US20120052498A1 - Detection of Nucleic Acids - Google Patents
Detection of Nucleic Acids Download PDFInfo
- Publication number
- US20120052498A1 US20120052498A1 US13/175,582 US201113175582A US2012052498A1 US 20120052498 A1 US20120052498 A1 US 20120052498A1 US 201113175582 A US201113175582 A US 201113175582A US 2012052498 A1 US2012052498 A1 US 2012052498A1
- Authority
- US
- United States
- Prior art keywords
- label
- sequence
- nucleic acid
- capture
- extenders
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
Definitions
- Detection may be, for instance, in vivo, in cellulo or in situ. Detection may include or be directed towards detection and quantitation of single nucleotide polymorphisms, i.e. SNP detection, copy number, micro-RNA, siRNA, transcription level determination, and other similar genetic information.
- a variety of techniques for detection of nucleic acids involve a first step of capturing or binding of the target nucleic acid or nucleic acids to a surface through hybridization of each nucleic acid to an oligonucleotide (or other nucleic acid) that is attached to the surface.
- DNA microarray technology which is widely used to analyze gene expression, copy number determination and single nucleotide polymorphism detection, relies on hybridization of DNA targets to preformed arrays of polynucleotides. (See, e.g., Lockhart and Winzeler, “Genomics, gene expression and DNA arrays,” Nature, 405:827-36 (2000); Gerhold et al.
- SNPs can help determine the likelihood that a person might develop various diseases or illnesses.
- Studies using panels of human SNPs to identify evidence for linkage between genomic regions and disease phenotypes have been described. (See, for example, Boyles et al., Am. J. Med. Genet. A., 140(24):2776-85 (2006), Klein et al., Science, 308: 385 (2005), Papassotiropoulos et al., Science, 314:475-478 (2006), Craig and Stephan, Expert Rev. Mol. Diagn., 5(2):159-70 (2005) and Puffenberger et al., Proc. Nat'l. Acad. Sci. USA, 101:11689-94 (2004)).
- CNState Copy Number State
- LCSH Homozygosity
- CNVs Copy Number Variations
- FISH fluorescent in situ hybridization
- CGH comparative genomic hybridization
- VNL virtual karyotyping using oligonucleotide microarrays.
- Some CNVs have been associated with various diseases and this is an on-going and exciting field of research. For instance, elevated levels of EGFR gene has been found in non-small cell lung cancer, a higher level of the gene CCL3L1 has been associated with a lower susceptibility to human HIV, and various other CNVs have been associated with diseases such as autism, schizophrenia and idiopathic learning disability.
- UPD Uniparental Disomy
- a major focus in cytogenetics research is on Uniparental Disomy (UPD) events where a child inherits two copies of chromosomal material from one parent and nothing from the other.
- UPD events are known to be linked with recessive disorders and also cause developmental disorders due to gene imprinting. These events occur without associated copy number changes. For instance approximately 30% of Prader-Willi cases are associated with paternal UPD of chromosome 15q, 2-3% of Angelman Syndrome are associated with maternal UPD of 15q, 10-30% of Beckwith-Wiedemann Syndrome are associated with maternal UPD of 11p15, and 5% of Silver-Russell Syndrome are associated with maternal UPD of chromosome 7.
- a typical DNA microarray contains a large number of spots or features, with each spot or feature containing oligonucleotides which have a single oligonucleotide sequence, each intended to be complementary to and to hybridize to a specific nucleic acid target.
- the GENECHIP® microarray available from Affymetrix can includes millions of features, with each feature containing multiple copies of a different single 25mer oligonucleotide sequence.
- longer oligonucleotides are used to form the spots in the microarray.
- longer oligonucleotides or cDNAs can be used to capture the target nucleic acids.
- Use of longer probes can provide increased specificity, but it can also make discrimination of closely related sequences difficult. Adjusting the length of the oligonucleotide probe to provide the desired specificity and sensitivity often proves extremely difficult. This further requires precise adjustment of hybridization temperature and other solution-phase parameters.
- RNA expression has traditionally been measured using Northern blot and nuclease protection assays. However, these approaches are time-consuming and have limited sensitivity, and the data generated are more qualitative than quantitative in nature. Greater sensitivity and quantification are possible with reverse transcription polymerase chain reaction (RT-PCR) based methods, such as quantitative real-time RT-PCR, but these approaches have low multiplex capabilities.
- RT-PCR reverse transcription polymerase chain reaction
- Microarray technology has been widely used in discovery research, but its moderate sensitivity and its relatively long experimental procedure have limited its use in high throughput expression profiling applications (Epstein and Butow, (2000) “Microarray technology—enhanced versatility, persistent challenge,” Curr. Opin. Biotechnol., 11:36-41).
- MicroRNA are short ribonucleic acid molecules which have been shown to be post-transcriptional regulators that bind complementary oligonucleotide sequences of mRNA transcripts. Upon binding, typically at the 3′ Untranslated Regions (UTR), gene silencing may occur. Typically miRNA are about 15-25 nucleotides in length and a single miRNA could silence hundreds of mRNA transcripts inside the cell. Since the turn of the century, it has been recognized the miRNA play a vital role in gene regulation, through mechanisms including transcript degradation, sequestering of transcripts, and translational suppression or even up-regulation. Thus, aberrant expression of miRNA can lead to various disease states.
- UTR 3′ Untranslated Regions
- FISH Fluorescence In Situ Hybridization
- the FISH technique can be used to detect genetic abnormalities in nearly any type of tissue.
- FISH analyses single-stranded nucleic acids which are fluorescently labeled are allowed to bind to specific regions of the chromosome, and then examined through a microscope. Chromosome samples must first be fixed onto a slide, the labeled probe then hybridized to the chromosomes and then visualization is achieved through various enzyme-linked label-based detection protocols.
- the resolution of FISH analysis is on the order of detection of 60 base pairs (bp) up to 100 kilobase pairs of DNA.
- CGH can detect abnormalities on the scale of 100 bp.
- the FISH analysis though the golden standard today in cytogenetics, is time consuming and requires many steps, and in the end only provides 60 bp to 100 kb resolution.
- Yet another method of detection of genetic abnormalities involves binding of prepared DNA samples in solution to beads or microparticles comprised of oligonucleotides having sequences which are complementary to the target sequence, thereby capturing the target sequence for further analysis.
- Products such as the FLEXMAP3D (Luminex, Austin, Tex.), are illustrative of this type of technology.
- FLEXMAP3D Luminex, Austin, Tex.
- these types of instruments also have limitations, governed by the ability of the oligonucleotide on the bead to specifically and sensitively bind to the target molecule. If the target is too short, such techniques are unable to detect the target. Additionally, the number of targets able to be assayed in a single test is limited by the types of beads, microparticles or substrate used.
- microparticles wherein the particle comprises a barcode, detectable by visible light.
- the particle comprises a barcode, detectable by visible light.
- This new microparticle technology allows detection of 100's of targets in a single sample with ease, using the unique barcode contained in each particle, assignable to a specific target.
- Microparticles or nanoparticles are often referred to as structures whose characteristic dimensions are on the order of micrometers or less, such as those with volumes of 1 mm 3 or less. Due to their unique properties arising from their small characteristic dimensions, microparticles have found useful applications in laboratory research and many industrial fields. Encoded microparticles possess spatial codes and therefore a means of identification and are an important subclass of the general field of microparticles. Because encoded particles carry information and can be physically tracked in space and time, they greatly extend the capabilities of non-encoded particles. A particularly important application for encoded microparticles is multiplexed bioassays, including those involving DNA, RNA and proteins.
- encoded microparticles include combinatorial chemistry, tagging, sugar biochemistry, and many other biochemical and non-biochemical applications as will be discussed hereinbelow.
- one more desirable attributes include: a large number of identifiable codes (i.e. a high codespace), accurate and reliable identification of the encoded particles, material compatibility for a particular application, low cost manufacturing of the microparticles (on a per batch, per particle, and per code set basis), and flexibility in the detection systems.
- the QUANTIGENE® technology allows unparalleled signal amplification capabilities that provide an extremely sensitive assay. For instance, it is commonly claimed that the limit of detection in situ for mRNA species is about 20 copies of message per cell. However, in practice the limit of detection, due to the variability in the assay, is generally found to be around 50-60 copies of message per cell. This limit of detection limits the field of research since 80% of mRNAs are present at fewer than 5 copies per cell and 95% of mRNAs are present in cells at fewer than 50 copies per cell. As mentioned above, to arrive at this sensitivity, other approaches are very time consuming and complicated. Other technologies rely on the use of a panel of various enzymes and are affected by the fixation process of FFPE.
- the QUANTIGENE® technology such as QUANTIGENE® 2.0 and ViewRNA, is very simple, efficient and is capable of applying up to 400 labels per 50 base pairs of target.
- This breakthrough technology allows efficient and simple detection on the level of even a single mRNA copy per cell. Coupling this technology to detection of both mRNA and protein species will propel this field of research into heretofor inaccessible areas of study.
- the present invention provides methods that overcome the above noted limitations and permit rapid, simple, and sensitive detection of multiple mRNAs (and/or other nucleic acids) simultaneously. A complete understanding of the invention will be obtained upon review of the following.
- a sample comprising or suspected of comprising a target nucleic acid comprising at least one single nucleotide polymorphism is incubated with at least two label extender probes each comprising a different L-1 sequence, at least two capture extender probes each comprising a different C-1 sequence, and a label probe system with the sample comprising or suspected of comprising the target nucleic acid comprising the at least one single nucleotide polymorphism, wherein at least one L-1 sequence is complementary to the at least one allele of a single nucleotide polymorphism.
- encoded microparticles which comprise at least two capture probes covalently bound to the microparticles, under conditions in which the encoded microparticles bind to the capture extender probes, wherein the capture probes are covalently bound to the microparticles, wherein the encoded microparticles comprise at least one spatial code.
- the assay allows detection of whether the encoded microparticles have bound thereto the label probe system.
- the at least one L-1 sequence may comprise one or more locked nucleic acids which may be constrained ethyl nucleic acid(s) (cEt).
- Targets useful in the present assay systems may be one or more of double-stranded DNA, miRNA, siRNA, mRNA, and single-stranded DNA.
- the disclosed methods may be performed in situ, in cellulo, in vitro, or in any number of different contexts due to the very flexible nature of the components.
- the sample may purified chromosomes, as typically analyzed in traditional karyotyping assays.
- the sample may be cells obtained from a cell culture or tissue culture medium.
- the assays, embodiments and systems disclosed may be easily altered for multiplex reactions, i.e. wherein multiple targets are detected in a single sample.
- the sample may comprise a target nucleic acid comprising at least two single nucleotide polymorphisms, or multiple target nucleic acids. Due to the inherent flexibility of the present assays, methods, embodiments, compositions and systems, it is shown that the label extenders may be designed to operate in any one of a number of different structural orientations, such as the cruciform orientation.
- Method embodiments are disclosed which are capable of detecting one or more single nucleotide polymorphisms with or without the use of substrates such as encoded microparticles.
- a sample comprising or suspected of comprising a target nucleic acid comprising at least one single nucleotide polymorphism may be incubated with at least two label extender probes each comprising a different L-1 sequence, and a label probe system with the sample comprising or suspected of comprising the target nucleic acid comprising the at least one single nucleotide polymorphism, wherein at least one L-1 sequence is complementary to the at least one single nucleotide polymorphism.
- the targets may be detected with the label probe system when the label probe system is associated with the sample.
- L-1 sequences may also be comprised of nucleotide analogs such as LNA or more specifically, cEt molecules and the like. Due to the inherent flexibility of the present assays, methods, embodiments, compositions and systems, it is shown that the label extenders may be designed to operate in any one of a number of different structural orientations, such as the cruciform orientation.
- These general embodiments may also include application to detection of micro-RNA species, such as mature and immature miRNA, siRNA and the like.
- the methods enable the ability to distinguishably detect various forms and species of miRNA on the pathway to maturity within a cell or tissue. Further siRNA may be detected as a control to determine whether siRNA molecules have penetrated desired cell types, tissue types and/or are hybridizing with the appropriate targets. Mutations in miRNA species may also be detected using these methods and various embodiments of the compositions and systems disclosed herein. Further, multiple different miRNA species or siRNA in a single may be detected simultaneously in a single multiplex assay.
- Samples may be obtained from any number of organisms, including bacteria, plants, animals, humans, mice, rats, guinea pigs, monkeys, dogs, cats, fish, anaerobic bacteria, aerobic bacteria, fungi, marine life, and the like. Basically any DNA, RNA or like polymer sequence may be subjected to the present embodiments.
- a sample comprising or suspected of comprising a translocation event or fusion event or deletion event is incubated with at least two label extender probes each comprising a different L-1 sequence, and a label probe system.
- At least one L-1 sequence would be designed to be complementary to at least part of the sequence resulting from the translocation event or fusion event.
- Detection may be based on whether the label probe system is associated with the sample or not.
- the samples may be any number of different types including tissues, cells, chromosomes, etc.
- the genetic material comprising the sample may be obtained from any number of organisms as described above.
- Label extenders may be designed in any number of useful and suitable orientations, as described herein. Further, the L-1 sequences of the label extenders may be designed such that they are complementary to one half of the translocation or fusion sequence and a second L-1 sequence may be designed such that it is complementary to the second half of the translocation or fusion sequence. Thus, association of the label probe system would indicate the possibility and/or presence of a translocation or fusion event in the sample.
- variations of this embodiment include use of multiple distinguishable labels, sets of label extenders designed to hybridize to genes which have fused or are suspected of having taken part in a fusion/translocation/deletion event and a standard microarray designed to bind prepared labeled genetic samples and be scanned by a standard microarray scanner.
- FIG. 1 schematically illustrates a typical standard bDNA assay.
- FIG. 2 Panels A-E schematically depict a multiplex nucleic acid detection assay, in which the nucleic acids of interest are captured on distinguishable subsets of microspheres and then detected.
- FIG. 3 Panels A-D schematically depict an embodiment of a multiplex nucleic acid detection assay, in which the nucleic acids of interest are captured at selected positions on a solid support and then detected.
- Panel A shows a top view of the solid support, while Panels B-D show the support in cross-section.
- FIG. 4 Panel A schematically depicts a double Z label extender configuration.
- Panel B schematically depicts a cruciform label extender configuration.
- FIG. 5A schematically illustrates an encoded microparticle of the invention.
- FIG. 5B is a side view cross-section of the microparticle in FIG. 5A .
- FIG. 6A schematic of amplification multimer complex and labeling system for a cruciform structure label extender design. Note that in this non-limiting depiction, as in others provided herein, only provides a single example of amplifier/pre-amplifier complex. In the assays, more or fewer amplifiers and label probes may be employed as needed.
- FIG. 6B schematic of amplification multimer complex and labeling system for a “double z” or ZZ structure label extender design. Note that in this non-limiting depiction, as in others provided herein, only provides a single example of amplifier/pre-amplifier complex. In the assays, more or fewer amplifiers and label probes may be employed as needed.
- FIG. 7A depiction of a locked nucleic acid analog known as the constrained ethyl (cEt) nucleic acid analog. Note that as depicted various protecting groups known in the art are presented but may be substituted by any number of suitable protecting groups.
- cEt constrained ethyl
- FIG. 7B depiction of a generic locked nucleic acid analog in the ⁇ -D, C3′-endo, conformation.
- the letter “B” stands for “base” which may be any one of A, G, C, mC, T or U.
- the methylene bridge connecting the 2′-0 atom with the 4′-C atom is the chemical structure which “locks” the analog into the energy-favorable ⁇ -D conformation.
- this bridge may be any number of carbon atoms in length and may contain any number of variable groups or substitutions as has been reported in the literature Note that as depicted various protecting groups known in the art are presented but may be substituted by any number of suitable protecting groups.
- FIG. 8A depicts one embodiment of fusion gene or translocation event detection. It is understood that any number of label extender structure variations other than the double Z geometry may be equally suitable and may be utilized for this embodiment.
- FIG. 8B depicts one embodiment of fusion gene or translocation event detection. It is understood that any number of label extender structure variations other than the double Z geometry may be equally suitable and may be utilized for this embodiment.
- FIG. 9A depiction of single-stranded target SNP detection embodiments utilizing the cruciform (left panel) and the double Z (right panel) structures for the label extenders.
- FIG. 9B depiction of double-stranded (dsDNA) target SNP detection embodiments utilizing the cruciform (left panel) and the double Z (right panel) structures for the label extenders.
- FIG. 10A depicts various non-limiting conformations and geometries of label extender (LE) probes for detecting single stranded nucleic acid species. Other stereoisomers, conformers and various conformations are possible which achieve similar results but may not be depicted here. Note that for convenience the amplifiers and pre-amplifiers and label probes are not fully represented for all figures.
- the single line in light shading labeled as “label probe system” is meant to denote all possible configurations of label probe structures as depicted in FIGS. 6A , 6 B, 12 A and 12 B.
- FIG. 10B depicts various non-limiting conformations and geometries of label extender (LE) probes for detecting double-stranded nucleic acid species (ability to distinguish between double-stranded DNA targets and ssDNA or RNA targets). Other stereoisomers, conformers and various conformations are possible which achieve similar results but may not be depicted here. Note that for convenience the amplifiers and pre-amplifiers and label probes are not fully represented for all figures. The single line in light shading labeled as “label probe system” is meant to denote all possible configurations of label probe structures as depicted in FIGS. 6A , 6 B, 12 A and 12 B.
- FIG. 11 depiction of one embodiment of miRNA detection.
- FIG. 12 depicts directionality of various label extenders and the possibility that label extenders may be designed in either direction as indicated.
- FIG. 13 provides S/N ratio results for SNP detection of various single point mutations in miR-107 transfected into HeLa cells using cEt-doped L-1 sequences in a double-z label extender design.
- FIG. 14 provides S/N ratio results for SNP detection of various double point mutations in miR-107 transfected into HeLa cells using cEt-doped L-1 sequences in a double-z label extender design.
- FIG. 15A provides data from detection of miR-671 using the QUANTIGENE® 2.0 general protocols and the design scheme provided in FIG. 11 , showing samples of pure miR-671 and samples with added corn leaf tissue homogenate, with y-axis data being signal-background.
- FIG. 15B shows control experiments of pure miR-93 miRNA added to corn leaf tissue homogenate and quantitative detection of the miRNA using QUANTIGENE® 2.0 protocols.
- FIG. 15C shows control experiments of pure miR-107 miRNA added to corn leaf tissue homogenate and quantitative detection of the miRNA using QUANTIGENE® ViewRNA protocols.
- FIG. 15D provides data from detection of miR-107 using the QUANTIGENE® 2.0 general protocols and the design scheme provided in FIG. 11 , showing samples of pure miR-107 and samples with added corn leaf tissue homogenate, with y-axis data being signal-background.
- FIG. 16 depicts the ability of the assay to discriminate between Let-7a, Let-7b and Let-7c miRNA homologs.
- FIG. 17 depicts the stem-loop sequences for human miR-93 and miR-107. Pre-miRNA sequences are the immature stem-loop sequences. Mature miRNA sequences for each are highlighted in bold.
- FIG. 18 depicts the ability of the assay to discriminate between Pre-miRNA and Mature miRNA for miR-93, miR-107, and miR-155 using the QUANTIGENE® 2.0 general protocols.
- FIG. 19 provides S/B (signal/base line (negative control)) bar graphs depicting the activity and specificity of two LE configurations.
- Left panel shows data related to the performance of the Double Z (ZZ) LE configuration and the cruciform LE configuration in a single-plex assay.
- Right panel provides data related to the performance of the same LE's now in multiplex format with four targets each.
- FIG. 20 provides signal-base line (negative control) bar graphs depicting the activity and specificity of two LE configurations.
- Left panel shows data related to the performance of the Double Z (ZZ) LE configuration and the cruciform LE configuration in a single-plex assay.
- Right panel provides data related to the performance of the same LE's now in multiplex format with four targets each.
- Y-axis units are RLU (relative light units).
- polynucleotide encompasses any physical string of monomer units that can be corresponded to a string of nucleotides, including a polymer of nucleotides (e.g., a typical DNA or RNA polymer), peptide nucleic acids (PNAs), modified oligonucleotides (e.g., oligonucleotides comprising nucleotides that are not typical to biological RNA or DNA, such as 2′-O-methylated oligonucleotides), and the like.
- PNAs peptide nucleic acids
- modified oligonucleotides e.g., oligonucleotides comprising nucleotides that are not typical to biological RNA or DNA, such as 2′-O-methylated oligonucleotides
- the nucleotides of the polynucleotide can be deoxyribonucleotides, ribonucleotides or nucleotide analogs, can be natural or non-natural, and can be unsubstituted, unmodified, substituted or modified.
- the nucleotides can be linked by phosphodiester bonds, or by phosphorothioate linkages, methylphosphonate linkages, boranophosphate linkages, or the like.
- the polynucleotide can additionally comprise non-nucleotide elements such as labels, quenchers, blocking groups, or the like.
- the polynucleotide can be, e.g., single-stranded or double-stranded.
- nucleic acid analog in the context of nucleic acid analog is meant to denote any of a number of known nucleic acid analogs such as, but not limited to, LNA, PNA, etc.
- LNA when incorporated into oligonucleotides, exhibit an increase in the duplex melting temperature of 2° C. to 8° C. per analog incorporated into a single strand of the duplex.
- the melting temperature effect of incorporated analogs may vary depending on the chemical structure of the analog, e.g. the structure of the atoms present in the bridge between the 2′-O atom and the 4′-C atom of the ribose ring of a nucleic acid.
- nucleosides have also been reported.
- Oligonucleotides in solution as single stranded species rotate and move in space in various energy-minimized conformations.
- an oligonucleotide Upon binding and ultimately hybridizing to a complementary sequence, an oligonucleotide is known to undergo a conformational transition from the relatively random coil structure of the single stranded state to the ordered structure of the duplex state.
- conformationally-restricted oligonucleotides analogs including bicyclic and tricyclic nucleoside analogues, have been synthesized, incorporated into oligonucleotides and tested for their ability to hybridize.
- nucleic acid analogs such as the common “Locked Nucleic Acid” or LNA, exhibit a very low energy-minimized state upon hybridizing to the complementary oligonucleotide, even when the complementary oligonucleotide is wholly comprised of the native or natural nucleic acids A, T, C, U and G.
- bicyclo[3.3.0] nucleosides with an additional C-3′,C-5′-ethano-bridge have been reported for all five of the native or natural nucleobases (G, A, T, C and U) whereas (C) has been synthesised only with T and A nucleobases.
- C has been synthesised only with T and A nucleobases.
- Oligonucleotides containing these analogues have been found to form Watson-Crick bonded duplexes with complementary DNA and RNA oligonucleotides.
- the thermostability of the resulting duplexes is varied and not always improved over comparable native hybridized oligonucleotide sequences.
- All bcDNA oligomers exhibited an increase in sensitivity to the ionic strength of the hybridization media compared to natural counterparts.
- a bicyclo[3.3.0] nucleoside dimer containing an additional C-2′,C-3′-dioxalane ring has been reported in the literature having an unmodified nucleoside where the additional ring is part of the internucleoside linkage replacing a natural phosphodiester linkage.
- thymine-thymine or thymine-5-methylcytosine blocks a 15-mer polypyrimidine sequence containing seven dimeric blocks and having alternating phosphodiester- and riboacetal-linkages exhibited a substantially decreased T m in hybridization with complementary ssRNA as compared to a control sequence with exclusively natural phosphordiester internucleoside linkages.
- U.S. Pat. No. 7,399,845 provides 6-modified bicyclic nucleosides, oligomeric compounds and compositions prepared therefrom, including novel synthetic intermediates, and methods of preparing the nucleosides, oligomeric compounds, compositions, and novel synthetic intermediates.
- the '845 patent discloses nucleosides having a bridge between the 4′ and 2′-positions of the ribose portion having the formula: 2′-O—C(H)(Z)-4′ and oligomers and compositions prepared therefrom.
- Z is in a particular configuration providing either the (R) or (S) isomer, e.g. 2′-O,4′-methanoribonucleoside.
- nucleic acid analog exists as the strictly constrained N-conformer 2′-exo-3′-endo conformation.
- Oligonucleotides of 12 nucleic acids in length have been shown, when comprised completely or partially of the Imanishi et al. analogs, to have substantially increased melting temperatures, showing that the corresponding duplexes with complementary native oligonucleotides are very stable.
- a “polynucleotide sequence” or “nucleotide sequence” is a polymer of nucleotides (an oligonucleotide, a DNA, a nucleic acid, etc.) or a character string representing a nucleotide polymer, depending on context. From any specified polynucleotide sequence, either the given nucleic acid or the complementary polynucleotide sequence (e.g., the complementary nucleic acid) can be determined.
- Two polynucleotides “hybridize” when they associate to form a stable duplex, e.g., under relevant assay conditions.
- Nucleic acids hybridize due to a variety of well characterized physico-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like.
- An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, part I chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assays” (Elsevier, New York), as well as in Ausubel, infra.
- the “T m ” (melting temperature) of a nucleic acid duplex under specified conditions is the temperature at which half of the base pairs in a population of the duplex are disassociated and half are associated.
- the T m for a particular duplex can be calculated and/or measured, e.g., by obtaining a thermal denaturation curve for the duplex (where the T m is the temperature corresponding to the midpoint in the observed transition from double-stranded to single-stranded form).
- complementary refers to a polynucleotide that forms a stable duplex with its “complement,” e.g., under relevant assay conditions.
- two polynucleotide sequences that are complementary to each other have mismatches at less than about 20% of the bases, at less than about 10% of the bases, preferably at less than about 5% of the bases, and more preferably have no mismatches.
- a “capture extender” or “CE” is a polynucleotide that is capable of hybridizing to a nucleic acid of interest and to a capture probe.
- the capture extender typically has a first polynucleotide sequence C-1, which is complementary to the capture probe, and a second polynucleotide sequence C-3, which is complementary to a polynucleotide sequence of the nucleic acid of interest. Sequences C-1 and C-3 are typically not complementary to each other.
- the capture extender is preferably single-stranded.
- a “capture probe” or “CP” is a polynucleotide that is capable of hybridizing to at least one capture extender and that is tightly bound (e.g., covalently or noncovalently, directly or through a linker, e.g., streptavidin-biotin or the like) to a solid support, a spatially addressable solid support, a slide, a particle, a microsphere, or the like.
- the capture probe typically comprises at least one polynucleotide sequence C-2 that is complementary to polynucleotide sequence C-1 of at least one capture extender.
- the capture probe is preferably single-stranded.
- a “label extender” or “LE” is a polynucleotide that is capable of hybridizing to a nucleic acid of interest and to a label probe system.
- the label extender typically has a first polynucleotide sequence L-1, which is complementary to a polynucleotide sequence of the nucleic acid of interest, and a second polynucleotide sequence L-2, which is complementary to a polynucleotide sequence of the label probe system (e.g., L-2 can be complementary to a polynucleotide sequence of an amplification multimer, a preamplifier, a label probe, or the like).
- the label extender is preferably single-stranded.
- Label extenders designed in both directions are contemplated, i.e. a label extender in the 3′ to 5′ direction could just as easily be designed to bind in the reverse direction as depicted in the Figures.
- FIGS. 12A and 12B for exemplary depictions of the various configurations which may be designed to be suitable for use in the presently disclosed invention.
- label is a moiety that facilitates detection of a molecule.
- Common labels in the context of the present invention include fluorescent, luminescent, light-scattering, and/or colorimetric labels.
- Suitable labels include enzymes and fluorescent moieties, as well as radionuclides, substrates, cofactors, inhibitors, chemiluminescent moieties, magnetic particles, and the like.
- Patents teaching the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241. Many labels are commercially available and can be used in the context of the invention.
- a “label probe system” comprises one or more polynucleotides that collectively comprise a label and at least two polynucleotide sequences M-1, each of which is capable of hybridizing to a label extender.
- the label provides a signal, directly or indirectly.
- Polynucleotide sequence M-1 is typically complementary to sequence L-2 in the label extenders.
- the at least two polynucleotide sequences M-1 are optionally identical sequences or different sequences.
- the label probe system can include a plurality of label probes (e.g., a plurality of identical label probes) and an amplification multimer; it optionally also includes a preamplifier or the like, or optionally includes only label probes, for example.
- An “amplification multimer” is a polynucleotide comprising a plurality of polynucleotide sequences M-2, typically (but not necessarily) identical polynucleotide sequences M-2. Polynucleotide sequence M-2 is complementary to a polynucleotide sequence in the label probe.
- the amplification multimer also includes at least one polynucleotide sequence that is capable of hybridizing to a label extender or to a nucleic acid that hybridizes to the label extender, e.g., a preamplifier.
- the amplification multimer optionally includes at least one (and preferably at least two) polynucleotide sequence(s) M-1, optionally identical sequences M-1; polynucleotide sequence M-1 is typically complementary to polynucleotide sequence L-2 of the label extenders.
- the amplification multimer optionally includes at least one polynucleotide sequence that is complementary to a polynucleotide sequence in a preamplifier.
- the amplification multimer can be, e.g., a linear or a branched nucleic acid.
- the amplification multimer may be entirely comprised of a single contiguous chain of nucleic acids, or alternative a first chain possessing the sequence M-1 and additionally possessing one more sequences A-1 that are complementary to sequences A-2 on separate oligonucleotides which comprise one or more repeats of the sequence M-2.
- the amplification multimer may in fact be an assembly of multiple oligonucleotides comprising or consisting of a pre-amplifier possessing the M-2 sequence and one or more A-1 sequences; and one or more amplifier oligonucleotides possessing the sequence A-2 and one or more sequences M-2.
- the structure may yield a tree-like geometrical shape comprising a single pre-amplifier, multiple amplifiers and attached to the amplifiers, multiple label probes which hybridize to site(s) M-2.
- the amplification multimer can include modified nucleotides and/or nonstandard internucleotide linkages as well as standard deoxyribonucleotides, ribonucleotides, and/or phosphodiester bonds. Suitable amplification multimers are described, for example, in U.S. Pat. No. 5,635,352, U.S. Pat. No. 5,124,246, U.S. Pat. No. 5,710,264, and U.S. Pat. No. 5,849,481.
- a “label probe” or “LP” is a single-stranded polynucleotide that comprises a label (or optionally that is configured to bind to a label) that directly or indirectly provides a detectable signal.
- the label probe typically comprises a polynucleotide sequence that is complementary to the repeating polynucleotide sequence M-2 of the amplification multimer; however, if no amplification multimer is used in the bDNA assay, the label probe can, e.g., hybridize directly to a label extender.
- a “preamplifier” is a nucleic acid that serves as an intermediate between one or more label extenders and amplifiers. Typically, the preamplifier is capable of hybridizing simultaneously to at least two label extenders and to a plurality of amplifiers.
- a “microsphere” is a small spherical, or roughly spherical, particle.
- a microsphere typically has a diameter less than about 1000 micrometers (e.g., less than about 100 micrometers, optionally less than about 10 micrometers).
- Microparticles include particles having a code, including sets of encoded microparticles. (See, for instance, U.S. patent application Ser. No. 11/521,057, allowed, which is incorporated herein by reference in its entirety for all purposes). Such encoded microparticles may have a longest dimension of 50 microns, an outer surface substantially of glass and a spatial code that can be read with optical magnification. A microparticle may be cuboid in shape and elongated along the Y direction in the Cartesian coordinate. The cross-sections perpendicular to the length of the microparticle may have substantially the same topological shape—such as square shape.
- Microparticles may have a set of segments and gaps intervening the segments in parallel along the axis of the longest dimension if the microparticle is rectangular.
- segments with different lengths may represent different coding elements; whereas gaps preferably have the same length for differentiating the segments during detection of the microparticles.
- the segments of the microparticle may be fully enclosed within the microparticle, i.e. completely encapsulated by a surrounding outer layer which may be silicon/glass.
- the segments can be arranged such that the geometric centers of the segments are aligned to the geometric central axis of the elongated microparticle.
- a particular sequence of segments and gaps thereby represent a code within each micoparticle.
- the codes may be derived from a pre-determined coding scheme thereby allowing identification of the microparticle.
- the microparticles may additionally have various structural aberrations, such as tags or tabs, on one or more ends, thus allowing for a two-fold or more increase in code space.
- the microparticles may also be present as a “bi-particle” wherein the microparticle actually comprises two or more particles stuck together, i.e. missing the last etching step so as to allow two particles to remain attached together with an intervening material between them comprised of material consistent with the coating present on the rest of the microparticle. (See, for instance, U.S. patent application Ser. No. 12/779,413, filed May 13, 2010, incorporated herein by reference in its entirety for all purposes).
- a “microorganism” is an organism of microscopic or submicroscopic size. Examples include, but are not limited to, bacteria, fungi, yeast, protozoans, microscopic algae (e.g., unicellular algae), viruses (which are typically included in this category although they are incapable of growth and reproduction outside of host cells), subviral agents, viroids, and mycoplasma.
- a first polynucleotide sequence that is located “5′ of” a second polynucleotide sequence on a nucleic acid strand is positioned closer to the 5′ terminus of the strand than is the second polynucleotide sequence.
- a first polynucleotide sequence that is located “3′ of” a second polynucleotide sequence on a nucleic acid strand is positioned closer to the 3′ terminus of the strand than is the second polynucleotide sequence.
- the present invention provides methods, compositions, and kits for capture and detection of various types of nucleic acids, particularly multiplex capture and detection. As will be shown in more detail below, the disclosed methodologies and compositions are highly adaptable to many applications. A non-limiting list of various embodiments is as follows:
- a general class of embodiments includes methods of capturing two or more nucleic acids of interest and identification thereof.
- a sample a pooled population of particles (or microparticles, or encoded microparticles), and two or more subsets of n target capture probes, wherein n is at least two, are provided.
- the sample comprises or is suspected of comprising the nucleic acids of interest.
- the pooled population of particles includes two or more subsets of particles. The particles in each subset have associated therewith a different capture probes.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n target capture probes with a selected subset of the particles.
- a plurality of the particles in each subset is distinguishable from a plurality of the particles in every other subset. (Typically, substantially all of the particles in each subset are distinguishable from substantially all of the particles in every other subset.)
- Each nucleic acid of interest can thus, by hybridizing to its corresponding subset of n capture extenders which are in turn hybridized to a corresponding capture probes, be associated with an identifiable subset of the particles.
- the particles in the various subsets need not be distinguishable from each other (for example, in embodiments in which any nucleic acid of interest present is to be isolated, amplified, and/or detected, without regard to its identity, following its capture on the particles.)
- a particular nucleic acid of interest, or target oligonucleotide may be captured to a surface through cooperative hybridization of multiple target capture probes to the nucleic acid.
- Each of the capture extenders (CE) has a first polynucleotide sequence that can hybridize to the target nucleic acid and a second polynucleotide sequence that can hybridize to a complementary sequence on a capture probe that is bound to a surface.
- the temperature and the stability of the complex between a single CE and its CP can be controlled such that binding of a single CE to a target nucleic acid and to the CP is not sufficient to stably capture the nucleic acid on the surface to which the CP is bound, whereas simultaneous binding of two or more CEs to a target nucleic acid can capture it on the surface vie the two or more CPs.
- Assays requiring such cooperative hybridization of multiple target capture probes for capture of each nucleic acid of interest results in high specificity and low background from cross-hybridization of the target capture probes with other, non-target nucleic acids.
- Such low background and minimal cross-hybridization are typically substantially more difficult to achieve in multiplex than a single-plex capture of nucleic acids, because the number of potential nonspecific interactions are greatly increased in a multiplex experiment due to the increased number of probes used (e.g., the greater number of target capture probes). Requiring multiple simultaneous CE-CP interactions for the capture of a target nucleic acid minimizes the chance that nonspecific capture will occur, even when some nonspecific target-CE and/or CE-CP interactions occur.
- Branched-chain DNA (bDNA) signal amplification technology has been used, e.g., to detect and quantify mRNA transcripts in cell lines and to determine viral loads in blood.
- bDNA Branched-chain DNA
- the bDNA assay is a sandwich nucleic acid hybridization procedure that enables direct measurement of mRNA expression, e.g., from crude cell lysate. It provides direct quantification of nucleic acid molecules at physiological levels.
- mRNA expression e.g., from crude cell lysate.
- Several advantages of the technology distinguish it from other DNA/RNA amplification technologies, including linear amplification, good sensitivity and dynamic range, great precision/specificity and accuracy, simple sample preparation procedure, and reduced sample-to-sample variation.
- a target mRNA whose expression is to be detected is released from cells and captured by a Capture Probe (CP) on a solid surface (e.g., a well of a microtiter plate) through synthetic oligonucleotide probes called Capture Extenders (CEs).
- CP Capture Probe
- CEs Capture Extenders
- Each capture extender has a first polynucleotide sequence that can hybridize to the target mRNA and a second polynucleotide sequence that can hybridize to the capture probe.
- two or more capture extenders are used.
- Probes of another type hybridize to different sequences on the target mRNA and to sequences on an amplification multimer.
- Blocking Probes which hybridize to regions of the target mRNA not occupied by CEs or LEs, are often used to reduce non-specific target probe binding.
- a probe set for a given mRNA thus consists of CEs, LEs, and optionally BPs for the target mRNA.
- the CEs, LEs, and BPs are complementary to nonoverlapping sequences in the target mRNA, and are typically, but not necessarily, contiguous.
- Signal amplification begins with the binding of the LEs to the target mRNA.
- An amplification multimer is then typically hybridized to the LEs.
- the amplification multimer has multiple copies of a sequence that is complementary to a label probe (it is worth noting that the amplification multimer is typically, but not necessarily, a branched-chain nucleic acid; for example, the amplification multimer can be a branched, forked, or comb-like nucleic acid or a linear nucleic acid).
- a label for example, alkaline phosphatase, is covalently attached to each label probe.
- labeled complexes are detected, e.g., by the alkaline phosphatase-mediated degradation of a chemilumigenic substrate, e.g., dioxetane.
- Luminescence is reported as relative light unit (RLUs) on a microplate reader. The amount of chemiluminescence is proportional to the level of mRNA expressed from the target gene.
- the amplification multimer and the label probes comprise a label probe system.
- the label probe system also comprises a preamplifier, e.g., as described in U.S. Pat. No. 5,635,352 and U.S. Pat. No. 5,681,697, which further amplifies the signal from a single target mRNA.
- the label extenders hybridize directly to the label probes and no amplification multimer or preamplifier is used, so the signal from a single target mRNA molecule is only amplified by the number of distinct label extenders that hybridize to that mRNA.
- kits for performing basic bDNA assays comprising instructions and reagents such as amplification multimers, alkaline phosphatase labeled label probes, chemilumigenic substrate, capture probes immobilized on a solid support, and the like are commercially available, e.g., from Panomics, Inc.
- ProbeDesignerTM from Panomics, Inc.; see also Bushnell et al. (1999) “ProbeDesigner: for the design of probe sets for branched DNA (bDNA) signal amplification assays Bioinformatics 15:348-55).
- the basic bDNA assay permits detection of only a single target nucleic acid per assay, while, as described above, detection of multiple nucleic acids is frequently desirable.
- the present invention provides multiplex bDNA assays that can be used for simultaneous detection of two or more target nucleic acids.
- one aspect of the present invention provides bDNA assays, singleplex or multiplex, that have reduced background from nonspecific hybridization events.
- the present invention provides a multiplex bDNA assay that can be used for simultaneous detection of two or more target nucleic acids.
- the assay temperature and the stability of the complex between a single CE and its corresponding CP can be controlled such that binding of a single CE to a nucleic acid and to the CP is not sufficient to stably capture the nucleic acid on the surface to which the CP is bound, whereas simultaneous binding of two or more CEs to a nucleic acid can capture it on the surface. Requiring such cooperative hybridization of multiple CEs for capture of each nucleic acid of interest results in high specificity and low background from cross-hybridization of the CEs with other, non-target nucleic acids.
- an assay For an assay to achieve high specificity and sensitivity, it preferably has a low background, resulting, e.g., from minimal cross-hybridization.
- Such low background and minimal cross-hybridization are typically substantially more difficult to achieve in a multiplex assay than a single-plex assay, because the number of potential nonspecific interactions are greatly increased in a multiplex assay due to the increased number of probes used in the assay (e.g., the greater number of CEs and LEs). Requiring multiple simultaneous CE-CP interactions for the capture of a target nucleic acid minimizes the chance that nonspecific capture will occur, even when some nonspecific CE-CP interactions do occur.
- two or more label extenders are used to capture a single component of the label probe system (e.g., a preamplifier or amplification multimer).
- the assay temperature and the stability of the complex between a single LE and the component of the label probe system can be controlled such that binding of a single LE to the component is not sufficient to stably associate the component with a nucleic acid to which the LE is bound, whereas simultaneous binding of two or more LEs to the component can capture it to the nucleic acid. Requiring such cooperative hybridization of multiple LEs for association of the label probe system with the nucleic acid(s) of interest results in high specificity and low background from cross-hybridization of the LEs with other, non-target nucleic acids.
- an assay For an assay to achieve high specificity and sensitivity, it preferably has a low background, resulting, e.g., from minimal cross-hybridization.
- Such low background and minimal cross-hybridization are typically substantially more difficult to achieve in a multiplex assay than a single-plex assay, because the number of potential nonspecific interactions are greatly increased in a multiplex assay due to the increased number of probes used in the assay (e.g., the greater number of CEs and LEs).
- Requiring multiple simultaneous LE-label probe system component interactions for the capture of the label probe system to a target nucleic acid minimizes the chance that nonspecific capture will occur, even when some nonspecific CE-LE or LE-CP interactions, for example, do occur. This reduction in background through minimization of undesirable cross-hybridization events thus facilitates multiplex detection of the nucleic acids of interest.
- the methods of the invention can be used, for example, for multiplex detection of two or more nucleic acids simultaneously, from even complex samples, without requiring prior purification of the nucleic acids, when the nucleic acids are present at low concentration, and/or in the presence of other, highly similar nucleic acids.
- the methods involve capture of the nucleic acids to particles (e.g., distinguishable subsets of microspheres), while in another aspect, the nucleic acids are captured to a spatially addressable solid support.
- Compositions, kits, and systems related to the methods are also provided.
- one aspect of the invention provides multiplex nucleic acid assays.
- one general class of embodiments includes methods of detecting two or more nucleic acids of interest.
- a sample comprising or suspected of comprising the nucleic acids of interest, two or more subsets of m label extenders, wherein m is at least two, and a label probe system are provided.
- Each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest.
- the label probe system comprises a label, and a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in a subset.
- nucleic acids of interest present in the sample are captured on a solid support.
- Each nucleic acid of interest captured on the solid support is hybridized to its corresponding subset of m label extenders, and the label probe system is hybridized to the m label extenders.
- the presence or absence of the label on the solid support is then detected. Since the label is associated with the nucleic acid(s) of interest via hybridization of the label extenders and label probe system, the presence or absence of the label on the solid support is correlated with the presence or absence of the nucleic acid(s) of interest on the solid support and thus in the original sample.
- a sample, a pooled population of particles, and two or more subsets of n capture extenders, wherein n is at least two are provided.
- the sample comprises or is suspected of comprising the nucleic acids of interest.
- the pooled population of particles includes two or more subsets of particles, and a plurality of the particles in each subset are distinguishable from a plurality of the particles in every other subset. (Typically, substantially all of the particles in each subset are distinguishable from substantially all of the particles in every other subset.)
- the particles in each subset have associated therewith a different capture probe.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles.
- Each nucleic acid of interest can thus, by hybridizing to its corresponding subset of n capture extenders which are in turn hybridized to a corresponding capture probe, be associated with an identifiable subset of the particles.
- the solid support can comprise particles such as microspheres or microparticles, or it can comprise a substantially planar and/or spatially addressable support.
- Different nucleic acids are optionally captured on different distinguishable subsets of particles or at different positions on a spatially addressable solid support.
- the nucleic acids of interest can be captured to the solid support by any of a variety of techniques, for example, by binding directly to the solid support or by binding to a moiety bound to the support, or through hybridization to another nucleic acid bound to the solid support.
- the nucleic acids are captured to the solid support through hybridization with capture extenders and capture probes.
- a pooled population of particles which constitute the solid support comprises two or more subsets of particles, and a plurality of the particles in each subset is distinguishable from a plurality of the particles in every other subset. (Typically, substantially all of the particles in each subset are distinguishable from substantially all of the particles in every other subset.)
- the particles in each subset have associated therewith a different capture probe.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes, thereby associating each subset of n capture extenders with a selected subset of the particles.
- Each of the nucleic acids of interest present in the sample is hybridized to its corresponding subset of n capture extenders and the subset of n capture extenders is hybridized to its corresponding capture probe, thereby capturing the nucleic acid on the subset of particles with which the capture extenders are associated.
- At least a portion of the particles from each subset are identified and the presence or absence of the label on those particles is detected. Since a correlation exists between a particular subset of particles and a particular nucleic acid of interest, which subsets of particles have the label present indicates which of the nucleic acids of interest were present in the sample.
- any suitable particles e.g., particles having distinguishable characteristics and to which capture probes can be attached, can be used.
- the particles are microspheres.
- the microspheres of each subset can be distinguishable from those of the other subsets, e.g., on the basis of their fluorescent emission spectrum, their diameter, or a combination thereof.
- the microspheres of each subset can be labeled with a unique fluorescent dye or mixture of such dyes, quantum dots with distinguishable emission spectra, and/or the like.
- the particles of each subset can be identified by an optical barcode, unique to that subset, present on the particles.
- the particles optionally have additional desirable characteristics.
- the particles can be magnetic or paramagnetic, which provides a convenient means for separating the particles from solution, e.g., to simplify separation of the particles from any materials not bound to the particles.
- the nucleic acids are captured at different positions on a non-particulate, spatially addressable solid support.
- the solid support comprises two or more capture probes, wherein each capture probe is provided at a selected position on the solid support.
- Two or more subsets of n capture extenders, wherein n is at least two, are provided.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes, thereby associating each subset of n capture extenders with a selected position on the solid support.
- Each of the nucleic acids of interest present in the sample is hybridized to its corresponding subset of n capture extenders and the subset of n capture extenders is hybridized to its corresponding capture probe, thereby capturing the nucleic acid on the solid support at the selected position with which the capture extenders are associated.
- the presence or absence of the label at the selected positions on the solid support is detected. Since a correlation exists between a particular position on the support and a particular nucleic acid of interest, which positions have a label present indicates which of the nucleic acids of interest were present in the sample.
