US20140093501A1 - Human-Murine Chimeric Antibodies Against Respiratory Syncytial Virus - Google Patents
Human-Murine Chimeric Antibodies Against Respiratory Syncytial Virus Download PDFInfo
- Publication number
- US20140093501A1 US20140093501A1 US14/039,174 US201314039174A US2014093501A1 US 20140093501 A1 US20140093501 A1 US 20140093501A1 US 201314039174 A US201314039174 A US 201314039174A US 2014093501 A1 US2014093501 A1 US 2014093501A1
- Authority
- US
- United States
- Prior art keywords
- antibody
- human
- murine
- cdr
- rsv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C07K16/1027—
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/10—RNA viruses
- C07K16/11—Paramyxoviridae (F); Pneumoviridae (F), e.g. respiratory syncytial virus [RSV]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- Respiratory syncytial virus is the major cause of acute respiratory illness in young children admitted to hospitals, and the community practice will treat perhaps five times the number of hospitalized children. It is therefore, the most common cause of lower respiratory tract infection in young children. While the majority of community-acquired RSV infections resolve themselves in a week to ten days, many hospitalized children, especially under six months of age require assisted ventilation.
- ribavirin has been licensed for therapy of RSV pneumonia and bronchiolitis (2,3); its value is controversial (4).
- ribavirin has shown efficacy (9), the drug has to be administered over an 18 hour period by aerosol inhalation.
- the level of secondary infections following cessation of treatment is significantly higher than in untreated patients.
- RSV immunoglobulin was effective both in prophylaxis and therapy for RSV infections in animal models (6, 7). Infected animals treated with RSV immune globulin, showed no evidence of pulmonary immune-complex disease (6, 7).
- RSV hyperimmune globulin Even if RSV hyperimmune globulin is shown to reduce the incidence and severity of RSV lower respiratory tract infection in high risk children, several disadvantages may limit its use.
- One drawback is the necessity for intravenous infusion in these children who have limited venous access because of prior intensive therapy.
- a second disadvantage is the large volume of RSVIG required for protection, particularly since most these children have compromised cardiopulmonary function.
- a third disadvantage is that intravenous infusion necessitates monthly hospital visits during the RSV season which places these children at risk of nosocomial RSV infection (1).
- a final problem is that it may prove to be very difficult to select sufficient donors to produce a hyperimmune globulin for RSV to meet the demand for this product.
- Currently only about 8% of normal donors have RSV neutralizing antibody titers high enough to qualify for the production of hyperimmune globulin.
- Another approach may be the development of monoclonal antibodies with high specific neutralizing activity as an alternative to hyperimmune globulin. It is preferable, if not necessary, to use human monoclonal antibodies rather than murine or rat antibodies to minimize the development of human anti-rodent antibody responses which may compromise the therapeutic efficacy of the antibody or induce immune-complex pathology. However, the generation of human monoclonal antibodies with the desired specificity may be difficult and the level of production from human cell lines is often low, precluding their development.
- CDR complementarity determining region
- the monoclonal antibody may be derived from any non-human animal, preferably however, it is derived from a rodent and most preferably it is a murine monoclonal antibody.
- the murine monoclonal antibody is a neutralizing antibody. It is also preferable that said murine antibody is an antibody against RSV F antigen.
- animal as used herein is used in its broadest sense includes mammals including humans.
- FIG. 1A-B shows the amino acid (AA) sequence design of CDR-Grafted anti-RSV F glycoprotein V H .
- the figure depicts the AA sequence for the human HV3 V H before grafting (SEQ ID NO:16), CDR grafted V H (SEQ ID NO:17), and murine MAb1308F V H (SEQ ID NO:18) from which the CDR sequence was grafted.
- the heavily underlined regions identify the CDR sequence which was grafted into the human HV3 V H and each of the three regions is identified as CDR1, CDR2 and CDR3, respectively.
- FIG. 2A-B shows the amino acid (AA) sequence design of CDR-Grafted anti-RSV F Protein V L .
- the figure depicts the AA sequence for the human K102 V L before grafting (SEQ ID NO:19), CDR grafted V L (SEQ ID NO:20), and murine MAb1308F V L (SEQ ID NO:21) from which the CDR sequence was grafted.
- the heavily underlined regions identify the CDR sequence which was grafted into the human K102 V L and each of the three regions is identified as CDR1, CDR2 and CDR3, respectively.
- FIG. 3A-B depicts the oligonucleotides used to make Hu1308 V H , the sequences which are underlined are the specific primer sequences (SEQ ID NO:22-25).
- FIG. 4A-B depicts the oligonucleotides used to make Hu1308 V L , the sequences which are underlined are the specific primer sequences (SEQ ID NO:26-29).
- FIG. 5 depicts the plasmid construction of the expression vectors for Humanized 1308.
- FIG. 6 depicts a graph of the neutralization of RSV as percent neutralization versus ng MAb per reaction for neutralizing with Cos Hu1308F and with Mu1308F.
- FIG. 7A-B shows the amino acid (AA) sequence design of CDR-Grafted anti-RSV F glycoprotein V H .
- the figure depicts the AA sequence for the human COR V H before grafting (SEQ ID NO:30), CDR grafted V H (SEQ ID NO:31), and murine MAb1129 V H (SEQ ID NO:32) from which the CDR sequence was grafted.
- the heavily underlined regions identify the CDR sequence which was grafted into the human COR V H and each of the three regions is identified as CDR1 (SEQ ID NO:43), CDR2 (SEQ ID NO:44) and CDR3 (SEQ ID NO:45), respectively.
- FIG. 8A-B shows the amino acid (AA) sequence design of CDR-Grafted anti-RSV F Protein V L .
- the figure depicts the AA sequence for the human K102 V L before grafting (SEQ ID NO:33), CDR grafted V L (SEQ ID NO:34), and murine MAb1129 V L (SEQ ID NO:35) from which the CDR sequence was grafted.
- the heavily underlined regions identify the CDR sequence which was grafted into the human K102 V L and each of the three regions is identified as CDR1 (SEQ ID NO:46), CDR2 (SEQ ID NO:47) and CDR3 (SEQ ID NO:48), respectively.
- FIG. 9A-B shows the oligonucleotides used to construct the humanized 1129 V (SEQ ID NO:36-42).
- FIG. 10 shows binding data for humanized 1129 in an ELISA assay.
- the murine antibody is a neutralizing antibody against RSV.
- Another aspect of the present invention provides for the murine antibody to be an antibody against RSV F antigen.
- the murine antibody is neutralizing antibody against RSV F antigen.
- the substitution of the mouse CDR's into the human variable framework segments minimizes the potential for human anti-mouse antibody (HAMA) responses while retaining binding affinity and specificity for antigen, RSV F protein.
- the human antibodies containing the murine antibody CDR's are essentially indistinguishable from completely human antibodies, thereby, minimizing the human antibody response while retaining binding affinity and specificity for RSV F antigen.
- murine antibodies of this type are: MAb 1436C, MAb 113, MAb 112, MAb 151, MAb 1200, MAb 1214, MAb 1237, MAb 1129, MAb 1121, MAb 1107, MAb 131-1, MAb 43-1, MAb 1112, MAb 1269, MAb 1243, MAb 1331H, MAb 1308F and MAb 1302A (see citation 21).
- An aspect of the present invention provides that the CDRs of the human antibody are comprised of three complementarity determining regions (CDRs) from each variable heavy and variable light chain of the murine antibody.
- CDRs complementarity determining regions
- the murine antibodies against RSV F antigen have been mapped by competitive binding and reactivity profiles of virus escape mutants to three broad antigenic sites (A, B, C) containing 16 distinct epitopes (20).
- the epitopes within antigenic sites A and C have shown the least variability in natural isolates.
- another aspect of this invention provides for a human antibody containing at least one CDR from each variable heavy and variable light chain of at least one murine antibody against RSV F antigen which is specific for antigenic site A or C.
- this invention provides for the murine antibody against RSV F antigen specific for antigenic site C, where the murine antibody is MAb 1308F.
- a human antibody contains CDR's of the variable heavy chain of murine antibody MAb 1308F against the RSV F antigen.
- the CDR variable heavy chain of MAb 1308F comprises three CDRs having the following amino acid sequences: Nos. 31 to 35, 47 to 60 and 99 to 106.
- this embodiment contains CDR's of a variable light chain of MAb 1308F of murine antibody against RSV F antigen.
- the CDR variable light chain comprises three CDR's having the following amino acid sequences: Nos. 24 to 34, 50 to 56 and 89 to 97.
- Another aspect of this invention provides for a human antibody containing at least one CDR from each variable heavy and variable light chain of at least one murine antibody against RSV F antigen which is specific for antigenic site A.
- this invention provides for the murine antibody against RSV F antigen specific for antigenic site A, where the murine antibody is MAb 1129.
- a human antibody which contains CDR's of the variable heavy chain of murine antibody MAb 1129 against the RSV F antigen.
- the CDR variable heavy chain of MAb 1129 comprises three CDRs having the following amino acid residues: Nos. 31 to 37, 52 to 67 and 100 to 109.
- this embodiment contains CDR's of a variable light chain of MAb 1129 of murine antibody against RSV F antigen.
- the CDR variable light chain comprises three CDR's having the following amino acid residues: Nos. 24 to 33, 50 to 56 and 89 to 97.
- An additional aspect of applicants' invention is a process for preventing or treating RSV infection comprising administering to the animal an effective amount of a human antibody containing at least one CDR from each variable heavy and variable light chain, of at least one murine antibody against RSV F antigen.
- compositions comprising administering an effective amount of the human antibody as described above in conjunction with an acceptable pharmaceutical carrier.
- Acceptable pharmaceutical carriers include but are not limited to non-toxic buffers, fillers, isotonic solutions, etc.
- composition of Applicant's invention may be administered topically or systemically.
- topical administration are intranasal administration and inhalation of an aerosol containing the human antibody composition.
- Systemic administration may be accomplished by intravenous or intramuscular injection of the human antibody composition.
- a preferred aspect of Applicants' invention is that the human antibody is administered as part of a plurality of human antibodies against RSV F antigen. These antibodies can be against the same or different epitopes of the RSV F antigen.
- the human antibody of this invention can be used clinically for diagnosing respiratory syncytial virus in patients. Because of their affinity for RSV F antigen these human antibodies can be used in known diagnostic assay procedures for detecting the presence and concentration of RSV F antigen cells in samples, e.g., body fluids.
- the human antibodies of the present invention can for example be attached or bound to a solid support, such as latex beads, a column, etc., which are then contacted with a sample believed to contain RSV F antigen.
- One such antibody was selected, which is specific for antigenic site C, to produce mouse-human chimeric antibodies.
- This antibody was chosen on the basis that it: (i) reacted with a large number of virus strains tested (at least 13 out of 14 isolated); (ii) retained neutralizing activity against virus escape mutants selected with other anti-F antibodies and (iii) blocked RSV replication when administered at low doses to cotton rats by intranasal route prior to virus challenge. The antibody showed significant reduction in pulmonary virus titer among antibodies in that respective region.
- Murine antibody 1308F specific for the C region of RSV F protein, was chosen as the initial target for humanization.
- the human antibodies were constructed as follows: the RNA was extracted from the murine antibody-producing cell line, the murine variable regions which are responsible for the binding of the antibody to RSV were cloned and sequenced, resulting in the identification of the murine antibody CDRs. Then a human variable heavy and light chain framework sequence having the highest homology with the variable heavy and light chain murine antibody, was selected. A human framework sequence such as described above is best able to accept the murine-derived CDRs.
- the murine 1308F variable heavy chain was compared to various human germline genes, the highest homology was to the human germline gene HV3.
- the two sequences were 62% homologous overall and 65% in the framework regions. Significantly, there is good homology at the junctions of the CDR segments and the frameworks with the exception of the 5′ end of FR2.
- the murine derived variable heavy chain CDRs were then substituted into the variable heavy chain human germline gene HV3.
- the mouse and human sequences as well as that of a potential CDR-Grafted combination of the two is shown in FIG. 1A-B .
- V L region A similar analysis of the V L region revealed high homology to the human germ line V-Kappa gene K 102. The alignment of these sequences is shown in FIG. 2A-B . In this case the homology is 62% overall and 73% in the framework regions. The murine-derived variable light CDRs were then substituted into the human variable light chain of human germline gene K102. In each case a human J-region can be selected which is identical to the mouse sequence.
- murine 1129 variable heavy chain was compared to various human variable region amino acid sequences, the highest homology was to the human rearranged COR sequence.
- the two amino acid sequences were 75% homologous overall and 80% in the framework regions. Significantly, there is good homology at the junctions of the CDR segments and the frameworks.
- the murine derived variable heavy chain CDRs were then substituted into the variable heavy chain human COR V H sequence.
- the mouse and human sequences as well as that of a potential CDR-Grafted combination of the two is shown in FIG. 7A-B .
- V L region revealed high homology to the human germ line K102.
- the alignment of these sequences is shown in FIG. 8A-B .
- the homology is 73% overall and 82% in the framework regions.
- the murine-derived variable light CDRs were then substituted into the human variable light chain of human germline K102.
- a human J-region, human JK4 was selected which is similar to the mouse sequence.
- human antibodies are expressed and characterized relative to the parental murine antibodies to be certain that the genetic manipulation has not drastically altered the binding properties of the antibodies.
- cDNA copies of the V H and V L of the target antibody were generated as follows.
- the first strand cDNA reaction was carried out using AMV reverse transcriptase and a phosphorylated oligonucleotide primer complementary to a segment of the mRNA coding for the constant region of the particular heavy or light chain isotype.
- the isotype is gamma1, kappa and the specific oligonucleotides were 5′AGCGGATCCAGGGGCCAGTGGATAGAC (SEQ ID NO:1) complementary to codons 129-137 of the CH1 region of the murine Gamma1 gene, and 5′TGGATGGTGGGAAGATG (SEQ ID NO:2) complementary to codons 116-122 of the murine C-kappa gene.
- the primer anneals to a segment of the mRNA adjacent to the variable region.
- Second strand cDNA synthesis was carried out using RNase H and E. coli DNA polymerase I, as described by Gubler and Hoffman (Gene 25,;263, 1983), followed by T4 DNA polymerase to assure that blunt ends are produced.
- the ds-cDNA was ligated into pUC18 which had been digested with restriction endonuclease SmaI and treated with alkaline phosphatase.
- the ligation was used to transform E. coli DH5a by the method of Hanahan (J. Mol. Biol. 166;557, 1983).
- Oligonucleotide probes corresponding to C-region sequence lying between the first strand cDNA primer and the V-region were used in colony hybridizations to identify transformants carrying the desired cDNA segment.
