamma adaptin ear trans face|clathrin coat of trans-Golgi network
    containing, ARF vesicle|intra-Golgi transport|intracellular protein
    binding protein 2 transport|intracellular protein
    transport|membrane|protein complex assembly|protein
    transporter activity
    miR- AL049709 GGTL3 gamma- M + P + T
    125b glutamyltransferase-like 3
    miR- NM_000165 GJA1 gap junction protein, P + T cell-cell signaling|connexon channel
    125b alpha 1, 43 kDa activity|connexon complex|gap junction
    (connexin 43) assembly|heart development|integral to plasma
    membrane|ion transporter activity|muscle
    contraction|perception of sound|positive regulation of
    I-kappaB kinase/NF-kappaB cascade|protein
    binding|signal transducer activity|transport
    miR- NM_014905 GLS glutaminase P + T glutaminase activity|glutamine catabolism|hydrolase
    125b activity|mitochondrion
    miR- NM_005113 GOLGA5 golgi autoantigen, P + T ATP binding|Golgi membrane|cell surface receptor
    125b golgin subfamily a, 5 linked signal transduction|integral to plasma
    membrane|protein amino acid
    phosphorylation|protein-tyrosine kinase activity
    miR- NM_001448 GPC4 glypican 4 M + P + T cell proliferation|extracellular matrix (sensu
    125b Metazoa)|integral to plasma
    membrane|membrane|morphogenesis
    miR- NM_005296 GPR23 G protein-coupled M + T G-protein coupled receptor protein signaling
    125b receptor 23 pathway|integral to plasma membrane|purinergic
    nucleotide receptor activity, G-protein
    coupled|receptor activity|rhodopsin-like receptor
    activity|signal transduction
    miR- U66065 GRB10 growth factor receptor- M + T SH3/SH2 adaptor activity|cell-cell
    125b bound protein 10 signaling|cytoplasm|insulin receptor signaling
    pathway|intracellular signaling cascade|plasma
    membrane
    miR- NM_021643 GS3955 GS3955 protein P + T ATP binding|protein amino acid
    125b phosphorylation|protein kinase activity|transferase
    activity
    miR- NM_019096 GTPBP2 GTP binding protein 2 M + T GTP binding|GTPase activity|protein
    125b biosynthesis|small GTPase mediated signal
    transduction
    miR- U78181 hBNaC2 amiloride-sensitive P + T amiloride-sensitive sodium channel activity|integral to
    125b cation channel 2, plasma membrane|ion channel activity|ion
    neuronal transport|membrane|response to pH|signal
    transduction|sodium ion transport
    miR- NM_005477 HCN4 hyperpolarization P + T 3′,5′-cAMP binding|cation channel activity|cation
    125b activated cyclic transport|circulation|integral to plasma
    nucleotide-gated membrane|membrane|membrane fraction|muscle
    potassium channel 4 contraction|nucleotide binding|potassium ion
    transport|sodium ion transport|voltage-gated
    potassium channel activity
    miR- NM_002112 HDC histidine decarboxylase P + T amino acid metabolism|catecholamine
    125b biosynthesis|histidine decarboxylase activity|histidine
    metabolism|lyase activity
    miR- U64317 HEF1 enhancer of P + T actin filament bundle formation|cell adhesion|
    125b filamentation 1 (cas-like cytokinesis|cytoplasm|cytoskeleton|cytoskeleton
    docking; Crk-associated organization and biogenesis|integrin-mediated
    substrate related) signaling pathway|mitosis|nucleus|protein
    binding|regulation of cell cycle|regulation of cell
    growth|signal transduction|spindle
    miR- L38487 hERRa estrogen-related P + T nucleus|regulation of transcription, DNA-
    125b receptor alpha dependent|steroid binding|steroid hormone receptor
    activity|transcription|transcription factor activity
    miR- AB028943 HIC2 hypermethylated in P + T DNA binding|negative regulation of transcription,
    125b cancer 2 DNA-dependent|nucleus|protein C-terminus
    binding|transcription|zinc ion binding
    miR- AL023584 HIVEP2 human P + T
    125b immunodeficiency virus
    type I enhancer binding
    protein 2
    miR- AL023584 HIVEP2 human P + T
    125b immunodeficiency virus
    type I enhancer binding
    protein 2
    miR- NM_005342 HMGB3 high-mobility group P + T DNA bending activity|DNA
    125b box 3 binding|chromatin|development|nucleus|regulation of
    transcription, DNA-dependent
    miR- AL031295 HMGCL; lysophospholipase II M + P + T
    125b HL
    miR- NM_004503 HOXC6 homeo box C6 P + T development|development|nucleus|regulation of
    125b transcription from RNA polymerase II
    promoter|regulation of transcription, DNA-
    dependent|transcription corepressor
    activity|transcription factor activity
    miR- AA844682 HRD1 HRD1 protein P + T protein ubiquitination|ubiquitin ligase
    125b complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR- AL136667 HSPC039 HSPC039 protein P + T integral to membrane
    125b
    miR- AF245044 HT023 hypothetical protein P + T
    125b HT023
    miR- U13022 Ich-1 caspase 2, apoptosis- P + T anti-apoptosis|apoptotic program|caspase
    125b related cysteine activity|caspase activity|caspase activity|cysteine-type
    protease (neural peptidase activity|enzyme binding|intracellular|protein
    precursor cell binding|proteolysis and peptidolysis|proteolysis and
    expressed, peptidolysis|regulation of apoptosis
    developmentally down-
    regulated 2)
    miR- NM_004513 IL16 interleukin 16 M + P + T chemotaxis|cytokine activity|extracellular
    125b (lymphocyte space|immune response|protein binding|sensory
    chemoattractant factor) perception
    miR- NM_002460 IRF4 interferon regulatory P + T RNA polymerase II transcription factor activity|T-cell
    125b factor 4 activation|T-cell
    activation|nucleus|nucleus|nucleus|positive regulation
    of interleukin-10 biosynthesis|positive regulation of
    interleukin-10 biosynthesis|positive regulation of
    interleukin-13 biosynthesis|positive regulation of
    interleukin-13 biosynthesis|positive regulation of
    interleukin-2 biosynthesis|positive regulation of
    interleukin-2 biosynthesis|positive regulation of
    interleukin-4 biosynthesis|positive regulation of
    interleukin-4 biosynthesis|positive regulation of
    transcription|positive regulation of
    transcription|regulation of T-helper cell
    differentiation|regulation of T-helper cell
    differentiation|regulation of transcription, DNA-
    dependent|regulation of transcription, DNA-
    dependent|transcription|transcription factor
    activity|transcription factor activity|transcription
    factor binding|transcription factor
    binding|transcriptional activator
    activity|transcriptional activator activity
    miR- NM_002207 ITGA9 integrin, alpha 9 P + T cell-matrix adhesion|integral to membrane|integrin
    125b complex|integrin-mediated signaling pathway|protein
    binding|receptor activity
    miR- NM_000212 ITGB3 integrin, beta 3 (platelet P + T blood coagulation|cell-matrix adhesion|integrin
    125b glycoprotein IIIa, complex|integrin-mediated signaling pathway|protein
    antigen CD61) binding|receptor activity
    miR- NM_021991 JUP junction plakoglobin P + T cell adhesion|cell adhesion|cytoplasm|cytoskeletal
    125b protein binding|cytoskeleton|cytoskeleton|membrane
    fraction|mitotic chromosome condensation|protein
    binding|soluble fraction|structural molecule activity
    miR- AF032897 KCNH7 potassium voltage-gated P + T cation transport|integral to
    125b channel, subfamily H membrane|membrane|potassium ion
    (eag-related), member 7 transport|regulation of transcription, DNA-
    dependent|signal transducer activity|signal
    transduction|voltage-gated potassium channel activity
    miR- NM_002252 KCNS3 potassium voltage-gated M + P + T cation transport|delayed rectifier potassium channel
    125b channel, delayed- activity|membrane|membrane fraction|potassium
    rectifier, subfamily S, channel regulator activity|potassium ion
    member 3 transport|protein binding|voltage-gated potassium
    channel complex
    miR- NM_014735 KIAA0215 KIAA0215 gene P + T DNA binding|regulation of transcription, DNA-
    125b product dependent
    miR- NM_015288 KIAA0239 KIAA0239 protein P + T DNA binding|regulation of transcription, DNA-
    125b dependent
    miR- D87469 KIAA0279 cadherin, EGF LAG M + P + T G-protein coupled receptor activity|calcium ion
    125b seven-pass G-type binding|cell adhesion|development|homophilic cell
    receptor 2 (flamingo adhesion|integral to
    homolog, Drosophila) membrane|membrane|neuropeptide signaling
    pathway|receptor activity|signal
    transduction|structural molecule activity
    miR- AB002356 KIAA0358 MAP-kinase activating P + T cell surface receptor linked signal
    125b death domain transduction|cytoplasm|death receptor binding|kinase
    activity|plasma membrane|protein kinase activator
    activity
    miR- NM_014871 KIAA0710 KIAA0710 gene P + T cysteine-type endopeptidase activity|exonuclease
    125b product activity|nucleus|ubiquitin cycle|ubiquitin thiolesterase
    activity|ubiquitin-dependent protein catabolism
    miR- AB 018333 KIAA0790 KIAA0790 protein P + T cell cycle|negative regulation of cell cycle
    125b
    miR- NM_014912 KIAA0940 KIAA0940 protein P + T nucleic acid binding
    125b
    miR- AB028957 KIAA1034 KIAA1034 protein P + T DNA binding|nucleus|regulation of transcription,
    125b DNA-dependent|transcription factor activity
    miR- NM_014901 KIAA1100 KIAA1100 protein M + P + T protein ubiquitination|ubiquitin ligase
    125b complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR- AB033016 KIAA1190 hypothetical protein P + T DNA binding|nucleic acid binding|nucleus|protein
    125b KIAA1190 binding|regulation of transcription, DNA-
    dependent|zinc ion binding
    miR- AA056548 KIAA1268 KIAA1268 protein P + T NAD + ADP-ribosyltransferase
    125b activity|nucleus|protein amino acid ADP-ribosylation
    miR- BE670098 KIAA1594 KIAA1594 protein M + P + T cysteine-type endopeptidase activity|ubiquitin
    125b cycle|ubiquitin thiolesterase activity|ubiquitin-
    dependent protein catabolism
    miR- AU157109 KIAA1598 KIAA1598 protein P + T
    125b
    miR- AA772278 KIAA1673 KIAA1673 P + T
    125b
    miR- NM_015995 KLF13 Kruppel-like factor 13 P + T DNA binding|RNA polymerase II transcription factor
    125b activity|nucleus|regulation of transcription, DNA-
    dependent|transcription|transcription from RNA
    polymerase II promoter|zinc ion binding
    miR- NM_016531 KLF3 Kruppel-like factor 3 P + T development|negative regulation of transcription from
    125b (basic) RNA polymerase II promoter|nucleus|regulation of
    transcription, DNA-
    dependent|transcription|transcription factor
    activity|zinc ion binding
    miR- BE892574 LACTB lactamase, beta P + T hydrolase activity|integral to membrane|response to
    125b antibiotic
    miR- BE566136 LBP-32 LBP protein 32 P + T
    125b
    miR- NM_024090 LCE long-chain fatty-acyl P + T integral to membrane
    125b elongase
    miR- NM_003893 LDB1 LIM domain binding 1 P + T LIM domain
    125b binding|development|development|negative regulation
    of transcription, DNA-dependent|nucleus|transcription
    cofactor activity|transcriptional repressor activity
    miR- U94354 LFNG lunatic fringe homolog M + T Golgi apparatus|development|extracellular
    125b (Drosophila) region|integral to
    membrane|membrane|organogenesis|transferase
    activity, transferring glycosyl groups
    miR- NM_002310 LIFR leukemia inhibitory M + P + T cell surface receptor linked signal
    125b factor receptor transduction|integral to plasma membrane|leukemia
    inhibitory factor receptor activity|membrane|receptor
    activity
    miR- NM_016339 Link- Link guanine nucleotide P + T G-protein coupled receptor protein signaling
    125b GEFII exchange factor II pathway|guanyl-nucleotide exchange factor
    activity|membrane fraction|neurogenesis|small
    GTPase mediated signal transduction
    miR- NM_005575 LNPEP leucyl/cystinyl P + T aminopeptidase activity|cell-cell signaling|integral to
    125b aminopeptidase plasma membrane|membrane alanyl aminopeptidase
    activity|metallopeptidase activity|plasma
    membrane|pregnancy|proteolysis and peptidolysis|zinc
    ion binding
    miR- AL031186 LOC129080 putative emu1 P + T
    125b
    miR- AI884701 LOC221002 CG4853 gene product M + P guanyl-nucleotide exchange factor activity|small
    125b GTPase mediated signal transduction
    miR- AI953847 LOC255488 Homo sapiens mRNA P + T electron transport|electron transporter activity|integral
    125b full length insert cDNA to membrane|iron ion binding|ligase activity|protein
    clone EUROIMAGE binding|protein ubiquitination during ubiquitin-
    186647, mRNA dependent protein catabolism|ubiquitin ligase
    sequence complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR- NM_015899 LOC51054 putative glycolipid P + T
    125b transfer protein
    miR- AA209239 LOC57406 lipase protein P + T aromatic compound metabolism|hydrolase
    125b activity|response to toxin|xenobiotic metabolism
    miR- NM_005576 LOXL1 lysyl oxidase-like 1 M + P + T copper ion binding|electron transporter
    125b activity|extracellular region|oxidoreductase
    activity|protein modification|protein-lysine 6-oxidase
    activity
    miR- AA584297 LRP4 low density lipoprotein M + T calcium ion binding|endocytosis|integral to
    125b receptor-related protein 4 membrane|membrane|receptor activity
    miR- NM_007260 LYPLA2 lysophospholipase II M + P + T fatty acid metabolism|hydrolase activity|lipid
    125b metabolism
    miR- NM_004901 LYSAL1 lysosomal apyrase-like 1 P + T Golgi apparatus|UDP catabolism|apyrase
    125b activity|hydrolase activity|integral to Golgi
    membrane|integral to membrane|lysosome|magnesium
    ion binding|nucleobase, nucleoside, nucleotide and
    nucleic acid metabolism|uridine-diphosphatase
    activity|vacuolar membrane
    miR- NM_002355 M6PR mannose-6-phosphate M + P + T endosome to lysosome transport|integral to plasma
    125b receptor (cation membrane|lysosome|receptor mediated
    dependent) endocytosis|transmembrane receptor
    activity|transport|transporter activity
    miR- AB002356 MADD MAP-kinase activating P + T cell surface receptor linked signal
    125b death domain transduction|cytoplasm|death receptor binding|kinase
    activity|plasma membrane|protein kinase activator
    activity
    miR- NM_016219 MAN1B1 mannosidase, alpha, P + T N-linked glycosylation|N-linked
    125b class 1B, member 1 glycosylation|calcium ion binding|calcium ion
    binding|carbohydrate metabolism|endoplasmic
    reticulum|hydrolase activity, acting on glycosyl
    bonds|integral to membrane|mannosyl-
    oligosaccharide 1,2-alpha-mannosidase
    activity|mannosyl-oligosaccharide 1,2-alpha-
    mannosidase activity|membrane|membrane
    fraction|oligosaccharide metabolism
    miR- NM_002446 MAP3K10 mitogen-activated P + T ATP binding|JUN kinase kinase kinase
    125b protein kinase kinase activity|activation of
    kinase 10 JNK|autophosphorylation|induction of
    apoptosis|protein homodimerization activity|protein
    serine/threonine kinase activity|protein-tyrosine
    kinase activity|signal transduction|transferase activity
    miR- NM_002419 MAP3K11 mitogen-activated M + P + T ATP binding|G1 phase of mitotic cell cycle|JUN
    125b protein kinase kinase kinase kinase kinase activity|activation of
    kinase 11 JNK|autophosphorylation|cell
    proliferation|centrosome|microtubule|microtubule-
    based process|protein homodimerization
    activity|protein oligomerization|protein
    serine/threonine kinase activity|protein-tyrosine
    kinase activity|transferase activity
    miR- Z25432 MAPK14 mitogen-activated P + T ATP binding|MAP kinase activity|MAP kinase kinase
    125b protein kinase 14 activity|MP kinase activity|antimicrobial humoral
    response (sensu Vertebrata)|cell motility|cell surface
    receptor linked signal
    transduction|chemotaxis|cytoplasm|nucleus|protein
    amino acid phosphorylation|protein kinase
    cascade|protein serine/threonine kinase
    activity|protein-tyrosine kinase activity|response to
    stress|transferase activity
    miR- NM_018650 MARK1 MAP/microtubule P + T ATP binding|cytoplasm|cytoskeleton|cytoskeleton
    125b affinity-regulating organization and biogenesis|magnesium ion
    kinase
    1 binding|microtubule cytoskeleton|protein amino acid
    phosphorylation|protein amino acid
    phosphorylation|protein kinase cascade|protein
    serine/threonine kinase activity|protein
    serine/threonine kinase activity|transferase activity
    miR- NM_001879 MASP1 mannan-binding lectin P + T calcium ion binding|chymotrypsin
    125b serine protease 1 activity|complement activation|complement
    (C4/C2 activating activation, classical pathway|extracellular
    component of Ra- region|immune response|peptidase activity|proteolysis
    reactive factor) and peptidolysis|trypsin activity
    miR- NM_005911 MAT2A methionine P + T ATP binding|magnesium ion binding|methionine
    125b adenosyltransferase II, adenosyltransferase activity|one-carbon compound
    alpha metabolism|transferase activity
    miR- NM_005920 MEF2D MADS box P + T muscle development|nucleus|regulation of
    125b transcription enhancer transcription, DNA-
    factor 2, polypeptide D dependent|transcription|transcription coactivator
    (myocyte enhancer activity|transcription factor activity|transcription from
    factor 2D) RNA polymerase II promoter
    miR- NM_020149 MEIS2 Meis1, myeloid M + P negative regulation of transcription from RNA
    125b ecotropic viral polymerase II promoter|nucleus|regulation of
    integration site 1 transcription, DNA-dependent|specific RNA
    homolog 2 (mouse) polymerase II transcription factor
    activity|transcription corepressor activity|transcription
    factor activity|transcription factor activity
    miR- NM_017927 MEN1 mitofusin 1 P + T GTP binding|GTPase activity|hydrolase
    125b activity|integral to membrane|mitochondrial
    fusion|mitochondrial outer membrane|mitochondrion
    miR- AI139252 MGC16063 ribosomal protein L35a P + T JAK-STAT cascadelacute-phase response|calcium ion
    125b binding|cell
    motility|cytoplasm|hematopoietin/interferon-class
    (D200-domain) cytokine receptor signal transducer
    activity|intracellular signaling cascade|negative
    regulation of transcription from RNA polymerase II
    promoter|neurogenesis|nucleus|nucleus|regulation of
    transcription, DNA-dependent|signal transducer
    activity|transcription|transcription factor
    activity|transcription factor activity
    miR- AI862120 MGC21981 hypothetical protein P + T membrane
    125b MGC21981
    miR- AL515061 MGC24302 hypothetical protein P + T
    125b MGC24302
    miR- BE618656 MGC2541 similar to RIKEN M + P + T
    125b cDNA 2610030J16
    gene
    miR- BC005842 MGC2705 hypothetical protein P + T
    125b MGC2705
    miR- NM_024293 MGC3035 hypothetical protein M + P
    125b MGC3035
    miR- NM_017572 MKNK2 MAP kinase-interacting P + T ATP binding|ATP binding|cell surface receptor linked
    125b serine/threonine kinase 2 signal transduction|protein amino acid
    phosphorylation|protein amino acid
    phosphorylation|protein kinase cascade|protein
    serine/threonine kinase activity|protein
    serine/threonine kinase activity|protein-tyrosine
    kinase activity|regulation of translation|response to
    stress|transferase activity
    miR- NM_005439 MLF2 myeloid leukemia factor 2 P + T defense response|nucleus
    125b
    miR- NM_007359 MLN51 MLN51 protein P + T mRNA processing|mRNA-nucleus
    125b export|molecular_function unknown|nucleus|transport
    miR- NM_002442 MSI1 musashi homolog 1 M + P + T RNA binding|neurogenesis|nucleotide binding|nucleus
    125b (Drosophila)
    miR- NM_021090 MTMR3 myotubularin related M + P + T cytoplasm|hydrolase activity|inositol or
    125b protein 3 phosphatidylinositol phosphatase
    activity|membrane|membrane fraction|phospholipid
    dephosphorylation|protein amino acid
    dephosphorylation|protein serine/threonine
    phosphatase activity|protein tyrosine phosphatase
    activity|protein tyrosine/serine/threonine phosphatase
    activity|zinc ion binding
    miR- AK024501 MXD4 MAX dimerization M + P + T DNA binding|negative regulation of cell
    125b protein 4 proliferation|negative regulation of transcription from
    RNA polymerase II promoter|nucleus|protein
    binding|regulation of transcription, DNA-
    dependent|transcription|transcription corepressor
    activity
    miR- AB020642 MYT1 myelin transcription M + P + T nucleus|regulation of transcription, DNA-
    125b factor 1 dependent|transcription|transcription factor
    activity|zinc ion binding
    miR- NM_004540 NCAM2 neural cell adhesion P + T cell adhesion|integral to membrane|membrane| neuron
    125b molecule
    2 adhesion|plasma membrane|protein binding
    miR- NM_012338 NET-2 transmembrane 4 P + T integral to membrane|membrane fraction
    125b superfamily member
    tetraspan NET-2
    miR- U84246 NEU1 sialidase 1 (lysosomal P + T carbohydrate metabolism|exo-alpha-sialidase
    125b sialidase) activity|hydrolase activity, acting on glycosyl
    bonds|lysosome
    miR- AI824012 NRIP1 nuclear receptor P + T nucleus|regulation of transcription, DNA-
    125b interacting protein 1 dependent|transcription|transcription coactivator
    activity
    miR- D81048 NRM nurim (nuclear envelope P + T
    125b membrane protein)
    miR- BC001794 NUMBL numb homolog P + T neurogenesis
    125b (Drosophila)-like
    miR- AB020713 NUP210 nucleoporin 210 P + T development|nucleus
    125b
    miR- NM_002537 OAZ2 ornithine decarboxylase M + P + T ornithine decarboxylase inhibitor activity| polyamine
    125b antizyme
    2 metabolism
    miR- NM_024586 OSBPL9 oxysterol binding P + T lipid transport|steroid metabolism
    125b protein-like 9
    miR- U64661 PABP ESTs, Highly similar to P + T
    125b PAB1_HUMAN
    Polyadenylate-binding
    protein 1 (Poly(A)-
    binding protein 1)
    (PABP 1) (PABP1)
    [H. sapiens]
    miR- AK000003 PCQAP PC2 (positive cofactor P + T
    125b
    2, multiprotein
    complex) glutamine/Q-
    rich-associated protein
    miR- NM_004716 PCSK7 proprotein convertase M + P + T integral to Golgi membrane|integral to
    125b subtilisin/kexin type 7 membrane|peptidase activity|peptidase activity|peptide
    hormone processing|proteolysis and
    peptidolysis|subtilase activity
    miR- NM_006201 PCTK1 PCTAIRE protein M + P + T ATP binding|protein amino acid
    125b kinase
    1 phosphorylation|protein amino acid
    phosphorylation|protein serine/threonine kinase
    activity|protein serine/threonine kinase
    activity|regulation of cell cycle|transferase activity
    miR- NM_021213 PCTP phosphatidylcholine M + P + T cytosol|lipid binding|lipid
    125b transfer protein transport|phosphatidylcholine transporter activity
    miR- NM_021255 PELI2 pellino homolog 2 M + P + T
    125b (Drosophila)
    miR- NM_002646 PIK3C2B phosphoinositide-3- P + T inositol or phosphatidylinositol kinase
    125b kinase, class 2, beta activity|intracellular signaling
    polypeptide cascade|microsome (phosphatidylinositol 3-kinase
    activity|phosphatidylinositol-4-phosphate 3-kinase
    activity|phosphoinositide 3-kinase complex|plasma
    membrane|transferase activity
    miR- NM_003628 PKP4 plakophilin 4 P + T cell adhesion|cytoskeleton|intercellular
    125b junction|protein binding|structural molecule activity
    miR- NM_006718 PLAGL1 pleiomorphic adenoma P + T DNA binding|cell cycle arrest|induction of
    125b gene-like 1 apoptosis|nucleic acid binding|nucleus|regulation of
    transcription, DNA-dependent|transcription|zinc ion
    binding
    miR- AI457120 PPAT phosphoribosyl P + T amidophosphoribosyltransferase activity|glutamine
    125b pyrophosphate metabolism|magnesium ion
    amidotransferase binding|metabolism|nucleoside metabolism|purine
    base biosynthesis|purine nucleotide
    biosynthesis|transferase activity, transferring glycosyl
    groups
    miR- NM_002719 PPP2R5C protein phosphatase 2, P + T hydrolase activity|nucleus|phosphoprotein
    125b regulatory subunit B phosphatase activity|protein phosphatase type 2A
    (B56), gamma isoform complex|protein phosphatase type 2A complex|protein
    phosphatase type 2A regulator activity|protein
    phosphatase type 2A regulator activity|signal
    transduction|signal transduction
    miR- AL022067 PRDM1 PR domain containing P + T
    125b 1, with ZNF domain
    miR- U23736 PRDM2 PR domain containing P + T DNA binding|metal ion
    125b 2, with ZNF domain binding|nucleus|nucleus|regulation of
    transcription|regulation of transcription, DNA-
    dependent|transcription factor activity|transcription
    regulator activity|zinc ion binding|zinc ion binding
    miR- AF083033 PRKRA protein kinase, P + T double-stranded RNA binding|enzyme activator
    125b interferon-inducible activity|immune response|intracellular|kinase
    double stranded RNA activity|negative regulation of cell
    dependent activator proliferation|response to virus|signal transducer
    activity|signal transduction
    miR- NM_014369 PTPN18 protein tyrosine P + T hydrolase activity|non-membrane spanning protein
    125b phosphatase, non- tyrosine phosphatase activity|protein amino acid
    receptor type 18 (brain- dephosphorylation|protein amino acid
    derived) dephosphorylation|protein tyrosine phosphatase
    activity
    miR- AI762627 PTPRF protein tyrosine P + T cell adhesion|hydrolase activity|integral to
    125b phosphatase, receptor membrane|integral to plasma membrane|protein
    type, F amino acid dephosphorylation|protein binding|protein
    tyrosine phosphatase activity|receptor
    activity|transmembrane receptor protein tyrosine
    phosphatase activity|transmembrane receptor protein
    tyrosine phosphatase signaling pathway
    miR- NM_002840 PTPRF protein tyrosine P + T cell adhesion|hydrolase activity|integral to
    125b phosphatase, receptor membrane|integral to plasma membrane|protein
    type, F amino acid dephosphorylation|protein binding|protein
    tyrosine phosphatase activity|receptor
    activity|transmembrane receptor protein tyrosine
    phosphatase activity|transmembrane receptor protein
    tyrosine phosphatase signaling pathway
    miR- AF142419 QKI homolog of mouse P + T
    125b quaking QKI (KH
    domain RNA binding
    protein)
    miR- NM_004283 RAB3D RAB3D, member RAS P + T GTP binding|GTPase activity|exocytosis|hemocyte
    125b oncogene family development|protein transport|small GTPase mediated
    signal transduction
    miR- BC002510 RAB6B RAB6B, member RAS P + T GTP binding|GTPase activity|Golgi
    125b oncogene family apparatus|intracellular protein transport|retrograde
    transport, Golgi to ER|small GTPase mediated signal
    transduction
    miR- AK022662 RASAL2 RAS protein activator P + T GTPase activator activity|Ras GTPase activator
    125b like 2 activity|signal transduction
    miR- NM_004841 RASAL2 RAS protein activator P + T GTPase activator activity|Ras GTPase activator
    125b like 2 activity|signal transduction
    miR- NM_016090 RBM7 RNA binding motif P + T RNA binding|meiosis|nucleic acid binding|nucleotide
    125b protein 7 binding
    miR- NM_006268 REQ requiem, apoptosis M + P + T DNA binding|apoptosis|induction of apoptosis by
    125b response zinc finger extracellular signals|nucleus|protein
    gene ubiquitination|regulation of transcription, DNA-
    dependent|transcription|ubiquitin ligase
    complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR- NM_000449 RFX5 regulatory factor X, 5 P + T nucleus|regulation of transcription, DNA-
    125b (influences HLA class dependent|transcription|transcription coactivator
    II expression) activity|transcription factor activity|transcription from
    RNA polymerase II promoter
    miR- NM_003721 RFXANK regulatory factor X- P + T humoral immune response|nucleus|regulation of
    125b associated ankyrin- transcription, DNA-
    containing protein dependent|transcription|transcription coactivator
    activity|transcription factor activity|transcription from
    RNA polymerase II promoter
    miR- NM_014746 RNF144 likely ortholog of P + T nucleus|protein ubiquitination|ubiquitin ligase
    125b mouse ubiquitin complex|ubiquitin-protein ligase activity|zinc ion
    conjugating enzyme 7 binding
    interacting protein 4
    miR- NM_014771 RNF40 ring finger protein 40 M + P + T protein ubiquitination|ubiquitin ligase
    125b complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR- AL109955 RNPC1 RNA-binding region P + T
    125b (RNP1, RRM)
    containing 1
    miR- AF116627 RPL29 ribosomal protein L29 M + T
    125b
    miR- NM_002953 RPS6KA1 ribosomal protein S6 M + P + T ATP binding|protein amino acid
    125b kinase, 90 kDa, phosphorylation|protein serine/threonine kinase
    polypeptide
    1 activity|protein serine/threonine kinase
    activity|protein-tyrosine kinase activity|signal
    transduction|transferase activity
    miR- NM_000332 SCA1 spinocerebellar ataxia 1 P + T RNA binding|cytoplasm|nucleus
    125b (olivopontocerebellar
    ataxia
    1, autosomal
    dominant, ataxin 1)
    miR- NM_012429 SEC14L2 SEC14-like 2 P + T cytoplasm|intracellular protein
    125b (S. cerevisiae) transport|membrane|nucleus|phospholipid
    binding|positive regulation of transcription, DNA-
    dependent|protein carrier activity|regulation of
    cholesterol biosynthesis|transcription|transcriptional
    activator activity|transport|vitamin E binding
    miR- NM_005065 SEL1L sel-1 suppressor of lin- P + T catalytic activity|integral to membrane
    125b 12-like (C. elegans)
    miR- NM_017789 SEMA4C sema domain, M + P + T cell differentiation|integral to
    125b immunoglobulin membrane|membrane|neurogenesis|receptor activity
    domain (Ig),
    transmembrane domain
    (TM) and short
    cytoplasmic domain,
    (semaphorin) 4C
    miR- NM_006378 SEMA4D sema domain, P + T anti-apoptosis|cell adhesion|cell
    125b immunoglobulin differentiation|immune response|integral to
    domain (Ig), membrane|membrane|neurogenesis|receptor activity
    transmembrane domain
    (TM) and short
    cytoplasmic domain,
    (semaphorin) 4D
    miR- BE622841 SENP2 sentrin-specific protease M + P
    125b
