US20110319478A1

US20110319478A1 - Compositions to Treat Cardiac Pacing Conditions

Info

Publication number: US20110319478A1
Application number: US13/096,193
Authority: US
Inventors: Vinod Sharma; Xiaohong Qiu
Original assignee: Medtronic Inc
Current assignee: Medtronic Inc
Priority date: 2010-06-04
Filing date: 2011-04-28
Publication date: 2011-12-29
Also published as: US20110301568A1; US20110300107A1; WO2011153253A1; US8734780B2

Abstract

The HCN polynucleotide includes a nucleotide sequence encoding an HCN polypeptide having channel activity. The amino acid sequence of the HCN polypeptide and the amino acid sequence of a reference polypeptide have at least 80% identity, where the reference polypeptide begins with an amino acid selected from amino acids 92-214 and ends with an amino acid selected from amino acids 723-1188 of SEQ ID NO:8. An example of a reference polypeptide is amino acids 214-723 of SEQ ID NO:8. The HCN polynucleotide may be DNA or RNA. The HCN polynucleotide may be present in a vector, such as a viral vector (including, for instance, a single strand adeno-associated virus or a self complementary adeno-associated virus), a transposon vector, or a plasmid vector.

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No. 60/351,836 filed Jun. 4, 2010 and cross reference is hereby made to the commonly assigned related U.S. Application No. XX/XXX,XXX (Attorney Docket Number P0036355.02), entitled “Compositions and Methods to Treat Cardiac Pacing Conditions” and U.S. application Ser. No. XX/XXX,XXX (Attorney Docket Number P0036355.03), entitled “Systems and Methods to Treat Cardiac Pacing Conditions”, filed concurrently herewith and incorporated herein by reference in its entirety.

BACKGROUND

Cardiac contraction in a healthy human heart is initiated by spontaneous excitation of the sinoatrial (“SA”) node, which is located in the right atrium. The electric impulse generated by the SA node travels to the atrioventricular (“AV”) node where it is transmitted to the bundle of His and to the Purkinje network. The fibers in the Purkinje network branch out in many directions to facilitate coordinated contraction of the left and right ventricles. In some disease states, the heart loses some of its natural capacity to pace properly. Such dysfunction is commonly treated by implanting a pacemaker.
While effectively improving the lives of many patients, implantable pacemakers have certain technical limitations. For example, implantable pacemakers rely on a self-contained power source such as a battery and consequently have a limited lifetime before the power source is in need of replacement. Implantable pacemakers also require pacing leads, which may fail and result in loss of therapy. Hence, an otherwise healthy patient may require multiple surgeries to replace the power source, leads, or the entire implantable pacemaker. Also, implantable pacemakers may not directly respond to physiological signals similar to the way the SA node responds to such signals.
Recently, biological methods of influencing a patient's cardiac cells have been developed, some of which include administering biopharmaceutical compositions that affect cardiac pacing. Developments in genetic engineering have produced methods for genetically modifying cardiac cells to modify non-pacemaking cardiac cells to pacemaker-like cardiac cells or regenerate the pacing capabilities of cells in the conduction system of the heart. For example, Johns and Marban (U.S. Pat. No. 6,214,620) describes a method for modulating the excitability of ventricular cells by controlling the regulation of the expression of certain ion channels (e.g. K⁺channels). Marban and Li (PCT Publication No. WO 02/087419) and Sigg et al. (PCT Publication No. WO 05/062890A3) describe methods and systems for modulating electrophysiological behavior of cardiac cells by genetic modification of inwardly rectifying K⁺channels (I_K1) in quiescent ventricular cells.
Another recent biological approach for modulating cardiac pacing involves implanting into the SA node or other suitable heart regions cells having particular ion channels that are commonly referred to as hyperpolarization-activated and cyclic nucleotide-gated (HCN) channels. For example, see Rosen and Robinson (PCT Publication No. WO 02/098286) and Sigg et al. (PCT Publication No. WO 05/062958A2). Physiologically originating in the SA node, the HCN channels play a prominent role in the control of rhythmic electrical heart activity. Cyclic nucleotides modulate the HCN channel activity, and channel activation occurs upon hyperpolarization rather than depolarization. There are four isoforms of HCN channels (HCN1-4), and each has greater or lesser prevalence in different heart regions. Because the HCN isoforms are directly involved in pacemaker current modulation and activation, implantation of HCN-expressing cells into cardiac tissue that is diseased or experiencing conduction blockage is a viable method for regulating cardiac pacemaker function.