- the solid support typically has a planar surface and is typically rigid, but essentially any spatially addressable solid support can be adapted to the practice of the present invention.
- Exemplary materials for the solid support include, but are not limited to, glass, silicon, silica, quartz, plastic, polystyrene, nylon, and nitrocellulose.
- an array of capture probes can be formed at selected positions on a glass slide as the solid support.
- n the number of capture extenders in a subset, is at least one, preferably at least two, and more preferably at least three. n can be at least four or at least five or more. Typically, but not necessarily, n is at most ten. For example, n can be between three and ten, e.g., between five and ten or between five and seven, inclusive. Use of fewer capture extenders can be advantageous, for example, in embodiments in which nucleic acids of interest are to be specifically detected from samples including other nucleic acids with sequences very similar to that of the nucleic acids of interest.
- n can be more than 10, e.g., between 20 and 50. n can be the same for all of the subsets of capture extenders, but it need not be; for example, one subset can include three capture extenders while another subset includes five capture extenders.
- the n capture extenders in a subset preferably hybridize to nonoverlapping polynucleotide sequences in the corresponding nucleic acid of interest. The nonoverlapping polynucleotide sequences can, but need not be, consecutive within the nucleic acid of interest.
- Each capture extender is capable of hybridizing to its corresponding capture probe.
- the capture extender typically includes a polynucleotide sequence C-1 that is complementary to a polynucleotide sequence C-2 in its corresponding capture probe. Capture of the nucleic acids of interest via hybridization to the capture extenders and capture probes optionally involves cooperative hybridization.
- the capture extenders and capture probes are configured as described in U.S. patent application 60/680,976 filed May 12, 2005 by Luo et al., entitled “Multiplex branched-chain DNA assays.”
- C-1 and C-2 are 20 nucleotides or less in length.
- C-1 and C-2 are between 9 and 17 nucleotides in length (inclusive), preferably between 12 and 15 nucleotides (inclusive).
- C-1 and C-2 can be 14, 15, 16, or 17 nucleotides in length, or they can be between 9 and 13 nucleotides in length (e.g., for lower hybridization temperatures, e.g., hybridization at room temperature).
- the capture probe can include polynucleotide sequence in addition to C-2, or C-2 can comprise the entire polynucleotide sequence of the capture probe.
- each capture probe optionally includes a linker sequence between the site of attachment of the capture probe to the particles and sequence C-2 (e.g., a linker sequence containing 8 Ts, as just one possible example).
- each individual capture extender and its corresponding capture probe affects the T m of the complex between that capture extender and capture probe, as does, e.g., the GC base content of sequences C-1 and C-2.
- all the capture probes are the same length (as are sequences C-1 and C-2) from subset of particles to subset, but not necessarily so.
- different support capture probes optionally have different lengths and/or different length sequences C-2, to achieve the desired T m .
- Different support capture probe-target capture probe complexes optionally have the same or different T m s.
- the number of capture extenders required for stable capture of a nucleic acid depends, in part, on the amount of overlap between the capture extenders and the capture probe (i.e., the length of C-1 and C-2). For example, if n is 5-7 for a 14 nucleotide overlap, n could be 3-5 for a 15 nucleotide overlap or 2-3 for a 16 nucleotide overlap.
- the hybridizing the subset of n capture extenders to the corresponding support capture probe is performed at a hybridization temperature which is greater than a melting temperature T m of a complex between each individual capture extender and its corresponding capture probe.
- the hybridization temperature is typically about 5° C. or more greater than the T m , e.g., about 7° C. or more, about 10° C. or more, about 12° C. or more, about 15° C. or more, about 17° C. or more, or even about 20° C. or more greater than the T m .
- Stable capture of nucleic acids of interest can be achieved, for example, by balancing n (the number of target capture probes), the amount of overlap between the capture extenders and the capture probes (the length of C-1 and C-2), and/or the stringency of the conditions under which the target capture probes, the nucleic acids, and the support capture probes are hybridized.
- n, amount of complementarity between the capture extenders and the capture probes, and stringency of hybridization can, for example, be determined experimentally by one of skill in the art. For example, a particular value of n and a particular set of hybridization conditions can be selected, while the number of nucleotides of complementarity between the capture extenders and the capture probes is varied until hybridization of the n capture extenders to a nucleic acid captures the nucleic acid while hybridization of a single capture extender does not efficiently capture the nucleic acid. Similarly, n, amount of complementarity, and stringency of hybridization can be selected such that the desired nucleic acid of interest is captured while other nucleic acids present in the sample are not efficiently captured. Stringency can be controlled, for example, by controlling the formamide concentration, chaotropic salt concentration, salt concentration, pH, organic solvent content, and/or hybridization temperature.
- the corresponding target capture probes are preferably complementary to physically distinct, nonoverlapping sequences in the nucleic acid of interest, which are preferably, but not necessarily, contiguous.
- the T m s of the individual capture extender-nucleic acid complexes are preferably greater than the hybridization temperature, e.g., by 5° C. or 10° C. or preferably by 15° C. or more, such that these complexes are stable at the hybridization temperature.
- Sequence C-3 which is the sequence of the CE which is complementary to the target nucleic acid, for each capture extender is typically (but not necessarily) about 17-35 nucleotides in length, with about 30-70% GC content.
- Potential capture extender sequences are optionally examined for possible interactions with non-corresponding nucleic acids of interest, repetitive sequences (such as polyC or polyT, for example), any detection probes used to detect the nucleic acids of interest, and/or any relevant genomic sequences, for example; sequences expected to cross-hybridize with undesired nucleic acids are typically not selected for use in the target support capture probes.
- Examination can be, e.g., visual (e.g., visual examination for complementarity), computational (e.g., computation and comparison of percent sequence identity and/or binding free energies; for example, sequence comparisons can be performed using BLAST software publicly available through the National Center for Biotechnology Information on the world wide web at ncbi.nlm.nih.gov), and/or experimental (e.g., cross-hybridization experiments).
- Capture probe sequences are preferably similarly examined, to ensure that the polynucleotide sequence C-1 complementary to a particular capture probe's sequence C-2 is not expected to cross-hybridize with any of the other capture probes that are to be associated with other subsets of particles.
- the methods are useful for multiplex detection of nucleic acids, optionally highly multiplex detection.
- the two or more nucleic acids of interest i.e., the nucleic acids to be detected
- the two or more subsets of m label extenders comprise five or more, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, or even 100 or more subsets of m label extenders.
- capture extenders, particulate solid supports, and/or spatially addressable solid support are used, a like number of subsets of capture extenders, subsets of particles, and/or selected positions on the solid support are provided.
- the label probe system optionally includes an amplification multimer and a plurality of label probes, wherein the amplification multimer is capable of hybridizing to the label extenders and to a plurality of label probes.
- the label probe system includes a preamplifier, a plurality of amplification multimers, and a plurality of label probes, wherein the preamplifier hybridizes to the label extenders, and the amplification multimers hybridize to the preamplifier and to the plurality of label probes.
- the label probe system can include only label probes, which hybridize directly to the label extenders.
- the label probe comprises the label, e.g., a covalently attached label.
- the label probe is configured to bind a label; for example, a biotinylated label probe can bind to a streptavidin-associated label.
- the label can be essentially any convenient label that directly or indirectly provides a detectable signal.
- the label is a fluorescent label (e.g., a fluorophore or quantum dot). Detecting the presence of the label on the particles thus comprises detecting a fluorescent signal from the label.
- fluorescent emission by the label is typically distinguishable from any fluorescent emission by the particles, e.g., microspheres, and many suitable fluorescent label-fluorescent microsphere combinations are possible.
- the label can be a luminescent label, a light-scattering label (e.g., colloidal gold particles), or an enzyme (e.g., HRP).
- Alexa Fluor Dyes Life Technologies, Inc., California, USA, available in a wide variety of wavelengths, see for instance, Panchuk, et al., J. Hist. Cyto., 47:1179-1188, 1999
- biotin-based dyes digoxigenin, AttoPhos (JBL Scientific, Inc., California, USA, available in a variety of wavelengths, see for instance, Cano et al., Biotechniques, 12(2):264-269, 1992
- ATTO dyes Sigma-Aldrich, St. Louis, Mo.
- a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in a subset.
- the component of the label probe system that hybridizes to the two or more label extenders is an amplification multimer or preamplifier.
- binding of a single label extender to the component of the label probe system e.g., the amplification multimer or preamplifier
- the amplification multimer or preamplifier is insufficient to capture the label probe system to the nucleic acid of interest to which the label extender binds.
- the label probe system comprises an amplification multimer or preamplifier, which amplification multimer or preamplifier is capable of hybridizing to the at least two label extenders, and the label probe system (or the component thereof) is hybridized to the m label extenders at a hybridization temperature, which hybridization temperature is greater than a melting temperature T m of a complex between each individual label extender and the amplification multimer or preamplifier.
- the hybridization temperature is typically about 5° C. or more greater than the T m , e.g., about 7° C. or more, about 10° C. or more, about 12° C. or more, about 15° C. or more, about 17° C. or more, or even about 20° C. or more greater than the T m . It is worth noting that the hybridization temperature can be the same or different than the temperature at which the label extenders and optional capture extenders are hybridized to the nucleic acids of interest.
- Each label extender typically includes a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the corresponding nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system (e.g., the preamplifier or amplification multimer).
- the amount of overlap between each individual label extender and the component of the label probe system i.e., the length of L-2 and M-1) affects the T m of the complex between the label extender and the component, as does, e.g., the GC base content of sequences L-2 and M-1.
- all the label extenders have the same length sequence L-2 and/or identical polynucleotide sequences L-2.
- different label extenders can have different length and/or sequence polynucleotide sequences L-2. It will also be evident that the number of label extenders required for stable capture of the component to the nucleic acid of interest depends, in part, on the amount of overlap between the label extenders and the component (i.e., the length of L-2 and M-1).
- Stable capture of the component of the label probe system by the at least two label extenders can be achieved, for example, by balancing the number of label extenders that bind to the component, the amount of overlap between the label extenders and the component (the length of L-2 and M-1), and/or the stringency of the conditions under which the label extenders and the component are hybridized.
- any number of label extenders may be used, such as, for instance, 1-30 pairs of label extender probes, or 2-28 pairs of label extender probes, or 3-25 pairs of label extender probes, or 4-20 pairs of label extender probes, or a number of label extender probe pairs which is suitable to specifically attach the label probe system to the target with the desired affinity.
- some embodiments generally utilize two label extender probes to hybridize to each pre-amplifier, it is possible in other embodiments to design systems in which three label extender probes hybridize to a single target and single pre-amplifier probe, or even four label extender probes per pre-amplifier.
- the target nucleic acid is particularly short, as in siRNA or miRNA, it is possible to use only a single label extender probe, in concert with a single capture extender probe, to detect the target. (See, for instance, FIG. 11 ).
- a single pair of label extender probes may be designed to contain the entire complement to the target sequence (half of which would be encoded in the L-1 sequence of a first label extender probe, and the other half of which would be encoded in the second L-1 sequence of the second label extender probe).
- Appropriate combinations of the amount of complementarity between the label extenders and the component of the label probe system, number of label extenders binding to the component, and stringency of hybridization can, for example, be determined experimentally by one of skill in the art. For example, a particular number of label extenders and a particular set of hybridization conditions can be selected, while the number of nucleotides of complementarity between the label extenders and the component is varied until hybridization of the label extenders to a nucleic acid captures the component to the nucleic acid while hybridization of a single label extender does not efficiently capture the component.
- Stringency can be controlled, for example, by controlling the formamide concentration, chaotropic salt concentration, salt concentration, pH, organic solvent content, and/or hybridization temperature.
- the T m of any nucleic acid duplex can be directly measured, using techniques well known in the art. For example, a thermal denaturation curve can be obtained for the duplex, the midpoint of which corresponds to the T m . It will be evident that such denaturation curves can be obtained under conditions having essentially any relevant pH, salt concentration, solvent content, and/or the like.
- the T m for a particular duplex (e.g., an approximate T m ) can also be calculated.
- the T m for an oligonucleotide-target duplex can be estimated using the following algorithm, which incorporates nearest neighbor thermodynamic parameters:
- Tm (Kelvin) ⁇ H°/( ⁇ S°+R ln C t ), where the changes in standard enthalpy ( ⁇ H°) and entropy ( ⁇ S°) are calculated from nearest neighbor thermodynamic parameters (see, e.g., SantaLucia (1998) “A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics” Proc. Natl. Acad. Sci. USA 95:1460-1465, Sugimoto et al. (1996) “Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes” Nucleic Acids Research 24: 4501-4505, Sugimoto et al.
- a Web calculator for estimating T m using the above algorithms is available on the Internet at scitools.idtdna.com/analyzer/oligocalc.asp.
- Other algorithms for calculating T m are known in the art and are optionally applied to the present invention.
- the component of the label probe system is capable of hybridizing simultaneously to two of the m label extenders in a subset, although it optionally hybridizes to three, four, or more of the label extenders.
- sequence L-2 is 20 nucleotides or less in length.
- L-2 can be between 9 and 17 nucleotides in length, e.g., between 12 and 15 nucleotides in length, between 13 and 15 nucleotides in length, or between 13 and 14 nucleotides in length.
- m is at least two, and can be at least three, at least five, at least 10, or more. m can be the same or different from subset to subset of label extenders.
- the label extenders can be configured in any of a variety ways.
- the two label extenders that hybridize to the component of the label probe system can assume a cruciform arrangement, with one label extender having L-1 5′ of L-2 and the other label extender having L-1 3′ of L-2.
- a configuration in which either the 5′ or the 3′ end of both label extenders hybridizes to the nucleic acid while the other end binds to the component yields stronger binding of the component to the nucleic acid than does a cruciform arrangement of the label extenders.
- the at least two label extenders each have L-1 5′ of L-2 or each have L-1 3′ of L-2.
- L-1 which hybridizes to the nucleic acid of interest
- L-2 which hybridizes to the component of the label probe system
- L-1 and L-2 are optionally separated by additional sequence.
- L-1 is located at the 5′ end of the label extender and is about 20-30 nucleotides in length
- L-2 is located at the 3′ end of the label extender and is about 13-14 nucleotides in length
- L-1 and L-2 are separated by a spacer (e.g., 5 Ts).
- a label extender, preamplifier, amplification multimer, label probe, capture probe and/or capture extender optionally comprises at least one non-natural nucleotide.
- a label extender and the component of the label probe system e.g., the amplification multimer or preamplifier
- normatural nucleotides include, but are not limited to, Locked NucleicAcidTM nucleotides (available from Exiqon A/S, (www.) exiqon.com; see, e.g., SantaLucia Jr. (1998) Proc Natl Acad Sci 95:1460-1465) and isoG, isoC, and other nucleotides used in the AEGIS system (Artificially Expanded Genetic Information System, available from EraGen Biosciences, (www.) eragen.com; see, e.g., U.S. Pat. No. 6,001,983, U.S. Pat. No. 6,037,120, and U.S. Pat. No. 6,140,496).
- non-natural base pairs e.g., isoG-isoC base pairs
- Use of such non-natural base pairs can, for example, reduce background and/or simplify probe design by decreasing cross hybridization, or it can permit use of shorter probes (e.g., shorter sequences L-2 and M-1) when the non-natural base pairs have higher binding affinities than do natural base pairs.
- the methods can optionally be used to quantitate the amounts of the nucleic acids of interest present in the sample.
- an intensity of a signal from the label is measured, e.g., for each subset of particles or selected position on the solid support, and correlated with a quantity of the corresponding nucleic acid of interest present.
- blocking probes are optionally also hybridized to the nucleic acids of interest, which can reduce background in the assay.
- the corresponding label extenders, optional capture extenders, and optional blocking probes are preferably complementary to physically distinct, nonoverlapping sequences in the nucleic acid of interest, which are preferably, but not necessarily, contiguous.
- the T m s of the capture extender-nucleic acid, label extender-nucleic acid, and blocking probe-nucleic acid complexes are preferably greater than the temperature at which the capture extenders, label extenders, and/or blocking probes are hybridized to the nucleic acid, e.g., by 5° C. or 10° C. or preferably by 15° C.
- CE and LE sequences are optionally examined for possible interactions with non-corresponding nucleic acids of interest, LEs or CEs, the preamplifier, the amplification multimer, the label probe, and/or any relevant genomic sequences, for example; sequences expected to cross-hybridize with undesired nucleic acids are typically not selected for use in the CEs or LEs. See, e.g., Player et al. (2001) “Single-copy gene detection using branched DNA (bDNA) in situ hybridization” J Histochem Cytochem 49:603-611 and U.S. patent application 60/680,976.
- Capture probe sequences are preferably similarly examined, to ensure that the polynucleotide sequence C-1 complementary to a particular capture probe's sequence C-2 is not expected to cross-hybridize with any of the other capture probes that are to be associated with other subsets of particles or selected positions on the support.
- materials not captured on the solid support are optionally separated from the support.
- the support is optionally washed to remove unbound nucleic acids and probes; after the label extenders and amplification multimer are hybridized, the support is optionally washed to remove unbound amplification multimer; and/or after the label probes are hybridized to the amplification multimer, the support is optionally washed to remove unbound label probe prior to detection of the label.
- nucleic acids can be isolated from selected positions on a spatially addressable solid support.
- the isolated nucleic acid can optionally be removed from the particles and/or subjected to further manipulation, if desired (e.g., amplification by PCR or the like).
- determining which subsets of particles have a nucleic acid of interest captured on the particles may further comprise amplifying any nucleic acid of interest captured on the particles.
- amplifying nucleic acids include, but not limited to, PCR (polymerase chain reaction), rolling circle amplification, and transcription mediated amplification. (See, e.g., Hatch et al. (1999) “Rolling circle amplification of DNA immobilized on solid surfaces and its application to multiplex mutation detection” Genet Anal. 15:35-40; Baner et al.
- a labeled primer and/or labeled nucleotides are optionally incorporated during amplification.
- the nucleic acids of interest captured on the particles are detected and/or amplified without identifying the subsets of particles and/or the nucleic acids (e.g., in embodiments in which the subsets of particles are not distinguishable).
- the methods can be used to detect the presence of the nucleic acids of interest in essentially any type of sample.
- the sample can be derived from an animal, a human, a plant, a cultured cell, a virus, a bacterium, a pathogen, and/or a microorganism.
- the sample optionally includes a cell lysate, an intercellular fluid, a bodily fluid (including, but not limited to, blood, serum, saliva, urine, sputum, or spinal fluid), and/or a conditioned culture medium, and is optionally derived from a tissue (e.g., a tissue homogenate), a biopsy, and/or a tumor.
- the nucleic acids can be essentially any desired nucleic acids (e.g., DNA, RNA, mRNA, rRNA, miRNA, etc.).
- the nucleic acids of interest can be derived from one or more of an animal, a human, a plant, a cultured cell, a microorganism, a virus, a bacterium, or a pathogen.
- nucleic acids present at low concentration can be captured.
- at least one of the nucleic acids of interest is present in the sample in a non-zero amount of 200 attomole (amol) or less, 150 amol or less, 100 amol or less, 50 amol or less, 10 amol or less, 1 amol or less, or even 0.1 amol or less, 0.01 amol or less, 0.001 amol or less, or 0.0001 amol or less.
- two nucleic acids of interest can be captured simultaneously, even when they differ in concentration by 1000-fold or more in the sample. The methods are thus extremely versatile.
- Capture of a particular nucleic acid is optionally quantitative.
- the sample includes a first nucleic acid of interest, and at least 30%, at least 50%, at least 80%, at least 90%, at least 95%, or even at least 99% of a total amount of the first nucleic acid present in the sample is captured on a first subset of particles.
- Second, third, etc. nucleic acids can similarly be quantitatively captured. Such quantitative capture can occur without capture of a significant amount of undesired nucleic acids, even those of very similar sequence to the nucleic acid of interest.
- the methods can be used for gene expression analysis.
- the two or more nucleic acids of interest comprise two or more mRNAs.
- the methods can also be used for clinical diagnosis and/or detection of microorganisms, e.g., pathogens.
- the nucleic acids include bacterial and/or viral genomic RNA and/or DNA (double-stranded or single-stranded), plasmid or other extra-genomic DNA, or other nucleic acids derived from microorganisms (pathogenic or otherwise). It will be evident that double-stranded nucleic acids of interest will typically be denatured before hybridization with capture extenders, label extenders, and the like.
- the methods may similarly be applied towards detection and identification of single nucleotide polymorphisms (SNPs) residing in a genomic sample.
- SNPs single nucleotide polymorphisms
- the methods are very flexible and can be applied equally as well to SNP detection across the entire genome, if desired.
- Various methods of SNP detection may be employed, as explained in further detail below.
- Panel A illustrates three distinguishable subsets of microspheres 201 , 202 , and 203 , which have associated therewith capture probes 204 , 205 , and 206 , respectively.
- Each capture probe includes a sequence C-2 ( 250 ), which is different from subset to subset of microspheres.
- the three subsets of microspheres are combined to form pooled population 208 (Panel B).
- a subset of capture extenders is provided for each nucleic acid of interest; subset 211 for nucleic acid 214 , subset 212 for nucleic acid 215 which is not present, and subset 213 for nucleic acid 216 .
- Each capture extender includes sequences C-1 ( 251 , complementary to the respective capture probe's sequence C-2) and C-3 ( 252 , complementary to a sequence in the corresponding nucleic acid of interest).
- Three subsets of label extenders ( 221 , 222 , and 223 for nucleic acids 214 , 215 , and 216 , respectively) and three subsets of blocking probes ( 224 , 225 , and 226 for nucleic acids 214 , 215 , and 216 , respectively) are also provided.
- Each label extender includes sequences L-1 ( 254 , complementary to a sequence in the corresponding nucleic acid of interest) and L-2 ( 255 , complementary to M-1).
- Non-target nucleic acids 230 are also present in the sample of nucleic acids.
- Subsets of label extenders 221 and 223 are hybridized to nucleic acids 214 and 216 , respectively.
- nucleic acids 214 and 216 are hybridized to their corresponding subset of capture extenders ( 211 and 213 , respectively), and the capture extenders are hybridized to the corresponding capture probes ( 204 and 206 , respectively), capturing nucleic acids 214 and 216 on microspheres 201 and 203 , respectively (Panel C).
- Materials not bound to the microspheres e.g., capture extenders 212 , nucleic acids 230 , etc.
- Label probe system 240 including preamplifier 245 (which includes two sequences M-1 257 ), amplification multimer 241 (which includes sequences M-2 258 ), and label probe 242 (which contains label 243 ) is provided.
- Each preamplifier 245 is hybridized to two label extenders, amplification multimers 241 are hybridized to the preamplifier, and label probes 242 are hybridized to the amplification multimers (Panel D). Materials not captured on the microspheres are optionally removed by washing the microspheres.
- Microspheres from each subset are identified, e.g., by their fluorescent emission spectrum ( ⁇ 2 and ⁇ 3 , Panel E), and the presence or absence of the label on each subset of microspheres is detected ( ⁇ 1 , Panel E). Since each nucleic acid of interest is associated with a distinct subset of microspheres, the presence of the label on a given subset of microspheres correlates with the presence of the corresponding nucleic acid in the original sample.
- each capture probe typically includes a single sequence C-2 and thus hybridizes to a single capture extender.
- a capture probe can include two or more sequences C-2 and hybridize to two or more capture extenders.
- each of the capture extenders in a particular subset typically includes an identical sequence C-1, and thus only a single capture probe is needed for each subset of particles; however, different capture extenders within a subset optionally include different sequences C-1 (and thus hybridize to different sequences C-2, within a single capture probe or different capture probes on the surface of the corresponding subset of particles).
- the label probe system includes the preamplifier, amplification multimer, and label probe. It will be evident that similar considerations apply to embodiments in which the label probe system includes only an amplification multimer and label probe or only a label probe.
- each nucleic acid of interest can be hybridized simultaneously with its corresponding subset of m label extenders and its corresponding subset of n capture extenders, and then the capture extenders can be hybridized with capture probes associated with the solid support. Materials not captured on the support are preferably removed, e.g., by washing the support, and then the label probe system is hybridized to the label extenders.
- FIG. 3 Another exemplary embodiment is schematically illustrated in FIG. 3 .
- Panel A depicts solid support 301 having nine capture probes provided on it at nine selected positions (e.g., 334 - 336 ).
- Panel B depicts a cross section of solid support 301 , with distinct capture probes 304 , 305 , and 306 at different selected positions on the support ( 334 , 335 , and 336 , respectively).
- a subset of capture extenders is provided for each nucleic acid of interest. Only three subsets are depicted; subset 311 for nucleic acid 314 , subset 312 for nucleic acid 315 which is not present, and subset 313 for nucleic acid 316 .
- Each capture extender includes sequences C-1 ( 351 , complementary to the respective capture probe's sequence C-2) and C-3 ( 352 , complementary to a sequence in the corresponding nucleic acid of interest).
- Three subsets of label extenders ( 321 , 322 , and 323 for nucleic acids 314 , 315 , and 316 , respectively) and three subsets of blocking probes ( 324 , 325 , and 326 for nucleic acids 314 , 315 , and 316 , respectively) are also depicted (although nine would be provided, one for each nucleic acid of interest).
- Each label extender includes sequences L-1 ( 354 , complementary to a sequence in the corresponding nucleic acid of interest) and L-2 ( 355 , complementary to M-1).
- Non-target nucleic acids 330 are also present in the sample of nucleic acids.
- Subsets of label extenders 321 and 323 are hybridized to nucleic acids 314 and 316 , respectively.
- Nucleic acids 314 and 316 are hybridized to their corresponding subset of capture extenders ( 311 and 313 , respectively), and the capture extenders are hybridized to the corresponding capture probes ( 304 and 306 , respectively), capturing nucleic acids 314 and 316 at selected positions 334 and 336 , respectively (Panel C).
- Materials not bound to the solid support e.g., capture extenders 312 , nucleic acids 330 , etc. are separated from the support by washing.
- Label probe system 340 including preamplifier 345 (which includes two sequences M-1 357 ), amplification multimer 341 (which includes sequences M-2 358 ) and label probe 342 (which contains label 343 ) is provided.
- Each preamplifier 345 is hybridized to two label extenders, amplification multimers 341 are hybridized to the preamplifier, and label probes 342 are hybridized to the amplification multimers (Panel D).
- Materials not captured on the solid support are optionally removed by washing the support, and the presence or absence of the label at each position on the solid support is detected. Since each nucleic acid of interest is associated with a distinct position on the support, the presence of the label at a given position on the support correlates with the presence of the corresponding nucleic acid in the original sample.
- Another general class of embodiments provides methods of detecting one or more nucleic acids, using the novel label extender configuration described above.
- a sample comprising or suspected of comprising the nucleic acids of interest, one or more subsets of m label extenders, wherein m is at least two, and a label probe system are provided.
- Each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest.
- the label probe system comprises a label, and a component of the label probe system (e.g., a preamplifier or an amplification multimer) is capable of hybridizing simultaneously to at least two of the m label extenders in a subset.
- Each label extender comprises a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the corresponding nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system, and the at least two label extenders (e.g., the m label extenders in a subset) each have L-1 5′ of L-2 or each have L-1 3′ of L-2.
- nucleic acids of interest present in the sample are captured on a solid support.
- Each nucleic acid of interest captured on the solid support is hybridized to its corresponding subset of m label extenders, and the label probe system (or the component thereof) is hybridized to the m label extenders at a hybridization temperature.
- the hybridization temperature is greater than a melting temperature T m of a complex between each individual label extender and the component of the label probe system. The presence or absence of the label on the solid support is then detected.
- the label is associated with the nucleic acid(s) of interest via hybridization of the label extenders and label probe system
- the presence or absence of the label on the solid support is correlated with the presence or absence of the nucleic acid(s) of interest on the solid support and thus in the original sample.
- the solid support may be one or more particles, microparticles or nanoparticles.
- FIGS. 5A and 5B schematically illustrates an encoded microparticle which may be utilized as a substrate.
- Microparticle 500 is a cuboid structure elongated along the Y direction in the Cartesian coordinate as shown in the figure. The cross-sections perpendicular to the length of the microparticle have substantially the same topological shape—which is square in this example.
- the microparticle in this particular example has a set of segments (e.g. segment 502 ) and gaps (e.g. gap 504 ) intervening the segments. Specifically, segments with different lengths (the dimension along the length of the microparticle, e.g.
- the segments of the microparticle in this example are fully enclosed within the microparticle, for example within body 106 .
- the segments can be arranged such that the geometric centers of the segments are aligned to the geometric central axis of the elongated microparticle.
- a particular sequence of segments and gaps represents a code.
- the codes are derived from a pre-determined coding scheme.
- Segments of the microparticle can be any suitable form.
- each segment of the microparticle may have a substantially square cross-section (i.e. the cross-section in the X-Z plane of a Cartesian coordinate as shown in FIG. 5A ) taken perpendicular to the length (i.e. along the Y direction in the Cartesian coordinate in FIG. 5A ) of the microparticle.
- the segments may or may not be fabricated to have substantially square cross-section.
- Other shapes such as rectangular, circular, and elliptical, jagged, curved or other shapes are also applicable.
- the code elements—i.e. segments and gaps may also take any other suitable desired shape.
- the segment (and/or the gaps) each may have a cross-section that is rectangular (e.g. with the aspect ratio of the rectangular being 2:1 or higher, such as 4:1 or higher, 10:1 or higher, 20:1 or higher, or even 100:1 or higher, but preferably less than 500:1).
- the code elements, i.e. the segments and gaps may take any desired dimensions.
- each coding structure may have a characteristic dimension that is 5 ⁇ m (microns) or less, such as 3 microns or less, and more preferably 1 micron or less, such as 0.8 or 0.5 microns or less.
- each gap preferably has a characteristic dimension that is 1.5 microns or less, such as 0.8 or 0.5 microns or less.
- the gap areas can be made to have 0.13 ⁇ m minimum widths, with the less transparent segments having widths of from 0.13 ⁇ m to much larger (depending upon the desired length of the particle and the encoding scheme and code space desired).
- Minimum gap widths, as well as minimum segment widths, of from 0.13 to 1.85 ⁇ m (e.g. from 0.25 to 0.85 ⁇ m) are possible depending upon the wafer fabrication used.
- the microparticle can have any suitable number of coding structures depending upon the shape or length of the particle, and the code space desired. Specifically, the total number of coding structures of a microparticle can be from 1 to 20, or more typically from 3 to 15, and more typically from 3 to 8.
- the desired code can be incorporated in and represented by the microparticle in many ways.
- the coding elements of the pre-determined coding scheme can be represented by the segment(s)—e.g. segments of different lengths represent different coding elements of the coding scheme. Different spatial arrangements of the segments with the different (or the same) lengths and intervened by gaps represent different codes.
- the intervening gaps preferably have substantially the same dimension, especially the length in the direction to which the segments are aligned.
- the codes are incorporated in the microparticle by arranging gaps that vary in lengths; while the segments have substantially the same dimension and are disposed between adjacent gaps.
- the both segments and gaps vary in their dimensions so as to represent a code.
- the code can also be represented in many other alternative ways using the segments, gaps, and the combination thereof.
- the particle code space may be further expanded by manufacturing a subset of the microparticles such that a tab protrudes from a face of the particle.
- the code may also incorporate refractive or reflective coatings to expand the maximum number of allowable codes.
- the segments and gaps in each microparticle can be composed of materials of different optical, electrical, magnetic, fluid dynamic, or other desired properties that are compatible with the desired detection methods.
- the segments and gaps are directly spatially distinguishable under transmitted and/or reflected light in the visible spectrum.
- the distinguishable property can be a difference in transmissivity to the particular light used for imaging (which can be any desired electromagnetic radiation—e.g. visible and near-visible light, IR, and ultra-violet light.
- the segments can be made to be more light absorbing (or light reflecting) than the intervening spacing material (or vice versa).
- the segments and gaps are preferred to exhibit sufficient difference in the specific property such that the difference is detectable using the corresponding code detection method.
- the segments and gaps are composed of materials exhibiting different transmissivity (in an optical transmittance mode) or reflectivity (in optical reflectance mode) to the specific light used in imaging the microparticles.
- the segments of the microparticle of the less transparent material can block and/or reflect 30% or more, preferably 50% or more, or e.g. 80% or more, of the visible light or near visible light incident thereon.
- the microparticles may be made of organic and/or inorganic materials or a combination of organic and inorganic material.
- the gaps (which are preferably more transmissive to visible or near-visible light) and segments (which are preferably less transmissive to visible or near-visible light as compared to gaps) each can be composed organic or inorganic materials, or a hybrid organic-inorganic material.
- the segments can be composed of a metal (e.g. aluminum), an early transition metal (e.g. tungsten, chromium, titanium, tantalum or molybdenum), or a metalloid (e.g. silicon or germanium), or combinations (or nitrides, oxides and/or carbides) thereof.
- the segments can be composed of a ceramic compound, such as a compound that comprises an oxide of a metalloid or early transition metal, a nitride of a metalloid or early transition metal, or a carbide of a metalloid or early transition metal.
- a ceramic compound such as a compound that comprises an oxide of a metalloid or early transition metal, a nitride of a metalloid or early transition metal, or a carbide of a metalloid or early transition metal.
- Early transition metals are those from columns 3b Sc, Y, Lu, Lr), 4b (Ti, Zr, Hf, Rf), 5b (V, Nb, Ta, Db), 6b (Cr, Mo, W, Sg) and 7b (Mn, Tc, Re, Bh) of the periodic table.
- the particles may be entirely comprised of different forms of silica, glass, or suitable known polymeric materials.
- the gaps which are in this example more transparent, can comprise any suitable material that is more transparent than the segments.
- the spacing material can be a siloxane, siloxene or silsesquioxane material, among others, if a hybrid material is selected.
- the spacing material if inorganic, can be a glass material. Thin film deposited silicon dioxide is a suitable material, with or without boron or phosphorous doping/alloying agents.
- inorganic glass materials are also suitable such as silicon nitride, silicon oxynitride, germanium oxide, germanium oxynitride, germanium-silicon-oxynitride, or various transition metal oxides for example.
- a spin on glass (SOG) could also be used.
- a plastic e.g. polystyrene or latex for example
- Both the segments and the gaps can be deposited by any suitable methods such as CVD (chemical vapor deposition), PVD (physical vapor deposition), spin-on, sol gel, etc.
- the CVD could be LPCVD (low pressure chemical vapor deposition), PECVD (plasma enhanced chemical vapor deposition), APCVD (atmospheric pressure chemical vapor deposition), SACVD (sub atmospheric chemical vapor deposition), etc. If a PVD method is used, sputtering or reactive sputtering are possible depending upon the desired final material. Spin on material (SOG or hybrid organic-inorganic siloxane materials
- microparticles are disclosed in the specification of U.S. patent application Ser. No. 11/521,057, especially at, for instance, sections entitled “Frabrication”, “Detection,” “Method for Producing Codes,” “Coding Scheme,” “Assays,” “A Bioassay Process Using the Microparticles,” and Figures, etc., all of which is incorporated herein by reference for all purposes.
- the one or more nucleic acids of interest comprise two or more nucleic acids of interest
- the one or more subsets of m label extenders comprise two or more subsets of m label extenders.
- a pooled population of particles which constitute the solid support is provided.
- the population comprises two or more subsets of particles, and a plurality of the particles in each subset is distinguishable from a plurality of the particles in every other subset. (Typically, substantially all of the particles in each subset are distinguishable from substantially all of the particles in every other subset.)
- the particles in each subset have associated therewith a different capture probe.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes, thereby associating each subset of n capture extenders with a selected subset of the particles.
- Each of the nucleic acids of interest present in the sample is hybridized to its corresponding subset of n capture extenders and the subset of n capture extenders is hybridized to its corresponding capture probe, thereby capturing the nucleic acid on the subset of particles with which the capture extenders are associated.
- At least a portion of the particles from each subset are identified and the presence or absence of the label on those particles is detected. Since a correlation exists between a particular subset of particles and a particular nucleic acid of interest, which subsets of particles have the label present indicates which of the nucleic acids of interest were present in the sample.
- the nucleic acids of interest comprise two or more nucleic acids of interest and the one or more subsets of m label extenders comprise two or more subsets of m label extenders
- the nucleic acids are captured at different positions on a non-particulate, spatially addressable solid support.
- the solid support comprises two or more capture probes, wherein each capture probe is provided at a selected position on the solid support. Two or more subsets of n capture extenders, wherein n is at least two, are provided.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes, thereby associating each subset of n capture extenders with a selected position on the solid support.
- Each of the nucleic acids of interest present in the sample is hybridized to its corresponding subset of n capture extenders and the subset of n capture extenders is hybridized to its corresponding capture probe, thereby capturing the nucleic acid on the solid support at the selected position with which the capture extenders are associated.
- the presence or absence of the label at the selected positions on the solid support is detected. Since a correlation exists between a particular position on the support and a particular nucleic acid of interest, which positions have a label present indicates which of the nucleic acids of interest were present in the sample.
- the invention provides methods for capturing a labeled probe to a target nucleic acid, through hybridization of the labeled probe directly to label extenders hybridized to the nucleic acid or through hybridization of the labeled probe to one or more nucleic acids that are in turn hybridized to the label extenders.
- one general class of embodiments provides methods of capturing a label to a first nucleic acid of interest in a multiplex assay in which two or more nucleic acids of interest are to be detected.
- a sample comprising the first nucleic acid of interest and also comprising or suspected of comprising one or more other nucleic acids of interest is provided.
- a first subset of m label extenders, wherein m is at least two, and a label probe system comprising the label are also provided.
- the first subset of m label extenders is capable of hybridizing to the first nucleic acid of interest, and a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in the first subset.
- the first nucleic acid of interest is hybridized to the first subset of m label extenders, and the label probe system is hybridized to the m label extenders, thereby capturing the label to the first nucleic acid of interest.
- the label probe system comprises a label probe, which label probe comprises the label, and which label probe is capable of hybridizing simultaneously to at least two of the m label extenders.
- the label probe system includes the label probe and an amplification multimer that is capable of hybridizing simultaneously to at least two of the m label extenders.
- the label probe system includes the label probe, an amplification multimer, and a preamplifier that is capable of hybridizing simultaneously to at least two of the m label extenders.
- Another general class of embodiments provides methods of capturing a label to a nucleic acid of interest.
- m label extenders wherein m is at least two, are provided.
- the m label extenders are capable of hybridizing to the nucleic acid of interest.
- a label probe system comprising the label is also provided.
- a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders.
- Each label extender comprises a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system, and the m label extenders each have L-1 5′ of L-2 or wherein the m label extenders each have L-1 3′ of L-2.
- the nucleic acid of interest is hybridized to the m label extenders, and the label probe system is hybridized to the m label extenders at a hybridization temperature, thereby capturing the label to the nucleic acid of interest.
- the hybridization temperature is greater than a melting temperature T m of a complex between each individual label extender and the component of the label probe system.
- the label probe system comprises a label probe, which label probe comprises the label, and which label probe is capable of hybridizing simultaneously to at least two of the m label extenders.
- the label probe system includes the label probe and an amplification multimer that is capable of hybridizing simultaneously to at least two of the m label extenders.
- the label probe system includes the label probe, an amplification multimer, and a preamplifier that is capable of hybridizing simultaneously to at least two of the m label extenders.
- capture probes are bound to encoded microparticles of the type described above.
- Capture extenders are employed to capture the target nucleic acid to the encoded microparticles.
- Branched DNA technology is then used, comprising pre-amplifiers, amplifiers and label probes, to amplify the signal associated with the captured target nucleic acids.
- nucleic acid analogs are utilized in the capture extender probes. This provides increase specificity for the target.
- nucleic acid analogs such as constrained-ethyl (cEt) analogs may be used, as depicted in FIG. 7A .
- cEt constrained-ethyl
- FIG. 7A See, for additional variations of this analog which may also be suitable in the present embodiments, Seth et al., “Short Antisense Oligonucleotides with Novel 2′-4′ Conformationaly Restricted Nucleoside Analogues Show Improved Potency Without Increased Cytotoxicity in Animals,” J. Med. Chem., 52(1):10-13, 2009, incorporated herein by reference in its entirety for all purposes).
- the capture extender probe may be entirely comprised of such cEt analogs, or may be only partially comprised of cEt analogs.
- the capture extender probe may only have cEt analogs at sequence L-1.
- the capture extender may have cEt analogs at the C-2 sequence as well as the L-1 sequence and/or cEt content beyond those sequences up to and including the entire capture extender probe.
- Use of the cEt analogs in the capture portion of the assay is especially beneficial because it is known that cEt analogs, when present in probes, act to increase the melting temperature of the resulting hybridized probe:target pair, which provides increased stability of the hybridized pair and therefore increased stability of the captured target nucleic acid bound to the encoded microparticle.
- the length of label extender probes may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length.
- the sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length.
- the sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base.
- the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog.
- the underlying principle to the use of nucleotide analogs, such as cEt is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence.
- the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay.
- the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant.
- FIG. 6 depicts a typical interaction for such an assay method.
- the number of capture extenders hybridized per target nucleic acid may be as many as 2, 3, 4, 5, 6, 7 or even 8.
- the number of label extenders hybridized per target nucleic acid may be as many as 2, 3, 4, 5, 6, 7 or even 8.
- it has been found that using even just a single capture extender bound to each target nucleic acid is in some cases sufficient to provide the desired specificity and sensitivity for the assay.
- label extenders used to bind to the captured target nucleic acid and the pre-amplifiers, may be in any of many different conformations. That is, the label extenders may be designed in the double-z (ZZ) configuration, the cruciform configuration, or any other related conformation as depicted, for instance, in FIGS. 10A and 10B . Each of these interchangeable conformations may be designed and utilized in these assays to achieve similar results.
- the structural variations of label extender probe design depicted in FIGS. 10A and 10B are only non-limiting examples and the Figures are do not depict all possible geometries or strategies. One of skill will immediately recognize that other useful and suitable label extender probe designs may be derived from these exemplary structures.
- FIGS. 10A , 10 B, 12 A and 12 B various geometric alignments may be utilized in designing the cruciform and ZZ conformations, such as depicted in FIGS. 10A , 10 B, 12 A and 12 B.
- FIGS. 12A and 12B are not intended to depict every possible design of the label extenders. Rather, these Figures merely depict specific embodiments of label extender design.
- One of skill in the art would be able to design other variations based on these themes which may also be suitable for the hereindescribed methodological embodiments.
- Each encoded microparticle used in the assay will have its own unique barcode. Thus, as many as 1000 different target nucleic acids may be detected in a single assay from a sample using this approach.
- this assay may be particularly useful for detecting single nucleotide polymorphisms (SNPs).
- this assay method may be utilized to detect and quantitate micro-RNA (miRNA) species. Micro-RNA species are particularly difficult to detect due to their short sequence length, which is typically from approximately 11 to 22 nucleotides.
- This assay approach may be utilized to detect mRNA, DNA, siRNA, miRNA (mature and immature sequences), SNP detection, and utilized on, for instance, WGA samples, or any type of sample desired.
- sample DNA is sheared prior to performing the assay such that the average length is 20-50 nucleotides, or 30-50 nucleotides, or 40-50 nucleotides, using methods known in the art.
- At least approximately 50,000 cells should be harvested per sample. However, this is merely a general guide and as many as 100,000 cells, or more may be used to increase the robustness of the assay. Depending on the cell type, anywhere from 50,000 to 250,000 cells may be harvested and prepared for each sample.
- nucleic acid material RNA or DNA depending on the assay type
- the amount of nucleic acid material or genetic material required for optimum results will vary depending on target sequence identity and probe design, but may be at least 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, or 500 ng for each sample.
- the encoded microparticles once prepared in a uniformly dispersed manner in the assay buffer, are allowed to interact with the target thereby binding the target to the encoded microparticle or barcode. Once bound, optional washing steps may be employed to wash away non-specifically bound molecules using various higher or lower stringency buffers as known in the art.
- the microparticles may be allowed to settle, for instance, in a dish, well, slide, or other substrate such that the microparticles form a monoloayer and may be imaged either from above or below to obtain data concerning which encoded microparticle or barcode has bound to it the target, thereby identifying the sequence of the target and/or the presence or absence of a target sequence.
- the microparticles may be imaged in flow, such as by using a fluid-handling machine capable of dispersing the microparticles in solution and transporting that solution through a clear tube or other imaging cell, one particle at a time, and the particles may then be imaged as they flow through the channel, cell, tube, or other imaging stage.
- a fluid-handling machine capable of dispersing the microparticles in solution and transporting that solution through a clear tube or other imaging cell, one particle at a time, and the particles may then be imaged as they flow through the channel, cell, tube, or other imaging stage.
- Such optically-induced flow cytometry microfluidic devices are known in the art.
- the microparticles may be imaged simply by detecting reflected or refracted light and thereby the code of the particle determined. A second exposure could be conducted either before or after the first, detecting the fluorescent signal of the target. By superimposing these two images the identity of the particle and target may be determined.
- G-banding Prior to the development of FISH techniques, scientists typically used what was termed “G-banding” to identify gross chromosomal abnormalities. G-banding allows detection of abnormalities of the chromosome based on size, number, centromere position and banding pattern, i.e. karyotyping of whole chromosomes using a light microscope. With the advent of molecular genetics, these techniques were improved upon, culminating in the present day FISH techniques which accomplish the same goals, and more, and with much higher accuracy. FISH uses fluorescently-labeled DNA probes to hybridize to specific genetic regions of the chromosome which correlate with known linkages to diseases and genetic abnormalities. FISH utilizes fluorescent microscopy to aide in the detection of these regions. FISH is often used in laboratories testing samples for genetic abnormalities in conjunction with microarray technologies, which provides for independent validation of detection and diagnoses. FISH techniques have been in use in the scientific and clinical fields for at least the last 20 years.
- FISH Fluorescence in situ hybridization
- FISH analysis may be utilized in the areas of clinical research, medical genetics, prenatal testing, pharmacogenomics (for example in the cancer treatment field), carcinogenesis, and postnatal testing. More broadly, the field of use of the present methods may be considered the molecular cytogenetics market. Most cytogenetics testing laboratories continue to use FISH techniques to validate and provide independent diagnoses.
- the various abnormalities that may be detected by FISH include SNP detection, CNV detection, translocations and other such related abnormalities, i.e. LCH, LOH, UPD, etc.
- the various disease which may be associated with such genetic abnormalities may include, but are not limited to, for instance, cancer, developmental delay, autism, central nervous system disorders, heart diseases such as coronary artery disease, diabetes, psychological disorders such as schizophrenia, etc.