    miR- NM_003011 SET SET translocation M + T DNA replication|endoplasmic reticulum|histone
    125b (myeloid leukemia- binding|negative regulation of histone
    associated) acetylation|nucleocytoplasmic transport|nucleosome
    assembly|nucleosome disassembly|nucleus|perinuclear
    region|protein phosphatase inhibitor activity|protein
    phosphatase type 2A regulator activity
    miR- NM_006275 SFRS6 splicing factor, P + T RNA binding|mRNA splice site selection|nuclear
    125b arginine/serine-rich 6 mRNA splicing, via spliceosome|nucleotide
    binding|nucleus
    miR- AF015043 SH3BP4 SH3-domain binding P + T cell cycle|endocytosis|nucleus|signal transducer
    125b protein 4 activity
    miR- NM_016538 SIRT7 sirtuin silent mating P + T DNA binding|chromatin silencing|chromatin silencing
    125b type information complex|hydrolase activity|regulation of transcription,
    regulation 2 homolog 7 DNA-dependent
    (S. cerevisiae)
    miR- NM_020309 SLC17A7 solute carrier family 17 P + T integral to membrane|phosphate transport|sodium-
    125b (sodium-dependent dependent phosphate transporter
    inorganic phosphate activity|transport|transporter activity
    cotransporter), member 7
    miR- NM_013272 SLC21A11 solute carrier family 21 P + T integral to membrane|ion
    125b (organic anion transport|membrane|transporter activity
    transporter), member 11
    miR- AK000722 SLC27A4 solute carrier family 27 P + T catalytic activity|fatty acid transport|fatty acid
    125b (fatty acid transporter), transporter activity|ligase activity|lipid
    member 4 metabolism|lipid transport|metabolism
    miR- NM_003759 SLC4A4 solute carrier family 4, P + T anion transport|inorganic anion exchanger
    125b sodium bicarbonate activity|integral to membrane|integral to plasma
    cotransporter, member 4 membrane|membrane|sodium:bicarbonate symporter
    activity|transport
    miR- NM_003045 SLC7A1 solute carrier family 7 P + T amino acid metabolism|amino acid permease
    125b (cationic amino acid activity|amino acid transport|basic amino acid
    transporter, y+ system), transporter activity|integral to plasma
    member
    1 membrane|membrane|receptor activity|transport
    miR- NM_003983 SLC7A6 solute carrier family 7 P + T amino acid metabolism|amino acid transport|amino
    125b (cationic amino acid acid-polyamine transporter activity|integral to plasma
    transporter, y+ system), membrane|plasma membrane|protein complex
    member
    6 assembly|transport
    miR- AF113019 SMARCD2 SWI/SNF related, M + P + T chromatin remodeling|nucleoplasm|regulation of
    125b matrix associated, actin transcription from RNA polymerase II
    dependent regulator of promoter|transcription|transcription coactivator
    chromatin, subfamily d, activity
    member
    2
    miR- NM_005985 SNAI1 snail homolog 1 P + T DNA binding|cartilage
    125b (Drosophila) condensation|development|neurogenesis|nucleus|zinc
    ion binding
    miR- AB037750 SORCS2 VPS10 domain receptor P + T integral to membrane|intracellular protein
    125b protein transport|membrane|membrane|neuropeptide receptor
    activity|neuropeptide signaling pathway|protein
    binding|protein transporter activity|sugar binding
    miR- BE742268 SORT1 sortilin 1 P + T endocytosis|endosome|integral to membrane|integral
    125b to membrane|intracellular protein
    transport|membrane|neurotensin receptor activity, G-
    protein coupled|protein transporter activity|receptor
    activity
    miR- AI360875 SOX11 SRY (sex determining M + T DNA binding|neurogenesis|nucleus|regulation of
    125b region Y)-box 11 transcription, DNA-dependent|transcription
    miR- AU121035 SP1 Sp1 transcription factor P + T DNA binding|RNA polymerase II transcription factor
    125b activity|nucleus|regulation of transcription, DNA-
    dependent|transcription|transcriptional activator
    activity|zinc ion binding
    miR- NM_003131 SRF serum response factor M + T RNA polymerase II transcription factor
    125b (c-fos serum response activity|nucleus|regulation of transcription from RNA
    element-binding polymerase II promoter|signal
    transcription factor) transduction|transcription|transcription factor activity
    miR- NM_005637 SS18 synovial sarcoma P + T nucleus
    125b translocation,
    chromosome 18
    miR- AF343880 SSX2 synovial sarcoma, X P + T nucleus
    125b breakpoint
    2
    miR- NM_014682 ST18 suppression of P + T nucleus|regulation of transcription, DNA-
    125b tumorigenicity 18 dependent|transcription factor activity
    (breast carcinoma) (zinc
    finger protein)
    miR- AA128023 STARD13 START domain P + T
    125b containing 13
    miR- BC000627 STAT3 signal transducer and P + T JAK-STAT cascade|acute-phase response|calcium ion
    125b activator of binding|cell
    transcription 3 (acute- motility|cytoplasm|hematopoietin/interferon-class
    phase response factor) (D200-domain) cytokine receptor signal transducer
    activity|intracellular signaling cascade|negative
    regulation of transcription from RNA polymerase II
    promoter|neurogenesis|nucleus|nucleus|regulation of
    transcription, DNA-dependent|signal transducer
    activity|transcription|transcription factor
    activity|transcription factor activity
    miR- NM_003155 STC1 stanniocalcin 1 P + T calcium ion homeostasis|cell surface receptor linked
    125b signal transduction|cell-cell signaling|extracellular
    region|hormone activity|response to nutrients
    miR- NM_003173 SUV39H1 suppressor of P + T DNA replication and chromosome cycle|S-
    125b variegation 3-9 adenosylmethionine-dependent methyltransferase
    homolog 1 (Drosophila) activity|chromatin|chromatin assembly or
    disassembly|chromatin binding|chromatin
    modification|condensed nuclear chromosome|histone
    lysine N-methyltransferase activity (H3-K9
    specific)|histone-lysine N-methyltransferase
    activity|methyltransferase
    activity|nucleus|nucleus|protein binding|transferase
    activity|zinc ion binding
    miR- AW139618 SYN2 synapsin II P + T neurotransmitter secretion|synapse|synaptic
    125b transmission|synaptic vesicle
    miR- R60550 TAF5L TAF5-like RNA M + P + T nucleus|regulation of transcription, DNA-
    125b polymerase II, dependent|transcription factor activity|transcription
    p300/CBP-associated from RNA polymerase II promoter
    factor (PCAF)-
    associated factor,
    65 kDa
    miR- AF220509 TAF9L TAF9-like RNA P + T DNA binding|nucleus|regulation of transcription,
    125b polymerase II, TATA DNA-dependent|transcription factor TFIID
    box binding protein complex|transcription initiation
    (TBP)-associated factor,
    31 kDa
    miR- NM_000116 TAZ tafazzin M + P + T acyltransferase activity|heart development|integral to
    125b (cardiomyopathy, membrane|metabolism|muscle contraction|muscle
    dilated 3A (X-linked); development
    endocardial
    fibroelastosis
    2; Barth
    syndrome)
    miR- NM_018488 TBX4 T-box 4 P + T development|nucleus|regulation of transcription,
    125b DNA-dependent|transcription|transcription factor
    activity
    miR- NM_012249 TC10 ras-like protein TC10 M + T GTP binding|GTPase activity|plasma membrane|small
    125b GTPase mediated signal transduction
    miR- BG387172 TEAD2 TEA domain family P + T nucleus|nucleus|regulation of transcription, DNA-
    125b member 2 dependent|regulation of transcription, DNA-
    dependent|transcription|transcription factor
    activity|transcription factor activity
    miR- U06935 TEF thyrotrophic embryonic P + T RNA polymerase II transcription factor
    125b factor activity|nucleus|regulation of transcription from RNA
    polymerase II promoter|rhythmic
    process|transcription|transcription factor activity
    miR- NM_006464 TGOLN2 trans-golgi network P + T Golgi trans face|integral to membrane| transport
    125b protein
    2 vesicle
    miR- BE219311 TIMM22 translocase of inner P + T integral to membrane|mitochondrial inner
    125b mitochondrial membrane|mitochondrion|protein transport|protein
    membrane
    22 homolog transporter activity
    (yeast)
    miR- NM_003326 TNFSF4 tumor necrosis factor P + T cell-cell signaling|immune response|integral to plasma
    125b (ligand) superfamily, membrane|membrane|positive regulation of cell
    member 4 (tax- proliferation|signal transduction|tumor necrosis factor
    transcriptionally receptor binding
    activated glycoprotein
    1, 34 kDa)
    miR- AA873275 TOR2A torsin family 2, member A P + T ATP binding|GTP cyclohydrolase I
    125b activity|biosynthesis|chaperone cofactor dependent
    protein folding|endoplasmic reticulum|nucleoside-
    triphosphatase activity|nucleotide binding
    miR- AW341649 TP53INP1 tumor protein p53 M + P + T apoptosis|nucleus
    125b inducible nuclear
    protein
    1
    miR- NM_014112 TRPS1 trichorhinophalangeal P + T NLS-bearing substrate-nucleus
    125b syndrome I import|nucleus|regulation of transcription, DNA-
    dependent|skeletal
    development|transcription|transcription factor
    activity|transcription from RNA polymerase II
    promoter|zinc ion binding
    miR- NM_001070 TUBG1 tubulin, gamma 1 P + T GTP binding|GTPase activity|centrosome|condensed
    125b nuclear chromosome|gamma-tubulin complex|meiotic
    spindle organization and
    biogenesis|microtubule|microtubule
    nucleation|microtubule-based movement|mitotic
    spindle organization and biogenesis|polar
    microtubule|protein binding|protein
    polymerization|spindle pole body|structural
    constituent of cytoskeleton
    miR- NM_003330 TXNRD1 thioredoxin reductase 1 P + T FAD binding|cell redox
    125b homeostasis|cytoplasm|disulfide oxidoreductase
    activity|electron transport|electron transporter
    activity|oxidoreductase activity, acting on NADH or
    NADPH, disulfide as acceptor|signal
    transduction|thioredoxin-disulfide reductase activity
    miR- BC004862 UBE2R2 ubiquitin-conjugating P + T ligase activity|ubiquitin conjugating enzyme
    125b enzyme E2R 2 activity|ubiquitin cycle|ubiquitin-protein ligase
    activity
    miR- NM_003728 UNC5C unc-5 homolog B P + T apoptosis|axon guidance|brain
    125b (C. elegans) development|development|integral to membrane |netrin
    receptor activity|protein binding|receptor
    activity|signal transduction
    miR- NM_003369 UVRAG UV radiation resistance P + T DNA repair|cytoplasm
    125b associated gene
    miR- AF195514 VPS4B vacuolar protein sorting M + P + T ATP binding|ATPase activity,
    125b 4B (yeast) coupled|membrane|membrane fusion|nucleoside-
    triphosphatase activity|nucleotide binding|peroxisome
    organization and biogenesis|protein binding|regulation
    of transcription, DNA-dependent
    miR- R51061 VTS58635 mitogen-activated P + T GTP binding|small GTPase mediated signal
    125b protein kinase kinase transduction
    kinase kinase
    1
    miR- NM_004184 WARS tryptophanyl-tRNA M + T ATP binding|cytoplasm|ligase activity|negative
    125b synthetase regulation of cell proliferation|protein
    biosynthesis|soluble fraction|tryptophan-tRNA ligase
    activity|tryptophanyl-tRNA
    aminoacylation|tryptophanyl-tRNA aminoacylation
    miR- NM_005433 YES1 v-yes-1 Yamaguchi P + T ATP binding|intracellular signaling cascade|protein
    125b sarcoma viral oncogene amino acid phosphorylation|protein-tyrosine kinase
    homolog
    1 activity|transferase activity
    miR- NM_017740 ZDHHC7 zinc finger, DHHC P + T integral to membrane|metal ion binding
    125b domain containing 7
    miR- BF525395 ZFP385 likely ortholog of M + P + T DNA binding|nucleic acid binding|nucleus|regulation
    125b mouse zinc finger of transcription, DNA-dependent|transcription|zinc
    protein 385 ion binding
    miR- NM_007345 ZNF236 zinc finger protein 236 P + T nucleus|regulation of transcription, DNA-
    125b dependent|transcription|transcription factor
    activity|zinc ion binding
    miR- NM_012482 ZNF281 zinc finger protein 281 M + P + T DNA binding|DNA-directed RNA polymerase II, core
    125b complex|negative regulation of transcription from
    RNA polymerase II promoter|nucleus|regulation of
    transcription, DNA-dependent|specific RNA
    polymerase II transcription factor
    activity|transcription|zinc ion binding
    miR- NM_003427 ZNF76 zinc finger protein 76 P + T DNA binding|nucleus|regulation of transcription from
    125b (expressed in testis) RNA polymerase II promoter|regulation of
    transcription from RNA polymerase III
    promoter|transcription|zinc ion binding
    miR- NM_022465 ZNFN1A4 zinc finger protein, M + P + T nucleic acid binding|nucleus|transcription factor
    125b subfamily 1A, 4 (Eos) activity|transcriptional repressor activity|zinc ion
    binding
    miR- NM_005502 ABCA1 ATP-binding cassette, P + T ATP binding|ATP binding|ATPase activity|anion
    145 sub-family A (ABC1), transporter activity|cholesterol metabolism|integral to
    member 1 plasma membrane|lipid metabolism|membrane
    fraction|nucleotide binding|steroid metabolism|sterol
    transporter activity|transport|transport
    miR- AL527773 ABR active BCR-related M + P + T GTPase activator activity|guanyl-nucleotide exchange
    145 gene factor activity|small GTPase mediated signal
    transduction
    miR- NM_001616 ACVR2 activin A receptor, type M + P + T ATP binding|integral to plasma
    145 II membrane|membrane|protein amino acid
    phosphorylation|receptor activity|transferase
    activity|transforming growth factor beta receptor
    activity|transmembrane receptor protein
    serine/threonine kinase signaling pathway
    miR- NM_003183 ADAM17 a disintegrin and P + T cell-cell signaling|integral to plasma
    145 metalloproteinase membrane|metalloendopeptidase activity|proteolysis
    domain 17 (tumor and peptidolysis|zinc ion binding
    necrosis factor, alpha,
    converting enzyme)
    miR- NM_019903 ADD3 adducin 3 (gamma) M + P + T calmodulin binding|cytoskeleton|membrane|structural
    145 constituent of cytoskeleton
    miR- AB003476 AKAP12 A kinase (PRKA) P + T G-protein coupled receptor protein signaling
    145 anchor protein (gravin) pathway|cytoplasm|protein binding|protein kinase A
    12 binding|protein targeting|signal transduction
    miR- NM_016201 AMOTL2 angiomotin like 2 M + P + T
    145
    miR- NM_001128 AP1G1 adaptor-related protein M + P + T Golgi apparatus|binding|clathrin coat of trans-Golgi
    145 complex 1, gamma 1 network vesicle|coated pit|endocytosis|intracellular
    subunit protein transport|intracellular protein
    transport|membrane coat adaptor complex|protein
    complex assembly|transporter activity
    miR- NM_001284 AP3S1 adaptor-related protein M + P + T Golgi apparatus|clathrin vesicle coat|insulin receptor
    145 complex 3, sigma 1 signaling pathway|intracellular protein
    subunit transport|membrane coat adaptor
    complex|transport|transport vesicle|transporter activity
    miR- NM_006380 APPBP2 amyloid beta precursor M + P + T binding|cytoplasm|intracellular protein
    145 protein (cytoplasmic transport|membrane|microtubule associated
    tail) binding protein 2 complex|microtubule motor activity|nucleus
    miR- AB037845 ARHGAP10 Rho-GTPase activating M + T protein binding
    145 protein 10
    miR- AL516350 ARPC5 actin related protein 2/3 P + T Arp2/3 protein complex|actin cytoskeleton
    145 complex, subunit 5, organization and biogenesis|cell
    16 kDa motility|cytoplasm|cytoskeleton|regulation of actin
    filament polymerization|structural constituent of
    cytoskeleton
    miR- U72937 ATRX alpha M + T ATP binding|DNA binding|DNA helicase
    145 thalassemia/mental activity|DNA methylation|DNA recombination|DNA
    retardation syndrome repair|chromosome organization and biogenesis
    X-linked (RAD54 (sensu Eukaryota)|helicase activity|hydrolase
    homolog, S. cerevisiae) activity|nuclear heterochromatin|nucleus|perception of
    sound|regulation of transcription, DNA-
    dependent|transcription factor activity
    miR- NM_021813 BACH2 BTB and CNC P + T DNA binding|nucleus|protein binding|regulation of
    145 homology 1, basic transcription, DNA-dependent|transcription
    leucine zipper
    transcription factor
    2
    miR- NM_013449 BAZ2A bromodomain adjacent P + T DNA binding|chromatin remodeling|nucleolus
    145 to zinc finger domain, organizer complex|nucleus|regulation of transcription,
    2A DNA-dependent|transcription|transcription regulator
    activity
    miR- NM_007005 BCE-1 BCE-1 protein M + P frizzled signaling pathway|molecular_function
    145 unknown|nucleus|nucleus|regulation of
    transcription|regulation of transcription, DNA-
    dependent
    miR- NM_003458 BSN bassoon (presynaptic P + T cytoskeleton|metal ion binding|nucleus|structural
    145 cytomatrix protein) constituent of cytoskeleton|synapse|synaptic
    transmission|synaptosome
    miR- NM_013279 C11orf9 chromosome 11 open M + P + T
    145 reading frame 9
    miR- NM_024643 C14orf140 hypothetical protein P + T
    145 FLJ23093
    miR- NM_018270 C20orf20 chromosome 20 open P + T chromatin modification|nucleus|regulation of cell
    145 reading frame 20 growth|regulation of transcription, DNA-
    dependent|transcription
    miR- NM_004276 CABP1 calcium binding protein P + T calcium ion binding|calcium ion binding|enzyme
    145 1 (calbrain) inhibitor activity
    miR- NM_001755 CBFB core-binding factor, M + P + T RNA polymerase II transcription factor
    145 beta subunit activity|nucleus|transcription coactivator
    activity|transcription factor activity|transcription from
    RNA polymerase II promoter
    miR- NM_001759 CCND2 cyclin D2 P + T cytokinesis|nucleus|regulation of cell cycle
    145
    miR- NM_020307 CCNL1 cyclin L ania-6a M + P + T cell cycle|regulation of cell cycle
    145
    miR- AL118798 CD47 CD47 antigen (Rh- P + T cell-matrix adhesion|integral to plasma
    145 related antigen, membrane|integrin-mediated signaling
    integrin-associated pathway|plasma membrane|protein binding
    signal transducer)
    miR- BF576053 CFL2 cofilin 2 (muscle) M + P + T actin binding|cytoskeleton|nucleus
    145
    miR- AA835485 CKLiK CamKI-like protein P + T ATP binding|calcium- and calmodulin-dependent
    145 kinase protein kinase activity|calmodulin
    binding|nucleus|protein amino acid
    phosphorylation|protein serine/threonine kinase
    activity|transferase activity
    miR- NM_004921 CLCA3 chloride channel, P + T extracellular space|transport|transporter activity
    145 calcium activated,
    family member 3
    miR- NM_001326 CSTF3 cleavage stimulation M + P + T RNA binding|binding|mRNA cleavage|mRNA
    145 factor, 3′ pre-RNA, polyadenylylation|nucleus
    subunit
    3, 77 kDa
    miR- NM_020248 CTNNBIP1 catenin, beta interacting P + T Wnt receptor signaling pathway|beta-catenin
    145 protein 1 binding|cell
    proliferation|development|nucleus|regulation of
    transcription, DNA-dependent|signal transduction
    miR- AW772082 DACH dachshund homolog P + T DNA binding|development|eye morphogenesis (sensu
    145 (Drosophila) Endopterygota)|nucleus|regulation of transcription,
    DNA-dependent|transcription
    miR- NM_004393 DAG1 dystroglycan 1 M + P + T actin cytoskeleton|calcium ion binding|extracellular
    145 (dystrophin-associated matrix (sensu Metazoa)|integral to plasma
    glycoprotein 1) membrane|laminin receptor activity|membrane
    fraction|muscle contraction|plasma membrane|protein
    binding|protein complex assembly
    miR- NM_003887 DDEF2 development and P + T GTPase activator activity|Golgi apparatus|regulation
    145 differentiation of GTPase activity
    enhancing factor
    2
    miR- AL080239 DKFZp547M2010 hypothetical protein M + P + T
    145 DKFZp547M2010
    miR- AL137517 DKFZp564O1278 hypothetical protein P + T integral to membrane
    145 DKFZp564O1278
    miR- NM_001386 DPYSL2 dihydropyrimidinase- P + T dihydropyrimidinase activity|hydrolase
    145 like 2 activity|neurogenesis|nucleobase, nucleoside,
    nucleotide and nucleic acid metabolism|signal
    transduction
    miR- BC003143 DUSP6 dual specificity P + T MAP kinase phosphatase activity|cytoplasm|hydrolase
    145 phosphatase 6 activity|inactivation of MAPK|protein amino acid
    dephosphorylation|protein serine/threonine
    phosphatase activity|protein tyrosine phosphatase
    activity|regulation of cell cycle|soluble fraction
    miR- D86550 DYRK1A dual-specificity P + T ATP binding|neurogenesis|nucleus|protein amino acid
    145 tyrosine-(Y)- phosphorylation|protein serine/threonine kinase
    phosphorylation activity|protein-tyrosine kinase activity|transferase
    regulated kinase 1A activity
    miR- NM_001967 EIF4A2 eukaryotic translation M + P + T ATP binding|ATP-dependent helicase activity|DNA
    145 initiation factor 4A, binding|RNA binding|eukaryotic translation initiation
    isoform
    2 factor 4F complex|hydrolase activity|protein
    biosynthesis|regulation of translational
    initiation|translation initiation factor activity
    miR- NM_001417 EIF4B eukaryotic translation M + T RNA binding|eukaryotic translation initiation factor
    145 initiation factor 4B 4F complex|nucleic acid binding|nucleotide
    binding|protein biosynthesis|regulation of translational
    initiation|translation initiation factor
    activity|translation initiation factor activity
    miR- BC005057 EIF4EBP2 eukaryotic translation P + T eukaryotic initiation factor 4E binding|negative
    145 initiation factor 4E regulation of protein biosynthesis|negative regulation
    binding protein
    2 of translational initiation|regulation of translation
    miR- NM_020909 EPB41L5 erythrocyte membrane P + T binding|cytoplasm|cytoskeletal protein
    145 protein band 4.1 like 5 binding|cytoskeleton|membrane
    miR- NM_005797 EVA1 epithelial V-like antigen 1 P + T cell adhesion|cytoskeleton|homophilic cell
    145 adhesion|integral to
    membrane|membrane|morphogenesis|protein binding
    miR- NM_022977 FACL4 fatty-acid-Coenzyme A M + P + T fatty acid metabolism|integral to membrane|learning
    145 ligase, long-chain 4 and/or memory|ligase activity|lipid metabolism|long-
    chain-fatty-acid-CoA ligase activity|magnesium ion
    binding|metabolism
    miR- AL042120 FHOD2 formin homology 2 M + P Rho GTPase binding|actin binding|actin cytoskeleton
    145 domain containing 2 organization and biogenesis|cell organization and
    biogenesis|nucleus|regulation of transcription, DNA-
    dependent|transcription factor activity|translation
    initiation factor activity|translational initiation
    miR- NM_002013 FKBP3 FK506 binding protein P + T FK506 binding|isomerase activity|nucleus|peptidyl-
    145 3, 25 kDa prolyl cis-trans isomerase activity|protein
    folding|receptor activity
    miR- NM_002017 FLI1 Friend leukemia virus M + P + T hemostasis|nucleus|organogenesis|regulation of
    145 integration 1 transcription, DNA-
    dependent|transcription|transcription factor activity
    miR- NM_023071 FLJ13117 hypothetical protein P + T
    145 FLJ13117
    miR- AL561281 FLJ20373 hypothetical protein M + P + T ATP binding|cellular_component unknown|protein
    145 FLJ20373 amino acid phosphorylation|protein kinase
    cascade|protein serine/threonine kinase
    activity|response to stress|signal transduction|small
    GTPase regulator activity|transferase activity
    miR- AK025444 FLJ21791 hypothetical protein M + T
    145 FLJ21791
    miR- NM_024713 FLJ22557 hypothetical protein P + T
    145 FLJ22557
    miR- AA872588 FLJ36155 likely ortholog of P + T DNA binding|negative regulation of transcription
    145 mouse Gli-similar 1 from RNA polymerase II promoter|nucleus|positive
    Kruppel-like zinc finger regulation of transcription from RNA polymerase II
    (Glis1) promoter|regulation of transcription, DNA-
    dependent|specific RNA polymerase II transcription
    factor activity|transcription|zinc ion binding
    miR- AI434509 FLJ38499 Unnamed protein P + T nucleic acid binding
    145 product [Homo
    sapiens], mRNA
    sequence
    miR- M62994 FLNB filamin B, beta (actin P + T actin binding|actin binding|actin cytoskeleton|actin
    145 binding protein 278) cytoskeleton organization and biogenesis|cell
    differentiation|cytoskeletal anchoring|integral to
    plasma membrane|myogenesis|signal transduction
    miR- NM_002025 FMR2 fragile X mental M + T brain development|learning and/or memory
    145 retardation 2
    miR- N29672 FOS v-fos FBJ murine M + T proto-oncogene
    145 osteosarcoma viral
    oncogene homolog
    miR- NM_002015 FOX01A forkhead box O1A M + P + T anti-apoptosis|nucleus|regulation of transcription from
    145 (rhabdomyosarcoma) RNA polymerase II
    promoter|transcription|transcription factor activity
    miR- NM_003507 FZD7 frizzled homolog 7 M + P + T G-protein coupled receptor activity|G-protein coupled
    145 (Drosophila) receptor protein signaling pathway|Wnt receptor
    activity|development|frizzled signaling
    pathway|integral to membrane|plasma membrane
    miR- AL049709 GGTL3 gamma- M + P + T
    145 glutamyltransferase-like 3
    miR- NM_022735 GOCAP1 golgi complex M + P + T Golgi apparatuslacyl-CoA binding|catalytic
    145 associated protein 1, activity|intracellular protein
    60 kDa transport|membrane|mitochondrion|protein carrier
    activity|steroid biosynthesis
    miR- NM_020806 GPHN gephyrin P + T Mo-molybdopterin cofactor biosynthesis|catalytic
    145 activity|cytoskeleton
    miR- NM_015071 GRAF GTPase regulator P + T Rho GTPase activator activitylactin cytoskeleton
    145 associated with focal organization and biogenesis|cellular_component
    adhesion kinase unknown|neurogenesis
    pp125(FAK)
    miR- NM_017913 HARC Hsp90-associating P + T cytokinesis|regulation of cell cycle
    145 relative of Cdc37
    miR- BC006237 HECTD1 HECT domain M + T intracellular|ligase activity|receptor activity|ubiquitin
    145 containing 1 cycle|ubiquitin-protein ligase activity
    miR- U64317 HEF1 enhancer of P + T actin filament bundle formation|cell
    145 filamentation 1 (cas-like adhesion|cytokinesis|cytoplasm|cytoskeleton|
    docking; Crk-associated cytoskeleton organization and biogenesis|integrin-
    substrate related) mediated signaling pathway|mitosis|nucleus|
    protein binding|regulation of cell cycle|regulation
    of cell growth|signal transduction|spindle
    miR- NM_016258 HGRG8 high-glucose-regulated P + T
    145 protein 8
    miR- AL162003 HIC2 hypermethylated in P + T DNA binding|negative regulation of transcription,
    145 cancer 2 DNA-dependent|nucleus|protein C-terminus
    binding|transcription|zinc ion binding
    miR- NM_014212 HOXC11 homeo box C11 M + P + T RNA polymerase II transcription factor
    145 activity|development|endoderm
    development|nucleus|regulation of transcription,
    DNA-dependent|transcription factor activity
    miR- NM_002193 INHBB inhibin, beta B (activin M + P + T cell differentiation|cytokine activity|defense
    145 AB beta polypeptide) response|extracellular region|growth|growth factor
    activity|hormone activity|host cell surface receptor
    binding|negative regulation of follicle-stimulating
    hormone secretion|negative regulation of hepatocyte
    growth factor biosynthesis|ovarian follicle
    development|positive regulation of follicle-
    stimulating hormone secretion|protein binding|protein
    homodimerization activity|response to external
    stimulus
    miR- NM_005544 IRS1 insulin receptor M + P + T cytoplasm|insulin receptor binding|protein
    145 substrate 1 binding|signal transducer activity|signal
    transduction|transmembrane receptor protein tyrosine
    kinase docking protein activity
    miR- NM_006459 KEO4 similar to P + T catalytic activity
    145 Caenorhabditis elegans
    protein C42C1.9
    miR- NM_014686 KIAA0355 KIAA0355 gene P + T
    145 product
    miR- NM_015176 KIAA0483 KIAA0483 protein P + T ubiquitin cycle
    145
    miR- NM_014871 KIAA0710 KIAA0710 gene M + P + T cysteine-type endopeptidase activity|exonuclease
    145 product activity|nucleus|ubiquitin cycle|ubiquitin thiolesterase
    activity|ubiquitin-dependent protein catabolism
    miR- AA772278 KIAA1673 KIAA1673 M + P + T
    145
    miR- AB051495 KIAA1708 KIAA1708 protein P + T ATP binding|microtubule associated
    145 complex|microtubule motor activity|microtubule-
    based movement
    miR- AI814587 KIAA1715 KIAA1715 protein M + T
    145
    miR- AI187364 KIAA1894 KIAA1894 protein P + T integral to membrane
    145
    miR- AF155117 KIF21A kinesin family member P + T ATP binding|microtubule associated
    145 21A complex|microtubule motor activity|microtubule-
    based movement
    miR- NM_004235 KLF4 Kruppel-like factor 4 M + T mesodermal cell fate determination|negative
    145 (gut) regulation of cell proliferation|negative regulation of
    transcription, DNA-dependent|negative regulation of
    transcription, DNA-dependent|nucleic acid
    binding|nucleus|transcription|transcription factor
    activity|transcription factor activity|transcriptional
    activator activity|transcriptional activator
    activity|transcriptional repressor
    activity|transcriptional repressor activity|zinc ion
    binding|zinc ion binding
    miR- T68150 LL5beta hypothetical protein M + T
    145 FLJ21791
    miR- AI797833 LOC285148 a disintegrin and P + T catalytic activity
    145 metalloproteinase
    domain 17 (tumor
    necrosis factor, alpha,
    converting enzyme)
    miR- NM_025146 MAK3P likely ortholog of P + T N-acetyltransferase activity
    145 mouse Mak3p homolog
    (S. cerevisiae)
    miR- BF971923 MAP3K3 mitogen-activated M + P ATP binding|MAP kinase kinase kinase
    145 protein kinase kinase activity|MAPKKK cascade|magnesium ion
    kinase
    3 binding|positive regulation of I-kappaB kinase/NF-
    kappaB cascade|protein amino acid
    phosphorylation|protein kinase activity|protein
    serine/threonine kinase activity|signal transducer
    activity|transferase activity
    miR- NM_004834 MAP4K4 mitogen-activated M + P + T ATP binding|cellular_component unknown|protein
    145 protein kinase kinase amino acid phosphorylation|protein kinase
    kinase kinase 4 cascade|protein serine/threonine kinase
    activity|response to stress|signal transduction|small
    GTPase regulator activity|transferase activity