SUMMARY OF THE INVENTION

The present invention provides methods for treating a cardiac pacing condition. The method may include administering to a subject in need thereof an effective amount of an HCN polynucleotide. The HCN polynucleotide includes a nucleotide sequence encoding an HCN polypeptide having channel activity. The amino acid sequence of the HCN polypeptide and the amino acid sequence of a reference polypeptide have at least 80% identity, where the reference polypeptide begins with an amino acid selected from amino acids 92-214 and ends with an amino acid selected from amino acids 723-1188 of SEQ ID NO:8. An example of a reference polypeptide is amino acids 214-723 of SEQ ID NO:8. The HCN polynucleotide may be DNA or RNA. The HCN polynucleotide may be present in a vector, such as a viral vector (including, for instance, a single strand adeno-associated virus or a self complementary adeno-associated virus), a transposon vector, or a plasmid vector.
The HCN polynucleotide administered to the subject may be present in a genetically modified cell, and the HCN polynucleotide may be integrated in the genomic DNA of the genetically modified cell, or may be present as part of an extra-chromosomal vector in the cell. The method may further include administering to the subject a second HCN polynucleotide.
The HCN polynucleotide may be administered by introduction of the HCN polynucleotide into cardiac atrium cells or cardiac ventricle cells. Various methods may be used to introduce the HCN polynucleotide, including, for instance, a syringe or a catheter.
The present invention also provides a composition that includes an HCN polynucleotide present in a vector. Preferably, the HCN polynucleotide includes a nucleotide sequence encoding an HCN polypeptide having channel activity, wherein the amino acid sequence of the HCN polypeptide and the amino acid sequence of a reference polypeptide have at least 80% identity, and where the reference polypeptide begins with an amino acid selected from amino acids 92-214 and ends with an amino acid selected from amino acids 723-1188 of SEQ ID NO:8. The composition may further include a pharmaceutically acceptable carrier. The vector may be a viral vector (including, for instance, a single strand adeno-associated virus or a self complementary adeno-associated virus), a transposon vector, or a plasmid vector.
Further provided by the invention is a genetically modified cell that includes an HCN polynucleotide. Preferably, the HCN polynucleotide includes a nucleotide sequence encoding an HCN polypeptide having channel activity, wherein the amino acid sequence of the HCN polypeptide and the amino acid sequence of a reference polypeptide have at least 80% identity, and where the reference polypeptide begins with an amino acid selected from amino acids 92-214 and ends with an amino acid selected from amino acids 723-1188 of SEQ ID NO:8. The HCN polynucleotide may be integrated in the genomic DNA of the genetically modified cell, or may be present as part of an extra-chromosomal vector in the cell. The genetically modified cell may be part of a composition, and the composition may include a pharmaceutically acceptable carrier.
The present invention is also directed to methods that include identifying a distal end of a catheter at a tissue site of a patient and delivering a fluid or polymer that contains an HCN polynucleotide to the tissue site of the patient via the catheter. The identifying may include an electrically sensing contact between a distal end of a catheter and the tissue site of the patient.
The method may further include delivering an electrical stimulus to the cardiac tissue site of the patient to enhance transfer of the HCN polynucleotide to the tissue site via electroporation. The electrical stimulus may be delivered to the tissue site via the catheter, for instance, via an electrode coupled to the catheter and an electrode coupled to a distal tip of a probe extending from the catheter. An example of delivering the the electrical stimulus to the tissue site via the catheter may include delivering the electrical stimulus to the tissue site via an electrode coupled to the catheter and a distal tip of a probe extending from the catheter, the distal tip of the probe is formed from an electrically conductive material. The electrical stimulus may be delivered to the tissue site via an implanted medical device. The electrical stimulus delivered to the tissue site may include a stimulation pulse, or a series of stimulation pulses. The delivering fluid to the tissue site of the patient via the catheter may include delivering fluid to the tissue site of the patient via one or more exit ports of a distal tip of a probe extending from the catheter. The distal tip of the probe may include a needle or may be a helix shaped distal tip. The distal tip of the probe may extend from a body of the catheter upon sensing contact between the tissue site of the patient and the catheter.
Also provided by the present invention is a system that includes a fluid supply, a catheter, and a power supply to generate an electrical stimulus that is delivered to the tissue site. The system may include a pump to drive fluid from the fluid supply through the catheter, and/or the power supply may include an implanted medical device that delivers the electrical stimulus to the tissue site. The implanted medical device may include one of an implantable pulse generator, an implantable cardioverter/defibrillator, and an implantable pacemaker/cardioverter/defibrillator. The fluid supply may include an implanted fluid reservoir. The power supply may be coupled to the catheter, and the catheter may deliver the electrical stimulus to the tissue site.
The catheter of the system may include a catheter body that defines an inner lumen, a probe within the inner lumen that delivers fluid from the fluid supply to a tissue site of a patient, and at least one electrode coupled to the catheter to detect contact between the catheter and the tissue site, wherein the fluid comprises an HCN polynucleotide described herein. The probe may include a distal tip made from an electrically conductive material, and the electrode may be coupled to the catheter body, where the catheter delivers the electrical stimulus to the tissue site via the electrode coupled to the catheter body and the distal tip of the probe. The catheter may include a pair of electrodes, a first electrode coupled to the probe and a second electrode coupled to the catheter body, where the catheter delivers the electrical stimulus to the tissue site via the electrode coupled to the catheter body and the electrode coupled to the probe. The electrical stimulus delivered to the tissue site may include a stimulation pulse or a series of stimulation pulses. The fluid may include a polymer.
As used herein, an “isolated” substance is one that has been removed from its natural environment, produced using recombinant techniques, or chemically or enzymatically synthesized. For instance, a polypeptide, a polynucleotide, or a cell can be isolated. Preferably, a substance is purified, i.e., is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated.
As used herein, the term “polynucleotide” refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides, and includes both double- and single-stranded RNA and DNA. A polynucleotide can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic, or chemical techniques. A polynucleotide can be linear or circular in topology. A polynucleotide may be, for example, a portion of a vector, such as an expression or cloning vector, or a fragment. A polynucleotide may include nucleotide sequences having different functions, including, for instance, coding regions, and non-coding regions such as regulatory regions.
As used herein, the terms “coding region” and “coding sequence” are used interchangeably and refer to a nucleotide sequence that encodes a polypeptide and, when placed under the control of appropriate regulatory sequences, expresses the encoded polypeptide. The boundaries of a coding region are generally determined by a translation start codon at its 5′ end and a translation stop codon at its 3′ end. A “regulatory sequence” is a nucleotide sequence that regulates expression of a coding sequence to which it is operably linked. Non-limiting examples of regulatory sequences include promoters, enhancers, transcription initiation sites, translation start sites, translation stop sites, and transcription terminators. The term “operably linked” refers to a juxtaposition of components such that they are in a relationship permitting them to function in their intended manner A regulatory sequence is “operably linked” to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory sequence.
A polynucleotide that includes a coding region may include heterologous nucleotides that flank one or both sides of the coding region. As used herein, “heterologous nucleotides” refer to nucleotides that are not normally present flanking a coding region that is present in a wild-type cell. For instance, a coding region present in a wild-type cell and encoding an HCN polypeptide is flanked by homologous sequences, and any other nucleotide sequence flanking the coding region is considered to be heterologous. Examples of heterologous nucleotides include, but are not limited to regulatory sequences. Typically, heterologous nucleotides are present in a polynucleotide of the present invention through the use of standard genetic and/or recombinant methodologies well known to one skilled in the art. A polynucleotide of the present invention may be included in a suitable vector.
As used herein, an “exogenous polynucleotide” refers to a polynucleotide that has been introduced into a cell by artificial means. As used herein, the term “endogenous polynucleotide” refers to a polynucleotide that is normally or naturally found in a cell. An “endogenous polynucleotide ” is also referred to as a “native polynucleotide.”
The terms “complement” and “complementary” as used herein, refer to the ability of two single stranded polynucleotides to base pair with each other, where an adenine on one strand of a polynucleotide will base pair to a thymine or uracil on a strand of a second polynucleotide, and a cytosine on one strand of a polynucleotide will base pair to a guanine on a strand of a second polynucleotide. Two polynucleotides are complementary to each other when a nucleotide sequence in one polynucleotide can base pair with a nucleotide sequence in a second polynucleotide. For instance, 5′-ATGC and 5′-GCAT are complementary. The term “substantial complement” and cognates thereof as used herein, refer to a polynucleotide that is capable of selectively hybridizing to a specified polynucleotide under stringent hybridization conditions. Stringent hybridization can take place under a number of pH, salt and temperature conditions. The pH can vary from 6 to 9, preferably 6.8 to 8.5. The salt concentration can vary from 0.15 M sodium to 0.9 M sodium, and other cations can be used as long as the ionic strength is equivalent to that specified for sodium. The temperature of the hybridization reaction can vary from 30° C. to 80° C., preferably from 45° C. to 70° C. Additionally, other compounds can be added to a hybridization reaction to promote specific hybridization at lower temperatures, such as at or approaching room temperature. Among the compounds contemplated for lowering the temperature requirements is formamide. Thus, a polynucleotide is typically substantially complementary to a second polynucleotide if hybridization occurs between the polynucleotide and the second polynucleotide. As used herein, “specific hybridization” refers to hybridization between two polynucleotides under stringent hybridization conditions.
As used herein, the term “polypeptide” refers broadly to a polymer of two or more amino acids joined together by peptide bonds. The term “polypeptide” also includes molecules which contain more than one polypeptide joined by a disulfide bond, or complexes of polypeptides that are joined together, covalently or noncovalently, as multimers (e.g., dimers, tetramers). Thus, the terms peptide, oligopeptide, enzyme, and protein are all included within the definition of polypeptide and these terms are used interchangeably. It should be understood that these terms do not connote a specific length of a polymer of amino acids, nor are they intended to imply or distinguish whether the polypeptide is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring.
As used herein, “identity” refers to sequence similarity between two polypeptides or two polynucleotides. The sequence similarity between two polypeptides is determined by aligning the residues of the two polypeptides (e.g., a candidate amino acid sequence and a reference amino acid sequence, such as SEQ ID NO:2, 4, 6, or 8, or a portion thereof) to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of shared amino acids, although the amino acids in each sequence must nonetheless remain in their proper order. The sequence similarity is typically at least 80% identity, at least 81% identity, at least 82% identity, at least 83% identity, at least 84% identity, at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity. Sequence similarity may be determined, for example, using sequence techniques such as the BESTFIT algorithm in the GCG package (Madison Wis.), or the Blastp program of the BLAST 2 search algorithm, as described by Tatusova, et al. (FEMS Microbiol Lett 1999, 174:247-250), and available through the World Wide Web, for instance at the internet site maintained by the National Center for Biotechnology Information, National Institutes of Health. Preferably, sequence similarity between two amino acid sequences is determined using the Blastp program of the BLAST 2 search algorithm. Preferably, the default values for all BLAST 2 search parameters are used, including matrix=BLOSUM62; open gap penalty=11, extension gap penalty=1, gap x_dropoff=50, expect=10, wordsize=3, and optionally, filter on. In the comparison of two amino acid sequences using the BLAST search algorithm, structural similarity is referred to as “identities.”
The sequence similarity between two polynucleotides is determined by aligning the residues of the two polynucleotides (e.g., a candidate nucleotide sequence and a reference nucleotide sequence, such as SEQ ID NO:1, 3, 5, 7, or a portion thereof) to optimize the number of identical nucleotides along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of shared nucleotides, although the nucleotides in each sequence must nonetheless remain in their proper order. The sequence similarity is typically at least 80% identity, at least 81% identity, at least 82% identity, at least 83% identity, at least 84% identity, at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity. Sequence similarity may be determined, for example, using sequence techniques such as GCG FastA (Genetics Computer Group, Madison, Wis.), MacVector 4.5 (Kodak/IBI software package) or other suitable sequencing programs or methods known in the art. Preferably, sequence similarity between two nucleotide sequences is determined using the Blastn program of the BLAST 2 search algorithm, as described by Tatusova, et al. (1999, FEMS Microbiol Lett., 174:247-250), and available through the World Wide Web, for instance at the internet site maintained by the National Center for Biotechnology Information, National Institutes of Health. Preferably, the default values for all BLAST 2 search parameters are used, including reward for match=1, penalty for mismatch=−2, open gap penalty=5, extension gap penalty=2, gap x_dropoff=50, expect=10, wordsize=11, and optionally, filter on. In the comparison of two nucleotide sequences using the BLAST search algorithm, sequence similarity is referred to as “identities.”
Conditions that “allow” an event to occur or conditions that are “suitable” for an event to occur, such as an enzymatic reaction, or “suitable” conditions are conditions that do not prevent such events from occurring. Thus, these conditions permit, enhance, facilitate, and/or are conducive to the event.
As used herein, “genetically modified cell” refers to a cell into which has been introduced an exogenous polynucleotide, e.g., an expression vector. For example, a cell is a genetically modified cell by virtue of introduction into a suitable cell of an exogenous polynucleotide that is foreign to the cell, or an exogenous polynucleotide that encodes a polypeptide that is normally present in the cell. “Genetically modified cell” also refers to a cell that has been genetically manipulated such that endogenous nucleotides have been altered. For example, a cell is a genetically modified cell by virtue of introduction into a suitable cell of an alteration of endogenous nucleotides. For instance, an endogenous coding region could be mutagenized. Such mutations may result in a polypeptide having a different amino acid sequence than was encoded by the endogenous polynucleotide. Another example of a genetically modified cell is one having an altered regulatory sequence, such as a promoter, to result in increased or decreased expression of an operably linked endogenous coding region.
The term “and/or” means one or all of the listed elements or a combination of any two or more of the listed elements.
The words “preferred” and “preferably” refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the invention.
The terms “comprises” and variations thereof do not have a limiting meaning where these terms appear in the description and claims.
Unless otherwise specified, “a,” “an,” “the,” and “at least one” are used interchangeably and mean one or more than one.
Also herein, the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. Multiple sequence alignment of a human HCN1 (SEQ ID NO:2), a human HCN2 (SEQ ID NO:4), a human HCN3 (SEQ ID NO:6), and a human HCN4 (SEQ ID NO:8). The six α-helical segments (S1-S6), the pore helix (PoreH), the selectivity filter (SF), and the cyclic-nucleotide binding domain (CNBD) are depicted.