- the specific probe sequences were GGCCAGTGGATAGAC (SEQ ID NO:3) complementary to codons 121-125 of murine CH1 regions and TACAGTTGGTGCAGCA (SEQ ID NO:4) complementary to codons 110-115 of c-Kappa, respectively.
- Candidate plasmids isolated from colonies which were positive in the hybridization, were analyzed by digestion with restriction endonucleases Eco RI and Hind III to release the CDNA insert. Those with inserts of 400-500 bp were subjected to DNA sequencing.
- the cDNA inserts were inserted into M13 mp18 and mp19 for the determination of the DNA sequence on both strands.
- Single stranded DNA from the resulting recombinant bacteriophage was isolated and sequenced by the dideoxy chain termination method (Proc. Nat. Acad. Sci. USA 74; 5463, 1977).
- the CDR regions of the V H and V L were identified by comparing the amino acid sequence to known sequences as described by Kabat (38). In order to select the human framework sequences best able to accept the mouse derived CDR sequences in a conformation which retains the structure of the antigen combining site, the following strategy was employed. First, the sequence of the murine V H and V L regions will be compared to known human sequences from both the Genbank and NBRF protein databanks using the Wordsearch program in the Wisconsin package of sequence manipulation programs (Nucleic Acid Res. 12; 387). The best several human V-regions were then analyzed further on the basis of similarity in the framework regions, especially at the junctions of the framework and CDR regions (see FIGS. 1A-B and 2 A-B).
- the CDR-grafted V H region together with the respective leader sequence of the human v-region gene was synthesized de novo using four overlapping oligonucleotides ranging from 100-137 nucleotides in length (see FIG. 3A-B ).
- the oligonucleotides were first allowed to anneal in pairwise combinations and extended with DNA polymerase to generate approximately 200 bp ds DNA fragments with an overlapping region.
- the fragments were then mixed and subjected to PCR using primers at the 3′ end of one fragment and the 5′ end of the other fragment.
- the only product which can be formed under these condition is the full length V H segment.
- the specific primer sequences are underlined in FIG. 3A-B .
- An endonuclease Sac I site was included at the 3′ end of the V H sequence in order to join it to a human constant region gene segment.
- the CDR-grafted V L region was synthesized in a similar way (see FIG. 4A-B ).
- the initial 200 bp fragments were amplified separately and inserted into separate plasmids.
- the fragment coding for the amino terminus was cloned into a pUC18 derivative as an NcoI-SmaI fragment while the fragment coding for the carboxyl-terminus was cloned as a SmaI to Hind III fragment.
- the fragments were subsequently combined via a SmaI site at the junction.
- the oligonucleotides are indicated in FIG. 4A-B .
- a Hind III site was included near the 3′ end of the gene segment in order to join it to a human C-kappa gene.
- the NcoI-SacI fragment representing the humanized V H was joined to a SacI-NotI fragment representing a human c-Gamma I CDNA and inserted into pS 18 (which is pUC 18 with Nco1 and NotI restriction sites incorporated into the polylinker region between the BamHI and Kpn1 sites).
- the humanized 1308F-gamma1 gene on a SacI-NotI fragment was then combined with a Pvu1-NotI fragment from pSJ37 carrying a poly A addition site and a PvuI-SacI fragment from pSV2-dhfr-pCMV containing the SV40 origin of replication, a dhfr gene and the CMV immediate early promoter.
- the resulting plasmid was designated pSJ60.
- the NcoI-HindIII fragment representing the humanized V L was joined to a HindIII-NotI fragment representing a human c-Kappa CDNA in pS18.
- the humanized 1308F-Kappa gene on a SalI-NotI fragment was then combined with a Pvu1-NotI fragment from pSJ37 carrying a poly A addition site and a PvuI-SalI fragment from pSV2-dhfr-pCMV, containing the SV40 origin of replication, a dhfr gene and the CMV immediate early promoter.
- the resulting plasmid was designated pSJ61.
- pSJ60 and pSJ61 were combined into a single plasmid containing both the light and heavy chains and expression signals. This was accomplished by isolating a PvuI-Bam HI fragment from pSJ61 carrying the light chain with a PvuI-Bgl II fragment from pSJ60 carrying the heavy chain to generate pSJ66. (See FIG. 5 ).
- COS 1 cells (ATCC CRL1650) were maintained in a humidified 5% C02 incubator in 75 cm 2 tissue culture flasks in Dulbecco's Modified Eagle Medium (DMEM, GIBCO #320-1965) supplemented with 10% Fetal Bovine Serum (FBS, GIBCO #200-6140) and 2 mM L-glutamine (BRL #320-5030) and passed at a split ratio of 1:20 when the cells had reached confluence.
- DMEM Dulbecco's Modified Eagle Medium
- FBS Fetal Bovine Serum
- BBL #320-5030 2 mM L-glutamine
- tissue culture dishes were seeded with 1.5 ⁇ 10 6 cells per dish in 12 ml DMEM, 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin (P-S, GIBCO #600-5070).
- the day of the transfection 120 ug each of the plasmids pSJ60 and pSJ61 were combined, ethanol precipitated, and aseptically resuspended in 2.5 ml Tris-Buffered-Saline.
- the resuspended DNA was added dropwise, with mixing, to 10 ml of DMLEM containing 1 mg/ml DEAE-dextran (Phamiacia #17-0350-01) and 250 uM chloroquine (Sigma #C6628).
- the medium was removed from the COS1 cells in the 100 mm dishes and the cells were washed once with Dulbecco's phosphate buffered saline (D-PBS, GIBCO #310-4190), and 2.5 ml DMEM supplemented with 10% NuSerum (Collaborative Research #55000) were added to each plate.
- the medium was removed from the plates, pooled, and stored at ⁇ 20 C.
- the cells were harvested, pooled, and seeded into 4 150 cm 2 tissue culture flasks two with 40 ml DMEM/10% NuSerum and two with 40 ml DMEM/10% FBS/2 mM L-glutamine.
- the medium was collected and the cells refed at 7, 10, and 14 days. In this way a total of 125 ug of humanized 1308F antibody was accumulated in 310 ml of medium supplemented with FBS and 85 ug in 240 ml of medium supplemented with NuSerum.
- tissue culture dishes were seeded with 1.5 ⁇ 10 6 cells per dish in 12 ml DMEM, 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin (P-S, GIBCO #600-5070).
- 125 ug of the plasmid pSJ66 were ethanol precipitated and aseptically resuspended in 1.0 ml Tris-Buffered-Saline.
- the resuspended DNA was added dropwise, with mixing, to 4.0 ml of DMEM containing 1 mg/ml DEAE-dextran (Pharmacia #17-0350-01) and 250 uM chloroquine (Sigma #C6628).
- the medium was removed from the COS1 cells in the 100 mm dishes and the cells were washed once with Dulbecco's phosphate buffered saline (D-PBS, GIBCO #310-4190), and 2.5 ml DMEM supplemented with 10% NuSerum (Collaborative Research #55000) were added to each plate.
- the medium was removed from the plates, pooled, and stored at ⁇ 20 C.
- the cells were harvested, pooled, and seeded into 4 150 cm.sup.2 tissue culture flasks two with 40 ml DMEM/10% NuSerum and two with 40 ml DMEM/10% FBS/2 mM L-glutamine.
- the medium was collected and the cells refed at 7, 10, and 14 days. In this way a total of 190 ug of humanized 1308F antibody was accumulated in 310 ml of medium supplemented with FBS and 120 ug in 240 ml of medium supplemented with NuSerum.
- the concentration of humanized 1308F antibody secreted from the Cos1 cells into the medium was determined using a capture ELISA.
- Goat anti-human IgG Fc coated onto 96 well plates was used to capture the humanized antibody.
- Peroxidase conjugated goat anti-human whole IgG developed with a chromogenic substrate was then used to detect the bound antibody.
- a purified human IgG1/Kappa preparation was used to calibrate the assay.
- RSV was neutralized with either humanized 1308F from Cos cell supernatant or purified 1308F murine monoclonal antibody. This was done by incubating 50 plaque-forming units of RSV with serial 2-fold dilutions of antibody for 1.0 hour at 37 C. Confluent monolayers of Hep2 cells in 24 well panels were infected with 100 ⁇ l of antibody treated virus, untreated control virus, and mock infected controls. Incubated for 1.5 hours at 37 C, humidified, tand 5% CO 2 and overlayed with 1.5 mL EMEM, 1% FBS, and 1% methyl cellulose. Cells were fixed and stained with glutaldehyde and crystal violet on day 4.
- Poly-A+ RNA was purified from a lysate of 2 ⁇ 10 7 murine 1129 hybridoma cells using oligo-dt cellulose.
- First strand CDNA was made from 1 ug pA+ RNA using random hexamer primers and AMV reverse transcriptase 1 ug pA+ RNA, 50 mM Tris-HCl pH 8.5, 8 mM Mg 2 Cl, 30 mM KCl, 1 mM dithiothrietol, 1 mM dNTP's, 25 units of placental ribonuclease inhibitor, 33 uM random hexamer and 10 units of AMV reverse transcriptase for one hour at 42° C.
- the cDNA from the 1129 VL region was amplified by PCR using oligonucleotides SJ41 and SJ11, see Table 1.
- cDNA from the 1129 VH region was similarly amplified using oligonucleotides SJ42 and SJ10, see Table 1.
- the resulting DNA fragment(s) were then extracted once with phenol/chloroform (1/1), precipitated with 2.5 volumes of ETOH, resuspended in the appropriate restriction endonuclease buffer and digested with restriction endonucleases to produce cohesive ends for cloning.
- the resulting fragments were then separated by electrophoresis on a 1% agarose gel. After staining the gel with ethidium bromide the fragments were excised and purified from the agarose by freezing and extraction in the presence of phenol.
- the fragments were then digested with restriction endonucleases EcoR1 and BamH1 and cloned into plasmid pUC18.
- the inserts were then sequenced by the dideoxynucleotide chain termination method using modified T7 DNA polymerase (Sequenase, US Biochemical).
- the translated sequences were compared to human antibody protein sequences.
- the VL was found to be most homologous to the K102 light chain and the VH was found to be most homologous to the Cor VH region.
- the 1129 Fv region was then modeled by substitution of the residues from the 1129 VL and VH sequence into the coordinates of corresponding residues in the crystal structure the MCPC603 antibody. Residues were identified as being integral to the folded structure or solvent exposed by visual inspection of the model.
- the designed humanized 1129 VH was constructed using synthetic oligonucleotides SJ147-SJ153 ( FIG. 9A-B ) (SEQ ID NO:36-42) which were combined using PCR.
- the products of this PCR were then digested with Nco1 and Sac1 and cloned into plasmid vector pSJ40 which is a pUC18 derivative in which an out of frame lacZ1 segment is restored in frame as a fusion to an in-frame V region segment when such a segment is inserted as an Nco1-Sac1 fragment.
- pSJ40 is a pUC18 derivative in which an out of frame lacZ1 segment is restored in frame as a fusion to an in-frame V region segment when such a segment is inserted as an Nco1-Sac1 fragment.
- a plasmid containing an insert in which 5 mutations were clustered in a single 50 bp region was then subjected to repair of these changes using recombinant PCR
- the VL was generated by site directed mutagenesis of the humanized 1308F light chain gene.
- Oligonucleotides SJ155, see Table 1, (CDR1), and SJ157 (CDR3) were used to separately mutagenize the H1308L gene. Mutagenesis was carried out using T7 DNA polymerase on uracil containing single stranded DNA templates generated in E. coli strain BW313 (dut ⁇ ,ung ⁇ ) and subsequently transformed into E. coli strain DH5 (dut+,ung+). The two mutants were combined and CDR2 introduced by recombinant PCR using oligonucleotides SJ170, SJ154, see Table 1, (5′ end) and SJ171, SJ53, see Table 1, (3′ end).
- the CDR-grafted VH and VL genes were placed into pSJ60 (see Example 3) and pSJ61 (see Example 3), respectively as Nco1-Sac1 fragments in place of the H1308F Vregion segments resulting in plasmids pSJ81 and pSJ105.
- the murine VH and VL cDNA segments were similarly joined to human C-Gamma1 and CKappa respectively to generate expression vectors pSJ75 and pSJ84.
- COS1 cells (ATCC CRL1650) were maintained in a humidified 5% CO 2 incubator in 75 cm 2 tissue culture flasks in Dulbecco's Modified Eagle Medium (DMEM, GIBCO #320-1965) supplemented with 10% fetal bovine serum (FBS, GIBCO #200-6140) and 2 mM L-glutamine (GIBCO #320-5030) and passed at a split ratio of 1:20 just prior to reaching confluence.
- DMEM Dulbecco's Modified Eagle Medium
- FBS fetal bovine serum
- FBS fetal bovine serum
- 2 mM L-glutamine GIBCO #320-5030
- Transfections were carried out according to the method of McCutchan and Pagano (J. Nat. Can. Inst. 41: 351-356, 1968) with the following modifications. Twenty four hours prior to transfection 100 mm tissue culture dishes (Corning #25020) were seeded with 2 ⁇ 10 6 COS1 cells per dish in 14 ml DMEM, 10% FBS, 2 mM L-glutamine.
- the medium was removed from the COS1 cell dishes, the cell monolayers were washed once with 10 ml Dulbecco's phosphate buffered saline (D-PBS, GIBCO #310-4190), and 2.5 ml DMEM supplemented with 10% NuSerum (Collaborative Research #55000) and 2 mM L-glutamine were added to each plate. 2.5 ml of the DNA/DEAE dextran/chloroquine mix were added dropwise to each plate, the plates were swirled to mix the DNA, and returned to the incubator. After an eight hour DNA adsorption period the plates were removed from the incubator and the supernatant was aspirated from the plates.
- the cells were shocked by the addition of 5 ml of 10% DMSO in D-PBS per plate for 3 minutes at room temperature, after which the DMSO was aspirated from the cells and the cells were washed once with 5 ml D-PBS. 15 ml DMEM, 10% NuSerum, 2 mM L-glutamine (production medium) were added to each plate and the plates were returned to the incubator.
- the conditioned medium was harvested from the plates and stored at ⁇ 20° C., and 15 ml production medium was added to the plates and the plates were returned to the incubator. Ninety six hours later the medium was collected from the plates and stored at 20° C.
- a purified human IgG1 kappa standard (Sigma #1-3889) was made up at 100 ng/ml in PBS-T and serially diluted 1:2 to 1.56 ng/ml, and 50 ul of each were added to duplicate wells of the assay plate. COS1 cell supernatants were diluted in PBS-T and duplicate 50 ul samples were added to the plate. After an one hour room temperature incubation the wells were evacuated and washed three times with PBS-T.