    miR- BF382281 MGC10120 Homo sapiens cDNA P + T
    145 FLJ30135 fis, clone
    BRACE2000061,
    mRNA sequence
    miR- BG231756 MGC10986 hypothetical protein M + P ATP binding|MAP kinase kinase kinase
    145 MGC10986 activity|MAPKKK cascade|magnesium ion
    binding|positive regulation of I-kappaB kinase/NF-
    kappaB cascade|protein amino acid
    phosphorylation|protein kinase activity|protein
    serine/threonine kinase activity|signal transducer
    activity|transferase activity
    miR- BC004869 MGC2817 hypothetical protein P + T outer membrane|protein transport
    145 MGC2817
    miR- BC002712 MYCN v-myc M + T chromatin|nucleus|protein binding|regulation of
    145 myelocytomatosis viral transcription from RNA polymerase II
    related oncogene, promoter|transcription factor activity
    neuroblastoma derived
    (avian)
    miR- AB007899 NEDD4L neural precursor cell P + T excretion|intracellular|intracellular|ligase
    145 expressed, activity|positive regulation of endocytosis|protein
    developmentally down- binding|protein ubiquitination|regulation of protein
    regulated 4-like catabolism|response to metal ion|sodium channel
    regulator activity|sodium ion homeostasis|sodium ion
    transport|ubiquitin cycle|ubiquitin-protein ligase
    activity|ubiquitin-protein ligase activity|water
    homeostasis
    miR- NM_005863 NET1 neuroepithelial cell P + T guanyl-nucleotide exchange factor
    145 transforming gene 1 activity|nucleus|regulation of cell growth|signal
    transduction
    miR- NM_003204 NFE2L1 nuclear factor P + T DNA binding|heme biosynthesis|inflammatory
    145 (erythroid-derived 2)- response|morphogenesis|nucleus|nucleus|regulation of
    like 1 transcription, DNA-
    dependent|transcription|transcription cofactor
    activity|transcription factor activity|transcription from
    RNA polymerase II promoter
    miR- NM_006469 NS1-BP NS1-binding protein M + P + T RNA splicing|protein binding|response to
    145 virus|spliceosome complex|transcription factor
    complex|transcription from RNA polymerase III
    promoter
    miR- NM_019094 NUDT4 nudix (nucleoside P + T calcium-mediated signaling|cyclic nucleotide
    145 diphosphate linked metabolism|cyclic-nucleotide-mediated
    moiety X)-type motif 4 signaling|diphosphoinositol-polyphosphate
    diphosphatase activity|hydrolase
    activity|intracellular|intracellular signaling
    cascade|intracellular transport|magnesium ion
    binding|regulation of RNA-nucleus export
    miR- AW149417 OAZ OLF-1/EBF associated P + T nucleic acid binding|nucleus|zinc ion binding
    145 zinc finger gene
    miR- NM_024586 OSBPL9 oxysterol binding M + P lipid transport|steroid metabolism
    145 protein-like 9
    miR- AB040812 PAK7 p21(CDKN1A)- M + T ATP binding|protein amino acid
    145 activated kinase 7 phosphorylation|protein serine/threonine kinase
    activity|transferase activity
    miR- NM_014456 PDCD4 programmed cell death M + P + T apoptosis
    145 4 (neoplastic
    transformation
    inhibitor)
    miR- NM_002657 PLAGL2 pleiomorphic adenoma M + P + T nucleus|regulation of transcription, DNA-
    145 gene-like 2 dependent|transcription|transcription factor
    activity|zinc ion binding
    miR- AK023546 PLCL2 phospholipase C-like 2 P + T calcium ion binding|intracellular signaling
    145 cascade|lipid metabolism|phosphoinositide
    phospholipase C activity
    miR- AI274352 PLN phospholamban P + T
    145
    miR- NM_000944 PPP3CA protein phosphatase 3 P + T calcineurin complex|calcium ion binding|calmodulin
    145 (formerly 2B), catalytic binding|hydrolase activity|protein amino acid
    subunit, alpha isoform dephosphorylation|protein serine/threonine
    (calcineurin A alpha) phosphatase activity
    miR- BF247371 PRO1843 hypothetical protein M + T
    145 PRO1843
    miR- NM_000959 PTGFR prostaglandin F receptor P + T G-protein coupled receptor protein signaling
    145 (FP) pathway|G-protein coupled receptor protein signaling
    pathway|integral to membrane|integral to plasma
    membrane|parturition|prostaglandin F receptor
    activity|prostaglandin F receptor activity|receptor
    activity|rhodopsin-like receptor activity|signal
    transduction|thromboxane receptor activity
    miR- NM_002890 RASA1 RAS p21 protein P + T Ras GTPase activator activity|intracellular signaling
    145 activator (GTPase cascade
    activating protein) 1
    miR- NM_006506 RASA2 RAS p21 protein P + T Ras GTPase activator activity|intracellular signaling
    145 activator 2 cascade
    miR- NM_002912 REV3L REV3-like, catalytic M + P + T 3′-5′ exonuclease activity|DNA binding|DNA
    145 subunit of DNA repair|DNA replication|DNA-dependent DNA
    polymerase zeta (yeast) replication|DNA-directed DNA polymerase
    activity|nucleotide binding|nucleus|transferase
    activity|zeta DNA polymerase activity|zeta DNA
    polymerase complex
    miR- NM_002924 RGS7 regulator of G-protein P + T heterotrimeric G-protein complex|intracellular
    145 signalling 7 signaling cascade|regulation of G-protein coupled
    receptor protein signaling pathway|regulator of G-
    protein signaling activity|signal transducer activity
    miR- AL136924 RIN2 Ras and Rab interactor 2 P + T GTPase activator activity|Rab guanyl-nucleotide
    145 exchange factor activity|cellular_component
    unknown|endocytosis|intracellular signaling
    cascade|small GTPase mediated signal
    transduction|small GTPase regulator activity
    miR- BE463945 RTKN rhotekin P + T intracellular|protein binding|signal transduction|signal
    145 transduction
    miR- AF225986 SCN3A sodium channel, P + T cation channel activity|cation transport|integral to
    145 voltage-gated, type III, membrane|membrane|sodium ion transport|voltage-
    alpha polypeptide gated sodium channel activity|voltage-gated sodium
    channel complex
    miR- NM_006080 SEMA3A sema domain, P + T cell differentiation|extracellular region|neurogenesis
    145 immunoglobulin
    domain (Ig), short basic
    domain, secreted,
    (semaphorin) 3A
    miR- NM_020796 SEMA6A sema domain, P + T apoptosis|axonlaxon guidance|cell differentiation|cell
    145 transmembrane domain surface receptor linked signal
    (TM), and cytoplasmic transduction|cytoskeleton organization and
    domain, (semaphorin) biogenesis|development|integral to
    6A membrane|membrane|neurogenesis|protein
    binding|receptor activity
    miR- NM_004171 SLC1A2 solute carrier family 1 P + T L-glutamate transport|L-glutamate transporter
    145 (glial high affinity activity|dicarboxylic acid transport|integral to
    glutamate transporter), membrane|membrane|membrane
    member
    2 fraction|sodium:dicarboxylate symporter
    activity|symporter activity|synaptic
    transmission|transport
    miR- NM_003759 SLC4A4 solute carrier family 4, P + T anion transport|inorganic anion exchanger
    145 sodium bicarbonate activity|integral to membrane|integral to plasma
    cotransporter, member 4 membrane|membrane|sodium:bicarbonate symporter
    activity|transport
    miR- NM_030918 SNX27 hypothetical protein M + P + T intracellular signaling cascade|protein binding|protein
    145 My014 transport
    miR- AI360875 SOX11 SRY (sex determining M + T DNA binding|neurogenesis|nucleus|regulation of
    145 region Y)-box 11 transcription, DNA-dependent|transcription
    miR- NM_000346 SOX9 SRY (sex determining P + T DNA binding|cartilage
    145 region Y)-box 9 condensation|nucleus|regulation of transcription from
    (campomelic dysplasia, RNA polymerase II promoter|skeletal
    autosomal sex-reversal) development|specific RNA polymerase II
    transcription factor activity|transcription
    miR- AK023899 SRGAP1 SLIT-ROBO Rho P + T GTPase activator activity
    145 GTPase activating
    protein
    1
    miR- NM_003155 STC1 stanniocalcin 1 M + T calcium ion homeostasis|cell surface receptor linked
    145 signal transduction|cell-cell signaling|extracellular
    region|hormone activity|response to nutrients
    miR- BE219311 TIMM22 translocase of inner M + P + T integral to membrane|mitochondrial inner
    145 mitochondrial membrane|mitochondrion|protein transport|protein
    membrane
    22 homolog transporter activity
    (yeast)
    miR- AA705845 TLE4 transducin-like M + P frizzled signaling pathway|molecular_function
    145 enhancer of split 4 unknown|nucleus|nucleus|regulation of
    (E(sp1) homolog, transcription|regulation of transcription, DNA-
    Drosophila) dependent
    miR- BC005016 TRIM2 tripartite motif- P + T cytoplasm|myosin binding|protein
    145 containing 2 ubiquitination|ubiquitin ligase complex|ubiquitin-
    protein ligase activity|zinc ion binding
    miR- NM_025076 UXS1 UDP-glucuronate M + P + T carbohydrate metabolism|isomerase
    145 decarboxylase 1 activity|nucleotide-sugar metabolism
    miR- NM_005433 YES1 v-yes-1 Yamaguchi P + T ATP binding|intracellular signaling cascade|protein
    145 sarcoma viral oncogene amino acid phosphorylation|protein-tyrosine kinase
    homolog
    1 activity|transferase activity
    miR- BC003128 ZDHHC9 zinc finger, DHHC P + T integral to membrane|metal ion binding
    145 domain containing 9
    miR- NM_019903 ADD3 adducin 3 (gamma) P + T calmodulin binding|cytoskeleton|membrane|structural
    155 constituent of cytoskeleton
    miR- NM_020661 AICDA activation-induced P + T B-cell differentiation|cellular_component
    155 cytidine deaminase unknown|cytidine deaminase activity|hydrolase
    activity|mRNA processing|zinc ion binding
    miR- NM_007202 AKAP10 A kinase (PRKA) P + T kinase activity|mitochondrion|protein binding|protein
    155 anchor protein 10 localization|signal transducer activity|signal
    transduction
    miR- AI806395 ALFY ALFY P + T binding|zinc ion binding
    155
    miR- NM_000038 APC adenomatosis polyposis P + T Wnt receptor signaling pathway|beta-catenin
    155 coli binding|cell adhesion|microtubule binding|negative
    regulation of cell cycle|protein complex
    assembly|signal transduction
    miR- NM_017610 ARK Arkadia P + T protein ubiquitination|ubiquitin ligase
    155 complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR- BG032269 ARL8 ADP-ribosylation-like M + P + T GTP binding|small GTPase mediated signal
    155 factor 8 transduction
    miR- AB000815 ARNTL aryl hydrocarbon P + T circadian rhythm|nucleus|regulation of transcription,
    155 receptor nuclear DNA-dependent|signal transducer activity|signal
    translocator-like transduction|transcription|transcription factor activity
    miR- NM_001670 ARVCF armadillo repeat gene P + T cell adhesion|cytoskeleton|development|protein
    155 deletes in binding|structural molecule activity
    velocardiofacial
    syndrome
    miR- AK024064 ASTN2 astrotactin 2 P + T integral to membrane
    155
    miR- M95541 ATP2B1 ATPase, Ca++ M + P + T ATP binding|calcium ion binding|calcium ion
    155 transporting, plasma transport|calcium-transporting ATPase
    membrane
    1 activity|calmodulin binding|cation transport|hydrolase
    activity|hydrolase activity, acting on acid anhydrides,
    catalyzing transmembrane movement of
    substances|integral to plasma membrane|magnesium
    ion binding|membrane|metabolism
    miR- NM_001186 BACH1 BTB and CNC P + T DNA binding|nucleus|protein binding|regulation of
    155 homology 1, basic transcription, DNA-
    leucine zipper dependent|transcription|transcription factor activity
    transcription factor
    1
    miR- NM_007005 BCE-1 BCE-1 protein P + T frizzled signaling pathway|molecular_function
    155 unknown|nucleus|nucleus|regulation of
    transcription|regulation of transcription, DNA-
    dependent
    miR- NM_022893 BCL11A B-cell CLL/lymphoma P + T cytoplasm|hemopoiesis|nucleic acid
    155 11A (zinc finger binding|nucleus|nucleus|regulation of transcription,
    protein) DNA-dependent|transcription|zinc ion binding
    miR- NM_001709 BDNF brain-derived M + T growth factor activity|growth factor
    155 neurotrophic factor activity|neurogenesis
    miR- NM_014577 BRD1 bromodomain P + T DNA binding|cell cycle|nucleus|nucleus|regulation of
    155 containing 1 transcription, DNA-dependent
    miR- NM_024529 C1orf28 chromosome 1 open M + P + T
    155 reading frame 28
    miR- NM_000719 CACNA1C calcium channel, P + T calcium ion binding|calcium ion transport|cation
    155 voltage-dependent, L transport|integral to membrane|ion channel
    type, alpha 1C subunit activity|ion transport|membrane|regulation of heart
    contraction rate|voltage-gated calcium channel
    activity|voltage-gated calcium channel
    activity|voltage-gated calcium channel
    complex|voltage-gated calcium channel complex
    miR- AL118798 CD47 CD47 antigen (Rh- P + T cell-matrix adhesion|integral to plasma
    155 related antigen, membrane|integrin-mediated signaling
    integrin-associated pathway|plasma membrane|protein binding
    signal transducer)
    miR- AL564683 CEBPB CCAAT/enhancer M + P + T acute-phase response|inflammatory
    155 binding protein response|nucleus|regulation of transcription, DNA-
    (C/EBP), beta dependent|transcription|transcription factor
    activity|transcription from RNA polymerase II
    promoter
    miR- NM_007023 CGEF2 cAMP-regulated M + P 3′,5′-cAMP binding|G-protein coupled receptor
    155 guanine nucleotide protein signaling pathway|cAMP-dependent protein
    exchange factor II kinase complex|cAMP-dependent protein kinase
    regulator activity|exocytosis|guanyl-nucleotide
    exchange factor activity|membrane fraction|nucleotide
    binding|protein amino acid phosphorylation|small
    GTPase mediated signal transduction
    miR- AU152178 CMG2 capillary P + T integral to membrane|receptor activity
    155 morphogenesis protein 2
    miR- NM_005776 CNIH cornichon homolog P + T immune response|integral to membrane|intracellular
    155 (Drosophila) signaling cascade|membrane
    miR- AW241703 CNTN4 Homo sapiens cDNA P + T cell adhesion|membrane|protein binding
    155 FLJ32716 fis, clone
    TESTI2000808, highly
    similar to Rattus
    norvegicus neural cell
    adhesion protein BIG-2
    precursor (BIG-2)
    mRNA, mRNA
    sequence
    miR- NM_000094 COL7A1 collagen, type VII, P + T basement membrane|cell adhesion|collagen type
    155 alpha 1 (epidermolysis VII|cytoplasm|epidermis development|phosphate
    bullosa, dystrophic, transport|protein binding|serine-type endopeptidase
    dominant and recessive) inhibitor activity|structural molecule activity
    miR- NM_003653 COPS3 COP9 constitutive P + T signalosome complex
    155 photomorphogenic
    homolog subunit 3
    (Arabidopsis)
    miR- NM_005211 CSF1R colony stimulating M + P + T ATP binding|antimicrobial humoral response (sensu
    155 factor 1 receptor, Vertebrata)|cell proliferation|development|integral to
    formerly McDonough plasma membrane|macrophage colony stimulating
    feline sarcoma viral (v- factor receptor activity|plasma membrane|protein
    fms) oncogene homolog amino acid phosphorylation|receptor activity|signal
    transduction|transferase activity|transmembrane
    receptor protein tyrosine kinase signaling pathway
    miR- NM_001892 CSNK1A1 casein kinase 1, alpha 1 P + T ATP binding|Wnt receptor signaling pathway|casein
    155 kinase I activity|protein amino acid
    phosphorylation|protein amino acid
    phosphorylation|protein serine/threonine kinase
    activity|protein-tyrosine kinase activity|transferase
    activity
    miR- NM_005214 CTLA4 cytotoxic T- P + T immune response|immune response|integral to plasma
    155 lymphocyte-associated membrane|membrane
    protein 4
    miR- U69546 CUGBP2 CUG triplet repeat, M + P + T RNA binding|RNA binding|RNA
    155 RNA binding protein 2 processing|neuromuscular junction
    development|nucleotide binding|regulation of heart
    contraction rate
    miR- NM_030927 DC- tetraspanin similar to P + T integral to membrane
    155 TM4F2 TM4SF9
    miR- NM_015652 DKFZP564P1916 DKFZP564P1916 P + T
    155 protein
    miR- AF151831 DKFZP566C134 DKFZP566C134 P + T protein binding
    155 protein
    miR- NM_004411 DNCI1 dynein, cytoplasmic, P + T cytoplasmic dynein complex|motor activity
    155 intermediate
    polypeptide
    1
    miR- NM_001400 EDG1 endothelial P + T G-protein coupled receptor protein signaling
    155 differentiation, pathway|cell adhesion|integral to plasma
    sphingolipid G-protein- membrane|lysosphingolipid and lysophosphatidic acid
    coupled receptor, 1 receptor activity|plasma membrane|receptor
    activity|signal transduction
    miR- NM_006795 EHD1 EH-domain containing 1 P + T ATP binding|GTP binding|GTPase
    155 activity|biological_process unknown|calcium ion
    binding|cellular_component unknown
    miR- NM_012081 ELL2 ELL-related RNA M + P + T RNA elongation from RNA polymerase II
    155 polymerase II, promoter|RNA polymerase II transcription factor
    elongation factor activity|nucleus|regulation of transcription, DNA-
    dependent|transcription|transcription elongation factor
    complex
    miR- NM_005238 ETS1 v-ets erythroblastosis P + T RNA polymerase II transcription factor
    155 virus E26 oncogene activity|immune response|negative regulation of cell
    homolog 1 (avian) proliferation|nucleus|regulation of transcription,
    DNA-dependent|transcription|transcription factor
    activity|transcription from RNA polymerase II
    promoter
    miR- NM_002009 FGF7 fibroblast growth factor P + T cell proliferation|cell-cell signaling|epidermis
    155 7 (keratinocyte growth development|extracellular region|growth factor
    factor) activity|positive regulation of cell
    proliferation|regulation of cell cycle|response to
    wounding|signal transduction
    miR- NM_018208 FLJ10761 hypothetical protein P + T biological_process unknown|cellular_component
    155 FLJ10761 unknown|choline kinase activity|transferase activity
    miR- NM_018243 FLJ10849 hypothetical protein P + T GTP binding|cell cycle|cytokinesis
    155 FLJ10849
    miR- NM_022064 FLJ12565 hypothetical protein P + T ligase activity|protein ubiquitination|ubiquitin ligase
    155 FLJ12565 complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR- NM_018391 FLJ23277 FLJ23277 protein P + T
    155
    miR- NM_021078 GCN5L2 GCN5 general control M + P + T N-acetyltransferase activity|chromatin
    155 of amino-acid synthesis remodeling|histone acetyltransferase activity|histone
    5-like 2 (yeast) deacetylase binding|nucleus|protein amino acid
    acetylation|regulation of transcription from RNA
    polymerase II promoter|transcription|transcription
    coactivator activity|transferase activity
    miR- NM_018178 GPP34R hypothetical protein P + T
    155 FLJ10687
    miR- AF019214 HBP1 HMG-box containing M + P DNA binding|nucleus|regulation of transcription,
    155 protein 1 DNA-dependent
    miR- NM_006037 HDAC4 histone deacetylase 4 P + T B-cell differentiation|cell cycle|chromatin
    155 modification|cytoplasm|development|histone
    deacetylase activity|histone deacetylase
    complex|hydrolase activity|inflammatory
    response|negative regulation of
    myogenesis|neurogenesis|nucleus|regulation of
    transcription, DNA-
    dependent|transcription|transcription factor
    binding|transcriptional repressor activity
    miR- NM_001530 HIF1A hypoxia-inducible P + T RNA polymerase II transcription factor activity,
    155 factor 1, alpha subunit enhancer binding|electron transport|histone
    (basic helix-loop-helix acetyltransferase
    transcription factor) binding|homeostasis|nucleus|nucleus|protein
    heterodimerization activity|protein heterodimerization
    activity|regulation of transcription, DNA-
    dependent|response to hypoxia|signal transducer
    activity|signal transduction|signal
    transduction|transcription factor activity
    miR- AL023584 HIVEP2 human P + T
    155 immunodeficiency virus
    type I enhancer binding
    protein
    2
    miR- AI682088 HLCS holocarboxylase P + T biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-
    155 synthetase (biotin- [methylcrotonoyl-CoA-carboxylase] ligase
    [proprionyl-Coenzyme activity|biotin-[methylmalonyl-CoA-
    A-carboxylase (ATP- carboxytransferase] ligase activity|biotin-[propionyl-
    hydrolysing)] ligase) CoA-carboxylase (ATP-hydrolyzing)] ligase
    activity|ligase activity|protein modification
    miR- NM_020190 HNOEL- HNOEL-iso protein P + T
    155 iso
    miR- NM_014002 IKBKE inhibitor of kappa light P + T ATP binding|NF-kappaB-inducing kinase
    155 polypeptide gene activity|cytoplasm|immune response|positive
    enhancer in B-cells, regulation of I-kappaB kinase/NF-kappaB
    kinase epsilon cascade|protein amino acid phosphorylation|protein
    serine/threonine kinase activity|signal transducer
    activity|transferase activity
    miR- D13720 ITK IL2-inducible T-cell P + T ATP binding|cellular defense response|intracellular
    155 kinase signaling cascade|non-membrane spanning protein
    tyrosine kinase activity|protein amino acid
    phosphorylation|transferase activity
    miR- NM_002249 KCNN3 potassium P + T calcium-activated potassium channel activity|calcium-
    155 intermediate/small activated potassium channel activity|calmodulin
    conductance calcium- binding|integral to membrane|ion channel activity|ion
    activated channel, transport|membrane|membrane
    subfamily N, member 3 fraction|neurogenesis|potassium ion
    transport|potassium ion transport|small conductance
    calcium-activated potassium channel activity|synaptic
    transmission|voltage-gated potassium channel
    complex
    miR- AB033100 KIAA1274 KIAA protein (similar P + T protein tyrosine phosphatase activity
    155 to mouse paladin)
    miR- NM_017780 KIAA1416 KIAA1416 protein P + T ATP binding|chromatin|chromatin assembly or
    155 disassembly|chromatin binding|helicase
    activity|nucleus
    miR- NM_002264 KPNA1 karyopherin alpha 1 P + T NLS-bearing substrate-nucleus
    155 (importin alpha 5) import|cytoplasm|intracellular protein
    transport|nuclear localization sequence
    binding|nuclear pore|nucleus|protein binding|protein
    transporter activity|regulation of DNA recombination
    miR- AK021602 KPNA4 karyopherin alpha 4 P + T NLS-bearing substrate-nucleus
    155 (importin alpha 3) import|binding|intracellular protein
    transport|nucleus|protein transporter activity
    miR- NM_020354 LALP1 lysosomal apyrase-like M + P + T hydrolase activity
    155 protein 1
    miR- AW242408 LOC151531 Similar to uridine M + P + T cytosol|nucleoside metabolism|nucleotide
    155 phosphorylase [Homo catabolism|protein binding|transferase activity,
    sapiens], mRNA transferring glycosyl groups|type III intermediate
    sequence filament|uridine metabolism|uridine phosphorylase
    activity
    miR- NM_016210 LOC51161 g20 protein P + T
    155
    miR- NM_018557 LRP1B low density lipoprotein- P + T calcium ion binding|integral to membrane|low-density
    155 related protein 1B lipoprotein receptor activity|membrane|protein
    (deleted in tumors) transport|receptor activity|receptor mediated
    endocytosis
    miR- NM_002446 MAP3K10 mitogen-activated M + P + T ATP binding|JUN kinase kinase kinase
    155 protein kinase kinase activity|activation of
    kinase 10 JNK|autophosphorylation|induction of
    apoptosis|protein homodimerization activity|protein
    serine/threonine kinase activity|protein-tyrosine
    kinase activity|signal transduction|transferase activity
    miR- NM_003954 MAP3K14 mitogen-activated P + T ATP binding|protein amino acid
    155 protein kinase kinase phosphorylation|protein serine/threonine kinase
    kinase
    14 activity|transferase activity
    miR- AL117407 MAP3K7IP2 mitogen-activated P + T kinase activity|positive regulation of I-kappaB
    155 protein kinase kinase kinase/NF-kappaB cascade|positive regulation of I-
    kinase 7 interacting kappaB kinase/NF-kappaB cascade|signal transducer
    protein
    2 activity|signal transducer activity
    miR- NM_004992 MECP2 methyl CpG binding M + P + T DNA binding|negative regulation of transcription
    155 protein 2 (Rett from RNA polymerase II promoter|nucleus|regulation
    syndrome) of transcription, DNA-
    dependent|transcription|transcription corepressor
    activity
    miR- NM_002398 MEIS1 Meis1, myeloid M + P + T RNA polymerase II transcription factor
    155 ecotropic viral activity|nucleus|regulation of transcription, DNA-
    integration site 1 dependent|transcription factor activity
    homolog (mouse)
    miR- NM_016289 MO25 MO25 protein P + T
    155
    miR- AA621962 MYO1D myosin ID M + P + T ATP bindinglactin binding|calmodulin binding|motor
    155 activity|myosin
    miR- NM_030571 N4WBP5 likely ortholog of P + T positive regulation of I-kappaB kinase/NF-kappaB
    155 mouse Nedd4 WW cascade|signal transducer activity
    binding protein 5
    miR- NM_014903 NAV3 neuron navigator 3 P + T ATP binding|mitochondrion|nucleoside-
    155 triphosphatase activity|nucleotide binding
    miR- NM_030571 NDFIP1 likely ortholog of P + T positive regulation of I-kappaB kinase/NF-kappaB
    155 mouse Nedd4 WW cascade|signal transducer activity
    binding protein 5
    miR- NM_006599 NFAT5 nuclear factor of M + P + T RNA polymerase II transcription factor
    155 activated T-cells 5, activity|excretion|nucleus|regulation of transcription,
    tonicity-responsive DNA-dependent|signal transduction|transcription
    factor activity|transcription from RNA polymerase II
    promoter
    miR- NM_002515 NOVA1 neuro-oncological M + P + T RNA binding|RNA binding|RNA splicing|RNA
    155 ventral antigen 1 splicing|locomotory behavior|locomotory
    behavior|nucleus|synaptic transmission|synaptic
    transmission
    miR- AI373299 PANK1 pantothenate kinase 1 P + T ATP binding|coenzyme A biosynthesis|pantothenate
    155 kinase activity|transferase activity
    miR- BG110231 PAPOLA poly(A) polymerase P + T RNA binding|cytoplasm|mRNA
    155 alpha polyadenylylation|mRNA
    processing|nucleus|polynucleotide adenylyltransferase
    activity|transcription|transferase activity
    miR- NM_020403 PCDH9 protocadherin 9 M + P + T calcium ion binding|cell adhesion|homophilic cell
    155 adhesion|integral to membrane|membrane|protein
    binding
    miR- NM_002655 PLAG1 pleiomorphic adenoma P + T nucleic acid binding|nucleus|transcription factor
    155 gene 1 activity|zinc ion binding
    miR- AJ272212 PSKH1 protein serine kinase H1 P + T ATP binding|Golgi apparatus|nucleus|protein amino
    155 acid phosphorylation|protein serine/threonine kinase
    activity|transferase activity
    miR- NM_014904 Rab11- KIAA0941 protein P + T
    155 FIP2
    miR- AF322067 RAB34 RAB34, member RAS P + T GTP binding|Golgi apparatus|protein transport|small
    155 oncogene family GTPase mediated signal transduction
    miR- NM_002869 RAB6A RAB6A, member RAS M + P + T GTP binding|GTPase activity|Golgi apparatus|protein
    155 oncogene family transport|small GTPase mediated signal transduction
    miR- AL136727 RAB6C RAB6C, member RAS M + P + T GTP binding|GTPase activity|intracellular|protein
    155 oncogene family transport|response to drug|small GTPase mediated
    signal transduction
    miR- NM_002902 RCN2 reticulocalbin 2, EF- P + T calcium ion binding|endoplasmic reticulum|protein
    155 hand calcium binding binding
    domain
    miR- AJ223321 RP58 zinc finger protein 238 M + P + T
    155
    miR- NM_002968 SALL1 sal-like 1 (Drosophila) P + T morphogenesis|nucleus|regulation of transcription,
    155 DNA-dependent|transcription|transcription factor
    activity|zinc ion binding
    miR- NM_002971 SATB1 special AT-rich P + T double-stranded DNA binding|establishment and/or
    155 sequence binding maintenance of chromatin
    protein 1 (binds to architecture|nucleus|regulation of transcription, DNA-
    nuclear matrix/scaffold- dependent|transcription factor activity
    associating DNA's)
    miR- NM_003469 SCG2 secretogranin II P + T calcium ion binding|protein secretion
    155 (chromogranin C)
    miR- NM_005625 SDCBP syndecan binding P + T actin cytoskeleton organization and
    155 protein (syntenin) biogenesis|adherens junction|cytoskeletal adaptor
    activity|cytoskeleton|endoplasmic
    reticulum|interleukin-5 receptor binding|interleukin-5
    receptor complex|intracellular signaling
    cascade|metabolism|neurexin
    binding|nucleus|oxidoreductase activity|plasma
    membrane|protein binding|protein heterodimerization
    activity|protein-membrane targeting|substrate-bound
    cell migration, cell extension|synaptic
    transmission|syndecan binding
    miR- NM_000232 SGCB sarcoglycan, beta P + T cytoskeleton|cytoskeleton organization and
    155 (43 kDa dystrophin- biogenesis|integral to plasma membrane|muscle
    associated glycoprotein) development|sarcoglycan complex
    miR- NM_013257 SGKL serum/glucocorticoid P + T ATP binding|intracellular signaling cascade|protein
    155 regulated kinase-like amino acid phosphorylation|protein amino acid
    phosphorylation|protein serine/threonine kinase
    activity|protein serine/threonine kinase
    activity|protein-tyrosine kinase activity|response to
    stress|transferase activity
    miR- NM_005069 SIM2 single-minded homolog P + T cell differentiation|neurogenesis|nucleus|regulation of
    155 2 (Drosophila) transcription, DNA-dependent|signal transducer
    activity|signal transduction|transcription|transcription
    factor activity
    miR- AA927480 SKI v-ski sarcoma viral P + T
    155 oncogene homolog
    (avian)
    miR- NM_006748 SLA Src-like-adaptor P + T SH3/SH2 adaptor activity|intracellular signaling
    155 cascade
    miR- AI684141 SMARCA4 SWI/SNF related, P + T ATP binding|DNA binding|helicase activity|helicase
    155 matrix associated, actin activity|hydrolase
    dependent regulator of activity|nucleoplasm|nucleus|regulation of
    chromatin, subfamily a, transcription from RNA polymerase II
    member 4 promoter|transcription|transcription coactivator
    activity|transcription factor activity
    miR- AB005043 SOCS1 suppressor of cytokine M + P + T JAK-STAT cascade|cytoplasm|insulin-like growth
    155 signaling 1 factor receptor binding|intracellular signaling
    cascade|negative regulation of JAK-STAT
    cascade|protein kinase binding|protein kinase inhibitor