- nucleic acid analogs such as but not limited to, cEt molecules, locked nucleic acids, PNA's, and other such analogs
- use of nucleic acid analogs will provide increased sensitivity and stability of prepared samples
- use of multicolor fluorescent tags which specifically hybridize to specific label extender probes offer the capability to perform multiplex FISH analysis, identifying multiple targets in a single sample and in a single test.
- the label extenders may be any number of possible and suitable conformations, such as the ZZ or cruciform, or any other suitable conformation as illustrated in the non-exhaustive examples depicted in FIGS. 10A and 10B .
- the sequence L-1 in the label extender in these embodiments is partially or completely comprised of nucleic acid analog molecules to provide the increased melting temperature and the desired amount of specificity and stability for the label probe machinery interaction with the target sequence. There is no need in this application for a capture probe or capture extender since the label extender binds directly to the chromosomal material.
- RNA and DNA targets may be distinguished from each other in the same assay.
- label extender probes depicted in FIG. 10B one could design one set of label extender probes which are specific for double-stranded DNA as in this Figure, and design label extender probes specific for single-stranded RNA species as in FIG. 10A , which may be utilized in a single assay.
- This design approach may be utilized in the present embodiment, as well as in embodiments using encoded microparticles, other in situ or in cellulo embodiments, miRNA detection embodiments, SNP detection embodiments, and fusion/translocation embodiments as described in further detail below.
- Samples may be prepared and processed on a slide according to any of many well known procedures provided either on the Panomics website or other websites. (See, for instance, Nature Methods, 2:237-238, 2005 and references cited therein).
- the internet offers a plethora of protocols for FISH sample preparation. Samples may be, for instance, cells grown in culture, isolated cells from primary sources, tissue slices, purified chromosomes as in traditional karyotyping, and other samples suitable for FISH analysis.
- the hybridization step may be accomplished by any of the methods also provided in the literature.
- the manual for this protocol “QUANTIGENE® ViewRNA User Manual,” incorporated by reference in its entirety for all purposes, may also be downloaded from the Panomics website (see, panomics.com/downloads/UM15646_QGViewRNA_RevA — 080526.pdf, contents of which are incorporated herein by reference in its entirety for all purposes).
- the length of label extender probes may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length.
- the sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length.
- the sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base.
- the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog.
- the underlying principle to the use of nucleotide analogs, such as cEt is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence.
- the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay.
- the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant.
- the other components of the label machinery may be added to the sample to assemble the full labeling structure onto the sample.
- a labeling structure which includes some or all of the labeling components depicted, for instance, in FIG. 6 , may be partly assembled onto the label extender prior to hybridizing the label extender to the target sequence. Further, perhaps only the pre-amplifier and amplifier will be hybridized with the label extender probes prior to contact with the sample.
- the various structure components depicted in FIG. 6 may be assembled in any order desired to achieve optimum signal and sample handling results. For instance, to minimize sample preparation steps, it may be advantageous to have all labeling structure components in a single tube which is added to the sample in a single step.
- the resultant signal is not optimal, it may be necessary to add the various components of the label scaffolding in multiple steps or even one step at a time so each component hybridizes separately to its intended target component. Washing steps may be implemented between some or all of the steps of the process to optimize the desired result.
- multiple fluorescent labels may be used in the present methods. That is, one of skill in the art is aware of the various labels in existence in the market place which may be amenable to the presently disclosed method. Further, it should be noted that various fluors or known to provide different ranges of fluorescent wavelength. Thus, one could build a labeling structure such that one target genomic sequence is hybridized with one specific set of labeling structures providing a specific fluor color or wavelength, whereas a second and different target sequence may be designed using the labeling machinery to bind a differently labeled set of fluors yielding a different fluor color or wavelength, allowing for multiplex assays with the FISH protocol.
- siRNA antisense RNA molecules
- the general methodology calls for design and synthesis of specific, relatively short, 10-45 nucleotides, RNA molecules that will hybridize to mRNA transcripts in the cell.
- RNA molecules that will hybridize to mRNA transcripts in the cell.
- Salomon et al. “Highly Potent RNAi Compounds Derived from a Single, Short Oligonucleotides Sequence,” Keystone Symposia's RNA Silencing: Mechanism, Biology and Application, Jan. 14-19, 2010, Keystone, Colo.).
- These cell-produced mRNA are targeted to be turned off by the introduction into the cell of complementary antisense RNA, thereby down-regulating or stopping translation of the message into protein.
- the synthesized siRNA molecules are delivered to target cells producing the harmful message and once inside the cell, bind to the target mRNA and preclude translation of the mRNA, thus preventing or ameliorating the disease state.
- siRNA has been delivered to the cell and whether delivery was in sufficient quantity to elicit the desired result. Further, it is useful to determine the pharmacokinetics of the delivered siRNA, the half life, whether the appropriate location of the siRNA within the cell has been achieved, etc. In whole tissue studies it is desirable to determine whether the siRNA was effectively introduced into the target cell types or tissue types and the extent to which the siRNA was able to be introduced into said cells or tissues. Thus, a method is required for detection of siRNA. The detection of siRNA molecules in the cell or in situ is not easy since they molecules are generally around 20 nucleotides in length, on average.
- the sample is first prepared by either mounting the tissue to a solid support and fixing it as in FFPE sample preparations, or adherence of cells to a substrate and permeabilizing the cells to allow entry of the detection probes. Additionally, the method is further perfected by the use of conjugation chemistry to form covalent bonds between the label extender and the target siRNA molecule, thereby fixing in place the detection probe scaffolding to the siRNA in situ. This approach has been shown to be very successful and able to achieve detection of as many as 1, 2, 3, 4, 5, 6, 7, 8, 9 and even 10 or more targets in a single sample.
- the length of label extender probes employed in the present in embodiment may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length.
- the sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length.
- the sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs.
- the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog.
- the underlying principle to the use of nucleotide analogs, such as cEt is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence.
- the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc.
- this may vary depending on buffer conditions and assay.
- a neutralizing or denaturing agent such as formamide
- the target melting temperature downwards to a range of 40° C. to 50° C. or lower.
- the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity.
- the desired melting temperature may also be target-dependant.
- Various substrates may be used for this in situ assay, including plates comprising wells, such as 96-well plates and the like.
- wells such as 96-well plates and the like.
- Various known chemical cross-linking agents may be adapted to the protocol to aid in more permanently fixing the label probe system of QUANTIGENE® to the tissues or cells, such as, for instance, carbodiimides such as 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (see, for instance, Nat. Protoc., 3(6):1077-1084, 2008 and Nuc.
- EDC 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride
- cross linking examples include, but are not limited to, the use of Br-dU and/or I-dU modified nucleic acids where the 5-methyl group on the U base is substituted for the atom Br or I and crosslinking is triggered by irradiation at 308 nm.
- Other useful crosslinking agents may include psoralens which intercalate between bases and upon irradiation at 350 nm covalent crosslinking occurs between thymidine bases, which is reversible when irradiated again at 254 nm. (See, Pieles et al., Nuc. Acid Res., 17:285, 1989).
- crosslinkers of the same family and of other well known families may be useful in achieving the same or similar results, i.e. stabilizing the interaction between the siRNA and the target nucleic acid by forming a covalent bond between the two species of molecules, thereby precluding the siRNA from simply diffusing away from the intended targets.
- Label probes of any desirable variety may be used to finally detect the presence and location of the siRNA targets. As explained above, many different labels are known, both enzymatic and non-enzymatic labels, which may be useful in the disclosed method. Detection of siRNA may also be achieved using traditional FISH protocols. Furthermore, samples may be prepared according to the traditional FFPE process if desired.
- the above embodiments may also be implemented in such a way so that the L-1 sequence is able to distinguish between various SNP identities at a specific position within the chromosome, genome, genetic material, message RNA, miRNA, DNA (both single stranded and double stranded), or other sample to be tested. That is, the L-1 sequence may be designed such that the SNP which is to be detected resides in the very middle of one of the L-1 sequences on one of the label extender probes, or another location which provides optimal sensitivity. It should be noted that the label extender probes may be designed such that the L-1 sequence complementary to the SNP is in either one of the two LE probes.
- nucleic acid analogs such as LNA, PNA, cEt, etc.
- label extenders to bind to only the SNP allele that is perfectly complementary to the L-1 sequence. If the label extender binds to target, and subsequently the other components of the labeling system are added and detected, then the sequence of the SNP in the target nucleic acid may be determined.
- the label extender can further be designed such that it will only bind to a perfectly complementary target sequence such that if the identity of the nucleic acid at the SNP position is not perfectly complementary to the corresponding L-1 position, the label extender will not bind and no signal will be detected.
- FIGS. 9A and 9B A general depiction of one embodiment of this assay is provided in FIGS. 9A and 9B . Though FIGS.
- FIGS. 10A and 10B illustrate the use of label extender probes both in the cruciform (left panels) and double Z (right panels) configurations for both single stranded targets and double stranded targets
- other label extender configurations such as those depicted in FIGS. 10A and 10B
- the length of label extender probes in the present SNP detection embodiment may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length.
- the sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length.
- the sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs.
- the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog.
- the underlying principle to the use of nucleotide analogs, such as cEt is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence.
- the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc.
- this may vary depending on buffer conditions and assay.
- a neutralizing or denaturing agent such as formamide
- the target melting temperature downwards to a range of 40° C. to 50° C. or lower.
- the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity.
- the desired melting temperature may also be target-dependant.
- the assay may be designed such that one specific label is utilized for detection of one allele of the SNP, and a second distinguishable label is used for detection of another allele of the SNP.
- a signal will always be detected regardless of the identity of the SNP allele and the person conducting the experiment need only to distinguish between detection of both types of signals. In this way a sample can be identified as being homozygous for either allele, if a single label is detected, or heterozygous if signal for both labels is detected.
- the label extender probe may be a semicircle which has a break at the location of the SNP. Genotyping may then be achieved by ligation of the label extender loop by replacing the single missing base with, for instance, a labeled base.
- the label extender probes may simply be fully circular DNA probes wherein the L-1 sequence and the L-2 sequence are located at opposite ends of the circle, as depicted in FIG. 10A . It should be apparent to one of skill in the art that any of the label probe extender designs depicted in FIG. 10A may be swapped with any other label extender probe design, such that, for instance, perhaps one label probe is of the full circle variety while another may be of the “Z” variety, and the like. This “mix and match” property of the label probes is applicable to all of the embodiment provided here, not just the present embodiment.
- the present assay is utilized to genotype multiple SNPs in a given stretch of target nucleic of interest. For instance, there may be multiple, linked SNP's in a specific region of the genome of interest and to be assayed. It is often desirable to determine whether SNPs localized in a small genomic region are “linked.” That is, it is of interest to determine if one or more SNP's in a specific region of the genome, localized in a short sequence, are identified as either one allele or the other, at the same time.
- the term “genetic linkage” described the tendency of certain loci or alleles to be inherited together.
- SNPs on the same chromosome are physically close to one another and tend to stay together during meiosis, and thus are considered in the art to be “genetically linked.” From SNP genotyping, linkage maps may be generated showing the relationship between various SNPs in a specific region of the genome, and it may be determined whether these SNPs are linked.
- the present assays allow multiple SNP genotyping by simply associating specific labels for each SNP location and allele sequence. Thus, one SNP location may have, for instance, two alleles, one which is labeled with a “green” fluorescent label through its specifically assigned label probe system, and one which is labeled with a “yellow” fluor in its specifically assigned label probe system.
- a second SNP location just downstream or upstream of the first SNP may be similarly genotyped using the same colors or two distinguishably different colors. If the two SNP locations are close enough, label extender probes may be designed such that each of the label extender probes in a pair of label extender probes may have an L-1 sequence perfectly complementary to one possible allele each of the closely located SNPs. Separate label probe extenders comprising different L-1 sequences which are perfectly complementary to the other alleles may also be used, and each specific pair of label probe extenders then designed to hybridize to their own specific label probe system, thereby genotyping multiple SNPs in a single assay.
- the C-3 sequence of the capture extender probe may instead be used to capture and simultaneously genotype the SNP in the target sequence.
- the C-3 sequence in the capture extender probe could also be comprised of nucleic acid analogs, as described above for the L-1 sequence, and be perfectly complementary to one allele of the SNP to be genotype. Therefore, if the target nucleic acid sequence containing the SNP binds to the capture extender probe and thereby is captured to the substrate, the genotype will be known. After capture, the sample may be optionally washed to remove non-specifically bound nucleic acids, and the presence detected by application of the remainder of the label probe system or any other suitable means.
- the sample may be labeled prior to exposure to the substrate and the capture extenders, or even after capture. Labeling may be achieved using any of a myriad suitable means known in the art.
- the substrate may be, for example, a particle, a microparticle, a microsphere, or even an encoded microparticle, as explained above.
- the genotype of the target sequence may be determined.
- multiple capture extenders may be used, with each C-3 sequence being perfectly complimentary to a different SNP allele.
- Panomics provides compositions and products referred to as the QUANTIGENE line of products. These kits and compositions usually utilize anywhere from between six and twelve capture extender probes and twelve to twenty four label extender probes. However, kits do not necessary need to be bound by these number of probes per kit and may comprise any number of probes, as desired or as suitable for detection of the desired number of targets.
- the melting temperature selected for these assays is typically from 62° C. to 67° C.
- the average length of the probes is about 24 nucleic acids.
- mature miRNA is typically in the range of 15-28 nucleic acids in length and have an average melting temperature of around 64° C.
- the present embodiment incorporates use of LNA or other nucleic acid analogs to allow adjustment of hybridization regions L-1 and probe lengths to enable detection of mature miRNA.
- This present embodiment is designed such that the probes will hybridize only if the miRNA is in the mature form. (See, for instance, FIG. 11 , representing an embodiment of capturing and detecting mature miRNA, this would not work if the miRNA were in pre-mature form since the hairpin-loop structure and excess sequences surrounding the mature miRNA would interfere with binding of the probes). Any miRNA species that are longer than the mature miRNA, i.e.
- the assay employs LNA, such as, for instance, cEt and analogs thereof, in the L-1 sequence which also allows for detection of the presence of mutations in the complementary regions of the target miRNA.
- LNA such as, for instance, cEt and analogs thereof
- a capture extender is provided which has a region C-1 which is complementary to the capture probe.
- the capture extender also comprises a sequence C-3 which is complementary to a sequence in the miRNA and is typically comprised of one or more nucleic acid analogs to increase specificity and stability of the resultant hybridization pair created by hybridization of the capture probe to the miRNA target sequence.
- One or more label extender probes are also provided comprising the L-1 and L-2 sequences as above, which may also be comprised of one or more nucleic acid analogs which provide the same melting temperature properties as previously described. The remainder of the typical label probe system then is allowed to hybridize to the label extender probe providing detectable signal.
- the sequence C-3 may be generally as short as 7, 8, 9, 10, 11 or even 12 nucleotides or fewer and still function adequately to capture the target miRNA due to the use of highly selective complementary nucleic acid analogs in the C-3 sequence.
- the sequence L-1 may be generally as short as 7, 8, 9, 10, 11 or even 12 nucleotides or fewer and still function adequately to capture the target miRNA due to the use of highly selective complementary nucleic acid analogs.
- the sequences L-1 and C-3 may be 100% nucleic acid analog, or less, such as 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or even as low as 10% nucleic acid analog content.
- the assay may detect even very closely related miRNA homologs.
- the L-1 sequence may be as long as 50% of the entire miRNA or siRNA sequence.
- the C-3 sequence may be as long as 50% of the entire miRNA or siRNA sequence, such that when added together, the L-1 sequence and C-3 sequence together are the same length as the miRNA or siRNA sequence when added together, such that the entire miRNA or siRNA sequence is completely hybridized to these two probes.
- one or more bases of the target siRNA or miRNA sequence may be unhybridized to any other probe during the assay, i.e. not a target of, or in any way hybridized to, the capture or label probe system components. In general the number of target nucleic acid bases not hybridized to one or more components of the assay components would be 0, 1, 2, 3, 4, 5 or as many as 10 nucleic acids.
- the length of label extender probes may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length.
- the sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length.
- the sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base.
- the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog.
- the underlying principle to the use of nucleotide analogs, such as cEt is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence.
- the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay.
- the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant.
- this assay may be employed both in vitro and in situ, as needed. That is, the assay may be redesigned without the capture extender probes such that the detection occurs entirely in situ without the aid of a solid support.
- the label extenders may be designed in various configurations as depicted in FIG. 10 , i.e. such as, for example, a ZZ configuration or a cruciform configuration. It will also be clear to one in the art that similar methodologies can be applied to any nucleic acid target of this length or shorter, such as siRNA, for instance.
- an assay may be designed to detect the translocation of genes or fusion of genes, which is known to occur in various cancer diseases.
- the Philadelphia chromosome or translocation is associated with chronic myelogenous leukemia (CML) and is the result of a reciprocal translocation between chromosomes 9 and 22, designated t(9;22)(q34;q11).
- CML chronic myelogenous leukemia
- t(9;22)(q34;q11) The resultant fused gene is the gene product BCR-ABL.
- TMPRSS2-ETS gene fusion is associated with prostate cancer and is found in 50%-70% of prostate-specific-antigen (PSA)-screened hospital-based prostate cancers.
- PSA prostate-specific-antigen
- FISH-based assays are used to detect these genetic events.
- FISH-based assays are only effective for DNA-based fusion events, not RNA-based fusion events such as the SLC45A3-ELK4 fusion.
- a target sequence of between 500 to 1000 nucleic acids in length is sufficient to provide a sensitive assay signal.
- the target sequence may be 300, 400, 500, 600, 700, 800 or even 900 to 1000 nucleic acids in length.
- separate pairs of label extenders are hybridized through their L-1 sequences to the two targets, i.e. one target being one-half of the fusion gene (such as, for instance, BCR) and the second target being the second half of the fusion gene (such as, for instance, ABL).
- the two sets of label extenders may be specific for specific pre-amplifiers hybridizing through the L-2 sequence such that each target is separately labeled with different labels, such as differently colored dyes. When viewed through a fluorescence microscope, for instance—if this is the detection method specific for the label utilized in the assay, then one would look for the co-localization of the two different labels. If the labels are not co-localized, then no translocation is detected. If the labels are co-localized, this is evidence of a translocation event of the type being assayed.
- Various labels may be employed for the two sets of label extenders such that when the two different labels are within proximity of each other, a FRET reaction may occur to generate a third color distinguishable from the first two colors.
- a translocation event positive signal would be indicated by the appearance of a third color.
- one set of label extender probes may hybridize to one specific label probe system with green fluorescent labels.
- a second label probe system may be employed with a different label probe system comprising, for example, a red fluorescent label. If there is a translocation event in the sample, these two different colored label systems will be found in very close proximity to each other and the combination of labels will interact to general a third distinctive color which may be detected and indicative therefore of the translocation event.
- a single label extender may be made which traverses the translocation site.
- detection of a signal indicates the genetic event being detected has occurred. No signal in this embodiment is indicative of no translocation/fusion genetic event in the test sample.
- the length of label extender probes may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length.
- the sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length.
- the sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base.
- the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog.
- the underlying principle to the use of nucleotide analogs, such as cEt is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence.
- the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay.
- the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant.
- FIG. 8 An example of such as an assay is depicted in FIG. 8 .
- FIGS. 8A and 8B depict the use of label extenders in the ZZ formation
- other suitable label extender structures may be designed and utilized in the assay, such as the cruciform formation or other formations as depictured in FIG. 10 .
- the two different sets of label extenders may utilize different conformations, i.e. one using ZZ conformation for one-half of the target, and the other label extenders for the other half of the target sequence being in a different conformation selected from those depicted, for instance, in FIG. 10 .
- additional sets of label extenders may be employed, i.e. more than just two per target.
- an assay may be designed which utilized any number of label extenders in multiples of two.
- the assay may be designed such that half of the translocation target sequence is bound by as many as 2, 4, 6, 8, 10, 12, 14 or any multiple of two between 16-40 label extenders.
- the other half of the target may be designed to be bound by the same number, or a different number of label extenders.
- Another variation of the above embodiment of the present invention related to the discovery in nucleotide samples of chromosomal translocation and deletion events present in genetic samples, involves use of oligonucleotides microarrays and components of the bDNA assays described above. By implementing this embodiment, fusions, deletions and their locations may be detected.
- the mutation arises in genetic samples and can result in fusion of the BCR gene with the ABL gene, often including only parts of each.
- the exact location of the translocation event i.e. how much of ABL is fused to BCR and how much of BCR is left, is sometimes difficult to determine using common techniques such as paired-end sequencing. But cost of this known technique is high and employment of the sequencing technique is not easy.
- a microarray is manufactured which has bound to it DNA probes complementary to the BCR gene and/or the ABL gene. Probes on the microarray would be tiled so that the entire sequence of both genes is present in one or more probes on the array.
- compositions and kits of this embodiment would include label extenders which are designed such that they are tiled across both genes. The totality of all label extenders would therefore comprise the entire sequences of one or both of the two genes which are the subject of the translocation or deletion event being queried.
- the genetic material is fractionated and labeled according to standard protocols for analysis by microarray.
- Label extenders for one or both genes are also prepared as usual but with different labels which are distinguishable from the labels used for the genetic material. Additionally, the label extenders for each gene may be differentially labeled so they are distinguishable from the other gene and from the probes on the microarray.
- Hybridization of the prepared genetic sample on the array will yield BCR and ABL genes, in this example, labeled and bound to the array as in any other typical microarray experiment.
- the label extenders designed to be complimentary to one of the genes may be added under conditions allowing hybridization of the label extender(s) to one gene sequence of the pair of genes known to be or are suspected of being the subject of a genetic translocation event.
- the second set of label extenders designed to be complimentary to the other gene of the genetic translocation event, may also be bound to the array.
- multiple different label signals may be detected. If only one label is detected, i.e. that of the label associated with the prepared genetic sample, the conclusion would be that there is no chromosomal translocation event and the sample is normal. However, if at least two different colors are detected on the array, the conclusion would be that some translocation event occurred between the two subject genes.
- translocation event For instance, by determining the location of the microarray probe which hybridized to a sample gene fragment, one can know the sequence of that gene fragment from the sample and conclude that sequence was present in the original genetic sample. If this position on the microarray is also associated with a second label type or color, the conclusion would be that this known sequence is part of the translocation event. This type of analysis may be performed for each and every signal detected on the microarray, or some representative subset thereof, to determine the exact location in the sequence of the two genes of the translocation event.
- the present embodiment was exemplified by reference to the commonly-known and well-studied BCR/ABL chromosomal gene fusion event, this method and these reagents and kits may be employed equally as well for determination of other novel gene fusion and deletion events.
- the BCR/ABL fusion event is merely a non-limiting example of over 350 known chromosomal gene fusion events known to occur in humans to date.
- each label extender for each gene in question being assayed may be designed such that a different distinguishable label binds to that label extender.
- each label extender being distinguishable from any other based on differential labeling, one can detect each individual label signal and correlate this with the hybridization to the genetic sample of a particular label extender. Correlation of the label extender sequence with the label detected at that position yields the result that this particular gene sample sequence is present in the sample.
- a specific label signal for a specific label extender is not detected, one may conclude that this sequence is not present in the genetic sample and either was deleted or was removed when the chromosomal translocation event occurred.
- a label extender for every part of the known sequences of the two genes, only subsets of such label extenders may be included, or even single label extender species may be included. For instance, when it is known that the translocation event occurred at a specific small sequence segment between the two genes, it may be the case in this instance that only one or two specific label extenders need to be designed to detect whether that particular sequence, i.e. the unique genetic sample sequence created when the translocation event occurred, is present in the genetic sample.
- This simplified version of the assay is particularly efficient and easy to perform and as in the other variations of this embodiment, may be easily incorporated into a kit designed to detect and diagnose such translocation and deletion events from human genetic samples.
- the genetic sample may be chromosomal material or RNA samples.
- the source of the genetic material may be from any type of tissue from which genetic material is known to be extractable, manipulated, and prepared in the typical manner known for preparing genetic material for standard microarray assays.
- the genetic material may be obtained from human tissues or any other animal or species which is the subject of the genetic study. It is also understood that all the variations of design of label extenders, use of oligonucleotides analog sequences and assay variations discussed above with respect to other embodiments may be applied equally as well to the variations of the present embodiment.
- compositions related to the methods are another feature of the invention.
- one general class of embodiments provides a composition for detecting two or more nucleic acids of interest.
- the composition includes a pooled population of particles.
- the population comprises two or more subsets of particles, with a plurality of the particles in each subset being distinguishable from a plurality of the particles in every other subset.
- the particles in each subset have associated therewith a different capture probe.
- the composition includes a solid support comprising two or more capture probes, wherein each capture probe is provided at a selected position on the solid support.
- the composition also optionally may include two or more subsets of n capture extenders, wherein n is at least two, two or more subsets of m label extenders, wherein m is at least two, and a label probe system comprising a label, wherein a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in a subset.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles or with a selected position on the solid support.
- each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest.
- the composition optionally includes a sample comprising or suspected of comprising at least one of the nucleic acids of interest, e.g., two or more, three or more, etc. nucleic acids.
- the composition comprises one or more of the nucleic acids of interest or target nucleic acids.
- each nucleic acid of interest present in the composition is hybridized to its corresponding subset of n capture extenders, and the corresponding subset of n capture extenders is hybridized to its corresponding capture probe.
- Each nucleic acid of interest is thus associated with an identifiable subset of the particles.
- each nucleic acid of interest present in the composition is also hybridized to its corresponding subset of m label extenders.
- the component of the label probe system (e.g., the amplification multimer or preamplifier) is hybridized to the m label extenders.
- the composition is maintained at a hybridization temperature that is greater than a melting temperature T m of a complex between each individual label extender and the component of the label probe system (e.g., the amplification multimer or preamplifier).
- the hybridization temperature is typically about 5° C. or more greater than the T m , e.g., about 7° C. or more, about 10° C. or more, about 12° C. or more, about 15° C. or more, about 17° C. or more, or even about 20° C. or more greater than the T m .
- the capture probe, capture extenders and particles are not included in the compositions.
- compositions for detecting one or more nucleic acids of interest includes a solid support comprising one or more capture probes, one or more subsets of n capture extenders, wherein n is at least two, one or more subsets of m label extenders, wherein m is at least two, and a label probe system comprising a label.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with the solid support.
- Each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest.
- a component of the label probe system (e.g., a preamplifier or amplification multimer) is capable of hybridizing simultaneously to at least two of the m label extenders in a subset.
- Each label extender comprises a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the corresponding nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system, and the at least two label extenders (e.g., the m label extenders in a subset) each have L-1 5′ of L-2 or each have L-1 3′ of L-2.
- the one or more nucleic acids of interest comprise two or more nucleic acids of interest
- the one or more subsets of n capture extenders comprise two or more subsets of n capture extenders
- the one or more subsets of m label extenders comprise two or more subsets of m label extenders
- the solid support comprises a pooled population of particles.
- the population comprises two or more subsets of particles.
- a plurality of the particles in each subset are distinguishable from a plurality of the particles in every other subset, and the particles in each subset have associated therewith a different capture probe.
- the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles.
- the one or more nucleic acids of interest comprise two or more nucleic acids of interest, or target nucleic acids
- the one or more subsets of n capture extenders comprise two or more subsets of n capture extenders
- the one or more subsets of m label extenders comprise two or more subsets of m label extenders
- the solid support comprises two or more capture probes, wherein each capture probe is provided at a selected position on the solid support.
- the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected position on the solid support.
- the label probe system can include an amplification multimer or preamplifier, which amplification multimer or preamplifier is capable of hybridizing to the at least two label extenders.
- the composition optionally includes one or more of the nucleic acids of interest, wherein each nucleic acid of interest is hybridized to its corresponding subset of m label extenders and to its corresponding subset of n capture extenders, which in turn is hybridized to its corresponding capture probe.
- the amplification multimer or preamplifier is hybridized to the m label extenders.
- the composition is maintained at a hybridization temperature that is greater than a melting temperature T m of a complex between each individual label extender and the amplification multimer or preamplifier (e.g., about 5° C. or more, about 7° C. or more, about 10° C. or more, about 12° C. or more, about 15° C. or more, about 17° C. or more, or about 20° C. or more greater than the T m ).
- compositions are also understood to comprise label extenders and capture extenders having one or more nucleic acid analogs. That is, the sequences of L-1 and C-3, may contain anywhere from 1% to 100% nucleic acid analogs, such as, for instance, cEt, LNA, PNA and the like, and mixtures thereof. With regard to cEt, it is understood that other nucleic acid analogs of similar structure and having the same or similar properties, i.e. the ability to increase the melting temperature of a hybridization event between the capture extender and/or label extender sequence and the target sequence.
- compositions are further intended to include those compositions designed specifically for detection of target nucleic acids in situ, which would not require the use of, and therefore not include in the composition, capture probes, capture extenders and/or particles.
- kits for detecting two or more nucleic acids of interest includes a pooled population of particles.
- the population comprises two or more subsets of particles, with a plurality of the particles in each subset being distinguishable from a plurality of the particles in every other subset.
- the particles in each subset have associated therewith a different capture probe.
- the kit includes a solid support comprising two or more capture probes, wherein each capture probe is provided at a selected position on the solid support.
- the kit also includes two or more subsets of n capture extenders, wherein n is at least two, two or more subsets of m label extenders, wherein m is at least two, and a label probe system comprising a label, wherein a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in a subset.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles or with a selected position on the solid support.
- each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest.
- the components of the kit are packaged in one or more containers.
- the kit optionally also includes instructions for using the kit to capture and detect the nucleic acids of interest, one or more buffered solutions (e.g., lysis buffer, diluent, hybridization buffer, and/or wash buffer), standards comprising one or more nucleic acids at known concentration, and/or the like.
- buffered solutions e.g., lysis buffer, diluent, hybridization buffer, and/or wash buffer
- kits for detecting one or more nucleic acids of interest includes a solid support comprising one or more capture probes, one or more subsets of n capture extenders, wherein n is at least two, one or more subsets of m label extenders, wherein m is at least two, and a label probe system comprising a label.
- Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with the solid support.
- Each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest.
- a component of the label probe system (e.g., a preamplifier or amplification multimer) is capable of hybridizing simultaneously to at least two of the m label extenders in a subset.
- Each label extender comprises a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the corresponding nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system, and the at least two label extenders (e.g., the m label extenders in a subset) each have L-1 5′ of L-2 or each have L-1 3′ of L-2.
- the components of the kit are packaged in one or more containers.
- the kit optionally also includes instructions for using the kit to capture and detect the nucleic acids of interest, one or more buffered solutions (e.g., lysis buffer, diluent, hybridization buffer, and/or wash buffer), standards comprising one or more nucleic acids at known concentration, and/or the like.
- buffered solutions e.g., lysis buffer, diluent, hybridization buffer, and/or wash buffer
- standards comprising one or more nucleic acids at known concentration, and/or the like.
- the one or more nucleic acids of interest comprise two or more nucleic acids of interest
- the one or more subsets of n capture extenders comprise two or more subsets of n capture extenders
- the one or more subsets of m label extenders comprise two or more subsets of m label extenders
- the solid support comprises a pooled population of particles.
- the population comprises two or more subsets of particles.
- a plurality of the particles in each subset are distinguishable from a plurality of the particles in every other subset, and the particles in each subset have associated therewith a different capture probe.
- the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles.
- the one or more nucleic acids of interest comprise two or more nucleic acids of interest
- the one or more subsets of n capture extenders comprise two or more subsets of n capture extenders
- the one or more subsets of m label extenders comprise two or more subsets of m label extenders
- the solid support comprises two or more capture probes, wherein each capture probe is provided at a selected position on the solid support.
- the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected position on the solid support.
- Kits are also understood to comprise label extenders and capture extenders having one or more nucleic acid analogs. That is, the sequences of L-1 and C-3, may contain anywhere from 1% to 100% nucleic acid analogs, such as, for instance, cEt, LNA, PNA and the like, and mixtures thereof. With regard to cEt, it is understood that other nucleic acid analogs of similar structure and having the same or similar properties, i.e. the ability to increase the melting temperature of a hybridization event between the capture extender and/or label extender sequence and the target sequence.
- cEt it is understood that other nucleic acid analogs of similar structure and having the same or similar properties, i.e. the ability to increase the melting temperature of a hybridization event between the capture extender and/or label extender sequence and the target sequence.
- Kits are further intended to include those compositions designed specifically for detection of target nucleic acids in situ, which would not require the use of, and therefore not include in the kit, capture probes, capture extenders and/or particles.
- the invention includes systems, e.g., systems used to practice the methods herein and/or comprising the compositions described herein.
- the system can include, e.g., a fluid and/or microsphere handling element, a fluid and/or microsphere containing element, a laser for exciting a fluorescent label and/or fluorescent microspheres, a detector for detecting light emissions from a chemiluminescent reaction or fluorescent emissions from a fluorescent label and/or fluorescent microspheres, and/or a robotic element that moves other components of the system from place to place as needed (e.g., a multiwell plate handling element).
- a composition of the invention is contained in a flow cytometer, a Luminex 100TM or HTSTM instrument, a microplate reader, a microarray reader, a luminometer, a colorimeter, fluorescence microscope, substrates (such as slides, well plates, etc.) on which samples may be prepared for assay, or like instrument.
- the system can optionally include a computer.
- the computer can include appropriate software for receiving user instructions, either in the form of user input into a set of parameter fields, e.g., in a GUI, or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations.
- the software optionally converts these instructions to appropriate language for controlling the operation of components of the system (e.g., for controlling a fluid handling element, robotic element and/or laser).
- the computer can also receive data from other components of the system, e.g., from a detector, and can interpret the data, provide it to a user in a human readable format, or use that data to initiate further operations, in accordance with any programming by the user.
- luminescent labels and light-scattering labels e.g., colloidal gold particles
- luminescent labels and light-scattering labels have been described.
- Csaki et al. (2002) “Gold nanoparticles as novel label for DNA diagnostics,” Expert Rev. Mol. Diagn., 2:187-93.
- fluorescent labels are well known in the art, including but not limited to, hydrophobic fluorophores (e.g., phycoerythrin, rhodamine, Alexa Fluor 488 and fluorescein), green fluorescent protein (GFP) and variants thereof (e.g., cyan fluorescent protein and yellow fluorescent protein), and quantum dots.
- hydrophobic fluorophores e.g., phycoerythrin, rhodamine, Alexa Fluor 488 and fluorescein
- GFP green fluorescent protein
- variants thereof e.g., cyan fluorescent protein and yellow fluorescent protein
- quantum dots e.g., quantum dots.
- quantum dots For use of quantum dots as labels for biomolecules, see e.g., Dubertret et al. (2002) Science, 298:1759; Nature Biotechnology (2003) 21:41-46; and Nature Biotechnology (2003) 21:47-51.
- Other various labels are known in the art, such as Alexa Fluor Dyes (Life Technologies, Inc., California, USA, available in a wide variety of wavelengths, see for instance, Panchuk, et al., J. Hist.
- Labels can be introduced to molecules, e.g. polynucleotides, during synthesis or by postsynthetic reactions by techniques established in the art; for example, kits for fluorescently labeling polynucleotides with various fluorophores are available from Molecular Probes, Inc. ((www.) molecularprobes.com), and fluorophore-containing phosphoramidites for use in nucleic acid synthesis are commercially available.
- signals from the labels e.g., absorption by and/or fluorescent emission from a fluorescent label
- signals from the labels can be detected by essentially any method known in the art. For example, multicolor detection, detection of FRET, fluorescence polarization, and the like, are well known in the art.
- Microspheres are preferred particles in certain embodiments described herein since they are generally stable, are widely available in a range of materials, surface chemistries and uniform sizes, and can be fluorescently dyed. Microspheres can be distinguished from each other by identifying characteristics such as their size (diameter) and/or their fluorescent emission spectra, for example. Furthermore, as explained in better detail above, the particles may be microspheres which may also be microparticles having a code therein.
- Luminex Corporation ((www.) luminexcorp.com), for example, offers 100 sets of uniform diameter polystyrene microspheres. The microspheres of each set are internally labeled with a distinct ratio of two fluorophores. A flow cytometer or other suitable instrument can thus be used to classify each individual microsphere according to its predefined fluorescent emission ratio. Fluorescently-coded microsphere sets are also available from a number of other suppliers, including Radix Biosolutions ((www.) radixbiosolutions.com) and Upstate Biotechnology ((www.) upstatebiotech.com). Alternatively, BD Biosciences ((www.) bd.com) and Bangs Laboratories, Inc.
- microsphere sets distinguishable by a combination of fluorescence and size.
- microspheres can be distinguished on the basis of size alone, but fewer sets of such microspheres can be multiplexed in an assay because aggregates of smaller microspheres can be difficult to distinguish from larger microspheres.
- Microspheres with a variety of surface chemistries are commercially available, from the above suppliers and others (e.g., see additional suppliers listed in Kellar and Iannone (2002) “Multiplexed microsphere-based flow cytometric assays” Experimental Hematology 30:1227-1237 and Fitzgerald (2001) “Assays by the score” The Scientist 15[11]:25).
- microspheres with carboxyl, hydrazide or maleimide groups are available and permit covalent coupling of molecules (e.g., polynucleotide capture probes with free amine, carboxyl, aldehyde, sulfhydryl or other reactive groups) to the microspheres.
- microspheres with surface avidin or streptavidin are available and can bind biotinylated capture probes; similarly, microspheres coated with biotin are available for binding capture probes conjugated to avidin or streptavidin.
- services that couple a capture reagent of the customer's choice to microspheres are commercially available, e.g., from Radix Biosolutions ((www.) radixbiosolutions.com).
- Protocols for using such commercially available microspheres e.g., methods of covalently coupling polynucleotides to carboxylated microspheres for use as capture probes, methods of blocking reactive sites on the microsphere surface that are not occupied by the polynucleotides, methods of binding biotinylated polynucleotides to avidin-functionalized microspheres, and the like
- methods of covalently coupling polynucleotides to carboxylated microspheres for use as capture probes methods of blocking reactive sites on the microsphere surface that are not occupied by the polynucleotides, methods of binding biotinylated polynucleotides to avidin-functionalized microspheres, and the like
- coupling of reagents to microspheres is well described in the literature. For example, see Yang et al.
- microsphere populations e.g. methods of identifying microsphere subsets by their size and/or fluorescence characteristics, methods of using size to distinguish microsphere aggregates from single uniformly sized microspheres and eliminate aggregates from the analysis, methods of detecting the presence or absence of a fluorescent label on the microsphere subset, and the like
- methods of analyzing microsphere populations e.g. methods of identifying microsphere subsets by their size and/or fluorescence characteristics, methods of using size to distinguish microsphere aggregates from single uniformly sized microspheres and eliminate aggregates from the analysis, methods of detecting the presence or absence of a fluorescent label on the microsphere subset, and the like.
- Suitable instruments, software, and the like for analyzing microsphere populations to distinguish subsets of microspheres and to detect the presence or absence of a label (e.g., a fluorescently labeled label probe) on each subset are commercially available.
- a label e.g., a fluorescently labeled label probe
- flow cytometers are widely available, e.g., from Becton-Dickinson ((www.) bd.com) and Beckman Coulter ((www.) beckman.com).
- Luminex 100TM and Luminex HTSTM systems are available from Luminex Corporation ((www.) luminexcorp.com); the similar Bio-PlexTM Protein Array System is available from Bio-Rad Laboratories, Inc. ((www.) bio-rad.com).
- a confocal microplate reader suitable for microsphere analysis, the FMATTM System 8100, is available from Applied Biosystems ((www.) appliedbiosystems.com).
- sets of microbeads that include optical barcodes are available from CyVera Corporation ((www.) cyvera.com).
- the optical barcodes are holographically inscribed digital codes that diffract a laser beam incident on the particles, producing an optical signature unique for each set of microbeads.
- nucleic acids e.g., by in vitro amplification, purification from cells, or chemical synthesis
- methods for manipulating nucleic acids e.g., by restriction enzyme digestion, ligation, etc.
- various vectors, cell lines and the like useful in manipulating and making nucleic acids
- methods of making branched polynucleotides e.g., amplification multimers
- U.S. Pat. No. 5,635,352 U.S. Pat. No. 5,124,246, U.S. Pat. No. 5,710,264, and U.S. Pat. No. 5,849,481, as well as in other references mentioned above.
- any polynucleotide can be custom or standard ordered from any of a variety of commercial sources, such as The Midland Certified Reagent Company ((www.) mcrc.com), The Great American Gene Company ((www.) genco.com), ExpressGen Inc. ((www.) expressgen.com), Qiagen (oligos.qiagen.com) and many others.
- a label, biotin, or other moiety can optionally be introduced to a polynucleotide, either during or after synthesis.
- a biotin phosphoramidite can be incorporated during chemical synthesis of a polynucleotide.
- any nucleic acid can be biotinylated using techniques known in the art; suitable reagents are commercially available, e.g., from Pierce Biotechnology ((www.) piercenet.com).
- any nucleic acid can be fluorescently labeled, for example, by using commercially available kits such as those from Molecular Probes, Inc. ((www.) molecularprobes.com) or Pierce Biotechnology ((www.) piercenet.com) or by incorporating a fluorescently labeled phosphoramidite during chemical synthesis of a polynucleotide.
- each capture probe is typically bound (e.g., electrostatically or covalently bound, directly or via a linker) to the support at a unique selected location.
- a solid support e.g., a membrane, a glass or plastic slide, a silicon or quartz chip, a plate, or other spatially addressable solid support
- each capture probe is typically bound (e.g., electrostatically or covalently bound, directly or via a linker) to the support at a unique selected location.
- Methods of making, using, and analyzing such arrays are well known in the art. See, e.g., Baldi et al.
- Arrays of pre-synthesized polynucleotides can be formed (e.g., printed), for example, using commercially available instruments such as a GMS 417 Arrayer (Affymetrix, Santa Clara, Calif.).
- the polynucleotides can be synthesized at the selected positions on the solid support; see, e.g., U.S. Pat. No. 6,852,490 and U.S. Pat. No. 6,306,643, each to Gentanlen and Chee entitled “Methods of using an array of pooled probes in genetic analysis.”
- Suitable solid supports are commercially readily available.
- membranes e.g., nylon, PVDF, and nitrocellulose membranes
- Sigma-Aldrich, Inc. ((www.) sigmaaldrich.com).
- surface-modified and pre-coated slides with a variety of surface chemistries are commercially available, e.g., from TeleChem International ((www.) arrayit.com), Corning, Inc. (Corning, N.Y.), or Greiner Bio-One, Inc. ((www.) greinerbiooneinc.com).
- silanated and silyated slides with free amino and aldehyde groups are available and permit covalent coupling of molecules (e.g., polynucleotides with free aldehyde, amine, or other reactive groups) to the slides.
- molecules e.g., polynucleotides with free aldehyde, amine, or other reactive groups
- slides with surface streptavidin are available and can bind biotinylated capture probes.
- services that produce arrays of polynucleotides of the customer's choice are commercially available, e.g., from TeleChem International ((www.) arrayit.com) and Agilent Technologies (Palo Alto, Calif.).
- Suitable instruments, software, and the like for analyzing arrays to distinguish selected positions on the solid support and to detect the presence or absence of a label are commercially available.
- a label e.g., a fluorescently labeled label probe
- microarray readers are available, e.g., from Agilent Technologies (Palo Alto, Calif.), Affymetrix (Santa Clara, Calif.), and Zeptosens (Switzerland).
- RNA targets were detected in RNA targets of approximately 20 base pairs, in situ using the QUANTIGENE® ViewRNA protocol.
- no capture probes or capture extenders are utilized since there is no need to capture the target nucleic acids onto a solid surface.
- the samples are placed onto a solid surface, such a slide or well but not directly covalently attached to the surface.
- Each target contained 0, 1 or 2 SNPs.
- the RNA targets were synthesized using known protocols and purified to homogeneity. RNA target probes were then transfected at 15 nM into HeLa cells using known transfection protocols and reagents, such as DeliverX (Panomics, Santa Clara, Calif., see website for transfection protocols, incorporated herein by reference for all purposes).
- Label extenders were designed in the “Double Z” (ZZ) format as depicted, for instance, in the right panel of FIG. 9A .
- Cell were prepared as in the published QUANTIGENE® ViewRNA User Manual protocol, downloadable from the Panomics website at: panomics.com/downloads/UM15646_QGViewRNA_RevA — 080526.pdf (incorporated herein by reference in its entirety for all purposes).
- Constrained ethyl, cEt, nucleic acid analogs were incorporated into the L-1 sequence of the label extenders where indicated, below (capital letters indicate use of cEt analogs, lower case letters are native nucleic acid bases, in the sequences provided below).
- the target sequences are based on the miR-107 miRNA sequence, a human cancer-linked micro-RNA sequence. (See, Takahashi et al., PLoS ONE, 4(8):e6677, Aug. 18, 2009, incorporated herein by reference). Label extender design was as follows (note that L-1 sequences below are in reverse order in relationship to the target since they are the complements of the target):
- Probe sets for mutated version of RNA Targets (lower case base letter indicates mutation), ONE mutation per target:
- HeLa cells were plated at a density of 4000 cells/well on 96-well plastic bottom plates (Thermo Scientific Nalge Nunc, Int'l., Rochester, N.Y.) which were pre-treated with Poly-L-Lysine. Cells were allowed to grow for 2 days under standard tissue culture conditions for HeLa cells. Using a non-residual volume protocol, cells were fixed in 4% formaldehyde and cross-linked with 0.16 M EDC. Briefly, the non-residual volume protocol calls for aspiration of all but a few microliters of assay solution from sample wells throughout the entire assay.
- protease used for this protocol was Protease XXIV (Sigma-Aldrich, MO, also known as alkaline protease, protease from Bacillus licheniformis ), at a concentration of 5 ⁇ g/ml (1:2000 dilution of stock).
- Labels used for the label probe system were AP-LP/Fast Red chromogenic labels and FAM-labeled probes.