- horseradish peroxidase conjugated affinity purified goat anti-human IgG (whole molecule, Cappel #3601-0081) was diluted 1:1000 in PBS-T and 50 ul was added to each well of the assay plate and incubated at room temperature for one hour. The plate was washed three times with PBS-T and 100 ul of the chromogenic substrate TMBlue (TSI #TM102) was added to each well. The plate was incubated at room temperature in the dark for ten minutes and the reaction was stopped by the addition of 50 ul per well of 4.5M H 2 SO 4 . The plate was read at 450 nm using a Molecular Devices Vmax microplate reader, and data analysis was performed using Softmax software (Molecular Devices) running on an IBM P/S2 model 80 computer.
- Softmax software Molecular Devices
- the COS1 cells produced 0.06 ug/ml Hu1129, for a total of 0.9 ug. In the next ninety six hours of production the COS1 cells produced 0.99 ug/ml Hu1129, for a total of 14.85 ug.
- Binding assays of the Hu1129 were performed in a capture ELISA, essentially as for the quantitation ELISA, but with the following changes. Plates were coated with the Mul 331 antibody at 0.5 ug/well, the wells were blocked with 3% non-fat milk in PBS-T, and 50 ul of RSV infected HEP2 cell lysate was added to each well and incubated at room temperature for 1 hour. The remainder of the assay was carried out as for the quantitation assay starting with the addition of diluted samples to the wells. Results were analyzed as a double reciprocal plot of OD vs antibody concentration from which an apparent Kd for the H1129 molecule of 0.7 nM was determined compared to 10 nM for the M1129 HuGamma1, Kappa antibody.
- the kinetics of interaction between humanized RSV Mabs and the RSV F protein was studied by surface plasmon resonance using a Pharmacia BIAcoreTM biosensor.
- a recombinant baculovirus expressing a C-terminal truncated F protein provided an abundant source of antigen for kinetic studies.
- the supernatant, which contained the secreted F protein was enriched approximately 20-fold by successive chromatography on concanalvalin A and Q-sepharose columns.
- the pooled fractions were dialyzed against 10 mM sodium citrate (pH 5.5), and concentrated to approximately 0.1 mg/ml. An aliquot of the F-protein (100 ml) was amine-coupled to the BIAcore sensor chip.
- Kd k diss /k assoc .
- the value for k assoc was calculated based on the following rate equation:
- R and Rmax are the response units at time t and infinity, respectively.
- a plot of dr/dt as a function of R gives a slope of (k assoc [Mab]+k diss )—Since these slopes are linearly related to the [Mab], the value k assoc can be derived from a replot of the slopes versus [Mab]. The slope of the new line is equal to k assoc .
- R 0 /R t are the response units at time 0 (start of dissociation phase) and t, respectively.
- plotting In(R 0 /R t ) as a function of t gives a slope of k diss .
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Communicable Diseases (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pulmonology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
This invention relates to a human antibody which contains the one CDR from each variable heavy and variable light chain of at least one murine monoclonal antibody, against respiratory syncytial virus which is MAb1129 and the use thereof for the prevention and/or treatment of RSV infection.
Description
- This application is a divisional of U.S. application Ser. No. 11/198,322 filed on Aug. 8, 2005, which is a continuation of U.S. application Ser. No. 09/158,120 filed on Sep. 21, 1998, which is a divisional of U.S. application Ser. No. 08/290,592 filed on Aug. 15, 1994, now issued as U.S. Pat. No. 5,824,307, each of which is incorporated by reference in their entireties.
- Respiratory syncytial virus (RSV) is the major cause of acute respiratory illness in young children admitted to hospitals, and the community practice will treat perhaps five times the number of hospitalized children. It is therefore, the most common cause of lower respiratory tract infection in young children. While the majority of community-acquired RSV infections resolve themselves in a week to ten days, many hospitalized children, especially under six months of age require assisted ventilation.
- Efforts to produce an effective vaccine have been unsuccessful (8). A major obstacle to vaccine development is safety; the initial formalin inactivated RSV vaccine caused an increased incidence of RSV lower respiratory tract disease and death in immunized children upon exposure to virus (5).
- Recently, the drug ribavirin has been licensed for therapy of RSV pneumonia and bronchiolitis (2,3); its value is controversial (4). Although ribavirin has shown efficacy (9), the drug has to be administered over an 18 hour period by aerosol inhalation. In addition, the level of secondary infections following cessation of treatment is significantly higher than in untreated patients.
- Studies have shown that high-titered RSV immunoglobulin was effective both in prophylaxis and therapy for RSV infections in animal models (6, 7). Infected animals treated with RSV immune globulin, showed no evidence of pulmonary immune-complex disease (6, 7).
- Even if RSV hyperimmune globulin is shown to reduce the incidence and severity of RSV lower respiratory tract infection in high risk children, several disadvantages may limit its use. One drawback is the necessity for intravenous infusion in these children who have limited venous access because of prior intensive therapy. A second disadvantage is the large volume of RSVIG required for protection, particularly since most these children have compromised cardiopulmonary function. A third disadvantage is that intravenous infusion necessitates monthly hospital visits during the RSV season which places these children at risk of nosocomial RSV infection (1). A final problem is that it may prove to be very difficult to select sufficient donors to produce a hyperimmune globulin for RSV to meet the demand for this product. Currently only about 8% of normal donors have RSV neutralizing antibody titers high enough to qualify for the production of hyperimmune globulin.
- Another approach may be the development of monoclonal antibodies with high specific neutralizing activity as an alternative to hyperimmune globulin. It is preferable, if not necessary, to use human monoclonal antibodies rather than murine or rat antibodies to minimize the development of human anti-rodent antibody responses which may compromise the therapeutic efficacy of the antibody or induce immune-complex pathology. However, the generation of human monoclonal antibodies with the desired specificity may be difficult and the level of production from human cell lines is often low, precluding their development.
- An alternative approach involves the production of human-mouse chimeric antibodies in which the genetic information encoding the murine heavy and light chain variable regions are fixed to genes encoding the human heavy and light constant regions. The resulting mouse-human hybrid has about 30% of the intact immunoglobulin derived from murine sequences. Therefore, although a number of laboratories have constructed chimeric antibodies with mouse variable and human constant domains (10-18), the mouse variable region may still be seen as foreign (19).
- It is therefore an object of the present invention to provide a complementarity determining region (CDR)-grafted human antibody which contains at least one CDR from each variable heavy chain and variable light chain of at least one monoclonal antibody, against the RSV antigen. The monoclonal antibody may be derived from any non-human animal, preferably however, it is derived from a rodent and most preferably it is a murine monoclonal antibody. Preferably, the murine monoclonal antibody is a neutralizing antibody. It is also preferable that said murine antibody is an antibody against RSV F antigen.
- The term “animal” as used herein is used in its broadest sense includes mammals including humans.
- The drawings depicted and described herein are intended to further illustrate the present invention and are not intended to limit the invention in any manner whatsoever.
-
FIG. 1A-B shows the amino acid (AA) sequence design of CDR-Grafted anti-RSV F glycoprotein VH. The figure depicts the AA sequence for the human HV3 VH before grafting (SEQ ID NO:16), CDR grafted VH (SEQ ID NO:17), and murine MAb1308F VH (SEQ ID NO:18) from which the CDR sequence was grafted. The heavily underlined regions identify the CDR sequence which was grafted into the human HV3 VH and each of the three regions is identified as CDR1, CDR2 and CDR3, respectively. -
FIG. 2A-B shows the amino acid (AA) sequence design of CDR-Grafted anti-RSV F Protein VL. The figure depicts the AA sequence for the human K102 VL before grafting (SEQ ID NO:19), CDR grafted VL (SEQ ID NO:20), and murine MAb1308F VL (SEQ ID NO:21) from which the CDR sequence was grafted. The heavily underlined regions identify the CDR sequence which was grafted into the human K102 VL and each of the three regions is identified as CDR1, CDR2 and CDR3, respectively. -
FIG. 3A-B depicts the oligonucleotides used to make Hu1308 VH, the sequences which are underlined are the specific primer sequences (SEQ ID NO:22-25). -
FIG. 4A-B depicts the oligonucleotides used to make Hu1308 VL, the sequences which are underlined are the specific primer sequences (SEQ ID NO:26-29). -
FIG. 5 depicts the plasmid construction of the expression vectors for Humanized 1308. -
FIG. 6 depicts a graph of the neutralization of RSV as percent neutralization versus ng MAb per reaction for neutralizing with Cos Hu1308F and with Mu1308F. -
FIG. 7A-B shows the amino acid (AA) sequence design of CDR-Grafted anti-RSV F glycoprotein VH. The figure depicts the AA sequence for the human COR VH before grafting (SEQ ID NO:30), CDR grafted VH (SEQ ID NO:31), and murine MAb1129 VH (SEQ ID NO:32) from which the CDR sequence was grafted. The heavily underlined regions identify the CDR sequence which was grafted into the human COR VH and each of the three regions is identified as CDR1 (SEQ ID NO:43), CDR2 (SEQ ID NO:44) and CDR3 (SEQ ID NO:45), respectively. -
FIG. 8A-B shows the amino acid (AA) sequence design of CDR-Grafted anti-RSV F Protein VL. The figure depicts the AA sequence for the human K102 VL before grafting (SEQ ID NO:33), CDR grafted VL (SEQ ID NO:34), and murine MAb1129 VL (SEQ ID NO:35) from which the CDR sequence was grafted. The heavily underlined regions identify the CDR sequence which was grafted into the human K102 VL and each of the three regions is identified as CDR1 (SEQ ID NO:46), CDR2 (SEQ ID NO:47) and CDR3 (SEQ ID NO:48), respectively. -
FIG. 9A-B shows the oligonucleotides used to construct the humanized 1129 V (SEQ ID NO:36-42). -
FIG. 10 shows binding data for humanized 1129 in an ELISA assay. - Applicants have found that transplantation into a human antibody, of only the genetic information for at least one CDR from each of the variable heavy and variable light chain derived from murine monoclonal antibody against RSV antigen, is effective for the prevention and treatment of RSV in animals. Preferably the murine antibody is a neutralizing antibody against RSV. Another aspect of the present invention provides for the murine antibody to be an antibody against RSV F antigen. Preferably, the murine antibody is neutralizing antibody against RSV F antigen. The substitution of the mouse CDR's into the human variable framework segments minimizes the potential for human anti-mouse antibody (HAMA) responses while retaining binding affinity and specificity for antigen, RSV F protein. Since, the CDR's do not contain characteristic murine or human motifs, the human antibodies containing the murine antibody CDR's are essentially indistinguishable from completely human antibodies, thereby, minimizing the human antibody response while retaining binding affinity and specificity for RSV F antigen.
- The development of a humanized antibody against RSV F antigen began with a murine antibody against RSV F antigen. Examples of murine antibodies of this type are: MAb 1436C, MAb 113, MAb 112, MAb 151, MAb 1200, MAb 1214, MAb 1237,
MAb 1129, MAb 1121, MAb 1107, MAb 131-1, MAb 43-1, MAb 1112, MAb 1269, MAb 1243, MAb 1331H,MAb 1308F and MAb 1302A (see citation 21). - An aspect of the present invention provides that the CDRs of the human antibody are comprised of three complementarity determining regions (CDRs) from each variable heavy and variable light chain of the murine antibody.
- The murine antibodies against RSV F antigen have been mapped by competitive binding and reactivity profiles of virus escape mutants to three broad antigenic sites (A, B, C) containing 16 distinct epitopes (20). The epitopes within antigenic sites A and C have shown the least variability in natural isolates.
- Therefore, another aspect of this invention provides for a human antibody containing at least one CDR from each variable heavy and variable light chain of at least one murine antibody against RSV F antigen which is specific for antigenic site A or C. In one aspect, this invention provides for the murine antibody against RSV F antigen specific for antigenic site C, where the murine antibody is
MAb 1308F. - In such an embodiment of this invention a human antibody contains CDR's of the variable heavy chain of
murine antibody MAb 1308F against the RSV F antigen. The CDR variable heavy chain ofMAb 1308F comprises three CDRs having the following amino acid sequences: Nos. 31 to 35, 47 to 60 and 99 to 106. In addition, this embodiment contains CDR's of a variable light chain ofMAb 1308F of murine antibody against RSV F antigen. The CDR variable light chain comprises three CDR's having the following amino acid sequences: Nos. 24 to 34, 50 to 56 and 89 to 97. - Another aspect of this invention provides for a human antibody containing at least one CDR from each variable heavy and variable light chain of at least one murine antibody against RSV F antigen which is specific for antigenic site A. Preferably, this invention provides for the murine antibody against RSV F antigen specific for antigenic site A, where the murine antibody is
MAb 1129. - In the embodiment of this invention a human antibody which contains CDR's of the variable heavy chain of
murine antibody MAb 1129 against the RSV F antigen. The CDR variable heavy chain ofMAb 1129 comprises three CDRs having the following amino acid residues: Nos. 31 to 37, 52 to 67 and 100 to 109. In addition, this embodiment contains CDR's of a variable light chain ofMAb 1129 of murine antibody against RSV F antigen. The CDR variable light chain comprises three CDR's having the following amino acid residues: Nos. 24 to 33, 50 to 56 and 89 to 97. - An additional aspect of applicants' invention is a process for preventing or treating RSV infection comprising administering to the animal an effective amount of a human antibody containing at least one CDR from each variable heavy and variable light chain, of at least one murine antibody against RSV F antigen.
- Another aspect of applicants' invention is a composition comprising administering an effective amount of the human antibody as described above in conjunction with an acceptable pharmaceutical carrier. Acceptable pharmaceutical carriers include but are not limited to non-toxic buffers, fillers, isotonic solutions, etc.
- The composition of Applicant's invention may be administered topically or systemically. Examples of topical administration are intranasal administration and inhalation of an aerosol containing the human antibody composition. Systemic administration may be accomplished by intravenous or intramuscular injection of the human antibody composition.
- A preferred aspect of Applicants' invention is that the human antibody is administered as part of a plurality of human antibodies against RSV F antigen. These antibodies can be against the same or different epitopes of the RSV F antigen.
- Additionally, the human antibody of this invention can be used clinically for diagnosing respiratory syncytial virus in patients. Because of their affinity for RSV F antigen these human antibodies can be used in known diagnostic assay procedures for detecting the presence and concentration of RSV F antigen cells in samples, e.g., body fluids. The human antibodies of the present invention can for example be attached or bound to a solid support, such as latex beads, a column, etc., which are then contacted with a sample believed to contain RSV F antigen.