    activity|regulation of cell growth|ubiquitin cycle
    miR- NM_004232 SOCS4 suppressor of cytokine M + P JAK-STAT cascade|cytoplasm|defense
    155 signaling 4 response|intracellular signaling cascade|regulation of
    cell growth
    miR- NM_005986 SOX1 SRY (sex determining P + T DNA binding|establishment and/or maintenance of
    155 region Y)-box 1 chromatin architecture|nucleus|regulation of
    transcription, DNA-dependent|regulation of
    transcription, DNA-dependent|transcription factor
    activity
    miR- AI360875 SOX11 SRY (sex determining M + T DNA binding|neurogenesis|nucleus|regulation of
    155 region Y)-box 11 transcription, DNA-dependent|transcription
    miR- AL136780 SOX6 SRY (sex determining P + T establishment and/or maintenance of chromatin
    155 region Y)-box 6 architecture|heart development|muscle
    development|nucleus|regulation of transcription,
    DNA-dependent|transcription|transcription factor
    activity
    miR- AW470841 SP3 Sp3 transcription factor P + T DNA binding|nucleus|regulation of transcription,
    155 DNA-dependent|transcription|transcriptional activator
    activity|transcriptional repressor activity|zinc ion
    binding
    miR- BF224259 SPF30 splicing factor 30, P + T RNA splicing|RNA splicing factor activity,
    155 survival of motor transesterification
    neuron-related mechanism|apoptosis|cytoplasm|induction of
    apoptosis|spliceosome assembly|spliceosome complex
    miR- NM_003120 SPI1 spleen focus forming M + T negative regulation of transcription from RNA
    155 virus (SFFV) proviral polymerase II promoter|nucleus|regulation of
    integration oncogene transcription, DNA-
    spi1 dependent|transcription|transcription factor activity
    miR- BE676214 SSH2 slingshot 2 P + T protein amino acid dephosphorylation|protein
    155 tyrosine/serine/threonine phosphatase activity
    miR- AF159447 SUFU suppressor of fused P + T cell cycle|cytoplasm|development|negative regulation
    155 homolog (Drosophila) of cell cycle|nucleus|proteolysis and
    peptidolysis|signal transducer activity|signal
    transduction|skeletal development|transcription
    corepressor activity
    miR- NM_006754 SYPL synaptophysin-like M + P + T integral to plasma membrane|membrane|synaptic
    155 protein transmission|synaptic vesicle|transport|transporter
    activity
    miR- NM_006286 TFDP2 transcription factor Dp- P + T DNA metabolism|nucleus|regulation of cell
    155 2 (E2F dimerization cycle|regulation of transcription from RNA
    partner 2) polymerase II promoter|transcription|transcription
    cofactor activity|transcription factor
    activity|transcription factor complex
    miR- AA705845 TLE4 transducin-like P + T frizzled signaling pathway|molecular_function
    155 enhancer of split 4 unknown|nucleus|nucleus|regulation of
    (E(sp1) homolog, transcription|regulation of transcription, DNA-
    Drosophila) dependent
    miR- NM_014765 TOMM20 translocase of outer P + T integral to membrane|mitochondrial outer membrane
    155 mitochondrial translocase complex|mitochondrion|outer
    membrane 20 (yeast) membrane|protein translocase activity|protein-
    homolog mitochondrial targeting
    miR- AW341649 TP53INP1 tumor protein p53 P + T apoptosis|nucleus
    155 inducible nuclear
    protein
    1
    miR- BC005016 TRIM2 tripartite motif- P + T cytoplasm|myosin binding|protein
    155 containing 2 ubiquitination|ubiquitin ligase complex|ubiquitin-
    protein ligase activity|zinc ion binding
    miR- AA524505 TSGA zinc finger protein P + T nucleus
    155
    miR- AW157525 TSGA14 testis specific, 14 M + P + T centrosome
    155
    miR- X62048 WEE1 WEE1 homolog (S. pombe) P + T ATP binding|cytokinesis|mitosis|nucleus|protein
    155 amino acid phosphorylation|protein serine/threonine
    kinase activity|protein-tyrosine kinase
    activity|regulation of cell cycle|transferase activity
    miR- AC005539 WUGSC:H_NH0335J18.1 Similar to uridine M + P + T
    155 phosphorylase [Homo
    sapiens], mRNA
    sequence
    miR- NM_003413 ZIC3 Zic family member 3 P + T DNA binding|determination of left/right
    155 heterotaxy 1 (odd- symmetry|nucleus|regulation of transcription, DNA-
    paired homolog, dependent|transcription|zinc ion binding
    Drosophila)
    miR- NM_007345 ZNF236 zinc finger protein 236 P + T nucleus|regulation of transcription, DNA-
    155 dependent|transcription|transcription factor
    activity|zinc ion binding
    miR- NM_006352 ZNF238 zinc finger protein 238 M + P + T chromosome organization and biogenesis (sensu
    155 Eukaryota)|negative regulation of transcription from
    RNA polymerase II promoter|nuclear
    chromosome|nucleic acid binding|nucleus|protein
    binding|protein binding|regulation of transcription,
    DNA-dependent|specific RNA polymerase II
    transcription factor activity|transcription|transcription
    factor activity|transport|zinc ion binding
    miR-21 NM_005164 ABCD2 ATP-binding cassette, M + P ATP binding|ATP-binding cassette (ABC) transporter
    sub-family D (ALD), complex|ATPase activity|ATPase activity, coupled to
    member 2 transmembrane movement of substances|fatty acid
    metabolism|integral to plasma
    membrane|membrane|peroxisome|transport
    miR-21 NM_001616 ACVR2 activin A receptor, type P + T ATP binding|integral to plasma
    II membrane|membrane|protein amino acid
    phosphorylation|receptor activity|transferase
    activity|transforming growth factor beta receptor
    activity|transmembrane receptor protein
    serine/threonine kinase signaling pathway
    miR-21 NM_015339 ADNP activity-dependent P + T nucleus|regulation of transcription, DNA-
    neuroprotector dependent|transcription factor activity|zinc ion
    binding
    miR-21 AI990366 ARHGEF7 Rho guanine nucleotide P + T guanyl-nucleotide exchange factor activity|signal
    exchange factor (GEF) 7 transduction
    miR-21 NM_017610 ARK Arkadia P + T protein ubiquitination|ubiquitin ligase
    complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR-21 NM_014034 ASF1A DKFZP547E2110 P + T chromatin binding|loss of chromatin silencing|nucleus
    protein
    miR-21 NM_017680 ASPN asporin (LRR class 1) P + T
    miR-21 NM_000657 BCL2 B-cell CLL/lymphoma 2 P + T anti-apoptosis|endoplasmic reticulum|humoral
    immune response|integral to
    membrane|membrane|mitochondrial outer
    membrane|mitochondrial outer
    membrane|mitochondrion|negative regulation of cell
    proliferation|nucleus|protein binding|regulation of
    apoptosis|regulation of cell cycle|release of
    cytochrome c from mitochondria
    miR-21 NM_014577 BRD1 bromodomain P + T DNA binding|cell cycle|nucleus|nucleus|regulation of
    containing 1 transcription, DNA-dependent
    miR-21 AA902767 BRD2 bromodomain P + T nucleus|protein serine/threonine kinase
    containing 2 activity|spermatogenesis
    miR-21 NM_014962 BTBD3 BTB (POZ) domain P + T protein binding
    containing 3
    miR-21 NM_006763 BTG2 BTG family, member 2 P + T DNA repair|negative regulation of cell
    proliferation|regulation of transcription, DNA-
    dependent|transcription|transcription factor activity
    miR-21 AK025768 C20orf99 chromosome 20 open P + T nucleic acid binding
    reading frame 99
    miR-21 AI671238 CAPN3 Homo sapiens cDNA P + T calcium ion binding|calpain activity|calpain
    FLJ23750 fis, clone activity|intracellular|intracellular|muscle
    HEP16527, mRNA development|proteolysis and peptidolysis|proteolysis
    sequence and peptidolysis|signal transducer activity
    miR-21 NM_002981 CCL1 chemokine (C-C motif) P + T calcium ion homeostasis|cell-cell signaling|chemokine
    ligand
    1 activity|chemotaxis|extracellular space|inflammatory
    response|sensory perception|signal transduction|viral
    life cycle
    miR-21 BF939071 CCM1 cerebral cavernous M + P binding|catalytic activity|cytoskeleton|small GTPase
    malformations
    1 mediated signal transduction|small GTPase regulator
    activity
    miR-21 NM_001789 CDC25A cell division cycle 25A AP + T cell proliferation|cytokinesis|hydrolase
    activity|intracellular|mitosis|protein amino acid
    dephosphorylation|protein tyrosine phosphatase
    activity|regulation of cyclin dependent protein kinase
    activity
    miR-21 NM_001842 CNTFR ciliary neurotrophic M + P + T ciliary neurotrophic factor receptor activity|cytokine
    factor receptor binding|extrinsic to membrane|neurogenesis|receptor
    activity|signal transduction
    miR-21 NM_001310 CREBL2 cAMP responsive P + T nucleus|regulation of transcription, DNA-
    element binding dependent|signal
    protein-like 2 transduction|transcription|transcription factor activity
    miR-21 NM_016441 CRIM1 cysteine-rich motor M + P + T insulin-like growth factor receptor activity|integral to
    neuron 1 membrane|membrane fraction|neurogenesis|serine-
    type endopeptidase inhibitor activity
    miR-21 NM_015396 DKFZP434A043 DKFZP434A043 P + T cell adhesion|cytoskeleton|mitotic chromosome
    protein condensation|protein binding|structural molecule
    activity
    miR-21 AL047650 DKFZp434A2417 endozepine-related P + T acyl-CoA binding
    protein precursor
    miR-21 AB028628 DKFZP547E2110 DKFZP547E2110 P + T chromatin binding|loss of chromatin silencing|nucleus
    protein
    miR-21 NM_031305 DKFZP564B1162 hypothetical protein P + T GTPase activator activity
    DKFZp564B1162
    miR-21 NM_004405 DLX2 distal-less homeo box 2 P + T brain development|development|nucleus|regulation of
    transcription, DNA-dependent|transcription factor
    activity
    miR-21 NM_001949 E2F3 E2F transcription factor 3 M + P + T nucleus|protein binding|regulation of cell
    cycle|regulation of transcription, DNA-
    dependent|transcription|transcription factor
    activity|transcription factor complex|transcription
    initiation from RNA polymerase II promoter
    miR-21 NM_006795 EHD1 EH-domain containing 1 P + T ATP binding|GTP binding|GTPase
    activity|biological_process unknown|calcium ion
    binding|cellular_component unknown
    miR-21 NM_001412 EIF1A eukaryotic translation P + T RNA binding|eukaryotic translation initiation factor
    initiation factor 1A 4F complex|protein biosynthesis|translation initiation
    factor activity|translational initiation|translational
    initiation
    miR-21 AI832074 EIF2C2 eukaryotic translation P + T cellular_component unknown|protein
    initiation factor
    2C, 2 biosynthesis|translation initiation factor activity
    miR-21 NM_006874 ELF2 E74-like factor 2 (ets P + T nucleus|nucleus|protein binding|protein
    domain transcription binding|regulation of transcription from RNA
    factor) polymerase II promoter|regulation of transcription,
    DNA-dependent|transcription factor
    activity|transcriptional activator
    activity|transcriptional activator activity
    miR-21 NM_004438 EPHA4 EphA4 P + T ATP binding|ephrin receptor activity|integral to
    plasma membrane|membrane|protein amino acid
    phosphorylation|receptor activity|signal
    transduction|transferase activity|transmembrane
    receptor protein tyrosine kinase signaling pathway
    miR-21 BE888593 FLJ11220 hypothetical protein P + T
    FLJ11220
    miR-21 NM_017637 FLJ20043 hypothetical protein P + T nucleic acid binding|nucleus|zinc ion binding
    FLJ20043
    miR-21 AF019214 HBP1 HMG-box containing M + P + T DNA binding|nucleus|regulation of transcription,
    protein 1 DNA-dependent
    miR-21 NM_000214 JAG1 jagged 1 (Alagille M + P + T Notch binding|Notch signaling
    syndrome) pathway|angiogenesis|calcium ion binding|calcium
    ion binding|cell communication|cell fate
    determination|development|endothelial cell
    differentiation|extracellular region|growth factor
    activity|hemopoiesis|integral to plasma
    membrane|keratinocyte
    differentiation|membrane|myoblast
    differentiation|neurogenesis|regulation of cell
    migration|regulation of cell proliferation|structural
    molecule activity
    miR-21 NM_002232 KCNA3 potassium voltage-gated M + P + T cation transport|delayed rectifier potassium channel
    channel, shaker-related activity|integral to membrane|membrane|membrane
    subfamily, member 3 fraction|potassium ion transport|voltage-gated
    potassium channel complex
    miR-21 NM_014766 KIAA0193 KIAA0193 gene P + T cellular_component unknown|dipeptidase
    product activity|exocytosis|proteolysis and peptidolysis
    miR-21 NM_014912 KIAA0940 KIAA0940 protein M + P + T nucleic acid binding
    miR-21 NM_014952 KIAA0945 KIAA0945 protein P + T DNA binding
    miR-21 NM_017780 KIAA1416 KIAA1416 protein P + T ATP binding|chromatin|chromatin assembly or
    disassembly|chromatin binding|helicase
    activity|nucleus
    miR-21 AB040901 KIAA1468 KIAA1468 protein P + T binding|mitotic chromosome condensation
    miR-21 U90268 Krit1 cerebral cavernous M + P binding|catalytic activity|cytoskeleton|small GTPase
    malformations
    1 mediated signal transduction|small GTPase regulator
    activity
    miR-21 BF591611 LOC147632 hypothetical protein P + T oxidoreductase activity|zinc ion binding
    BC010734
    miR-21 NM_005904 MADH7 MAD, mothers against P + T intracellular|protein binding|receptor signaling protein
    decapentaplegic serine/threonine kinase signaling protein
    homolog 7 (Drosophila) activity|regulation of transcription, DNA-
    dependent|response to
    stress|transcription|transforming growth factor beta
    receptor signaling pathway|transforming growth
    factor beta receptor, inhibitory cytoplasmic mediator
    activity
    miR-21 NM_025146 MAK3P likely ortholog of P + T N-acetyltransferase activity
    mouse Mak3p homolog
    (S. cerevisiae)
    miR-21 NM_014319 MAN1 integral inner nuclear P + T integral to membrane|integral to nuclear inner
    membrane protein membrane|membrane fraction|nuclear
    membrane|nucleotide binding
    miR-21 AW025150 MAP3K12 mitogen-activated M + T ATP binding|JNK cascade|cytoplasm|magnesium ion
    protein kinase kinase binding|plasma membrane|protein amino acid
    kinase 12 phosphorylation|protein kinase cascade|protein
    serine/threonine kinase activity|protein-tyrosine
    kinase activity|transferase activity
    miR-21 NM_012325 MAPRE1 microtubule-associated P + T cell proliferation|cytokinesis|microtubule
    protein, RP/EB family, binding|mitosis|protein C-terminus binding|regulation
    member
    1 of cell cycle
    miR-21 NM_002380 MATN2 matrilin 2 P + T biological_process unknown|calcium ion
    binding|extracellular matrix (sensu Metazoa)
    miR-21 NM_018834 MATR3 matrin 3 M + P + T RNA binding|nuclear inner membrane|nucleotide
    binding|nucleus|structural molecule activity|zinc ion
    binding
    miR-21 NM_021038 MBNL1 muscleblind-like M + P + T cytoplasm|double-stranded RNA binding|embryonic
    (Drosophila) development (sensu Mammalia)|embryonic limb
    morphogenesis|muscle development|myoblast
    differentiation|neurogenesis|nucleic acid
    binding|nucleus|nucleus
    miR-21 AI139252 MGC16063 ribosomal protein L35a P + T JAK-STAT cascadelacute-phase response|calcium ion
    binding|cell
    motility|cytoplasm|hematopoietin/interferon-class
    (D200-domain) cytokine receptor signal transducer
    activity|intracellular signaling cascade|negative
    regulation of transcription from RNA polymerase II
    promoter|neurogenesis|nucleus|nucleus|regulation of
    transcription, DNA-dependent|signal transducer
    activity|transcription|transcription factor
    activity|transcription factor activity
    miR-21 BC004162 MGC2452 hypothetical protein P + T fatty acid metabolism|generation of precursor
    MGC2452 metabolites and energy|ligand-dependent nuclear
    receptor activity|lipid
    metabolism|nucleus|nucleus|regulation of
    transcription, DNA-dependent|steroid hormone
    receptor activity|transcription|transcription factor
    activity|transcription factor activity|transcription from
    RNA polymerase II promoter
    miR-21 NM_024052 MGC3048 hypothetical protein P + T
    MGC3048
    miR-21 AB049636 MRPL9 mitochondrial P + T mitochondrion|protein
    ribosomal protein L9 biosynthesis|ribosome|structural constituent of
    ribosome
    miR-21 NM_015678 NBEA neurobeachin P + T Golgi trans face|cytosol|endomembrane
    system|plasma membrane|post-Golgi
    transport|postsynaptic membrane|protein kinase A
    binding
    miR-21 AI700518 NFIB nuclear factor I/B M + T DNA replication|nucleus|nucleus|regulation of
    transcription, DNA-
    dependent|transcription|transcription factor
    activity|transcription factor activity
    miR-21 NM_002527 NTF3 neurotrophin 3 M + P anti-apoptosis|cell motility|cell-cell signaling|growth
    factor activity|neurogenesis|signal transduction
    miR-21 U24223 PCBP1 poly(rC) binding M + P + T RNA binding|catalytic activity|cytoplasm|mRNA
    protein
    1 metabolism|nucleus|ribonucleoprotein
    complex|single-stranded DNA binding
    miR-21 NM_005016 PCBP2 poly(rC) binding M + T DNA binding|RNA binding|cytoplasm|mRNA
    protein
    2 metabolism|nucleic acid
    binding|nucleus|ribonucleoprotein complex
    miR-21 NM_014456 PDCD4 programmed cell death P + T apoptosis
    4 (neoplastic
    transformation
    inhibitor)
    miR-21 AF338650 PDZD2 PDZ domain containing 2 P + T
    miR-21 NM_000325 PITX2 paired-like M + P + T determination of left/right
    homeodomain symmetry|development|nucleus|organogenesis|
    transcription factor 2 regulation of transcription, DNA-dependent|
    transcription factor activity
    miR-21 NM_002655 PLAG1 pleiomorphic adenoma P + T nucleic acid binding|nucleus|transcription factor
    gene
    1 activity|zinc ion binding
    miR-21 NM_005036 PPARA peroxisome P + T fatty acid metabolism|generation of precursor
    proliferative activated metabolites and energy|ligand-dependent nuclear
    receptor, alpha receptor activity|lipid
    metabolism|nucleus|nucleus|regulation of
    transcription, DNA-dependent|steroid hormone
    receptor activity|transcription|transcription factor
    activity|transcription factor activity|transcription from
    RNA polymerase II promoter
    miR-21 NM_002711 PPP1R3A protein phosphatase 1, P + T carbohydrate metabolism|glycogen
    regulatory (inhibitor) metabolism|hydrolase activity|integral to
    subunit 3A (glycogen membrane|phosphoprotein phosphatase activity|type 1
    and sarcoplasmic serine/threonine specific protein phosphatase inhibitor
    reticulum binding activity
    subunit, skeletal
    muscle)
    miR-21 NM_000944 PPP3CA protein phosphatase 3 P + T calcineurin complex|calcium ion binding|calmodulin
    (formerly 2B), catalytic binding|hydrolase activity|protein amino acid
    subunit, alpha isoform dephosphorylation|protein serine/threonine
    (calcineurin A alpha) phosphatase activity
    miR-21 NM_018569 PRO0971 hypothetical protein P + T
    PRO0971
    miR-21 AA156948 PRPF4B PRP4 pre-mRNA M + T ATP binding|RNA splicing|nuclear mRNA splicing,
    processing factor 4 via spliceosome|nucleus|protein amino acid
    homolog B (yeast) phosphorylation|protein serine/threonine kinase
    activity|transferase activity
    miR-21 BF337790 PURB purine-rich element M + P + T
    binding protein B
    miR-21 NM_002869 RAB6A RAB6A, member RAS P + T GTP binding|GTPase activity|Golgi apparatus|protein
    oncogene family transport|small GTPase mediated signal transduction
    miR-21 AL136727 RAB6C RAB6C, member RAS P + T GTP binding|GTPase activity|intracellular|protein
    oncogene family transport|response to drug|small GTPase mediated
    signal transduction
    miR-21 NM_002890 RASA1 RAS p21 protein P + T Ras GTPase activator activity|intracellular signaling
    activator (GTPase cascade
    activating protein) 1
    miR-21 NM_005739 RASGRP1 RAS guanyl releasing P + T Ras guanyl-nucleotide exchange factor activity|Ras
    protein 1 (calcium and protein signal transduction|calcium ion
    DAG-regulated) binding|calcium ion binding|diacylglycerol
    binding|guanyl-nucleotide exchange factor
    activity|membrane fraction|small GTPase mediated
    signal transduction
    miR-21 NM_021111 RECK reversion-inducing- M + P + T cell cycle|membrane|membrane
    cysteine-rich protein fraction|metalloendopeptidase inhibitor
    with kazal motifs activity|negative regulation of cell cycle|serine-type
    endopeptidase inhibitor activity
    miR-21 NM_006915 RP2 retinitis pigmentosa 2 P + T beta-tubulin folding|membrane|sensory
    (X-linked recessive) perception|unfolded protein binding|visual perception
    miR-21 AA906056 RPS6KA3 ribosomal protein S6 M + T ATP binding|central nervous system
    kinase, 90 kDa, development|protein amino acid
    polypeptide
    3 phosphorylation|protein serine/threonine kinase
    activity|signal transduction|skeletal
    development|transferase activity
    miR-21 NM_002971 SATB1 special AT-rich M + P + T double-stranded DNA binding|establishment and/or
    sequence binding maintenance of chromatin
    protein 1 (binds to architecture|nucleus|regulation of transcription, DNA-
    nuclear matrix/scaffold- dependent|transcription factor activity
    associating DNA's)
    miR-21 NM_014191 SCN8A sodium channel, voltage M + P + T ATP binding|cation channel activity|cation
    gated, type VIII, alpha transport|integral to
    polypeptide membrane|membrane|neurogenesis|sodium ion
    transport|voltage-gated sodium channel
    activity|voltage-gated sodium channel complex
    miR-21 AA927480 SKI v-ski sarcoma viral M + P + T
    oncogene homolog
    (avian)
    miR-21 NM_003983 SLC7A6 solute carrier family 7 P + T amino acid metabolism|amino acid transport|amino
    (cationic amino acid acid-polyamine transporter activity|integral to plasma
    transporter, y+ system), membrane|plasma membrane|protein complex
    member
    6 assembly|transport
    miR-21 NM_006359 SLC9A6 solute carrier family 9 P + T antiporter activity|endoplasmic reticulum
    (sodium/hydrogen membrane|integral to membrane|integral to
    exchanger), isoform 6 membrane|ion
    transport|microsome|mitochondrion|regulation of
    pH|sodium ion transport|sodium:hydrogen antiporter
    activity|solute:hydrogen antiporter activity
    miR-21 NM_003076 SMARCD1 SWI/SNF related, P + T chromatin remodeling|chromatin remodeling
    matrix associated, actin complex|regulation of transcription from RNA
    dependent regulator of polymerase II promoter|transcription coactivator
    chromatin, subfamily d, activity
    member
    1
    miR-21 AI669815 SOX2 SRY (sex determining P + T establishment and/or maintenance of chromatin
    region Y)-box 2 architecture|nucleus|regulation of transcription, DNA-
    dependent|transcription|transcription factor activity
    miR-21 NM_006940 SOX5 SRY (sex determining P + T nucleus|regulation of transcription, DNA-
    region Y)-box 5 dependent|transcription|transcription factor
    activity|transcription from RNA polymerase II
    promoter
    miR-21 AI808807 SOX7 SRY (sex determining P + T DNA binding|nucleus|regulation of transcription,
    region Y)-box 7 DNA-dependent|transcription
    miR-21 NM_006717 SPIN Spindling P + T gametogenesis|ribonucleoprotein complex
    miR-21 NM_005842 SPRY2 sprouty homolog 2 P + T cell-cell
    (Drosophila) signaling|development|membrane|organogenesis|
    regulation of signal transduction
    miR-21 NM_006751 SSFA2 sperm specific antigen 2 P + T plasma membrane
    miR-21 NM_006603 STAG2 stromal antigen 2 P + T cell cycle|chromosome
    segregation|cytokinesis|meiosis|mitosis|
    molecular_function unknown|nucleus
    miR-21 BC000627 STAT3 signal transducer and P + T JAK-STAT cascade|acute-phase response|calcium ion
    activator of binding|cell
    transcription 3 (acute- motility|cytoplasm|hematopoietin/interferon-class
    phase response factor) (D200-domain) cytokine receptor signal transducer
    activity|intracellular signaling cascade|negative
    regulation of transcription from RNA polymerase II
    promoter|neurogenesis|nucleus|nucleus|regulation of
    transcription, DNA-dependent|signal transducer
    activity|transcription|transcription factor
    activity|transcription factor activity
    miR-21 AW138827 TAF5 TAF5 RNA polymerase P + T nucleus|regulation of transcription, DNA-
    II, TATA box binding dependent|transcription factor TFIID
    protein (TBP)- complex|transcription factor activity
    associated factor,
    100 kDa
    miR-21 BF591040 TAGAP T-cell activation P + T GTPase activator activity
    GTPase activating
    protein
    miR-21 NM_000358 TGFBI transforming growth M + P + T cell adhesion|cell proliferation|extracellular matrix
    factor, beta-induced, (sensu Metazoa)|extracellular space|integrin
    68 kDa binding|negative regulation of cell adhesion|protein
    binding|sensory perception|visual perception
    miR-21 NM_000362 TIMP3 tissue inhibitor of P + T enzyme inhibitor activity|extracellular matrix (sensu
    metalloproteinase
    3 Metazoa)|extracellular matrix (sensu
    (Sorsby fundus Metazoa)|induction of apoptosis by extracellular
    dystrophy, signals|metalloendopeptidase inhibitor
    pseudoinflammatory) activity|sensory perception|visual perception
    miR-21 AA149745 TRIM2 tripartite motif- M + P + T cytoplasm|myosin binding|protein
    containing 2 ubiquitination|ubiquitin ligase complex|ubiquitin-
    protein ligase activity|zinc ion binding
    miR-21 AF346629 TRPM7 transient receptor P + T ATP binding|calcium channel activity|calcium ion
    potential cation transport|cation transport|integral to
    channel, subfamily M, membrane|membrane|protein amino acid
    member 7 phosphorylation|protein serine/threonine kinase
    activity|transferase activity
    miR-21 AI745185 YAP1 Yes-associated protein P + T
    1, 65 kDa
    miR-21 NM_005667 ZFP103 zinc finger protein 103 P + T central nervous system development|integral to
    homolog (mouse) membrane|protein ubiquitination|ubiquitin ligase
    complex|ubiquitin-protein ligase activity|zinc ion
    binding
    miR-21 N62196 ZNF367 zinc finger protein 367 M + P + T nucleic acid binding|nucleus|zinc ion binding
    M = MiRanda
    P = PicTar
    T = TargetScan
    • Example 3 Bio-Pathological Features and microRNA Expression
  • Materials and Methods
  • Immunohistochemical Analysis of Breast Cancer Samples.
  • Staining procedures were performed as described (Querzoli, P., et al., Anal. Quant. Cytol. Histol. 21:151-160 (1999)). Hormonal receptors were evaluated with 6F11 antibody for estrogen receptor α (ER) and PGR-1A6 antibody for progesterone receptor (PR) (Ventana, Tucson, Ariz., U.S.A.). The proliferation index was assessed with MIB1 antibody (DAKO, Copenhagen). ERBB2 was detected with CB11 antibody (Ventana, Tucson, Ariz., U.S.A.) and p53 protein expression was examined with DO7 antibody (Ventana, Tucson, Ariz., U.S.A.). Only tumor cells with distinct nuclear immunostaining for ER, PR, Mib1 and p53 were recorded as positive. Tumor cells were considered positive for ERBB2 when they showed distinct membrane immunoreactivity.
  • To perform a quantitative analysis of the expression of these various biological markers, the Eureka Menarini computerized image analysis system was used. For each tumor section, at least 20 microscopic fields of invasive carcinoma were measured using a 40× objective. The following cut-off values were employed: 10% of positive nuclear area for ER, PR, c-erbB2 and p53, 13% of nuclei expressing Mib1 was introduced to discriminate cases with high and low proliferative activity.
  • Results
  • To evaluate whether a correlation exists between various bio-pathological features associated with breast cancer and the expression of particular miRNAs, we generated and compared miRNA expression profiles for various cancer samples associated with the presence or absence of a particular breast cancer feature. In particular, we analyzed breast cancers with lobular or ductal histotypes, breast cancers with differential expression of either estrogen receptor alpha (ER) or progesterone receptor, and breast cancers with differences in lymph node metastasis, vascular invasion, proliferation index, and expression of ERBB2 and p53.
  • Expression profiles of lobular or ductal and +/−ERBB2 expression classes did not reveal any microRNAs that were differentially-expressed, while all other comparisons revealed a small number of differentially-expressed microRNAs (P<0.05). The results of this analysis are shown in FIG. 4.
  • Differentially-expressed miRNA families were identified for various bio-pathological features that are associated with human breast cancer. For example, all miR-30 miRNAs are down-regulated in both ER- and PR-tumors, suggesting that expression of miR-30 miRNAs is regulated by these hormones. In addition, the expression of various let-7 miRNAs was down-regulated in breast cancer samples with either lymph node metastasis or a high proliferation index, suggesting that reduced let-7 expression could be associated with a poor prognosis, a result that is consistent with previous findings. The discovery that the let-7 family of miRNAs regulates the expression of members of the RAS oncogene family provides a potential explanation for the role of let-7 miRNAs in human cancer.
  • miR-145 and miR-21, two miRNAs whose expression could differentiate cancer or normal tissues, were also differentially-expressed in cancers with a different proliferation index or different tumor stage. In particular, miR-145 is progressively down-regulated from normal breast to cancers with a high proliferation index. Similarly, miR-21 is progressively up-regulated from normal breast to cancers with high tumor stage. These findings suggest that deregulation of these two miRNAs may affect critical molecular events involved in tumor progression.
  • Another miRNA potentially involved in cancer progression is miR-9-3. miR-9-3 was downregulated in breast cancers with either high vascular invasion or lymph node metastasis, suggesting that its down-regulation was acquired during the course of tumor progression and, in particular, during the acquisition of metastatic potential.
  • The relevant teachings of all publications cited herein that have not explicitly been incorporated by reference, are incorporated herein by reference in their entirety. While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims

Claims (38)

What is claimed is:
1. A method of diagnosing a breast cancer associated with one or more prognostic markers in a subject, comprising:
measuring the level of at least one miR gene product in a breast cancer sample from said subject,
wherein an alteration in the level of the at least one miR gene product in the test sample, relative to the level of a corresponding miR gene product in a control sample, is indicative of the subject having a breast cancer associated with the one or more prognostic markers,
wherein the breast cancer associated with one or more prognostic markers and the at least one miR gene product are selected from the group consisting of:
(i) the breast cancer is a breast cancer associated with estrogen receptor expression and the miR gene product is selected from the group consisting of miR-26a, miR-26b, miR-102 (miR-29b), miR-30a-5p, miR-30b, miR-30c, miR-30d, miR-185, miR-191, miR-206, miR-212, and combinations thereof;
(ii) the breast cancer is a breast cancer associated with progesterone receptor expression and the miR gene product is selected from the group consisting of let-7c, miR-26a, miR-29b, miR-30a-5p, miR-30b, miR-30c, miR-30d, and combinations thereof;
(iii) the breast cancer is a breast cancer associated with positive lymph node metastasis and the miR gene product is selected from the group consisting of let-7f-1, let-7a-3, let-7a-2, miR-9-3, and combinations thereof;
(iv) the breast cancer is a breast cancer associated with a high proliferative index and the miR gene product is selected from the group consisting of let-7c, let-7d, miR-26a, miR-26b, miR-30a-5p, miR-102, miR-145, and combinations thereof;
(v) the breast cancer is a breast cancer associated with detectable p53 expression and the miR gene product is selected from the group consisting of miR-16a, miR-128b and a combination thereof;
(vi) the breast cancer is a breast cancer associated with high vascular invasion and the miR gene product is selected from the group consisting of miR-9-3, miR-10b, miR-27a, miR-29a, miR-123, miR-205 and combinations thereof; and
(vii) the breast cancer is a breast cancer associated with an advanced tumor stage and the miR gene product is selected from the group consisting of miR-9-2, miR-15-a, miR-21, miR-30a-s, miR-133a-1, miR-137, miR-153-2, miR-154, miR-181a, miR-203, miR-213, and combinations thereof.
2. The method of claim 1, further comprising: administering, to the subject, a pharmaceutical composition for treating breast cancer, wherein the pharmaceutical composition comprises: at least one miR expression inhibitor compound or at least one miR gene product and a pharmaceutically-acceptable carrier.
3. The method of claim 1, comprising:
reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides;
hybridizing the target oligodeoxynucleotides to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample; and
comparing the test sample hybridization profile to a hybridization profile generated from a control sample,
wherein an alteration in the signal of at least one miRNA is indicative of the subject either having, or being at risk for developing, breast cancer.
4. A method of treating breast cancer in a subject who has a breast cancer in which at least one miR gene product is down-regulated or up-regulated in the cancer cells of the subject relative to control cells, comprising:
(1) when the at least one miR gene product is down-regulated in the cancer cells, administering to the subject an effective amount of at least one isolated miR gene product, provided that the miR gene product is not miR-15a or miR-16-1, such that proliferation of cancer cells in the subject is inhibited; or
(2) when the at least one miR gene product is up-regulated in the cancer cells, administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene product, such that proliferation of cancer cells in the subject is inhibited.
5. The method of claim 4, wherein the at least one isolated miR gene product in step (1) is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
6. The method of claim 4 wherein the at least one miR gene product in step (2) is selected from the group consisting of: miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
7. The method of claim 4, further comprising:
determining the amount of at least one miR gene product in breast cancer cells, relative to control cells; and
altering the amount of miR gene product expressed in the breast cancer cells by:
(i) administering to the subject an effective amount of at least one isolated miR gene product, provided that the miR gene product is not miR-15a or miR-16-1, if the amount of the miR gene product expressed in the cancer cells is less than the amount of the miR gene product expressed in control cells; or
(ii) administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene product, if the amount of the miR gene product expressed in the cancer cells is greater than the amount of the miR gene product expressed in control cells,
such that proliferation of cancer cells in the subject is inhibited.
8. The method of claim 7, wherein the at least one isolated miR gene product in step (i) is selected from the group consisting of: miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.
9. The method of claim 7, wherein the at least one miR gene product in step (ii) is selected from the group consisting of miR-21, miR-155, miR-009-1 (miR-131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.
10. A pharmaceutical composition for treating breast cancer, comprising at least one isolated miR gene product of claim 8 and a pharmaceutically-acceptable carrier.
11. A pharmaceutical composition for treating breast cancer, comprising at least one miR expression inhibitor compound of claim 9, and a pharmaceutically-acceptable carrier.
12. A method of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising
measuring the level of at least one miR-125b gene product in a test sample from said subject,
wherein a decrease in the level of the miR-125b gene product in the test sample, relative to the level of a corresponding miR-155 gene product in a control sample, is indicative of the subject either having, or being at risk for developing, breast cancer.
13. The method of claim 12, which further comprises measuring at least one miR-125b-1 gene product.
14. The method of claim 12, which further comprises measuring at least one miR-125b-2 gene product.
15. The method of claim 12, which further comprises measuring at least one miR-10b gene product.
16. The method of claim 12, which further comprises measuring at least one miR-145 gene product.
17. The method of claim 12, which further comprises measuring at least one miR-21 gene product.
18. The method of claim 12, wherein the level of the at least one miR-125b gene product is measured using Northern blot analysis.
19. The method of claim 12, wherein the level of the at least one miR-125b gene product in the test sample is less than the level of the corresponding miR-125b gene product in the control sample.
20. The method of claim 12, wherein the level of the at least one miR-125b gene product in the test sample is greater than the level of the corresponding miR-125b gene product in the control sample.
21. A method of treating cancer in a subject in need thereof, comprising
administering to the subject an effective amount of a compound for inhibiting the expression of a gene encoding one or more gene products in the subject, wherein the gene products are selected from one or more of miR-155, miR-10b, and miR-125b;
thereby inhibiting the proliferation of cancer cells in the subject.
22. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is an antisense nucleic acid.
23. The method of claim 21, wherein the antisense nucleic acid is selected from the group consisting of a single-stranded RNA, a single-stranded DNA, a single-stranded RNA-DNA chimera and a single-stranded PNA.
24. The method of claim 21, wherein the antisense nucleic acid contains one or more modifications to the nucleic acid backbone, a sugar moiety, a base moiety or a combination thereof.
25. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is a double-stranded RNA molecule having at least 90% sequence homology with the mature miRNAs of: miR-10b in SEQ ID NO:31, miR-125b-1 in SEQ ID NO: 118, miR-125b-2 in SEQ ID NO: 121, and miR-155 in SEQ ID NO:183.
26. The method of claim 25, wherein the double-stranded RNA molecule is about 17 to about 29 nucleotides in length.
27. The method of claim 21, wherein the compound for inhibiting the expression of the gene encoding the gene product is a ribozyme.
28. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is formulated as a pharmaceutical composition comprising the compound or a pharmaceutically-acceptable salt thereof, and a pharmaceutically-acceptable carrier.
29. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is administered to the subject orally, parenterally, by injection or infusion.
30. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is administered to the subject by direct injection into a tumor in the subject.
31. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is administered in combination with a delivery reagent.
32. The method of claim 31, wherein the delivery reagent is a liposome.
33. The method of claim 21, wherein the nucleic acid encoding the compound for inhibiting the expression of a gene encoding the gene product is a recombinant plasmid or viral vector.
34. A method for inhibiting the proliferation of cancer cells, comprising administering a compound for inhibiting the expression of a gene encoding a miR-155 gene product to the cancer cells, thereby arresting or slowing the growth of the cancer cells.
35. The method of claim 34, wherein the compound for inhibiting the expression of a gene encoding a miR-155 gene product is an antisense nucleic acid.
36. A method for inhibiting the proliferation of cancer cells, comprising administering a compound for increasing the expression of a gene encoding one or more of a miR-10b, miR-125b-1 or miR-125b-2 gene product to the cancer cells, thereby arresting or slowing the growth of the cancer cells.
37. The method of claim 36, wherein the compound for increasing the expression of a gene encoding one or more of a miR-10b, miR-125b-1 or miR-125b-2g gene product is a sense nucleic acid.
38. A method of treating a subject with a breast cancer, comprising: i) selecting a subject with the breast cancer; and, ii) administering to the subject an isolated nucleic acid molecule encoding at least one transcript of: miR-155, miR-10b, miR-125b-1, and miR-125b-2, thereby treating the subject.
US14/145,364 2005-08-01 2013-12-31 MicroRNA-Based Methods and Compositions For the Diagnosis, Prognosis and Treatment of Breast Cancer Abandoned US20140147495A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US14/145,364 US20140147495A1 (en) 2005-08-01 2013-12-31 MicroRNA-Based Methods and Compositions For the Diagnosis, Prognosis and Treatment of Breast Cancer
US15/155,479 US20160251659A1 (en) 2005-08-01 2016-05-16 MicroRNA-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Breast Cancer