FIG. 2. Nucleotide sequence encoding a human HCN1 (SEQ ID NO:1), a human HCN2 (SEQ ID NO:3), a human HCN3 (SEQ ID NO:5), and a human HCN4 (SEQ ID NO:7), and the corresponding amino acid sequences of the HCN1 (SEQ ID NO:2), the HCN2 (SEQ ID NO:4), the HCN3 (SEQ ID NO:6), and the HCN4 (SEQ ID NO:8) polypeptides.

FIG. 3. Biological pacemaker from AV node ablated canine injected with the hHCN4t coding region carried by adenovirus vector. A significant increase in ventricular heart rate was observed following Adv-hHCN4t administration. Biological pacemaker reached a peak on day 2 and maintained a rate at peak level through termination at one week.

FIG. 4. Sequence homology between canine and human HCN4 coding regions. In comparison with each other, human and canine share high similarity in RNA sequence blocks of I, II and III (92, 95%, and 91% respectively). Other areas (in front of I block, between I to II and II to III blocks, and after block III) display significant distinctive sequences within these two species.

FIG. 5. Schematic diagram of proposed membrane topology of a HCN channel subunit.

FIG. 6. Three different super-truncated versions of HCN4 (HCN4st) in comparison with HCN4wt and HCN4t.

FIG. 7. Schematic diagram of generating super-truncated HCN4 plasmids for biological pacemaker gene therapy.

FIG. 8. Confirmation of functionality of HCN4st1 using patch clamp experiments. The panel on the left shows current responses as the cell membrane is pulsed to increasing hyperpolarizing voltages from a positive holding potential at which HCN4 channels are closed. The right panel shows the current-voltage relationship using two different pulse protocols. The electrophysiology of the channel, including reversal potential, is unaltered compared to its wild typed (wtHCN4) and truncated (HCN4t) counterparts.

FIG. 9. Cell image and recordings obtained using a micro-electrode array (MEA) of non-transduced neo-natal rat venetricular myocytes (NRVMs).

FIG. 10. Cell image and MEA recordings obtained from NRVM cells transduced with 10¹¹vg/ml of B-AAV1-HCN4st1 virus.

FIG. 11. MEA recordings obtained from NRVMs transduced with 10¹⁰-10⁸vg/ml of B-AAV1-HCN4st1 virus.

FIG. 12. Time course of NRVMs beating rates following transduction with B-AAV1-HCN4st1 at various doses.

FIG. 13. Time course of NRVMs beating rates after transduction with B-AAV1-empty vector at various doses.

FIG. 14. Biological pacemaker from AV node ablated canine injected with hHCN4st1 gene.

FIG. 15. Nucleotide sequence of HCN4 with MyC fusion.

DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

Polypeptides

The present invention includes isolated polypeptides having hyperpolarization-activated and cyclic nucleotide-gated channel activity, also referred to herein as channel activity. A polypeptide having channel activity is referred to herein as an HCN polypeptide. An HCN polypeptide includes at least three domains, the transmembrane core, the cytosolic N-terminal domain, and the cytosolic C-terminal domain (Wahl-Schott and Biel, 2009, Coll. Mol. Life Sci., 66:470-494). The transmembrane core includes six α-helical segments (S1-S6) and an ion conducting pore loop between S5 and S6 (see FIG. 6). A highly conserved asparagine residue is typically present in the extracellular loop between S5 and the pore loop (Much et al., 2003, J. Biol. Chem. 278:43781-43786). The pore loop typically includes a glycine-tyrosine-glycine (GYG) motif The voltage sensor of HCN polypeptides is formed by a charged S4-helix carrying a series of arginine or lysine residues regularly spaced at every third position (Vaca et al., 2000, FEBS Lett., 479:35-40), optionally including a serine residue (Chen et al., 2000, J. Biol. Chem., 275:36465-36471). There is evidence suggesting that the loop connecting the S4 with the S5 segment plays a role in conferring the differential response to voltage (Long et al., 2005, Science, 309:903-908, Decher et al., 2004, J. Biol. Chem., 279:13859-13865, and Prole et al., 2006, J. Gen. Physiol. 128:273-282). The proximal portion of the cytosolic C-terminus mediates the sensitivity of HCN polypeptides to cAMP (Zagotta et al., 2003, Nature, 425:200-205). This part of an HCN polypeptide includes a cyclic nucleotide-binding domain of about 120 amino acids (CNBD) and an 80 amino acid long linker region that connects the CNBD with the S6 segment.
Examples of HCN polypeptides useful in the methods described herein are depicted at SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8. In some embodiments an HCN polypeptide useful in the methods disclosed herein is truncated at the amino terminal end. Typically, such a truncation may result in the deletion of amino acids up to, but not including, amino acids corresponding to the S1 α-helical segment. For instance, with reference to the HCN polypeptide depicted at SEQ ID NO:8, the truncation may be from amino acid 1 to amino acid 258, 257, 256, 255, 254, 253, 252, 251, 250, 249, 248, 247, 246, 245, 244, 243, 242, 241, 240, 239, 238, 237, 236, 235, 234, 233, 232, 231, 230, 229, 228, 227, 226, 225, 224, 223, 222, 221, 220, 219, 218, 217, 216, 215, 214, 213, 212, 211, or 210, and so on up to the second amino acid of SEQ ID NO:8. In some embodiments an HCN polypeptide is truncated at the carboxy terminal end. Typically, such a truncation may result in the deletion of amino acids from the carboxy terminal end up to the amino acids that make up the CNBD domain. For instance, with reference to the HCN polypeptide depicted at SEQ ID NO:8, the truncation may begin at amino acid 723 (i.e., amino acids 723 to the last amino acid, 1203, are not present), 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, or 741, and so on up to amino acid 1202 of SEQ ID NO:8.
In some embodiments, an HCN polypeptide useful in the methods described herein includes a truncation at both the amino terminal and carboxy terminal ends. Accordingly, an HCN polypeptide of the present invention may include an amino acid sequence corresponding to a core region selected from the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8. The core region may be, for instance, amino acids 139-603 of SEQ ID NO:2, 208-672 of SEQ ID NO:4, 80-545 of SEQ ID NO:6, or 214-723 of SEQ ID NO:8, and may optionally include additional amino acids located on the amino terminal end and/or the carboxy terminal end. Such additional amino acids may be selected from the corresponding regions of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8, or may be other amino acid sequences as discussed herein. For instance, in one aspect an HCN polypeptide may have an amino acid sequence beginning with an amino acid selected from amino acids 92-214 of SEQ ID NO:8 and ending with an amino acid selected from amino acids 723-1188 of SEQ ID NO:8. Specific examples of HCN polypeptides include, but are not limited to, a core region from SEQ ID NO:8 beginning at amino acid 213, 214, 221, or 226, and ending at amino acid 723, 738, or 753.
Other examples of HCN polypeptides include those having sequence similarity with a region selected from the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8. An HCN polypeptide having sequence similarity with the region selected from the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8 has channel activity. An HCN polypeptide may be isolated from a eukaryotic cell, such as a vertebrate cell or an invertebrate cell. Examples of suitable vertebrate cells include, but are not limited to, cells obtained from members of the Family Canidae (such as dogs), members of the Family Suidae (such as pigs), members of the Family Muridae (such as rats and mice), members of the genus Ovis (such as sheep), non-human primates, and human cells. An HCN polypeptide may be produced using recombinant techniques, or chemically or enzymatically synthesized using routine methods.
HCN polypeptides form channels that are unique among vertebrate voltage-gated ion channels: they have a reverse voltage dependence that leads to activation upon hyperpolarization. In addition, voltage-dependent opening of these channels is directly regulated by the binding of cAMP. HCN polypeptides activate upon hyperpolarization with a characteristic sigmoidal time course. An HCN polypeptide having channel activity will display a reverse voltage dependence that leads to activation upon hyperpolarization under suitable conditions. Suitable conditions typically include the expression of an HCN polypeptide in a cell such that it can form channels, and then assaying for activation upon hyperpolarization. Suitable assays include whole cell patch clamp analysis and microelectrode array. Preferably, whole cell patch clamp analysis is used. Methods for whole cell patch clamp analysis are known and routine in the art (Hamill, 1981, Pflugers Arch., 391(2):85-100). An example of a whole cell patch clamp assay is described in Example 1. A polypeptide that leads to functional HCN4 current under suitable conditions is considered to have channel activity and to be an HCN polypeptide, while a polypeptide that does not lead to functional HCN4 current under suitable conditions is considered to not have channel activity and is not an HCN polypeptide.
The amino acid sequence of an HCN polypeptide having sequence similarity to a region of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8 may include conservative substitutions. A conservative substitution is typically the substitution of one amino acid for another that is a member of the same class. For example, it is well known in the art of protein biochemistry that an amino acid belonging to a grouping of amino acids having a particular size or characteristic (such as charge, hydrophobicity, and/or hydrophilicity) may generally be substituted for another amino acid without substantially altering the secondary and/or tertiary structure of a polypeptide. For the purposes of this invention, conservative amino acid substitutions are defined to result from exchange of amino acids residues from within one of the following classes of residues: Class I: Gly, Ala, Val, Leu, and Ile (representing aliphatic side chains); Class II: Gly, Ala, Val, Leu, Ile, Ser, and Thr (representing aliphatic and aliphatic hydroxyl side chains); Class III: Tyr, Ser, and Thr (representing hydroxyl side chains); Class IV: Cys and Met (representing sulfur-containing side chains); Class V: Glu, Asp, Asn and Gln (carboxyl or amide group containing side chains); Class VI: His, Arg and Lys (representing basic side chains); Class VII: Gly, Ala, Pro, Trp, Tyr, Ile, Val, Leu, Phe and Met (representing hydrophobic side chains); Class VIII: Phe, Trp, and Tyr (representing aromatic side chains); and Class IX: Asn and Gln (representing amide side chains). The classes are not limited to naturally occurring amino acids, but also include artificial amino acids, such as beta or gamma amino acids and those containing non-natural side chains, and/or other similar monomers such as hydroxyacids. SEQ ID NOs:2, 4, 6, and 8 are shown in FIG. 1 in a multiple protein alignment. Identical and conserved amino acids are marked. Also depicted are those regions corresponding to the six α-helical segments, the PoreH, the SF, and the CNBD domains. This information, and other information regarding conserved regions of HCN polypeptides described herein, permit the skilled person to predict whether alterations to the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8 are likely to result in an HCN polypeptide having channel activity.
Guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al. (1990, Science, 247:1306-1310), wherein the authors indicate proteins are surprisingly tolerant of amino acid substitutions. For example, Bowie et al. disclose that there are two main approaches for studying the tolerance of a polypeptide sequence to change. The first method relies on the process of evolution, in which mutations are either accepted or rejected by natural selection. The second approach uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene and selects or screens to identify sequences that maintain functionality. As stated by the authors, these studies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which changes are likely to be permissive at a certain position of the protein. For example, most buried amino acid residues require non-polar side chains, whereas few features of surface side chains are generally conserved. Other such phenotypically silent substitutions are described in Bowie et al, and the references cited therein.
In some aspects an HCN polypeptide may include specific mutations in the region linking the S3 and S4 segments (e.g., amino acids 360-367 of SEQ ID NO:8). Such mutations are depicted in Table 1 (see Sigg et al., U.S. Patent Application Publication 2009/0099611.