- Label Extender probes were designed in the double Z arrangement using LNA in the L-1 sequence. AP-conjugated label probes were employed with Fast Red as the chromagenic detection agent. Probes were designed to target Let-7a mature miRNA, Her2 mRNA and PPIB mRNA, only the Let-7a probe had LNA incorporated. Probe sequences are directed to endogenous Let-7a, Her2 and PPIB targets within the cells. Many sets of label extender probes were designed for the mRNA sequences since the targets were much longer and more label extender probes could bind simultaneously to the longer targets, providing enhanced signal. Probe sequences were as follows (where capitalized letters indicate use of nucleic acid analog cEt and lower case letters indicate use of normal or wild type nucleic acids and cEt and LNA indicate use of either cEt analog or straight LNA analog):
- ERBB21 LE (SEQ ID NO: 28) ggtaacctgtgatctcttccagagtTTTTTgaagttaccgtttt ERBB22 LE (SEQ ID NO: 29) ccggccatgctgagatgtataTTTTTctgagtcaaagcat ERBB23 LE (SEQ ID NO: 30) gctgaggtcaggcaggctgtTTTTTgaagttaccgttttt ERBB24 LE (SEQ ID NO: 31) gattacttgcaggttctggaagacTTTTTctgagtcaaagcat ERBB25 BL (SEQ ID NO: 32) tgtgcagaattcgtccccg ERBB210 BL (SEQ ID NO: 33) gagggccagtccactgcccg ERBB211 LE (SEQ ID NO: 34) agaggtgggt
- PPIB1-1R LE (SEQ ID NO: 72) cggtggctagggagccgTTTTTgaagttaccgttttt PPIB2-1R LE (SEQ ID NO: 73) ggaagagggtggggccgTTTTTctgagtcaaagcat PPIB3-1R LE (SEQ ID NO: 74) cccggacagctgaggccTTTTTgaagttaccgttttt PPIB4-1R LE (SEQ ID NO: 75) ggcggaggcgaaagcagTTTTTctgagtcaaagcat PPIB5-1R LE (SEQ ID NO: 76) agaggcgcagcatccacaTTTTTgaagttaccgttttt PPIB6-1R LE (SEQ ID NO: 77) caccttcatgttgcgttcggTTTTTct
- Let-7a was detected in HeLa cells using the LNA-modified probes (data not shown). Assays revealed that simultaneous detection of both mature miRNA and endogenous mRNA were possible using these protocols.
- HeLa cells were plated at a density of 8000 cells per well on 96-well plates which were pretreated with Poly-L-Lysine. Cells were allowed to incubate overnight under typical tissue culture conditions. The following day, the HeLa cells were transfected with FAM-labeled or unlabelled GAPDH siRNA at a final concentration of 15 nM using the QUANTIGENE DeliverX product and protocol (Panomics, CA). Cells were again incubated overnight at standard HeLa cell tissue culture conditions.
- Target sequences and probe sequences utilized in this example are as follows, where capital letters in the Probeset sequences indicate the use of cEt nucleic acid analogs and lower case letters indicate use of normal or wild type nucleic acids and “LE1” and “LE2” indicate the LE L-1 sequences, one for each LE:
- CAUCAUCCCUGCCUCUACUTT-sense (SEQ ID NO: 116) AGUAGAGGCAGGGAUGAUGTT-antisense (SEQ ID NO: 117)
- the cells were then fixed as in Example 3. In addition, cells were denatured by heating the cells at 75° C. for 15 minutes following protease treatment.
- the label extender probes were designed in the double Z configuration as above.
- GAPDH label probe L-1 sequences incorporated LNA as indicated above.
- the FAM-labeled LNA-containing label extender probes were effective in detecting and visualizing GAPDH siRNA in the HeLa cells using the ViewRNA assay protocol. Further, it was discovered that using either one of the LE's by itself did not generate significant signal above background. Use of formamide/SSC and NaOH yielded similar results for the denaturation step (data not shown). Additionally, both of these denaturation groups exhibited similar dose-dependent knockdown effects when additional GAPDH mRNA was added to the samples (data not shown).
- the basic protocol for this assay is based on the QUANTIGENE® 2.0 protocol and reagent system user's manual (for example pages 12-25) available at the Panomics website at (www.)panomics.com/downloads/UM13074_QG2Manual_RevB — 080102.pdf (incorporated herein by reference in its entirety for all purposes). All reagents available from Panomics (Santa Clara, Calif.).
- the design of the assay is depicted in FIG. 11 .
- the probe set design was as follows (where capitalized letters indicate use of nucleic acid analog cEt and lower case letters indicate use of normal or wild type nucleic acids):
- hsa-miR-107-CE (SEQ ID NO: 120) tacaatgCtgctctcttggaaagaaagtgaagtg has-miR-107-LE (SEQ ID NO: 121) ctgagtcaaagcatgaagttaccgtttttttttttgatagcCctg
- FIG. 15A provides data for the performance of the following probesets (where capitalized letters indicate use of nucleic acid analog cEt and lower case letters indicate use of normal or wild type nucleic acids):
- 15A provides relative light units (RLU) background subtracted for samples comprising various amounts of miRNA target and with or without corn leaf tissue homogenate, showing that the assay responds linearly over a very wide range of target concentration, even in the context of a complex tissue homogenate mixture.
- RLU relative light units
- FIG. 15B provides additional data showing linearity of quantitative detection of miR-93 target in the context of tissue homogenate.
- the assay was performed as above for FIG. 15A .
- FIGS. 15C and 15D shows similar data, except that target has been changed to miR-107.
- FIG. 16 shows, label extender probes designed to specifically bind to only Let-7a overwhelmingly only bound to Let-7a. Very little relative light signal (RLU) was detected for binding to other homologues. The same is true for Let-7b and Let-7c.
- RLU relative light signal
- the ability of the miRNA assay to discriminate between mature and pre-miRNA forms of specific human miRNA targets miR-93, miR-107 and miR-155 was investigated in simple competition experiments. Results are provided in FIG. 18 . Sequences for the human targets are provided in FIG. 17 . As the results show in FIG. 18 , the assay specifically detects the mature form of the miRNA when using the constrained ethyl (cEt) analogs at strategic locations (L-1 and C-1 sequences) to capture only the mature form (left side of graph in FIG. 18 ). The right side of the graph in FIG. 18 shows that regular probes which contain no nucleic acid analogs are capable of specifically detecting pre-miRNA species when using the basic QUANTIGENE® 2.0 general protocol.
- cEt constrained ethyl
- miR-93 CAAAGUGCUGUUCGUGCAGGUAG
- miR-107 AGCAGCAUUGUACAGGGCUAUCA
- miR-155 UUAAUGCUAAUCGUGAUAGGGGU
- miR-93 (SEQ ID NO: 139) 5′-CUGGGGGCUCCAAAGUGCUGUUCGUGCAGG UAGUGUGAUUACCCAACCUACUGCUGAGCU-3′ miR-107: (SEQ ID NO: 140) 5′-ACAGUGUUGCCUUGUGGCAUGGAGUUCAAG CAGCAUUGUACAGGGCUAUCAAAGCACAGA-3′ miR-155: (SEQ ID NO: 141) 5′-AAUGCUAAUCGUGAUAGGGGUUUUUGCCU CCAACUGACUCCUACAUAUUAGCAUUAACAG-3′
- Probe sets with cEt chemistry specific for mature miRNA where capitalized letters indicate use of nucleic acid analog cEt and lower case letters indicate use of normal or wild type nucleic acids):
- Probe sets designed with regular DNA bases specific for pre-miRNA (no nucleic acids used, capital letters are the spacer part of the LE probes):
- Probe sets used for these experiments and label probe system components designed for this assay were determined as above with other examples. Probe sequences were designed such that they comprised the described regions of interaction for the label probe system to function as intended, as above. Cells were imaged using ArrayWorX and Olympus IX71 microscope using filters matching fluorophores above. Negative controls were performed with no probes added.
- FIGS. 19 and 20 are bar graphs providing typical data observed using the ATTO dye chemistry (labels available from Sigma-Aldrich, St. Louis, Mo.). Signal was observed as described above for other Examples.
- FIG. 19 provides S/B (signal/base line (negative control)) bar graphs depicting the activity and specificity of two LE configurations.
- Left panel shows data related to the performance of the Double Z (ZZ) LE configuration and the cruciform LE configuration in a single-plex assay.
- Right panel provides data related to the performance of the same LE's. Data in the right panel was obtained in multiplex format with four targets tested for each LE pair. Data represents averaged values.
- FIG. 20 provides signal-base line (negative control) bar graphs depicting the activity and specificity of two LE configurations.
- Left panel shows data related to the performance of the Double Z (ZZ) LE configuration and the cruciform LE configuration in a single-plex assay.
- Right panel provides data related to the performance of the same LE's now in multiplex format with four targets each.
- Y-axis units are RLU (relative light units).
- Example 1 The data in Example 1 were obtained in the QUANTIGENE® 1.0 assay using a single target.
- the data in the present Example is obtained using the QUANTIGENE® ViewRNA assay and using newer 2.0 version label probe system components.
- the buffer conditions, temperatures and assay procedures between these two embodiments are very different, yielding different performance results for the cruciform structures versus the double Z structures.
- all of the structures, and more, as depicted in FIGS. 10A and 10B can be examined and specifically selected for each assay and each target, depending on various conditions and the identity of the target sequence. For instance, it may be true that different amplifier probes and different label extender probes will work better for one target, but not for another. Thus, one of skill understands that some routine optimization may be needed to achieve the desired results for each specific assay or embodiment.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
- The present application claims priority to U.S. Provisional Patent Application Ser. No. 61/360,887, filed on Jul. 1, 2010, the entire disclosure of which is incorporated herein by reference for all purposes.
- Disclosed are methods, compositions and kits for detection of nucleic acids, including methods for detecting the presence of two or more nucleic acids simultaneously in a single sample. Detection may be, for instance, in vivo, in cellulo or in situ. Detection may include or be directed towards detection and quantitation of single nucleotide polymorphisms, i.e. SNP detection, copy number, micro-RNA, siRNA, transcription level determination, and other similar genetic information.
- A variety of techniques for detection of nucleic acids involve a first step of capturing or binding of the target nucleic acid or nucleic acids to a surface through hybridization of each nucleic acid to an oligonucleotide (or other nucleic acid) that is attached to the surface. For example, DNA microarray technology, which is widely used to analyze gene expression, copy number determination and single nucleotide polymorphism detection, relies on hybridization of DNA targets to preformed arrays of polynucleotides. (See, e.g., Lockhart and Winzeler, “Genomics, gene expression and DNA arrays,” Nature, 405:827-36 (2000); Gerhold et al. “Monitoring expression of genes involved in drug metabolism and toxicology using DNA microarrays,” Physiol. Genomics, 5:161-70, (2001); Thomas et al. “Identification of toxicologically predictive gene sets using cDNA microarrays,” Mol. Pharmacol., 60:1189-94 (2001); and Epstein and Butow, “Microarray technology—enhanced versatility, persistent challenge,” Curr. Opin. Biotechnol., 11:36-41 (2000)). Single nucleotide polymorphism (SNP) has been used extensively for genetic analysis. Fast and reliable hybridization-based SNP assays have been developed. (See, Wang et al., Science, 280:1077-1082, 1998; Gingeras, et al., Genome Research, 8:435-448, 1998; and Halushka, et al., Nature Genetics, 22:239-247, 1999; incorporated herein by reference in their entireties). Methods and arrays for simultaneous genotyping of more than 10,000 SNPs, and more than 100,000 SNPs, have been described, for example, in Kennedy et al., Nat. Biotech., 21:1233-1237, 2003, Matsuzaki et al., Genome Res., 14(3):414-425, 2004, and Matsuzaki et al., Nature Methods, 1:109-111, 2004 (all of which are incorporated herein by reference in their entireties for all purposes).
- As provided by the Human Genome Project Information website ((genomics).energy.gov), “Although more than 99% of human DNA sequences are the same, variations in DNA sequence can have a major impact on how humans respond to disease; environmental factors such as bacteria, viruses, toxins, and chemicals; and drugs and other therapies. This makes SNPs valuable for biomedical research and for developing pharmaceutical products or medical diagnostics. SNPs are also evolutionarily stable—not changing much from generation to generation—making them easier to follow in population studies.” However, it is pointed out that SNPs do not cause disease and they are not absolute indicators of disease development. However, based on SNP identity and linkage analysis studies performed which link the occurrence of various SNPs in a person's genome to diseases found in various sub-populations, SNPs can help determine the likelihood that a person might develop various diseases or illnesses. Studies using panels of human SNPs to identify evidence for linkage between genomic regions and disease phenotypes have been described. (See, for example, Boyles et al., Am. J. Med. Genet. A., 140(24):2776-85 (2006), Klein et al., Science, 308: 385 (2005), Papassotiropoulos et al., Science, 314:475-478 (2006), Craig and Stephan, Expert Rev. Mol. Diagn., 5(2):159-70 (2005) and Puffenberger et al., Proc. Nat'l. Acad. Sci. USA, 101:11689-94 (2004)).
- One type of genetic characteristic or information which can now be tested for is the genetic copy number state of particular regions or segments of the chromosome. Copy Number State (CNState) values are typically determined in series for each chromosome within the genome of the experimental genetic sample to find segments where chromosomal material has incurred a gain or loss of copies of genetic material. Genetic testing also enables detection of area of loss of heterozygosity (LOH) or LCSH, and/or may reveal of areas of non-interger CNState, e.g. copy number mosaicism. Long Contiguous Stretches of Homozygosity (LCSH) in a genomic region (stretch) indicates a region in which the Copy Number is neutral (two copies) but which displays a Loss of normal heterozygosity, and thus is homozygous for the measured SNP allele information. These are areas where a mixture of samples provide data relating to a specific chromosomal region which varies in integer copy number between the two admixed samples. This is also known as “mosaicism,” e.g. a genetic phenomenon wherein the determined copy number of the genetic marker is not a near a whole integer, but rather is between two whole integers. These Copy Number Variations (CNVs) are typically discovered using techniques such as fluorescent in situ hybridization (FISH), comparative genomic hybridization (CGH) or virtual karyotyping using oligonucleotide microarrays. Some CNVs have been associated with various diseases and this is an on-going and exciting field of research. For instance, elevated levels of EGFR gene has been found in non-small cell lung cancer, a higher level of the gene CCL3L1 has been associated with a lower susceptibility to human HIV, and various other CNVs have been associated with diseases such as autism, schizophrenia and idiopathic learning disability. In particular, a major focus in cytogenetics research is on Uniparental Disomy (UPD) events where a child inherits two copies of chromosomal material from one parent and nothing from the other. These UPD events are known to be linked with recessive disorders and also cause developmental disorders due to gene imprinting. These events occur without associated copy number changes. For instance approximately 30% of Prader-Willi cases are associated with paternal UPD of chromosome 15q, 2-3% of Angelman Syndrome are associated with maternal UPD of 15q, 10-30% of Beckwith-Wiedemann Syndrome are associated with maternal UPD of 11p15, and 5% of Silver-Russell Syndrome are associated with maternal UPD of
chromosome 7. - A typical DNA microarray contains a large number of spots or features, with each spot or feature containing oligonucleotides which have a single oligonucleotide sequence, each intended to be complementary to and to hybridize to a specific nucleic acid target. For example, the GENECHIP® microarray available from Affymetrix (Santa Clara, Calif.) can includes millions of features, with each feature containing multiple copies of a different single 25mer oligonucleotide sequence. (See, Lockhart et al., “Expression monitoring by hybridization to high-density oligonucleotide arrays,” Nature Biotechnology, 1996, 14(13):1675-80; Golub et al., “Molecular classification of cancer: class discovery and class prediction by gene expression monitoring,” Science, 1999, 286(5439), 531-7, each of which is incorporated herein by reference in their entirety for all purposes).
- In another approach, longer oligonucleotides are used to form the spots in the microarray. For example, instead of short oligonucleotides, longer oligonucleotides or cDNAs can be used to capture the target nucleic acids. Use of longer probes can provide increased specificity, but it can also make discrimination of closely related sequences difficult. Adjusting the length of the oligonucleotide probe to provide the desired specificity and sensitivity often proves extremely difficult. This further requires precise adjustment of hybridization temperature and other solution-phase parameters. When attempting to detect multiple targets simultaneously in one assay, or for instance one microarray, all of these variables must be considered and optimized to increase the robustness of the assay and the yield of assured genotyping calls.
- Many different avenues of research have been investigated to address these issues of specificity and sensitivity of such hybridization-based genetic assays. For instance, the use of oligonucleotide analogs have been investigated which increase the melting temperature at which the target hybridizes to the capture oligonucleotide.
- Improved methods for hybridizing oligonucleotide probes in a specific manner with high affinity and desired sensitivity to target nucleic acids are thus desirable. Among other aspects, presently disclosed are methods that address these limitations and which permit rapid, simple, and highly specific capture of multiple nucleic acid targets simultaneously.
- Global gene expression profiling and other technologies have identified a large number of genes whose expression is altered in diseased tissues or in tissues and cells treated with pharmaceutical agents. (See, Lockhart and Winzeler, (2000) “Genomics, gene expression and DNA arrays,” Nature, 405:827-36, and Gunther et al., (2003) “Prediction of clinical drug efficacy by classification of drug-induced genomic expression profiles in vitro,” Proc. Natl. Acad. Sci. USA, 100:9608-13). The capability of measuring the expression level of all of the expressed genes in a cell enables linking of these expression patterns to specific diseases. Therefore, gene expression is increasingly being used as a biomarker or prognosticator of disease, determination of the stage of disease, and indicator of prognosis. (See, Golub et al., (1999) “Molecular classification of cancer: class discovery and class prediction by gene expression monitoring,” Science, 286:531-7). Other applications of gene expression analysis and detection include, but are not limited to, target identification, validation and pathway analysis (Roberts et al. (2000) “Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles,” Science, 287:873-80), drug screening (Hamadeh et al., (2002) “Prediction of compound signature using high density gene expression profiling,” Toxicol. Sci., 67:232-40), and studies of drug efficacy, structure-activity relationship, toxicity, and drug-target interactions (Gerhold et al., (2001) “Monitoring expression of genes involved in drug metabolism and toxicology using DNA microarrays,” Physiol. Genomics, 5:161-70 and Thomas et al., (2001) “Identification of toxicologically predictive gene sets using cDNA microarrays,” Mol. Pharmacol., 60:1189-94). As biomarkers are identified, their involvement in disease management and drug development will need to be evaluated in higher throughput and broader populations of samples. Simpler and more flexible expression profiling technology that allows the expression analysis of multiple genes with higher data quality and higher throughput is therefore needed.
- Levels of RNA expression have traditionally been measured using Northern blot and nuclease protection assays. However, these approaches are time-consuming and have limited sensitivity, and the data generated are more qualitative than quantitative in nature. Greater sensitivity and quantification are possible with reverse transcription polymerase chain reaction (RT-PCR) based methods, such as quantitative real-time RT-PCR, but these approaches have low multiplex capabilities. (See, Bustin, (2002) “Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems,” J. Mol. Endocrinol., 29:23-39, and Bustin and Nolan, (2004) “Pitfalls of quantitative real-time reverse-transcription polymerase chain reaction,” J. Biomol. Tech., 15:155-66). Microarray technology has been widely used in discovery research, but its moderate sensitivity and its relatively long experimental procedure have limited its use in high throughput expression profiling applications (Epstein and Butow, (2000) “Microarray technology—enhanced versatility, persistent challenge,” Curr. Opin. Biotechnol., 11:36-41).
- Most of the current methods of mRNA quantification require RNA isolation, reverse transcription, and target amplification. Each of these steps has the potential of introducing variability in yield and quality that often leads to low overall assay precision. Recently, a multiplex screening assay for mRNA quantification combining nuclease protection with luminescent array detection was reported. (See, Martel et al., (2002) “Multiplexed screening assay for mRNA combining nuclease protection with luminescent array detection,” Assay Drug Dev. Technol., 1:61-71). Although this assay has the advantage of measuring mRNA transcripts directly from cell lysates, limited assay sensitivity and reproducibility were reported. Another multiplex mRNA assay without the need for RNA isolation was also reported in Tian et al., entitled “Multiplex mRNA assay using electrophoretic tags for high-throughput gene expression analysis.” (Nucleic Acids Res., 32:126, 2004). This assay couples the primary INVADER® mRNA assay with small fluorescent molecule Tags that can be distinguished by capillary electrophoresis through distinct charge-to-mass ratios of Tags. However, this assay requires the use of a specially designed and synthesized set of eTagged signal probes, complicated capillary electrophoresis equipment, and a special data analysis package.
- Another relatively new and exciting area of genetic research involves the study of micro-RNA, or miRNA. MicroRNA are short ribonucleic acid molecules which have been shown to be post-transcriptional regulators that bind complementary oligonucleotide sequences of mRNA transcripts. Upon binding, typically at the 3′ Untranslated Regions (UTR), gene silencing may occur. Typically miRNA are about 15-25 nucleotides in length and a single miRNA could silence hundreds of mRNA transcripts inside the cell. Since the turn of the century, it has been recognized the miRNA play a vital role in gene regulation, through mechanisms including transcript degradation, sequestering of transcripts, and translational suppression or even up-regulation. Thus, aberrant expression of miRNA can lead to various disease states. Various scientific reports have been surfacing which in fact link aberrant miRNA expression to disease. This has led to the realization that certain diseases, such as cancer, heart disease and central nervous system abnormalities, may be addressed by controlling miRNA levels in the cell. (See, for instance, Heneghan et al., “MicroRNAs as Novel Biomarkers for Breast Cancer,” J. Oncology, 2010, ID 950201, Ryan et al., “Genetic variation in micrRNA networks: the implications for cancer research,” Nat. Rev. Cancer, 10(6):389-402 (2010), O'Connell et al., “Physiological and pathological roles for microRNAs in the immune system,” Nat. Rev. Immunol., 10:111-122, (2010), and Inui et al., “MicroRNA control of signal transduction,” Nat. Rev. Mol. Cell Biol., 11:252-263 (2010), all of which are incorporated herein by reference in their entirety for all purposes).
- Another common technique for detecting genetic abnormalities is Fluorescence In Situ Hybridization (FISH). The FISH technique can be used to detect genetic abnormalities in nearly any type of tissue. In FISH analyses, single-stranded nucleic acids which are fluorescently labeled are allowed to bind to specific regions of the chromosome, and then examined through a microscope. Chromosome samples must first be fixed onto a slide, the labeled probe then hybridized to the chromosomes and then visualization is achieved through various enzyme-linked label-based detection protocols. Generally, the resolution of FISH analysis is on the order of detection of 60 base pairs (bp) up to 100 kilobase pairs of DNA. In contrast, CGH can detect abnormalities on the scale of 100 bp. Thus, the FISH analysis, though the golden standard today in cytogenetics, is time consuming and requires many steps, and in the end only provides 60 bp to 100 kb resolution.
- Yet another method of detection of genetic abnormalities involves binding of prepared DNA samples in solution to beads or microparticles comprised of oligonucleotides having sequences which are complementary to the target sequence, thereby capturing the target sequence for further analysis. Products such as the FLEXMAP3D (Luminex, Austin, Tex.), are illustrative of this type of technology. However, these types of instruments also have limitations, governed by the ability of the oligonucleotide on the bead to specifically and sensitively bind to the target molecule. If the target is too short, such techniques are unable to detect the target. Additionally, the number of targets able to be assayed in a single test is limited by the types of beads, microparticles or substrate used. Recently next generation microparticles were disclosed wherein the particle comprises a barcode, detectable by visible light. For instance, see U.S. Pat. Nos. 7,745,091 and 7,745,092 and U.S. patent application Ser. Nos. 11/521,115, 11/521,058, 11/521,153, and 12/215,607 and related applications, all of which are incorporated herein by reference in their entirety for all purposes. This new microparticle technology allows detection of 100's of targets in a single sample with ease, using the unique barcode contained in each particle, assignable to a specific target.
- Microparticles or nanoparticles are often referred to as structures whose characteristic dimensions are on the order of micrometers or less, such as those with volumes of 1 mm3 or less. Due to their unique properties arising from their small characteristic dimensions, microparticles have found useful applications in laboratory research and many industrial fields. Encoded microparticles possess spatial codes and therefore a means of identification and are an important subclass of the general field of microparticles. Because encoded particles carry information and can be physically tracked in space and time, they greatly extend the capabilities of non-encoded particles. A particularly important application for encoded microparticles is multiplexed bioassays, including those involving DNA, RNA and proteins. Other important fields for encoded microparticles include combinatorial chemistry, tagging, sugar biochemistry, and many other biochemical and non-biochemical applications as will be discussed hereinbelow. For many applications, one more desirable attributes include: a large number of identifiable codes (i.e. a high codespace), accurate and reliable identification of the encoded particles, material compatibility for a particular application, low cost manufacturing of the microparticles (on a per batch, per particle, and per code set basis), and flexibility in the detection systems.
- Another genetic analysis product, called QUANTIGENE® (Panomics, Fremont, Calif.), is able to specifically bind and detect dozens of target sequences in a single sample. See, for instance, U.S. patent application Ser. Nos. 11/433,081 (allowed), 11/431,092, 11/471,025 (allowed), all of which are incorporated herein by reference in their entirety for all purposes. General protocols and user's guides on how the QUANTIGENE® system works and explanation of kits and components may be found at the Panomics website (see, www.panomics.com/index.php?id=
product —1#product_lit—1). Specifically, user's manual, “QUANTIGENE® 2.0 Reagent System User Manual,” (2007) provided at the Panomics website is incorporated herein by reference in its entirety for all purposes (see, panomics.com/downloads/UM13074_QG2Manual_RevB—080102.pdf and other addendums and FFPE Method Proficiency Kit User Manual and addendums also available from the Panomics website, for instance as the User Manual for FFPE available here: panomics.com/downloads/UM13898_QGFFPEProfManual_RevC—071209.pdf, all of which are specifically incorporated herein by reference in their entirety for all purposes). - The QUANTIGENE® technology allows unparalleled signal amplification capabilities that provide an extremely sensitive assay. For instance, it is commonly claimed that the limit of detection in situ for mRNA species is about 20 copies of message per cell. However, in practice the limit of detection, due to the variability in the assay, is generally found to be around 50-60 copies of message per cell. This limit of detection limits the field of research since 80% of mRNAs are present at fewer than 5 copies per cell and 95% of mRNAs are present in cells at fewer than 50 copies per cell. As mentioned above, to arrive at this sensitivity, other approaches are very time consuming and complicated. Other technologies rely on the use of a panel of various enzymes and are affected by the fixation process of FFPE. In contrast, the QUANTIGENE® technology, such as QUANTIGENE® 2.0 and ViewRNA, is very simple, efficient and is capable of applying up to 400 labels per 50 base pairs of target. This breakthrough technology allows efficient and simple detection on the level of even a single mRNA copy per cell. Coupling this technology to detection of both mRNA and protein species will propel this field of research into heretofor inaccessible areas of study.
- Among other aspects, the present invention provides methods that overcome the above noted limitations and permit rapid, simple, and sensitive detection of multiple mRNAs (and/or other nucleic acids) simultaneously. A complete understanding of the invention will be obtained upon review of the following.
- Methods of detecting single nucleotide polymorphisms are disclosed. A sample comprising or suspected of comprising a target nucleic acid comprising at least one single nucleotide polymorphism is incubated with at least two label extender probes each comprising a different L-1 sequence, at least two capture extender probes each comprising a different C-1 sequence, and a label probe system with the sample comprising or suspected of comprising the target nucleic acid comprising the at least one single nucleotide polymorphism, wherein at least one L-1 sequence is complementary to the at least one allele of a single nucleotide polymorphism. Then, encoded microparticles are added which comprise at least two capture probes covalently bound to the microparticles, under conditions in which the encoded microparticles bind to the capture extender probes, wherein the capture probes are covalently bound to the microparticles, wherein the encoded microparticles comprise at least one spatial code. Finally, the assay allows detection of whether the encoded microparticles have bound thereto the label probe system. The at least one L-1 sequence may comprise one or more locked nucleic acids which may be constrained ethyl nucleic acid(s) (cEt).
- Targets useful in the present assay systems may be one or more of double-stranded DNA, miRNA, siRNA, mRNA, and single-stranded DNA. The disclosed methods may be performed in situ, in cellulo, in vitro, or in any number of different contexts due to the very flexible nature of the components. In fact, the sample may purified chromosomes, as typically analyzed in traditional karyotyping assays. Alternatively, the sample may be cells obtained from a cell culture or tissue culture medium.
- The assays, embodiments and systems disclosed may be easily altered for multiplex reactions, i.e. wherein multiple targets are detected in a single sample. The sample may comprise a target nucleic acid comprising at least two single nucleotide polymorphisms, or multiple target nucleic acids. Due to the inherent flexibility of the present assays, methods, embodiments, compositions and systems, it is shown that the label extenders may be designed to operate in any one of a number of different structural orientations, such as the cruciform orientation.
- Method embodiments are disclosed which are capable of detecting one or more single nucleotide polymorphisms with or without the use of substrates such as encoded microparticles. For instance, a sample comprising or suspected of comprising a target nucleic acid comprising at least one single nucleotide polymorphism may be incubated with at least two label extender probes each comprising a different L-1 sequence, and a label probe system with the sample comprising or suspected of comprising the target nucleic acid comprising the at least one single nucleotide polymorphism, wherein at least one L-1 sequence is complementary to the at least one single nucleotide polymorphism. Finally, the targets may be detected with the label probe system when the label probe system is associated with the sample.
- As above, these methods may be applied to various sample types, such as purified chromosomes, tissue culture cells, tissue slices in situ, in cellulo, and in vitro. These methods are also amendable to multiplex applications. The L-1 sequences may also be comprised of nucleotide analogs such as LNA or more specifically, cEt molecules and the like. Due to the inherent flexibility of the present assays, methods, embodiments, compositions and systems, it is shown that the label extenders may be designed to operate in any one of a number of different structural orientations, such as the cruciform orientation.
- These general embodiments may also include application to detection of micro-RNA species, such as mature and immature miRNA, siRNA and the like. The methods enable the ability to distinguishably detect various forms and species of miRNA on the pathway to maturity within a cell or tissue. Further siRNA may be detected as a control to determine whether siRNA molecules have penetrated desired cell types, tissue types and/or are hybridizing with the appropriate targets. Mutations in miRNA species may also be detected using these methods and various embodiments of the compositions and systems disclosed herein. Further, multiple different miRNA species or siRNA in a single may be detected simultaneously in a single multiplex assay.
- Samples may be obtained from any number of organisms, including bacteria, plants, animals, humans, mice, rats, guinea pigs, monkeys, dogs, cats, fish, anaerobic bacteria, aerobic bacteria, fungi, marine life, and the like. Basically any DNA, RNA or like polymer sequence may be subjected to the present embodiments.
- Various embodiments of assays, methods, compositions and kits for detecting chromosomal translocation events or fusion events are disclosed, wherein a sample comprising or suspected of comprising a translocation event or fusion event or deletion event is incubated with at least two label extender probes each comprising a different L-1 sequence, and a label probe system. At least one L-1 sequence would be designed to be complementary to at least part of the sequence resulting from the translocation event or fusion event. Detection may be based on whether the label probe system is associated with the sample or not. Again, as in the other described embodiments, the samples may be any number of different types including tissues, cells, chromosomes, etc. The genetic material comprising the sample may be obtained from any number of organisms as described above. Nucleic acid analogs may be utilized to improve specificity and affinity. Label extenders may be designed in any number of useful and suitable orientations, as described herein. Further, the L-1 sequences of the label extenders may be designed such that they are complementary to one half of the translocation or fusion sequence and a second L-1 sequence may be designed such that it is complementary to the second half of the translocation or fusion sequence. Thus, association of the label probe system would indicate the possibility and/or presence of a translocation or fusion event in the sample. Other variations of this embodiment include use of multiple distinguishable labels, sets of label extenders designed to hybridize to genes which have fused or are suspected of having taken part in a fusion/translocation/deletion event and a standard microarray designed to bind prepared labeled genetic samples and be scanned by a standard microarray scanner.
- Essentially all of the features noted for the embodiments above apply to these embodiments as well, as relevant; for example, with respect to composition of the label probe system; type of label; inclusion of blocking probes; configuration of the capture extenders, capture probes, label extenders, and/or blocking probes; number of nucleic acids of interest and of subsets of particles or selected positions on the solid support, capture extenders and label extenders; number of capture or label extenders per subset; type of particles; source of the sample and/or nucleic acids; and/or the like.
-
FIG. 1 schematically illustrates a typical standard bDNA assay. -
FIG. 2 Panels A-E schematically depict a multiplex nucleic acid detection assay, in which the nucleic acids of interest are captured on distinguishable subsets of microspheres and then detected. -
FIG. 3 Panels A-D schematically depict an embodiment of a multiplex nucleic acid detection assay, in which the nucleic acids of interest are captured at selected positions on a solid support and then detected. Panel A shows a top view of the solid support, while Panels B-D show the support in cross-section. -
FIG. 4 Panel A schematically depicts a double Z label extender configuration. Panel B schematically depicts a cruciform label extender configuration. -
FIG. 5A schematically illustrates an encoded microparticle of the invention. -
FIG. 5B is a side view cross-section of the microparticle inFIG. 5A . -
FIG. 6A schematic of amplification multimer complex and labeling system for a cruciform structure label extender design. Note that in this non-limiting depiction, as in others provided herein, only provides a single example of amplifier/pre-amplifier complex. In the assays, more or fewer amplifiers and label probes may be employed as needed. -
FIG. 6B schematic of amplification multimer complex and labeling system for a “double z” or ZZ structure label extender design. Note that in this non-limiting depiction, as in others provided herein, only provides a single example of amplifier/pre-amplifier complex. In the assays, more or fewer amplifiers and label probes may be employed as needed. -
FIG. 7A depiction of a locked nucleic acid analog known as the constrained ethyl (cEt) nucleic acid analog. Note that as depicted various protecting groups known in the art are presented but may be substituted by any number of suitable protecting groups. -
FIG. 7B depiction of a generic locked nucleic acid analog in the β-D, C3′-endo, conformation. The letter “B” stands for “base” which may be any one of A, G, C, mC, T or U. The methylene bridge connecting the 2′-0 atom with the 4′-C atom is the chemical structure which “locks” the analog into the energy-favorable β-D conformation. However, it is understood that this bridge may be any number of carbon atoms in length and may contain any number of variable groups or substitutions as has been reported in the literature Note that as depicted various protecting groups known in the art are presented but may be substituted by any number of suitable protecting groups. -
FIG. 8A depicts one embodiment of fusion gene or translocation event detection. It is understood that any number of label extender structure variations other than the double Z geometry may be equally suitable and may be utilized for this embodiment. -
FIG. 8B depicts one embodiment of fusion gene or translocation event detection. It is understood that any number of label extender structure variations other than the double Z geometry may be equally suitable and may be utilized for this embodiment. -
FIG. 9A depiction of single-stranded target SNP detection embodiments utilizing the cruciform (left panel) and the double Z (right panel) structures for the label extenders. -
FIG. 9B depiction of double-stranded (dsDNA) target SNP detection embodiments utilizing the cruciform (left panel) and the double Z (right panel) structures for the label extenders. -
FIG. 10A depicts various non-limiting conformations and geometries of label extender (LE) probes for detecting single stranded nucleic acid species. Other stereoisomers, conformers and various conformations are possible which achieve similar results but may not be depicted here. Note that for convenience the amplifiers and pre-amplifiers and label probes are not fully represented for all figures. The single line in light shading labeled as “label probe system” is meant to denote all possible configurations of label probe structures as depicted inFIGS. 6A , 6B, 12A and 12B. -
FIG. 10B depicts various non-limiting conformations and geometries of label extender (LE) probes for detecting double-stranded nucleic acid species (ability to distinguish between double-stranded DNA targets and ssDNA or RNA targets). Other stereoisomers, conformers and various conformations are possible which achieve similar results but may not be depicted here. Note that for convenience the amplifiers and pre-amplifiers and label probes are not fully represented for all figures. The single line in light shading labeled as “label probe system” is meant to denote all possible configurations of label probe structures as depicted inFIGS. 6A , 6B, 12A and 12B. -
FIG. 11 depiction of one embodiment of miRNA detection. -
FIG. 12 depicts directionality of various label extenders and the possibility that label extenders may be designed in either direction as indicated. -
FIG. 13 provides S/N ratio results for SNP detection of various single point mutations in miR-107 transfected into HeLa cells using cEt-doped L-1 sequences in a double-z label extender design. -
FIG. 14 provides S/N ratio results for SNP detection of various double point mutations in miR-107 transfected into HeLa cells using cEt-doped L-1 sequences in a double-z label extender design. -
FIG. 15A provides data from detection of miR-671 using the QUANTIGENE® 2.0 general protocols and the design scheme provided inFIG. 11 , showing samples of pure miR-671 and samples with added corn leaf tissue homogenate, with y-axis data being signal-background. -
FIG. 15B shows control experiments of pure miR-93 miRNA added to corn leaf tissue homogenate and quantitative detection of the miRNA using QUANTIGENE® 2.0 protocols. -
FIG. 15C shows control experiments of pure miR-107 miRNA added to corn leaf tissue homogenate and quantitative detection of the miRNA using QUANTIGENE® ViewRNA protocols. -
FIG. 15D provides data from detection of miR-107 using the QUANTIGENE® 2.0 general protocols and the design scheme provided inFIG. 11 , showing samples of pure miR-107 and samples with added corn leaf tissue homogenate, with y-axis data being signal-background. -
FIG. 16 depicts the ability of the assay to discriminate between Let-7a, Let-7b and Let-7c miRNA homologs. -
FIG. 17 depicts the stem-loop sequences for human miR-93 and miR-107. Pre-miRNA sequences are the immature stem-loop sequences. Mature miRNA sequences for each are highlighted in bold. -
FIG. 18 depicts the ability of the assay to discriminate between Pre-miRNA and Mature miRNA for miR-93, miR-107, and miR-155 using the QUANTIGENE® 2.0 general protocols. -
FIG. 19 provides S/B (signal/base line (negative control)) bar graphs depicting the activity and specificity of two LE configurations. Left panel shows data related to the performance of the Double Z (ZZ) LE configuration and the cruciform LE configuration in a single-plex assay. Right panel provides data related to the performance of the same LE's now in multiplex format with four targets each. -
FIG. 20 provides signal-base line (negative control) bar graphs depicting the activity and specificity of two LE configurations. Left panel shows data related to the performance of the Double Z (ZZ) LE configuration and the cruciform LE configuration in a single-plex assay. Right panel provides data related to the performance of the same LE's now in multiplex format with four targets each. Y-axis units are RLU (relative light units). - Schematic figures are not necessarily to scale.
- Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. The following definitions supplement those in the art and are directed to the current application and are not to be imputed to any related or unrelated case, e.g., to any commonly owned patent or application. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. Accordingly, the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
- As used in this specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a molecule” includes a plurality of such molecules, and the like.
- The term “about” as used herein indicates the value of a given quantity varies by +/−10% of the value, or optionally +/−5% of the value, or in some embodiments, by +/−1% of the value so described.
- The term “polynucleotide” (and the equivalent term “nucleic acid”) encompasses any physical string of monomer units that can be corresponded to a string of nucleotides, including a polymer of nucleotides (e.g., a typical DNA or RNA polymer), peptide nucleic acids (PNAs), modified oligonucleotides (e.g., oligonucleotides comprising nucleotides that are not typical to biological RNA or DNA, such as 2′-O-methylated oligonucleotides), and the like. The nucleotides of the polynucleotide can be deoxyribonucleotides, ribonucleotides or nucleotide analogs, can be natural or non-natural, and can be unsubstituted, unmodified, substituted or modified. The nucleotides can be linked by phosphodiester bonds, or by phosphorothioate linkages, methylphosphonate linkages, boranophosphate linkages, or the like. The polynucleotide can additionally comprise non-nucleotide elements such as labels, quenchers, blocking groups, or the like. The polynucleotide can be, e.g., single-stranded or double-stranded.
- The term “analog” in the context of nucleic acid analog is meant to denote any of a number of known nucleic acid analogs such as, but not limited to, LNA, PNA, etc. For instance, it has been reported that LNA, when incorporated into oligonucleotides, exhibit an increase in the duplex melting temperature of 2° C. to 8° C. per analog incorporated into a single strand of the duplex. The melting temperature effect of incorporated analogs may vary depending on the chemical structure of the analog, e.g. the structure of the atoms present in the bridge between the 2′-O atom and the 4′-C atom of the ribose ring of a nucleic acid. Various bicyclic nucleic acid analogs have been prepared and reported. (See, for example, Singh et al., Chem. Commun., 1998, 4:455-456; Koshkin et al., Tetrahedron, 1998, 54:3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97:5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8:2219-2222; Wengel et al., PCT International Application Number PCT/DK98/00303 which published as WO 99/14226 on Mar. 25, 1999; Singh et al., J. Org. Chem., 1998, 63:10035-10039, the text of each is incorporated by reference herein, in their entirety). Examples of issued US patents and Published U.S. patent applications disclosing various bicyclic nucleic acids include, for example, U.S. Pat. Nos. 6,770,748, 6,268,490 and 6,794,499 and U.S. Patent Application Publication Nos. 20040219565, 20040014959, 20030207841, 20040192918, 20030224377, 20040143114, 20030087230 and 20030082807, the text of each of which is incorporated by reference herein, in their entirety.
- Various 5′-modified nucleosides have also been reported. (See, for example: Mikhailov et al., Nucleosides and Nucleotides, 1991, 10:393-343; Saha et al., J. Org. Chem., 1995, 60:788-789; Beigleman et al., Nucleosides and Nucleotides, 1995, 14:901-905; Wang, et al., Bioorganic & Medicinal Chemistry Letters, 1999, 9:885-890; and PCT Internation Application Number WO94/22890 which was published Oct. 13, 1994, the text of each of which is incorporated by reference herein, in their entirety).
- Oligonucleotides in solution as single stranded species rotate and move in space in various energy-minimized conformations. Upon binding and ultimately hybridizing to a complementary sequence, an oligonucleotide is known to undergo a conformational transition from the relatively random coil structure of the single stranded state to the ordered structure of the duplex state. With these physical-chemical dynamics in mind, a number of conformationally-restricted oligonucleotides analogs, including bicyclic and tricyclic nucleoside analogues, have been synthesized, incorporated into oligonucleotides and tested for their ability to hybridize. It has been found that various nucleic acid analogs, such as the common “Locked Nucleic Acid” or LNA, exhibit a very low energy-minimized state upon hybridizing to the complementary oligonucleotide, even when the complementary oligonucleotide is wholly comprised of the native or natural nucleic acids A, T, C, U and G.
- Other examples of issued US patents and published applications include, but are not limited to: U.S. Pat. Nos. 7,053,207, 6,770,748, 6,268,490 and 6,794,499 and published U.S. applications 20040219565, 20040014959, 20030207841, 20040192918, 20030224377, 20040143114 and 20030082807; the text of each is incorporated by reference herein, in their entirety.
- Additionally, bicyclo[3.3.0] nucleosides (bcDNA) with an additional C-3′,C-5′-ethano-bridge have been reported for all five of the native or natural nucleobases (G, A, T, C and U) whereas (C) has been synthesised only with T and A nucleobases. (See, Tarkoy et al., Helv. Chim. Acta, 1993, 76:481; Tarkoy and C. Leumann, Angew. Chem. Int. Ed. Engl., 1993, 32:1432; Egli et al., J. Am. Chem. Soc., 1993, 115:5855; Tarkoy et al., Helv. Chim. Acta, 1994, 77:716; M. Bolli and C. Leumann, Angew. Chem., Int. Ed. Engl., 1995, 34:694; Bolli et al., Helv. Chim. Acta, 1995, 78:2077; Litten et al., Bioorg. Med. Chem. Lett., 1995, 5:1231; J. C. Litten and C. Leumann, Helv. Chim. Acta, 1996, 79:1129; Bolli et al., Chem. Biol., 1996, 3:197; Bolli et al., Nucleic Acids Res., 1996, 24:4660). Oligonucleotides containing these analogues have been found to form Watson-Crick bonded duplexes with complementary DNA and RNA oligonucleotides. The thermostability of the resulting duplexes, however, is varied and not always improved over comparable native hybridized oligonucleotide sequences. All bcDNA oligomers exhibited an increase in sensitivity to the ionic strength of the hybridization media compared to natural counterparts.
- A bicyclo[3.3.0] nucleoside dimer containing an additional C-2′,C-3′-dioxalane ring has been reported in the literature having an unmodified nucleoside where the additional ring is part of the internucleoside linkage replacing a natural phosphodiester linkage. As either thymine-thymine or thymine-5-methylcytosine blocks, a 15-mer polypyrimidine sequence containing seven dimeric blocks and having alternating phosphodiester- and riboacetal-linkages exhibited a substantially decreased Tm in hybridization with complementary ssRNA as compared to a control sequence with exclusively natural phosphordiester internucleoside linkages. (See, Jones et al., J. Am. Chem. Soc., 1993, 115:9816).
- Other U.S. patents have disclosed various modifications of these analogs that exhibit the desired properties of being stably integrated into oligonucleotide sequences and increasing the melting temperature at which hybridization occurs, thus producing a very stable, energy-minimized duplex with oligonucleotides comprising even native nucleic acids. (See, for instance, U.S. Pat. Nos. 7,572,582, 7,399,845, 7,034,133, 6,794,499 and 6,670,461, all of which are incorporated herein by reference in their entirety for all purposes).
- For instance, U.S. Pat. No. 7,399,845 provides 6-modified bicyclic nucleosides, oligomeric compounds and compositions prepared therefrom, including novel synthetic intermediates, and methods of preparing the nucleosides, oligomeric compounds, compositions, and novel synthetic intermediates. The '845 patent discloses nucleosides having a bridge between the 4′ and 2′-positions of the ribose portion having the formula: 2′-O—C(H)(Z)-4′ and oligomers and compositions prepared therefrom. In a preferred embodiment, Z is in a particular configuration providing either the (R) or (S) isomer, e.g. 2′-O,4′-methanoribonucleoside. It was shown that this nucleic acid analog exists as the strictly constrained N-
conformer 2′-exo-3′-endo conformation. Oligonucleotides of 12 nucleic acids in length have been shown, when comprised completely or partially of the Imanishi et al. analogs, to have substantially increased melting temperatures, showing that the corresponding duplexes with complementary native oligonucleotides are very stable. (See, Imanishi et al., “Synthesis and property of novel conformationally constrained nucleoside and oligonucleotide analogs,” The Sixteenth International Congress of Heterocyclic Chemistry, Aug. 10-15, 1997, incorporated herein by reference in its entirety for all purposes). - A “polynucleotide sequence” or “nucleotide sequence” is a polymer of nucleotides (an oligonucleotide, a DNA, a nucleic acid, etc.) or a character string representing a nucleotide polymer, depending on context. From any specified polynucleotide sequence, either the given nucleic acid or the complementary polynucleotide sequence (e.g., the complementary nucleic acid) can be determined.