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US70446405P 2005-08-01 2005-08-01
PCT/US2006/029889 WO2007016548A2 (en) 2005-08-01 2006-07-31 Micro-rna-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
US12/012,235 US8658370B2 (en) 2005-08-01 2008-01-31 MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
US14/145,364 US20140147495A1 (en) 2005-08-01 2013-12-31 MicroRNA-Based Methods and Compositions For the Diagnosis, Prognosis and Treatment of Breast Cancer

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US12/012,235 Division US8658370B2 (en) 2005-08-01 2008-01-31 MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/155,479 Division US20160251659A1 (en) 2005-08-01 2016-05-16 MicroRNA-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Breast Cancer

Publications (1)

Publication Number Publication Date
US20140147495A1 true US20140147495A1 (en) 2014-05-29

Family

ID=37709309

Family Applications (3)

Application Number Title Priority Date Filing Date
US12/012,235 Active 2031-03-20 US8658370B2 (en) 2005-08-01 2008-01-31 MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
US14/145,364 Abandoned US20140147495A1 (en) 2005-08-01 2013-12-31 MicroRNA-Based Methods and Compositions For the Diagnosis, Prognosis and Treatment of Breast Cancer
US15/155,479 Abandoned US20160251659A1 (en) 2005-08-01 2016-05-16 MicroRNA-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Breast Cancer

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US12/012,235 Active 2031-03-20 US8658370B2 (en) 2005-08-01 2008-01-31 MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer

Family Applications After (1)

Application Number Title Priority Date Filing Date
US15/155,479 Abandoned US20160251659A1 (en) 2005-08-01 2016-05-16 MicroRNA-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Breast Cancer

Country Status (7)

Country Link
US (3) US8658370B2 (en)
EP (1) EP1937845B1 (en)
JP (3) JP5489459B2 (en)
CN (7) CN105902559A (en)
CA (1) CA2617581A1 (en)
ES (1) ES2545383T3 (en)
WO (1) WO2007016548A2 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9017940B2 (en) 2006-01-05 2015-04-28 The Ohio State University Methods for diagnosing colon cancer using MicroRNA signatures
US9434995B2 (en) 2012-01-20 2016-09-06 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
WO2016205461A1 (en) * 2015-06-16 2016-12-22 Emory University Detecting microrna and iso-microrna to evaluate vascular and cardiac health
WO2017095213A1 (en) * 2015-12-04 2017-06-08 Instituto Nacional De Medicina Genómica Method for prognosis in breast cancer
US9873916B2 (en) 2011-04-25 2018-01-23 Toray Industries, Inc. Method for predicting response to trastuzumab therapy in breast cancer patients
WO2024261242A1 (en) 2023-06-22 2024-12-26 Fondazione Di Religione E Di Culto "Casa Sollievo Della Sofferenza" - Opera Di San Pio Da Pietrelcina Prognostic method for non-metastatic female breast cancer