- Applicants' development of human antibodies against RSV, began with murine hybridoma cells producing murine monoclonal antibodies which have been shown to neutralize RSV in vitro and protect cotton rats against lower respiratory tract infection with RSV.
- One such antibody was selected, which is specific for antigenic site C, to produce mouse-human chimeric antibodies. This antibody was chosen on the basis that it: (i) reacted with a large number of virus strains tested (at least 13 out of 14 isolated); (ii) retained neutralizing activity against virus escape mutants selected with other anti-F antibodies and (iii) blocked RSV replication when administered at low doses to cotton rats by intranasal route prior to virus challenge. The antibody showed significant reduction in pulmonary virus titer among antibodies in that respective region.
Murine antibody 1308F, specific for the C region of RSV F protein, was chosen as the initial target for humanization. - In summary, the human antibodies were constructed as follows: the RNA was extracted from the murine antibody-producing cell line, the murine variable regions which are responsible for the binding of the antibody to RSV were cloned and sequenced, resulting in the identification of the murine antibody CDRs. Then a human variable heavy and light chain framework sequence having the highest homology with the variable heavy and light chain murine antibody, was selected. A human framework sequence such as described above is best able to accept the murine-derived CDRs.
- The murine 1308F variable heavy chain was compared to various human germline genes, the highest homology was to the human germline gene HV3. The two sequences were 62% homologous overall and 65% in the framework regions. Significantly, there is good homology at the junctions of the CDR segments and the frameworks with the exception of the 5′ end of FR2. The murine derived variable heavy chain CDRs were then substituted into the variable heavy chain human germline gene HV3. The mouse and human sequences as well as that of a potential CDR-Grafted combination of the two is shown in
FIG. 1A-B . - A similar analysis of the VL region revealed high homology to the human germ line V-Kappa gene K 102. The alignment of these sequences is shown in
FIG. 2A-B . In this case the homology is 62% overall and 73% in the framework regions. The murine-derived variable light CDRs were then substituted into the human variable light chain of human germline gene K102. In each case a human J-region can be selected which is identical to the mouse sequence. - In another embodiment, murine 1129 variable heavy chain was compared to various human variable region amino acid sequences, the highest homology was to the human rearranged COR sequence. The two amino acid sequences were 75% homologous overall and 80% in the framework regions. Significantly, there is good homology at the junctions of the CDR segments and the frameworks. The murine derived variable heavy chain CDRs were then substituted into the variable heavy chain human COR VH sequence. The mouse and human sequences as well as that of a potential CDR-Grafted combination of the two is shown in
FIG. 7A-B . - A similar analysis of the VL region revealed high homology to the human germ line K102. The alignment of these sequences is shown in
FIG. 8A-B . In this case the homology is 73% overall and 82% in the framework regions. The murine-derived variable light CDRs were then substituted into the human variable light chain of human germline K102. In this case a human J-region, human JK4, was selected which is similar to the mouse sequence. - Therefore, human antibodies are expressed and characterized relative to the parental murine antibodies to be certain that the genetic manipulation has not drastically altered the binding properties of the antibodies.
- Applicants present herein examples which are further illustrative of the claimed invention but not intended to limit the invention.
- cDNA copies of the VH and VL of the target antibody were generated as follows. The first strand cDNA reaction was carried out using AMV reverse transcriptase and a phosphorylated oligonucleotide primer complementary to a segment of the mRNA coding for the constant region of the particular heavy or light chain isotype. For 1308F the isotype is gamma1, kappa and the specific oligonucleotides were 5′AGCGGATCCAGGGGCCAGTGGATAGAC (SEQ ID NO:1) complementary to codons 129-137 of the CH1 region of the murine Gamma1 gene, and 5′TGGATGGTGGGAAGATG (SEQ ID NO:2) complementary to codons 116-122 of the murine C-kappa gene. The primer anneals to a segment of the mRNA adjacent to the variable region. Second strand cDNA synthesis was carried out using RNase H and E. coli DNA polymerase I, as described by Gubler and Hoffman (
Gene 25,;263, 1983), followed by T4 DNA polymerase to assure that blunt ends are produced. - The ds-cDNA was ligated into pUC18 which had been digested with restriction endonuclease SmaI and treated with alkaline phosphatase. The ligation was used to transform E. coli DH5a by the method of Hanahan (J. Mol. Biol. 166;557, 1983). Oligonucleotide probes corresponding to C-region sequence lying between the first strand cDNA primer and the V-region were used in colony hybridizations to identify transformants carrying the desired cDNA segment. The specific probe sequences were GGCCAGTGGATAGAC (SEQ ID NO:3) complementary to codons 121-125 of murine CH1 regions and TACAGTTGGTGCAGCA (SEQ ID NO:4) complementary to codons 110-115 of c-Kappa, respectively. Candidate plasmids, isolated from colonies which were positive in the hybridization, were analyzed by digestion with restriction endonucleases Eco RI and Hind III to release the CDNA insert. Those with inserts of 400-500 bp were subjected to DNA sequencing.
- The cDNA inserts were inserted into M13 mp18 and mp19 for the determination of the DNA sequence on both strands. Single stranded DNA from the resulting recombinant bacteriophage was isolated and sequenced by the dideoxy chain termination method (Proc. Nat. Acad. Sci. USA 74; 5463, 1977).
- In order to confirm that the pair of rearranged and somatically mutated V gene cDNA's isolated from the 1308F hybridoma represented those which were in the 1308F antibody, a single-chain Fv gene was generated, expressed in and secreted from mammalian cells, then assayed for binding to RS virus. Competition binding experiments then were used to demonstrate the identity of the binding site.
- The CDR regions of the VH and VL were identified by comparing the amino acid sequence to known sequences as described by Kabat (38). In order to select the human framework sequences best able to accept the mouse derived CDR sequences in a conformation which retains the structure of the antigen combining site, the following strategy was employed. First, the sequence of the murine VH and VL regions will be compared to known human sequences from both the Genbank and NBRF protein databanks using the Wordsearch program in the Wisconsin package of sequence manipulation programs (Nucleic Acid Res. 12; 387). The best several human V-regions were then analyzed further on the basis of similarity in the framework regions, especially at the junctions of the framework and CDR regions (see
FIGS. 1A-B and 2A-B). - The CDR-grafted VH region together with the respective leader sequence of the human v-region gene was synthesized de novo using four overlapping oligonucleotides ranging from 100-137 nucleotides in length (see
FIG. 3A-B ). The oligonucleotides were first allowed to anneal in pairwise combinations and extended with DNA polymerase to generate approximately 200 bp ds DNA fragments with an overlapping region. The fragments were then mixed and subjected to PCR using primers at the 3′ end of one fragment and the 5′ end of the other fragment. The only product which can be formed under these condition is the full length VH segment. The specific primer sequences are underlined inFIG. 3A-B . An endonuclease Sac I site was included at the 3′ end of the VH sequence in order to join it to a human constant region gene segment. - The CDR-grafted VL region was synthesized in a similar way (see
FIG. 4A-B ). In this instance the initial 200 bp fragments were amplified separately and inserted into separate plasmids. The fragment coding for the amino terminus was cloned into a pUC18 derivative as an NcoI-SmaI fragment while the fragment coding for the carboxyl-terminus was cloned as a SmaI to Hind III fragment. The fragments were subsequently combined via a SmaI site at the junction. The oligonucleotides are indicated inFIG. 4A-B . A Hind III site was included near the 3′ end of the gene segment in order to join it to a human C-kappa gene. - The NcoI-SacI fragment representing the humanized VH was joined to a SacI-NotI fragment representing a human c-Gamma I CDNA and inserted into pS 18 (which is pUC 18 with Nco1 and NotI restriction sites incorporated into the polylinker region between the BamHI and Kpn1 sites). The humanized 1308F-gamma1 gene on a SacI-NotI fragment was then combined with a Pvu1-NotI fragment from pSJ37 carrying a poly A addition site and a PvuI-SacI fragment from pSV2-dhfr-pCMV containing the SV40 origin of replication, a dhfr gene and the CMV immediate early promoter. The resulting plasmid was designated pSJ60.
- The NcoI-HindIII fragment representing the humanized VL was joined to a HindIII-NotI fragment representing a human c-Kappa CDNA in pS18. The humanized 1308F-Kappa gene on a SalI-NotI fragment was then combined with a Pvu1-NotI fragment from pSJ37 carrying a poly A addition site and a PvuI-SalI fragment from pSV2-dhfr-pCMV, containing the SV40 origin of replication, a dhfr gene and the CMV immediate early promoter. The resulting plasmid was designated pSJ61.
- Finally pSJ60 and pSJ61 were combined into a single plasmid containing both the light and heavy chains and expression signals. This was accomplished by isolating a PvuI-Bam HI fragment from pSJ61 carrying the light chain with a PvuI-Bgl II fragment from pSJ60 carrying the heavy chain to generate pSJ66. (See
FIG. 5 ). - Transfections were carried out according to the method of McCutchan and Pagano (J. Nat. Can. Inst. 41: 351-356, 1968) with the following modifications.
COS 1 cells (ATCC CRL1650) were maintained in a humidified 5% C02 incubator in 75 cm2 tissue culture flasks in Dulbecco's Modified Eagle Medium (DMEM, GIBCO #320-1965) supplemented with 10% Fetal Bovine Serum (FBS, GIBCO #200-6140) and 2 mM L-glutamine (BRL #320-5030) and passed at a split ratio of 1:20 when the cells had reached confluence. 48 hours prior to transfection, 5 100 mm tissue culture dishes were seeded with 1.5×106 cells per dish in 12 ml DMEM, 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin (P-S, GIBCO #600-5070). The day of the transfection, 120 ug each of the plasmids pSJ60 and pSJ61 were combined, ethanol precipitated, and aseptically resuspended in 2.5 ml Tris-Buffered-Saline. The resuspended DNA was added dropwise, with mixing, to 10 ml of DMLEM containing 1 mg/ml DEAE-dextran (Phamiacia #17-0350-01) and 250 uM chloroquine (Sigma #C6628). The medium was removed from the COS1 cells in the 100 mm dishes and the cells were washed once with Dulbecco's phosphate buffered saline (D-PBS, GIBCO #310-4190), and 2.5 ml DMEM supplemented with 10% NuSerum (Collaborative Research #55000) were added to each plate. 2.5 ml of the DNA/DEAE-dextran/chloroquine mix were added dropwise to each plate, the plates swirled to mix the DNA, and were returned to the incubator. After 4 hours in the incubator, the supernatant was aspirated from the cells and the cells were washed once with 5 ml D-PBS. The cells were shocked for 3 minutes by the addition of 5 ml of 10% dimethylsulfoxide (DMSO) in D-PBS at room temperature. The DMSO was aspirated from the cells and the cells were washed with 5 ml D-PBS. 14 ml of DMEM/10% FBS/2 mM L-glutamine/1% P-S were added to each plate and the plates were returned to the incubator. - Three days post-transfection the medium was removed from the plates, pooled, and stored at −20 C. The cells were harvested, pooled, and seeded into 4 150 cm2 tissue culture flasks two with 40 ml DMEM/10% NuSerum and two with 40 ml DMEM/10% FBS/2 mM L-glutamine. The medium was collected and the cells refed at 7, 10, and 14 days. In this way a total of 125 ug of humanized 1308F antibody was accumulated in 310 ml of medium supplemented with FBS and 85 ug in 240 ml of medium supplemented with NuSerum.
- 48 hours prior to transfection, 5 100 mm tissue culture dishes were seeded with 1.5×106 cells per dish in 12 ml DMEM, 10% FBS, 2 mM L-glutamine, 1% penicillin-streptomycin (P-S, GIBCO #600-5070). The day of the transfection, 125 ug of the plasmid pSJ66 were ethanol precipitated and aseptically resuspended in 1.0 ml Tris-Buffered-Saline. The resuspended DNA was added dropwise, with mixing, to 4.0 ml of DMEM containing 1 mg/ml DEAE-dextran (Pharmacia #17-0350-01) and 250 uM chloroquine (Sigma #C6628). The medium was removed from the COS1 cells in the 100 mm dishes and the cells were washed once with Dulbecco's phosphate buffered saline (D-PBS, GIBCO #310-4190), and 2.5 ml DMEM supplemented with 10% NuSerum (Collaborative Research #55000) were added to each plate. 2.5 ml of the DNA/DEAE-dextran/chloroquine mix were added dropwise to each plate, the plates swirled to mix the DNA, and were returned to the incubator. After 4 hours in the incubator, the supernatant was aspirated from the cells and the cells were washed once with 5 ml D-PBS. The cells were shocked for 3 minutes by the addition of 5 ml of 10% dimethylsulfoxide (DMSO) in D-PBS at room temperature. The DMSO was aspirated from the cells and the cells were washed with 5 ml D-PBS. 14 ml of DMEM/10% FBS/2 mM L-glutamine/1% P-S were added to each plate and the plates were returned to the incubator.
- Three days post-transfection the medium was removed from the plates, pooled, and stored at −20 C. The cells were harvested, pooled, and seeded into 4 150 cm.sup.2 tissue culture flasks two with 40 ml DMEM/10% NuSerum and two with 40 ml DMEM/10% FBS/2 mM L-glutamine. The medium was collected and the cells refed at 7, 10, and 14 days. In this way a total of 190 ug of humanized 1308F antibody was accumulated in 310 ml of medium supplemented with FBS and 120 ug in 240 ml of medium supplemented with NuSerum.
- The concentration of humanized 1308F antibody secreted from the Cos1 cells into the medium was determined using a capture ELISA. Goat anti-human IgG Fc coated onto 96 well plates was used to capture the humanized antibody. Peroxidase conjugated goat anti-human whole IgG developed with a chromogenic substrate was then used to detect the bound antibody. A purified human IgG1/Kappa preparation was used to calibrate the assay.