- Two polynucleotides “hybridize” when they associate to form a stable duplex, e.g., under relevant assay conditions. Nucleic acids hybridize due to a variety of well characterized physico-chemical forces, such as hydrogen bonding, solvent exclusion, base stacking and the like. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes,
part I chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assays” (Elsevier, New York), as well as in Ausubel, infra. - The “Tm” (melting temperature) of a nucleic acid duplex under specified conditions (e.g., relevant assay conditions) is the temperature at which half of the base pairs in a population of the duplex are disassociated and half are associated. The Tm for a particular duplex can be calculated and/or measured, e.g., by obtaining a thermal denaturation curve for the duplex (where the Tm is the temperature corresponding to the midpoint in the observed transition from double-stranded to single-stranded form).
- The term “complementary” refers to a polynucleotide that forms a stable duplex with its “complement,” e.g., under relevant assay conditions. Typically, two polynucleotide sequences that are complementary to each other have mismatches at less than about 20% of the bases, at less than about 10% of the bases, preferably at less than about 5% of the bases, and more preferably have no mismatches.
- A “capture extender” or “CE” is a polynucleotide that is capable of hybridizing to a nucleic acid of interest and to a capture probe. The capture extender typically has a first polynucleotide sequence C-1, which is complementary to the capture probe, and a second polynucleotide sequence C-3, which is complementary to a polynucleotide sequence of the nucleic acid of interest. Sequences C-1 and C-3 are typically not complementary to each other. The capture extender is preferably single-stranded.
- A “capture probe” or “CP” is a polynucleotide that is capable of hybridizing to at least one capture extender and that is tightly bound (e.g., covalently or noncovalently, directly or through a linker, e.g., streptavidin-biotin or the like) to a solid support, a spatially addressable solid support, a slide, a particle, a microsphere, or the like. The capture probe typically comprises at least one polynucleotide sequence C-2 that is complementary to polynucleotide sequence C-1 of at least one capture extender. The capture probe is preferably single-stranded.
- A “label extender” or “LE” is a polynucleotide that is capable of hybridizing to a nucleic acid of interest and to a label probe system. The label extender typically has a first polynucleotide sequence L-1, which is complementary to a polynucleotide sequence of the nucleic acid of interest, and a second polynucleotide sequence L-2, which is complementary to a polynucleotide sequence of the label probe system (e.g., L-2 can be complementary to a polynucleotide sequence of an amplification multimer, a preamplifier, a label probe, or the like). The label extender is preferably single-stranded. Label extenders designed in both directions are contemplated, i.e. a label extender in the 3′ to 5′ direction could just as easily be designed to bind in the reverse direction as depicted in the Figures. For instance, see
FIGS. 12A and 12B for exemplary depictions of the various configurations which may be designed to be suitable for use in the presently disclosed invention. - A “label” is a moiety that facilitates detection of a molecule. Common labels in the context of the present invention include fluorescent, luminescent, light-scattering, and/or colorimetric labels. Suitable labels include enzymes and fluorescent moieties, as well as radionuclides, substrates, cofactors, inhibitors, chemiluminescent moieties, magnetic particles, and the like. Patents teaching the use of such labels include U.S. Pat. Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241. Many labels are commercially available and can be used in the context of the invention.
- A “label probe system” comprises one or more polynucleotides that collectively comprise a label and at least two polynucleotide sequences M-1, each of which is capable of hybridizing to a label extender. The label provides a signal, directly or indirectly. Polynucleotide sequence M-1 is typically complementary to sequence L-2 in the label extenders. The at least two polynucleotide sequences M-1 are optionally identical sequences or different sequences. The label probe system can include a plurality of label probes (e.g., a plurality of identical label probes) and an amplification multimer; it optionally also includes a preamplifier or the like, or optionally includes only label probes, for example.
- An “amplification multimer” is a polynucleotide comprising a plurality of polynucleotide sequences M-2, typically (but not necessarily) identical polynucleotide sequences M-2. Polynucleotide sequence M-2 is complementary to a polynucleotide sequence in the label probe. The amplification multimer also includes at least one polynucleotide sequence that is capable of hybridizing to a label extender or to a nucleic acid that hybridizes to the label extender, e.g., a preamplifier. For example, the amplification multimer optionally includes at least one (and preferably at least two) polynucleotide sequence(s) M-1, optionally identical sequences M-1; polynucleotide sequence M-1 is typically complementary to polynucleotide sequence L-2 of the label extenders. Similarly, the amplification multimer optionally includes at least one polynucleotide sequence that is complementary to a polynucleotide sequence in a preamplifier. The amplification multimer can be, e.g., a linear or a branched nucleic acid. That is, the amplification multimer may be entirely comprised of a single contiguous chain of nucleic acids, or alternative a first chain possessing the sequence M-1 and additionally possessing one more sequences A-1 that are complementary to sequences A-2 on separate oligonucleotides which comprise one or more repeats of the sequence M-2. Thus, the amplification multimer may in fact be an assembly of multiple oligonucleotides comprising or consisting of a pre-amplifier possessing the M-2 sequence and one or more A-1 sequences; and one or more amplifier oligonucleotides possessing the sequence A-2 and one or more sequences M-2. Upon hybridization the structure may yield a tree-like geometrical shape comprising a single pre-amplifier, multiple amplifiers and attached to the amplifiers, multiple label probes which hybridize to site(s) M-2. As noted for all polynucleotides, the amplification multimer can include modified nucleotides and/or nonstandard internucleotide linkages as well as standard deoxyribonucleotides, ribonucleotides, and/or phosphodiester bonds. Suitable amplification multimers are described, for example, in U.S. Pat. No. 5,635,352, U.S. Pat. No. 5,124,246, U.S. Pat. No. 5,710,264, and U.S. Pat. No. 5,849,481.
- A “label probe” or “LP” is a single-stranded polynucleotide that comprises a label (or optionally that is configured to bind to a label) that directly or indirectly provides a detectable signal. The label probe typically comprises a polynucleotide sequence that is complementary to the repeating polynucleotide sequence M-2 of the amplification multimer; however, if no amplification multimer is used in the bDNA assay, the label probe can, e.g., hybridize directly to a label extender.
- A “preamplifier” is a nucleic acid that serves as an intermediate between one or more label extenders and amplifiers. Typically, the preamplifier is capable of hybridizing simultaneously to at least two label extenders and to a plurality of amplifiers.
- A “microsphere” is a small spherical, or roughly spherical, particle. A microsphere typically has a diameter less than about 1000 micrometers (e.g., less than about 100 micrometers, optionally less than about 10 micrometers).
- “Microparticles” include particles having a code, including sets of encoded microparticles. (See, for instance, U.S. patent application Ser. No. 11/521,057, allowed, which is incorporated herein by reference in its entirety for all purposes). Such encoded microparticles may have a longest dimension of 50 microns, an outer surface substantially of glass and a spatial code that can be read with optical magnification. A microparticle may be cuboid in shape and elongated along the Y direction in the Cartesian coordinate. The cross-sections perpendicular to the length of the microparticle may have substantially the same topological shape—such as square shape. Microparticles may have a set of segments and gaps intervening the segments in parallel along the axis of the longest dimension if the microparticle is rectangular. Specifically, segments with different lengths (the dimension along the length of the microparticle, e.g. along the Y direction) may represent different coding elements; whereas gaps preferably have the same length for differentiating the segments during detection of the microparticles. The segments of the microparticle may be fully enclosed within the microparticle, i.e. completely encapsulated by a surrounding outer layer which may be silicon/glass. As an alternative feature, the segments can be arranged such that the geometric centers of the segments are aligned to the geometric central axis of the elongated microparticle. A particular sequence of segments and gaps thereby represent a code within each micoparticle. The codes may be derived from a pre-determined coding scheme thereby allowing identification of the microparticle. The microparticles may additionally have various structural aberrations, such as tags or tabs, on one or more ends, thus allowing for a two-fold or more increase in code space. The microparticles may also be present as a “bi-particle” wherein the microparticle actually comprises two or more particles stuck together, i.e. missing the last etching step so as to allow two particles to remain attached together with an intervening material between them comprised of material consistent with the coating present on the rest of the microparticle. (See, for instance, U.S. patent application Ser. No. 12/779,413, filed May 13, 2010, incorporated herein by reference in its entirety for all purposes).
- A “microorganism” is an organism of microscopic or submicroscopic size. Examples include, but are not limited to, bacteria, fungi, yeast, protozoans, microscopic algae (e.g., unicellular algae), viruses (which are typically included in this category although they are incapable of growth and reproduction outside of host cells), subviral agents, viroids, and mycoplasma.
- A first polynucleotide sequence that is located “5′ of” a second polynucleotide sequence on a nucleic acid strand is positioned closer to the 5′ terminus of the strand than is the second polynucleotide sequence. Similarly, a first polynucleotide sequence that is located “3′ of” a second polynucleotide sequence on a nucleic acid strand is positioned closer to the 3′ terminus of the strand than is the second polynucleotide sequence.
- A variety of additional terms are defined or otherwise characterized herein.
- The present invention provides methods, compositions, and kits for capture and detection of various types of nucleic acids, particularly multiplex capture and detection. As will be shown in more detail below, the disclosed methodologies and compositions are highly adaptable to many applications. A non-limiting list of various embodiments is as follows:
-
- In one embodiment, nucleic acids of interest are captured to a solid support or microparticle and then detected, preferably in a branched-chain DNA assay. The microparticle may be an encoded microparticle, whose encoded identity may be detected using various imaging devices and the presence of bound target nucleic acid detected using other imaging devices, such as fluorescence microscopy and other such devices depending on the type of label used, i.e. quantum-dot, dye, radiolabel, etc.
- Alternatively, nucleic acids may be fixed in situ, in cellulo, or present in solution inside a cell and/or placed on a slide as whole, isolated chromosomes and detected using the disclosed signal amplification techniques or branched-chain DNA assays.
- In other embodiments nucleic acid analogs, such as constrained ethyl or locked nucleic acids, are used in the LE's, such as in sequence L-1, to provide increased specificity.
- In another embodiment, both DNA and RNA species may be detected simultaneously in a single sample.
- Further, micro-RNA species may be detected using the presently disclosed methodologies. Mature and pre-miRNA species may be distinguished using the present methodologies. Furthermore, mutations in miRNA species may be detected.
- SiRNA species inside animals, tissues, and/or cells may also be detected utilizing the presently disclosed techniques.
- Chromosomal fusion, deletion and translocation events can also be detected using the presently disclosed methods and compositions.
- Many variations may be employed for providing specificity and sensitivity to the assay, including various different label extender architectures and geometries as explained in further detail below.
- A general class of embodiments includes methods of capturing two or more nucleic acids of interest and identification thereof. In the methods, a sample, a pooled population of particles (or microparticles, or encoded microparticles), and two or more subsets of n target capture probes, wherein n is at least two, are provided. The sample comprises or is suspected of comprising the nucleic acids of interest. The pooled population of particles includes two or more subsets of particles. The particles in each subset have associated therewith a different capture probes. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n target capture probes with a selected subset of the particles. Preferably, a plurality of the particles in each subset is distinguishable from a plurality of the particles in every other subset. (Typically, substantially all of the particles in each subset are distinguishable from substantially all of the particles in every other subset.) Each nucleic acid of interest can thus, by hybridizing to its corresponding subset of n capture extenders which are in turn hybridized to a corresponding capture probes, be associated with an identifiable subset of the particles. Alternatively, the particles in the various subsets need not be distinguishable from each other (for example, in embodiments in which any nucleic acid of interest present is to be isolated, amplified, and/or detected, without regard to its identity, following its capture on the particles.)
- In one embodiment of the following methodologies and compositions, a particular nucleic acid of interest, or target oligonucleotide, may be captured to a surface through cooperative hybridization of multiple target capture probes to the nucleic acid. Each of the capture extenders (CE) has a first polynucleotide sequence that can hybridize to the target nucleic acid and a second polynucleotide sequence that can hybridize to a complementary sequence on a capture probe that is bound to a surface. The temperature and the stability of the complex between a single CE and its CP can be controlled such that binding of a single CE to a target nucleic acid and to the CP is not sufficient to stably capture the nucleic acid on the surface to which the CP is bound, whereas simultaneous binding of two or more CEs to a target nucleic acid can capture it on the surface vie the two or more CPs. Assays requiring such cooperative hybridization of multiple target capture probes for capture of each nucleic acid of interest results in high specificity and low background from cross-hybridization of the target capture probes with other, non-target nucleic acids. Such low background and minimal cross-hybridization are typically substantially more difficult to achieve in multiplex than a single-plex capture of nucleic acids, because the number of potential nonspecific interactions are greatly increased in a multiplex experiment due to the increased number of probes used (e.g., the greater number of target capture probes). Requiring multiple simultaneous CE-CP interactions for the capture of a target nucleic acid minimizes the chance that nonspecific capture will occur, even when some nonspecific target-CE and/or CE-CP interactions occur.
- Branched-chain DNA (bDNA) signal amplification technology has been used, e.g., to detect and quantify mRNA transcripts in cell lines and to determine viral loads in blood. (See, for instance, Player et al. (2001) “Single-copy gene detection using branched DNA (bDNA) in situ hybridization,” J. Histochem. Cytochem., 49:603-611, Van Cleve et al., Mol. Cell. Probes, (1998) 12:243-247, and U.S. Pat. No. 7,033,758, each of which is incorporated herein by reference in their entirety for all purposes). The bDNA assay is a sandwich nucleic acid hybridization procedure that enables direct measurement of mRNA expression, e.g., from crude cell lysate. It provides direct quantification of nucleic acid molecules at physiological levels. Several advantages of the technology distinguish it from other DNA/RNA amplification technologies, including linear amplification, good sensitivity and dynamic range, great precision/specificity and accuracy, simple sample preparation procedure, and reduced sample-to-sample variation.
- In brief, in a typical bDNA assay for gene expression analysis (
FIG. 1 ), a target mRNA whose expression is to be detected is released from cells and captured by a Capture Probe (CP) on a solid surface (e.g., a well of a microtiter plate) through synthetic oligonucleotide probes called Capture Extenders (CEs). Each capture extender has a first polynucleotide sequence that can hybridize to the target mRNA and a second polynucleotide sequence that can hybridize to the capture probe. Typically, two or more capture extenders are used. Probes of another type, called Label Extenders (LEs), hybridize to different sequences on the target mRNA and to sequences on an amplification multimer. Additionally, Blocking Probes (BPs), which hybridize to regions of the target mRNA not occupied by CEs or LEs, are often used to reduce non-specific target probe binding. A probe set for a given mRNA thus consists of CEs, LEs, and optionally BPs for the target mRNA. The CEs, LEs, and BPs are complementary to nonoverlapping sequences in the target mRNA, and are typically, but not necessarily, contiguous. - Signal amplification begins with the binding of the LEs to the target mRNA. An amplification multimer is then typically hybridized to the LEs. The amplification multimer has multiple copies of a sequence that is complementary to a label probe (it is worth noting that the amplification multimer is typically, but not necessarily, a branched-chain nucleic acid; for example, the amplification multimer can be a branched, forked, or comb-like nucleic acid or a linear nucleic acid). A label, for example, alkaline phosphatase, is covalently attached to each label probe. (Alternatively, the label can be noncovalently bound to the label probes.) In the final step, labeled complexes are detected, e.g., by the alkaline phosphatase-mediated degradation of a chemilumigenic substrate, e.g., dioxetane. Luminescence is reported as relative light unit (RLUs) on a microplate reader. The amount of chemiluminescence is proportional to the level of mRNA expressed from the target gene.
- In the preceding example, the amplification multimer and the label probes comprise a label probe system. In another example, the label probe system also comprises a preamplifier, e.g., as described in U.S. Pat. No. 5,635,352 and U.S. Pat. No. 5,681,697, which further amplifies the signal from a single target mRNA. In yet another example, the label extenders hybridize directly to the label probes and no amplification multimer or preamplifier is used, so the signal from a single target mRNA molecule is only amplified by the number of distinct label extenders that hybridize to that mRNA.
- Basic bDNA assays have been well described. See, e.g., U.S. Pat. No. 4,868,105 to Urdea et al. entitled “Solution phase nucleic acid sandwich assay”; U.S. Pat. No. 5,635,352 to Urdea et al. entitled “Solution phase nucleic acid sandwich assays having reduced background noise”; U.S. Pat. No. 5,681,697 to Urdea et al. entitled “Solution phase nucleic acid sandwich assays having reduced background noise and kits therefor”; U.S. Pat. No. 5,124,246 to Urdea et al. entitled “Nucleic acid multimers and amplified nucleic acid hybridization assays using same”; U.S. Pat. No. 5,624,802 to Urdea et al. entitled “Nucleic acid multimers and amplified nucleic acid hybridization assays using same”; U.S. Pat. No. 5,849,481 to Urdea et al. entitled “Nucleic acid hybridization assays employing large comb-type branched polynucleotides”; U.S. Pat. No. 5,710,264 to Urdea et al. entitled “Large comb type branched polynucleotides”; U.S. Pat. No. 5,594,118 to Urdea and Horn entitled “Modified N-4 nucleotides for use in amplified nucleic acid hybridization assays”; U.S. Pat. No. 5,093,232 to Urdea and Horn entitled “Nucleic acid probes”; U.S. Pat. No. 4,910,300 to Urdea and Horn entitled “Method for making nucleic acid probes”; U.S. Pat. No. 5,359,100; U.S. Pat. No. 5,571,670; U.S. Pat. No. 5,614,362; U.S. Pat. No. 6,235,465; U.S. Pat. No. 5,712,383; U.S. Pat. No. 5,747,244; U.S. Pat. No. 6,232,462; U.S. Pat. No. 5,681,702; U.S. Pat. No. 5,780,610; U.S. Pat. No. 5,780,227 to Sheridan et al. entitled “Oligonucleotide probe conjugated to a purified hydrophilic alkaline phosphatase and uses thereof”; U.S. patent application Publication No. US2002172950 by Kenny et al. entitled “Highly sensitive gene detection and localization using in situ branched-DNA hybridization”; Wang et al. (1997) “Regulation of insulin preRNA splicing by glucose” Proc Nat Acad Sci USA 94:4360-4365; Collins et al. (1998) “Branched DNA (bDNA) technology for direct quantification of nucleic acids: Design and performance” in Gene Quantification, F Ferre, ed.; and Wilber and Urdea (1998) “Quantification of HCV RNA in clinical specimens by branched DNA (bDNA) technology” Methods in Molecular Medicine: Hepatitis C 19:71-78. In addition, kits for performing basic bDNA assays (QUANTIGENE™ kits, comprising instructions and reagents such as amplification multimers, alkaline phosphatase labeled label probes, chemilumigenic substrate, capture probes immobilized on a solid support, and the like) are commercially available, e.g., from Panomics, Inc. (on the world wide web at (www.panomics.com). General protocols and user's guides on how the QUANTIGENE® system works and explanation of kits and components may be found at the Panomics website (see, www.panomics.com/index.php?id=
product —1#product_lit—1). Specifically, user's manual, “QUANTIGENE® 2.0 Reagent System User Manual,” (2007, 32 pages) provided at the Panomics website is incorporated herein by reference in its entirety for all purposes. Software for designing probe sets for a given mRNA target (i.e., for designing the regions of the CEs, LEs, and optionally BPs that are complementary to the target) is also commercially available (e.g., ProbeDesigner™ from Panomics, Inc.; see also Bushnell et al. (1999) “ProbeDesigner: for the design of probe sets for branched DNA (bDNA) signal amplification assays Bioinformatics 15:348-55). - The basic bDNA assay, however, permits detection of only a single target nucleic acid per assay, while, as described above, detection of multiple nucleic acids is frequently desirable.
- Among other aspects, the present invention provides multiplex bDNA assays that can be used for simultaneous detection of two or more target nucleic acids. Similarly, one aspect of the present invention provides bDNA assays, singleplex or multiplex, that have reduced background from nonspecific hybridization events.
- Among other aspects, the present invention provides a multiplex bDNA assay that can be used for simultaneous detection of two or more target nucleic acids. The assay temperature and the stability of the complex between a single CE and its corresponding CP can be controlled such that binding of a single CE to a nucleic acid and to the CP is not sufficient to stably capture the nucleic acid on the surface to which the CP is bound, whereas simultaneous binding of two or more CEs to a nucleic acid can capture it on the surface. Requiring such cooperative hybridization of multiple CEs for capture of each nucleic acid of interest results in high specificity and low background from cross-hybridization of the CEs with other, non-target nucleic acids. For an assay to achieve high specificity and sensitivity, it preferably has a low background, resulting, e.g., from minimal cross-hybridization. Such low background and minimal cross-hybridization are typically substantially more difficult to achieve in a multiplex assay than a single-plex assay, because the number of potential nonspecific interactions are greatly increased in a multiplex assay due to the increased number of probes used in the assay (e.g., the greater number of CEs and LEs). Requiring multiple simultaneous CE-CP interactions for the capture of a target nucleic acid minimizes the chance that nonspecific capture will occur, even when some nonspecific CE-CP interactions do occur.
- In general, in the assays of the invention, two or more label extenders are used to capture a single component of the label probe system (e.g., a preamplifier or amplification multimer). The assay temperature and the stability of the complex between a single LE and the component of the label probe system (e.g., the preamplifier or amplification multimer) can be controlled such that binding of a single LE to the component is not sufficient to stably associate the component with a nucleic acid to which the LE is bound, whereas simultaneous binding of two or more LEs to the component can capture it to the nucleic acid. Requiring such cooperative hybridization of multiple LEs for association of the label probe system with the nucleic acid(s) of interest results in high specificity and low background from cross-hybridization of the LEs with other, non-target nucleic acids.
- For an assay to achieve high specificity and sensitivity, it preferably has a low background, resulting, e.g., from minimal cross-hybridization. Such low background and minimal cross-hybridization are typically substantially more difficult to achieve in a multiplex assay than a single-plex assay, because the number of potential nonspecific interactions are greatly increased in a multiplex assay due to the increased number of probes used in the assay (e.g., the greater number of CEs and LEs). Requiring multiple simultaneous LE-label probe system component interactions for the capture of the label probe system to a target nucleic acid minimizes the chance that nonspecific capture will occur, even when some nonspecific CE-LE or LE-CP interactions, for example, do occur. This reduction in background through minimization of undesirable cross-hybridization events thus facilitates multiplex detection of the nucleic acids of interest.
- The methods of the invention can be used, for example, for multiplex detection of two or more nucleic acids simultaneously, from even complex samples, without requiring prior purification of the nucleic acids, when the nucleic acids are present at low concentration, and/or in the presence of other, highly similar nucleic acids. In one aspect, the methods involve capture of the nucleic acids to particles (e.g., distinguishable subsets of microspheres), while in another aspect, the nucleic acids are captured to a spatially addressable solid support. Compositions, kits, and systems related to the methods are also provided.
- As noted, one aspect of the invention provides multiplex nucleic acid assays. Thus, one general class of embodiments includes methods of detecting two or more nucleic acids of interest. In one embodiment of the method, a sample comprising or suspected of comprising the nucleic acids of interest, two or more subsets of m label extenders, wherein m is at least two, and a label probe system are provided. Each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest. The label probe system comprises a label, and a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in a subset.
- Those nucleic acids of interest present in the sample are captured on a solid support. Each nucleic acid of interest captured on the solid support is hybridized to its corresponding subset of m label extenders, and the label probe system is hybridized to the m label extenders. The presence or absence of the label on the solid support is then detected. Since the label is associated with the nucleic acid(s) of interest via hybridization of the label extenders and label probe system, the presence or absence of the label on the solid support is correlated with the presence or absence of the nucleic acid(s) of interest on the solid support and thus in the original sample.
- In another embodiment, a sample, a pooled population of particles, and two or more subsets of n capture extenders, wherein n is at least two, are provided. The sample comprises or is suspected of comprising the nucleic acids of interest. The pooled population of particles includes two or more subsets of particles, and a plurality of the particles in each subset are distinguishable from a plurality of the particles in every other subset. (Typically, substantially all of the particles in each subset are distinguishable from substantially all of the particles in every other subset.) The particles in each subset have associated therewith a different capture probe. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles. Each nucleic acid of interest can thus, by hybridizing to its corresponding subset of n capture extenders which are in turn hybridized to a corresponding capture probe, be associated with an identifiable subset of the particles.
- Essentially any suitable solid support can be employed in the methods. For example, the solid support can comprise particles such as microspheres or microparticles, or it can comprise a substantially planar and/or spatially addressable support. Different nucleic acids are optionally captured on different distinguishable subsets of particles or at different positions on a spatially addressable solid support. The nucleic acids of interest can be captured to the solid support by any of a variety of techniques, for example, by binding directly to the solid support or by binding to a moiety bound to the support, or through hybridization to another nucleic acid bound to the solid support. Preferably, the nucleic acids are captured to the solid support through hybridization with capture extenders and capture probes.
- In one class of embodiments, a pooled population of particles which constitute the solid support is provided. The population comprises two or more subsets of particles, and a plurality of the particles in each subset is distinguishable from a plurality of the particles in every other subset. (Typically, substantially all of the particles in each subset are distinguishable from substantially all of the particles in every other subset.) The particles in each subset have associated therewith a different capture probe.
- Two or more subsets of n capture extenders, wherein n is at least two, are also provided. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes, thereby associating each subset of n capture extenders with a selected subset of the particles. Each of the nucleic acids of interest present in the sample is hybridized to its corresponding subset of n capture extenders and the subset of n capture extenders is hybridized to its corresponding capture probe, thereby capturing the nucleic acid on the subset of particles with which the capture extenders are associated.
- Typically, in this class of embodiments, at least a portion of the particles from each subset are identified and the presence or absence of the label on those particles is detected. Since a correlation exists between a particular subset of particles and a particular nucleic acid of interest, which subsets of particles have the label present indicates which of the nucleic acids of interest were present in the sample.
- Essentially any suitable particles, e.g., particles having distinguishable characteristics and to which capture probes can be attached, can be used. For example, in one preferred class of embodiments, the particles are microspheres. The microspheres of each subset can be distinguishable from those of the other subsets, e.g., on the basis of their fluorescent emission spectrum, their diameter, or a combination thereof. For example, the microspheres of each subset can be labeled with a unique fluorescent dye or mixture of such dyes, quantum dots with distinguishable emission spectra, and/or the like. As another example, the particles of each subset can be identified by an optical barcode, unique to that subset, present on the particles.
- The particles optionally have additional desirable characteristics. For example, the particles can be magnetic or paramagnetic, which provides a convenient means for separating the particles from solution, e.g., to simplify separation of the particles from any materials not bound to the particles.
- In other embodiments, the nucleic acids are captured at different positions on a non-particulate, spatially addressable solid support. Thus, in one class of embodiments, the solid support comprises two or more capture probes, wherein each capture probe is provided at a selected position on the solid support. Two or more subsets of n capture extenders, wherein n is at least two, are provided. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes, thereby associating each subset of n capture extenders with a selected position on the solid support. Each of the nucleic acids of interest present in the sample is hybridized to its corresponding subset of n capture extenders and the subset of n capture extenders is hybridized to its corresponding capture probe, thereby capturing the nucleic acid on the solid support at the selected position with which the capture extenders are associated.
- Typically, in this class of embodiments, the presence or absence of the label at the selected positions on the solid support is detected. Since a correlation exists between a particular position on the support and a particular nucleic acid of interest, which positions have a label present indicates which of the nucleic acids of interest were present in the sample.
- The solid support typically has a planar surface and is typically rigid, but essentially any spatially addressable solid support can be adapted to the practice of the present invention. Exemplary materials for the solid support include, but are not limited to, glass, silicon, silica, quartz, plastic, polystyrene, nylon, and nitrocellulose. As just one example, an array of capture probes can be formed at selected positions on a glass slide as the solid support.
- In any of the embodiments described herein in which capture extenders are utilized to capture the nucleic acids to the solid support, n, the number of capture extenders in a subset, is at least one, preferably at least two, and more preferably at least three. n can be at least four or at least five or more. Typically, but not necessarily, n is at most ten. For example, n can be between three and ten, e.g., between five and ten or between five and seven, inclusive. Use of fewer capture extenders can be advantageous, for example, in embodiments in which nucleic acids of interest are to be specifically detected from samples including other nucleic acids with sequences very similar to that of the nucleic acids of interest. In other embodiments (e.g., embodiments in which capture of as much of the nucleic acid as possible is desired), however, n can be more than 10, e.g., between 20 and 50. n can be the same for all of the subsets of capture extenders, but it need not be; for example, one subset can include three capture extenders while another subset includes five capture extenders. The n capture extenders in a subset preferably hybridize to nonoverlapping polynucleotide sequences in the corresponding nucleic acid of interest. The nonoverlapping polynucleotide sequences can, but need not be, consecutive within the nucleic acid of interest.
- Each capture extender is capable of hybridizing to its corresponding capture probe. The capture extender typically includes a polynucleotide sequence C-1 that is complementary to a polynucleotide sequence C-2 in its corresponding capture probe. Capture of the nucleic acids of interest via hybridization to the capture extenders and capture probes optionally involves cooperative hybridization. In one aspect, the capture extenders and capture probes are configured as described in
U.S. patent application 60/680,976 filed May 12, 2005 by Luo et al., entitled “Multiplex branched-chain DNA assays.” In one aspect, C-1 and C-2 are 20 nucleotides or less in length. In one class of embodiments, C-1 and C-2 are between 9 and 17 nucleotides in length (inclusive), preferably between 12 and 15 nucleotides (inclusive). For example, C-1 and C-2 can be 14, 15, 16, or 17 nucleotides in length, or they can be between 9 and 13 nucleotides in length (e.g., for lower hybridization temperatures, e.g., hybridization at room temperature). - The capture probe can include polynucleotide sequence in addition to C-2, or C-2 can comprise the entire polynucleotide sequence of the capture probe. For example, each capture probe optionally includes a linker sequence between the site of attachment of the capture probe to the particles and sequence C-2 (e.g., a linker sequence containing 8 Ts, as just one possible example).
- It will be evident that the amount of overlap between each individual capture extender and its corresponding capture probe (i.e., the length of C-1 and C-2) affects the Tm of the complex between that capture extender and capture probe, as does, e.g., the GC base content of sequences C-1 and C-2. Typically, all the capture probes are the same length (as are sequences C-1 and C-2) from subset of particles to subset, but not necessarily so. Depending, e.g., on the precise nucleotide sequence of C-2, different support capture probes optionally have different lengths and/or different length sequences C-2, to achieve the desired Tm. Different support capture probe-target capture probe complexes optionally have the same or different Tms.
- It will also be evident that the number of capture extenders required for stable capture of a nucleic acid depends, in part, on the amount of overlap between the capture extenders and the capture probe (i.e., the length of C-1 and C-2). For example, if n is 5-7 for a 14 nucleotide overlap, n could be 3-5 for a 15 nucleotide overlap or 2-3 for a 16 nucleotide overlap.
- As noted, the hybridizing the subset of n capture extenders to the corresponding support capture probe is performed at a hybridization temperature which is greater than a melting temperature Tm of a complex between each individual capture extender and its corresponding capture probe. The hybridization temperature is typically about 5° C. or more greater than the Tm, e.g., about 7° C. or more, about 10° C. or more, about 12° C. or more, about 15° C. or more, about 17° C. or more, or even about 20° C. or more greater than the Tm.
- Stable capture of nucleic acids of interest, e.g., while minimizing capture of extraneous nucleic acids (e.g., those to which n−1 or fewer of the target capture probes bind) can be achieved, for example, by balancing n (the number of target capture probes), the amount of overlap between the capture extenders and the capture probes (the length of C-1 and C-2), and/or the stringency of the conditions under which the target capture probes, the nucleic acids, and the support capture probes are hybridized.
- Appropriate combinations of n, amount of complementarity between the capture extenders and the capture probes, and stringency of hybridization can, for example, be determined experimentally by one of skill in the art. For example, a particular value of n and a particular set of hybridization conditions can be selected, while the number of nucleotides of complementarity between the capture extenders and the capture probes is varied until hybridization of the n capture extenders to a nucleic acid captures the nucleic acid while hybridization of a single capture extender does not efficiently capture the nucleic acid. Similarly, n, amount of complementarity, and stringency of hybridization can be selected such that the desired nucleic acid of interest is captured while other nucleic acids present in the sample are not efficiently captured. Stringency can be controlled, for example, by controlling the formamide concentration, chaotropic salt concentration, salt concentration, pH, organic solvent content, and/or hybridization temperature.
- For a given nucleic acid of interest, the corresponding target capture probes are preferably complementary to physically distinct, nonoverlapping sequences in the nucleic acid of interest, which are preferably, but not necessarily, contiguous. The Tms of the individual capture extender-nucleic acid complexes are preferably greater than the hybridization temperature, e.g., by 5° C. or 10° C. or preferably by 15° C. or more, such that these complexes are stable at the hybridization temperature. Sequence C-3, which is the sequence of the CE which is complementary to the target nucleic acid, for each capture extender is typically (but not necessarily) about 17-35 nucleotides in length, with about 30-70% GC content. Potential capture extender sequences (e.g., potential sequences C-3) are optionally examined for possible interactions with non-corresponding nucleic acids of interest, repetitive sequences (such as polyC or polyT, for example), any detection probes used to detect the nucleic acids of interest, and/or any relevant genomic sequences, for example; sequences expected to cross-hybridize with undesired nucleic acids are typically not selected for use in the target support capture probes. Examination can be, e.g., visual (e.g., visual examination for complementarity), computational (e.g., computation and comparison of percent sequence identity and/or binding free energies; for example, sequence comparisons can be performed using BLAST software publicly available through the National Center for Biotechnology Information on the world wide web at ncbi.nlm.nih.gov), and/or experimental (e.g., cross-hybridization experiments). Capture probe sequences are preferably similarly examined, to ensure that the polynucleotide sequence C-1 complementary to a particular capture probe's sequence C-2 is not expected to cross-hybridize with any of the other capture probes that are to be associated with other subsets of particles.
- The methods are useful for multiplex detection of nucleic acids, optionally highly multiplex detection. Thus, the two or more nucleic acids of interest (i.e., the nucleic acids to be detected) optionally comprise five or more, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, or even 100 or more nucleic acids of interest, while the two or more subsets of m label extenders comprise five or more, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, or even 100 or more subsets of m label extenders. In embodiments in which capture extenders, particulate solid supports, and/or spatially addressable solid support are used, a like number of subsets of capture extenders, subsets of particles, and/or selected positions on the solid support are provided.
- The label probe system optionally includes an amplification multimer and a plurality of label probes, wherein the amplification multimer is capable of hybridizing to the label extenders and to a plurality of label probes. In another aspect, the label probe system includes a preamplifier, a plurality of amplification multimers, and a plurality of label probes, wherein the preamplifier hybridizes to the label extenders, and the amplification multimers hybridize to the preamplifier and to the plurality of label probes. As another example, the label probe system can include only label probes, which hybridize directly to the label extenders. In one class of embodiments, the label probe comprises the label, e.g., a covalently attached label. In other embodiments, the label probe is configured to bind a label; for example, a biotinylated label probe can bind to a streptavidin-associated label.
- The label can be essentially any convenient label that directly or indirectly provides a detectable signal. In one aspect, the label is a fluorescent label (e.g., a fluorophore or quantum dot). Detecting the presence of the label on the particles thus comprises detecting a fluorescent signal from the label. In embodiments in which the solid support comprises particles, fluorescent emission by the label is typically distinguishable from any fluorescent emission by the particles, e.g., microspheres, and many suitable fluorescent label-fluorescent microsphere combinations are possible. As other examples, the label can be a luminescent label, a light-scattering label (e.g., colloidal gold particles), or an enzyme (e.g., HRP). Various labels are known in the art, such as Alexa Fluor Dyes (Life Technologies, Inc., California, USA, available in a wide variety of wavelengths, see for instance, Panchuk, et al., J. Hist. Cyto., 47:1179-1188, 1999), biotin-based dyes, digoxigenin, AttoPhos (JBL Scientific, Inc., California, USA, available in a variety of wavelengths, see for instance, Cano et al., Biotechniques, 12(2):264-269, 1992), ATTO dyes (Sigma-Aldrich, St. Louis, Mo.), or any other suitable label.
- As noted above, a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in a subset. Typically, the component of the label probe system that hybridizes to the two or more label extenders is an amplification multimer or preamplifier. Preferably, binding of a single label extender to the component of the label probe system (e.g., the amplification multimer or preamplifier) is insufficient to capture the label probe system to the nucleic acid of interest to which the label extender binds. Thus, in one aspect, the label probe system comprises an amplification multimer or preamplifier, which amplification multimer or preamplifier is capable of hybridizing to the at least two label extenders, and the label probe system (or the component thereof) is hybridized to the m label extenders at a hybridization temperature, which hybridization temperature is greater than a melting temperature Tm of a complex between each individual label extender and the amplification multimer or preamplifier. The hybridization temperature is typically about 5° C. or more greater than the Tm, e.g., about 7° C. or more, about 10° C. or more, about 12° C. or more, about 15° C. or more, about 17° C. or more, or even about 20° C. or more greater than the Tm. It is worth noting that the hybridization temperature can be the same or different than the temperature at which the label extenders and optional capture extenders are hybridized to the nucleic acids of interest.
- Each label extender typically includes a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the corresponding nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system (e.g., the preamplifier or amplification multimer). It will be evident that the amount of overlap between each individual label extender and the component of the label probe system (i.e., the length of L-2 and M-1) affects the Tm of the complex between the label extender and the component, as does, e.g., the GC base content of sequences L-2 and M-1. Optionally, all the label extenders have the same length sequence L-2 and/or identical polynucleotide sequences L-2. Alternatively, different label extenders can have different length and/or sequence polynucleotide sequences L-2. It will also be evident that the number of label extenders required for stable capture of the component to the nucleic acid of interest depends, in part, on the amount of overlap between the label extenders and the component (i.e., the length of L-2 and M-1).
- Stable capture of the component of the label probe system by the at least two label extenders, e.g., while minimizing capture of extraneous nucleic acids, can be achieved, for example, by balancing the number of label extenders that bind to the component, the amount of overlap between the label extenders and the component (the length of L-2 and M-1), and/or the stringency of the conditions under which the label extenders and the component are hybridized. For instance, when detecting a large message RNA of several hundred base pairs or less, any number of label extenders may be used, such as, for instance, 1-30 pairs of label extender probes, or 2-28 pairs of label extender probes, or 3-25 pairs of label extender probes, or 4-20 pairs of label extender probes, or a number of label extender probe pairs which is suitable to specifically attach the label probe system to the target with the desired affinity.
- As noted above, while some embodiments generally utilize two label extender probes to hybridize to each pre-amplifier, it is possible in other embodiments to design systems in which three label extender probes hybridize to a single target and single pre-amplifier probe, or even four label extender probes per pre-amplifier. Further, when the target nucleic acid is particularly short, as in siRNA or miRNA, it is possible to use only a single label extender probe, in concert with a single capture extender probe, to detect the target. (See, for instance,
FIG. 11 ). Alternatively, if performing the assay in situ, for example, or in other suitable conditions, a single pair of label extender probes may be designed to contain the entire complement to the target sequence (half of which would be encoded in the L-1 sequence of a first label extender probe, and the other half of which would be encoded in the second L-1 sequence of the second label extender probe). - Appropriate combinations of the amount of complementarity between the label extenders and the component of the label probe system, number of label extenders binding to the component, and stringency of hybridization can, for example, be determined experimentally by one of skill in the art. For example, a particular number of label extenders and a particular set of hybridization conditions can be selected, while the number of nucleotides of complementarity between the label extenders and the component is varied until hybridization of the label extenders to a nucleic acid captures the component to the nucleic acid while hybridization of a single label extender does not efficiently capture the component. Stringency can be controlled, for example, by controlling the formamide concentration, chaotropic salt concentration, salt concentration, pH, organic solvent content, and/or hybridization temperature.
- As noted, the Tm of any nucleic acid duplex can be directly measured, using techniques well known in the art. For example, a thermal denaturation curve can be obtained for the duplex, the midpoint of which corresponds to the Tm. It will be evident that such denaturation curves can be obtained under conditions having essentially any relevant pH, salt concentration, solvent content, and/or the like.
- The Tm for a particular duplex (e.g., an approximate Tm) can also be calculated. For example, the Tm for an oligonucleotide-target duplex can be estimated using the following algorithm, which incorporates nearest neighbor thermodynamic parameters:
- Tm (Kelvin)=ΔH°/(ΔS°+R ln Ct), where the changes in standard enthalpy (ΔH°) and entropy (ΔS°) are calculated from nearest neighbor thermodynamic parameters (see, e.g., SantaLucia (1998) “A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics” Proc. Natl. Acad. Sci. USA 95:1460-1465, Sugimoto et al. (1996) “Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes” Nucleic Acids Research 24: 4501-4505, Sugimoto et al. (1995) “Thermodynamic parameters to predict stability of RNA/DNA hybrid duplexes” Biochemistry 34:11211-11216, and et al. (1998) “Thermodynamic parameters for an expanded nearest-neighbor model for formation of RNA duplexes with Watson-Crick base
pairs” Biochemistry 37: 14719-14735), R is the ideal gas constant (1.987 cal·K−1 mole−1), and Ct is the molar concentration of the oligonucleotide. The calculated Tm is optionally corrected for salt concentration, e.g., Na+ concentration, using the formula
1/Tm(Na+)=1/Tm(1M)+(4.29f (G·C)−3.95)×10−5 ln[Na+]+9.40×10−6 ln2[Na+]. See, e.g., Owczarzy et al. (2004) “Effects of Sodium Ions on DNA Duplex Oligomers: Improved Predictions of Melting Temperatures” Biochemistry 43:3537-3554 for further details. A Web calculator for estimating Tm using the above algorithms is available on the Internet at scitools.idtdna.com/analyzer/oligocalc.asp. Other algorithms for calculating Tm are known in the art and are optionally applied to the present invention. - Typically, the component of the label probe system (e.g., the amplification multimer or preamplifier) is capable of hybridizing simultaneously to two of the m label extenders in a subset, although it optionally hybridizes to three, four, or more of the label extenders. In one class of embodiments, e.g., embodiments in which two (or more) label extenders bind to the component of the label probe system, sequence L-2 is 20 nucleotides or less in length. For example, L-2 can be between 9 and 17 nucleotides in length, e.g., between 12 and 15 nucleotides in length, between 13 and 15 nucleotides in length, or between 13 and 14 nucleotides in length. As noted, m is at least two, and can be at least three, at least five, at least 10, or more. m can be the same or different from subset to subset of label extenders.
- The label extenders can be configured in any of a variety ways. For example, the two label extenders that hybridize to the component of the label probe system can assume a cruciform arrangement, with one label extender having L-1 5′ of L-2 and the other label extender having L-1 3′ of L-2. Unexpectedly, however, a configuration in which either the 5′ or the 3′ end of both label extenders hybridizes to the nucleic acid while the other end binds to the component yields stronger binding of the component to the nucleic acid than does a cruciform arrangement of the label extenders. Thus, in one class of embodiments, the at least two label extenders (e.g., the m label extenders in a subset) each have L-1 5′ of L-2 or each have L-1 3′ of L-2. For example, L-1, which hybridizes to the nucleic acid of interest, can be at the 5′ end of each label extender, while L-2, which hybridizes to the component of the label probe system, is at the 3′ end of each label extender (or vice versa). L-1 and L-2 are optionally separated by additional sequence. In one exemplary embodiment, L-1 is located at the 5′ end of the label extender and is about 20-30 nucleotides in length, L-2 is located at the 3′ end of the label extender and is about 13-14 nucleotides in length, and L-1 and L-2 are separated by a spacer (e.g., 5 Ts).
- A label extender, preamplifier, amplification multimer, label probe, capture probe and/or capture extender optionally comprises at least one non-natural nucleotide. For example, a label extender and the component of the label probe system (e.g., the amplification multimer or preamplifier) optionally comprise, at complementary positions, at least one pair of non-natural nucleotides that base pair with each other but that do not Watson-Crick base pair with the bases typical to biological DNA or RNA (i.e., A, C, G, T, or U). Examples of normatural nucleotides include, but are not limited to, Locked NucleicAcid™ nucleotides (available from Exiqon A/S, (www.) exiqon.com; see, e.g., SantaLucia Jr. (1998) Proc Natl Acad Sci 95:1460-1465) and isoG, isoC, and other nucleotides used in the AEGIS system (Artificially Expanded Genetic Information System, available from EraGen Biosciences, (www.) eragen.com; see, e.g., U.S. Pat. No. 6,001,983, U.S. Pat. No. 6,037,120, and U.S. Pat. No. 6,140,496). Use of such non-natural base pairs (e.g., isoG-isoC base pairs) in the probes can, for example, reduce background and/or simplify probe design by decreasing cross hybridization, or it can permit use of shorter probes (e.g., shorter sequences L-2 and M-1) when the non-natural base pairs have higher binding affinities than do natural base pairs.
- The methods can optionally be used to quantitate the amounts of the nucleic acids of interest present in the sample. For example, in one class of embodiments, an intensity of a signal from the label is measured, e.g., for each subset of particles or selected position on the solid support, and correlated with a quantity of the corresponding nucleic acid of interest present.
- As noted, blocking probes are optionally also hybridized to the nucleic acids of interest, which can reduce background in the assay. For a given nucleic acid of interest, the corresponding label extenders, optional capture extenders, and optional blocking probes are preferably complementary to physically distinct, nonoverlapping sequences in the nucleic acid of interest, which are preferably, but not necessarily, contiguous. The Tms of the capture extender-nucleic acid, label extender-nucleic acid, and blocking probe-nucleic acid complexes are preferably greater than the temperature at which the capture extenders, label extenders, and/or blocking probes are hybridized to the nucleic acid, e.g., by 5° C. or 10° C. or preferably by 15° C. or more, such that these complexes are stable at that temperature. Potential CE and LE sequences (e.g., potential sequences C-3 and L-1) are optionally examined for possible interactions with non-corresponding nucleic acids of interest, LEs or CEs, the preamplifier, the amplification multimer, the label probe, and/or any relevant genomic sequences, for example; sequences expected to cross-hybridize with undesired nucleic acids are typically not selected for use in the CEs or LEs. See, e.g., Player et al. (2001) “Single-copy gene detection using branched DNA (bDNA) in situ hybridization” J Histochem Cytochem 49:603-611 and
U.S. patent application 60/680,976. Examination can be, e.g., visual (e.g., visual examination for complementarity), computational (e.g., computation and comparison of binding free energies), and/or experimental (e.g., cross-hybridization experiments). Capture probe sequences are preferably similarly examined, to ensure that the polynucleotide sequence C-1 complementary to a particular capture probe's sequence C-2 is not expected to cross-hybridize with any of the other capture probes that are to be associated with other subsets of particles or selected positions on the support. - At any of various steps, materials not captured on the solid support are optionally separated from the support. For example, after the capture extenders, nucleic acids, label extenders, blocking probes, and support-bound capture probes are hybridized, the support is optionally washed to remove unbound nucleic acids and probes; after the label extenders and amplification multimer are hybridized, the support is optionally washed to remove unbound amplification multimer; and/or after the label probes are hybridized to the amplification multimer, the support is optionally washed to remove unbound label probe prior to detection of the label.
- In embodiments in which different nucleic acids are captured to different subsets of particles, one or more of the subsets of particles is optionally isolated, whereby the associated nucleic acid of interest is isolated. Similarly, nucleic acids can be isolated from selected positions on a spatially addressable solid support. The isolated nucleic acid can optionally be removed from the particles and/or subjected to further manipulation, if desired (e.g., amplification by PCR or the like).
- As another exemplary embodiment, determining which subsets of particles have a nucleic acid of interest captured on the particles may further comprise amplifying any nucleic acid of interest captured on the particles. A wide variety of techniques for amplifying nucleic acids are known in the art, including, but not limited to, PCR (polymerase chain reaction), rolling circle amplification, and transcription mediated amplification. (See, e.g., Hatch et al. (1999) “Rolling circle amplification of DNA immobilized on solid surfaces and its application to multiplex mutation detection” Genet Anal. 15:35-40; Baner et al. (1998) “Signal amplification of padlock probes by rolling circle replication,” Nucleic Acids Res., 26:5073-8; and Nallur et al. (2001) “Signal amplification by rolling circle amplification on DNA microarrays,” Nucleic Acids Res., 29:E118.) A labeled primer and/or labeled nucleotides are optionally incorporated during amplification. In other embodiments, the nucleic acids of interest captured on the particles are detected and/or amplified without identifying the subsets of particles and/or the nucleic acids (e.g., in embodiments in which the subsets of particles are not distinguishable).
- The methods can be used to detect the presence of the nucleic acids of interest in essentially any type of sample. For example, the sample can be derived from an animal, a human, a plant, a cultured cell, a virus, a bacterium, a pathogen, and/or a microorganism. The sample optionally includes a cell lysate, an intercellular fluid, a bodily fluid (including, but not limited to, blood, serum, saliva, urine, sputum, or spinal fluid), and/or a conditioned culture medium, and is optionally derived from a tissue (e.g., a tissue homogenate), a biopsy, and/or a tumor. Similarly, the nucleic acids can be essentially any desired nucleic acids (e.g., DNA, RNA, mRNA, rRNA, miRNA, etc.). As just a few examples, the nucleic acids of interest can be derived from one or more of an animal, a human, a plant, a cultured cell, a microorganism, a virus, a bacterium, or a pathogen.
- Due to cooperative hybridization of multiple target capture probes to a nucleic acid of interest, for example, even nucleic acids present at low concentration can be captured. Thus, in one class of embodiments, at least one of the nucleic acids of interest is present in the sample in a non-zero amount of 200 attomole (amol) or less, 150 amol or less, 100 amol or less, 50 amol or less, 10 amol or less, 1 amol or less, or even 0.1 amol or less, 0.01 amol or less, 0.001 amol or less, or 0.0001 amol or less. Similarly, two nucleic acids of interest can be captured simultaneously, even when they differ in concentration by 1000-fold or more in the sample. The methods are thus extremely versatile.
- Capture of a particular nucleic acid is optionally quantitative. Thus, in one exemplary class of embodiments, the sample includes a first nucleic acid of interest, and at least 30%, at least 50%, at least 80%, at least 90%, at least 95%, or even at least 99% of a total amount of the first nucleic acid present in the sample is captured on a first subset of particles. Second, third, etc. nucleic acids can similarly be quantitatively captured. Such quantitative capture can occur without capture of a significant amount of undesired nucleic acids, even those of very similar sequence to the nucleic acid of interest.
- As noted, the methods can be used for gene expression analysis. Accordingly, in one class of embodiments, the two or more nucleic acids of interest comprise two or more mRNAs. The methods can also be used for clinical diagnosis and/or detection of microorganisms, e.g., pathogens. Thus, in certain embodiments, the nucleic acids include bacterial and/or viral genomic RNA and/or DNA (double-stranded or single-stranded), plasmid or other extra-genomic DNA, or other nucleic acids derived from microorganisms (pathogenic or otherwise). It will be evident that double-stranded nucleic acids of interest will typically be denatured before hybridization with capture extenders, label extenders, and the like.
- The methods may similarly be applied towards detection and identification of single nucleotide polymorphisms (SNPs) residing in a genomic sample. The methods are very flexible and can be applied equally as well to SNP detection across the entire genome, if desired. Various methods of SNP detection may be employed, as explained in further detail below.
- An exemplary embodiment is schematically illustrated in
FIG. 2 . Panel A illustrates three distinguishable subsets of 201, 202, and 203, which have associated therewith capture probes 204, 205, and 206, respectively. Each capture probe includes a sequence C-2 (250), which is different from subset to subset of microspheres. The three subsets of microspheres are combined to form pooled population 208 (Panel B). A subset of capture extenders is provided for each nucleic acid of interest;microspheres subset 211 fornucleic acid 214,subset 212 for nucleic acid 215 which is not present, and subset 213 fornucleic acid 216. Each capture extender includes sequences C-1 (251, complementary to the respective capture probe's sequence C-2) and C-3 (252, complementary to a sequence in the corresponding nucleic acid of interest). Three subsets of label extenders (221, 222, and 223 for 214, 215, and 216, respectively) and three subsets of blocking probes (224, 225, and 226 fornucleic acids 214, 215, and 216, respectively) are also provided. Each label extender includes sequences L-1 (254, complementary to a sequence in the corresponding nucleic acid of interest) and L-2 (255, complementary to M-1). Non-targetnucleic acids nucleic acids 230 are also present in the sample of nucleic acids. - Subsets of
221 and 223 are hybridized tolabel extenders 214 and 216, respectively. In addition,nucleic acids 214 and 216 are hybridized to their corresponding subset of capture extenders (211 and 213, respectively), and the capture extenders are hybridized to the corresponding capture probes (204 and 206, respectively), capturingnucleic acids 214 and 216 onnucleic acids 201 and 203, respectively (Panel C). Materials not bound to the microspheres (e.g., capturemicrospheres extenders 212,nucleic acids 230, etc.) are separated from the microspheres by washing.Label probe system 240 including preamplifier 245 (which includes two sequences M-1 257), amplification multimer 241 (which includes sequences M-2 258), and label probe 242 (which contains label 243) is provided. Eachpreamplifier 245 is hybridized to two label extenders,amplification multimers 241 are hybridized to the preamplifier, and label probes 242 are hybridized to the amplification multimers (Panel D). Materials not captured on the microspheres are optionally removed by washing the microspheres. Microspheres from each subset are identified, e.g., by their fluorescent emission spectrum (λ2 and λ3, Panel E), and the presence or absence of the label on each subset of microspheres is detected (λ1, Panel E). Since each nucleic acid of interest is associated with a distinct subset of microspheres, the presence of the label on a given subset of microspheres correlates with the presence of the corresponding nucleic acid in the original sample. - As depicted in
FIG. 2 , all of the label extenders in all of the subsets typically include an identical sequence L-2. Optionally, however, different label extenders (e.g., label extenders in different subsets) can include different sequences L-2. Also as depicted inFIG. 2 , each capture probe typically includes a single sequence C-2 and thus hybridizes to a single capture extender. Optionally, however, a capture probe can include two or more sequences C-2 and hybridize to two or more capture extenders. Similarly, as depicted, each of the capture extenders in a particular subset typically includes an identical sequence C-1, and thus only a single capture probe is needed for each subset of particles; however, different capture extenders within a subset optionally include different sequences C-1 (and thus hybridize to different sequences C-2, within a single capture probe or different capture probes on the surface of the corresponding subset of particles). - In the embodiment depicted in
FIG. 2 , the label probe system includes the preamplifier, amplification multimer, and label probe. It will be evident that similar considerations apply to embodiments in which the label probe system includes only an amplification multimer and label probe or only a label probe. - The various hybridization and capture steps can be performed simultaneously or sequentially, in any convenient order. For example, in embodiments in which capture extenders are employed, each nucleic acid of interest can be hybridized simultaneously with its corresponding subset of m label extenders and its corresponding subset of n capture extenders, and then the capture extenders can be hybridized with capture probes associated with the solid support. Materials not captured on the support are preferably removed, e.g., by washing the support, and then the label probe system is hybridized to the label extenders.
- Another exemplary embodiment is schematically illustrated in
FIG. 3 . Panel A depictssolid support 301 having nine capture probes provided on it at nine selected positions (e.g., 334-336). Panel B depicts a cross section ofsolid support 301, with distinct capture probes 304, 305, and 306 at different selected positions on the support (334, 335, and 336, respectively). A subset of capture extenders is provided for each nucleic acid of interest. Only three subsets are depicted;subset 311 fornucleic acid 314,subset 312 for nucleic acid 315 which is not present, andsubset 313 fornucleic acid 316. Each capture extender includes sequences C-1 (351, complementary to the respective capture probe's sequence C-2) and C-3 (352, complementary to a sequence in the corresponding nucleic acid of interest). Three subsets of label extenders (321, 322, and 323 for 314, 315, and 316, respectively) and three subsets of blocking probes (324, 325, and 326 fornucleic acids 314, 315, and 316, respectively) are also depicted (although nine would be provided, one for each nucleic acid of interest). Each label extender includes sequences L-1 (354, complementary to a sequence in the corresponding nucleic acid of interest) and L-2 (355, complementary to M-1). Non-targetnucleic acids nucleic acids 330 are also present in the sample of nucleic acids. - Subsets of
321 and 323 are hybridized tolabel extenders 314 and 316, respectively.nucleic acids 314 and 316 are hybridized to their corresponding subset of capture extenders (311 and 313, respectively), and the capture extenders are hybridized to the corresponding capture probes (304 and 306, respectively), capturingNucleic acids 314 and 316 at selectednucleic acids 334 and 336, respectively (Panel C). Materials not bound to the solid support (e.g., capturepositions extenders 312,nucleic acids 330, etc.) are separated from the support by washing.Label probe system 340 including preamplifier 345 (which includes two sequences M-1 357), amplification multimer 341 (which includes sequences M-2 358) and label probe 342 (which contains label 343) is provided. Eachpreamplifier 345 is hybridized to two label extenders,amplification multimers 341 are hybridized to the preamplifier, and label probes 342 are hybridized to the amplification multimers (Panel D). Materials not captured on the solid support are optionally removed by washing the support, and the presence or absence of the label at each position on the solid support is detected. Since each nucleic acid of interest is associated with a distinct position on the support, the presence of the label at a given position on the support correlates with the presence of the corresponding nucleic acid in the original sample. - Another general class of embodiments provides methods of detecting one or more nucleic acids, using the novel label extender configuration described above. In the methods, a sample comprising or suspected of comprising the nucleic acids of interest, one or more subsets of m label extenders, wherein m is at least two, and a label probe system are provided. Each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest. The label probe system comprises a label, and a component of the label probe system (e.g., a preamplifier or an amplification multimer) is capable of hybridizing simultaneously to at least two of the m label extenders in a subset. Each label extender comprises a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the corresponding nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system, and the at least two label extenders (e.g., the m label extenders in a subset) each have L-1 5′ of L-2 or each have L-1 3′ of L-2.
- Those nucleic acids of interest present in the sample are captured on a solid support. Each nucleic acid of interest captured on the solid support is hybridized to its corresponding subset of m label extenders, and the label probe system (or the component thereof) is hybridized to the m label extenders at a hybridization temperature. The hybridization temperature is greater than a melting temperature Tm of a complex between each individual label extender and the component of the label probe system. The presence or absence of the label on the solid support is then detected. Since the label is associated with the nucleic acid(s) of interest via hybridization of the label extenders and label probe system, the presence or absence of the label on the solid support is correlated with the presence or absence of the nucleic acid(s) of interest on the solid support and thus in the original sample.
- As previously mentioned, the solid support may be one or more particles, microparticles or nanoparticles. As an example,
FIGS. 5A and 5B schematically illustrates an encoded microparticle which may be utilized as a substrate.Microparticle 500 is a cuboid structure elongated along the Y direction in the Cartesian coordinate as shown in the figure. The cross-sections perpendicular to the length of the microparticle have substantially the same topological shape—which is square in this example. The microparticle in this particular example has a set of segments (e.g. segment 502) and gaps (e.g. gap 504) intervening the segments. Specifically, segments with different lengths (the dimension along the length of the microparticle, e.g. along the Y direction) represent different coding elements; whereas gaps preferably have the same length for differentiating the segments during detection of the microparticles. The segments of the microparticle in this example are fully enclosed within the microparticle, for example within body 106. As an alternative feature, the segments can be arranged such that the geometric centers of the segments are aligned to the geometric central axis of the elongated microparticle. A particular sequence of segments and gaps represents a code. The codes are derived from a pre-determined coding scheme. - Segments of the microparticle can be any suitable form. For instance, each segment of the microparticle may have a substantially square cross-section (i.e. the cross-section in the X-Z plane of a Cartesian coordinate as shown in
FIG. 5A ) taken perpendicular to the length (i.e. along the Y direction in the Cartesian coordinate inFIG. 5A ) of the microparticle. The segments may or may not be fabricated to have substantially square cross-section. Other shapes, such as rectangular, circular, and elliptical, jagged, curved or other shapes are also applicable. In particular, the code elements—i.e. segments and gaps, may also take any other suitable desired shape. For example, the segment (and/or the gaps) each may have a cross-section that is rectangular (e.g. with the aspect ratio of the rectangular being 2:1 or higher, such as 4:1 or higher, 10:1 or higher, 20:1 or higher, or even 100:1 or higher, but preferably less than 500:1). The code elements, i.e. the segments and gaps, may take any desired dimensions. As an example, each coding structure may have a characteristic dimension that is 5 μm (microns) or less, such as 3 microns or less, and more preferably 1 micron or less, such as 0.8 or 0.5 microns or less. In particular, when gaps are kept substantially the same dimension while the segments vary in dimension, each gap preferably has a characteristic dimension that is 1.5 microns or less, such as 0.8 or 0.5 microns or less. As one example, if forming the microparticles on a 12-inch silicon wafer with 0.13 line widths, the gap areas can be made to have 0.13 μm minimum widths, with the less transparent segments having widths of from 0.13 μm to much larger (depending upon the desired length of the particle and the encoding scheme and code space desired). Minimum gap widths, as well as minimum segment widths, of from 0.13 to 1.85 μm (e.g. from 0.25 to 0.85 μm) are possible depending upon the wafer fabrication used. Of course larger minimum gap and segment lengths (e.g. 1.85 to 5.0 μm, or more) are also possible. Other sized wafers (4 inch, 6 inch, 8 inch etc.) can of course be used, as well as wafers other than silicon (e.g. glass), as well as other substrates other than silicon (larger glass panels, for example). - The microparticle can have any suitable number of coding structures depending upon the shape or length of the particle, and the code space desired. Specifically, the total number of coding structures of a microparticle can be from 1 to 20, or more typically from 3 to 15, and more typically from 3 to 8. The desired code can be incorporated in and represented by the microparticle in many ways. As an example, the coding elements of the pre-determined coding scheme can be represented by the segment(s)—e.g. segments of different lengths represent different coding elements of the coding scheme. Different spatial arrangements of the segments with the different (or the same) lengths and intervened by gaps represent different codes. In this code-incorporation method, the intervening gaps preferably have substantially the same dimension, especially the length in the direction to which the segments are aligned. As another example, the codes are incorporated in the microparticle by arranging gaps that vary in lengths; while the segments have substantially the same dimension and are disposed between adjacent gaps. In another example, the both segments and gaps vary in their dimensions so as to represent a code. In fact, the code can also be represented in many other alternative ways using the segments, gaps, and the combination thereof. The particle code space may be further expanded by manufacturing a subset of the microparticles such that a tab protrudes from a face of the particle. Further, the code may also incorporate refractive or reflective coatings to expand the maximum number of allowable codes.
- To enable detection of codes incorporated in microparticles, the segments and gaps in each microparticle can be composed of materials of different optical, electrical, magnetic, fluid dynamic, or other desired properties that are compatible with the desired detection methods. In one example the segments and gaps are directly spatially distinguishable under transmitted and/or reflected light in the visible spectrum. For example, when the code detection relies upon optical imaging, the distinguishable property (segments vs. gaps) can be a difference in transmissivity to the particular light used for imaging (which can be any desired electromagnetic radiation—e.g. visible and near-visible light, IR, and ultra-violet light. The segments can be made to be more light absorbing (or light reflecting) than the intervening spacing material (or vice versa). Regardless of which specific property is relied upon, the segments and gaps are preferred to exhibit sufficient difference in the specific property such that the difference is detectable using the corresponding code detection method. In particular, when the code is to be detected by means of optical imaging, the segments and gaps are composed of materials exhibiting different transmissivity (in an optical transmittance mode) or reflectivity (in optical reflectance mode) to the specific light used in imaging the microparticles. For example, the segments of the microparticle of the less transparent material can block and/or reflect 30% or more, preferably 50% or more, or e.g. 80% or more, of the visible light or near visible light incident thereon.
- The microparticles may be made of organic and/or inorganic materials or a combination of organic and inorganic material. Specifically, the gaps (which are preferably more transmissive to visible or near-visible light) and segments (which are preferably less transmissive to visible or near-visible light as compared to gaps) each can be composed organic or inorganic materials, or a hybrid organic-inorganic material. The segments can be composed of a metal (e.g. aluminum), an early transition metal (e.g. tungsten, chromium, titanium, tantalum or molybdenum), or a metalloid (e.g. silicon or germanium), or combinations (or nitrides, oxides and/or carbides) thereof. In particular, the segments can be composed of a ceramic compound, such as a compound that comprises an oxide of a metalloid or early transition metal, a nitride of a metalloid or early transition metal, or a carbide of a metalloid or early transition metal. Early transition metals are those from columns 3b Sc, Y, Lu, Lr), 4b (Ti, Zr, Hf, Rf), 5b (V, Nb, Ta, Db), 6b (Cr, Mo, W, Sg) and 7b (Mn, Tc, Re, Bh) of the periodic table. However, preferred are early transition metals in columns 4b to 6b, in particular tungsten, titanium, zirconium, hafnium, niobium, tantalum, vanadium and chromium. Alternatively, the particles may be entirely comprised of different forms of silica, glass, or suitable known polymeric materials. The gaps which are in this example more transparent, can comprise any suitable material that is more transparent than the segments. The spacing material can be a siloxane, siloxene or silsesquioxane material, among others, if a hybrid material is selected. The spacing material, if inorganic, can be a glass material. Thin film deposited silicon dioxide is a suitable material, with or without boron or phosphorous doping/alloying agents. Other inorganic glass materials are also suitable such as silicon nitride, silicon oxynitride, germanium oxide, germanium oxynitride, germanium-silicon-oxynitride, or various transition metal oxides for example. A spin on glass (SOG) could also be used. If an organic material is used for the gap material, a plastic (e.g. polystyrene or latex for example) could be used. Both the segments and the gaps can be deposited by any suitable methods such as CVD (chemical vapor deposition), PVD (physical vapor deposition), spin-on, sol gel, etc. If a CVD deposition method is used, the CVD could be LPCVD (low pressure chemical vapor deposition), PECVD (plasma enhanced chemical vapor deposition), APCVD (atmospheric pressure chemical vapor deposition), SACVD (sub atmospheric chemical vapor deposition), etc. If a PVD method is used, sputtering or reactive sputtering are possible depending upon the desired final material. Spin on material (SOG or hybrid organic-inorganic siloxane materials
- Other aspects of the microparticles are disclosed in the specification of U.S. patent application Ser. No. 11/521,057, especially at, for instance, sections entitled “Frabrication”, “Detection,” “Method for Producing Codes,” “Coding Scheme,” “Assays,” “A Bioassay Process Using the Microparticles,” and Figures, etc., all of which is incorporated herein by reference for all purposes.
- Typically, the one or more nucleic acids of interest comprise two or more nucleic acids of interest, and the one or more subsets of m label extenders comprise two or more subsets of m label extenders.
- In one class of embodiments in which the one or more nucleic acids of interest comprise two or more nucleic acids of interest and the one or more subsets of m label extenders comprise two or more subsets of m label extenders, a pooled population of particles which constitute the solid support is provided. The population comprises two or more subsets of particles, and a plurality of the particles in each subset is distinguishable from a plurality of the particles in every other subset. (Typically, substantially all of the particles in each subset are distinguishable from substantially all of the particles in every other subset.) The particles in each subset have associated therewith a different capture probe.
- Two or more subsets of n capture extenders, wherein n is at least two, are also provided. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes, thereby associating each subset of n capture extenders with a selected subset of the particles. Each of the nucleic acids of interest present in the sample is hybridized to its corresponding subset of n capture extenders and the subset of n capture extenders is hybridized to its corresponding capture probe, thereby capturing the nucleic acid on the subset of particles with which the capture extenders are associated.
- Typically, in this class of embodiments, at least a portion of the particles from each subset are identified and the presence or absence of the label on those particles is detected. Since a correlation exists between a particular subset of particles and a particular nucleic acid of interest, which subsets of particles have the label present indicates which of the nucleic acids of interest were present in the sample.
- In other embodiments in which the one or more nucleic acids of interest comprise two or more nucleic acids of interest and the one or more subsets of m label extenders comprise two or more subsets of m label extenders, the nucleic acids are captured at different positions on a non-particulate, spatially addressable solid support. Thus, in one class of embodiments, the solid support comprises two or more capture probes, wherein each capture probe is provided at a selected position on the solid support. Two or more subsets of n capture extenders, wherein n is at least two, are provided. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes, thereby associating each subset of n capture extenders with a selected position on the solid support. Each of the nucleic acids of interest present in the sample is hybridized to its corresponding subset of n capture extenders and the subset of n capture extenders is hybridized to its corresponding capture probe, thereby capturing the nucleic acid on the solid support at the selected position with which the capture extenders are associated.
- Typically, in this class of embodiments, the presence or absence of the label at the selected positions on the solid support is detected. Since a correlation exists between a particular position on the support and a particular nucleic acid of interest, which positions have a label present indicates which of the nucleic acids of interest were present in the sample.
- Essentially all of the features noted for the methods above apply to these embodiments as well, as relevant; for example, with respect to composition of the label probe system; type of label; type of solid support; inclusion of blocking probes; configuration of the capture extenders, capture probes, label extenders, and/or blocking probes; number of nucleic acids of interest and of subsets of particles or selected positions on the solid support, capture extenders and label extenders; number of capture or label extenders per subset; type of particles; source of the sample and/or nucleic acids; and/or the like.
- In one aspect, the invention provides methods for capturing a labeled probe to a target nucleic acid, through hybridization of the labeled probe directly to label extenders hybridized to the nucleic acid or through hybridization of the labeled probe to one or more nucleic acids that are in turn hybridized to the label extenders.
- Accordingly, one general class of embodiments provides methods of capturing a label to a first nucleic acid of interest in a multiplex assay in which two or more nucleic acids of interest are to be detected. In the methods, a sample comprising the first nucleic acid of interest and also comprising or suspected of comprising one or more other nucleic acids of interest is provided. A first subset of m label extenders, wherein m is at least two, and a label probe system comprising the label are also provided. The first subset of m label extenders is capable of hybridizing to the first nucleic acid of interest, and a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in the first subset. The first nucleic acid of interest is hybridized to the first subset of m label extenders, and the label probe system is hybridized to the m label extenders, thereby capturing the label to the first nucleic acid of interest.
- Essentially all of the features noted for the embodiments above apply to these methods as well, as relevant; for example, with respect to configuration of the label extenders, number of label extenders per subset, composition of the label probe system, type of label, number of nucleic acids of interest, source of the sample and/or nucleic acids, and/or the like. For example, in one class of embodiments, the label probe system comprises a label probe, which label probe comprises the label, and which label probe is capable of hybridizing simultaneously to at least two of the m label extenders. In other embodiments, the label probe system includes the label probe and an amplification multimer that is capable of hybridizing simultaneously to at least two of the m label extenders. Similarly, in yet other embodiments, the label probe system includes the label probe, an amplification multimer, and a preamplifier that is capable of hybridizing simultaneously to at least two of the m label extenders.
- Another general class of embodiments provides methods of capturing a label to a nucleic acid of interest. In the methods, m label extenders, wherein m is at least two, are provided. The m label extenders are capable of hybridizing to the nucleic acid of interest. A label probe system comprising the label is also provided. A component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders. Each label extender comprises a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system, and the m label extenders each have L-1 5′ of L-2 or wherein the m label extenders each have L-1 3′ of L-2. The nucleic acid of interest is hybridized to the m label extenders, and the label probe system is hybridized to the m label extenders at a hybridization temperature, thereby capturing the label to the nucleic acid of interest. Preferably, the hybridization temperature is greater than a melting temperature Tm of a complex between each individual label extender and the component of the label probe system.
- Essentially all of the features noted for the embodiments above apply to these methods as well, as relevant; for example, with respect to configuration of the label extenders, number of label extenders per subset, composition of the label probe system, type of label, and/or the like. For example, in one class of embodiments, the label probe system comprises a label probe, which label probe comprises the label, and which label probe is capable of hybridizing simultaneously to at least two of the m label extenders. In other embodiments, the label probe system includes the label probe and an amplification multimer that is capable of hybridizing simultaneously to at least two of the m label extenders. Similarly, in yet other embodiments, the label probe system includes the label probe, an amplification multimer, and a preamplifier that is capable of hybridizing simultaneously to at least two of the m label extenders.
- An exemplary method involves the use of multiple technologies to achieve an unparalleled result in the research and diagnostic fields. In this embodiment of the present methods, capture probes are bound to encoded microparticles of the type described above. Capture extenders are employed to capture the target nucleic acid to the encoded microparticles. Branched DNA technology is then used, comprising pre-amplifiers, amplifiers and label probes, to amplify the signal associated with the captured target nucleic acids. To make the assay more robust, nucleic acid analogs are utilized in the capture extender probes. This provides increase specificity for the target.
- For instance, nucleic acid analogs such as constrained-ethyl (cEt) analogs may be used, as depicted in
FIG. 7A . (See, for additional variations of this analog which may also be suitable in the present embodiments, Seth et al., “Short Antisense Oligonucleotides withNovel 2′-4′ Conformationaly Restricted Nucleoside Analogues Show Improved Potency Without Increased Cytotoxicity in Animals,” J. Med. Chem., 52(1):10-13, 2009, incorporated herein by reference in its entirety for all purposes). The capture extender probe may be entirely comprised of such cEt analogs, or may be only partially comprised of cEt analogs. Specifically, the capture extender probe may only have cEt analogs at sequence L-1. The capture extender may have cEt analogs at the C-2 sequence as well as the L-1 sequence and/or cEt content beyond those sequences up to and including the entire capture extender probe. Use of the cEt analogs in the capture portion of the assay is especially beneficial because it is known that cEt analogs, when present in probes, act to increase the melting temperature of the resulting hybridized probe:target pair, which provides increased stability of the hybridized pair and therefore increased stability of the captured target nucleic acid bound to the encoded microparticle. - The length of label extender probes may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length. The sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length. The sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base. Alternatively, the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog. The underlying principle to the use of nucleotide analogs, such as cEt, is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence. Typically, the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay. For instance, when performing an in situ assay, it may be useful to add a neutralizing or denaturing agent such as formamide, and thereafter adjust the target melting temperature downwards to a range of 40° C. to 50° C. or lower. Thus the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant. That is, if a specific miRNA or SNP target is rich in, or has a high content of, G and C bases, then perhaps less melting temperature-increasing nucleic acid analogs, like cEt, will be necessary to achieve the desired melting temperature, as compared to a target region which is rich in A and T bases. In summary, design of the L-1 sequence, as in any probe sequence binding to the target, and determination of the amount of nucleotide analog to use in a specific embodiment of the presently disclosed assays, will depend on many factors including target sequence, buffer conditions and melting temperature needed to achieve the desired specificity and affinity in the assay.
- In these assays, cooperative hybridization is employed to capture the target to the encoded microparticle using at least two capture extender/target nucleic acid interactions per target, and also employed to bind the pre-amplifier structure to the target using at least two label extender probes per target.
FIG. 6 depicts a typical interaction for such an assay method. In practice, the number of capture extenders hybridized per target nucleic acid may be as many as 2, 3, 4, 5, 6, 7 or even 8. In practice, the number of label extenders hybridized per target nucleic acid may be as many as 2, 3, 4, 5, 6, 7 or even 8. However, in some alternative embodiments, it has been found that using even just a single capture extender bound to each target nucleic acid is in some cases sufficient to provide the desired specificity and sensitivity for the assay. - It is further noted that the label extenders, used to bind to the captured target nucleic acid and the pre-amplifiers, may be in any of many different conformations. That is, the label extenders may be designed in the double-z (ZZ) configuration, the cruciform configuration, or any other related conformation as depicted, for instance, in
FIGS. 10A and 10B . Each of these interchangeable conformations may be designed and utilized in these assays to achieve similar results. The structural variations of label extender probe design depicted inFIGS. 10A and 10B are only non-limiting examples and the Figures are do not depict all possible geometries or strategies. One of skill will immediately recognize that other useful and suitable label extender probe designs may be derived from these exemplary structures. More specifically it has been determined that especially the ZZ and the cruciform conformations work well in these assays. Furthermore, it is noted that various geometric alignments may be utilized in designing the cruciform and ZZ conformations, such as depicted inFIGS. 10A , 10B, 12A and 12B.FIGS. 12A and 12B are not intended to depict every possible design of the label extenders. Rather, these Figures merely depict specific embodiments of label extender design. One of skill in the art would be able to design other variations based on these themes which may also be suitable for the hereindescribed methodological embodiments. - Each encoded microparticle used in the assay will have its own unique barcode. Thus, as many as 1000 different target nucleic acids may be detected in a single assay from a sample using this approach.
- Many different types of assays may be successful utilizing this multi-faceted approach to capture and detection. For instance, as will be explained in more detail below, this assay may be particularly useful for detecting single nucleotide polymorphisms (SNPs). Furthermore, because of the increased specificity and stability of probes comprising the cEt analogs, this assay method may be utilized to detect and quantitate micro-RNA (miRNA) species. Micro-RNA species are particularly difficult to detect due to their short sequence length, which is typically from approximately 11 to 22 nucleotides. This assay approach may be utilized to detect mRNA, DNA, siRNA, miRNA (mature and immature sequences), SNP detection, and utilized on, for instance, WGA samples, or any type of sample desired.
- Generally, to perform SNP detection using this method, it is useful to design the label extender probes such that the SNP resides in the middle of the L-1 sequence, which may be comprised entirely of cEt molecules. Typically, sample DNA is sheared prior to performing the assay such that the average length is 20-50 nucleotides, or 30-50 nucleotides, or 40-50 nucleotides, using methods known in the art. At least approximately 50,000 cells should be harvested per sample. However, this is merely a general guide and as many as 100,000 cells, or more may be used to increase the robustness of the assay. Depending on the cell type, anywhere from 50,000 to 250,000 cells may be harvested and prepared for each sample. Alternatively, at least approximately 200-400 ng of nucleic acid material (RNA or DNA depending on the assay type) may be prepared for each sample. The amount of nucleic acid material or genetic material required for optimum results will vary depending on target sequence identity and probe design, but may be at least 150 ng, 200 ng, 250 ng, 300 ng, 350 ng, 400 ng, or 500 ng for each sample.
- Generally, the encoded microparticles, once prepared in a uniformly dispersed manner in the assay buffer, are allowed to interact with the target thereby binding the target to the encoded microparticle or barcode. Once bound, optional washing steps may be employed to wash away non-specifically bound molecules using various higher or lower stringency buffers as known in the art. Thus prepared, the microparticles may be allowed to settle, for instance, in a dish, well, slide, or other substrate such that the microparticles form a monoloayer and may be imaged either from above or below to obtain data concerning which encoded microparticle or barcode has bound to it the target, thereby identifying the sequence of the target and/or the presence or absence of a target sequence. Alternatively, the microparticles may be imaged in flow, such as by using a fluid-handling machine capable of dispersing the microparticles in solution and transporting that solution through a clear tube or other imaging cell, one particle at a time, and the particles may then be imaged as they flow through the channel, cell, tube, or other imaging stage. Such optically-induced flow cytometry microfluidic devices are known in the art. (See, for example, Yen-Heng et al., “Optically induced flow cytometry for continuous microparticle counting and sorting,” Biosensors and Bioelectrics, 24(4):572-578, 2008 and Chiou et al., “Massively parallel manipulation of single cells and microparticles using optical images,” Nature, 436:370-372, 2005, and references cited therein, both of which are incorporated herein by reference in their entireties for all purposes).
- Various imaging technologies may be employed to visualize the encoded microparticles, such as lazars, cameras, microscopes, radiometers, or other detecting devices depending on the microparticle used and the type of label employed for tagging the target. Generally, in a non-limiting example, the microparticles may be imaged simply by detecting reflected or refracted light and thereby the code of the particle determined. A second exposure could be conducted either before or after the first, detecting the fluorescent signal of the target. By superimposing these two images the identity of the particle and target may be determined.
- Prior to the development of FISH techniques, scientists typically used what was termed “G-banding” to identify gross chromosomal abnormalities. G-banding allows detection of abnormalities of the chromosome based on size, number, centromere position and banding pattern, i.e. karyotyping of whole chromosomes using a light microscope. With the advent of molecular genetics, these techniques were improved upon, culminating in the present day FISH techniques which accomplish the same goals, and more, and with much higher accuracy. FISH uses fluorescently-labeled DNA probes to hybridize to specific genetic regions of the chromosome which correlate with known linkages to diseases and genetic abnormalities. FISH utilizes fluorescent microscopy to aide in the detection of these regions. FISH is often used in laboratories testing samples for genetic abnormalities in conjunction with microarray technologies, which provides for independent validation of detection and diagnoses. FISH techniques have been in use in the scientific and clinical fields for at least the last 20 years.
- Karyotyping using the old G-banding techniques typically provided 3 to 5 Mb resolution, i.e. was able to detect abnormalities that result in a change in the chromosome of 3 to 5 Mb, which only allows for detection of gross abnormalities. FISH, on the other hand, is still used today and can provide resolution of about 60 to 100,000 base pairs using fluorescence microscopy and labeled DNA probes. This type of resolution enables detection of translocations, may be combined with phenotypic analyses, and allows for visualization of rearrangements and aberrations and resultant positions of involved genomic sequences. Other FISH techniques utilize fosmids which are 40 kb in length. Bac clone resolutions achievable utilizing fosmid approaches using Bac clones are on the order of about 40 kb to 300 kb. FISH analysis may be utilized in the areas of clinical research, medical genetics, prenatal testing, pharmacogenomics (for example in the cancer treatment field), carcinogenesis, and postnatal testing. More broadly, the field of use of the present methods may be considered the molecular cytogenetics market. Most cytogenetics testing laboratories continue to use FISH techniques to validate and provide independent diagnoses.
- The various abnormalities that may be detected by FISH include SNP detection, CNV detection, translocations and other such related abnormalities, i.e. LCH, LOH, UPD, etc. The various disease which may be associated with such genetic abnormalities may include, but are not limited to, for instance, cancer, developmental delay, autism, central nervous system disorders, heart diseases such as coronary artery disease, diabetes, psychological disorders such as schizophrenia, etc.
- The methods disclosed herein may be applied within the FISH technology field to offer enhanced and broadened applications. For instance, use of nucleic acid analogs, such as but not limited to, cEt molecules, locked nucleic acids, PNA's, and other such analogs, will provide increased sensitivity and stability of prepared samples, while use of multicolor fluorescent tags which specifically hybridize to specific label extender probes offer the capability to perform multiplex FISH analysis, identifying multiple targets in a single sample and in a single test.
- More specifically, the label extenders may be any number of possible and suitable conformations, such as the ZZ or cruciform, or any other suitable conformation as illustrated in the non-exhaustive examples depicted in
FIGS. 10A and 10B . The sequence L-1 in the label extender in these embodiments is partially or completely comprised of nucleic acid analog molecules to provide the increased melting temperature and the desired amount of specificity and stability for the label probe machinery interaction with the target sequence. There is no need in this application for a capture probe or capture extender since the label extender binds directly to the chromosomal material. - It is further noted that in this embodiment, and others, simultaneous detection of both RNA and DNA targets may be achieved. Further, RNA and DNA targets may be distinguished from each other in the same assay. For instance, considering the structures of label extender probes depicted in
FIG. 10B , one could design one set of label extender probes which are specific for double-stranded DNA as in this Figure, and design label extender probes specific for single-stranded RNA species as inFIG. 10A , which may be utilized in a single assay. Providing amplifiers and pre-amplifiers with specific recognitions sequences distinct for two different label probe systems, one zip code address for the double-stranded label extender probe set and a different zip code address for the single-stranded label extender probe set, allows for discrimination and detection of both RNA and DNA species in a single assay. This design approach may be utilized in the present embodiment, as well as in embodiments using encoded microparticles, other in situ or in cellulo embodiments, miRNA detection embodiments, SNP detection embodiments, and fusion/translocation embodiments as described in further detail below. - Samples may be prepared and processed on a slide according to any of many well known procedures provided either on the Panomics website or other websites. (See, for instance, Nature Methods, 2:237-238, 2005 and references cited therein). The internet offers a plethora of protocols for FISH sample preparation. Samples may be, for instance, cells grown in culture, isolated cells from primary sources, tissue slices, purified chromosomes as in traditional karyotyping, and other samples suitable for FISH analysis. Once prepared either on a slide or in a well, the hybridization step may be accomplished by any of the methods also provided in the literature. For instance, Panomics produces the QUANTIGENE® ViewRNA product and kits which are provided with a user's manual describing the protocol and methods in which samples may be prepared and hybridized, and which are known to one of skill in the art (see, www.panomics.com/index.php?id=product—87#product_works—87). The manual for this protocol, “QUANTIGENE® ViewRNA User Manual,” incorporated by reference in its entirety for all purposes, may also be downloaded from the Panomics website (see, panomics.com/downloads/UM15646_QGViewRNA_RevA—080526.pdf, contents of which are incorporated herein by reference in its entirety for all purposes).
- The length of label extender probes may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length. The sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length. The sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base. Alternatively, the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog. The underlying principle to the use of nucleotide analogs, such as cEt, is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence. Typically, the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay. For instance, when performing an in situ assay, it may be useful to add a neutralizing or denaturing agent such as formamide, and thereafter adjust the target melting temperature downwards to a range of 40° C. to 50° C. or lower. Thus the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant. That is, if a specific miRNA or SNP target is rich in, or has a high content of, G and C bases, then perhaps less melting temperature-increasing nucleic acid analogs, like cEt, will be necessary to achieve the desired melting temperature, as compared to a target region which is rich in A and T bases. In summary, design of the L-1 sequence, as in any probe sequence binding to the target, and determination of the amount of nucleotide analog to use in a specific embodiment of the presently disclosed assays, will depend on many factors including target sequence, buffer conditions and melting temperature needed to achieve the desired specificity and affinity in the assay.
- Once the label extender is hybridized to the target, the other components of the label machinery may be added to the sample to assemble the full labeling structure onto the sample. Alternatively, a labeling structure, which includes some or all of the labeling components depicted, for instance, in
FIG. 6 , may be partly assembled onto the label extender prior to hybridizing the label extender to the target sequence. Further, perhaps only the pre-amplifier and amplifier will be hybridized with the label extender probes prior to contact with the sample. In short, the various structure components depicted inFIG. 6 , may be assembled in any order desired to achieve optimum signal and sample handling results. For instance, to minimize sample preparation steps, it may be advantageous to have all labeling structure components in a single tube which is added to the sample in a single step. However, if the resultant signal is not optimal, it may be necessary to add the various components of the label scaffolding in multiple steps or even one step at a time so each component hybridizes separately to its intended target component. Washing steps may be implemented between some or all of the steps of the process to optimize the desired result. - It should be noted that multiple fluorescent labels may be used in the present methods. That is, one of skill in the art is aware of the various labels in existence in the market place which may be amenable to the presently disclosed method. Further, it should be noted that various fluors or known to provide different ranges of fluorescent wavelength. Thus, one could build a labeling structure such that one target genomic sequence is hybridized with one specific set of labeling structures providing a specific fluor color or wavelength, whereas a second and different target sequence may be designed using the labeling machinery to bind a differently labeled set of fluors yielding a different fluor color or wavelength, allowing for multiplex assays with the FISH protocol.
- An expanding area of research involves the use of antisense RNA molecules (siRNA) to treat various genetic-based diseases. The general methodology calls for design and synthesis of specific, relatively short, 10-45 nucleotides, RNA molecules that will hybridize to mRNA transcripts in the cell. (See, for instance, Salomon et al., “Highly Potent RNAi Compounds Derived from a Single, Short Oligonucleotides Sequence,” Keystone Symposia's RNA Silencing: Mechanism, Biology and Application, Jan. 14-19, 2010, Keystone, Colo.). These cell-produced mRNA are targeted to be turned off by the introduction into the cell of complementary antisense RNA, thereby down-regulating or stopping translation of the message into protein. The synthesized siRNA molecules are delivered to target cells producing the harmful message and once inside the cell, bind to the target mRNA and preclude translation of the mRNA, thus preventing or ameliorating the disease state.
- To develop such protocols for disease treatment, it is helpful to know whether the siRNA has been delivered to the cell and whether delivery was in sufficient quantity to elicit the desired result. Further, it is useful to determine the pharmacokinetics of the delivered siRNA, the half life, whether the appropriate location of the siRNA within the cell has been achieved, etc. In whole tissue studies it is desirable to determine whether the siRNA was effectively introduced into the target cell types or tissue types and the extent to which the siRNA was able to be introduced into said cells or tissues. Thus, a method is required for detection of siRNA. The detection of siRNA molecules in the cell or in situ is not easy since they molecules are generally around 20 nucleotides in length, on average. Today researchers typically employ a fluorescently tagged siRNA molecule to monitor the location and half life of the siRNA. However, often the fluorescent tags perturb the natural behavior of the siRNA, changing the kinetics of entry and/or localizations and/or half life of the siRNA. The presently disclosed method is ideal for achieving the goals of siRNA research without causing these side effects.
- The method described herein utilizes the cooperative hybridization of the ZZ geometry of the label extender, or any similar geometry as depicted in
FIG. 10 , for the in situ detection of siRNA. Briefly, the method follows the protocol described at the Panomics website for the QUANTIGENE® ViewRNA product (see, www.panomics.com/index.php?id=product—87#product_works—87). The manual for this protocol, “QUANTIGENE® ViewRNA User Manual,” incorporated by reference in its entirety for all purposes, may also be downloaded from the Panomics website (see, panomics.com/downloads/UM15646_QGViewRNA_RevA—080526.pdf, incorporated herein by reference in its entirety for all purposes). Combining this technology with the use of cEt molecules in the label extender L-1 sequence provides ideal sensitivity and specificity for this application embodiment. In general, the sample is first prepared by either mounting the tissue to a solid support and fixing it as in FFPE sample preparations, or adherence of cells to a substrate and permeabilizing the cells to allow entry of the detection probes. Additionally, the method is further perfected by the use of conjugation chemistry to form covalent bonds between the label extender and the target siRNA molecule, thereby fixing in place the detection probe scaffolding to the siRNA in situ. This approach has been shown to be very successful and able to achieve detection of as many as 1, 2, 3, 4, 5, 6, 7, 8, 9 and even 10 or more targets in a single sample. - As mentioned above, in the present embodiment as in other embodiments, the length of label extender probes employed in the present in embodiment may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length. The sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length. The sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base. Alternatively, the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog. The underlying principle to the use of nucleotide analogs, such as cEt, is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence. Typically, the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay. For instance, when performing an in situ assay, it may be useful to add a neutralizing or denaturing agent such as formamide, and thereafter adjust the target melting temperature downwards to a range of 40° C. to 50° C. or lower. Thus the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant. That is, if a specific miRNA or SNP target is rich in, or has a high content of, G and C bases, then perhaps less melting temperature-increasing nucleic acid analogs, like cEt, will be necessary to achieve the desired melting temperature, as compared to a target region which is rich in A and T bases. In summary, design of the L-1 sequence, as in any probe sequence binding to the target, and determination of the amount of nucleotide analog to use in a specific embodiment of the presently disclosed assays, will depend on many factors including target sequence, buffer conditions and melting temperature needed to achieve the desired specificity and affinity in the assay.
- Various substrates may be used for this in situ assay, including plates comprising wells, such as 96-well plates and the like. One of skill in the art is aware of the many different plates available in various sizes and numbers of wells per plate. Various known chemical cross-linking agents may be adapted to the protocol to aid in more permanently fixing the label probe system of QUANTIGENE® to the tissues or cells, such as, for instance, carbodiimides such as 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (see, for instance, Nat. Protoc., 3(6):1077-1084, 2008 and Nuc. Acids Res., 38(7):e98, 2010 both of which are incorporated herein by reference for all purposes) and similar amine-to-carboxyl cross linkers known in the art (see, for instance, Pierce Cross-Linking Reagents Technical Handbook, from Pierce Biotechnology, Inc., 2005, available for download from the internet at the Pierce website, at (www.) piercenet.com/Files/1601673_Crosslink_HB_Intl.pdf, incorporated herein by reference for all purposes), or other suitable cross-linkers as may be determined empirically, such as carboxyl-carboxyl, carboxyl-amine and amine-amine cross linking reagents, for instance such as those listed in the Pierce Biotechnology, Inc. catalogs. Other methods for cross linking known in the art include, but are not limited to, the use of Br-dU and/or I-dU modified nucleic acids where the 5-methyl group on the U base is substituted for the atom Br or I and crosslinking is triggered by irradiation at 308 nm. (See, Willis et al., Science, 262:1255, 1993). Other useful crosslinking agents may include psoralens which intercalate between bases and upon irradiation at 350 nm covalent crosslinking occurs between thymidine bases, which is reversible when irradiated again at 254 nm. (See, Pieles et al., Nuc. Acid Res., 17:285, 1989). These and other crosslinkers of the same family and of other well known families may be useful in achieving the same or similar results, i.e. stabilizing the interaction between the siRNA and the target nucleic acid by forming a covalent bond between the two species of molecules, thereby precluding the siRNA from simply diffusing away from the intended targets.