TABLE 1

		S3-S4 linker
SEQ ID		(amino acids
NO:	Mutant	360-368)

9	Wild-type HCN4	ETRIDSEVY

10	T360A	EARIDSEVY

11	Δ363-367	ETRI

12	T360A, Δ363-367	EARI

13	TRI360-362AGM	EAGMDSEVY

14	TRI360-362KGM	EKGMDSEVY

15	T360A, I362M	EARMDSEVY

16	T360A, Δ365-367	EARIDS

17	E365G	ETRIDSGVY

18	E365A	ETRIDSAVY

19	R361G	ETGIDSEVY

20	TR360-361AA	EAAIDSEVY

21	I362C	ETRCDSEVY

22	I362S	ETRSDSEVY

23	I362T	ETRTDSEVY

24	TRI360-362AGM,	EAGM
	Δ363-367

An HCN polypeptide may be expressed as a fusion polypeptide that includes an HCN polypeptide and an additional amino acid sequence. For instance, the additional amino acid sequence may be useful for purification of the fusion polypeptide by affinity chromatography. Various methods are available for the addition of such affinity purification moieties to proteins. Examples of affinity tags include a polyhistidine-tag and a MyC-tag (see, for instance, Hopp et al. (U.S. Pat. No. 4,703,004), Hopp et al. (U.S. Pat. No. 4,782,137), Sgarlato (U.S. Pat. No. 5,935,824), and Sharma Sgarlato (U.S. Pat. No. 5,594,115)). In another example, the additional amino acid sequence may be useful fortagging the fusion polypeptide to aid in identification of the polypeptide in various conditions, including in a tissue or in a cell.