- Methods:
- RSV was neutralized with either humanized 1308F from Cos cell supernatant or purified 1308F murine monoclonal antibody. This was done by incubating 50 plaque-forming units of RSV with serial 2-fold dilutions of antibody for 1.0 hour at 37 C. Confluent monolayers of Hep2 cells in 24 well panels were infected with 100 μl of antibody treated virus, untreated control virus, and mock infected controls. Incubated for 1.5 hours at 37 C, humidified, tand 5% CO2 and overlayed with 1.5 mL EMEM, 1% FBS, and 1% methyl cellulose. Cells were fixed and stained with glutaldehyde and crystal violet on
day 4. Plaques were counted in triplicate wells and plotted as percent neutralization. The results shown inFIG. 6 indicate that both the purifiedmurine 1308F monoclonal and the humanized 1308F monoclonal antibody at 5 to 10 ng per well yield similar 50% reductions in RSV plaques. - Poly-A+ RNA was purified from a lysate of 2×107 murine 1129 hybridoma cells using oligo-dt cellulose. First strand CDNA was made from 1 ug pA+ RNA using random hexamer primers and AMV
reverse transcriptase 1 ug pA+ RNA, 50 mM Tris-HCl pH 8.5, 8 mM Mg2Cl, 30 mM KCl, 1 mM dithiothrietol, 1 mM dNTP's, 25 units of placental ribonuclease inhibitor, 33 uM random hexamer and 10 units of AMV reverse transcriptase for one hour at 42° C. The cDNA from the 1129 VL region was amplified by PCR using oligonucleotides SJ41 and SJ11, see Table 1. cDNA from the 1129 VH region was similarly amplified using oligonucleotides SJ42 and SJ10, see Table 1. -
TABLE 1 SEQ ID Oligonucleotide Sequence NO. SJ10 AGCGGATCCAGGGGCCAGTGGATAGAC 1 SJ11 GATGGATCCAGTTGGTGCAGCATC 5 SJ41 CACGTCGACATTCAGCTGACCCAGTCTCCA 6 SJ42 CGGAATTCAGGTIIAICTGCAGIAGTC(A,T)GG 7 (I = deoxy-Inosine) SJ53 CCCAAGCTTGGTCCCCCCTCCGAACGTG 8 SJ154 GGCGTCGACTCACCATGGACATGAGGGTCC(C/T)CGCTCAGC 9 SJ155 GTCACCATCACTTGCAAGTGCCAGCTGAGTGTAGGTTACATGCACTGGTAC 10 (H1129L CDR 1) CAGCAG SJ157 GCAACTTATTACTGCTTTCAGGGGAGTGGGTACCCATTCACGTTCGGAGGG 11 (H1129L CDR 3) GGG SJ168 GTGACCAACATGGACCCTGCTGATACTGCCAC 12 SJ169 CCATGTTGGTCACTTTAAGGACCACCTGG 13 SJ170 CCAGTTTACTAGTGTCATAGATCAGGAGCTTAGGGGC 14 SJ171 TGACACTAGTAAACTGGCTTCTGGGGTCCCATCAAGG 15 - PCR Conditions:
- 0.5 uL of 1st strand CDNA, 10 mM Tris-HCl pH8.3, 50 mM KCl, 1.5 mM Mg2Cl, 0.2 mM dNTP's, 0.001% gelatin, 1 uM each primer, 1 ng DNA template and 2.5 u AmpliTaq™ DNA polymerase (Perkin Elmer—Cetus). 94° 1 minute, 55° 2 minutes, 72° 2 minutes in Perkin Elmer 480 thermocycler for 25 cycles. The resulting DNA fragment(s) were then extracted once with phenol/chloroform (1/1), precipitated with 2.5 volumes of ETOH, resuspended in the appropriate restriction endonuclease buffer and digested with restriction endonucleases to produce cohesive ends for cloning. The resulting fragments were then separated by electrophoresis on a 1% agarose gel. After staining the gel with ethidium bromide the fragments were excised and purified from the agarose by freezing and extraction in the presence of phenol.
- The fragments were then digested with restriction endonucleases EcoR1 and BamH1 and cloned into plasmid pUC18. The inserts were then sequenced by the dideoxynucleotide chain termination method using modified T7 DNA polymerase (Sequenase, US Biochemical). The translated sequences were compared to human antibody protein sequences. The VL was found to be most homologous to the K102 light chain and the VH was found to be most homologous to the Cor VH region. The 1129 Fv region was then modeled by substitution of the residues from the 1129 VL and VH sequence into the coordinates of corresponding residues in the crystal structure the MCPC603 antibody. Residues were identified as being integral to the folded structure or solvent exposed by visual inspection of the model.
- Several residues which were integral and which were different in the mouse and human sequences were left as the mouse residue in order to maintain the integrity of the Fv and thus the binding site. Such residues were 31, 83, 113, and 116 on the VH and 47 in the VL region. The resulting sequences are shown in
FIGS. 7A-B and 8A-B. - The designed humanized 1129 VH was constructed using synthetic oligonucleotides SJ147-SJ153 (
FIG. 9A-B ) (SEQ ID NO:36-42) which were combined using PCR. The products of this PCR were then digested with Nco1 and Sac1 and cloned into plasmid vector pSJ40 which is a pUC18 derivative in which an out of frame lacZ1 segment is restored in frame as a fusion to an in-frame V region segment when such a segment is inserted as an Nco1-Sac1 fragment. A plasmid containing an insert in which 5 mutations were clustered in a single 50 bp region was then subjected to repair of these changes using recombinant PCR and the primers SJ168 and SJ169, see Table 1. - The VL was generated by site directed mutagenesis of the humanized 1308F light chain gene. Oligonucleotides SJ155, see Table 1, (CDR1), and SJ157 (CDR3) were used to separately mutagenize the H1308L gene. Mutagenesis was carried out using T7 DNA polymerase on uracil containing single stranded DNA templates generated in E. coli strain BW313 (dut−,ung−) and subsequently transformed into E. coli strain DH5 (dut+,ung+). The two mutants were combined and CDR2 introduced by recombinant PCR using oligonucleotides SJ170, SJ154, see Table 1, (5′ end) and SJ171, SJ53, see Table 1, (3′ end). The CDR-grafted VH and VL genes were placed into pSJ60 (see Example 3) and pSJ61 (see Example 3), respectively as Nco1-Sac1 fragments in place of the H1308F Vregion segments resulting in plasmids pSJ81 and pSJ105. In addition the murine VH and VL cDNA segments were similarly joined to human C-Gamma1 and CKappa respectively to generate expression vectors pSJ75 and pSJ84.
- COS1 cells (ATCC CRL1650) were maintained in a humidified 5% CO2 incubator in 75 cm2 tissue culture flasks in Dulbecco's Modified Eagle Medium (DMEM, GIBCO #320-1965) supplemented with 10% fetal bovine serum (FBS, GIBCO #200-6140) and 2 mM L-glutamine (GIBCO #320-5030) and passed at a split ratio of 1:20 just prior to reaching confluence.
- Transfections were carried out according to the method of McCutchan and Pagano (J. Nat. Can. Inst. 41: 351-356, 1968) with the following modifications. Twenty four hours prior to
transfection 100 mm tissue culture dishes (Corning #25020) were seeded with 2×106 COS1 cells per dish in 14 ml DMEM, 10% FBS, 2 mM L-glutamine. The day of thetransfection 10 ug of the Hu1129 heavy chain plasmid (pSJ81, from Example 7 were combined with 10 ug of the Hu1129 kappa light chain plasmid pSJ105, from Example 7, the DNA was ethanol precipitated and aseptically resuspended in 1.0 ml Tris-Buffered-Saline. The resuspended DNA was added dropwise, with mixing, to 4.0 ml of DMEM containing 1 mg/ml DEAE-dextran (Pharmacia #170350-01) and 250 uM Chloroquine (Sigma #C6628). The medium was removed from the COS1 cell dishes, the cell monolayers were washed once with 10 ml Dulbecco's phosphate buffered saline (D-PBS, GIBCO #310-4190), and 2.5 ml DMEM supplemented with 10% NuSerum (Collaborative Research #55000) and 2 mM L-glutamine were added to each plate. 2.5 ml of the DNA/DEAE dextran/chloroquine mix were added dropwise to each plate, the plates were swirled to mix the DNA, and returned to the incubator. After an eight hour DNA adsorption period the plates were removed from the incubator and the supernatant was aspirated from the plates. The cells were shocked by the addition of 5 ml of 10% DMSO in D-PBS per plate for 3 minutes at room temperature, after which the DMSO was aspirated from the cells and the cells were washed once with 5 ml D-PBS. 15 ml DMEM, 10% NuSerum, 2 mM L-glutamine (production medium) were added to each plate and the plates were returned to the incubator. - Seventy two hours post-transfection the conditioned medium was harvested from the plates and stored at −20° C., and 15 ml production medium was added to the plates and the plates were returned to the incubator. Ninety six hours later the medium was collected from the plates and stored at 20° C.
- Quantitation of the Hu1129 IgG1 antibody secreted into the medium by the COS1 cells was performed using a sandwich type ELISA. In brief, Nunc Maxisorp Immunoplates (Nunc #439454) were coated with 50 ul/well of 0.5 ug/ml goat anti-human IgG Fc (Cappel #55071) in 0.1M sodium bicarbonate pH 9.6 for 3 hours at room temperature. The wells were washed three times with 0.01M sodium phosphate pH 7.4, 0.15M NaCl, 0.1% Tween 20 (PBS-T). Nonspecific protein binding to the plate was blocked by treatment of the wells with 200 ul/well of 3% (w/v) nonfat dry milk in PBS for 30 minutes at room temperature. A purified human IgG1 kappa standard (Sigma #1-3889) was made up at 100 ng/ml in PBS-T and serially diluted 1:2 to 1.56 ng/ml, and 50 ul of each were added to duplicate wells of the assay plate. COS1 cell supernatants were diluted in PBS-T and duplicate 50 ul samples were added to the plate. After an one hour room temperature incubation the wells were evacuated and washed three times with PBS-T. To detect the presence of bound Hu1129 antibody, horseradish peroxidase conjugated affinity purified goat anti-human IgG (whole molecule, Cappel #3601-0081) was diluted 1:1000 in PBS-T and 50 ul was added to each well of the assay plate and incubated at room temperature for one hour. The plate was washed three times with PBS-T and 100 ul of the chromogenic substrate TMBlue (TSI #TM102) was added to each well. The plate was incubated at room temperature in the dark for ten minutes and the reaction was stopped by the addition of 50 ul per well of 4.5M H2SO4. The plate was read at 450 nm using a Molecular Devices Vmax microplate reader, and data analysis was performed using Softmax software (Molecular Devices) running on an IBM P/
S2 model 80 computer. - During the first seventy two hours of production the COS1 cells produced 0.06 ug/ml Hu1129, for a total of 0.9 ug. In the next ninety six hours of production the COS1 cells produced 0.99 ug/ml Hu1129, for a total of 14.85 ug.
- Binding assays of the Hu1129 were performed in a capture ELISA, essentially as for the quantitation ELISA, but with the following changes. Plates were coated with the Mul 331 antibody at 0.5 ug/well, the wells were blocked with 3% non-fat milk in PBS-T, and 50 ul of RSV infected HEP2 cell lysate was added to each well and incubated at room temperature for 1 hour. The remainder of the assay was carried out as for the quantitation assay starting with the addition of diluted samples to the wells. Results were analyzed as a double reciprocal plot of OD vs antibody concentration from which an apparent Kd for the H1129 molecule of 0.7 nM was determined compared to 10 nM for the M1129 HuGamma1, Kappa antibody.
- RSV neutralization assays on H1129 and ch1129 antibody were performed according to the following procedure:
-
- 1. Unwrap 96 well Costar cell culture plates in hood.
- 2. Warm Growth Medium (GM) to 37° C.
- 3. Thaw MA104 cells at 37° C. Dilute to about 150,000 cells per mL with GM. Mix cells and dispense 200 ul per well.
- 4. Culture cells 37° C., 5% CO2, and humidified overnight before infection.
- 5. Dilute RSV Stock to 10,000 pfu per mL in Maintenance Medium (MM).
- 6. Mix equal volume of Antibody diluted in MM with equal volume of diluted RSV. Incubate at 37° C., 5% CO2, and humidified for 1.0 h before infection.
- 7. Infect replicate wells of MA104 cells with 200 ul of the Antibody and Virus mixture. Infect replicate wells with virus and mock infected controls.
- 8. Wrap the plates in cellophane and incubate at 37° C., 95% humidity, and 5% CO2 for 5 days.
- 9. ELISA for RSV: Aspirate each well; add 100
ul 80% Acetone/PBS (vol./vol.) and incubate atroom temperature 30 minutes. - 10. Aspirate each well and air dry for 30 minutes on the grill of a laminar flow hood.
- 11.
Wash 4 times with PBS, 0.05% Tween 20. - 12. Add 100 .mu.1 of monoclonal antibody to RSV F-protein to each well. Incubate for 1.0 h at 37° C.
- 13.
Wash 4 times with PBS, 0.05% Tween 20. - 14. Add 100 ul of anti-murine antibody goat serum-horseradish peroxidase conjugate to each well. Incubate for 1.0 h at 37° C.
- 15.
Wash 4 times with PBS, 0.05% Tween 20. - 16. Add 100 ul of a freshly prepared 1:1 mixture of ABTS and peroxide to each well. Incubate at room temperature until the optical density (405 nm) of the virus control is 5 to 10 times that of the mock infected controls.
- Appendix:
- Growth Medium (GM):
- Minimum Essential Medium (Eagle) with Earle's BSS,
- 2 mM glutamine,
- Eagle's non-essential amino acids 0.1 mM final,
- Fetal
bovine serum 10% (v/v), -
Penicillin 50 units/ml, -
Streptomycin 50 mcg/ml - Maintenance Medium (MM): as above with serum reduced to 1 to 2%.
- MA104 cell stocks are grown up in T150 flasks with Growth Medium. Stocks are frozen at 3×106 cells per 1.8 mL vial in 10% DMSO and Growth Medium. Stored in a LN2 refrigerator.
- RSV stocks: are grown up in MA104 (monkey kidney) or
Hep 2 cells in T150 flasks. Add about 0.2 ml (about 100,000 pfu) virus stock per confluent T150. Adsorption for 1.0 h at room temperature. Then add 20 mL maintenance medium with 1% fetal bovine serum. Incubate 4-5 days at 37° C. Collect cells just before 100% cpe by scraping. Spin down cells; remove all but 10 mL of supernatant. Freeze (dry ice-ethanol bath) thaw cell pellet, vortex, re-freeze, and store virus stock in LN2 refrigerator. - ELISA Antibody Buffer: PBS, 0.05% Tween 20 (w/v), 2.0% goat serum (v/v) and 0.5% gelatin (w/v).
- RSV F Protein Antibody: Chemicon Mab 858-1 anti-RSV fusion protein diluted about 1:5000 in ELISA Antibody Buffer.
- Anti-Murine Serum: Fisher horseradish peroxidase conjugated to goat anti-mouse IgG (Heavy Chain Specific) diluted about 1:4000 in ELISA Antibody Buffer.