- Label probes of any desirable variety may be used to finally detect the presence and location of the siRNA targets. As explained above, many different labels are known, both enzymatic and non-enzymatic labels, which may be useful in the disclosed method. Detection of siRNA may also be achieved using traditional FISH protocols. Furthermore, samples may be prepared according to the traditional FFPE process if desired.
- The above embodiments may also be implemented in such a way so that the L-1 sequence is able to distinguish between various SNP identities at a specific position within the chromosome, genome, genetic material, message RNA, miRNA, DNA (both single stranded and double stranded), or other sample to be tested. That is, the L-1 sequence may be designed such that the SNP which is to be detected resides in the very middle of one of the L-1 sequences on one of the label extender probes, or another location which provides optimal sensitivity. It should be noted that the label extender probes may be designed such that the L-1 sequence complementary to the SNP is in either one of the two LE probes. The use of nucleic acid analogs, such as LNA, PNA, cEt, etc. enables label extenders to bind to only the SNP allele that is perfectly complementary to the L-1 sequence. If the label extender binds to target, and subsequently the other components of the labeling system are added and detected, then the sequence of the SNP in the target nucleic acid may be determined. The label extender can further be designed such that it will only bind to a perfectly complementary target sequence such that if the identity of the nucleic acid at the SNP position is not perfectly complementary to the corresponding L-1 position, the label extender will not bind and no signal will be detected. A general depiction of one embodiment of this assay is provided in
FIGS. 9A and 9B . ThoughFIGS. 9A and 9B illustrate the use of label extender probes both in the cruciform (left panels) and double Z (right panels) configurations for both single stranded targets and double stranded targets, other label extender configurations, such as those depicted inFIGS. 10A and 10B , may be equally effective in this assay. For instance, one could also employ the cruciform label extender geometry to achieve the same results. - As previously mentioned, the length of label extender probes in the present SNP detection embodiment may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length. The sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length. The sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base. Alternatively, the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog. The underlying principle to the use of nucleotide analogs, such as cEt, is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence. Typically, the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay. For instance, when performing an in situ assay, it may be useful to add a neutralizing or denaturing agent such as formamide, and thereafter adjust the target melting temperature downwards to a range of 40° C. to 50° C. or lower. Thus the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant. That is, if a specific miRNA or SNP target is rich in, or has a high content of, G and C bases, then perhaps less melting temperature-increasing nucleic acid analogs, like cEt, will be necessary to achieve the desired melting temperature, as compared to a target region which is rich in A and T bases. In summary, design of the L-1 sequence, as in any probe sequence binding to the target, and determination of the amount of nucleotide analog to use in a specific embodiment of the presently disclosed assays, will depend on many factors including target sequence, buffer conditions and melting temperature needed to achieve the desired specificity and affinity in the assay.
- Optionally, the assay may be designed such that one specific label is utilized for detection of one allele of the SNP, and a second distinguishable label is used for detection of another allele of the SNP. In this optional embodiment, a signal will always be detected regardless of the identity of the SNP allele and the person conducting the experiment need only to distinguish between detection of both types of signals. In this way a sample can be identified as being homozygous for either allele, if a single label is detected, or heterozygous if signal for both labels is detected.
- In another embodiment, the label extender probe may be a semicircle which has a break at the location of the SNP. Genotyping may then be achieved by ligation of the label extender loop by replacing the single missing base with, for instance, a labeled base. Alternatively, the label extender probes may simply be fully circular DNA probes wherein the L-1 sequence and the L-2 sequence are located at opposite ends of the circle, as depicted in
FIG. 10A . It should be apparent to one of skill in the art that any of the label probe extender designs depicted inFIG. 10A may be swapped with any other label extender probe design, such that, for instance, perhaps one label probe is of the full circle variety while another may be of the “Z” variety, and the like. This “mix and match” property of the label probes is applicable to all of the embodiment provided here, not just the present embodiment. - In another embodiment, the present assay is utilized to genotype multiple SNPs in a given stretch of target nucleic of interest. For instance, there may be multiple, linked SNP's in a specific region of the genome of interest and to be assayed. It is often desirable to determine whether SNPs localized in a small genomic region are “linked.” That is, it is of interest to determine if one or more SNP's in a specific region of the genome, localized in a short sequence, are identified as either one allele or the other, at the same time. The term “genetic linkage” described the tendency of certain loci or alleles to be inherited together. Genetic loci on the same chromosome are physically close to one another and tend to stay together during meiosis, and thus are considered in the art to be “genetically linked.” From SNP genotyping, linkage maps may be generated showing the relationship between various SNPs in a specific region of the genome, and it may be determined whether these SNPs are linked. The present assays allow multiple SNP genotyping by simply associating specific labels for each SNP location and allele sequence. Thus, one SNP location may have, for instance, two alleles, one which is labeled with a “green” fluorescent label through its specifically assigned label probe system, and one which is labeled with a “yellow” fluor in its specifically assigned label probe system. A second SNP location just downstream or upstream of the first SNP may be similarly genotyped using the same colors or two distinguishably different colors. If the two SNP locations are close enough, label extender probes may be designed such that each of the label extender probes in a pair of label extender probes may have an L-1 sequence perfectly complementary to one possible allele each of the closely located SNPs. Separate label probe extenders comprising different L-1 sequences which are perfectly complementary to the other alleles may also be used, and each specific pair of label probe extenders then designed to hybridize to their own specific label probe system, thereby genotyping multiple SNPs in a single assay.
- In an alternative embodiment, the C-3 sequence of the capture extender probe may instead be used to capture and simultaneously genotype the SNP in the target sequence. The C-3 sequence in the capture extender probe could also be comprised of nucleic acid analogs, as described above for the L-1 sequence, and be perfectly complementary to one allele of the SNP to be genotype. Therefore, if the target nucleic acid sequence containing the SNP binds to the capture extender probe and thereby is captured to the substrate, the genotype will be known. After capture, the sample may be optionally washed to remove non-specifically bound nucleic acids, and the presence detected by application of the remainder of the label probe system or any other suitable means. For instance, the sample may be labeled prior to exposure to the substrate and the capture extenders, or even after capture. Labeling may be achieved using any of a myriad suitable means known in the art. The substrate may be, for example, a particle, a microparticle, a microsphere, or even an encoded microparticle, as explained above. Thus, by identifying the location where the target nucleic acid is bound and/or the identity of the particle/microparticle, etc., the genotype of the target sequence may be determined. As in the prior embodiment, multiple capture extenders may be used, with each C-3 sequence being perfectly complimentary to a different SNP allele.
- As described above, Panomics provides compositions and products referred to as the QUANTIGENE line of products. These kits and compositions usually utilize anywhere from between six and twelve capture extender probes and twelve to twenty four label extender probes. However, kits do not necessary need to be bound by these number of probes per kit and may comprise any number of probes, as desired or as suitable for detection of the desired number of targets. The melting temperature selected for these assays is typically from 62° C. to 67° C. The average length of the probes is about 24 nucleic acids. However, mature miRNA is typically in the range of 15-28 nucleic acids in length and have an average melting temperature of around 64° C. Thus, design of probesets useful in the QUANTIGENE® model for detection and quantitation of mature miRNA is difficult. To address this problem, the present embodiment incorporates use of LNA or other nucleic acid analogs to allow adjustment of hybridization regions L-1 and probe lengths to enable detection of mature miRNA. This present embodiment is designed such that the probes will hybridize only if the miRNA is in the mature form. (See, for instance,
FIG. 11 , representing an embodiment of capturing and detecting mature miRNA, this would not work if the miRNA were in pre-mature form since the hairpin-loop structure and excess sequences surrounding the mature miRNA would interfere with binding of the probes). Any miRNA species that are longer than the mature miRNA, i.e. such as with pre-miRNA, will not be detected. Further, the assay employs LNA, such as, for instance, cEt and analogs thereof, in the L-1 sequence which also allows for detection of the presence of mutations in the complementary regions of the target miRNA. In other words, use of cEt and like analogs can allow for sequencing of miRNA. - Referring to
FIG. 11 , depicted is one embodiment of the miRNA assay design. Attached to a support is a capture probe. A capture extender is provided which has a region C-1 which is complementary to the capture probe. The capture extender also comprises a sequence C-3 which is complementary to a sequence in the miRNA and is typically comprised of one or more nucleic acid analogs to increase specificity and stability of the resultant hybridization pair created by hybridization of the capture probe to the miRNA target sequence. One or more label extender probes are also provided comprising the L-1 and L-2 sequences as above, which may also be comprised of one or more nucleic acid analogs which provide the same melting temperature properties as previously described. The remainder of the typical label probe system then is allowed to hybridize to the label extender probe providing detectable signal. - The sequence C-3 may be generally as short as 7, 8, 9, 10, 11 or even 12 nucleotides or fewer and still function adequately to capture the target miRNA due to the use of highly selective complementary nucleic acid analogs in the C-3 sequence. Likewise, the sequence L-1 may be generally as short as 7, 8, 9, 10, 11 or even 12 nucleotides or fewer and still function adequately to capture the target miRNA due to the use of highly selective complementary nucleic acid analogs. The quantity of nucleic acid analog present in this embodiment, as in other embodiments, varied depending on the required sensitivity. The sequences L-1 and C-3 may be 100% nucleic acid analog, or less, such as 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or even as low as 10% nucleic acid analog content. By adjusting the content of nucleic acid analog in sequences C-3 and L-1, the assay may detect even very closely related miRNA homologs. Further, the L-1 sequence may be as long as 50% of the entire miRNA or siRNA sequence. Likewise the C-3 sequence may be as long as 50% of the entire miRNA or siRNA sequence, such that when added together, the L-1 sequence and C-3 sequence together are the same length as the miRNA or siRNA sequence when added together, such that the entire miRNA or siRNA sequence is completely hybridized to these two probes. Alternatively, one or more bases of the target siRNA or miRNA sequence may be unhybridized to any other probe during the assay, i.e. not a target of, or in any way hybridized to, the capture or label probe system components. In general the number of target nucleic acid bases not hybridized to one or more components of the assay components would be 0, 1, 2, 3, 4, 5 or as many as 10 nucleic acids.
- The length of label extender probes may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length. The sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length. The sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base. Alternatively, the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog. The underlying principle to the use of nucleotide analogs, such as cEt, is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence. Typically, the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay. For instance, when performing an in situ assay, it may be useful to add a neutralizing or denaturing agent such as formamide, and thereafter adjust the target melting temperature downwards to a range of 40° C. to 50° C. or lower. Thus the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant. That is, if a specific miRNA, expression target, translocation event sequence or SNP target is rich in, or has a high content of, G and C bases, then perhaps less melting temperature-increasing nucleic acid analogs, like cEt, will be necessary to achieve the desired melting temperature, as compared to a target region which is rich in A and T bases. In summary, design of the L-1 sequence, as in any probe sequence binding to the target, and determination of the amount of nucleotide analog to use in a specific embodiment of the presently disclosed assays, will depend on many factors including target sequence, buffer conditions and melting temperature needed to achieve the desired specificity and affinity in the assay.
- Various embodiments of this assay may be employed both in vitro and in situ, as needed. That is, the assay may be redesigned without the capture extender probes such that the detection occurs entirely in situ without the aid of a solid support. Again, as in other embodiments, the label extenders may be designed in various configurations as depicted in
FIG. 10 , i.e. such as, for example, a ZZ configuration or a cruciform configuration. It will also be clear to one in the art that similar methodologies can be applied to any nucleic acid target of this length or shorter, such as siRNA, for instance. - In another embodiment, using similar components, an assay may be designed to detect the translocation of genes or fusion of genes, which is known to occur in various cancer diseases. For instance, the Philadelphia chromosome or translocation is associated with chronic myelogenous leukemia (CML) and is the result of a reciprocal translocation between chromosomes 9 and 22, designated t(9;22)(q34;q11). The resultant fused gene is the gene product BCR-ABL. Furthermore, it has been reported that the TMPRSS2-ETS gene fusion is associated with prostate cancer and is found in 50%-70% of prostate-specific-antigen (PSA)-screened hospital-based prostate cancers. (See, Kirsten et al., Other examples found in the literature includes the SLC45A3-ELK4 fusion. Presently FISH-based assays are used to detect these genetic events. However, FISH-based assays are only effective for DNA-based fusion events, not RNA-based fusion events such as the SLC45A3-ELK4 fusion.
- In a typical assay, a target sequence of between 500 to 1000 nucleic acids in length is sufficient to provide a sensitive assay signal. Optionally, the target sequence may be 300, 400, 500, 600, 700, 800 or even 900 to 1000 nucleic acids in length. In one embodiment of the assay, as depicted in
FIG. 8A , separate pairs of label extenders are hybridized through their L-1 sequences to the two targets, i.e. one target being one-half of the fusion gene (such as, for instance, BCR) and the second target being the second half of the fusion gene (such as, for instance, ABL). The two sets of label extenders may be specific for specific pre-amplifiers hybridizing through the L-2 sequence such that each target is separately labeled with different labels, such as differently colored dyes. When viewed through a fluorescence microscope, for instance—if this is the detection method specific for the label utilized in the assay, then one would look for the co-localization of the two different labels. If the labels are not co-localized, then no translocation is detected. If the labels are co-localized, this is evidence of a translocation event of the type being assayed. Various labels may be employed for the two sets of label extenders such that when the two different labels are within proximity of each other, a FRET reaction may occur to generate a third color distinguishable from the first two colors. Thus, a translocation event positive signal would be indicated by the appearance of a third color. For instance, one set of label extender probes may hybridize to one specific label probe system with green fluorescent labels. A second label probe system may be employed with a different label probe system comprising, for example, a red fluorescent label. If there is a translocation event in the sample, these two different colored label systems will be found in very close proximity to each other and the combination of labels will interact to general a third distinctive color which may be detected and indicative therefore of the translocation event. - In another embodiment, as depicted in
FIG. 8B , a single label extender may be made which traverses the translocation site. In this embodiment, detection of a signal indicates the genetic event being detected has occurred. No signal in this embodiment is indicative of no translocation/fusion genetic event in the test sample. - The length of label extender probes may vary in length anywhere from 10 to 60 nucleic acids or more, i.e. 11, 13, 15, 17, 19, 21, 25, 30, 35, 40, 45 or 50 nucleic acids in length. The sequence L-1 will also vary depending on the identity of the target and the number of potentially cross-reacting probes within the hybridization mixture. For instance, L-1 may be anywhere from 7 to 50 nucleic acids in length, or 10 to 40, or 12 to 30 or 15 to 20 nucleotides in length. The sequence L-1 may be entirely comprised of nucleic acid analogs or only partly comprised of nucleic acid analogs. For instance, it may be that every other nucleic acid is an analog in L-1, providing a 50% substitution of analog for native or wild type base. Alternatively, the L-1 sequence may be 100% comprised of nucleic acid analog. Further the L-1 sequence may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% comprised of nucleic acid analog. The underlying principle to the use of nucleotide analogs, such as cEt, is to increase the melting temperature or temperature at which the L-1 sequence remains hybridized to the target sequence. Typically, the LE and CE may be designed such that the target melting temperature for the assay is in the range of 50° C. to 56° C., or 49° C. to 57° C., or 48° C. to 48° C., etc. However, this may vary depending on buffer conditions and assay. For instance, when performing an in situ assay, it may be useful to add a neutralizing or denaturing agent such as formamide, and thereafter adjust the target melting temperature downwards to a range of 40° C. to 50° C. or lower. Thus the amount of melting temperature-increasing nucleotide analog present in L-1 can be doped up or down to the desired and empirically-determined most suitable amount to achieve the desired melting temperature, which will in turn provide the best performance with respect to affinity and specificity. Further, the desired melting temperature may also be target-dependant. That is, if a specific miRNA or SNP target is rich in, or has a high content of, G and C bases, then perhaps less melting temperature-increasing nucleic acid analogs, like cEt, will be necessary to achieve the desired melting temperature, as compared to a target region which is rich in A and T bases. In summary, design of the L-1 sequence, as in any probe sequence binding to the target, and determination of the amount of nucleotide analog to use in a specific embodiment of the presently disclosed assays, will depend on many factors including target sequence, buffer conditions and melting temperature needed to achieve the desired specificity and affinity in the assay.
- An example of such as an assay is depicted in
FIG. 8 . ThoughFIGS. 8A and 8B depict the use of label extenders in the ZZ formation, other suitable label extender structures may be designed and utilized in the assay, such as the cruciform formation or other formations as depictured inFIG. 10 . Furthermore, the two different sets of label extenders may utilize different conformations, i.e. one using ZZ conformation for one-half of the target, and the other label extenders for the other half of the target sequence being in a different conformation selected from those depicted, for instance, inFIG. 10 . Additionally, in some assays, additional sets of label extenders may be employed, i.e. more than just two per target. For instance, an assay may be designed which utilized any number of label extenders in multiples of two. Thus, the assay may be designed such that half of the translocation target sequence is bound by as many as 2, 4, 6, 8, 10, 12, 14 or any multiple of two between 16-40 label extenders. The other half of the target may be designed to be bound by the same number, or a different number of label extenders. - Another variation of the above embodiment of the present invention, related to the discovery in nucleotide samples of chromosomal translocation and deletion events present in genetic samples, involves use of oligonucleotides microarrays and components of the bDNA assays described above. By implementing this embodiment, fusions, deletions and their locations may be detected.
- As a non-limiting example, one may consider the case of the BCR-ABL gene fusion event which has been well studied and known to be linked to various disease states in humans. In this case, the mutation arises in genetic samples and can result in fusion of the BCR gene with the ABL gene, often including only parts of each. The exact location of the translocation event, i.e. how much of ABL is fused to BCR and how much of BCR is left, is sometimes difficult to determine using common techniques such as paired-end sequencing. But cost of this known technique is high and employment of the sequencing technique is not easy.
- In this embodiment, a microarray is manufactured which has bound to it DNA probes complementary to the BCR gene and/or the ABL gene. Probes on the microarray would be tiled so that the entire sequence of both genes is present in one or more probes on the array. Likewise, compositions and kits of this embodiment would include label extenders which are designed such that they are tiled across both genes. The totality of all label extenders would therefore comprise the entire sequences of one or both of the two genes which are the subject of the translocation or deletion event being queried.
- In the first part of this assay, the sample preparation step, the genetic material is fractionated and labeled according to standard protocols for analysis by microarray. Label extenders for one or both genes are also prepared as usual but with different labels which are distinguishable from the labels used for the genetic material. Additionally, the label extenders for each gene may be differentially labeled so they are distinguishable from the other gene and from the probes on the microarray.
- Hybridization of the prepared genetic sample on the array will yield BCR and ABL genes, in this example, labeled and bound to the array as in any other typical microarray experiment. As a second step, the label extenders designed to be complimentary to one of the genes may be added under conditions allowing hybridization of the label extender(s) to one gene sequence of the pair of genes known to be or are suspected of being the subject of a genetic translocation event.
- As an optional third step, the second set of label extenders, designed to be complimentary to the other gene of the genetic translocation event, may also be bound to the array. At this point, multiple different label signals may be detected. If only one label is detected, i.e. that of the label associated with the prepared genetic sample, the conclusion would be that there is no chromosomal translocation event and the sample is normal. However, if at least two different colors are detected on the array, the conclusion would be that some translocation event occurred between the two subject genes.
- Further analysis of the exact location of the multiple signals on the array would yield additional information in the case of a translocation event. For instance, by determining the location of the microarray probe which hybridized to a sample gene fragment, one can know the sequence of that gene fragment from the sample and conclude that sequence was present in the original genetic sample. If this position on the microarray is also associated with a second label type or color, the conclusion would be that this known sequence is part of the translocation event. This type of analysis may be performed for each and every signal detected on the microarray, or some representative subset thereof, to determine the exact location in the sequence of the two genes of the translocation event.
- Various algorithms are known in the art which enable correlation between the various signals detected on the microarray by a microarray scanner and the genetic sequence present in the sample. Additional algorithms and programs, such as the Affymetrix Chromosome Analysis Suite, which enable correlation of these intensity data with sequence presence and copy number, etc. Using these tools, one can determine whether the genes are the subject of a translocation event and where in the two sequences the genes were joined in the genetic sample. Further manipulation of these data can also reveal where possible gene deletions have occurred in the sample.
- Though the present embodiment was exemplified by reference to the commonly-known and well-studied BCR/ABL chromosomal gene fusion event, this method and these reagents and kits may be employed equally as well for determination of other novel gene fusion and deletion events. The BCR/ABL fusion event is merely a non-limiting example of over 350 known chromosomal gene fusion events known to occur in humans to date.
- In another optional variation of the present embodiment, each label extender for each gene in question being assayed may be designed such that a different distinguishable label binds to that label extender. Thus, with each label extender being distinguishable from any other based on differential labeling, one can detect each individual label signal and correlate this with the hybridization to the genetic sample of a particular label extender. Correlation of the label extender sequence with the label detected at that position yields the result that this particular gene sample sequence is present in the sample. As above, if a specific label signal for a specific label extender is not detected, one may conclude that this sequence is not present in the genetic sample and either was deleted or was removed when the chromosomal translocation event occurred.
- In another optional variation of the present embodiment, rather than including in the assays, methods, compositions and kits a label extender for every part of the known sequences of the two genes, only subsets of such label extenders may be included, or even single label extender species may be included. For instance, when it is known that the translocation event occurred at a specific small sequence segment between the two genes, it may be the case in this instance that only one or two specific label extenders need to be designed to detect whether that particular sequence, i.e. the unique genetic sample sequence created when the translocation event occurred, is present in the genetic sample. This simplified version of the assay is particularly efficient and easy to perform and as in the other variations of this embodiment, may be easily incorporated into a kit designed to detect and diagnose such translocation and deletion events from human genetic samples.
- Of course, this embodiment, and all the above embodiments, may be equally as well applied to any type of genetic sample, from any type of tissue. For instance, the genetic sample may be chromosomal material or RNA samples. Additionally, the source of the genetic material may be from any type of tissue from which genetic material is known to be extractable, manipulated, and prepared in the typical manner known for preparing genetic material for standard microarray assays. Furthermore, the genetic material may be obtained from human tissues or any other animal or species which is the subject of the genetic study. It is also understood that all the variations of design of label extenders, use of oligonucleotides analog sequences and assay variations discussed above with respect to other embodiments may be applied equally as well to the variations of the present embodiment.
- Compositions related to the methods are another feature of the invention. Thus, one general class of embodiments provides a composition for detecting two or more nucleic acids of interest. In one aspect, the composition includes a pooled population of particles. The population comprises two or more subsets of particles, with a plurality of the particles in each subset being distinguishable from a plurality of the particles in every other subset. The particles in each subset have associated therewith a different capture probe. In another aspect, the composition includes a solid support comprising two or more capture probes, wherein each capture probe is provided at a selected position on the solid support.
- The composition also optionally may include two or more subsets of n capture extenders, wherein n is at least two, two or more subsets of m label extenders, wherein m is at least two, and a label probe system comprising a label, wherein a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in a subset. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles or with a selected position on the solid support. Similarly, each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest.
- The composition optionally includes a sample comprising or suspected of comprising at least one of the nucleic acids of interest, e.g., two or more, three or more, etc. nucleic acids. Optionally, the composition comprises one or more of the nucleic acids of interest or target nucleic acids. In one class of embodiments, each nucleic acid of interest present in the composition is hybridized to its corresponding subset of n capture extenders, and the corresponding subset of n capture extenders is hybridized to its corresponding capture probe. Each nucleic acid of interest is thus associated with an identifiable subset of the particles. In this class of embodiments, each nucleic acid of interest present in the composition is also hybridized to its corresponding subset of m label extenders. The component of the label probe system (e.g., the amplification multimer or preamplifier) is hybridized to the m label extenders. The composition is maintained at a hybridization temperature that is greater than a melting temperature Tm of a complex between each individual label extender and the component of the label probe system (e.g., the amplification multimer or preamplifier). The hybridization temperature is typically about 5° C. or more greater than the Tm, e.g., about 7° C. or more, about 10° C. or more, about 12° C. or more, about 15° C. or more, about 17° C. or more, or even about 20° C. or more greater than the Tm. Where in situ applications are called for, the capture probe, capture extenders and particles are not included in the compositions.
- Essentially all of the features noted for the methods above apply to these embodiments as well, as relevant; for example, with respect to composition of the label probe system; type of label; inclusion of blocking probes; configuration of the capture extenders, capture probes, label extenders, and/or blocking probes; number of nucleic acids of interest and of subsets of particles or selected positions on the solid support, capture extenders and label extenders; number of capture or label extenders per subset; type of particles; source of the sample and/or nucleic acids; and/or the like.
- Another general class of embodiments provides a composition for detecting one or more nucleic acids of interest. The composition includes a solid support comprising one or more capture probes, one or more subsets of n capture extenders, wherein n is at least two, one or more subsets of m label extenders, wherein m is at least two, and a label probe system comprising a label. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with the solid support. Each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest. A component of the label probe system (e.g., a preamplifier or amplification multimer) is capable of hybridizing simultaneously to at least two of the m label extenders in a subset. Each label extender comprises a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the corresponding nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system, and the at least two label extenders (e.g., the m label extenders in a subset) each have L-1 5′ of L-2 or each have L-1 3′ of L-2.
- In one class of embodiments, the one or more nucleic acids of interest comprise two or more nucleic acids of interest, the one or more subsets of n capture extenders comprise two or more subsets of n capture extenders, the one or more subsets of m label extenders comprise two or more subsets of m label extenders, and the solid support comprises a pooled population of particles. The population comprises two or more subsets of particles. A plurality of the particles in each subset are distinguishable from a plurality of the particles in every other subset, and the particles in each subset have associated therewith a different capture probe. The capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles.
- In another class of embodiments, the one or more nucleic acids of interest comprise two or more nucleic acids of interest, or target nucleic acids, the one or more subsets of n capture extenders comprise two or more subsets of n capture extenders, the one or more subsets of m label extenders comprise two or more subsets of m label extenders, and the solid support comprises two or more capture probes, wherein each capture probe is provided at a selected position on the solid support. The capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected position on the solid support.
- Essentially all of the features noted for the embodiments above apply to these embodiments as well, as relevant; for example, with respect to composition of the label probe system; type of label; inclusion of blocking probes; configuration of the capture extenders, capture probes, label extenders, and/or blocking probes; number of nucleic acids of interest and of subsets of particles or selected positions on the solid support, capture extenders and label extenders; number of capture or label extenders per subset; type of particles; source of the sample and/or nucleic acids; and/or the like.
- For example, the label probe system can include an amplification multimer or preamplifier, which amplification multimer or preamplifier is capable of hybridizing to the at least two label extenders. The composition optionally includes one or more of the nucleic acids of interest, wherein each nucleic acid of interest is hybridized to its corresponding subset of m label extenders and to its corresponding subset of n capture extenders, which in turn is hybridized to its corresponding capture probe. The amplification multimer or preamplifier is hybridized to the m label extenders. The composition is maintained at a hybridization temperature that is greater than a melting temperature Tm of a complex between each individual label extender and the amplification multimer or preamplifier (e.g., about 5° C. or more, about 7° C. or more, about 10° C. or more, about 12° C. or more, about 15° C. or more, about 17° C. or more, or about 20° C. or more greater than the Tm).
- Compositions are also understood to comprise label extenders and capture extenders having one or more nucleic acid analogs. That is, the sequences of L-1 and C-3, may contain anywhere from 1% to 100% nucleic acid analogs, such as, for instance, cEt, LNA, PNA and the like, and mixtures thereof. With regard to cEt, it is understood that other nucleic acid analogs of similar structure and having the same or similar properties, i.e. the ability to increase the melting temperature of a hybridization event between the capture extender and/or label extender sequence and the target sequence. Thus, minor alterations to the structure of the cEt, including, but not limited to, addition of other alkyl groups, alkylene groups, thiols, amines, carboxyls, etc. which have similar chemical properties suitable to the assays and methods provided above, are also included in these compositions. Compositions are further intended to include those compositions designed specifically for detection of target nucleic acids in situ, which would not require the use of, and therefore not include in the composition, capture probes, capture extenders and/or particles.
- Yet another general class of embodiments provides a kit for detecting two or more nucleic acids of interest. In one aspect, the kit includes a pooled population of particles. The population comprises two or more subsets of particles, with a plurality of the particles in each subset being distinguishable from a plurality of the particles in every other subset. The particles in each subset have associated therewith a different capture probe. In another aspect, the kit includes a solid support comprising two or more capture probes, wherein each capture probe is provided at a selected position on the solid support.
- The kit also includes two or more subsets of n capture extenders, wherein n is at least two, two or more subsets of m label extenders, wherein m is at least two, and a label probe system comprising a label, wherein a component of the label probe system is capable of hybridizing simultaneously to at least two of the m label extenders in a subset. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles or with a selected position on the solid support. Similarly, each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest. The components of the kit are packaged in one or more containers. The kit optionally also includes instructions for using the kit to capture and detect the nucleic acids of interest, one or more buffered solutions (e.g., lysis buffer, diluent, hybridization buffer, and/or wash buffer), standards comprising one or more nucleic acids at known concentration, and/or the like.
- Essentially all of the features noted for the embodiments above apply to these embodiments as well, as relevant; for example, with respect to composition of the label probe system; type of label; inclusion of blocking probes; configuration of the capture extenders, capture probes, label extenders, and/or blocking probes; number of nucleic acids of interest and of subsets of particles or selected positions on the solid support, capture extenders and label extenders; number of capture or label extenders per subset; type of particles; source of the sample and/or nucleic acids; and/or the like.
- Another general class of embodiments provides a kit for detecting one or more nucleic acids of interest. The kit includes a solid support comprising one or more capture probes, one or more subsets of n capture extenders, wherein n is at least two, one or more subsets of m label extenders, wherein m is at least two, and a label probe system comprising a label. Each subset of n capture extenders is capable of hybridizing to one of the nucleic acids of interest, and the capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with the solid support. Each subset of m label extenders is capable of hybridizing to one of the nucleic acids of interest. A component of the label probe system (e.g., a preamplifier or amplification multimer) is capable of hybridizing simultaneously to at least two of the m label extenders in a subset. Each label extender comprises a polynucleotide sequence L-1 that is complementary to a polynucleotide sequence in the corresponding nucleic acid of interest and a polynucleotide sequence L-2 that is complementary to a polynucleotide sequence in the component of the label probe system, and the at least two label extenders (e.g., the m label extenders in a subset) each have L-1 5′ of L-2 or each have L-1 3′ of L-2. The components of the kit are packaged in one or more containers. The kit optionally also includes instructions for using the kit to capture and detect the nucleic acids of interest, one or more buffered solutions (e.g., lysis buffer, diluent, hybridization buffer, and/or wash buffer), standards comprising one or more nucleic acids at known concentration, and/or the like.
- Essentially all of the features noted for the embodiments above apply to these embodiments as well, as relevant; for example, with respect to composition of the label probe system; type of label; inclusion of blocking probes; configuration of the capture extenders, capture probes, label extenders, and/or blocking probes; number of nucleic acids of interest and of subsets of particles or selected positions on the solid support, capture extenders and label extenders; number of capture or label extenders per subset; type of particles; source of the sample and/or nucleic acids; and/or the like.
- For example, in one class of embodiments, the one or more nucleic acids of interest comprise two or more nucleic acids of interest, the one or more subsets of n capture extenders comprise two or more subsets of n capture extenders, the one or more subsets of m label extenders comprise two or more subsets of m label extenders, and the solid support comprises a pooled population of particles. The population comprises two or more subsets of particles. A plurality of the particles in each subset are distinguishable from a plurality of the particles in every other subset, and the particles in each subset have associated therewith a different capture probe. The capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected subset of the particles.
- In another class of embodiments, the one or more nucleic acids of interest comprise two or more nucleic acids of interest, the one or more subsets of n capture extenders comprise two or more subsets of n capture extenders, the one or more subsets of m label extenders comprise two or more subsets of m label extenders, and the solid support comprises two or more capture probes, wherein each capture probe is provided at a selected position on the solid support. The capture extenders in each subset are capable of hybridizing to one of the capture probes and thereby associating each subset of n capture extenders with a selected position on the solid support.
- Kits are also understood to comprise label extenders and capture extenders having one or more nucleic acid analogs. That is, the sequences of L-1 and C-3, may contain anywhere from 1% to 100% nucleic acid analogs, such as, for instance, cEt, LNA, PNA and the like, and mixtures thereof. With regard to cEt, it is understood that other nucleic acid analogs of similar structure and having the same or similar properties, i.e. the ability to increase the melting temperature of a hybridization event between the capture extender and/or label extender sequence and the target sequence. Thus, minor alterations to the structure of the cEt, including, but not limited to, addition of other alkyl groups, alkylene groups, thiols, amines, carboxyls, etc. which have similar chemical properties suitable to the assays and methods provided above, are also included in these kits. Kits are further intended to include those compositions designed specifically for detection of target nucleic acids in situ, which would not require the use of, and therefore not include in the kit, capture probes, capture extenders and/or particles.
- In one aspect, the invention includes systems, e.g., systems used to practice the methods herein and/or comprising the compositions described herein. The system can include, e.g., a fluid and/or microsphere handling element, a fluid and/or microsphere containing element, a laser for exciting a fluorescent label and/or fluorescent microspheres, a detector for detecting light emissions from a chemiluminescent reaction or fluorescent emissions from a fluorescent label and/or fluorescent microspheres, and/or a robotic element that moves other components of the system from place to place as needed (e.g., a multiwell plate handling element). For example, in one class of embodiments, a composition of the invention is contained in a flow cytometer, a
Luminex 100™ or HTS™ instrument, a microplate reader, a microarray reader, a luminometer, a colorimeter, fluorescence microscope, substrates (such as slides, well plates, etc.) on which samples may be prepared for assay, or like instrument. - The system can optionally include a computer. The computer can include appropriate software for receiving user instructions, either in the form of user input into a set of parameter fields, e.g., in a GUI, or in the form of preprogrammed instructions, e.g., preprogrammed for a variety of different specific operations. The software optionally converts these instructions to appropriate language for controlling the operation of components of the system (e.g., for controlling a fluid handling element, robotic element and/or laser). The computer can also receive data from other components of the system, e.g., from a detector, and can interpret the data, provide it to a user in a human readable format, or use that data to initiate further operations, in accordance with any programming by the user.
- A wide variety of labels are well known in the art and can be adapted to the practice of the present invention. For example, luminescent labels and light-scattering labels (e.g., colloidal gold particles) have been described. (See, e.g., Csaki et al. (2002) “Gold nanoparticles as novel label for DNA diagnostics,” Expert Rev. Mol. Diagn., 2:187-93).
- As another example, a number of fluorescent labels are well known in the art, including but not limited to, hydrophobic fluorophores (e.g., phycoerythrin, rhodamine, Alexa Fluor 488 and fluorescein), green fluorescent protein (GFP) and variants thereof (e.g., cyan fluorescent protein and yellow fluorescent protein), and quantum dots. (See, e.g., The Handbook: A Guide to Fluorescent Probes and Labeling Technologies, Tenth Edition or Web Edition (2006) from Invitrogen (available on the internet at probes.invitrogen.com/handbook), for descriptions of fluorophores emitting at various different wavelengths (including tandem conjugates of fluorophores that can facilitate simultaneous excitation and detection of multiple labeled species). For use of quantum dots as labels for biomolecules, see e.g., Dubertret et al. (2002) Science, 298:1759; Nature Biotechnology (2003) 21:41-46; and Nature Biotechnology (2003) 21:47-51. Other various labels are known in the art, such as Alexa Fluor Dyes (Life Technologies, Inc., California, USA, available in a wide variety of wavelengths, see for instance, Panchuk, et al., J. Hist. Cyto., 47:1179-1188, 1999), biotin-based dyes, digoxigenin, AttoPhos (JBL Scientific, Inc., California, USA, available in a variety of wavelengths, see for instance, Cano et al., Biotechniques, 12(2):264-269, 1992), etc.
- Labels can be introduced to molecules, e.g. polynucleotides, during synthesis or by postsynthetic reactions by techniques established in the art; for example, kits for fluorescently labeling polynucleotides with various fluorophores are available from Molecular Probes, Inc. ((www.) molecularprobes.com), and fluorophore-containing phosphoramidites for use in nucleic acid synthesis are commercially available. Similarly, signals from the labels (e.g., absorption by and/or fluorescent emission from a fluorescent label) can be detected by essentially any method known in the art. For example, multicolor detection, detection of FRET, fluorescence polarization, and the like, are well known in the art.
- Microspheres are preferred particles in certain embodiments described herein since they are generally stable, are widely available in a range of materials, surface chemistries and uniform sizes, and can be fluorescently dyed. Microspheres can be distinguished from each other by identifying characteristics such as their size (diameter) and/or their fluorescent emission spectra, for example. Furthermore, as explained in better detail above, the particles may be microspheres which may also be microparticles having a code therein.
- Luminex Corporation ((www.) luminexcorp.com), for example, offers 100 sets of uniform diameter polystyrene microspheres. The microspheres of each set are internally labeled with a distinct ratio of two fluorophores. A flow cytometer or other suitable instrument can thus be used to classify each individual microsphere according to its predefined fluorescent emission ratio. Fluorescently-coded microsphere sets are also available from a number of other suppliers, including Radix Biosolutions ((www.) radixbiosolutions.com) and Upstate Biotechnology ((www.) upstatebiotech.com). Alternatively, BD Biosciences ((www.) bd.com) and Bangs Laboratories, Inc. ((www.) bangslabs.com) offer microsphere sets distinguishable by a combination of fluorescence and size. As another example, microspheres can be distinguished on the basis of size alone, but fewer sets of such microspheres can be multiplexed in an assay because aggregates of smaller microspheres can be difficult to distinguish from larger microspheres.
- Microspheres with a variety of surface chemistries are commercially available, from the above suppliers and others (e.g., see additional suppliers listed in Kellar and Iannone (2002) “Multiplexed microsphere-based flow cytometric assays” Experimental Hematology 30:1227-1237 and Fitzgerald (2001) “Assays by the score” The Scientist 15[11]:25). For example, microspheres with carboxyl, hydrazide or maleimide groups are available and permit covalent coupling of molecules (e.g., polynucleotide capture probes with free amine, carboxyl, aldehyde, sulfhydryl or other reactive groups) to the microspheres. As another example, microspheres with surface avidin or streptavidin are available and can bind biotinylated capture probes; similarly, microspheres coated with biotin are available for binding capture probes conjugated to avidin or streptavidin. In addition, services that couple a capture reagent of the customer's choice to microspheres are commercially available, e.g., from Radix Biosolutions ((www.) radixbiosolutions.com).
- Protocols for using such commercially available microspheres (e.g., methods of covalently coupling polynucleotides to carboxylated microspheres for use as capture probes, methods of blocking reactive sites on the microsphere surface that are not occupied by the polynucleotides, methods of binding biotinylated polynucleotides to avidin-functionalized microspheres, and the like) are typically supplied with the microspheres and are readily utilized and/or adapted by one of skill. In addition, coupling of reagents to microspheres is well described in the literature. For example, see Yang et al. (2001) “BADGE, Beads Array for the Detection of Gene Expression, a high-throughput diagnostic bioassay” Genome Res. 11:1888-98; Fulton et al. (1997) “Advanced multiplexed analysis with the FlowMetrix™ system” Clinical Chemistry 43:1749-1756; Jones et al. (2002) “Multiplex assay for detection of strain-specific antibodies against the two variable regions of the G protein of respiratory syncytial virus” 9:633-638; Camilla et al. (2001) “Flow cytometric microsphere-based immunoassay: Analysis of secreted cytokines in whole-blood samples from asthmatics” Clinical and Diagnostic Laboratory Immunology 8:776-784; Martins (2002) “Development of internal controls for the Luminex instrument as part of a multiplexed seven-analyte viral respiratory antibody profile” Clinical and Diagnostic Laboratory Immunology 9:41-45; Kellar and Iannone (2002) “Multiplexed microsphere-based flow cytometric assays” Experimental Hematology 30:1227-1237; Oliver et al. (1998) “Multiplexed analysis of human cytokines by use of the FlowMetrix system” Clinical Chemistry 44:2057-2060; Gordon and McDade (1997) “Multiplexed quantification of human IgG, IgA, and IgM with the FlowMetrix™ system” Clinical Chemistry 43:1799-1801; U.S. Pat. No. 5,981,180 entitled “Multiplexed analysis of clinical specimens apparatus and methods” to Chandler et al. (Nov. 9, 1999); U.S. Pat. No. 6,449,562 entitled “Multiplexed analysis of clinical specimens apparatus and methods” to Chandler et al. (Sep. 10, 2002); and references therein.
- Methods of analyzing microsphere populations (e.g. methods of identifying microsphere subsets by their size and/or fluorescence characteristics, methods of using size to distinguish microsphere aggregates from single uniformly sized microspheres and eliminate aggregates from the analysis, methods of detecting the presence or absence of a fluorescent label on the microsphere subset, and the like) are also well described in the literature. See, e.g., the above references.
- Suitable instruments, software, and the like for analyzing microsphere populations to distinguish subsets of microspheres and to detect the presence or absence of a label (e.g., a fluorescently labeled label probe) on each subset are commercially available. For example, flow cytometers are widely available, e.g., from Becton-Dickinson ((www.) bd.com) and Beckman Coulter ((www.) beckman.com).
Luminex 100™ and Luminex HTS™ systems (which use microfluidics to align the microspheres and two lasers to excite the microspheres and the label) are available from Luminex Corporation ((www.) luminexcorp.com); the similar Bio-Plex™ Protein Array System is available from Bio-Rad Laboratories, Inc. ((www.) bio-rad.com). A confocal microplate reader suitable for microsphere analysis, the FMAT™ System 8100, is available from Applied Biosystems ((www.) appliedbiosystems.com). - As another example of particles that can be adapted for use in the present invention, sets of microbeads that include optical barcodes are available from CyVera Corporation ((www.) cyvera.com). The optical barcodes are holographically inscribed digital codes that diffract a laser beam incident on the particles, producing an optical signature unique for each set of microbeads.
- In practicing the present invention, many conventional techniques in molecular biology, microbiology, and recombinant DNA technology are optionally used. These techniques are well known and are explained in, for example, Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, Calif.; Sambrook et al., Molecular Cloning—A Laboratory Manual (3rd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 2000 and Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 2006). Other useful references, e.g. for cell isolation and culture (e.g., for subsequent nucleic acid or protein isolation) include Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, third edition, Wiley-Liss, New York and the references cited therein; Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems John Wiley & Sons, Inc. New York, N.Y.; Gamborg and Phillips (Eds.) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin Heidelberg New York) and Atlas and Parks (Eds.) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, Fla.
- Methods of making nucleic acids (e.g., by in vitro amplification, purification from cells, or chemical synthesis), methods for manipulating nucleic acids (e.g., by restriction enzyme digestion, ligation, etc.) and various vectors, cell lines and the like useful in manipulating and making nucleic acids are described in the above references. In addition, methods of making branched polynucleotides (e.g., amplification multimers) are described in U.S. Pat. No. 5,635,352, U.S. Pat. No. 5,124,246, U.S. Pat. No. 5,710,264, and U.S. Pat. No. 5,849,481, as well as in other references mentioned above.
- In addition, essentially any polynucleotide (including, e.g., labeled or biotinylated polynucleotides) can be custom or standard ordered from any of a variety of commercial sources, such as The Midland Certified Reagent Company ((www.) mcrc.com), The Great American Gene Company ((www.) genco.com), ExpressGen Inc. ((www.) expressgen.com), Qiagen (oligos.qiagen.com) and many others.
- A label, biotin, or other moiety can optionally be introduced to a polynucleotide, either during or after synthesis. For example, a biotin phosphoramidite can be incorporated during chemical synthesis of a polynucleotide. Alternatively, any nucleic acid can be biotinylated using techniques known in the art; suitable reagents are commercially available, e.g., from Pierce Biotechnology ((www.) piercenet.com). Similarly, any nucleic acid can be fluorescently labeled, for example, by using commercially available kits such as those from Molecular Probes, Inc. ((www.) molecularprobes.com) or Pierce Biotechnology ((www.) piercenet.com) or by incorporating a fluorescently labeled phosphoramidite during chemical synthesis of a polynucleotide.
- In an array of capture probes on a solid support (e.g., a membrane, a glass or plastic slide, a silicon or quartz chip, a plate, or other spatially addressable solid support), each capture probe is typically bound (e.g., electrostatically or covalently bound, directly or via a linker) to the support at a unique selected location. Methods of making, using, and analyzing such arrays (e.g., microarrays) are well known in the art. See, e.g., Baldi et al. (2002) DNA Microarrays and Gene Expression: From Experiments to Data Analysis and Modeling, Cambridge University Press; Beaucage (2001) “Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications” Curr Med Chem 8:1213-1244; Schena, ed. (2000) Microarray Biochip Technology, pp. 19-38, Eaton Publishing; technical note “Agilent SurePrint Technology: Content centered microarray design enabling speed and flexibility” available on the web at chem.agilent.com/temp/rad01539/00039489.pdf; and references therein. Arrays of pre-synthesized polynucleotides can be formed (e.g., printed), for example, using commercially available instruments such as a GMS 417 Arrayer (Affymetrix, Santa Clara, Calif.). Alternatively, the polynucleotides can be synthesized at the selected positions on the solid support; see, e.g., U.S. Pat. No. 6,852,490 and U.S. Pat. No. 6,306,643, each to Gentanlen and Chee entitled “Methods of using an array of pooled probes in genetic analysis.”
- Suitable solid supports are commercially readily available. For example, a variety of membranes (e.g., nylon, PVDF, and nitrocellulose membranes) are commercially available, e.g., from Sigma-Aldrich, Inc. ((www.) sigmaaldrich.com). As another example, surface-modified and pre-coated slides with a variety of surface chemistries are commercially available, e.g., from TeleChem International ((www.) arrayit.com), Corning, Inc. (Corning, N.Y.), or Greiner Bio-One, Inc. ((www.) greinerbiooneinc.com). For example, silanated and silyated slides with free amino and aldehyde groups, respectively, are available and permit covalent coupling of molecules (e.g., polynucleotides with free aldehyde, amine, or other reactive groups) to the slides. As another example, slides with surface streptavidin are available and can bind biotinylated capture probes. In addition, services that produce arrays of polynucleotides of the customer's choice are commercially available, e.g., from TeleChem International ((www.) arrayit.com) and Agilent Technologies (Palo Alto, Calif.).
- Suitable instruments, software, and the like for analyzing arrays to distinguish selected positions on the solid support and to detect the presence or absence of a label (e.g., a fluorescently labeled label probe) at each position are commercially available. For example, microarray readers are available, e.g., from Agilent Technologies (Palo Alto, Calif.), Affymetrix (Santa Clara, Calif.), and Zeptosens (Switzerland).
- It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. Accordingly, the following examples are offered to illustrate, but not to limit, the claimed invention.
- In the present experiment, SNPs were detected in RNA targets of approximately 20 base pairs, in situ using the QUANTIGENE® ViewRNA protocol. In these assays, no capture probes or capture extenders are utilized since there is no need to capture the target nucleic acids onto a solid surface. The samples are placed onto a solid surface, such a slide or well but not directly covalently attached to the surface. Each target contained 0, 1 or 2 SNPs. The RNA targets were synthesized using known protocols and purified to homogeneity. RNA target probes were then transfected at 15 nM into HeLa cells using known transfection protocols and reagents, such as DeliverX (Panomics, Santa Clara, Calif., see website for transfection protocols, incorporated herein by reference for all purposes). Label extenders were designed in the “Double Z” (ZZ) format as depicted, for instance, in the right panel of
FIG. 9A . Cell were prepared as in the published QUANTIGENE® ViewRNA User Manual protocol, downloadable from the Panomics website at: panomics.com/downloads/UM15646_QGViewRNA_RevA—080526.pdf (incorporated herein by reference in its entirety for all purposes). Constrained ethyl, cEt, nucleic acid analogs were incorporated into the L-1 sequence of the label extenders where indicated, below (capital letters indicate use of cEt analogs, lower case letters are native nucleic acid bases, in the sequences provided below). The target sequences are based on the miR-107 miRNA sequence, a human cancer-linked micro-RNA sequence. (See, Takahashi et al., PLoS ONE, 4(8):e6677, Aug. 18, 2009, incorporated herein by reference). Label extender design was as follows (note that L-1 sequences below are in reverse order in relationship to the target since they are the complements of the target): -
(SEQ ID NO: 1) Target: 5′-AGCAGCAUUGUACAGGGCUAUCA-3′ (SEQ ID NO: 2) Left LE (L-1): 5′-taCaAtgCtgct-3′ (SEQ ID NO: 3) Right LE (L-1): 5′-tGatAgcCctg-3′ - Probe sets for mutated version of RNA Targets (lower case base letter indicates mutation), ONE mutation per target:
-
(SEQ ID NO: 4) MUT-107-1 uGCAGCAUUGUACAGGGCUAUCA (SEQ ID NO: 5) MUT-107-2 AGgAGCAUUGUACAGGGCUAUCA (SEQ ID NO: 6) MUT-107-3 AGCAgCAUUGUACAGGGCUAUCA (SEQ ID NO: 7) MUT-107-4 AGCAGCuUUGUACAGGGCUAUCA (SEQ ID NO: 8) MUT-107-5 AGCAGCAUaGUACAGGGCUAUCA (SEQ ID NO: 9) MUT-107-6 AGCAGCAUUGaACAGGGCUAUCA (SEQ ID NO: 10) MUT-107-7 AGCAGCAUUGUAgAGGGCUAUCA (SEQ ID NO: 11) MUT-107-8 AGCAGCAUUGUACAcGGCUAUCA (SEQ ID NO: 12) MUT-107-9 AGCAGCAUUGUACAGGcCUAUCA (SEQ ID NO: 13) MUT-107-10 AGCAGCAUUGUACAGGGCUAUCu - Probe sets for mutated version of RNA Targets (lower case base letters indicate mutations), TWO mutation per target:
-
(SEQ ID NO: 14) MUT2-107-1 ucCAGCAUUGUACAGGGCUAUCA (SEQ ID NO: 15) MUT2-107-2 AGgAGCAUaGUACAGGGCUAUCA (SEQ ID NO: 16) MUT2-107-3 AGCACCuUUGUcCAGGGCUAUCA (SEQ ID NO: 17) MUT2-107-4 AGCAGCUUUGUuaAGGGCUAUCA (SEQ ID NO: 18) MUT2-107-5 AGCAGCuUAGUACAGGGCaAUCA (SEQ ID NO: 19) MUT2-107-6 uGCAGCAUUGAACAGGGCUAUCu (SEQ ID NO: 20) MUT2-107-7 AGCAGCAUUGUAaAGGGCUAUCc (SEQ ID NO: 21) MUT2-107-8 AGCAGCAUUGUACACGaCUAUCc (SEQ ID NO: 22) MUT2-107-9 AGCAGCAUUGUACAGGCCUAUac (SEQ ID NO: 23) MUT2-107-10 AGCAGCAUUGauCAGGGCAAUCA - The results are provided in the graphs of
FIGS. 13 and 14 for both single and double-SNP detection embodiments. CyteSeer image analysis software (Vala Sciences, San Diego, Calif.) was used to quantitate the integrated signal intensities observed from themiRNA 107 wild type and mutated miRNA with respect to background signal (background samples comprised wells with no probes added). Graphs presented inFIGS. 13 and 14 represent the S/N ratio (noise=blank or negative control) of integrated intensity values as a percentage of mutant/wild type signal. The data clearly indicate that the probes are sensitive to the position of mutations present at various locations throughout the sequence when assayed using the present methods. - In the present experiment, HeLa cells were plated at a density of 4000 cells/well on 96-well plastic bottom plates (Thermo Scientific Nalge Nunc, Int'l., Rochester, N.Y.) which were pre-treated with Poly-L-Lysine. Cells were allowed to grow for 2 days under standard tissue culture conditions for HeLa cells. Using a non-residual volume protocol, cells were fixed in 4% formaldehyde and cross-linked with 0.16 M EDC. Briefly, the non-residual volume protocol calls for aspiration of all but a few microliters of assay solution from sample wells throughout the entire assay. This prevents drying of the cells between manipulations and minimizes cell loss due to over-aspiration/dispension manipulations of samples. Cells were then treated with protease to permeabilize the membranes. The type of protease used for this protocol was Protease XXIV (Sigma-Aldrich, MO, also known as alkaline protease, protease from Bacillus licheniformis), at a concentration of 5 μg/ml (1:2000 dilution of stock). Labels used for the label probe system were AP-LP/Fast Red chromogenic labels and FAM-labeled probes.
- Label Extender probes were designed in the double Z arrangement using LNA in the L-1 sequence. AP-conjugated label probes were employed with Fast Red as the chromagenic detection agent. Probes were designed to target Let-7a mature miRNA, Her2 mRNA and PPIB mRNA, only the Let-7a probe had LNA incorporated. Probe sequences are directed to endogenous Let-7a, Her2 and PPIB targets within the cells. Many sets of label extender probes were designed for the mRNA sequences since the targets were much longer and more label extender probes could bind simultaneously to the longer targets, providing enhanced signal. Probe sequences were as follows (where capitalized letters indicate use of nucleic acid analog cEt and lower case letters indicate use of normal or wild type nucleic acids and cEt and LNA indicate use of either cEt analog or straight LNA analog):
-
Let 7a miRNA Probe Set -
(SEQ ID NO: 24) LE1-7ac10base-cEt3 TACTaCCtCATTTTTgaagttaccgtttt (SEQ ID NO: 25) LE2-7a12base-cEt3 AACTAtaCaaCcTTTTTctgagtcaaagcat (SEQ ID NO: 26) LE1-7ac10base-LNA3 TACTaCCtCATTTTTgaagttaccgtttt (SEQ ID NO: 27) LE2-7a12base-LNA3 AACTAtaCaaCcTTTTTctgagtcaaagcat - ERBB2 (HER2) Probe Sets:
-
ERBB21 LE (SEQ ID NO: 28) ggtaacctgtgatctcttccagagtTTTTTgaagttaccgtttt ERBB22 LE (SEQ ID NO: 29) ccggccatgctgagatgtataTTTTTctgagtcaaagcat ERBB23 LE (SEQ ID NO: 30) gctgaggtcaggcaggctgtTTTTTgaagttaccgtttt ERBB24 LE (SEQ ID NO: 31) gattacttgcaggttctggaagacTTTTTctgagtcaaagcat ERBB25 BL (SEQ ID NO: 32) tgtgcagaattcgtccccg ERBB210 BL (SEQ ID NO: 33) gagggccagtccactgcc ERBB211 LE (SEQ ID NO: 34) agaggtgggtgttatggtggatTTTTTgaagttaccgtttt ERBB212 LE (SEQ ID NO: 35) gcaccgtgtgcacgaagcTTTTTctgagtcaaagcat ERBB213 BL (SEQ ID NO: 36) cgaaagagctggtcccagg ERBB220 BL (SEQ ID NO: 37) acacactgggtgggccct ERBB221 LE (SEQ ID NO: 38) cgaaggaactggctgcagttgTTTTTgaagttaccgtttt ERBB222 LE (SEQ ID NO: 39) ccacgcactcctggcccTTTTTctgagtcaaagcat ERBB223 BL (SEQ ID NO: 40) cctgcagtactcggcattcct ERBB224 BL (SEQ ID NO: 41) cacatactccctggggagcc ERBB225 LE (SEQ ID NO: 42) gcaaacagtgcctggcattTTTTTgaagttaccgtttt ERBB226 LE (SEQ ID NO: 43) tgacactcagggtggcacgTTTTTctgagtcaaagcat ERBB227 LE (SEQ ID NO: 44) cactgagccattctggggcTTTTTgaagttaccgtttt ERBB228 LE (SEQ ID NO: 45) cctccggtccaaaacaggtTTTTTctgagtcaaagcat ERBB229 LE (SEQ ID NO: 46) cacaggccacacactggtcagTTTTTgaagttaccgtttt ERBB230 LE (SEQ ID NO: 47) agggagggtccttatagtgggTTTTTctgagtcaaagcat ERBB231 BL (SEQ ID NO: 48) cagcgggccacgcaga ERBB232 LE -(SEQ ID NO: 49) ggtttcacaccgciggggTTTTTgaagttaccgtttt ERBB233 LE (SEQ ID NO: 50) atgggcatgtaggagaggtcaTTTTTctgagtcaaagcat ERBB234 BL (SEQ ID NO: 51) cctcctcatctggaaacttccag ERBB239 BL (SEQ ID NO: 52) gggctggctctctgctcg ERBB240 LE (SEQ ID NO: 53) cgcagagatgatggacgtcagaTTTTTgaagttaccgtttt ERBB241 LE (SEQ ID NO: 54) accagcagaatgccaaccacTTTTTctgagtcaaagcat ERBB242 BL (SEQ ID NO: 55) accacccccaagaccacg ERBB243 LE (SEQ ID NO: 56) cgcttgatgaggatcccaaagTTTTTgaagttaccgtttt ERBB244 LE (SEQ ID NO: 57) ccggatcttctgctgccgtTTTTTctgagtcaaagcat ERBB245 BL (SEQ ID NO: 58) gcagtctccgcatcgtgtactt ERBB246 LE (SEQ ID NO: 59) ccagctccgtttcctgcaTTTTTgaagttaccgtttt ERBB247 LE (SEQ ID NO: 60) ctaggtgtcagcggctccaTTTTTctgagtcaaagcat ERBB248 LE (SEQ ID NO: 61) ggttgggcatcgctccgTTTTTgaagttaccgtttt ERBB249 LE (SEQ ID NO: 62) gatccgcatctgcgcctTTTTTctgagtcaaagcat ERBB250 BL (SEQ ID NO: 63) cctcagctccgtctctttcag ERBB251 BL (SEQ ID NO: 64) cagatccaagcaccttcacctt ERBB252 LE (SEQ ID NO: 65) tgtagactgtgccaaaagcgcTTTTTgaagttaccgtttt ERBB253 LE (SEQ ID NO: 66) tcagggatccagatgccctTTTTTctgagtcaaagcat ERBB254 LE (SEQ ID NO: 67) ggaattttcacattctccccaTTTTTgaagttaccgtttt ERBB255 LE (SEQ ID NO: 68) cctcaacactttgatggccactTTTTTctgagtcaaagcat ERBB256 BL (SEQ ID NO: 69) gctttgggggatgtgttttc ERBB257 LE (SEQ ID NO: 70) tgcttcgtctaagatttctttgttgTTTTTgaagttaccgtttt ERBB258 LE (SEQ ID NO: 71) cccacaccagccatcacgtaTTTTTctgagtcaaagcat - PPIB Probe Sets:
-
PPIB1-1R LE (SEQ ID NO: 72) cggtggctagggagccgTTTTTgaagttaccgtttt PPIB2-1R LE (SEQ ID NO: 73) ggaagagggtggggccgTTTTTctgagtcaaagcat PPIB3-1R LE (SEQ ID NO: 74) cccggacagctgaggccTTTTTgaagttaccgtttt PPIB4-1R LE (SEQ ID NO: 75) ggcggaggcgaaagcagTTTTTctgagtcaaagcat PPIB5-1R LE (SEQ ID NO: 76) agaggcgcagcatccacaTTTTTgaagttaccgtttt PPIB6-1R LE (SEQ ID NO: 77) caccttcatgttgcgttcggTTTTTctgagtcaaagcat PPIB7-1R BL (SEQ ID NO: 78) ggcggcggcaaggag PPIB8-1R BL (SEQ ID NO: 79) cggaccccgcgatgag PPIB9-1R LE (SEQ ID NO: 80) ggcagcagcaggaagaagaTTTTTgaagttaccgtttt PPIB10-1R LE (SEQ ID NO: 81) cggccgcagaaggtcccTTTTTctgagtcaaagcat PPIB11-1R LE (SEQ ID NO: 82) gggccccttcttcttctcatTTTTTgaagttaccgtttt PPIB12-1R LE (SEQ ID NO: 83) aaaatacaccttgacggtgactttTTTTTctgagtcaaagcat PPIB13-1R LE (SEQ ID NO: 84) atcttcatctccaattcgtaggtcTTTTTgaagttaccgtttt PPIB14-1R LE (SEQ ID NO: 85) ccaaagatcacccggcctacTTTTTctgagtcaaagcat PPIB15-1R BL (SEQ ID NO: 86) tggaacagtctttccgaagaga PPIB16-1R BL (SEQ ID NO: 87) ggccacaaaattatccactgtttt PPIB17-1R LE (SEQ ID NO: 88) caaatcctttctctcctgtagctaaTTTTTgaagttaccgtttt PPIB18-1R LE (SEQ ID NO: 89) atggaatttgctgtttttgtagcTTTTTctgagtcaaagcat PPIB19-1R BL (SEQ ID NO: 90) ggatcatgaagtccttgattacacg PPIB20-1R BL (SEQ ID NO: 91) ctggtgaagtctccgccct PPIB21-1R LE (SEQ ID NO: 92) tcctcctgtgccatctcccTTTTTgaagttaccgtttt PPIB22-1R LE (SEQ ID NO: 93) gcgctcaccgtagatgctcttTTTTTctgagtcaaagcat PPIB23-1R BL (SEQ ID NO: 94) tttgaagttctcatcggggaa PPIB24-1R BL (SEQ ID NO: 95) ccaggcccgtagtgcttcag PPIB25-1R LE (SEQ ID NO: 96) ttggccatgctcacccagTTTTTgaagttaccgtttt PPIB26-1R LE (SEQ ID NO: 97) gttggtgtctttgcctgcgTTTTTctgagtcaaagcat PPIB27-1R LE (SEQ ID NO: 98) cgtgatgaagaactgggagccTTTTTgaagttaccgtttt PPIB28-1R LE (SEQ ID NO: 99) tctagccaggctgtcttgactgtTTTTTctgagtcaaagcat PPIB29-1R LE (SEQ ID NO: 100) caaacaccacatgcttgccaTTTTTgaagttaccgtttt PPIB30-1R LE (SEQ ID NO: 101) ccatgccctctagaactttgcTTTTTctgagtcaaagcat PPIB31-1R LE (SEQ ID NO: 102) ccaccttccgcaccacctTTTTTgaagttaccgtttt PPIB32-1R LE (SEQ ID NO: 103) ggctgtctgtcttggtgctctTTTTTctgagtcaaagcat PPIB33-1R LE (SEQ ID NO: 104) catccttcaggggtttatcccTTTTTgaagttaccgtttt PPIB34-1R LE (SEQ ID NO: 105) ccgcagtctgcgatgatcaTTTTTctgagtcaaagcat PPIB35-1R LE (SEQ ID NO: 106) ggcttctccacctcgatcttgTTTTTgaagttaccgtttt PPIB36-1R LE (SEQ ID NO: 107) tccttggcgatggcaaagTTTTTctgagtcaaagcat PPIB37-1R LE (SEQ ID NO: 108) gaaagatgtccctgtgccctacTTTTTgaagttaccgtttt PPIB38-1R LE (SEQ ID NO: 109) ctgcacagacggtcactcaaaTTTTTctgagtcaaagcat PPIB39-1R LE (SEQ ID NO: 110) ctgtggcggactacagggcTTTTTgaagttaccgtttt PPIB40-1R LE (SEQ ID NO: 111) gccagtgcagctcagagccTTTTTctgagtcaaagcat PPIB41-1R LE (SEQ ID NO: 112) cagatgccagcaccgggTTTTTgaagttaccgtttt PPIB42-1R LE (SEQ ID NO: 113) ggagtgggtccgctccacTTTTTctgagtcaaagcat PPIB43-1R LE (SEQ ID NO: 114) gggcctgtggaatgtgaggTTTTTgaagttaccgtttt PPIB44-1R LE (SEQ ID NO: 115) ggagtttgttacaaaagtgagtccatTTTTTctgagtcaaagcat - Using this protocol and design, and following the QUANTIGENE ViewRNA method, Let-7a was detected in HeLa cells using the LNA-modified probes (data not shown). Assays revealed that simultaneous detection of both mature miRNA and endogenous mRNA were possible using these protocols.
- Protocol was similar to that described for Example 3. Briefly, HeLa cells were plated at a density of 8000 cells per well on 96-well plates which were pretreated with Poly-L-Lysine. Cells were allowed to incubate overnight under typical tissue culture conditions. The following day, the HeLa cells were transfected with FAM-labeled or unlabelled GAPDH siRNA at a final concentration of 15 nM using the QUANTIGENE DeliverX product and protocol (Panomics, CA). Cells were again incubated overnight at standard HeLa cell tissue culture conditions.
- Target sequences and probe sequences utilized in this example are as follows, where capital letters in the Probeset sequences indicate the use of cEt nucleic acid analogs and lower case letters indicate use of normal or wild type nucleic acids and “LE1” and “LE2” indicate the LE L-1 sequences, one for each LE:
- GAPDH-siRNA Sequence:
-
CAUCAUCCCUGCCUCUACUTT-sense (SEQ ID NO: 116) AGUAGAGGCAGGGAUGAUGTT-antisense (SEQ ID NO: 117) - Probe Set, Antisense Strand
-
(SEQ ID NO: 118) LE1: tGcCtCtaCTtttttgaagttaccgtttt (SEQ ID NO: 119) LE2: aaCatCaTcCctttttctgagtcaaagcat - The cells were then fixed as in Example 3. In addition, cells were denatured by heating the cells at 75° C. for 15 minutes following protease treatment. The label extender probes were designed in the double Z configuration as above. GAPDH label probe L-1 sequences incorporated LNA as indicated above. The FAM-labeled LNA-containing label extender probes were effective in detecting and visualizing GAPDH siRNA in the HeLa cells using the ViewRNA assay protocol. Further, it was discovered that using either one of the LE's by itself did not generate significant signal above background. Use of formamide/SSC and NaOH yielded similar results for the denaturation step (data not shown). Additionally, both of these denaturation groups exhibited similar dose-dependent knockdown effects when additional GAPDH mRNA was added to the samples (data not shown).
- The basic protocol for this assay is based on the QUANTIGENE® 2.0 protocol and reagent system user's manual (for example pages 12-25) available at the Panomics website at (www.)panomics.com/downloads/UM13074_QG2Manual_RevB—080102.pdf (incorporated herein by reference in its entirety for all purposes). All reagents available from Panomics (Santa Clara, Calif.). The design of the assay is depicted in
FIG. 11 . The probe set design was as follows (where capitalized letters indicate use of nucleic acid analog cEt and lower case letters indicate use of normal or wild type nucleic acids): -
hsa-miR-107-CE (SEQ ID NO: 120) tacaatgCtgctctcttggaaagaaagtgaagtg has-miR-107-LE (SEQ ID NO: 121) ctgagtcaaagcatgaagttaccgttttttttttgatagcCctg - The following sequences are the target sequences for mature miR-671:
-
(SEQ ID NO: 122) hsa-miR-671 AGGAAGCCCTGGAGGGGCTGGAGGT (SEQ ID NO: 123) hsa-miR-671-SNP AGGAAGtCCTGGAGGGGCTGGAGGT -
FIG. 15A provides data for the performance of the following probesets (where capitalized letters indicate use of nucleic acid analog cEt and lower case letters indicate use of normal or wild type nucleic acids): -
Human miR-93: (SEQ ID NO: 124) CAAAGUGCUGUUCGUGCAGGUAG CE: (SEQ ID NO: 125) aaCagcaCtttgctcttggaaagaaagtgaagtg LE: (SEQ ID NO: 126) ctgagtcaaagcatgaagttaccgtttttttttctacCtgcacg - Serial dilutions of miR-93 miRNA from 3,000 copies to 6,144,000 copies were detected with or without corn leaf tissue homogenate added. As can be seen from the graph, the signal minus background (S-B) is consistent whether detecting purified miR-93 miRNA or the same miRNA present in a complex mixture of corn leaf tissue homogenate. The corn leaf tissue homogenate was prepared by briefly freezing corn leaf in liquid nitrogen, pulverizing into powder, then resuspending in powder in homogenization solution, which is part of the QUANTIGENE® 2.0 target preparation kit (available from Panomics, Santa Clara, Calif.). The y-axis data of
FIG. 15A provides relative light units (RLU) background subtracted for samples comprising various amounts of miRNA target and with or without corn leaf tissue homogenate, showing that the assay responds linearly over a very wide range of target concentration, even in the context of a complex tissue homogenate mixture. Signal was measured in all experiments herein using an L(max) luminometer from Molecular Devices (Sunnyvale, Calif.). -
FIG. 15B provides additional data showing linearity of quantitative detection of miR-93 target in the context of tissue homogenate. The assay was performed as above forFIG. 15A .FIGS. 15C and 15D shows similar data, except that target has been changed to miR-107. - Further experiments were performed to show the degree of specificity of the assay against Let7 homologues. The targets were as follows:
-
(SEQ ID NO: 127) Human Let-7a UGAGGUAGUAGGUUGUAUAGUU (SEQ ID NO: 128) Human Let-7b UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 129) Human Let-7c UGAGGUAGUAGGUUGUAUGGUU
Probes designed for this ViewRNA assay were as follows (where capitalized letters indicate use of nucleic acid analog cEt and lower case letters indicate use of normal or wild type nucleic acids): -
Let-7a (SEQ ID NO: 130) CE: cTaCtaCctcactcttggaaagaaagtgaagtg (SEQ ID NO: 131) LE: ctgagtcaaagcatgaagttaccgtttttttttaacTaTaCaAC Let-7b (SEQ ID NO: 132) CE: cTaCtACctcactcttggaaagaaagtgaagtg (SEQ ID NO: 133) LE: ctgagtcaaagcatgaagttaccgtttttttttaacCaCacaac Let-7c (SEQ ID NO: 134) CE: taCtaCCtCactcttggaaagaaagtgaagtg (SEQ ID NO: 135) LE: ctgagtcaaagcatgaagttaccgtttttttttaaccataCaAcc - As
FIG. 16 shows, label extender probes designed to specifically bind to only Let-7a overwhelmingly only bound to Let-7a. Very little relative light signal (RLU) was detected for binding to other homologues. The same is true for Let-7b and Let-7c. - Similar to experiments performed above, using the QUANTIGENE® 2.0 general protocols as in Example 5, the ability of the miRNA assay to discriminate between mature and pre-miRNA forms of specific human miRNA targets miR-93, miR-107 and miR-155 was investigated in simple competition experiments. Results are provided in
FIG. 18 . Sequences for the human targets are provided inFIG. 17 . As the results show inFIG. 18 , the assay specifically detects the mature form of the miRNA when using the constrained ethyl (cEt) analogs at strategic locations (L-1 and C-1 sequences) to capture only the mature form (left side of graph inFIG. 18 ). The right side of the graph inFIG. 18 shows that regular probes which contain no nucleic acid analogs are capable of specifically detecting pre-miRNA species when using the basic QUANTIGENE® 2.0 general protocol. - Probes designed for this experiment are as shown below.
- Mature miRNA Sequences (Human):
-
(SEQ ID NO: 136) miR-93: CAAAGUGCUGUUCGUGCAGGUAG (SEQ ID NO: 137) miR-107: AGCAGCAUUGUACAGGGCUAUCA (SEQ ID NO: 138) miR-155: UUAAUGCUAAUCGUGAUAGGGGU - Pre-miRNA Sequences (Human):
-
miR-93: (SEQ ID NO: 139) 5′-CUGGGGGCUCCAAAGUGCUGUUCGUGCAGG UAGUGUGAUUACCCAACCUACUGCUGAGCU-3′ miR-107: (SEQ ID NO: 140) 5′-ACAGUGUUGCCUUGUGGCAUGGAGUUCAAG CAGCAUUGUACAGGGCUAUCAAAGCACAGA-3′ miR-155: (SEQ ID NO: 141) 5′-AAUGCUAAUCGUGAUAGGGGUUUUUGCCU CCAACUGACUCCUACAUAUUAGCAUUAACAG-3′ - Probe sets with cEt chemistry specific for mature miRNA (where capitalized letters indicate use of nucleic acid analog cEt and lower case letters indicate use of normal or wild type nucleic acids):
-
miR-93: (SEQ ID NO: 142) CE: aaCagcaCtttgctcttggaaagaaagtgaagtg (SEQ ID NO: 143) LE: ctgagtcaaagcatgaagttaccgtttttttttctacCtgcacg miR-107: (SEQ ID NO: 144) CE: tacaatgCtgctctcttggaaagaaagtgaagtg (SEQ ID NO: 145) LE: ctgagtcaaagcatgaagttaccgttttttttttgatagcCctg miR-155: (SEQ ID NO: 146) CE: gAttAgCaTtAactcttggaaagaaagtgaagtg (SEQ ID NO: 147) LE: ctgagtcaaagcatgaagttaccgtttttttttAccccTAtcac - Probe sets designed with regular DNA bases specific for pre-miRNA (no nucleic acids used, capital letters are the spacer part of the LE probes):
-
miR-93: (SEQ ID NO: 148) CE: gcactttggagcccccagTTTTTctcttggaaagaaagtgaagtg (SEQ ID NO: 149) LE: gtaatcacactacctgcacgaacaTTTTTctgagtcaaagcatgaa gttac miR-107: (SEQ ID NO: 150) CE: ccctgtacaatgctgcttgaacTTTTTctcttggaaagaaagtgaa gtg (SEQ ID NO: 151) LE: tccatgccacaaggcaacaTTTTTctgagtcaaagcatgaagttac miR-155: (SEQ ID NO: 152) CE: gctaatatgtaggagtcagttggaggcTTTTTctcttggaaagaaa gtgaagtg (SEQ ID NO: 153) LE: aaaaacccctatcacgattagcattaTTTTTctgagtcaaagcatg aagttac - In a further test of the ability of the QUANTIGENE® ViewRNA assay to utilize different LE architectural designs, as depicted in
FIGS. 10A and 10B , for instance, direct comparisons were made of the ZZ architecture design for the LE (as inFIG. 12A ) and the cruciform architecture (as inFIG. 12A ). The general protocol followed was identical to that described in the QUANTIGENE® ViewRNA assay (for details, see User Manuals available at the Panomics website as discussed herein and incorporated herein by reference elsewhere). Target nucleic acid sequences chosen for this study include the human mRNA sequences for the HPRT gene, the PPIB gene and the ERBB2 gene. Assay was performed in HeLa cells in situ according to protocols as described for the QUANTIGENE® ViewRNA protocols. Targets were assayed in both single plex and multi-plex assays. - Probe sets used for these experiments and label probe system components designed for this assay were determined as above with other examples. Probe sequences were designed such that they comprised the described regions of interaction for the label probe system to function as intended, as above. Cells were imaged using ArrayWorX and Olympus IX71 microscope using filters matching fluorophores above. Negative controls were performed with no probes added.
- Generally, the data indicate that the cruciform LE architecture performs as well as, if not better than, the ZZ architecture in the QUANTIGENE® ViewRNA assay protocols using the indicated human gene targets.
FIGS. 19 and 20 are bar graphs providing typical data observed using the ATTO dye chemistry (labels available from Sigma-Aldrich, St. Louis, Mo.). Signal was observed as described above for other Examples. -
FIG. 19 provides S/B (signal/base line (negative control)) bar graphs depicting the activity and specificity of two LE configurations. Left panel shows data related to the performance of the Double Z (ZZ) LE configuration and the cruciform LE configuration in a single-plex assay. Right panel provides data related to the performance of the same LE's. Data in the right panel was obtained in multiplex format with four targets tested for each LE pair. Data represents averaged values. -
FIG. 20 provides signal-base line (negative control) bar graphs depicting the activity and specificity of two LE configurations. Left panel shows data related to the performance of the Double Z (ZZ) LE configuration and the cruciform LE configuration in a single-plex assay. Right panel provides data related to the performance of the same LE's now in multiplex format with four targets each. Y-axis units are RLU (relative light units). - Though these data show that the cruciform label extender structures behave similarly to the double Z label extender structures, this is not inconsistent with results, above provided in Example 1. The data in Example 1 were obtained in the QUANTIGENE® 1.0 assay using a single target. The data in the present Example is obtained using the QUANTIGENE® ViewRNA assay and using newer 2.0 version label probe system components. The buffer conditions, temperatures and assay procedures between these two embodiments are very different, yielding different performance results for the cruciform structures versus the double Z structures. Likewise, all of the structures, and more, as depicted in
FIGS. 10A and 10B , can be examined and specifically selected for each assay and each target, depending on various conditions and the identity of the target sequence. For instance, it may be true that different amplifier probes and different label extender probes will work better for one target, but not for another. Thus, one of skill understands that some routine optimization may be needed to achieve the desired results for each specific assay or embodiment. - While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. For example, all the techniques and apparatus described above can be used in various combinations. All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and/or other document were individually indicated to be incorporated by reference for all purposes.
Claims (36)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/175,582 US20120052498A1 (en) | 2010-07-01 | 2011-07-01 | Detection of Nucleic Acids |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US36088710P | 2010-07-01 | 2010-07-01 | |
| US13/175,582 US20120052498A1 (en) | 2010-07-01 | 2011-07-01 | Detection of Nucleic Acids |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20120052498A1 true US20120052498A1 (en) | 2012-03-01 |
Family
ID=45697751
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/175,582 Abandoned US20120052498A1 (en) | 2010-07-01 | 2011-07-01 | Detection of Nucleic Acids |
Country Status (1)
| Country | Link |
|---|---|
| US (1) | US20120052498A1 (en) |
Cited By (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080038725A1 (en) * | 2005-06-20 | 2008-02-14 | Yuling Luo | Methods of detecting nucleic acids in individual cells and of identifying rare cells from large heterogeneous cell populations |
| US20090081688A1 (en) * | 2005-06-20 | 2009-03-26 | Advanced Cell Diagnostics | Methods of detecting nucleic acids in individual cells and of identifying rare cells from large heterogeneous cell populations |
| US8658361B2 (en) | 2010-10-21 | 2014-02-25 | Advanced Cell Diagnostics, Inc. | Ultra sensitive method for in situ detection of nucleic acids |
| US20140120540A1 (en) * | 2011-07-01 | 2014-05-01 | Htg Molecular Diagnostics, Inc. | Methods of detecting gene fusions |
| WO2015120273A1 (en) | 2014-02-07 | 2015-08-13 | The General Hospital Corporation | Differential diagnosis of hepatic neoplasms |
| WO2015123565A1 (en) | 2014-02-14 | 2015-08-20 | The General Hospital Corporation | Methods for diagnosing igg4-related disease |
| WO2015131099A1 (en) | 2014-02-28 | 2015-09-03 | The General Hospital Corporation | Diagnosis of multiple myeloma and lymphoma |
| WO2015200697A1 (en) | 2014-06-25 | 2015-12-30 | The General Hospital Corporation | Targeting human satellite ii (hsatii) |
| US9273349B2 (en) | 2013-03-14 | 2016-03-01 | Affymetrix, Inc. | Detection of nucleic acids |
| US9783841B2 (en) | 2012-10-04 | 2017-10-10 | The Board Of Trustees Of The Leland Stanford Junior University | Detection of target nucleic acids in a cellular sample |
| US10415080B2 (en) | 2016-11-21 | 2019-09-17 | Nanostring Technologies, Inc. | Chemical compositions and methods of using same |
| US20200224243A1 (en) * | 2017-03-22 | 2020-07-16 | The Board Of Trustees Of The Leland Stanford Junior University | Proximity Ligation in Situ Hybridization (PLISH) |
| US11078528B2 (en) | 2015-10-12 | 2021-08-03 | Advanced Cell Diagnostics, Inc. | In situ detection of nucleotide variants in high noise samples, and compositions and methods related thereto |
| US11142800B2 (en) | 2010-10-07 | 2021-10-12 | The General Hospital Corporation | Biomarkers of cancer |
| US20210355485A1 (en) * | 2018-11-21 | 2021-11-18 | Avida Biomed, Inc. | Methods for targeted nucleic acid library formation |
| CN113795592A (en) * | 2019-03-12 | 2021-12-14 | 领先细胞医疗诊断有限公司 | In situ detection of double-stranded nucleic acids and methods relating thereto |
| WO2022029159A1 (en) | 2020-08-04 | 2022-02-10 | Theraxen S.A. | Xeno-nucleotide based branched dna assay for the detection of nucleic acids |
| US11549139B2 (en) | 2018-05-14 | 2023-01-10 | Nanostring Technologies, Inc. | Chemical compositions and methods of using same |
| EP4317972A2 (en) | 2018-02-06 | 2024-02-07 | The General Hospital Corporation | Repeat rna as biomarkers of tumor immune response |
| US12630869B2 (en) | 2023-06-07 | 2026-05-19 | Board Of Regents, The University Of Texas System | Simultaneous quantification of gene expression in a user-defined region of a cross-sectioned tissue |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6264825B1 (en) * | 1998-06-23 | 2001-07-24 | Clinical Micro Sensors, Inc. | Binding acceleration techniques for the detection of analytes |
| US20010014449A1 (en) * | 1993-11-01 | 2001-08-16 | Michael I. Nerenberg | Methods for determination of single nucleic acid polymorphisms using bioelectronic microchip |
| US20020182628A1 (en) * | 1998-10-13 | 2002-12-05 | Ventana Medical Systems, Inc. | Multiple fusion probes |
| US20030198982A1 (en) * | 2000-08-03 | 2003-10-23 | Frank Seela | Nucleic acid binding compounds containing pyrazolo[3,4-d]pyrimidine analogues of purin-2,6-diamine and their uses |
| WO2007002006A2 (en) * | 2005-06-20 | 2007-01-04 | Panomics, Inc. | Multiplex detection of nucleic acids |
| US20070105806A1 (en) * | 2005-11-04 | 2007-05-10 | Dinah Sah | Compositions and methods for inhibiting expression of Nav1.8 gene |
| US20080038559A1 (en) * | 2005-09-13 | 2008-02-14 | Randall True | Miniaturized microparticles |
| US20080051296A1 (en) * | 2006-08-25 | 2008-02-28 | Research Foundation For Mental Hygiene, Inc. | Methods and Compositions For Amplification and Detection of MicroRNAs |
| US20090035762A1 (en) * | 2007-07-30 | 2009-02-05 | Nicholas Michael Sampas | Allele-specific copy number measurement using single nucleotide polymorphism and DNA arrays |
-
2011
- 2011-07-01 US US13/175,582 patent/US20120052498A1/en not_active Abandoned
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20010014449A1 (en) * | 1993-11-01 | 2001-08-16 | Michael I. Nerenberg | Methods for determination of single nucleic acid polymorphisms using bioelectronic microchip |
| US6264825B1 (en) * | 1998-06-23 | 2001-07-24 | Clinical Micro Sensors, Inc. | Binding acceleration techniques for the detection of analytes |
| US20020182628A1 (en) * | 1998-10-13 | 2002-12-05 | Ventana Medical Systems, Inc. | Multiple fusion probes |
| US20030198982A1 (en) * | 2000-08-03 | 2003-10-23 | Frank Seela | Nucleic acid binding compounds containing pyrazolo[3,4-d]pyrimidine analogues of purin-2,6-diamine and their uses |
| WO2007002006A2 (en) * | 2005-06-20 | 2007-01-04 | Panomics, Inc. | Multiplex detection of nucleic acids |
| US20080038559A1 (en) * | 2005-09-13 | 2008-02-14 | Randall True | Miniaturized microparticles |
| US20070105806A1 (en) * | 2005-11-04 | 2007-05-10 | Dinah Sah | Compositions and methods for inhibiting expression of Nav1.8 gene |
| US20080051296A1 (en) * | 2006-08-25 | 2008-02-28 | Research Foundation For Mental Hygiene, Inc. | Methods and Compositions For Amplification and Detection of MicroRNAs |
| US20090035762A1 (en) * | 2007-07-30 | 2009-02-05 | Nicholas Michael Sampas | Allele-specific copy number measurement using single nucleotide polymorphism and DNA arrays |
Non-Patent Citations (1)
| Title |
|---|
| Seth et al. Nucleic Acids Symposium. 2008. Series No. 52 553-554. * |
Cited By (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080038725A1 (en) * | 2005-06-20 | 2008-02-14 | Yuling Luo | Methods of detecting nucleic acids in individual cells and of identifying rare cells from large heterogeneous cell populations |
| US20110059442A1 (en) * | 2005-06-20 | 2011-03-10 | Advanced Cell Diagnostics, Inc. | Multiplex detection of nucleic acids |
| US20110059866A1 (en) * | 2005-06-20 | 2011-03-10 | Advanced Cell Diagnostics, Inc. | Multiplex detection of nucleic acids |
| US8604182B2 (en) | 2005-06-20 | 2013-12-10 | Advanced Cell Diagnostics, Inc. | Multiplex detection of nucleic acids |
| US8951726B2 (en) | 2005-06-20 | 2015-02-10 | Advanced Cell Diagnostics, Inc. | Multiplex detection of nucleic acids |
| US20090081688A1 (en) * | 2005-06-20 | 2009-03-26 | Advanced Cell Diagnostics | Methods of detecting nucleic acids in individual cells and of identifying rare cells from large heterogeneous cell populations |
| US11142800B2 (en) | 2010-10-07 | 2021-10-12 | The General Hospital Corporation | Biomarkers of cancer |
| US8658361B2 (en) | 2010-10-21 | 2014-02-25 | Advanced Cell Diagnostics, Inc. | Ultra sensitive method for in situ detection of nucleic acids |
| US9315854B2 (en) | 2010-10-21 | 2016-04-19 | Advanced Cell Diagnostics, Inc. | Ultra sensitive method for in situ detection of nucleic acids |
| US11268133B2 (en) | 2011-07-01 | 2022-03-08 | Htg Molecular Diagnostics, Inc. | Methods of detecting gene fusions |
| US20140120540A1 (en) * | 2011-07-01 | 2014-05-01 | Htg Molecular Diagnostics, Inc. | Methods of detecting gene fusions |
| US10294515B2 (en) * | 2011-07-01 | 2019-05-21 | Htg Molecular Diagnostics, Inc. | Methods of detecting gene fusions |
| US9783841B2 (en) | 2012-10-04 | 2017-10-10 | The Board Of Trustees Of The Leland Stanford Junior University | Detection of target nucleic acids in a cellular sample |
| US10689687B2 (en) | 2012-10-04 | 2020-06-23 | The Board Of Trustees Of The Leland Stanford Junior University | Detection of target nucleic acids in a cellular sample |
| US9273349B2 (en) | 2013-03-14 | 2016-03-01 | Affymetrix, Inc. | Detection of nucleic acids |
| US10266879B2 (en) | 2013-03-14 | 2019-04-23 | Affymetrix, Inc. | Detection of nucleic acids |
| WO2015120273A1 (en) | 2014-02-07 | 2015-08-13 | The General Hospital Corporation | Differential diagnosis of hepatic neoplasms |
| WO2015123565A1 (en) | 2014-02-14 | 2015-08-20 | The General Hospital Corporation | Methods for diagnosing igg4-related disease |
| WO2015131099A1 (en) | 2014-02-28 | 2015-09-03 | The General Hospital Corporation | Diagnosis of multiple myeloma and lymphoma |
| WO2015200697A1 (en) | 2014-06-25 | 2015-12-30 | The General Hospital Corporation | Targeting human satellite ii (hsatii) |
| US12152241B2 (en) | 2014-06-25 | 2024-11-26 | The General Hospital Corporation | Targeting human satellite II (HSATII) |
| EP3760208A1 (en) | 2014-06-25 | 2021-01-06 | The General Hospital Corporation | Targeting human satellite ii (hsatii) |
| US11078528B2 (en) | 2015-10-12 | 2021-08-03 | Advanced Cell Diagnostics, Inc. | In situ detection of nucleotide variants in high noise samples, and compositions and methods related thereto |
| US11821026B2 (en) | 2016-11-21 | 2023-11-21 | Nanostring Technologies, Inc. | Chemical compositions and methods of using same |
| US10415080B2 (en) | 2016-11-21 | 2019-09-17 | Nanostring Technologies, Inc. | Chemical compositions and methods of using same |
| US12209275B2 (en) | 2016-11-21 | 2025-01-28 | Bruker Spatial Biology, Inc. | Chemical compositions and methods of using same |
| US12049666B2 (en) | 2016-11-21 | 2024-07-30 | Bruker Spatial Biology, Inc. | Chemical compositions and methods of using same |
| US11279969B2 (en) | 2016-11-21 | 2022-03-22 | Nanostring Technologies, Inc. | Chemical compositions and methods of using same |
| US20200224243A1 (en) * | 2017-03-22 | 2020-07-16 | The Board Of Trustees Of The Leland Stanford Junior University | Proximity Ligation in Situ Hybridization (PLISH) |
| EP4317972A2 (en) | 2018-02-06 | 2024-02-07 | The General Hospital Corporation | Repeat rna as biomarkers of tumor immune response |
| US11549139B2 (en) | 2018-05-14 | 2023-01-10 | Nanostring Technologies, Inc. | Chemical compositions and methods of using same |
| US12281356B2 (en) | 2018-05-14 | 2025-04-22 | Bruker Spatial Biology, Inc. | Chemical compositions and methods of using same |
| US20210355485A1 (en) * | 2018-11-21 | 2021-11-18 | Avida Biomed, Inc. | Methods for targeted nucleic acid library formation |
| EP3938535A4 (en) * | 2019-03-12 | 2022-12-28 | Advanced Cell Diagnostics, Inc. | Detection of double stranded nucleic acids in situ and methods related thereto |
| CN113795592A (en) * | 2019-03-12 | 2021-12-14 | 领先细胞医疗诊断有限公司 | In situ detection of double-stranded nucleic acids and methods relating thereto |
| WO2022029159A1 (en) | 2020-08-04 | 2022-02-10 | Theraxen S.A. | Xeno-nucleotide based branched dna assay for the detection of nucleic acids |
| US12630869B2 (en) | 2023-06-07 | 2026-05-19 | Board Of Regents, The University Of Texas System | Simultaneous quantification of gene expression in a user-defined region of a cross-sectioned tissue |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20120172246A1 (en) | Detection of Nucleic Acids | |
| US20120004132A1 (en) | Detection of Nucleic Acids and Proteins | |
| EP2460893B1 (en) | Multiplex detection of nucleic acids | |
| US8426578B2 (en) | Multiplex branched-chain DNA assays | |
| US20240425908A1 (en) | Methods of detecting nucleic acid sequences with high specificity | |
| US20120178081A1 (en) | Methods of Labeling Cells, Labeled Cells, and uses Thereof | |
| US20110195864A1 (en) | Assays for determining telomere length and repeated sequence copy number | |
| US20120003648A1 (en) | Signal Multiplexing and Signal Amplification | |
| EP1880206B1 (en) | Multiplex capture of nucleic acids | |
| US10266879B2 (en) | Detection of nucleic acids | |
| US7927798B2 (en) | Detection of nucleic acids from whole blood | |
| Lu et al. | Application of exonuclease III-aided target recycling in flow cytometry: DNA detection sensitivity enhanced by orders of magnitude | |
| AU2004267398A1 (en) | RNA detection and quantitation | |
| US20090104613A1 (en) | Methods and compositions relating to multiplexed genomic gain and loss assays |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: AFFYMETRIX, INC., CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:NGUYEN, QUAN N.;MCMASTER, GARY K.;MA, YUNQING;AND OTHERS;SIGNING DATES FROM 20111020 TO 20111025;REEL/FRAME:027118/0731 |
|
| AS | Assignment |
Owner name: GENERAL ELECTRIC CAPITAL CORPORATION, AS AGENT, MARYLAND Free format text: SECURITY AGREEMENT;ASSIGNOR:AFFYMETRIX, INC.;REEL/FRAME:028465/0541 Effective date: 20120625 Owner name: GENERAL ELECTRIC CAPITAL CORPORATION, AS AGENT, MA Free format text: SECURITY AGREEMENT;ASSIGNOR:AFFYMETRIX, INC.;REEL/FRAME:028465/0541 Effective date: 20120625 |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |
|
| AS | Assignment |
Owner name: AFFYMETRIX, INC., CALIFORNIA Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:GENERAL ELECTRIC CAPITAL CORPORATION, AS AGENT;REEL/FRAME:037109/0132 Effective date: 20151028 |