Families Citing this family (134)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005078139A2 (en) * 2004-02-09 2005-08-25 Thomas Jefferson University DIAGNOSIS AND TREATMENT OF CANCERS WITH MicroRNA LOCATED IN OR NEAR CANCER-ASSOCIATED CHROMOSOMAL FEATURES
EP2290071B1 (en) 2004-05-28 2014-12-31 Asuragen, Inc. Methods and compositions involving microRNA
JP2008519606A (en) 2004-11-12 2008-06-12 アンビオン インコーポレーティッド Methods and compositions relating to miRNA and miRNA-inhibiting molecules
CA2603881A1 (en) 2005-04-04 2006-10-12 The Board Of Regents Of The University Of Texas System Micro-rna's that regulate muscle cells
EP1937845B1 (en) 2005-08-01 2015-06-10 The Ohio State University Research Foundation Micro-rna-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
EP1937280B1 (en) 2005-09-12 2014-08-27 The Ohio State University Research Foundation Compositions for the therapy of bcl2-associated cancers
WO2007081720A2 (en) 2006-01-05 2007-07-19 The Ohio State University Research Foundation Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer
CN103361424A (en) 2006-01-05 2013-10-23 俄亥俄州立大学研究基金会 MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors
WO2007109236A2 (en) 2006-03-20 2007-09-27 The Ohio State University Research Foundation Microrna fingerprints during human megakaryocytopoiesis
WO2008008430A2 (en) 2006-07-13 2008-01-17 The Ohio State University Research Foundation Micro-rna-based methods and compositions for the diagnosis and treatment of colon cancer-related diseases
JP2010504350A (en) * 2006-09-19 2010-02-12 アシュラジェン インコーポレイテッド Genes and pathways regulated by miR-200 as targets for therapeutic intervention
AU2007346101B2 (en) 2006-09-19 2013-08-15 The Ohio State University Research Foundation TCL1 expression in chronic lymphocytic leukemia (CLL) regulated by miR-29 and miR-181
AU2007314212B2 (en) 2006-11-01 2014-05-29 The Govt. Of The Usa As Represented By The Secretary Of The Department Of Health And Human Services MicroRNA expression signature for predicting survival and metastases in Hepatocellular carcinoma
US8034560B2 (en) 2007-01-31 2011-10-11 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia (AML)
CA2699418A1 (en) * 2007-02-27 2008-09-04 Moshe Oren Composition and methods for modulating cell proliferation and cell death
US9006206B2 (en) 2007-02-27 2015-04-14 Rosetta Genomics Ltd. Composition and methods for modulating cell proliferation and cell death
EP1990414A1 (en) * 2007-05-10 2008-11-12 Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. Means for treating inflammatory diseases, autoimmune diseases and cancer
WO2008154098A2 (en) * 2007-06-07 2008-12-18 Wisconsin Alumni Research Foundation Reagents and methods for mirna expression analysis and identification of cancer biomarkers
AU2008262252B2 (en) 2007-06-08 2013-09-12 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for determining hepatocellular carcinoma subtype and detecting hepatic cancer stem cells
EP2719773A3 (en) 2007-06-15 2014-07-30 The Ohio State University Research Foundation miRNA as marker for acute lamphomic leucemia
WO2009004632A2 (en) * 2007-07-05 2009-01-08 Yeda Research And Development Co. Ltd. Methods of identifying components of a biological pathway and use of said components in regulating diseases associated with altered cell proliferation
EP2182969B1 (en) 2007-07-31 2016-11-16 The Board of Regents of The University of Texas System A micro-rna family that modulates fibrosis and uses thereof
ES2496172T3 (en) 2007-07-31 2014-09-18 The Ohio State University Research Foundation Methods to reverse methylation by targeted selection of DNMT3A and DNMT3B
AU2008283997B2 (en) 2007-08-03 2014-04-10 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
US20120070442A1 (en) * 2007-08-09 2012-03-22 The Regents Of The University Of Colorado, A Body Corporate Methods and compositions for treating cancer
WO2009026487A1 (en) 2007-08-22 2009-02-26 The Ohio State University Research Foundation Methods and compositions for inducing deregulation of epha7 and erk phosphorylation in human acute leukemias
EP2198050A1 (en) 2007-09-14 2010-06-23 Asuragen, INC. Micrornas differentially expressed in cervical cancer and uses thereof
WO2009055773A2 (en) 2007-10-26 2009-04-30 The Ohio State University Research Foundation Methods for identifying fragile histidine triad (fhit) interaction and uses thereof
US8071562B2 (en) 2007-12-01 2011-12-06 Mirna Therapeutics, Inc. MiR-124 regulated genes and pathways as targets for therapeutic intervention
WO2009086156A2 (en) * 2007-12-21 2009-07-09 Asuragen, Inc. Mir-10 regulated genes and pathways as targets for therapeutic intervention
CA2718520C (en) 2008-03-17 2020-01-07 The Board Of Regents Of The University Of Texas System Identification of micro-rnas involved in neuromuscular synapse maintenance and regeneration
EP2285960B1 (en) 2008-05-08 2015-07-08 Asuragen, INC. Compositions and methods related to mir-184 modulation of neovascularization or angiogenesis
CN102149827B (en) 2008-06-11 2014-08-20 由卫生与公众服务部代表的美利坚合众国政府 Use of the MiR-26 family as a predictive marker for hepatocellular carcinoma and responsiveness to treatment
KR101043433B1 (en) * 2008-07-18 2011-06-22 국립암센터 Anticancer composition containing micro RNA molecule
EP2315832B1 (en) 2008-08-01 2015-04-08 Roche Innovation Center Copenhagen A/S Micro-rna mediated modulation of colony stimulating factors
WO2010022166A2 (en) * 2008-08-19 2010-02-25 Maine Institute For Human Genetics And Health Micro rna (mirna) and neurofibromatosis type 1 : a role in diagnosis and therapy
CN101368213A (en) * 2008-10-13 2009-02-18 南京大学 Serum microRNA kit and its application in early diagnosis of hepatitis B
CA2742324A1 (en) * 2008-10-30 2010-06-03 Caris Life Sciences Luxembourg Holdings, S.A.R.L. Methods for assessing rna patterns
JP2012508577A (en) 2008-11-12 2012-04-12 カリス ライフ サイエンシズ ルクセンブルク ホールディングス Method and system for using exosomes to determine phenotype
US9090943B2 (en) * 2008-11-30 2015-07-28 Rosetta Genomics Ltd. Methods for detecting an increased susceptibility to cancer
US20120014927A1 (en) 2008-12-03 2012-01-19 Tel Hashomer Medical Research Infrastructure And Services Ltd. Methods and kits for determining predisposition to cancer
EP2373301B1 (en) * 2008-12-05 2013-11-06 Yeda Research and Development Co. Ltd. Methods of diagnosing motor neuron diseases
AU2009322907B2 (en) * 2008-12-05 2016-05-05 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis and treatment of ovarian cancer
WO2010070637A2 (en) * 2008-12-15 2010-06-24 Rosetta Genomics Ltd. Method for distinguishing between adrenal tumors
WO2010084488A1 (en) 2009-01-20 2010-07-29 Ramot At Tel-Aviv University Ltd. Mir-21 promoter driven targeted cancer therapy
FI20095227A0 (en) 2009-03-06 2009-03-06 Valtion Teknillinen Nucleic acids regulating estrogen receptor (ER) alpha signaling in breast cancer
US20120029055A1 (en) * 2009-03-19 2012-02-02 Agecy for Science, Technology and Research Modulators of apoptosis and the uses thereof
US20120190729A1 (en) * 2009-07-27 2012-07-26 The Regents Of The University Of Colorado A Body Corporate Mirna inhibition of six1 expression
CN101987197B (en) * 2009-07-31 2012-09-12 中国科学院上海生命科学研究院 Method and reagent for inhibiting invasiveness of cancer cells
WO2011024918A1 (en) * 2009-08-26 2011-03-03 国立大学法人大阪大学 Antiangiogenic agent and method for inhibition of angiogenesis
CN101993892A (en) * 2009-08-31 2011-03-30 长沙赢润生物技术有限公司 Eukaryotic expression vector for expressing shRNA (short hairpin Ribonucleic Acid) in manner of targeting in cancer cells
CN102018963B (en) * 2009-09-11 2013-03-13 中国科学院上海生命科学研究院 MiR-125a for adjusting regulated on activation normal T cell expressed and secreted (RANTES) expressions as well as composition and application thereof
WO2011063382A1 (en) 2009-11-23 2011-05-26 The Ohio State University Materials and methods useful for affecting tumor cell growth, migration and invasion
CN102078621B (en) * 2009-11-27 2013-04-10 中国科学院上海生命科学研究院 Method and composition of regulating and controlling plasmacytoid dendritic cell I type interferon expression
WO2011068865A1 (en) * 2009-12-01 2011-06-09 Board Of Trustees Of Southern Illinois University Micro-rna-101 promotes estrogen-independent growth and confers tamoxifen resistance in er-positive cancer cells
WO2011103345A2 (en) * 2010-02-17 2011-08-25 The Board Of Regents Of The University Of Texas System Methods and compositions for influencing tumors using microrna-185 as a tumor suppressor
CN103237901B (en) 2010-03-01 2016-08-03 卡里斯生命科学瑞士控股有限责任公司 For treating the biomarker of diagnosis
EP2545190A1 (en) * 2010-03-11 2013-01-16 National University of Ireland Galway Detection and quantification of micrornas in the circulation and the use of circulating micrornas as biomarkers for cancer
BR112012025593A2 (en) 2010-04-06 2019-06-25 Caris Life Sciences Luxembourg Holdings circulating biomarkers for disease
US8975021B2 (en) * 2010-04-08 2015-03-10 Kyoto Prefectural Public University Corporation Method for detecting rhabdomyosarcoma using sample derived from body fluid
WO2011128886A1 (en) * 2010-04-12 2011-10-20 Ramot At Tel Aviv University Ltd. A micro-rna for cancer diagnosis, prognosis and therapy
CN101921760B (en) * 2010-09-08 2012-02-01 南京医科大学 A serum/plasma miRNA marker associated with breast cancer and its application
EP2622076A1 (en) 2010-09-30 2013-08-07 University of Zürich Treatment of b-cell lymphoma with microrna
CN102021169A (en) * 2010-10-14 2011-04-20 南京大学 Serum/plasma miRNA composition and use thereof
SG180031A1 (en) * 2010-10-15 2012-05-30 Agency Science Tech & Res Combination treatment of cancer
GB201018377D0 (en) * 2010-10-29 2010-12-15 Niendorf Axel Method for the analysis of a biological sample of a patient
US8946187B2 (en) 2010-11-12 2015-02-03 The Ohio State University Materials and methods related to microRNA-21, mismatch repair, and colorectal cancer
CN103313706A (en) 2010-11-15 2013-09-18 俄亥俄州立大学研究基金会 Controlled release mucoadhesive systems
CN102146412B (en) * 2011-01-11 2012-10-03 中山大学 A small molecule non-coding RNA gene hsa-miR-29b and its application
EP2683387A4 (en) * 2011-03-07 2014-09-03 Univ Ohio State MUTATORY ACTIVITY INDUCED BY INFLAMMATION OF MICROARN-155 (MIR-155) BINDING AND CANCER
US8685727B2 (en) 2011-06-20 2014-04-01 California Institute Of Technology Regulation of macrophage activation using miR-125b
WO2013040251A2 (en) 2011-09-13 2013-03-21 Asurgen, Inc. Methods and compositions involving mir-135b for distinguishing pancreatic cancer from benign pancreatic disease
WO2013038737A1 (en) 2011-09-16 2013-03-21 北海道公立大学法人 札幌医科大学 Method for detecting bladder cancer cells, primer used in method for detecting bladder cancer cells, and bladder cancer marker
JP2014530612A (en) 2011-10-14 2014-11-20 ジ・オハイオ・ステート・ユニバーシティ Methods and materials for ovarian cancer
GB2533873B (en) * 2011-10-19 2016-08-31 Council Scient Ind Res Biomarkers useful for detection of types, grades and stages of human breast cancer
AU2012345666A1 (en) * 2011-11-30 2014-06-19 Cedars-Sinai Medical Center Targeting microRNAs miR-409-5p, miR-379 and miR-154* to treat prostate cancer bone metastasis and drug resistant lung cancer
US9745578B2 (en) 2011-11-30 2017-08-29 Cedars-Sinai Medical Center Targeting microRNA miR-409-3P to treat prostate cancer
CN104619353A (en) 2011-12-13 2015-05-13 俄亥俄州国家创新基金会 Methods and compositions related to miR-21 and miR-29a, exosome inhibition, and cancer metastasis
ITRM20110685A1 (en) 2011-12-23 2013-06-24 Internat Ct For Genetic En Gineering And MICRORNA FOR CARDIAC REGENERATION THROUGH THE INDUCTION OF THE PROLIFERATION OF CARDIAC MYCYCLES
US9334498B2 (en) 2012-05-10 2016-05-10 Uab Research Foundation Methods and compositions for modulating MIR-204 activity
CA2880762A1 (en) * 2012-08-01 2014-02-06 Pacylex Pharmaceuticals Inc. Methods and compositions for diagnosis and prognosis in breast cancer
CN103275979B (en) * 2012-10-25 2014-12-17 北京迈誉森生物科技有限公司 MicroRNA (Ribose Nucleic Acid) marker for detecting breast cancer and application thereof in kit
JP6478916B2 (en) * 2012-11-16 2019-03-06 ザ ボード オブ リージェンツ オブ ザ ユニバーシティー オブ テキサス システム MiRNA as a therapeutic adjuvant and biomarker for prognosis and treatment of drug resistant breast cancer
CN103773764A (en) * 2012-12-27 2014-05-07 山东省眼科研究所 miRNA and application of miRNA in preparation of product for diagnosing and treating posterior capsule opacification
US10793913B2 (en) * 2013-03-08 2020-10-06 City Of Hope Methods and compositions for treatment of breast cancer
WO2014193309A1 (en) * 2013-05-30 2014-12-04 Agency For Science, Technology And Research Method For Determining Cancer Prognosis
WO2014202090A1 (en) * 2013-06-19 2014-12-24 Syddansk Universitet Circulating microrna based cancer biomarkers
CN103432595B (en) * 2013-08-19 2015-06-10 南京市妇幼保健院 Application of human miR-26b in preparation of drugs for inhibiting fat cell proliferation
BR112016005413A8 (en) * 2013-09-11 2018-04-03 Fund De Amparo A Pesquisa Do Estado De Sao Paulo USES OF AT LEAST ONE MIRNA, KIT, BREAST CANCER DIAGNOSIS METHODS AND METHODS FOR METASTASIS RISK ASSESSMENT
WO2015073531A1 (en) * 2013-11-13 2015-05-21 The Texas A & M University System Micro-rnas that modulate lymphangiogenesis and inflammatory pathways in lymphatic vessel cells
CN104164485B (en) * 2014-06-09 2016-06-01 济南金域医学检验中心有限公司 The application of the reagent of detection miR-129-2 methyl in preparation detection breast cancer kit
ES2481819B1 (en) * 2014-06-12 2015-04-01 Sistemas Genómicos, S.L. ASSESSMENT METHOD TO EVALUATE A POSSIBILITY OF BREAST CANCER
CN105586390B (en) * 2014-10-23 2019-01-22 王辉云 A kind of kit for Prognosis in Breast Cancer judgement
CN108064380A (en) * 2014-10-24 2018-05-22 皇家飞利浦有限公司 Use the prediction of the medical prognosis and therapeutic response of various kinds of cell signal transduction path activity
CN104502601B (en) * 2014-12-03 2016-04-06 上海交通大学医学院附属上海儿童医学中心 SCN3A closes or open mark as diagnosis arterial duct
CN104611429B (en) * 2015-01-21 2017-02-22 湖州市中心医院 Application of miR-10b (micro ribonucleic acid-10b) gene to regulation of gastric cancer gene expression
CN104630216A (en) * 2015-01-23 2015-05-20 北京大学第一医院 Radionuclide marked microRNA-155 targeting probe and application thereof in tumor imaging
CN104630377B (en) * 2015-02-28 2017-11-17 上海赛安生物医药科技股份有限公司 A kind of application of breast cancer miRNA detection kits and its miRNA
MX368314B (en) 2015-06-05 2019-09-27 Miragen Therapeutics Inc Mir-155 inhibitors for treating cutaneous t cell lymphoma (ctcl).
CN105200043B (en) * 2015-06-26 2018-08-03 宋尔卫 A kind of kit for assessing Prognosis in Breast Cancer risk
US20170145421A1 (en) * 2015-11-25 2017-05-25 Kaohsiung Medical Univeristy Mir-125a-5p as a biomarker for breast cancer
US20170349955A1 (en) * 2015-11-25 2017-12-07 Kaohsiung Medical University Mir-125a-5p as a biomarker for breast cancer
US11566292B2 (en) * 2015-12-07 2023-01-31 Ontario Institute For Cancer Research (Oicr) Gene signature of residual risk following endocrine treatment in early breast cancer
CN107299129B (en) * 2016-04-15 2021-07-27 昆山市工业技术研究院小核酸生物技术研究所有限责任公司 Application of circulating nucleic acid as breast cancer biomarker
CN106222270A (en) * 2016-08-02 2016-12-14 滨州医学院 A kind of breast carcinoma occurs or the diagnostic kit of transfer
US11584932B2 (en) 2016-11-01 2023-02-21 The Research Foundation For The State University Of New York 5-halouracil-modified microRNAs and their use in the treatment of cancer
US11236337B2 (en) 2016-11-01 2022-02-01 The Research Foundation For The State University Of New York 5-halouracil-modified microRNAs and their use in the treatment of cancer
TWI732827B (en) * 2017-02-24 2021-07-11 大陸商蘇州翊準基因科技有限公司 Detection method of high-efficiency mRNA labeling detection reagent set
WO2018213412A1 (en) 2017-05-19 2018-11-22 Georgia State University Research Foundation, Inc. Recombinant oncolytic virus
CN107064511B (en) * 2017-06-09 2020-07-24 南京安吉生物科技有限公司 Tumor marker TMEM170B protein and application thereof in preparation of tumor inhibition products
WO2019117257A1 (en) 2017-12-13 2019-06-20 国立大学法人広島大学 Method for assisting in detection of breast cancer
WO2019227254A1 (en) * 2018-05-26 2019-12-05 深圳市博奥康生物科技有限公司 Construction of mirna-25 overexpression vector and use thereof
WO2019227257A1 (en) * 2018-05-26 2019-12-05 深圳市博奥康生物科技有限公司 Construction and application of mirna-210 overexpression vector
CN108588226A (en) * 2018-06-22 2018-09-28 南阳师范学院 Detect the miRNA combination of breast cancer patients with brain transfer and the kit containing the combination
CN113908278B (en) * 2018-08-21 2022-12-20 上海交通大学医学院附属瑞金医院 miR-221 and inhibitor thereof for preparing medicine for regulating and controlling liver fat deposition, liver fibrosis or hepatocellular carcinoma
CN109439748A (en) * 2018-09-25 2019-03-08 广州医科大学附属第三医院（广州重症孕产妇救治中心、广州柔济医院） Application of the miR-9-5p as breast cancer DISTANT METASTASES IN monitoring marker
CN109321656B (en) * 2018-10-22 2021-10-01 上海交通大学医学院附属仁济医院 Use of protein DEPDC1 as marker for diagnosing triple-negative breast cancer
CN110029107B (en) * 2019-04-22 2020-04-21 深圳市人民医院 Oligonucleotides targeting SNHG17 for the treatment of breast cancer
CN110423806A (en) * 2019-08-15 2019-11-08 宁夏医科大学 One kind miRNA marker relevant to AS plaque inflammation and its screening technique and application
CN110484605B (en) * 2019-09-23 2020-07-28 中国人民解放军陆军军医大学第一附属医院 Gene for in-situ detection of microRNA-34 by living cells and preparation method and application thereof
CN111518884B (en) * 2020-04-08 2022-02-18 中国医学科学院医药生物技术研究所 Application of miRNA30 cluster as a diagnostic marker for Alzheimer's disease
CN111514460B (en) * 2020-05-22 2021-12-14 西安交通大学 Application of atmospheric pressure cold plasma in inhibiting activity of glutaminase and enzyme inhibitor
CN111518914B (en) * 2020-06-09 2021-12-24 上海圣梓茂生物科技有限公司 MiRNA marker combination, kit and method for detecting breast cancer
WO2021262919A2 (en) 2020-06-26 2021-12-30 The Research Foundation For The State University Of New York 5-halouracil-modified micrornas and their use in the treatment of cancer
CN111850047B (en) * 2020-07-28 2022-08-12 枣庄学院 A kind of miR-16 and miR-30c joint expression vector and its construction method and application
US20230293730A1 (en) * 2020-08-05 2023-09-21 Hangzhou Exegenesis Bio Ltd. Nucleic acid constructs and uses thereof for treating spinal muscular atrophy
CN111910006A (en) * 2020-08-20 2020-11-10 广州医科大学附属第二医院 Diagnosis and treatment target point circ PLCL2 of prostatic cancer and bone metastasis
CN113481296A (en) * 2021-05-12 2021-10-08 广东省人民医院 Diagnostic kit for early evaluation of breast cancer risk
CN114214363B (en) * 2021-12-03 2024-04-19 浙江大学 A method for modifying mesenchymal stem cells against aging and its application
CN115521899A (en) * 2022-05-06 2022-12-27 西南大学 An efficient Japanese green culture cell CRISPR/Cas9 genome editing method and application thereof
CN115433779A (en) * 2022-08-23 2022-12-06 承启医学（深圳）科技有限公司 Plasma exosome miRNA biomarker for early diagnosis of breast cancer and miRNA detection kit
CN117604107B (en) * 2024-01-23 2024-04-12 杭州华得森生物技术有限公司 Use of FOXO6 and SNX4 in combination for diagnosing breast cancer
CN118236389B (en) * 2024-05-28 2024-09-24 南京晖丽生物科技有限公司 Application of miR-3120 in preparation of pharmaceutical composition for preventing and treating tumor and tumor cachexia
CN118370764B (en) * 2024-06-24 2024-11-08 江苏核泰生物有限公司 Application of nucleic acid in preparation of medicine for preventing and treating cachexia and application method

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8658370B2 (en) * 2005-08-01 2014-02-25 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer

Family Cites Families (156)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4196265A (en) 1977-06-15 1980-04-01 The Wistar Institute Method of producing antibodies
US4172124A (en) 1978-04-28 1979-10-23 The Wistar Institute Method of producing tumor antibodies
US4608337A (en) 1980-11-07 1986-08-26 The Wistar Institute Human hybridomas and the production of human monoclonal antibodies by human hybridomas
US4701409A (en) 1984-11-15 1987-10-20 The Wistar Institute Detection of B-cell neoplasms
US4693975A (en) 1984-11-20 1987-09-15 The Wistar Institute Human hybridroma fusion partner for production of human monoclonal antibodies
US5015568A (en) 1986-07-09 1991-05-14 The Wistar Institute Diagnostic methods for detecting lymphomas in humans
US5202429A (en) 1986-07-09 1993-04-13 The Wistar Institute DNA molecules having human BCL-2 gene sequences
US5198338A (en) 1989-05-31 1993-03-30 Temple University Molecular probing for human t-cell leukemia and lymphoma
US5149628A (en) 1989-11-15 1992-09-22 Temple University Methods for detecting bcl-3 gene in human leukemias
US5633135A (en) 1991-12-11 1997-05-27 Thomas Jefferson University Chimeric nucleic acids and proteins resulting from ALL-1 region chromosome abnormalities
US6040140A (en) 1991-12-11 2000-03-21 Thomas Jefferson University Methods for screening and treating leukemias resulting from all-1 region chromosome abnormalities
WO1993012136A1 (en) 1991-12-11 1993-06-24 Thomas Jefferson University Detection and treatment of acute leukemias resulting from chromosome abnormalities in the all-1 region
CA2148350A1 (en) 1992-10-29 1994-05-11 Carlo Croce Methods of detecting micrometastasis of prostate cancer
US5674682A (en) 1992-10-29 1997-10-07 Thomas Jefferson University Nucleic acid primers for detecting micrometastasis of prostate cancer
US5985598A (en) 1994-10-27 1999-11-16 Thomas Jefferson University TCL-1 gene and protein and related methods and compositions
US7175995B1 (en) 1994-10-27 2007-02-13 Thomas Jefferson University TCL-1 protein and related methods
US5695944A (en) 1995-05-05 1997-12-09 Thomas Jefferson University Modulation of bcl-2 phosphorylation
US5567586A (en) 1995-05-18 1996-10-22 Thomas Jefferson University Methods of indentifying solid tumors with chromosome abnormalities in the ALL-1 region
US6242212B1 (en) 1996-02-09 2001-06-05 Thomas Jefferson University Fragile histidine triad (FHIT) nucleic acids and methods of producing FHIT proteins
US5928884A (en) 1996-02-09 1999-07-27 Croce; Carlo M. FHIT proteins and nucleic acids and methods based thereon
AU6659298A (en) 1997-02-18 1998-09-08 Thomas Jefferson University Compositions that bind to pancreatic cancer cells and methods of using the same
US6258541B1 (en) 1997-04-04 2001-07-10 Texas A&M University Noninvasive detection of colonic biomarkers using fecal messenger RNA
EP1098968A4 (en) 1998-07-20 2002-01-02 Univ Jefferson NITRILASE HOMOLOGIST
AU5128999A (en) 1998-07-24 2000-02-14 Yeda Research And Development Co. Ltd. Prevention of metastasis with 5-aza-2'-deoxycytidine
US7141417B1 (en) 1999-02-25 2006-11-28 Thomas Jefferson University Compositions, kits, and methods relating to the human FEZ1 gene, a novel tumor suppressor gene
JP2003519463A (en) 1999-03-15 2003-06-24 トーマス・ジェファーソン・ユニバーシティー TCL-1b gene, protein, methods related thereto and substances related thereto
US7163801B2 (en) 1999-09-01 2007-01-16 The Burnham Institute Methods for determining the prognosis for cancer patients using tucan
US6891031B2 (en) 2000-02-18 2005-05-10 The Regents Of The University Of California Coordinate cytokine regulatory sequences
WO2001068666A1 (en) 2000-03-14 2001-09-20 Thomas Jefferson University Tcl1 enhances akt kinase activity and mediates its nuclear translocation
JP2004516002A (en) 2000-04-11 2004-06-03 トーマス・ジェファーソン・ユニバーシティー Muir-Toll-like syndrome in Fhit-deficient mice
US20020086331A1 (en) 2000-05-16 2002-07-04 Carlo Croce Crystal structure of worm NitFhit reveals that a Nit tetramer binds two Fhit dimers
US7060811B2 (en) 2000-10-13 2006-06-13 Board Of Regents, The University Of Texas System WWOX: a tumor suppressor gene mutated in multiple cancers
US20040033502A1 (en) 2001-03-28 2004-02-19 Amanda Williams Gene expression profiles in esophageal tissue
US20050176025A1 (en) 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of B-cell CLL/Lymphoma-2 (BCL-2) gene expression using short interfering nucleic acid (siNA)
EP2386637B1 (en) 2001-09-28 2018-05-16 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Microrna molecules
US7371736B2 (en) 2001-11-07 2008-05-13 The Board Of Trustees Of The University Of Arkansas Gene expression profiling based identification of DKK1 as a potential therapeutic targets for controlling bone loss
GB0128898D0 (en) 2001-12-03 2002-01-23 Biotech Res Ventures Pte Ltd Materials and methods relating to the stabilization and activation of a tumour suppressor protein
NZ535101A (en) 2002-03-08 2007-07-27 Eisai Co Ltd Macrocyclic compounds useful as pharmaceuticals
JP2005522677A (en) 2002-04-08 2005-07-28 シファーゲン バイオシステムズ， インコーポレイテッド Serum biomarkers for hepatocellular carcinoma
EP1499182B1 (en) 2002-04-29 2009-10-28 Thomas Jefferson University Human chronic lymphocytic leukemia modeled in mouse by targeted tcl1 expression
WO2003102215A2 (en) 2002-05-31 2003-12-11 The Board Of Trustees Of The Leland Stanford Junior University Methods of identifying and isolating stem cells and cancer stem cells
US20050260639A1 (en) 2002-09-30 2005-11-24 Oncotherapy Science, Inc. Method for diagnosing pancreatic cancer
US20050266443A1 (en) 2002-10-11 2005-12-01 Thomas Jefferson University Novel tumor suppressor gene and compositions and methods for making and using the same
WO2004033659A2 (en) 2002-10-11 2004-04-22 Thomas Jefferson University Novel tumor suppressor gene and compositions and methods for making and using the same
AU2003291433B2 (en) 2002-11-13 2008-05-22 Thomas Jefferson University Compositions and methods for cancer diagnosis and therapy
US7250496B2 (en) 2002-11-14 2007-07-31 Rosetta Genomics Ltd. Bioinformatically detectable group of novel regulatory genes and uses thereof
WO2004071464A2 (en) 2003-02-12 2004-08-26 Johns Hopkins University School Of Medicine Diagnostic application of differentially-expressed genes in lympho-hematopoietic stem cells
WO2004079013A1 (en) 2003-03-03 2004-09-16 Arizona Board Of Regents On Behalf Of The University Of Arizona Ecto-5’-nucleotidase (cd73) used in the diagnosis and the treatment of pancreatic cancer
US7183384B2 (en) 2003-03-06 2007-02-27 A & G Pharmaceutical, Inc. Monoclonal antibody 7H11 reactive with human cancer
WO2004098377A2 (en) 2003-05-02 2004-11-18 Thomas Jefferson University Methods and compositions for diagnosis and therapy of parkin-associated disorders
US20050069918A1 (en) 2003-05-29 2005-03-31 Francois Claret JAB1 as a prognostic marker and a therapeutic target for human cancer
SG179291A1 (en) 2003-06-18 2012-04-27 Genelux Corp Modified recombinant vaccinia viruses and other microorganisms, uses thereof
EP2530157B1 (en) 2003-07-31 2016-09-28 Regulus Therapeutics Inc. Oligomeric compounds and compositions for use in modulation of miRNAs
US8106180B2 (en) 2003-08-07 2012-01-31 Whitehead Institute For Biomedical Research Methods and products for expression of micro RNAs
US20050037362A1 (en) 2003-08-11 2005-02-17 Eppendorf Array Technologies, S.A. Detection and quantification of siRNA on microarrays
US8412541B2 (en) 2003-08-14 2013-04-02 Edda Technology, Inc. Method and system for intelligent qualitative and quantitative analysis for medical diagnosis
WO2005020795A2 (en) 2003-08-25 2005-03-10 The Johns Hopkins University Method of diagnosis and treatment of pancreatic endocrine neoplasms based on differntial gene expression analysis
JP2007505634A (en) 2003-09-22 2007-03-15 ロゼッタ インファーマティクス エルエルシー Synthetic lethal screening using RNA interference
WO2005028675A2 (en) 2003-09-24 2005-03-31 Oncotherapy Science, Inc. Methods for detecting, diagnosing and treating hepatocellular carcinomas (hcc)
WO2005047477A2 (en) 2003-11-07 2005-05-26 University Of Massachusetts Interspersed repetitive element rnas as substrates, inhibitors and delivery vehicles for rnai
US20050164252A1 (en) 2003-12-04 2005-07-28 Yeung Wah Hin A. Methods using non-genic sequences for the detection, modification and treatment of any disease or improvement of functions of a cell
WO2005060661A2 (en) 2003-12-19 2005-07-07 The Regents Of The University Of California Methods and materials for assessing prostate cancer therapies
WO2005078139A2 (en) * 2004-02-09 2005-08-25 Thomas Jefferson University DIAGNOSIS AND TREATMENT OF CANCERS WITH MicroRNA LOCATED IN OR NEAR CANCER-ASSOCIATED CHROMOSOMAL FEATURES
US20050256072A1 (en) 2004-02-09 2005-11-17 University Of Massachusetts Dual functional oligonucleotides for use in repressing mutant gene expression
AU2005214904B2 (en) 2004-02-13 2011-07-21 Rockefeller University Anti-microRNA oligonucleotide molecules
US20050182005A1 (en) * 2004-02-13 2005-08-18 Tuschl Thomas H. Anti-microRNA oligonucleotide molecules
WO2005080601A2 (en) 2004-02-23 2005-09-01 Erasmus Universiteit Rotterdam Classification, diagnosis and prognosis of acute myeloid leukemia by gene expression profiling
US7365058B2 (en) 2004-04-13 2008-04-29 The Rockefeller University MicroRNA and methods for inhibiting same
NZ551019A (en) * 2004-04-20 2009-08-28 Genaco Biomedical Products Inc Method for detecting ncRNA
EP2322650A1 (en) 2004-05-14 2011-05-18 Rosetta Genomics Ltd MicroRNAs and uses thereof
EP2290071B1 (en) 2004-05-28 2014-12-31 Asuragen, Inc. Methods and compositions involving microRNA
US7635563B2 (en) 2004-06-30 2009-12-22 Massachusetts Institute Of Technology High throughput methods relating to microRNA expression analysis
US20060037088A1 (en) 2004-08-13 2006-02-16 Shulin Li Gene expression levels as predictors of chemoradiation response of cancer
WO2006028967A2 (en) * 2004-09-02 2006-03-16 Yale University Regulation of oncogenes by micrornas
US7592441B2 (en) 2004-10-04 2009-09-22 Rosetta Genomics Ltd Liver cancer-related nucleic acids
US7642348B2 (en) 2004-10-04 2010-01-05 Rosetta Genomics Ltd Prostate cancer-related nucleic acids
FR2877350B1 (en) 2004-11-03 2010-08-27 Centre Nat Rech Scient IDENTIFICATION AND USE OF miRNAs INVOLVED IN THE DIFFERENTIATION OF CELLS FROM MYELOID LEUKEMIA
JP2008519606A (en) 2004-11-12 2008-06-12 アンビオン インコーポレーティッド Methods and compositions relating to miRNA and miRNA-inhibiting molecules
US7361752B2 (en) 2004-12-14 2008-04-22 Alnylam Pharmaceuticals, Inc. RNAi modulation of MLL-AF4 and uses thereof
US20060185027A1 (en) * 2004-12-23 2006-08-17 David Bartel Systems and methods for identifying miRNA targets and for altering miRNA and target expression
US20070099196A1 (en) 2004-12-29 2007-05-03 Sakari Kauppinen Novel oligonucleotide compositions and probe sequences useful for detection and analysis of micrornas and their target mRNAs
WO2006081284A2 (en) 2005-01-25 2006-08-03 Rosetta Inpharmatics Llc Methods for quantitating small rna molecules
US8071306B2 (en) 2005-01-25 2011-12-06 Merck Sharp & Dohme Corp. Methods for quantitating small RNA molecules
US20070065840A1 (en) 2005-03-23 2007-03-22 Irena Naguibneva Novel oligonucleotide compositions and probe sequences useful for detection and analysis of microRNAS and their target mRNAS
GB2425311A (en) 2005-04-15 2006-10-25 Ist Superiore Sanita Micro RNA against kit protein
JP5173793B2 (en) 2005-04-29 2013-04-03 ザ ロックフェラー ユニバーシティ MicroRNA and method for inhibiting the same
EP1904111A4 (en) 2005-06-03 2009-08-19 Univ Johns Hopkins COMPOSITIONS AND METHODS FOR DECREASING MICROARN EXPRESSION FOR THE TREATMENT OF NEOPLASIA
US20070065844A1 (en) 2005-06-08 2007-03-22 Massachusetts Institute Of Technology Solution-based methods for RNA expression profiling
US20060292616A1 (en) * 2005-06-23 2006-12-28 U.S. Genomics, Inc. Single molecule miRNA-based disease diagnostic methods
WO2007021896A2 (en) 2005-08-10 2007-02-22 Alnylam Pharmaceuticals, Inc. Chemically modified oligonucleotides for use in modulating micro rna and uses thereof
US20070213292A1 (en) 2005-08-10 2007-09-13 The Rockefeller University Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
EP1937280B1 (en) 2005-09-12 2014-08-27 The Ohio State University Research Foundation Compositions for the therapy of bcl2-associated cancers
WO2007044413A2 (en) 2005-10-05 2007-04-19 The Ohio State University Research Foundation Wwox gene, vectors containing the same, and uses in treatment of cancer
US7390792B2 (en) 2005-12-15 2008-06-24 Board Of Regents, The University Of Texas System MicroRNA1 therapies
WO2007081720A2 (en) 2006-01-05 2007-07-19 The Ohio State University Research Foundation Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer
CN103361424A (en) 2006-01-05 2013-10-23 俄亥俄州立大学研究基金会 MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors
EP2487256B1 (en) 2006-01-05 2015-07-01 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis and treatment of solid cancers
WO2007084486A2 (en) 2006-01-13 2007-07-26 Battelle Memorial Institute Animal model for assessing copd-related diseases
WO2007109236A2 (en) 2006-03-20 2007-09-27 The Ohio State University Research Foundation Microrna fingerprints during human megakaryocytopoiesis
US20090324618A1 (en) 2006-03-24 2009-12-31 Armstrong Scott A Novel signature self renewal gene expression programs
MX2008012219A (en) 2006-04-03 2008-10-02 Santaris Pharma As Pharmaceutical composition comprising anti-mirna antisense oligonucleotides.
AU2007243475B2 (en) 2006-04-24 2013-02-07 The Ohio State University Research Foundation Pre-B cell proliferation and lymphoblastic leukemia/high-grade lymphoma in miR155 transgenic mice
WO2008008430A2 (en) * 2006-07-13 2008-01-17 The Ohio State University Research Foundation Micro-rna-based methods and compositions for the diagnosis and treatment of colon cancer-related diseases
BRPI0715506A2 (en) 2006-08-30 2014-07-08 Univ Michigan NEW SMALL INHIBITORS MDM2 AND USES OF THE SAME
US20080193943A1 (en) 2006-09-05 2008-08-14 Abbott Laboratories Companion diagnostic assays for cancer therapy
JP2010504350A (en) 2006-09-19 2010-02-12 アシュラジェン インコーポレイテッド Genes and pathways regulated by miR-200 as targets for therapeutic intervention
JP5520605B2 (en) 2006-09-19 2014-06-11 アシュラジェン インコーポレイテッド MicroRNA differentially expressed in pancreatic diseases and uses thereof
WO2008036776A2 (en) 2006-09-19 2008-03-27 Asuragen, Inc. Mir-15, mir-26, mir -31,mir -145, mir-147, mir-188, mir-215, mir-216 mir-331, mmu-mir-292-3p regulated genes and pathways as targets for therapeutic intervention
AU2007346101B2 (en) 2006-09-19 2013-08-15 The Ohio State University Research Foundation TCL1 expression in chronic lymphocytic leukemia (CLL) regulated by miR-29 and miR-181
AU2007314212B2 (en) 2006-11-01 2014-05-29 The Govt. Of The Usa As Represented By The Secretary Of The Department Of Health And Human Services MicroRNA expression signature for predicting survival and metastases in Hepatocellular carcinoma
US8293684B2 (en) 2006-11-29 2012-10-23 Exiqon Locked nucleic acid reagents for labelling nucleic acids
WO2008070082A2 (en) 2006-12-04 2008-06-12 The Johns Hopkins University Stem-progenitor cell specific micro-ribonucleic acids and uses thereof
WO2008073919A2 (en) 2006-12-08 2008-06-19 Asuragen, Inc. Mir-20 regulated genes and pathways as targets for therapeutic intervention
WO2008073920A2 (en) 2006-12-08 2008-06-19 Asuragen, Inc. Mir-21 regulated genes and pathways as targets for therapeutic intervention
CA2671299A1 (en) 2006-12-08 2008-06-19 Asuragen, Inc. Functions and targets of let-7 micro rnas
CN101622349A (en) 2006-12-08 2010-01-06 奥斯瑞根公司 miR-20 regulated genes and pathways as targets for therapeutic intervention
CA2671270A1 (en) 2006-12-29 2008-07-17 Asuragen, Inc. Mir-16 regulated genes and pathways as targets for therapeutic intervention
US8034560B2 (en) 2007-01-31 2011-10-11 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia (AML)
CA2699418A1 (en) 2007-02-27 2008-09-04 Moshe Oren Composition and methods for modulating cell proliferation and cell death
EP2126584B1 (en) 2007-03-16 2012-12-19 CovalX AG Direct mass spectrometric analysis of drug candidates targeting protein complexes
RU2009141359A (en) 2007-04-10 2011-05-20 Нэйшнл Тайвань Юниверсити (Tw) POST-THERAPEIC FORECAST OF SURVIVAL OF CANCER PATIENTS USING MICRORNA
AU2008248319B2 (en) 2007-04-30 2013-09-05 The Ohio State University Research Foundation Methods for differentiating pancreatic cancer from normal pancreatic function and/or chronic pancreatitis
US20090005336A1 (en) 2007-05-08 2009-01-01 Zhiguo Wang Use of the microRNA miR-1 for the treatment, prevention, and diagnosis of cardiac conditions
US20090232893A1 (en) 2007-05-22 2009-09-17 Bader Andreas G miR-143 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
US20090131354A1 (en) 2007-05-22 2009-05-21 Bader Andreas G miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION
WO2008154098A2 (en) 2007-06-07 2008-12-18 Wisconsin Alumni Research Foundation Reagents and methods for mirna expression analysis and identification of cancer biomarkers
AU2008262252B2 (en) 2007-06-08 2013-09-12 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for determining hepatocellular carcinoma subtype and detecting hepatic cancer stem cells
WO2008154333A2 (en) 2007-06-08 2008-12-18 Asuragen, Inc. Mir-34 regulated genes and pathways as targets for therapeutic intervention
EP2719773A3 (en) 2007-06-15 2014-07-30 The Ohio State University Research Foundation miRNA as marker for acute lamphomic leucemia
ES2496172T3 (en) 2007-07-31 2014-09-18 The Ohio State University Research Foundation Methods to reverse methylation by targeted selection of DNMT3A and DNMT3B
AU2008283997B2 (en) 2007-08-03 2014-04-10 The Ohio State University Research Foundation Ultraconserved regions encoding ncRNAs
WO2009026487A1 (en) 2007-08-22 2009-02-26 The Ohio State University Research Foundation Methods and compositions for inducing deregulation of epha7 and erk phosphorylation in human acute leukemias
US20090061424A1 (en) 2007-08-30 2009-03-05 Sigma-Aldrich Company Universal ligation array for analyzing gene expression or genomic variations
CN101939446B (en) 2007-09-06 2015-02-11 俄亥俄州立大学研究基金会 MicroRNA signatures in human ovarian cancer
EP2212440A4 (en) 2007-10-11 2011-04-06 Univ Ohio State Res Found METHODS AND COMPOSITIONS FOR DIAGNOSING AND TREATING ADENOCARCINOMA OF SOPHAGE
WO2009055773A2 (en) 2007-10-26 2009-04-30 The Ohio State University Research Foundation Methods for identifying fragile histidine triad (fhit) interaction and uses thereof
EP2217706B1 (en) 2007-11-12 2015-05-27 The Government of the United States of America as represented by the Secretary of the Department of Health and Human Services Therapeutic applications of p53 isoforms in regenerative medicine, aging and cancer
US20090123933A1 (en) 2007-11-12 2009-05-14 Wake Forest University Health Sciences Microrna biomarkers in lupus
EP2225396A4 (en) 2007-11-30 2011-03-02 Univ Ohio State Res Found MICRO-RNA EXPRESSION PROFILING AND OBJECTIVE IN PERIPHERAL BLOOD IN LUNG CANCER
US8071562B2 (en) 2007-12-01 2011-12-06 Mirna Therapeutics, Inc. MiR-124 regulated genes and pathways as targets for therapeutic intervention
WO2009086156A2 (en) 2007-12-21 2009-07-09 Asuragen, Inc. Mir-10 regulated genes and pathways as targets for therapeutic intervention
EP2604704B1 (en) 2008-02-01 2018-10-03 The General Hospital Corporation Use of microvesicles in diagnosis and prognosis of brain tumor
US20090263803A1 (en) 2008-02-08 2009-10-22 Sylvie Beaudenon Mirnas differentially expressed in lymph nodes from cancer patients
CN102007408A (en) 2008-02-28 2011-04-06 俄亥俄州立大学研究基金会 Microrna signatures associated with cytogenetics and prognosis in acute myeloid leukemia (aml) and uses thereof
JP2011517932A (en) 2008-02-28 2011-06-23 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション MicroRNA signatures associated with human chronic lymphocytic leukemia (CCL) and uses thereof
CN102007223B (en) 2008-02-28 2014-06-18 俄亥俄州立大学研究基金会 Microrna-based methods and compositions for the diagnosis, prognosis and treatment of gastric cancer
CA2716938A1 (en) 2008-02-28 2009-09-03 The Ohio State University Research Foundation Microrna-based methods and compositions for the diagnosis, pronosis and treatment of prostate related disorders
EP2268832A2 (en) 2008-03-06 2011-01-05 Asuragen, INC. Microrna markers for recurrence of colorectal cancer
US20090253780A1 (en) 2008-03-26 2009-10-08 Fumitaka Takeshita COMPOSITIONS AND METHODS RELATED TO miR-16 AND THERAPY OF PROSTATE CANCER
EP2285960B1 (en) 2008-05-08 2015-07-08 Asuragen, INC. Compositions and methods related to mir-184 modulation of neovascularization or angiogenesis
EP2306978A2 (en) 2008-06-06 2011-04-13 Mirna Therapeutics, Inc. Compositions for the in vivo delivery of rnai agents
CN102149827B (en) 2008-06-11 2014-08-20 由卫生与公众服务部代表的美利坚合众国政府 Use of the MiR-26 family as a predictive marker for hepatocellular carcinoma and responsiveness to treatment
JP2012500389A (en) 2008-08-12 2012-01-05 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション MicroRNA-based compositions and methods for diagnosis, prognosis and treatment of multiple myeloma
JP2012509886A (en) 2008-11-21 2012-04-26 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション Tcl1 as a transcriptional regulator
AU2009322907B2 (en) 2008-12-05 2016-05-05 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis and treatment of ovarian cancer
CA2753562A1 (en) 2009-02-26 2010-09-02 The Ohio State University Research Foundation Micrornas in never-smokers and related materials and methods

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8658370B2 (en) * 2005-08-01 2014-02-25 The Ohio State University Research Foundation MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Eis et al. (PNAS, 2005 Vol. 102, pages 3627-3632). *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9017940B2 (en) 2006-01-05 2015-04-28 The Ohio State University Methods for diagnosing colon cancer using MicroRNA signatures
US9873916B2 (en) 2011-04-25 2018-01-23 Toray Industries, Inc. Method for predicting response to trastuzumab therapy in breast cancer patients
US9434995B2 (en) 2012-01-20 2016-09-06 The Ohio State University Breast cancer biomarker signatures for invasiveness and prognosis
WO2016205461A1 (en) * 2015-06-16 2016-12-22 Emory University Detecting microrna and iso-microrna to evaluate vascular and cardiac health
WO2017095213A1 (en) * 2015-12-04 2017-06-08 Instituto Nacional De Medicina Genómica Method for prognosis in breast cancer
WO2024261242A1 (en) 2023-06-22 2024-12-26 Fondazione Di Religione E Di Culto "Casa Sollievo Della Sofferenza" - Opera Di San Pio Da Pietrelcina Prognostic method for non-metastatic female breast cancer

Also Published As

Publication number Publication date
CN105902559A (en) 2016-08-31
CN103820562A (en) 2014-05-28
CN102533966B (en) 2014-03-12
JP2013116114A (en) 2013-06-13
CN101341259A (en) 2009-01-07
CN103866018B (en) 2016-05-25
CN102533966A (en) 2012-07-04
ES2545383T3 (en) 2015-09-10
CN103882124B (en) 2015-11-18
EP1937845A4 (en) 2009-11-18
JP5489459B2 (en) 2014-05-14
US20080261908A1 (en) 2008-10-23
EP1937845A2 (en) 2008-07-02
JP2013230161A (en) 2013-11-14
CN101341259B (en) 2011-12-21
CN103866018A (en) 2014-06-18
WO2007016548A2 (en) 2007-02-08
EP1937845B1 (en) 2015-06-10
CN103866017B (en) 2016-05-25
CN103866017A (en) 2014-06-18
CN103882124A (en) 2014-06-25
WO2007016548A3 (en) 2007-08-30
CN103820562B (en) 2015-05-13
CA2617581A1 (en) 2007-02-08
US8658370B2 (en) 2014-02-25
US20160251659A1 (en) 2016-09-01
JP2009505639A (en) 2009-02-12

Similar Documents

Publication Publication Date Title
US8658370B2 (en) MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer
US9574239B2 (en) MicroRNA signatures in human ovarian cancer
EP2109687B1 (en) Micro-rna-based methods for the treatment of acute myeloid leukemia
AU2008310704B2 (en) Methods and compositions for the diagnosis and treatment of esphageal adenocarcinomas
US8071292B2 (en) Leukemia diagnostic methods
US20110152357A1 (en) Micro-RNA-Based Compositions and Methods for the Diagnosis, Prognosis and Treatment of Multiple Myeloma
EP1713938A2 (en) DIAGNOSIS AND TREATMENT OF CANCERS WITH MicroRNA LOCATED IN OR NEAR CANCER-ASSOCIATED CHROMOSOMAL FEATURES
AU2015202920B2 (en) MicroRNA signatures in human ovarian cancer

Legal Events

Date Code Title Description
AS Assignment

Owner name: THE OHIO STATE UNIVERSITY, OHIO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CROCE, CARLO M.;CALIN, GEORGE A.;SIGNING DATES FROM 20080221 TO 20080226;REEL/FRAME:031888/0160

Owner name: THE OHIO STATE UNIVERSITY RESEARCH FOUNDATION, OHI

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:THE OHIO STATE UNIVERSITY;REEL/FRAME:031888/0221

Effective date: 20090327

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:OHIO STATE UNIVERSITY;REEL/FRAME:037114/0023

Effective date: 20151112

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH, MARYLAND

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:THE OHIO UNIVERSITY;REEL/FRAME:053125/0119

Effective date: 20200706

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH, MARYLAND

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:THE OHIO STATE UNIVERSITY;REEL/FRAME:053185/0303

Effective date: 20200713