Polynucleotides

The present invention also includes isolated polynucleotides encoding an HCN polypeptide described herein. A polynucleotide encoding a polypeptide having channel activity is referred to herein as an HCN polynucleotide. HCN polynucleotides may have a nucleotide sequence encoding a polypeptide having the amino acid sequence shown in SEQ ID
NO:2, SEQ ID NO:4, SEQ ID NO:6, or SEQ ID NO:8, or region of one of those amino acid sequences, as described herein. An example of the class of nucleotide sequences encoding a region of a polypeptide disclosed at SEQ ID NO:2, 4, 6, or 8 is the corresponding region of SEQ ID NO:1, 3, 5, or 7, respectively. It should be understood that a polynucleotide encoding an HCN polypeptide represented by, for instance, SEQ ID NO:8, or a portion thereof, is not limited to the nucleotide sequence disclosed at SEQ ID NO:7, but also includes the class of polynucleotides encoding such polypeptides as a result of the degeneracy of the genetic code. For example, the naturally occurring nucleotide sequence SEQ ID NO:7 is but one member of the class of nucleotide sequences encoding a polypeptide having the amino acid sequence SEQ ID NO:8. The class of nucleotide sequences encoding a selected polypeptide sequence is large but finite, and the nucleotide sequence of each member of the class may be readily determined by one skilled in the art by reference to the standard genetic code, wherein different nucleotide triplets (codons) are known to encode the same amino acid. It should be understood that any nucleotide sequence taught herein also includes the complement thereof, and the corresponding RNA sequences.
An HCN polynucleotide of the present invention may have sequence similarity with the nucleotide sequence of SEQ ID NO:1, 3, 5, or 7. HCN polynucleotides having sequence similarity with the nucleotide sequence of SEQ ID NO:3 encode an HCN polypeptide. An HCN polynucleotide may be isolated from a vertebrate cell or an invertebrate cell, or may be produced using recombinant techniques, or chemically or enzymatically synthesized. An HCN polynucleotide may further include heterologous nucleotides flanking the open reading frame encoding the HCN polypeptide. Typically, heterologous nucleotides may be at the 5′ end of the coding region, at the 3′ end of the coding region, or the combination thereof The number of heterologous nucleotides may be, for instance, at least 10, at least 100, or at least 1000.
HCN polynucleotides may be obtained from a eukaryotic cell, such as a vertebrate cell or an invertebrate cell. Examples of suitable vertebrate cells include, but are not limited to, cells obtained from members of the Family Canidae, and human cells. HCN polynucleotides may be produced in vitro or in vivo. For instance, methods for in vitro synthesis include, but are not limited to, chemical synthesis with a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic polynucleotides and reagents for such synthesis are well known.
An HCN polynucleotide may be present in a vector. A vector is a replicating polynucleotide, such as a plasmid, phage, or cosmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. Construction of vectors containing a polynucleotide of the invention employs standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual., Cold Spring Harbor Laboratory Press (1989). A vector may provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of the polynucleotide, i.e., an expression vector. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, and artificial chromosome vectors. In some aspects preferred vectors include those useful for gene therapy, e.g., vectors that can be administered to a subject to result in transient or sustained expression of a coding region to result in a beneficial polypeptide. A large variety of such vectors are known in the art and are readily available. Examples of vectors useful in gene therapy include isolated nucleic acid, e.g., plasmid-based vectors which may be extrachromosomally maintained, including minicircle vectors; viral vectors, e.g., recombinant adenovirus, retrovirus, lentivirus, herpesvirus, poxvirus, papilloma virus, or adeno-associated virus; and transposons, e.g., recombinant transposons such as Sleeping Beauty and piggyBac. Preferred examples of vectors include single strand adeno-associated virus (ssAAV) and self complementary AAV (scAAV), a modified adeno-associated virus that bypasses the required second-strand DNA synthesis to achieve transcription of the coding region (McCarty, 2008, Mol Ther., 16:1648-1656). Useful ssAAV vectors and scAAV vectors are commercially available from, for instance, Virovek, Hayward, Calif.
Selection of a vector depends upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like. In some aspects, suitable host cells for cloning or expressing the vectors herein include eukaryotic cells. Suitable eukaryotic cells include fungi and mammalian cells. In other aspects, suitable host cells for cloning or expressing the vectors herein include prokaryotic cells. Suitable prokaryotic cells include eubacteria, such as gram-negative microbes, for example, E. coil. Vectors may be introduced into a host cell using methods that are known and used routinely by the skilled person. For example, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer are common methods for introducing nucleic acids into host cells.
An expression vector optionally includes regulatory sequences operably linked to the coding region. An example of a regulatory sequence includes a promoter. The invention is not limited by the use of any particular promoter, and a wide variety of promoters are known. Promoters act as regulatory signals that bind RNA polymerase in a cell to initiate transcription of a downstream (3′ direction) coding region. The promoter used may be a constitutive or an inducible promoter. It may be, but need not be, heterologous with respect to the host cell.
In some aspects, tissue-specific promoters may be used. Tissue-specific expression may enhance the safety of a therapy described herein as expression in non-target tissue becomes less likely. For example, cardiac tissue specific promoters allow cardiac myocyte specific expression of the coding region of interest (including expression in stem cells with cardiac phenotype). Examples of cardiac tissue specific promoters include, but are not limited to, promoters from the following coding regions: an α-myosin heavy chain coding region, e.g., a ventricular α-myosin heavy chain coding region, β-myosin heavy chain coding region, e.g., a ventricular β-myosin heavy chain coding region, myosin light chain 2v coding region, e.g., a ventricular myosin light chain 2 coding region, myosin light chain 2a coding region, e.g., a ventricular myosin light chain 2 coding region, cardiomyocyte-restricted cardiac ankyrin repeat protein (CARP) coding region, cardiac α-actin coding region, cardiac m2 muscarinic acetylcholine coding region, ANP coding region, BNP coding region, cardiac troponin C coding region, cardiac troponin I coding region, cardiac troponin T coding region, cardiac sarcoplasmic reticulum Ca-ATPase coding region, and skeletal α-actin coding region. Further, chamber-specific promoters or enhancers may also be employed, e.g., for atrial-specific expression, the quail slow myosin chain type 3 (MyHC3) or ANP promoter may be used. Examples of ventricular myocyte-specific promoters include a ventricular myosin light chain 2 promoter and a ventricular myosin heavy chain promoter.
Other useful promoters, for example, would be sensitive to electrical stimulus that could be provided from, for example, an implantable device. Electrical stimulation can promote gene expression (Padua et al., U.S. Patent Application No. 2003/0204206 A1).
Other regulatory regions include drug-sensitive elements (e.g., a drug-inducible suppressor or promoter). Drug-responsive promoters may induce or suppress expression of an operably linked coding region. For example, a tetracycline responsive element (TRE) that binds doxycycline may present within a promoter construct. When doxycycline is removed, transcripton from the TRE is turned off in a dose-dependent manner. Examples of inducible drug-responsive promoters are the ecdysone-inducible promoter (Johns and Marban, U.S. Pat. No. 6,214,620) and rapamycin-dependent expression (Clackson et al., U.S. Pat. No. 6,506,379, see also Discher et al., 1998, J. Biol. Chem., 273:26087-26093; Prentice et al., 1997, Cardiovascular Res., 35: 567-576).
Further examples of regulatory regions include enhancers, such as cardiac enhancers, to increase the expression of an operably linked coding region in cardiac tissue, such as regions of the cardiac conduction system. Such enhancer elements may include the cardiac specific enhancer elements derived from Csx/Nkx2.5 regulatory regions (Lee and Izumo, U.S. Patent Application 2002/0022259) or the cGATA-6 enhancer.
An expression vector may optionally include a ribosome binding site and a start site (e.g., the codon ATG) to initiate translation of the transcribed message to produce the polypeptide. It may also include a termination sequence to end translation. A termination sequence is typically a codon for which there exists no corresponding aminoacetyl-tRNA, thus ending polypeptide synthesis. The polynucleotide used to transform the host cell may optionally further include a transcription termination sequence.
A vector introduced into a host cell optionally includes one or more marker sequences, which typically encode a molecule that inactivates or otherwise detects or is detected by a compound in the growth medium. For example, the inclusion of a marker sequence may render the transformed cell resistant to an antibiotic, or it may confer compound-specific metabolism on the transformed cell. Selectable markers can be positive, negative or bifunctional. Positive selectable markers allow selection for cells carrying the marker, whereas negative selectable markers allow cells carrying the marker to be selectively eliminated. A variety of such marker genes have been described, including bifunctional (i.e., positive/negative) markers (see, e.g., Lupton, PCT Publication Nos. WO 92/08796 and WO 94/28143). Such marker genes can provide an added measure of control that can be advantageous in gene therapy contexts.
Polypeptides useful in the present invention may be produced using recombinant DNA techniques, such as an expression vector present in a cell. Such methods are routine and known in the art. The polypeptides may also be synthesized in vitro, e.g., by solid phase peptide synthetic methods. The solid phase peptide synthetic methods are routine and known in the art. A polypeptide produced using recombinant techniques or by solid phase peptide synthetic methods may be further purified by routine methods, such as fractionation on immunoaffinity or ion-exchange columns, ethanol precipitation, reverse phase HPLC, chromatography on silica or on an anion-exchange resin such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation, gel filtration using, for example, Sephadex G-75, or ligand affinity.
The present invention also includes genetically modified cells that have an HCN polynucleotide encoding an HCN polypeptide. Compared to a control cell that is not genetically modified according to the present invention, a genetically modified cell may exhibit production of an HCN polypeptide. A polynucleotide encoding an HCN polypeptide may be present in the cell as an extrachromosomal vector or integrated into a chromosome. Examples of cells include, but are not limited to, excitable cells, such as cardiomyocytes and HL-5 cells; and non-excitable cells, such as stem cells, fibroblasts, mesenchymal cells, and HEK293 cells. In some aspects the cells may also be modified to express connexions or gap junctions. The coding regions encoding connexion polypeptides are readily available to the skilled person.
A genetically modified cell may be ex vivo or in vivo. “Ex vivo” refers to a cell that has been removed from the body of an animal. Ex vivo cells include, for instance, primary cells (e.g., cells that have recently been removed from a animal and are capable of limited growth in tissue culture medium), and cultured cells (e.g., cells that are capable of long term culture in tissue culture medium). “In vivo” refers to cells that are present within the body of an animal.

Compositions

The present invention is also directed to compositions including an HCN polynucleotide, HCN polypeptide, or genetically modified cell. Such compositions typically include a pharmaceutically acceptable carrier. As used herein “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Additional active compounds can also be incorporated into the compositions.
A composition may be prepared by methods well known in the art of pharmacy. In general, a composition can be formulated to be compatible with its intended route of administration. Solutions or suspensions can include the following components: a sterile diluent such as water for administration, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfate; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates; electrolytes, such as sodium ion, chloride ion, potassium ion, calcium ion, and magnesium ion, and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. A composition can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
Compositions can include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline. A composition is typically sterile and, when suitable for injectable use, should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Sterile solutions can be prepared by incorporating the active compound (e.g., an HCN polynucleotide, or, in some aspects, an HCN polypeptide or genetically modified cell) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
An active compound may be administered by any route including, but not limited to, intramuscular, buccal, rectal, intravenous or intracoronary administration, and transfer to cells may be enhanced using electroporation and/or iontophoresis. Administration may be systemic or local. In some aspects local administration may have advantages for site-specific, targeted disease management. Local therapies may provide high, clinically effective concentrations directly to the treatment site, without causing systemic side effects. Examples of locations to which an active compound can be targeted include, but are not limited to, the right or left atrium, including the sinoatrial node, the right or left ventricle, including the atrioventricular node. For instance, endocardial or myocardial cells of an atrium or a ventricle may be targeted. In some aspects, an HCN polynucleotide can be implanted in, or downstream from, the conduction pathway, in a heart region that is experiencing or may experience poor conduction. For example, if cardiac contraction is not being properly initiated by the SA node but the AV node conduction is intact, an HCN polynucleotide may be implanted in the myocardium of the SA node or the right atrium to cause the targeted region to depolarize and create electric impulses that will travel to the AV node. Alternatively, if cardiac contraction is not being properly conducted by the AV node then an HCN polynucleotide may be implanted downstream in the conduction pathway from the right atrium, i.e. in the bundle of His, the Purkinje network, or one of the ventricles. Other delivery sites include, but are not limited to, left ventricular epicardium.
Examples of routes of administration include the use of a delivery tool, such as a syringe for direct injection into cardiac tissue (for instance, during open heart surgery) or by catheter. For instance, one type of catheter useful in the methods described herein has electric sensing capabilities, which permits introduction of an active compound directly into the targeted cardiac tissue. The delivery tool may include electrodes for sensing electric activity and delivering pacing stimuli in order to determine the desired location for the biological pacemakers. Once the location is determined, an active compound is delivered to the cardiac tissue. The delivery tool may include an injection device that injects the active compound into cardiac tissue. One suitable method for injecting a genetic construct directly into the myocardium is described by Guzman et al., 1993, Circ. Res., 73:1202-1207. Furthermore, a delivery system for delivering genetic material to a targeted heart region is described in Laske et al. (U.S. Pat. No. 7,103,418) and Stokes et al. (PCT Publication No. WO 98/02150). Systems for myocardial, endocardial, sub-epicardial and epicardial delivery are described in Sullivan and Hezi-Yamit (U.S. Published Patent Application 20100137976), Hiniduma-Lokuge et al. (PCT Publication No. WO/2008/055001), and Sommer et al., (U.S. Pat. No. 7,274,966 and U.S. Pat. No. 7,187,971). Alternatively, genetically engineered cells may be cultured and proliferated on a solid scaffold, and then surgically delivered to the selected heart region together with the scaffold. The scaffold may also be directly injected into cardiac tissue.
Perfusion protocols that are useful are often sufficiently capable of delivering a genetic construct to at least about 10% of cardiac myocytes. Infusion volumes of between 0.01 ml and 3 ml are useful for direct intramyocardial injection. Also, suitable methods for targeting non-viral vector genetic constructs to the heart are described in Lawrence (U.S. Pat. No. 6,376,471).
When a polynucleotide is introduced into cardiac cells using any suitable technique, the polynucleotide is delivered into the cells by, for example, transfection or transduction procedures. Transfection and transduction refer to the acquisition by a cell of new genetic material by incorporation of added polynucleotides. Transfection can occur by physical or chemical methods. Many transfection techniques are known to those of ordinary skill in the art including, without limitation, calcium phosphate DNA co-precipitation, DEAE-dextrin DNA transfection, electroporation, naked plasmid adsorption, and cationic liposome-mediated transfection (commonly known as lipofection). Transduction refers to the process of transferring nucleic acid into a cell using a DNA or RNA virus.
A polynucleotide described herein may be used in combination with other agents assisting the cellular uptake of polynucleotides, or assisting the release of poylnucleotides from endosomes or intracellular compartments into the cytoplasm or cell nuclei by, for instance, conjugation of those to the polynucleotide. The agents may be, but are not limited to, peptides, especially cell-penetrating peptides, protein transduction domains, and/or dsRNA-binding domains which enhance the cellular uptake of polynucleotides (Dowdy et al., US Published Patent Application 2009/0093026, Eguchi et al., 2009, Nature Biotechnology 27:567-571, Lindsay et al., 2002, Curr. Opin. Pharmacol., 2:587-594, Wadia and Dowdy, 2002, Curr. Opin. Biotechnol. 13:52-56. Gait, 2003, Cell. Mol. Life Sci., 60:1-10). The conjugations can be performed at an internal position at the oligonucleotide or at a terminal postions either the 5′-end or the 3′-end.
A polynucleotide described herein may be present in liposomes, including neutral or cationic liposomes, such as DOSPA/DOPE, DOGS/DOPE or DMRIE/DOPE liposomes, and/or associated with other molecules such as DNA-anti-DNA antibody-cationic lipid (DOTMA/DOPE) complexes or polyethyleneimine (PEI). An active compound may be present in a polymer matrix, for instance, a polymer matrix may be formed of any physiologically compatible material which generally retains a polynucleotide (which is a charged molecule) or optionally other agents including other agents under physiological conditions for a sustained period of time. The polymer matrix may extrude (release) the polynucleotide in response to an external stimulus, such as an electric field created by an electrical signal, or the matrix may provide for passive delivery.
Toxicity and therapeutic efficacy of such active compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the ED₅₀(the dose therapeutically effective in 50% of the population). The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED₅₀with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For a compound used in the methods of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. In those aspects where a viral vector is used, such as an AAV-based vector, a dosage may be at least 10⁹, 10¹⁰, 10¹¹, 10¹², 10¹³, or 10¹⁴viral particles.
Administration of an HCN polynucleotide, an HCN polypeptide, or a genetically modified cell described herein may be continuous or intermittent, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to a person skilled in the art. The administration may be essentially continuous over a preselected period of time or may be in a series of spaced doses.

Methods of Use

The present invention also includes methods of using the HCN polynucleotides, HCN polypeptides, and genetically modified cells described herein. The methods include, for instance, methods of treating a cardiac pacing condition. Examples of cardiac pacing conditions include, but are not limited to, patients with atrioventricular (AV) node dysfunction and/or sinoatrial (SA) node dysfunction. Such patients may have bradyarrhythmia, such as those with the clinical syndrome sick sinus syndrome. Cardiac pacing conditions may also occur in patients undergoing surgery (such as coronary artery bypass surgery or insertion of an artificial heart valve), or having endocarditis. Signs and symptoms associated with cardiac pacing conditions and the evaluation of such signs and symptoms are routine and known in the art. As used herein, the term “symptom” refers to subjective evidence of a cardiac pacing condition experienced by a subject. As used herein, the term “clinical sign” or, simply, “sign” refers to objective evidence of a cardiac pacing condition.
Treatment may be prophylactic or, alternatively, may be initiated after a cardiac pacing condition is evident. Treatment that is prophylactic, for instance, initiated before an animal manifests symptoms of a cardiac pacing condition, is referred to herein as treatment of a patient that is “at risk” of developing a cardiac pacing condition. Treatment initiated after development of symptoms of a cardiac pacing condition may result in decreasing the severity of the symptoms, or completely removing the symptoms. An “effective amount” is an amount effective to prevent the manifestation of symptoms of a cardiac pacing condition, decrease the severity of the symptoms of cardiac pacing condition, and/or completely remove the symptoms. It is not required that any composition of the present invention completely remove or cure all symptoms of a cardiac pacing condition.
Treatment may result in increasing the intrinsic pacing rate of cardiac cells, preferably to the normal physiological range for the subject. In some aspects, the intrinsic pacing rate is increased to 60-80 beats per minute (bpm) at rest and 90-115 bpm during moderate exercise.
The methods may include administering a composition of the present invention to a subject in need thereof. The subject may be human, or an animal, such as an animal typically used as a model in the study and evaluation of treatments for a cardiac pacing condition, such as a dog or pig, sheep, or non-human primate.
The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

EXAMPLE 1

This example describes the development a super-truncated HCN4 construct in order to be packaged in size limited scAAV vector and to be applicable across species and between human without inducing an immune response. Further, an AAV1 vector carrying this super-truncated HCN4 was to be generated by exploring an alternative AAV generation technology. The pace maker function was confirmed by ex vivo evaluation.