- The results are shown in
FIG. 10 , and indicate 25 ng/mi achieved 50% neutralization in this assay while 45 ug/ml of the ch1129 antibody was required for 50% neutralization in this experiment. Over a series of 6 separate assays the mean 50% neutralization value for H1129 was 17 ng/ml. As a control and to compare potency we also assayed a polyclonal human IgG preparation made from the plasma of individuals with high neutralizing titers for RSV. This preparation, termed RSVig (lot #4), gave a mean 50% neutralization value of 2.3 ug/ml over 3 experiments. Thus the H1129 is 100-fold more potent in this assay as the enriched polyclonal preparation. - The kinetics of interaction between humanized RSV Mabs and the RSV F protein was studied by surface plasmon resonance using a Pharmacia BIAcore™ biosensor. A recombinant baculovirus expressing a C-terminal truncated F protein provided an abundant source of antigen for kinetic studies. The supernatant, which contained the secreted F protein, was enriched approximately 20-fold by successive chromatography on concanalvalin A and Q-sepharose columns. The pooled fractions were dialyzed against 10 mM sodium citrate (pH 5.5), and concentrated to approximately 0.1 mg/ml. An aliquot of the F-protein (100 ml) was amine-coupled to the BIAcore sensor chip. The amount immobilized gave approximately 2000 response units (Rmax) Of signal when saturated with either H1129 or H1308F. This indicated that there was an equal number of “A” and “C” antigenic sites on the F-protein preparation following the coupling procedure. Two unrelated irrelevant Mabs (RVFV 4D4 and CMV H758) showed no interaction with the immobolized F protein. A typical kinetic study involved the injection of 35 ml of Mab at varying concentrations (25-300 nM) in PBS buffer containing 0.05% Tween-20 (PBS/Tween). The flow rate was maintained at 5 ml/min, giving a 7 min binding phase. Following the injection of Mab, the flow was exchanged with PBS/Tween buffer for 30 min for determining the rate of dissociation. The sensor chip was regenerated between cycles with a 2 min pulse of 10 mM HCl. The regeneration step caused a minimal loss of binding capacity of the immobilized F-protein (4% loss per cycle). This small decrease did not change the calculated values of the rate constants for binding and dissociation.
- The affinity of the various Mabs for binding to the F protein was calculated from the ratio of the first order rate constant for dissociation to the second order rate constant for binding (Kd=kdiss/kassoc). The value for kassoc was calculated based on the following rate equation:
-
dR/dt=k assoc[Mab]Rmax−(k assoc [Mab]+k diss)R (1) - where R and Rmax are the response units at time t and infinity, respectively. A plot of dr/dt as a function of R gives a slope of (kassoc [Mab]+kdiss)—Since these slopes are linearly related to the [Mab], the value kassoc can be derived from a replot of the slopes versus [Mab]. The slope of the new line is equal to kassoc. Although the value of kdiss can be extrapolated from the Y-intercept, a more accurate value was determined by direct measurement of kdiss. Following the injection phase of the Mab, PBS/Tween buffer flows across the sensor chip. From this point, [Mab]=0. Equation (1) thus reduces to:
-
dr/dt=k dissr or dR/R=k diss dt (2) - Integration of equation (2) gives:
-
ln(R 0 /R t)=k diss t (3) - where R0/Rt) are the response units at time 0 (start of dissociation phase) and t, respectively. Lastly, plotting In(R0/Rt) as a function of t gives a slope of kdiss.
-
Kinetic Constants for RSV Mabs ka (assoc) kd(dissoc) t1/2# Kd(kd/ka) Mab M−1sec−1 sec−1 (hours) nM CH1129 5.0 × 104 7.5 × 10−5 2.6 1.5 H1129 4.9 × 104 6.9 × 10−5 2.8 1.4 M1129 3.5 × 104 4.0 × 10−4 0.48 11.4 M1308F 3.5 × 104 3.8 × 10−5 5.1 1.1 H1308F 2.2 × 104 5.5 × 10−5 3.5 2.5 -
- 1. Hall, C. B., Doiuglas, R. G., Geiman, J. M. et al., N. Engl. J. Med. 293:1343, 1975.
- 2. Hall, C. B., McBride, J. T., Walsh, E. E. et al., N. Engl. J. Med. 308:1443, 1983.
- 3. Hall, C. B., McBride, J. T., Gala, C. L. et al., JAMA 254:3047, 1985.
- 4. Wald, E. R., et al., J. Pediat. 112:154, 1988.
- 5. Kapikian, A. Z., Mithcell, R. H., Chanock, R. M. et al., Am. J. Epidemiol. 89:405, 1969.
- 6. Prince, G. A., Hemming, V. G., Horswood, R. L. et al., Virus Res. 3:193, 1985.
- 7. Hemming, V. G., Prince, G. A., Horswood, R. L. et al., J. Infect. Dis. 152:1083, 1985.
- 8. Wright, P. F., Belshe, R. B., et al., Infect Immun 37:397, 1982.
- 9. Conrad, D. A., Christenson, J. C., et al., Peditr. Infect. Dis. J. 6:152, 1987.
- 10. LoBuglio, A. F., Wheeler, R. L., Trang, J. et al., Proc. Natl. Acad. Sci. 86:4220, 1989.
- 11. Steplewski, Z., Sun, L. K., Sheannan, C. W. et al., Proc. Natl. Acad. Sci. 85:4852, 1988.
- 12. Boulianne, G. L., Hozumi, N., Shulman, M. J. Nature. 312:643, 1984.
- 13. Sun, L. K., Curtis, P., Rakowicz-Szulczynska, E. et al., Proc. Natl. Acad. Sci. 84:214, 1987.
- 14. Liu, A. Y., Mack, P. W., Champion, C. I., Robinson, R. R., Gene 54:33, 1987.
- 15. Morrison, S. L., Johnson, M. J., Hersenber, L. A., Oi, V. T. Proc. Natl. Acad. Sci. 81:6851, 1984.
- 16. Morrison, S. L. Science 229:1202, 1985.
- 17. Sahagan, B. G., Dorai, H., Saltzgaber-Muller, J. et al., J. Immunol. 137:1066, 1986.
- 18. Taked, S., Naito, T., Hama, K., Noma, T., Honjo, T., Nature 314:452, 1985.
- 19. Carson, D. A., Freimark, B. D., Adv. Immunol. 38:275, 1986.
- 20. Beeler, J. A., et al., J. Virol. 63:2941-2950, 1989.
- 21. Coelingh, et al., Virology, 143:569-582, 1985.
Claims (20)
1. A human-murine chimeric antibody, comprising a human antibody containing at least one CDR from each of the variable heavy and variable light chains of a non-human monoclonal antibody against RSV.
2. An antibody as in claim 1 , wherein said murine monoclonal antibody is a neutralizing antibody against RSV.
3. An antibody as in claim 1 , wherein said murine monoclonal antibody is an antibody against RSV F protein.
4. An antibody as in claim 3 , wherein said murine monoclonal antibody is a neutralizing antibody against RSV F protein.
5. An antibody as in claim 3 , wherein:—said CDR comprises three complementarity determining regions from each of said variable heavy and variable light chains.
6. An antibody of claim 5 , wherein said murine antibody against RSV F protein is specific for antigenic site A of said protein.
7. A human antibody of claim 5 , wherein said murine antibody against RSV F protein is specific for antigenic site C of said protein.
8. A human antibody of claim 7 , wherein said murine antibody is Mab 1308F.
9. A human antibody as in claim 8 , wherein said three complementarity determining regions from said variable heavy chain of Mab 1308F comprise amino acid sequence Nos. 31 to 35, 47 to 60 and 99 to 106 and said three complementarity determining regions from said variable light chain of Mab 1308F comprise amino acid sequence Nos. 24 to 34, 50 to 56 and 89 to 97.
10. A process for preventing or treating a respiratory syncytial virus infection in an animal comprising administering to said animal an effective amount of a human antibody of claim 3 .
11. The process of claim 10 , wherein said CDR's have three complementarity determining regions from each of said variable heavy and variable light chains.
12. A composition for preventing or treating respiratory syncytial virus infection in an animal comprising:
(a) an effective amount of a human antibody of claim 3 , and
(b) and acceptable pharmaceutical carrier.
13. A process for preventing or treating a respiratory syncytial virus infection in an animal comprising administering to said animal an effective amount of a plurality of human antibodies which contain at least one CDR from each variable heavy and variable light chain of at least one murine monoclonal antibody against RSV F protein.
14. A human-murine chimeric antibody, comprising a human antibody containing at least one CDR from each of the variable heavy and variable light chains of a murine monoclonal antibody against RSV, where said murine antibody is Mab1129.
15. An antibody as in claim 14 , wherein said CDR comprises three complementarity determining regions from each of said variable heavy and variable light chains.
16. (canceled)
17. A process for preventing or treating a respiratory syncytial virus infection in an animal comprising: administering to said animal an effective amount of the human antibody of claim 14 .
18. (canceled)
19. A composition for preventing or treating respiratory syncytial virus infection in an animal comprising:
(a) an effective amount of the human antibody of claim 14 , and
(b) an acceptable pharmaceutical carrier.
20. A process for preventing or treating a respiratory syncytial virus infection in an animal comprising administering to said animal an effective amount of the composition of claim 19 .
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/039,174 US20140093501A1 (en) | 1994-08-15 | 2013-09-27 | Human-Murine Chimeric Antibodies Against Respiratory Syncytial Virus |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/290,592 US5824307A (en) | 1991-12-23 | 1994-08-15 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US09/158,120 US20020102257A1 (en) | 1998-09-21 | 1998-09-21 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US11/198,322 US20070020279A1 (en) | 1991-12-23 | 2005-08-08 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US12/244,068 US7704505B2 (en) | 1994-08-15 | 2008-10-02 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US12/719,063 US8562994B2 (en) | 1994-08-15 | 2010-03-08 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US14/039,174 US20140093501A1 (en) | 1994-08-15 | 2013-09-27 | Human-Murine Chimeric Antibodies Against Respiratory Syncytial Virus |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/719,063 Continuation US8562994B2 (en) | 1994-08-15 | 2010-03-08 | Human-murine chimeric antibodies against respiratory syncytial virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20140093501A1 true US20140093501A1 (en) | 2014-04-03 |
Family
ID=23116697
Family Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/290,592 Expired - Lifetime US5824307A (en) | 1991-12-23 | 1994-08-15 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US12/244,068 Expired - Fee Related US7704505B2 (en) | 1994-08-15 | 2008-10-02 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US12/719,063 Expired - Fee Related US8562994B2 (en) | 1994-08-15 | 2010-03-08 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US14/039,174 Abandoned US20140093501A1 (en) | 1994-08-15 | 2013-09-27 | Human-Murine Chimeric Antibodies Against Respiratory Syncytial Virus |
Family Applications Before (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/290,592 Expired - Lifetime US5824307A (en) | 1991-12-23 | 1994-08-15 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US12/244,068 Expired - Fee Related US7704505B2 (en) | 1994-08-15 | 2008-10-02 | Human-murine chimeric antibodies against respiratory syncytial virus |
| US12/719,063 Expired - Fee Related US8562994B2 (en) | 1994-08-15 | 2010-03-08 | Human-murine chimeric antibodies against respiratory syncytial virus |
Country Status (11)
| Country | Link |
|---|---|
| US (4) | US5824307A (en) |
| EP (3) | EP1659133B1 (en) |
| JP (6) | JP3896160B2 (en) |
| AT (1) | ATE341563T1 (en) |
| AU (1) | AU713113B2 (en) |
| CA (1) | CA2197684C (en) |
| DE (1) | DE69535253T2 (en) |
| DK (2) | DK0783525T3 (en) |
| ES (2) | ES2442460T3 (en) |
| PT (2) | PT783525E (en) |
| WO (1) | WO1996005229A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017021815A2 (en) | 2015-07-31 | 2017-02-09 | Pontificia Universidad Católica De Chile | Monoclonal antibodies specifically for the antigen p of the human respiratory syncytial virus, produced and secreted by the cells hybridomas, useful for detection and diagnostic of the infection caused by rsv |
Families Citing this family (135)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US20020102257A1 (en) * | 1998-09-21 | 2002-08-01 | Leslie Sid Johnson | Human-murine chimeric antibodies against respiratory syncytial virus |
| US5824307A (en) * | 1991-12-23 | 1998-10-20 | Medimmune, Inc. | Human-murine chimeric antibodies against respiratory syncytial virus |
| US6685942B1 (en) | 1993-12-10 | 2004-02-03 | The Scripps Research Institute | Human neutralizing monoclonal antibodies to respiratory syncytial virus |
| US20030082107A1 (en) * | 1997-10-01 | 2003-05-01 | Dugger Harry A. | Buccal, polar and non-polar spray or capsule containing drugs for treating an infectious disease or cancer |
| US20030095927A1 (en) * | 1997-10-01 | 2003-05-22 | Dugger Harry A. | Buccal, polar and non-polar spray or capsule containing drugs for treating muscular and skeletal disorders |
| US20030077229A1 (en) * | 1997-10-01 | 2003-04-24 | Dugger Harry A. | Buccal, polar and non-polar spray or capsule containing cardiovascular or renal drugs |
| US20030185761A1 (en) * | 1997-10-01 | 2003-10-02 | Dugger Harry A. | Buccal, polar and non-polar spray or capsule containing drugs for treating pain |
| US20030095926A1 (en) * | 1997-10-01 | 2003-05-22 | Dugger Harry A. | Buccal, polar and non-polar spray or capsule containing drugs for treating disorders of the gastrointestinal tract or urinary tract |
| US20030190286A1 (en) * | 1997-10-01 | 2003-10-09 | Dugger Harry A. | Buccal, polar and non-polar spray or capsule containing drugs for treating allergies or asthma |
| US20050180923A1 (en) * | 1997-10-01 | 2005-08-18 | Dugger Harry A.Iii | Buccal, polar and non-polar spray containing testosterone |
| US20030095925A1 (en) * | 1997-10-01 | 2003-05-22 | Dugger Harry A. | Buccal, polar and non-polar spray or capsule containing drugs for treating metabolic disorders |
| US20050002867A1 (en) * | 1997-10-01 | 2005-01-06 | Novadel Pharma Inc. | Buccal, polar and non-polar sprays containing propofol |
| EP1036561A1 (en) * | 1997-10-01 | 2000-09-20 | Flemington Pharmaceutical Corporation | Buccal, non-polar spray |
| US20040136914A1 (en) * | 1997-10-01 | 2004-07-15 | Dugger Harry A. | Buccal, polar and non-polar spray containing ondansetron |
| US20030077227A1 (en) * | 1997-10-01 | 2003-04-24 | Dugger Harry A. | Buccal, polar and non-polar spray or capsule containing drugs for treating disorders of the central nervous system |
| US20040136913A1 (en) * | 1997-10-01 | 2004-07-15 | Dugger Harry A. | Buccal, polar and non-polar spray containing sumatriptan |
| US7632517B2 (en) * | 1997-10-01 | 2009-12-15 | Novadel Pharma Inc. | Buccal, polar and non-polar spray containing zolpidem |
| US20050163719A1 (en) * | 1997-10-01 | 2005-07-28 | Dugger Harry A.Iii | Buccal, polar and non-polar spray containing diazepam |
| US20090162300A1 (en) * | 1997-10-01 | 2009-06-25 | Dugger Iii Harry A | Buccal, polar and non-polar spray containing alprazolam |
| US20040136915A1 (en) * | 1997-10-01 | 2004-07-15 | Dugger Harry A. | Buccal, polar and non-polar spray containing atropine |
| US20030077228A1 (en) * | 1997-10-01 | 2003-04-24 | Dugger Harry A. | Buccal, polar and non-polar spray or capsule containing drugs for treating endocrine disorders |
| US20050281752A1 (en) * | 1997-10-01 | 2005-12-22 | Dugger Harry A Iii | Buccal, polar and non-polar spray or capsule containing drugs for treating disorders of the central nervous system |
| US20040141923A1 (en) * | 1997-10-01 | 2004-07-22 | Dugger Harry A. | Buccal, polar and non-polar spray containing alprazolam |
| US20050287075A1 (en) * | 1997-10-01 | 2005-12-29 | Dugger Harry A Iii | Buccal, polar and non-polar spray or capsule containing drugs for treating pain |
| WO1999045959A1 (en) * | 1998-03-13 | 1999-09-16 | Dana-Farber Cancer Institute, Inc. | Humanized antibody and uses thereof |
| AR030019A1 (en) * | 1999-05-18 | 2003-08-13 | Smithkline Beecham Corp | HUMAN MONOCLONAL ANTIBODIES AND FUNCTIONAL FRAGMENTS OF THE SAME, A PROCEDURE FOR THEIR PRODUCTION, PHARMACEUTICAL COMPOSITIONS THAT INCLUDE THEM, A NUCLEIC ACID ISOLATED MOLECULA, A RECOMBINANT PLASMIDE, A HOSPED DIFFERENT USE OF A MUSCLE |
| ATE474854T1 (en) | 2000-01-27 | 2010-08-15 | Medimmune Llc | RSV NEUTRALIZING ANTIBODIES WITH VERY HIGH AFFINITY |
| WO2001064751A2 (en) * | 2000-03-01 | 2001-09-07 | Medimmune, Inc. | High potency recombinant antibodies and method for producing them |
| US7229619B1 (en) * | 2000-11-28 | 2007-06-12 | Medimmune, Inc. | Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment |
| WO2001059142A1 (en) * | 2000-02-09 | 2001-08-16 | Medimmune, Inc. | Antibody gene therapy with adeno-associated viral vectors |
| US6565849B2 (en) * | 2000-03-02 | 2003-05-20 | Medimmune, Inc. | Methods of enhancing activity of vaccines and vaccine compositions |
| ATE457177T1 (en) * | 2000-05-03 | 2010-02-15 | Medimmune Llc | COMBINATION THERAPY FOR THE TREATMENT OF RESPIRATORY DISEASES USING ANTIBODIES AND ANTI-INFLAMMATORY ACTIVES |
| US20020004046A1 (en) * | 2000-05-03 | 2002-01-10 | Johnson Leslie S. | Combination therapy of respiratory diseases using antibodies |
| US7179900B2 (en) | 2000-11-28 | 2007-02-20 | Medimmune, Inc. | Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment |
| AU2008202076B2 (en) * | 2000-11-28 | 2011-09-08 | Medimmune, Llc | Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment |
| US6855493B2 (en) * | 2000-11-28 | 2005-02-15 | Medimmune, Inc. | Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment |
| EP2412384A1 (en) | 2000-11-28 | 2012-02-01 | MedImmune, LLC | Methods of administering/dosing anti-RSV antibodies for prophylaxis and treatment |
| US6818216B2 (en) * | 2000-11-28 | 2004-11-16 | Medimmune, Inc. | Anti-RSV antibodies |
| PT1355919E (en) | 2000-12-12 | 2011-03-02 | Medimmune Llc | Molecules with extended half-lives, compositions and uses thereof |
| US7658921B2 (en) * | 2000-12-12 | 2010-02-09 | Medimmune, Llc | Molecules with extended half-lives, compositions and uses thereof |
| US20030232061A1 (en) * | 2001-10-18 | 2003-12-18 | Fouchier Ronaldus Adrianus Maria | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus |
| US8715922B2 (en) * | 2001-01-19 | 2014-05-06 | ViroNovative | Virus causing respiratory tract illness in susceptible mammals |
| KR101105984B1 (en) | 2001-01-19 | 2012-01-18 | 비로노바티브 비.브이. | A virus causing respiratory tract illness in susceptible mammals |
| GB2378949B (en) * | 2001-08-16 | 2005-09-07 | Morten Steen Hanefeld Dziegiel | Recombinant anti-plasmodium falciparum antibodies |
| CA2743750A1 (en) | 2002-02-21 | 2003-09-04 | Medimmune, Llc | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from respiratory syncytial virus |
| US20040063912A1 (en) * | 2002-03-15 | 2004-04-01 | The Brigham And Women's Hospital, Inc. | Central airway administration for systemic delivery of therapeutics |
| AU2002316574B2 (en) * | 2002-03-15 | 2008-05-01 | Brandeis University | Central airway administration for systemic delivery of therapeutics |
| EP2270049A3 (en) | 2002-04-12 | 2011-03-09 | Medimmune, Inc. | Recombinant anti-interleukin-9-antibody |
| US20050152899A1 (en) * | 2002-05-10 | 2005-07-14 | Kinch Michael S. | EphA2 agonistic monoclonal antibodies and methods of use thereof |
| ES2377720T3 (en) * | 2002-05-10 | 2012-03-30 | Purdue Research Foundation | AGON�? STICOS ANTIBODIES EPHA2 AND METHODS OF USE OF THE SAME. |
| US20040028685A1 (en) * | 2002-05-10 | 2004-02-12 | Kinch Michael S. | EphA2 monoclonal antibodies and methods of use thereof |
| US7425618B2 (en) | 2002-06-14 | 2008-09-16 | Medimmune, Inc. | Stabilized anti-respiratory syncytial virus (RSV) antibody formulations |
| US7132100B2 (en) | 2002-06-14 | 2006-11-07 | Medimmune, Inc. | Stabilized liquid anti-RSV antibody formulations |
| AU2013201261B2 (en) * | 2002-06-14 | 2016-06-23 | Medimmune, Llc | Stabilized liquid anti-RSV antibody formulations |
| AU2003256823B9 (en) * | 2002-07-25 | 2009-01-08 | Medimmune, Llc | Methods of treating and preventing RSV, hMPV, and PIV using anti-RSV, anti-hMPV, and anti-PIV antibodies |
| AR047392A1 (en) | 2002-10-22 | 2006-01-18 | Wyeth Corp | NEUTRALIZATION OF ANTIBODIES AGAINST GDF 8 AND ITS USE FOR SUCH PURPOSES |
| CN103965301A (en) | 2003-04-01 | 2014-08-06 | 国家健康医学研究所 | Antibodies Directed Against Hepatitis C Virus E1e2 Complex, Compositions Of Hcv Particles, And Pharmaceutical Compositions |
| JP2006524693A (en) * | 2003-04-11 | 2006-11-02 | メディミューン,インコーポレーテッド | EphA2 and non-neoplastic hyperproliferative cell disorders |
| EP1613273B1 (en) | 2003-04-11 | 2012-06-13 | MedImmune, LLC | Recombinant il-9 antibodies and uses thereof |
| AU2004230539A1 (en) * | 2003-04-11 | 2004-10-28 | Medimmune, Llc | EphA2, hypoproliferative cell disorders and epithelial and endothelial reconstitution |
| EP1623006A4 (en) * | 2003-04-25 | 2009-10-28 | Medimmune Vaccines Inc | METAPNEUMOVIRUS STRAINS AND THEIR USE IN VACCINE PREPARATIONS AND AS VECTORS FOR THE EXPRESSION OF ANTIGEN SEQUENCES AND METHODS FOR PROPAGATING A VIRUS |
| CN1813061B (en) * | 2003-04-25 | 2013-05-29 | 免疫医疗有限责任公司 | Recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from metapneumovirus |
| US7750123B2 (en) * | 2003-11-25 | 2010-07-06 | Dana Farber Cancer Institute, Inc. | Antibodies against SARS-CoV and methods of use thereof |
| WO2005079479A2 (en) * | 2004-02-17 | 2005-09-01 | Absalus, Inc. | Super-humanized antibodies against respiratory syncytial virus |
| WO2005080432A2 (en) * | 2004-02-19 | 2005-09-01 | Genentech, Inc. | Cdr-repaired antibodies |
| US7691379B2 (en) | 2004-04-12 | 2010-04-06 | Medimmune, Llc | Anti-IL-9 antibody formulations |
| US7700720B2 (en) * | 2004-09-21 | 2010-04-20 | Medimmune, Llc | Antibodies against and methods for producing vaccines for respiratory syncytial virus |
| US7910101B2 (en) | 2004-10-25 | 2011-03-22 | Centocor, Inc. | Melanocortin receptor binding mimetibodies, compositions, methods and uses |
| TW200636064A (en) * | 2004-10-28 | 2006-10-16 | Centocor Inc | Anti-respiratory syncytial virus antibodies, antigens and uses thereof |
| AU2005302453A1 (en) * | 2004-10-29 | 2006-05-11 | Medimmune, Llc | Methods of preventing and treating RSV infections and related conditions |
| KR20070110924A (en) * | 2005-03-10 | 2007-11-20 | 메드이뮨 백신즈 인코포레이티드 | Vectors for the expression of metapneumovirus lines and antigenic sequences and their use as vaccines and methods of propagation of viruses |
| WO2006110214A2 (en) * | 2005-04-08 | 2006-10-19 | Medimmune, Inc. | Antibodies against mammalian metapneumovirus |
| AU2006261920A1 (en) | 2005-06-23 | 2007-01-04 | Medimmune, Llc | Antibody formulations having optimized aggregation and fragmentation profiles |
| AU2006331775A1 (en) * | 2005-12-21 | 2007-07-05 | Medimmune, Llc | Affinity optimized EphA2 agonistic antibodies and methods of use thereof |
| CA2638833A1 (en) * | 2006-03-06 | 2007-09-13 | Symphogen A/S | Recombinant polyclonal antibody for treatment of respiratory syncytial virus infections |
| CA2649895C (en) * | 2006-04-19 | 2013-03-26 | Novadel Pharma Inc. | Stable hydroalcoholic oral spray formulations and methods |
| SG10201504662WA (en) | 2006-06-14 | 2015-07-30 | Macrogenics Inc | Methods For The Treatment Of Autoimmune Disorders Using Immunosuppressive Monoclonal Antibodies With Reduced Toxicity |
| EA021255B1 (en) | 2006-08-28 | 2015-05-29 | Киова Хакко Кирин Ко., Лимитед | Antagonistic human light-specific human monoclonal antibodies |
| CA2673049C (en) * | 2006-12-22 | 2016-02-23 | Novadel Pharma Inc. | Stable anti-nausea oral spray formulations and methods |
| EP2134747A2 (en) * | 2007-03-06 | 2009-12-23 | Symphogen A/S | Recombinant antibodies for treatment of respiratory syncytial virus infections |
| JP5622397B2 (en) * | 2007-03-12 | 2014-11-12 | エスバテック− ア ノバルティス カンパニー エルエルシー | Single-chain antibody sequence-based manipulation and optimization |
| US8747872B2 (en) | 2007-05-02 | 2014-06-10 | The Regents Of The University Of Michigan | Nanoemulsion therapeutic compositions and methods of using the same |
| WO2008141264A1 (en) * | 2007-05-10 | 2008-11-20 | Novadel Pharma Inc. | Anti-insomnia compositions and methods |
| EP1997830A1 (en) | 2007-06-01 | 2008-12-03 | AIMM Therapeutics B.V. | RSV specific binding molecules and means for producing them |
| DK2158315T3 (en) | 2007-06-25 | 2016-06-06 | Esbatech Alcon Biomed Res Unit | Methods of modifying antibodies and modified antibodies with improved functional properties |
| AU2008267733B2 (en) * | 2007-06-25 | 2013-11-14 | Esbatech, An Alcon Biomedical Research Unit Llc | Sequence based engineering and optimization of single chain antibodies |
| WO2009042589A1 (en) * | 2007-09-24 | 2009-04-02 | Vanderbilt University | Monoclonal antibodies to respiratory syncytial virus and uses thereof |
| US20090186050A1 (en) * | 2007-11-16 | 2009-07-23 | Fouchier Ron A M | Live attenuated metapneumovirus strains and their use in vaccine formulations and chimeric metapneumovirus strains |
| ES2713864T3 (en) * | 2008-06-05 | 2019-05-24 | Ablynx Nv | Amino acid sequences directed against envelope proteins of a virus and polypeptides comprising the same for the treatment of viral diseases |
| US9556265B2 (en) | 2008-06-25 | 2017-01-31 | Esbatech, An Alcon Biomedical Research Unit Llc | Solubility optimization of immunobinders |
| TWI516501B (en) | 2008-09-12 | 2016-01-11 | 禮納特神經系統科學公司 | Pcsk9 antagonists |
| US8775090B2 (en) | 2008-12-12 | 2014-07-08 | Medimmune, Llc | Crystals and structure of a human IgG Fc variant with enhanced FcRn binding |
| WO2010087927A2 (en) | 2009-02-02 | 2010-08-05 | Medimmune, Llc | Antibodies against and methods for producing vaccines for respiratory syncytial virus |