Background

Previously we had demonstrated biological pacemaker function using both human full length HCN4 polypeptide (wtHCN4) and a human C-terminal truncated HCN4 version (HCN4t) having amino acids 1-738 of SEQ ID NO:8, packaged in an adenovirus vector (Adv). We used Adv as a carrier to deliver human hyperpolarization-activated cyclic-nucleotide-gated (HCN) ion channel 4 and established proof of concept that HCN4t, along with the full length HCN4, are capable of generating a ventricular biological pacemaker in an AV blocked canine model (FIG. 3).
Although Adv has shown remarkable efficacy in gene transfer, we developed a clinically relevant vector, traditional adeno-associated virus vector (AAV), to carry a biological pacemaker coding region, HCN4. In comparison with Adv, traditional AAV, also referred to as single-stranded AAV (ssAAV), is a very attractive vector for cardiac gene therapy because of lack of pathogenicity, very low immunogenicity, and long-term gene transfer potential with decreased risk of malignant transformation in small and large animal models.
However, the problems associated with ssAAV vector include a latent period from 10 days to 1 month before ssAAV mediated gene expression peaks. While a 3-4 week waiting period required for ssAAV to reach the steady state may be acceptable for one-time life-saving therapy such as a biological pacemaker, a faster expressing system would certainly be most applicable clinically since it would minimize the time a patient is on electronic pacing as a bridge, and would also provide much quicker feedback to the physician if the biological pacemaker were to need any intervention (e.g., to adjust pacing rate). Therefore, it is desirable to determine whether a different type of AAV vector system, the self-complementary AAV vector system (scAAV) will function.
The traditional AAV system contains single stranded DNA and requires host cell synthesis of the complementary strand. Therefore there is a lag period, when the expression is generally quite slow with the peak function occurring 3-4 weeks after the gene administration. In contrast, scAAV system contains double strand DNA and therefore eliminates the rate-limiting step of second-strand DNA synthesis. Thus, scAAV can attain peak expression in a matter of days. This fast ramp-up feature makes scAAV a very promising vector for clinical applications.
ssAAV can package a coding region and regulatory sequences (including two ITR regions, promoter, transgene, and poly-A signal) roughly the size of 4.8 kilo-base pairs (kb) and allows packaging of HCN4t (2,214 base pairs (bp) for HCN4t versus 3,612 by for wtHCN4). As for scAAV, it can only package ˜2.5 kb of coding region and regulatory sequences. While much shorter than in its wild-type counterpart, the coding region encoding HCN4t is still longer than the packaging capacity of scAAV. We developed an even shorter version of HCN4 construct, so that the packaging in scAAV vector system is feasible. The shorter version was designated super truncated HCN4 (HCN4st).
In addition to the limitation related to their large sizes, another limitation of the wtHCN4 and HCN4t genes is that they have regions that show inter-species variability. For example, between canine and human genes, there is a considerable lack of homology in the 5′ region of the HCN4 gene (FIG. 4). The HCN4st removes all the regions that exhibit inter-species variability and this would imply that the risk of generating an immune response and loss of pacemaker function would be minimized with an HCN4st gene. There are greater than 98% identical residues between human and canine HCN4st1 sequence.
HCN4 channels (FIG. 5) consist of 6 transmembrane domains, with a pore region between S5 and S6 and a cyclic nucleotide-binding domain (CNBD) in the cytoplasmic C-terminal region. While HCN4t deleted nucleotides after the CNBD region, HCN4st was designed to delete regions from the amino terminal end, but not extend into the Si region. It is within block III of FIG. 4.
In an effort to generate scalable production of AAV vectors, as well as to overcome the toxicity of HCN4 in routine host cells, such as HEK293, a “BAC-to-AAV” technology (Chen U.S. Published Patent Application 20090203071) that uses a baculovirus expression system to produce AAV vectors in insect cells under serum-free condition was used. BAC-to-AAV technology enhances the packaging of much more VP1 proteins into the virions than other systems and therefore greatly increases the performance of AAV vectors.

Methods:

Generating Super-truncated version of HCN4 (HCN4st).
HCN4t construct was generated by truncating 1,398 base pairs (bp) nucleotides that encode the C-terminus of wild type HCN4. The truncation site was chosen such that a cyclic nucleotide-binding domain (CNBD) was preserved in the C-terminus region of HCN4t. HCN4st constructs included a series of deletions on the N-terminus of the HCN4t, in front of the six transmembrane domains (FIG. 6).
Each individual HCN4st gene was generated via PCR amplification by using HCN4t as template. Sequence specific primers were designed using the nucleotide sequence available at Genbank accession NM_—005477.2. Upstream primers HCN4st were 5′ ata gcg cga att ccc gcc atg cag cgc cag ttc ggg (SEQ ID NO:25), 5′ ata gcg cga att ccc gcc atg ctc caa ccc ggg g (SEQ ID NO:26) and 5′ ata gcg cga att ccc gcc atg ttc ggc agc cag aaa g (SEQ ID NO:27) respectively for HCN4st1, st2 and st3. The coding sequence encoding HCN4st1 encodes a polypeptide corresponding to amino acids 214-719 of SEQ ID NO:8 (FIG. 1), the coding sequence encoding HCN4st2 encodes a polypeptide corresponding to amino acids 221-719 of SEQ ID NO:8, and the coding sequence encoding HCN4st3 encodes a polypeptide corresponding to amino acids 233-719 of SEQ ID NO:8. The downstream primer for each HCN4st was 5′ cggcggatcccctagagatat (SEQ ID NO:28). MyC sequence (AGCAGAAGCTGATCTCAGAGGAGGACCTGCTT, SEQ ID NO:29) was attached at the C-terminal of different HCN4t modifications. Three HCN4st genes were cloned into a pTopo sequence plasmid (Invitrogen, Carlsbad, Calif., USA) and verified by restriction enzyme analysis (New England Biolabs, Ipswich, Mass., USA) and the nucleotide sequence was confirmed (Eurofins MWG Operon, Huntsville, Ala. USA). HCN4st genes were subsequently subcloned into the expression plasmid pIRES-EGFP (Clonetech, Mountain View, Calif., USA) for functional testing by patch clamp. Selected HCN4st genes were further subcloned into an AAV shuttle plasmid (ViroVek, Hayward, Calif., USA) for making B-AAV-HCN4st1 vector (FIG. 7, and described below).

Patch Clamp

HEK 293 Cell Transfection
Human embryonic kidney (HEK293, ATCC) cells were split on 12 well plate one day before transfection. Three pHCN4st-IRES-EGFP plasmids were transfected into 70% confluent HEK293 cells with Fugene 6 (Roche) transfection reagents, along with pHCN4t-IRES-EGFP. The transfected cells were replated on gelatin-fibronectin coated glass coverslips 24 hours after transfection.

Whole Cell Patch Clamp

One day after reculture, the cells plated on a coverslip were transported to a chamber mounted on the stage of a Nikon microscope. The chamber was continuously superfused (˜0.5 ml/min) with the Tyrode solution. The whole-cell configuration of the patch-clamp technique (Hamill et al., 1981, Pflugers Arch. 391(2):85-100) was applied. Briefly, glass electrodes (World Precision Instruments, Sarasota, Fla., USA) with 3 to 5 MΩ resistance were connected via an Ag-AgCl wire to an Axopatch 200A amplifier interfaced with a DigiData-1322 acquisition system. After forming a conventional “gigaohm” seal, electrode capacitance was compensated. Additional suction ruptured the patched membrane and formed the whole-cell configuration. Cell membrane capacitance (C_m) was measured in each patched cells with the pCLAMP program (version 9.2, Axon Instruments, Foster City, Calif., USA).
The hyperpolarization-activated cyclic nucleotide-gated inward current (I_h) was measured with the modified Tyrode bath solution. I_hwas evoked by 5 s hyperpolarizing steps to potentials ranging from 0 to −140 mV from a holding potential of −40 mV. The reversal potential of I_hwas evaluated by tail currents recorded by 3 s ‘tail’ steps to membrane potentials ranging from −80 to 20 mV in 10 mV increments followed by a 5 s conditioning potential step to −130 mV every 15 s. The holding potential was set at −40 mV. The activation of I_hwas elicited by 3 s ‘tail’ pulses to −130 mV followed 5 s conditioning pulses from 0 mV to −140 mV in 10 mV increments. The pulse rate was every 30 s.

Data Analysis

Data were collected with the pCLAMP software (version 9.02). I_hwas evaluated at a point near the end of each test pulse unless stated otherwise (tail-current measurements). The current amplitudes were normalized with respect to the corresponding values of C_mto minimize the current difference due to cell size. A single-exponential fit (Axon-Clampfit 9.02) of current traces allowed derivation of time constants (τ) of current activation and deactivation. Some data were fitted by a Boltzmann equation {1/[1+exp(V_1/2−V)/k], where V_1/2is the half-inactivation potential, V is the voltage potential, and k is the slope factor (in mV/e-fold change in current)}. The best-fit procedure was performed with a commercial software program (Origin 7.0, Microcal™ Software Inc., Northampton, Mass., USA). All data are presented as mean±standard error of the mean unless otherwise stated. Unpaired Student's t-test was applied for statistical analysis as appropriate. Differences were considered significant if P≦0.05.

B-AAV1-HCN4st1 Generation

Following patch clamp, functional HCN4st gene was further subcloned and the polynucleotide sequence depicted in FIG. 15 was used as a template for PCR using the primers 5′ ata gcg cga att ccc gcc atg cag cgc cag ttc ggg (SEQ ID NO:25) and 5′ cggcggatcccctagagatat (SEQ ID NO:28), and the amplification product was used by ViroVek to produce an AAV1 vector that encoded an HCN4st1 polypeptide that included a MyC sequence fused to the amino terminal end of the polypeptide. The methods used by ViroVek include cloning gene of interest into an pFB-AAV shuttle plasmid, generation of Bacmid and purification of Bacmid DNA, transfection of Sf9 cells to generate baculovirus, amplification of baculovirus and titration, production of AAV and CsCl purification, and desalting, filter sterilization, and AAV titration (see Chen, U.S. Published Patent Application 20090203071, U.S. Provisional Patent Application 60/839,761, and International Application PCT/US07/76799, and http://www.virovek.com/AAV_Production.html. Together with AAV rep component and vp component, this shuttle vector were co-transfected into SF9 insect cells for generation of recombinant baculovirus and production of a virus vector containing a coding region encoding HCN4st1, designated B-AAV1-HCN4st1, where the “B” refers to generation using the baculovirus system. Following purification of the virus vector through buffer exchange and sterile filtration, virus titer was determined by qPCR. The resulting B-AAV1-HCN4st1 was dissolved in PBS with 0.001% Pluronic F-68 buffer at concentration of 1.03E+13 vg/mL. Endotoxin level was tested by Biotest Labs with <1EU/ml.

Microelectrode Array (MEA) Measurements

Primary Cell Isolation
Neonatal rats were sacrificed by decapitation and hearts were rapidly excised and washed in Ca²⁺free balanced salt solution. The ventricles were minced into 1-2 mm³pieces and dissociated into single cell suspension by repeated digestion with proteolytic enzymes. Each digestion, enhanced with gentle shaking, lasted for 15-20 minutes. Then myocytes were mechanically dispersed by triturating. The undigested masses and first few digestion fractions were discarded after filtering through a cell strainer. Collected cells suspension was mixed with serum for enzyme deactivation, centrifuged, and re-suspended in culturing media. Cells were additionally incubated with 10 μg/ml of DNAse for 10 min at 37° C. For fibroblasts separation and myocytes enrichment two 1.5 hrs pre-plating steps (incubation of cell suspension in 75 cm²flasks) were performed. After pre-plating, slowly attaching myocytes were separated from quickly attaching fibroblasts, collected, counted, re-suspended, and plated in pretreated MEAs (at ˜500000 cells/ml, ˜180000cells/cm²). Each MEA had ˜64 electrodes spaced ˜100 μm and covering a total area of approximately 0.5 mm².
NRVMs were cultured with Norepinephrine and Bromodeoxyuridine (BrDu) for 2 days, than with BrDu for 2 more days, until synchronized spontaneously beating cell monolayers were formed, than maintained in serum free culture media (contained Insulin, BSA, and Vitamin B₁₂) preconditioned on cultured fibroblasts.

AAV Transduction

Transfection experiments with serial virus titers were performed twice.
During the first experiment, transfections of myocytes in MEA chambers were carried out on 5th day in culture at the following titers: 10¹¹, 10¹⁰, 10⁹, 10⁸vg/ml of B-AAV1-HCN4st1 and non transduction negative control (5 arrays for each condition).
During the second experiment, in addition to B-AAV1-HCN4st1 and negative control, a control of B-AAV1-empty particles was included.

MEA System

The day before transduction, and then each following day, electrograms for each culture were recorded with MEA system and microscopic fluorescence and bright field images of each array were taken with Leica inverted microscope at 10×magnification. Cultures were monitored for about 2 weeks, after which MEA recordings were processed using “MC Rack” Multi Channel Systems Software and analyzed in Microsoft Excel; microscopic images were processed with “ImageJ” software.
NRVM cultures showing signs of degradation were rapidly assessed for apoptosis with Vibrant Apoptosis Assay Kit #5 (Invitrogen, Carlsbbad, Calif., USA) based on fluorescence detection of the compacted state of the chromatin in apoptotic cells.

Results

HCN4st1, st2 and st3 evaluation by patch clamp.
We have expressed three HCN4st constructs individually in HEK293 cells by Fugene 6 transfection and performed whole-cell patch clamp experiments to assess their electrophysiology function. Our experiments suggested that only HCN4st1 remained indistinguishable from the HCN4t, thus suggesting that truncation at N-terminus of 213 amino acids does not compromise HCN4 function (FIG. 8). When using HEK293 cells HCN4st2 and HCN4st3 did not lead to functional HCN4 current, indicating that these constructs may not function properly in HEK293 cells, or that further modification on these two deletions may be needed. HCN4st1 gene contains only 1575 by nucleotides, well within the packaging capacity of scAAV vector system, and has both the C-terminus and N-terminus truncated.
B-AAV1-HCN4st1 in vitro Evaluation by MEA
Non transduced control NRVM cells demonstrated stable (˜20-40 BPM) beating rates and overall uniform healthy appearance during the two week observation period (FIG. 9).
NRVM cells transduced with 10¹¹vg/ml of B-AAV1-HCN4st1 were not beating by the next day after transduction and rapidly degraded showing the signs of apoptosis (FIG. 10).
For the next lower titer −10¹⁰vg/ml NRVM cells reached the maximum of beating rate ˜115 BPM by day 3 after transduction, and then degraded by day 7.
For the 10⁹vg/ml titer, NRVM cells reached maximum of beating rate ˜130-160 BPM by the day 6 and degraded by the day 10.
For the lowest tested 10⁸vg/ml titer, NRVM cells reached beating rate ˜75 BPM by the day 10 and did not show signs of degradation (FIG. 11, FIG. 12).
NRVM cells transduced with B-AAV1-empty particles did not show any signs of degradation and any noticeable rate increase compared to non transduced controls (FIG. 13).
Overall, neonatal rat ventricular myocytes transduced with B-AAV1-HCN4st1 showed increased induced beating. At higher titers (10¹¹, 10¹⁰, 10⁹vg/ml), B-AAV1-HCN4st1 caused cell degradation via apoptosis. At lower titer (10⁸vg/ml), B-AAV1-HCN4st1 was safe and reached induced beating rate at ˜75 BPM.

EXAMPLE 2

AAV1-HCN4-Mediated Biological Pacemaker Paces the Canine Heart with Vv Block Over 7 Months and Responds well to Autonomic Challenges

Implantation of an electronic pacemaker is necessary for a patient with severe bradycardia; however, while effectively improving the lives of many patients, such therapy has several limitations including hardware complications, limited battery life and lack of response to autonomic and physiologic demands on hearts. Compared to its counterpart, a biological pacemaker is a conceptually attractive alternative to electronic pacemakers.
This study was to test whether using adeno-associate virus-1 (AAV1) with truncated human HCN4 (hHCN4tr) would create a long-term (>6 months) and sustained (nearly 100% biologically induced pacing) biological pacemaker in the left ventricle (LV) of canines with atrioventricular (AV) nodal block.
Canines (n=3) with neutralizing anti-AAV 1 antibodies (NAb) at a titer≦1:40 serum dilution were selected. After complete AV block, the AAV1-hHCN4tr vectors were epicardially injected into the LV apex using a side-hole needle as described in Hiniduma-Lokuge et al. (PCT Publication No. WO/2008/055001). An electrical pacemaker (VVI 50 bpm) was implanted for backup pacing and recording of the electrocardiograms every two hours. During the follow-up monitoring, drug and exercise challenges were performed. Twenty-four hour Holter monitoring and pacemaker log record checks were also performed.
All canines demonstrated biological pacemaker activities 3 days after AAV1-hHCN4tr injection. The biological pacemaker in two canines with NAb at a titer of 1:40 diminished 3 weeks after the gene transfer presumably due to the pre-existing immunity to AAV1. However, the canine with NAb at a titer of 1:20 has exhibited sustained biological pacing activities at a range of 60-150 bpm over 7 months at the time of this abstract submission (FIG. 15). The electrical pacemaker intervened at 50 bpm when spontaneous ventricular rate fell below at that rate, triggering for <2% of the beats. The biological pacemaker responded well to drugs, such as isoproterenol and metoprolol, and also showed physiological diurnal variations and responses to exercise.
Conclusion: LV epicardial injection with AAV1-hHCN4tr creates long-term (over 7 months) and sustained (nearly 100% biologically induced pacing) biological pacemaker activities in a complete AV block canine model. Interestingly, such biological pacemaker responds well to autonomic challenges and physiological exercise.
The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. Supplementary materials referenced in publications (such as supplementary tables, supplementary figures, supplementary materials and methods, and/or supplementary experimental data) are likewise incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.
All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

Claims

1. A composition comprising an HCN polynucleotide present in a viral vector or a transposon vector, wherein the HCN polynucleotide comprises a nucleotide sequence encoding an HCN polypeptide having channel activity, wherein the amino acid sequence of the HCN polypeptide and the amino acid sequence of a reference polypeptide have at least 80% identity, the reference polypeptide beginning with an amino acid selected from amino acids 92-214 and ending with an amino acid selected from amino acids 723-1188 of SEQ ID NO:8.

2. The composition of claim 1 further comprising a pharmaceutically acceptable carrier.

3. The composition of claim 1 wherein the reference polypeptide is amino acids 214-723 of SEQ ID NO:8.

4. The composition of claim 1 wherein the viral vector is a single strand adeno-associated virus or a self complementary adeno-associated virus.