| US8840889B2 (en) | 2009-08-13 | 2014-09-23 | The Johns Hopkins University | Methods of modulating immune function |
| ES2553440T3 (en) | 2009-08-13 | 2015-12-09 | Crucell Holland B.V. | Antibodies against human respiratory syncytial virus (RSV) and method of use |
| US8568726B2 (en) | 2009-10-06 | 2013-10-29 | Medimmune Limited | RSV specific binding molecule |
| EP3372617B1 (en) | 2010-04-02 | 2024-07-24 | Amunix Pharmaceuticals, Inc. | Binding fusion proteins, binding fusion protein-drug conjugates, xten-drug conjugates and methods of making and using same |
| TWI627964B (en) * | 2010-07-09 | 2018-07-01 | 傑森疫苗防護公司 | Anti-human respiratory syncytial virus (rsv) antibodies and methods of use |
| US9320793B2 (en) * | 2010-07-14 | 2016-04-26 | Acumen Pharmaceuticals, Inc. | Method for treating a disease associated with soluble, oligomeric species of amyloid beta 1-42 |
| US8822663B2 (en) | 2010-08-06 | 2014-09-02 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| DK4108671T3 (en) | 2010-10-01 | 2025-01-06 | Modernatx Inc | MODIFIED NUCLEOSIDES, NUCLEOTIDES AND NUCLEIC ACIDS AND THEIR USES |
| JP2014511687A (en) | 2011-03-31 | 2014-05-19 | モデルナ セラピューティクス インコーポレイテッド | Engineered nucleic acid delivery and formulation |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| JP6113737B2 (en) | 2011-10-03 | 2017-04-12 | モデルナティエックス インコーポレイテッドModernaTX,Inc. | Modified nucleosides, nucleotides and nucleic acids and methods for their use |
| EP3559049B1 (en) | 2011-10-28 | 2025-06-11 | Teva Pharmaceuticals Australia Pty Ltd | Polypeptide constructs and uses thereof |
| KR20140102759A (en) | 2011-12-16 | 2014-08-22 | 모더나 세라퓨틱스, 인코포레이티드 | Modified nucleoside, nucleotide, and nucleic acid compositions |
| EP2834259A4 (en) | 2012-04-02 | 2016-08-24 | Moderna Therapeutics Inc | Modified polynucleotides |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| TWI659968B (en) * | 2013-03-14 | 2019-05-21 | 再生元醫藥公司 | Human antibodies to respiratory syncytial virus f protein and methods of use thereof |
| US9649375B2 (en) | 2013-03-14 | 2017-05-16 | The Administrators Of The Tulane Educational Fund | Immunogenic peptide conjugate and method for inducing an anti-influenza therapeutic antibody response therewith |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| JP6824735B2 (en) | 2013-06-06 | 2021-02-03 | ピエール、ファーブル、メディカマン | Anti-C10orf54 antibody and how to use it |
| US10023626B2 (en) | 2013-09-30 | 2018-07-17 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| EP3052521A1 (en) | 2013-10-03 | 2016-08-10 | Moderna Therapeutics, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| AU2015213593B2 (en) | 2014-02-10 | 2020-09-03 | Igm Biosciences, Inc. | IgA multi-specific binding molecules |
| WO2015118149A1 (en) * | 2014-02-10 | 2015-08-13 | Univercells Nv | System, apparatus and method for anti-rsv antibodies and formulations |
| GB201403775D0 (en) | 2014-03-04 | 2014-04-16 | Kymab Ltd | Antibodies, uses & methods |
| US9340604B1 (en) * | 2014-10-29 | 2016-05-17 | Aridis Pharmaceuticals, Inc. | Human monoclonal antibody specific for the F protein of respiratory syncytial virus (RSV) |
| WO2016069999A2 (en) | 2014-10-31 | 2016-05-06 | Medimmune, Llc | An improved manufacturing method |
| CA2970352A1 (en) | 2014-12-11 | 2016-06-16 | Pierre Fabre Medicament | Anti-c10orf54 antibodies and uses thereof |
| HRP20230046T1 (en) | 2015-03-03 | 2023-03-03 | Kymab Limited | ANTIBODIES, USE AND PROCEDURES |
| JO3555B1 (en) | 2015-10-29 | 2020-07-05 | Merck Sharp & Dohme | An antibody that inactivates the human pneumonia virus |
| SG11201903287PA (en) | 2016-10-21 | 2019-05-30 | Adimab Llc | Anti-respiratory syncytial virus antibodies, and methods of their generation and use |
| US11479600B2 (en) | 2016-10-21 | 2022-10-25 | Adimab, Llc | Anti-respiratory syncytial virus antibodies, and methods of their generation and use |
| CA3040893A1 (en) | 2016-10-21 | 2018-04-26 | Adimab, Llc | Anti-respiratory syncytial virus antibodies, and methods of their generation and use |
| US11779604B2 (en) | 2016-11-03 | 2023-10-10 | Kymab Limited | Antibodies, combinations comprising antibodies, biomarkers, uses and methods |
| MA53160A (en) | 2018-07-20 | 2021-05-26 | Pf Medicament | RECEIVER FOR VISTA |
| WO2021005232A1 (en) | 2019-07-11 | 2021-01-14 | Umc Utrecht Holding B.V. | Intranasal administration of neutralising antiviral antibodies |
| WO2021202463A1 (en) | 2020-03-30 | 2021-10-07 | Danisco Us Inc | Anti-rsv antibodies |
| CN119264248A (en) | 2022-07-22 | 2025-01-07 | 北京智仁美博生物科技有限公司 | Anti-respiratory syncytial virus neutralizing antibodies and uses thereof |
| WO2025104604A1 (en) | 2023-11-14 | 2025-05-22 | Janssen Pharmaceuticals, Inc. | Anti-respiratory syncytial virus antibodies and uses thereof |
Family Cites Families (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4517304A (en) * | 1980-07-01 | 1985-05-14 | National Research Development Corporation | Production of viral antigens |
| US4717766A (en) * | 1986-01-27 | 1988-01-05 | Miles Laboratories, Inc. | Method of preparing high titer anti-respiratory syncytial virus intravenous immune globulin |
| US4659563A (en) * | 1986-01-27 | 1987-04-21 | Miles Laboratories, Inc. | High titer anti-respiratory syncytial virus intravenous immune globulin |
| US5225539A (en) * | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US4800078A (en) * | 1987-05-28 | 1989-01-24 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Immunotherapeutic method of treating respiratory disease by intranasal administration of Igb |
| GB8720833D0 (en) * | 1987-09-04 | 1987-10-14 | Celltech Ltd | Recombinant dna product |
| US5223254A (en) * | 1987-09-29 | 1993-06-29 | Praxis Biologics, Inc. | Respiratory syncytial virus: vaccines |
| DE3878468T2 (en) * | 1987-12-23 | 1993-06-09 | Upjohn Co | CHIMARENE GLYCOPROTEINS, CONTAINING IMMUNOGENIC SEGMENTS OF THE HUMAN RESPIRATORY SYNCYTIAL VIRUS. |
| WO1989007142A1 (en) | 1988-02-05 | 1989-08-10 | Morrison Sherie L | Domain-modified constant region antibodies |
| US5183657A (en) * | 1988-03-11 | 1993-02-02 | Celltech Limited | Antibodies for use in antilymphocyte antibody therapy |
| FI903489A0 (en) | 1988-11-11 | 1990-07-10 | Medical Res Council | LIGANDER MED EN ENDA SEKTION, RECEPTORER INNEHAOLLANDE NAEMNDA LIGANDER, FOERFARANDEN FOER DERAS FRAMSTAELLNING SAMT ANVAENDNING AV LIGANDERNA OCH RECEPTORERNA. |
| US5530101A (en) * | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| IL162181A (en) | 1988-12-28 | 2006-04-10 | Pdl Biopharma Inc | A method of producing humanized immunoglubulin, and polynucleotides encoding the same |
| US5332567A (en) * | 1989-08-24 | 1994-07-26 | Immunomedics | Detection and treatment of infections with immunoconjugates |
| GB9019812D0 (en) * | 1990-09-11 | 1990-10-24 | Scotgen Ltd | Novel antibodies for treatment and prevention of infection in animals and man |
| GB9020282D0 (en) | 1990-09-17 | 1990-10-31 | Gorman Scott D | Altered antibodies and their preparation |
| CA2109528A1 (en) * | 1991-05-01 | 1992-11-02 | Gregory A. Prince | A method for treating infectious respiratory diseases |
| WO1993005796A1 (en) | 1991-09-19 | 1993-04-01 | The Scripps Research Institute | Method for producing human antibodies in a non-human animal, and animals therefor |
| US5240694A (en) * | 1991-09-23 | 1993-08-31 | University Of Virginia | Combined antiviral and antimediator treatment of common colds |
| US20020102257A1 (en) * | 1998-09-21 | 2002-08-01 | Leslie Sid Johnson | Human-murine chimeric antibodies against respiratory syncytial virus |
| US5824307A (en) | 1991-12-23 | 1998-10-20 | Medimmune, Inc. | Human-murine chimeric antibodies against respiratory syncytial virus |
| FR2686901A1 (en) | 1992-01-31 | 1993-08-06 | Rhone Poulenc Rorer Sa | NOVEL ANTITHROMBOTIC POLYPEPTIDES, THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM. |
| FR2686899B1 (en) | 1992-01-31 | 1995-09-01 | Rhone Poulenc Rorer Sa | NOVEL BIOLOGICALLY ACTIVE POLYPEPTIDES, THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM. |
| AU3923293A (en) | 1992-03-20 | 1993-10-21 | Immunet | Human monoclonal antibodies and methods for human monoclonal antibody production |
| GB9207479D0 (en) | 1992-04-06 | 1992-05-20 | Scotgen Ltd | Novel antibodies for treatment and prevention of respiratory syncytial virus infection in animals and man |
| AU686113B2 (en) | 1992-09-16 | 1998-02-05 | Scripps Research Institute, The | Human neutralizing monoclonal antibodies to respiratory syncytial virus |
| WO1994017105A1 (en) * | 1993-01-29 | 1994-08-04 | Medimmune, Inc. | Human-murine chimeric antibodies against respiratory syncytial virus |
| WO1994029351A2 (en) | 1993-06-16 | 1994-12-22 | Celltech Limited | Antibodies |
| US6818216B2 (en) * | 2000-11-28 | 2004-11-16 | Medimmune, Inc. | Anti-RSV antibodies |
-
1994
- 1994-08-15 US US08/290,592 patent/US5824307A/en not_active Expired - Lifetime
-
1995
- 1995-08-09 DE DE69535253T patent/DE69535253T2/en not_active Expired - Lifetime
- 1995-08-09 WO PCT/US1995/010053 patent/WO1996005229A1/en not_active Ceased
- 1995-08-09 AU AU32158/95A patent/AU713113B2/en not_active Expired
- 1995-08-09 ES ES06003224.0T patent/ES2442460T3/en not_active Expired - Lifetime
- 1995-08-09 PT PT95928353T patent/PT783525E/en unknown
- 1995-08-09 CA CA002197684A patent/CA2197684C/en not_active Expired - Lifetime
- 1995-08-09 DK DK95928353T patent/DK0783525T3/en active
- 1995-08-09 EP EP06003224.0A patent/EP1659133B1/en not_active Expired - Lifetime
- 1995-08-09 EP EP95928353A patent/EP0783525B1/en not_active Expired - Lifetime
- 1995-08-09 AT AT95928353T patent/ATE341563T1/en active
- 1995-08-09 ES ES95928353T patent/ES2274518T3/en not_active Expired - Lifetime
- 1995-08-09 DK DK06003224.0T patent/DK1659133T3/en active
- 1995-08-09 PT PT60032240T patent/PT1659133E/en unknown
- 1995-08-09 JP JP50745096A patent/JP3896160B2/en not_active Expired - Lifetime
- 1995-08-09 EP EP10010129A patent/EP2371858A3/en not_active Withdrawn
-
2006
- 2006-05-31 JP JP2006152600A patent/JP4216297B2/en not_active Expired - Lifetime
-
2007
- 2007-08-01 JP JP2007200866A patent/JP2008024707A/en active Pending
-
2008
- 2008-09-04 JP JP2008227316A patent/JP2009029817A/en active Pending
- 2008-10-02 US US12/244,068 patent/US7704505B2/en not_active Expired - Fee Related
-
2010
- 2010-03-08 US US12/719,063 patent/US8562994B2/en not_active Expired - Fee Related
- 2010-06-02 JP JP2010127314A patent/JP2010241819A/en active Pending
-
2012
- 2012-05-28 JP JP2012121164A patent/JP2012207022A/en active Pending
-
2013
- 2013-09-27 US US14/039,174 patent/US20140093501A1/en not_active Abandoned
Non-Patent Citations (8)
| Title |
|---|
| Beeler et al., Journal of Virology 1989 Vol 63, pages 2941-2950 * |
| Casset Biochem Biophys Research Com 2003, vol 307, pages 198-205 * |
| Coleman Reasearch Immunology 1994 Vol 145, pages 33-36 * |
| Jones et al. Nature 1986 Vol 324, pages 522-525 * |
| Paul Fundamental Immunology 3rd 1993, pages 242, 292-295 * |
| Rudikoff PNAS Vol 79 pages 1979-9183 1982 * |
| Sigal et al., The Journal of Immunology 1987 Vol 139, pages 1985-1990 * |
| Tempest et al. 1991 Biotechnology Vol 9, pages 266-271 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017021815A2 (en) | 2015-07-31 | 2017-02-09 | Pontificia Universidad Católica De Chile | Monoclonal antibodies specifically for the antigen p of the human respiratory syncytial virus, produced and secreted by the cells hybridomas, useful for detection and diagnostic of the infection caused by rsv |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8562994B2 (en) | Human-murine chimeric antibodies against respiratory syncytial virus | |
| US20070020279A1 (en) | Human-murine chimeric antibodies against respiratory syncytial virus | |
| FI108991B (en) | Method for Preparation of a Human Monoclonal Antibody | |
| DE69609188T2 (en) | NEUTRALIZING MONOCLONAL ANTIBODIES AGAINST RESPIRATORY SYNCYTIAL VIRUS | |
| KR101671452B1 (en) | Anti-rsv g protein antibodies | |
| BRPI0708636A2 (en) | recombinant polyclonal antibody for treatment of respiratory syncytial virus infections | |
| KR20090127341A (en) | Recombinant antibody for the treatment of respiratory syncytial virus infection | |
| PT98944B (en) | PROCESS FOR THE PREPARATION OF ALTERED ANTIBODIES AND PHARMACEUTICAL COMPOSITIONS FOR THE PREVENTION AND TREATMENT OF INFECTIONS | |
| WO1993020210A9 (en) | Antibodies for treatment and prevention of respiratory syncytial virus infection | |
| EP0636182A1 (en) | Antibodies for treatment and prevention of respiratory syncytial virus infection | |
| WO1994017105A1 (en) | Human-murine chimeric antibodies against respiratory syncytial virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |