US20110182872A1 - Methods of analysis of polymorphisms and uses thereof - Google Patents

Methods of analysis of polymorphisms and uses thereof Download PDF

Info

Publication number
US20110182872A1
US20110182872A1 US13/049,612 US201113049612A US2011182872A1 US 20110182872 A1 US20110182872 A1 US 20110182872A1 US 201113049612 A US201113049612 A US 201113049612A US 2011182872 A1 US2011182872 A1 US 2011182872A1
Authority
US
United States
Prior art keywords
protective
genotype
seq
polymorphisms
copd
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US13/049,612
Inventor
Robert Peter Young
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Synergenz Bioscience Ltd
Original Assignee
Synergenz Bioscience Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Synergenz Bioscience Ltd filed Critical Synergenz Bioscience Ltd
Priority to US13/049,612 priority Critical patent/US20110182872A1/en
Publication of US20110182872A1 publication Critical patent/US20110182872A1/en
Priority to US13/903,913 priority patent/US20130345287A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/10Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

Definitions

  • the present invention is concerned with methods for the assessment of diseases that result from the combined or interactive effects of two or more genetic variants, and in particular for diagnosing risk of developing such diseases in subjects using an analysis of genetic polymorphisms.
  • complex diseases Diseases that result from the combined or interactive effects of two or more genetic variants, with or without environmental factors, are called complex diseases and include cancer, coronary artery disease, diabetes, stroke, and chronic obstructive pulmonary disease (COPD).
  • COPD chronic obstructive pulmonary disease
  • these relatively common polymorphisms can confer either susceptibility and/or protective effects on the development of these diseases.
  • the likelihood that these polymorphisms are actually expressed (termed penetrance) as a disease or clinical manifestation requires a quantum of environmental exposure before such a genetic tendency can be clinically detected.
  • the present invention provides a method of assessing a subject's risk of developing a disease which includes:
  • each protective polymorphism can be the same or can be different.
  • the value assigned to each susceptibility polymorphism can be the same or can be different, with either each protective polymorphism having a negative value and each susceptibility polymorphism having a positive value, or vice versa.
  • the protective polymorphisms analysed can be selected from one or more of the group consisting of: +760GG or +760CG within the gene encoding superoxide dismutase 3 (SOD3); ⁇ 1296TT within the promoter of the gene encoding tissue inhibitor of metalloproteinase 3 (TIMP3); CC (homozygous P allele) within codon 10 of the gene encoding transforming growth factor beta (TGF ⁇ ); 2G2G within the promoter of the gene encoding metalloproteinase 1 (MMP1); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
  • SOD3 superoxide dismutase 3
  • TGF ⁇ transforming growth factor beta
  • MMP1 metalloproteinase 1
  • Linkage disequilibrium is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present implies the presence of the other. (Reich, D. E. et al. Linkage disequilibrium in the human genome. Nature 411:199-204 (2001), herein incorporated by reference in its entirety).
  • the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: ⁇ 82AA within the promoter of the gene encoding human macrophage elastase (MMP12); ⁇ 1562CT or ⁇ 1562TT within the promoter of the gene encoding metalloproteinase 9 (MMP9); 1237AG or 1237AA (Tt or tt allele genotypes) within the 3′ region of the gene encoding a1-antitrypsin (a1AT); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
  • MMP12 human macrophage elastase
  • MMP9 metalloproteinase 9
  • 1237AG or 1237AA Tt or tt allele genotypes
  • each protective polymorphism is assigned a value of ⁇ 1 and each susceptibility polymorphism is assigned a value of +1.
  • each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of ⁇ 1.
  • the protective polymorphisms analysed can be selected from one or more of the group consisting of: ⁇ 765 CC or CG in the promoter of the gene encoding cyclooxygenase 2 (COX2); Arg 130 Gln AA in the gene encoding Interleukin-13 (IL-13); Asp 298 Glu TT in the gene encoding nitric oxide synthase 3 (NOS3); Lys 420 Thr AA or AC in the gene encoding vitamin binding protein (VDBP); Glu 416 Asp TT or TG in the gene encoding VDBP; Ile 105 Val AA in the gene encoding glutathione S-transferase (GSTP1); MS in the gene encoding a 1-antitrypsin (a 1 AT); the +489 GG geneotype in the gene encoding Tissue Necrosis factor a (TNFa); the ⁇ 308 GG geneotype in the gene encoding TNFa); the ⁇
  • the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: Arg 16 Gly GG in the gene encoding ⁇ 2-adrenoreceptor (ADRB2); 105 AA in the gene encoding Interleukin-18 (IL-18); ⁇ 133 CC in the promoter of the gene encoding IL-18; ⁇ 675 5G5G in the promoter of the gene encoding plasminogen activator inhibitor 1 (PAI-1); ⁇ 1055 TT in the promoter of the gene encoding IL-13; 874 TT in the gene encoding interferon gamma (IFN?); the +489 AA or AG genotype in the gene encoding TNFa; the ⁇ 308 AA or AG genotype in the gene encoding TNFa; the C89Y GG genotype in the gene encoding SMAD3; the E469K GG genotype in the gene encoding Intracellular Adhesion molecule 1 (ICAM1)
  • each protective polymorphism is assigned a value of ⁇ 1 and each susceptibility polymorphism is assigned a value of +1.
  • each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of ⁇ 1.
  • the protective polymorphisms analysed can be selected from one or more of the group consisting of: ⁇ 765 CC or CG in the promoter of the gene encoding COX2; ⁇ 251 AA In the promoter of the gene encoding interleukin-8 (IL-8); Lys 420 Thr AA in the gene encoding VDBP; Glu 416 Asp TT or TG in the gene encoding VDBP; exon 3 T/C RR in the gene encoding microsomal epoxide hydrolase (MEH); Arg 312 Gln AG or GG in the gene encoding SOD3; MS or SS in the gene encoding a1AT; Asp 299 Gly AG or GG in the gene encoding toll-like receptor 4 (TLR4); Gln 27 Glu CC in the gene encoding ADRB2; ⁇ 518 AA in the gene encoding IL-11; Asp 298 Glu TT in the gene
  • the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: ⁇ 765 GG in the promoter of the gene encoding COX2; 105 AA in the gene encoding IL-18; ⁇ 133 CC in the promoter of the gene encoding IL-18; ⁇ 675 5G5G in the promoter of the gene encoding PAI-1; Lys 420 Thr CC in the gene encoding VDBP; Glu 416 Asp GG in the gene encoding VDBP; Ile 105 Val GG in the gene encoding GSTP1; Arg 312 Gln AA in the gene encoding SOD3; ⁇ 1055 TT in the promoter of the gene encoding IL-13; 3′ 1237 Tt or tt in the gene encoding a 1AT; ⁇ 1607 2G2G in the promoter of the gene encoding MMP1; or one or more polymorphisms in linkage disequilibrium
  • each protective polymorphism is assigned a value of ⁇ 1 and each susceptibility polymorphism is assigned a value of +1.
  • each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of ⁇ 1.
  • the protective polymorphisms analysed can be selected from one or more of the group consisting of: the Asp 298 Glu TT genotype in the gene encoding NOS3; the Arg 312 Gln CG or GG genotype in the gene encoding SOD3; the Asn 357 Ser AG or GG genotype in the gene encoding MMP12; the 105 AC or CC genotype in the gene encoding IL-18; the ⁇ 133 CG or GG genotype in the gene encoding IL-18; the ⁇ 765 CC or CG genotype in the promoter of the gene encoding COX2; the ⁇ 221 TT genotype in the gene encoding Mucin 5AC (MUC5AC); the intron 1 C/T TT genotype in the gene encoding Arginase 1 (Arg1); the Leu252Val GG genotype in the gene encoding Insulin-like growth factor II receptor (IGF2R); the ⁇ 1082 GG genotype
  • the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: the ⁇ 786 TT genotype in the promoter of the gene encoding NOS3; the Ala 15 Thr GG genotype in the gene encoding anti-chymotrypsin (ACT); the 105 AA genotype in the gene encoding IL-18; the ⁇ 133 CC genotype in the promoter of the gene encoding IL-18; the 874 AA genotype in the gene encoding IFN?; the ⁇ 765 GG genotype in the promoter of the gene encoding COX2; the ⁇ 447 CC or GC genotype in the gene encoding Connective tissue growth factor (CTGF); and the +161 AA or AG genotype in the gene encoding MBL2; ⁇ 511 GG genotype in the gene encoding IL-1B; the A-670G AA genotype in the gene encoding FAS (Apo-1/CD95); the Arg 197
  • each protective polymorphism is assigned a value of ⁇ 1 and each susceptibility polymorphism is assigned a value of +1.
  • each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of ⁇ 1.
  • the subject is or has been a smoker.
  • the methods of the invention are performed in conjunction with an analysis of one or more risk factors, including one or more epidemiological risk factors, associated with the risk of developing a lung disease including COPD, emphysema, OCOPD, and lung cancer.
  • risk factors include but are not limited to smoking or exposure to tobacco smoke, age, sex, and familial history.
  • the invention provides a method of determining a subject's risk of developing a disease, said method comprising
  • the present invention provides a method for assessing the risk of a subject developing a disease which includes
  • the present invention provides a kit for assessing a subject's risk of developing a disease, said kit comprising a means of analysing a sample from said subject for the presence or absence of one or more protective polymorphisms and one or more susceptibility polymorphisms as described herein.
  • the present invention provides a method of prophylactic or therapeutic intervention in relation to a subject having a net susceptibility score for a disease as determined by a method as defined above which includes the steps of communicating to said subject said net susceptibility score, and advising on changes to the subject's lifestyle that could reduce the risk of developing said disease.
  • the present invention provides a method of treatment of a subject to decrease to the risk of developing a disease through alteration of the net score for said subject as determined by a method as defined above, wherein said method of treatment includes reversing, genotypically or phenotypically, the presence and/or functional effect of one or more susceptibility polymorphisms associated with said disease; and/or replicating and/or mimicking, genotypically or phenotypically, the presence and/or functional effect of one or more protective polymorphisms associated with said disease.
  • FIG. 1 depicts a graph showing combined frequencies of the presence or absence of selected protective genotypes in the COPD subjects and in resistant smokers.
  • FIG. 2 depicts a graph showing net scores for protective and susceptibility polymorphisms in COPD subjects.
  • FIG. 3 depicts a graph showing net scores for protective and susceptibility polymorphisms in OCOPD subjects.
  • FIG. 4 depicts a graph showing net scores for protective and susceptibility polymorphisms in subjects with lung cancer.
  • FIG. 5 depicts a graph showing net scores for protective and susceptibility polymorphisms in subjects with lung cancer.
  • the present invention is directed to methods for the assessment of the genetic risk quotient of a particular subject with respect to a particular disease.
  • the methods rely upon the recognition that for many (if not all) diseases there exist genetic polymorphisms which fall into two categories—namely those indicative of a reduced risk of developing a particular disease (which can be termed “protective polymorphisms” or “protective SNPs”) and those indicative of an increased risk of developing a particular disease (which can be termed “susceptibility polymorphisms” or “susceptibility SNPs”).
  • the phrase “risk of developing [a] disease” means the likelihood that a subject to whom the risk applies will develop the disease, and includes predisposition to, and potential onset of the disease. Accordingly, the phrase “increased risk of developing [a] disease” means that a subject having such an increased risk possesses an hereditary inclination or tendency to develop the disease. This does not mean that such a person will actually develop the disease at any time, merely that he or she has a greater likelihood of developing the disease compared to the general population of individuals that either does not possess a polymorphism associated with increased disease risk, or does possess a polymorphism associated with decreased disease risk.
  • Subjects with an increased risk of developing the disease include those with a predisposition to the disease, for example in the case of COPD, a tendency or prediliction regardless of their lung function at the time of assessment, for example, a subject who is genetically inclined to COPD but who has normal lung function, those at potential risk, for example in the case of COPD, subjects with a tendency to mildly reduced lung function who are likely to go on to suffer COPD if they keep smoking, and subjects with potential onset of the disease, for example in the case of COPD, subjects who have a tendency to poor lung function on spirometry etc., consistent with COPD at the time of assessment.
  • the phrase “decreased risk of developing [a] disease” means that a subject having such a decreased risk possesses an hereditary disinclination or reduced tendency to develop the disease. This does not mean that such a person will not develop the disease at any time, merely that he or she has a decreased likelihood of developing the disease compared to the general population of individuals that either does possess one or more polymorphisms associated with increased disease risk, or does not possess a polymorphism associated with decreased disease risk.
  • polymorphism means the occurrence together in the same population at a rate greater than that attributable to random mutation (usually greater than 1%) of two or more alternate forms (such as alleles or genetic markers) of a chromosomal locus that differ in nucleotide sequence or have variable numbers of repeated nucleotide units. See www.ornl.gov/sci/techresources/Human_Genome/publicat/97pr/09gloss.html#p.
  • polymorphisms is used herein contemplates genetic variations, including single nucleotide substitutions, insertions and deletions of nucleotides, repetitive sequences (such as microsatellites), and the total or partial absence of genes (eg. null mutations).
  • polymorphisms also includes genotypes and haplotypes.
  • a genotype is the genetic composition at a specific locus or set of loci.
  • a haplotype is a set of closely linked genetic markers present on one chromosome which are not easily separable by recombination, tend to be inherited together, and can be in linkage disequilibrium.
  • a haplotype can be identified by patterns of polymorphisms such as SNPs.
  • polymorphisms such as SNPs.
  • single nucleotide polymorphism or “SNP” in the context of the present invention includes single base nucleotide substitutions and short deletion and insertion polymorphisms.
  • disease is used herein in its widest possible sense, and includes conditions which can be considered disorders and/or illnesses which have a genetic basis or to which the genetic makeup of the subject contributes.
  • the frequencies of polymorphisms between blood donor controls, resistant subjects and those with COPD, the frequencies of polymorphisms between blood donor controls, resistant subjects and those with OCOPD, and the frequencies of polymorphisms between blood donor controls, resistant subjects and those with lung cancer have been compared. This has resulted in both protective and susceptibility polymorphisms being identified for each disease.
  • the surprising finding relevant to this invention is that a combined analysis of protective and susceptibility polymorphisms discriminatory for a given disease yields a result that is indicative of that subject's risk quotient for that disease. This approach is widely applicable, on a disease-by-disease basis.
  • the present invention identifies methods of assessing the risk of a subject developing a disease which includes determining in said subject the presence or absence of protective and susceptibility polymorphisms associated with said disease.
  • a net score for said subject is derived, said score representing the balance between the combined value of the protective polymorphisms present in said subject and the combined value of the susceptibility polymorphisms present in said subject.
  • a net protective score is predictive of a reduced risk of developing said disease, and a net susceptibility score is predictive of an increased risk of developing said disease.
  • each category protection polymorphisms, susceptibility polymorphisms, respectively
  • the polymorphisms can each be assigned the same value.
  • each protective polymorphism associated with a given disease is assigned a value of +1
  • each susceptibility polymorphism is assigned a value of ⁇ 1.
  • polymorphisms discriminatory for a disease within the same category can each be assigned a different value to reflect their discriminatory value for said disease.
  • a polymorphism highly discriminatory of risk of developing a disease can be assigned a high weighting, for example a polymorphism with a high Odd's ratio can be considered highly discriminatory of disease, and can be assigned a high weighting.
  • the present invention provides a method of assessing a subject's risk of developing a disease which includes:
  • net score representing the balance between the combined value of the protective polymorphisms and the combined value of the susceptibility polymorphisms present in the subject sample
  • a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
  • the subject sample can have already been analysed for the presence or absence of one or more protective or susceptibility polymorphisms, and the method includes the steps of
  • Example 1 17 susceptibility genetic polymorphisms and 19 protective genetic polymorphisms identified as discriminatory for COPD were analysed using methods of the invention. These analyses can be used to determine the risk quotient of any subject for COPD, and in particular to identify subjects at greater risk of developing lung cancer.
  • 11 susceptibility genetic polymorphisms and 11 protective genetic polymorphisms identified as discriminatory for OCOPD are analysed using methods of the invention. These analyses can be used to determine the risk quotient of any subject for OCOPD, and in particular to identify subjects at greater risk of developing OCOPD.
  • Example 3 19 susceptibility genetic polymorphisms and 17 protective genetic polymorphisms identified as discriminatory for lung cancer are analysed using methods of the invention. These analyses can be used to determine the risk quotient of any subject for lung cancer, and in particular to identify subjects at greater risk of developing lung cancer.
  • Susceptibility and protective polymorphisms can readily be identified for other diseases using approaches similar to those described in the Examples, as well as in PCT International Application No. PCT/NZ02/00106 (published as WO 02/099134 and herein incorporated by reference in its entirety) via which four susceptibility and three protective polymorphisms discriminatory for lung disease were identified.
  • the one or more polymorphisms can be detected directly or by detection of one or more polymorphisms which are in linkage disequilibrium with said one or more polymorphisms.
  • linkage disequilibrium is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present implies the presence of the other. (Reich D E et al; Linkage disequilibrium in the human genome, Nature 2001, 411:199-204.)
  • polymorphisms reported to be in linkage disequilibrium include the Interleukin-18 ⁇ 133 C/G and 105 A/C polymorphisms, and the Vitamin D binding protein Glu 416 Asp and Lys 420 Thr polymorphisms, as shown below.
  • LD rs Alleles between Phenotype Gene SNPs numbers in LD alleles in COPD Interleukin- IL18 ⁇ 133 rs360721 C allele Strong LD CC 18 C/G susceptible IL18 105 rs549908 A allele AA A/C susceptible Vitamin D VDBP rs4588 A allele Strong LD AA/AC binding Lys 420 protective protein Thr VDBP rs7041 T allele TT/TG Glu 416 protective Asp
  • polymorphsisms in linkage disequilibrium with one or more other polymorphism associated with increased or decreased risk of developing COPD, emphysema, or both COPD and emphysema will also provide utility as biomarkers for risk of developing COPD, emphysema, or both COPD and emphysema.
  • the data presented herein shows that the frequency for SNPs in linkage disequilibrium is very similar. Accordingly, these genetically linked SNPs can be utilized in combined polymorphism analyses to derive a level of risk comparable to that calculated from the original SNP.
  • polymorphisms in linkage disequilibrium with the polymorphisms specified herein can be identified, for example, using public data bases. Examples of such polymorphisms reported to be in linkage disequilibrium with the polymorphisms specified herein are presented herein in Table 21.
  • a SNP is a single base change or point mutation resulting in genetic variation between individuals.
  • SNPs occur in the human genome approximately once every 100 to 300 bases, and can occur in coding or non-coding regions. Due to the redundancy of the genetic code, a SNP in the coding region may or may not change the amino acid sequence of a protein product.
  • a SNP in a non-coding region can, for example, alter gene expression by, for example, modifying control regions such as promoters, transcription factor binding sites, processing sites, ribosomal binding sites, and affect gene transcription, processing, and translation.
  • SNPs can facilitate large-scale association genetics studies, and there has recently been great interest in SNP discovery and detection.
  • SNPs show great promise as markers for a number of phenotypic traits (including latent traits), such as for example, disease propensity and severity, wellness propensity, and drug responsiveness including, for example, susceptibility to adverse drug reactions.
  • phenotypic traits including latent traits
  • NCBI SNP database “dbSNP” is incorporated into NCBI's Entrez system and can be queried using the same approach as the other Entrez databases such as PubMed and GenBank.
  • This database has records for over 1.5 million SNPs mapped onto the human genome sequence.
  • Each dbSNP entry includes the sequence context of the polymorphism (i.e., the surrounding sequence), the occurrence frequency of the polymorphism (by population or individual), and the experimental method(s), protocols, and conditions used to assay the variation, and can include information associating a SNP with a particular phenotypic trait.
  • Genotyping approaches to detect SNPs well-known in the art include DNA sequencing, methods that require allele specific hybridization of primers or probes, allele specific incorporation of nucleotides to primers bound close to or adjacent to the polymorphisms (often referred to as “single base extension”, or “minisequencing”), allele-specific ligation (joining) of oligonucleotides (ligation chain reaction or ligation padlock probes), allele-specific cleavage of oligonucleotides or PCR products by restriction enzymes (restriction fragment length polymorphisms analysis or RFLP) or chemical or other agents, resolution of allele-dependent differences in electrophoretic or chromatographic mobilities, by structure specific enzymes including invasive structure specific enzymes, or mass spectrometry. Analysis of amino acid variation is also possible where the SNP lies in a coding region and results in an amino acid change.
  • DNA sequencing allows the direct determination and identification of SNPs.
  • the benefits in specificity and accuracy are generally outweighed for screening purposes by the difficulties inherent in whole genome, or even targeted subgenome, sequencing.
  • Mini-sequencing involves allowing a primer to hybridize to the DNA sequence adjacent to the SNP site on the test sample under investigation.
  • the primer is extended by one nucleotide using all four differentially tagged fluorescent dideoxynucleotides (A,C,G, or T), and a DNA polymerase. Only one of the four nucleotides (homozygous case) or two of the four nucleotides (heterozygous case) is incorporated.
  • the base that is incorporated is complementary to the nucleotide at the SNP position.
  • the method utilises a single-step hybridization involving two hybridization events: hybridization of a first portion of the target sequence to a capture probe, and hybridization of a second portion of said target sequence to a detection probe. Both hybridization events happen in the same reaction, and the order in which hybridisation occurs is not critical.
  • US Application 20050042608 (herein incorporated by reference in its entirety) describes a modification of the method of electrochemical detection of nucleic acid hybridization of Thorp et al. (U.S. Pat. No. 5,871,918, herein incorporated by reference in its entirety).
  • capture probes are designed, each of which has a different SNP base and a sequence of probe bases on each side of the SNP base.
  • the probe bases are complementary to the corresponding target sequence adjacent to the SNP site.
  • Each capture probe is immobilized on a different electrode having a non-conductive outer layer on a conductive working surface of a substrate.
  • the extent of hybridization between each capture probe and the nucleic acid target is detected by detecting the oxidation-reduction reaction at each electrode, utilizing a transition metal complex. These differences in the oxidation rates at the different electrodes are used to determine whether the selected nucleic acid target has a single nucleotide polymorphism at the selected SNP site.
  • Lynx Therapeutics (Hayward, Calif.) using MEGATYPETM technology can genotype very large numbers of SNPs simultaneously from small or large pools of genomic material. This technology uses fluorescently labeled probes and compares the collected genomes of two populations, enabling detection and recovery of DNA fragments spanning SNPs that distinguish the two populations, without requiring prior SNP mapping or knowledge.
  • a preferred example is the use of mass spectrometric determination of a nucleic acid sequence which includes the polymorphisms of the invention, for example, which includes the promoter of the COX2 gene or a complementary sequence.
  • mass spectrometric methods are known to those skilled in the art, and the genotyping methods of the invention are amenable to adaptation for the mass spectrometric detection of the polymorphisms of the invention, for example, the COX2 promoter polymorphisms of the invention.
  • SNPs can also be determined by ligation-bit analysis. This analysis requires two primers that hybridize to a target with a one nucleotide gap between the primers. Each of the four nucleotides is added to a separate reaction mixture containing DNA polymerase, ligase, target DNA and the primers. The polymerase adds a nucleotide to the 3′ end of the first primer that is complementary to the SNP, and the ligase then ligates the two adjacent primers together. Upon heating of the sample, if ligation has occurred, the now larger primer will remain hybridized and a signal, for example, fluorescence, can be detected. A further discussion of these methods can be found in U.S. Pat. Nos. 5,919,626; 5,945,283; 5,242,794; and 5,952,174 (each of the foregoing which is herein incorporated by reference in its entirety).
  • U.S. Pat. No. 6,821,733 (herein incorporated by reference in its entirety) describes methods to detect differences in the sequence of two nucleic acid molecules that includes the steps of: contacting two nucleic acids under conditions that allow the formation of a four-way complex and branch migration; contacting the four-way complex with a tracer molecule and a detection molecule under conditions in which the detection molecule is capable of binding the tracer molecule or the four-way complex; and determining binding of the tracer molecule to the detection molecule before and after exposure to the four-way complex. Competition of the four-way complex with the tracer molecule for binding to the detection molecule indicates a difference between the two nucleic acids.
  • Protein- and proteomics-based approaches are also suitable for polymorphism detection and analysis. Polymorphisms which result in or are associated with variation in expressed proteins can be detected directly by analysing said proteins. This typically requires separation of the various proteins within a sample, by, for example, gel electrophoresis or HPLC, and identification of said proteins or peptides derived therefrom, for example by NMR or protein sequencing such as chemical sequencing or more prevalently mass spectrometry.
  • Proteomic methodologies are well known in the art, and have great potential for automation. For example, integrated systems, such as the ProteomIQTM system from Proteome Systems, provide high throughput platforms for proteome analysis combining sample preparation, protein separation, image acquisition and analysis, protein processing, mass spectrometry and bioinformatics technologies.
  • mass spectrometry including ion trap mass spectrometry, liquid chromatography (LC) and LC/MSn mass spectrometry, gas chromatography (GC) mass spectroscopy, Fourier transform-ion cyclotron resonance-mass spectrometer (FT-MS), MALDI-TOF mass spectrometry, and ESI mass spectrometry, and their derivatives.
  • Mass spectrometric methods are also useful in the determination of post-translational modification of proteins, such as phosphorylation or glycosylation, and thus have utility in determining polymorphisms that result in or are associated with variation in post-translational modifications of proteins.
  • Associated technologies are also well known, and include, for example, protein processing devices such as the “Chemical Inkjet Printer” comprising piezoelectric printing technology that allows in situ enzymatic or chemical digestion of protein samples electroblotted from 2-D PAGE gels to membranes by jetting the enzyme or chemical directly onto the selected protein spots (Sloane, A. J. et al. High throughput peptide mass fingerprinting and protein macroarray analysis using chemical printing strategies. Mol Cell Proteomics 1(7):490-9 (2002), herein incorporated by reference in its entirety). After in-situ digestion and incubation of the proteins, the membrane can be placed directly into the mass spectrometer for peptide analysis.
  • protein processing devices such as the “Chemical Inkjet Printer” comprising piezoelectric printing technology that allows in situ enzymatic or chemical digestion of protein samples electroblotted from 2-D PAGE gels to membranes by jetting the enzyme or chemical directly onto the selected protein spots (Sloane, A. J. et al. High throughput
  • Single Strand Conformational Polymorphism (SSCP, Orita et al., PNAS 86:2766-2770 (1989), herein incorporated by reference in its entirety) is a method reliant on the ability of single-stranded nucleic acids to form secondary structure in solution under certain conditions.
  • the secondary structure depends on the base composition and can be altered by a single nucleotide substitution, causing differences in electrophoretic mobility under nondenaturing conditions.
  • the various polymorphs are typically detected by autoradiography when radioactively labelled, by silver staining of bands, by hybridisation with detectably labelled probe fragments or the use of fluorescent PCR primers which are subsequently detected, for example by an automated DNA sequencer.
  • RNA-SSCP Gasparini, P. et al. Scanning the first part of the neurofibromatosis type 1 gene by RNA-SSCP: identification of three novel mutations and of two new polymorphisms. Hum Genet. 97(4):492-5 (1996), herein incorporated by reference in its entirety), restriction endonuclease fingerprinting-SSCP (Liu, Q. et al.
  • Restriction endonuclease fingerprinting (REF): a sensitive method for screening mutations in long, contiguous segments of DNA. Biotechniques 18(3):470-7 (1995), herein incorporated by reference in its entirety), dideoxy fingerprinting (a hybrid between dideoxy sequencing and SSCP) (Sarkar, G. et al. Dideoxy fingerprinting (ddF): a rapid and efficient screen for the presence of mutations. Genomics 13:441-443 (1992), herein incorporated by reference in its entirety), bi-directional dideoxy fingerprinting (in which the dideoxy termination reaction is performed simultaneously with two opposing primers) (Liu, Q. et al.
  • Bi-directional dideoxy fingerprinting (Bi-ddF): a rapid method for quantitative detection of mutations in genomic regions of 300-600 bp. Hum Mol. Genet. 5(1):107-14 (1996), herein incorporated by reference in its entirety), and Fluorescent PCR-SSCP (in which PCR products are internally labelled with multiple fluorescent dyes, can be digested with restriction enzymes, followed by SSCP, and analysed on an automated DNA sequencer able to detect the fluorescent dyes) (Makino, R. et al. F-SSCP: fluorescence-based polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) analysis. PCR Methods Appl. 2(1):10-13 (1992), herein incorporated by reference in its entirety).
  • DGGE Denaturing Gradient Gel Electrophoresis
  • TGGE Temperature Gradient Gel Electrophoresis
  • HAT Heteroduplex Analysis
  • Denaturing High Pressure Liquid Chromatography is yet a further method utilised to detect SNPs, using HPLC methods well-known in the art as an alternative to the separation methods described above (such as gel electophoresis) to detect, for example, homoduplexes and heteroduplexes which elute from the HPLC column at different rates, thereby enabling detection of mismatch nucleotides and thus SNPs (Giordano, M. et al. Identification by denaturing high-performance liquid chromatography of numerous polymorphisms in a candidate region for multiple sclerosis susceptibility. Genomics 56(3):247-53 (1999), herein incorporated by reference in its entirety).
  • PTT Protein Translation Test
  • Variations are detected by binding of, for example, the MutS protein, a component of Escherichia coli DNA mismatch repair system, or the human hMSH2 and GTBP proteins, to double stranded DNA heteroduplexes containing mismatched bases.
  • DNA duplexes are then incubated with the mismatch binding protein, and variations are detected by mobility shift assay.
  • a simple assay is based on the fact that the binding of the mismatch binding protein to the heteroduplex protects the heteroduplex from exonuclease degradation.
  • a particular SNP particularly when it occurs in a regulatory region of a gene such as a promoter, can be associated with altered expression of a gene. Altered expression of a gene can also result when the SNP is located in the coding region of a protein-encoding gene, for example where the SNP is associated with codons of varying usage and thus with tRNAs of differing abundance. Such altered expression can be determined by methods well known in the art, and can thereby be employed to detect such SNPs. Similarly, where a SNP occurs in the coding region of a gene and results in a non-synonomous amino acid substitution, such substitution can result in a change in the function of the gene product. Similarly, in cases where the gene product is an RNA, such SNPs can result in a change of function in the RNA gene product. Any such change in function, for example as assessed in an activity or functionality assay, can be employed to detect such SNPs.
  • a particular subject faces with respect to a particular disease that subject will be assessed to determine the presence or absence of polymorphisms (preferably SNPs) which are either associated with protection from the disease or susceptibility to the disease.
  • polymorphisms preferably SNPs
  • a sample containing material to be tested is obtained from the subject.
  • the sample can be any sample potentially containing the target SNPs (or target polypeptides, as the case may be) and obtained from any bodily fluid (blood, urine, saliva, etc) biopsies or other tissue preparations.
  • DNA or RNA can be isolated from the sample according to any of a number of methods well known in the art. For example, methods of purification of nucleic acids are described in Tijssen; Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with nucleic acid probes Part 1: Theory and Nucleic acid preparation, Elsevier, New York, N.Y. 1993, as well as in Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular Cloning Manual 1989 (each of the foregoing which is herein incorporated by reference in its entirety).
  • the critical step is to determine a net susceptibility score for the subject.
  • This score will represent the balance between the combined value of the protective polymorphisms present and the total value of the susceptibility polymorphisms present, with a net protective score (i.e., a greater weight of protective polymorphisms present than susceptibility polymorphisms) being predictive of a reduced risk of developing the disease in question.
  • a net protective score i.e., a greater weight of protective polymorphisms present than susceptibility polymorphisms
  • the individual polymorphisms are assigned a value. In the simplest embodiment, each polymorphisms within a category (i.e.
  • protective or susceptibility is assigned an equal value, with each protective polymorphism being ⁇ 1 and each susceptibility polymorphism being +1 (or vice versa). It is however contemplated that the values assigned to individual polymorphisms within a category can differ, with some polymorphisms being assigned a value that reflects their predictive or discriminatory value. For example, one particularly strong protective polymorphism can have a value of ⁇ 2, whereas another more weakly protective polymorphism can have a value of ⁇ 0.75.
  • the net score, and the associated predictive outcome in terms of the risk of the subject developing a particular disease can be represented in a number of ways.
  • One example is as a graph as more particularly exemplified herein.
  • Another example is a simple numerical score (eg +2 to represent a subject with a net susceptibility score or ⁇ 2 to represent a subject with a net protective score).
  • the result is communicated to the subject with an explanation of what that result means to that subject.
  • advice on ways the subject can change their lifestyle so as to reduce the risk of developing the disease is also communicated to the subject.
  • risk factors known to be associated with a disease, such as COPD, emphysema, OCOPD, or lung cancer.
  • risk factors include epidemiological risk factors associated with an increased risk of developing the disease.
  • risk factors include, but are not limited to smoking and/or exposure to tobacco smoke, age, sex and familial history. These risk factors can be used to augment an analysis of one or more polymorphisms as herein described when assessing a subject's risk of developing a disease such as COPD, emphysema, OCOPD, or lung cancer.
  • the predictive methods of the invention allow a number of therapeutic interventions and/or treatment regimens to be assessed for suitability and implemented for a given subject, depending upon the disease and the overall risk quotient.
  • the simplest of these can be the provision to a subject with a net susceptibility score of motivation to implement a lifestyle change, for example, in the case of OCOPD, to reduce exposure to aero-pollutants, for example, by an occupational change or by the use of safety equipment in the work place.
  • the methods of the invention can provide motivation to quit smoking.
  • a ‘quit smoking’ program can be followed, which can include the use of anti-smoking medicaments (such as nicotine patches and the like) as well as anti-addiction medicaments.
  • Other therapeutic interventions can involve altering the balance between protective and susceptibility polymorphisms towards a protective state (such as by neutralizing or reversing a susceptibility polymorphism).
  • the manner of therapeutic intervention or treatment will be predicated by the nature of the polymorphism(s) and the biological effect of said polymorphism(s).
  • intervention or treatment is preferably directed to the restoration of normal expression of said gene, by, for example, administration of an agent capable of modulating the expression of said gene.
  • therapy can involve administration of an agent capable of increasing the expression of said gene, and conversely, where a polymorphism is associated with increased expression of a gene, therapy can involve administration of an agent capable of decreasing the expression of said gene.
  • Methods useful for the modulation of gene expression are well known in the art. For example, in situations were a polymorphism is associated with upregulated expression of a gene, therapy utilising, for example, RNAi or antisense methodologies can be implemented to decrease the abundance of mRNA and so decrease the expression of said gene.
  • therapy can involve methods directed to, for example, modulating the activity of the product of said gene, thereby compensating for the abnormal expression of said gene.
  • a susceptibility polymorphism is associated with decreased gene product function or decreased levels of expression of a gene product
  • therapeutic intervention or treatment can involve augmenting or replacing of said function, or supplementing the amount of gene product within the subject for example, by administration of said gene product or a functional analogue thereof.
  • therapy can involve administration of active enzyme or an enzyme analogue to the subject.
  • therapeutic intervention or treatment can involve reduction of said function, for example, by administration of an inhibitor of said gene product or an agent capable of decreasing the level of said gene product in the subject.
  • therapy can involve administration of an enzyme inhibitor to the subject.
  • therapies can be directed to mimic such upregulation or expression in an individual lacking the resistive genotype, and/or delivery of such enzyme or other protein to such individual
  • desirable therapies can be directed to mimicking such conditions in an individual that lacks the protective genotype.
  • Subjects of European descent who had smoked a minimum of fifteen pack years and diagnosed by a physician with chronic obstructive pulmonary disease (COPD) were recruited. Subjects met the following criteria: were over 50 years old and had developed symptoms of breathlessness after 40 years of age, had a Forced expiratory volume in one second (FEV1) as a percentage of predicted ⁇ 70% and a FEV1/FVC ratio (Forced expiratory volume in one second/Forced vital capacity) of ⁇ 79% (measured using American Thoracic Society criteria). Two hundred and ninety-four subjects were recruited, of these 58% were male, the mean FEV1/FVC ( ⁇ 95% confidence limits) was 51% (49-53), mean FEV1 as a percentage of predicted was 43 (41-45).
  • FEV1 Forced expiratory volume in one second
  • FEV1/FVC ratio Forced expiratory volume in one second/Forced vital capacity
  • Genomic DNA was extracted from whole blood samples [2, herein incorporated by reference in its entirety].
  • the Cyclo-oxygenase 2 ⁇ 765 polymorphism was determined by minor modifications of a previously published method [3, herein incorporated by reference in its entirety].
  • the PCR reaction was carried out in a total volume of 25 ul and contained 20 ng genomic DNA, 500 pmol forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl 2 and 1 unit of polymerase (Life Technologies). Cycling times were incubations for 3 min at 95° C. followed by 33 cycles of 50 s at 94° C., 60 s at 66° C.
  • Genomic DNA was extracted from whole blood samples [2]. Purified genomic DNA was aliquoted (10 ng/ul concentration) into 96 well plates and genotyped on a SequenomTM system (SequenomTM Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser) using the following sequences, amplification conditions and methods.
  • SequenomTM system SequenomTM Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser
  • SAP Shrimp alkaline phosphotase
  • SNP_ID 2nd-PCRP 1st-PCRP Lipoxygenase5- ACGTTGGATGGAAGTCAGAGATGATGGCAG ACGTTGGATGATGAATCCTGGACCCAAGAC 366G/A [SEQ. ID. NO. 56] [SEQ. ID. NO. 57] TNFalpha+489G/A ACGTTGGATGGAAAGATGTGCGCTGATAGG ACGTTGGATGGCCACATCTCTTTCTGCATC [SEQ. ID. NO. 58] [SEQ. ID. NO. 59] SMAD3C89Y ACGTTGGATGTTGCAGGTGTCCCATCGGAA [SEQ. ID. NO. 60] ACGTTGGATGTAGCTCGTGGTGGCTGTGCA [SEQ.
  • Interleukin 1B (IL-1B) ⁇ 511 A/G Polymorphism Allele and Genotype Frequencies in COPD and Resistant Smokers.
  • Microsomal Epoxide Hydrolase (MEH) His 139 Arg A/G Example 4 Polymorphism Allele and Genotype Frequency in COPD and Resistant Smokers.
  • Heat Shock Protein 70 HOM T2437C Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
  • Chloride Channel Calcium-Activated 1 (CLCA1) +13924 T/A Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
  • Beta2-Adrenoreceptor Gln 27 Glu Polymorphism Allele and Genotype Frequency in the COPD Patients, Resistant Smokers and Controls.
  • MMP1 Maxtrix Metalloproteinase 1 (MMP1) ⁇ 1607 1G/2G Polymorphism Allele and Genotype Frequencies in COPD Patients, Resistant Smokers and Controls.
  • Table 2 below provides a summary of the protective and susceptibility polymorphisms determined for COPD.
  • Protective polymorphisms were assigned a score of +1 while susceptibility polymorphisms were assigned a score of ⁇ 1.
  • a net score was then calculated according to the presence of susceptibility and protective genotypes. This produced a linear spread of values. When assessed as a range between ⁇ 3 to +3, a linear relationship as depicted in FIG. 2 was observed. This analysis indicates that for subjects with a net score of ⁇ 2 or less, there was a 70% or greater risk of having COPD. In contrast, for subjects with a net score of 2+ or greater the risk was approximately 40% (see FIG. 2 ).
  • OOPD occupational chronic obstructive pulmonary disease
  • FEV1 forced expiratory volume in one second
  • FEV1/FVC ratio Force expiratory volume in one second/Forced vital capacity
  • Genomic DNA was extracted from whole blood samples [2]. The COX2 ⁇ 765 polymorphism was determined by minor modifications of a previously published method [3].
  • the PCR reaction was carried out in a total volume of 25 ul and contained 20 ng genomic DNA, 500 pmol forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl 2 and 1 unit of Taq polymerase (Life Technologies). Cycling times were incubations for 3 min at 95° C. followed by 33 cycles of 50 s at 94° C., 60 s at 66° C. and 60 s at 72° C. A final elongation of 10 min at 72° C.
  • PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 ⁇ l and contained 80 ng genomic DNA, 10 pmol forward and reverse primers, 0.1 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl 2 and 0.5 unit of Taq polymerase (Qiagen).
  • Aliquots of amplification product were digested for 4 hrs with 5 U of the relevant restriction enzymes (Roche Diagnostics, New Zealand) at designated temperatures and conditions. Digested products were separated on 8% polyacrylamide gels (49:1, Sigma). The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [5, herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions.
  • the PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 ⁇ l and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.5 mM MgCl 2 and 1.0 unit of Taq polymerase (Qiagen).
  • Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions
  • the PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 ⁇ l and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.5 mM MgCl 2 and 1.0 unit of Taq polymerase (Qiagen).
  • Forward and reverse prime sequences were 5′-CTACCAGGAATGGCCTTGTCC-3′ [SEQ.ID.NO.136] and 5′-CTCTCAGGTCTGGTGTCATCC-3′ [SEQ.ID.NO.137].
  • Cycling conditions consisted of 94 C 60 s, 56 C 20 s, 72 C 20 s for 38 cycles with an extended last extension of 3 min. Aliquots of amplification product were digested for 4 hrs with 2 Units of the restriction enzymes Taq 1 (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 3% agarose. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [6]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 ⁇ l and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.5 mM MgCl 2 and 1.0 unit of Taq polymerase (Qiagen).
  • Genomic DNA was extracted from whole blood samples [4]. Purified genomic DNA was aliquoted (10 ng/ul concentration) into 96 well plates and genotyped on a SequenomTM system (SequenomTM Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser) using the sequences, amplification conditions and methods described below.
  • SequenomTM system SequenomTM Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser
  • Table 7 provides a summary of the protective and susceptibility polymorphisms determined for OCOPD.
  • the SNP score can be negative if there are only susceptibility polymorphisms, positive, if there are only protective polymorphisms, or either positive or negative, depending upon the relative numbers of protective to susceptibility polymorphisms.
  • Subjects of European decent who had smoked a minimum of fifteen pack years and diagnosed with lung cancer were recruited. Subjects met the following criteria: diagnosed with lung cancer based on radiological and histological grounds, including primary lung cancers with histological types of small cell lung cancer, squamous cell lung cancer, adenocarinoma of the lung, non-small cell cancer (where histological markers can not distinguish the subtype) and broncho-alveolar carcinoma. Subjects can be of any age and at any stage of treatment after the diagnosis had been confirmed. One hundred and nine subjects were recruited, of these 58% were male, the mean FEV1/FVC ( ⁇ 95% confidence limits) was 51% (49-53), mean FEV1 as a percentage of predicted was 43 (41-45).
  • IQR Parameter Lung Cancer Resistant smokers Median
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [7, herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for our own laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 ⁇ l and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 200 mM dNTPs, 20 mM Tris-HCL (pH 8.4), 50 mM KCl, 2.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen).
  • Genomic DNA was extracted from whole blood samples (Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular Cloning Manual. 1989).
  • the Cyclo-oxygenase 2 ⁇ 765 polymorphism was determined by minor modifications of a previously published method (Papafili A, et al., 2002, incorporated in its entirety herein by reference)).
  • the PCR reaction was carried out in a total volume of 25 ul and contained 20 ng genomic DNA, 500 pmol forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl 2 and 1 unit of polymerase (Life Technologies).
  • Genotyping was done using minor modifications of the above protocol optimised for our own laboratory conditions
  • the PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 ⁇ l and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 200 mM dNTPs, 20 mM Tris-HCL (pH 8.4), 50 mM KCl, 1.5 mM MgCl 2 and 1.0 unit of Taq polymerase (Qiagen).
  • Forward and reverse prime sequences were 3′ TCGTGAGAATGTCTTCCCATT-3′ [SEQ.ID.NO.195] and 5′-TCTTGGATTGATTTGAGATAAGTGAAATC-3′[SEQ.ID.NO.196].
  • Genomic DNA was extracted from whole blood samples [2]. Purified genomic DNA was aliquoted (10 ng/ul concentration) into 96 well plates and genotyped on a SequenomTM system (SequenomTM Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser) using the following sequences, amplification conditions and methods. The following conditions were used for the PCR multiplex reaction: final concentrations were for 10 ⁇ Buffer 15 mM MgCl2 1.25 ⁇ , 25 mM MgCl2 1.625 mM, dNTP mix 25 mM 500 uM, primers 4 uM 100 nM, Taq polymerase (Quiagen hot start) 0.15 U/reaction, Genomic DNA 10 ng/ul.
  • SequenomTM system SequenomTM Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser
  • ACT IL-18 105 A/C ACGTTGGATGGTCAATGAAGAGAACTTGGTC ACGTTGGATGAATGTTTATTGTAGAAAACC
  • SEQ. ID. NO. 201 [SEQ. ID. NO. 202] ACT IL-18-133 G/C ACGTTGGATGGGGTATTCATAAGCTGAAAC ACGTTGGATGCCTTCAAGTTCAGTGGTCAG [SEQ. ID. NO. 203]
  • SEQ. ID. NO. 204 ACT CYP 1A1 Ile462Val ACGTTGGATGGTGATTATCTTTGGCATGGG ACGTTGGATGGGATAGCCAGGAAGAGAAAG [SEQ. ID. NO. 205] [SEQ. ID. NO.
  • TERM SNP_ID 2nd-PCRP 1st-PCRP ACT CTGF-447G/C ACGTTGGATGAGGTAGCTGAAGAG ACGTTGGATGGCCTATAGCCTCTAA GCAAAC [SEQ. ID. NO. 292] AACGC [SEQ. ID. NO. 293] ACT NBS1 Gln185Glu ACGTTGGATGCTTTCAATTTGTGGA ACGTTGGATGTGTGCACTCATTTGT G/C GGCTG [SEQ. ID. NO. 294] GGACG [SEQ. ID. NO. 295] ACT MBL2 161 G/A ACGTTGGATGGTAGCTCTCCAGGCA ACGTTGGATGGTACCTGGTTCCCCC TCAAC [SEQ. ID. NO.
  • TTTTC [SEQ. ID. NO. 297] ACT IGF2R Leu252Val ACGTTGGATGACACCAGGCGTTTGA ACGTTGGATGAAAAACGCCAACAGC C/G TGTTG [SEQ. ID. NO. 298] ATCGG [SEQ. ID. NO. 299] ACT MUC5AC -221 C/T ACGTTGGATGAGGCGGAGATGGGT ACGTTGGATGAGTCTAGGGTGGGG GTGTC [SEQ. ID. NO. 300] TATGTG [SEQ. ID. NO. 301] ACT Arg1 intron1 C/T ACGTTGGATGATGTGTGGATTCACA ACGTTGGATGGGGTTGGCAACTCTA GCTCG [SEQ. ID.
  • AAAGG [SEQ. ID. NO. 303] ACT REV1 Phe257Ser ACGTTGGATGCTCTGAAATCAGTGC ACGTTGGATGATGGTCAACAGTGTT C/T TGCTC [SEQ. ID. NO. 304] GCCAG [SEQ. ID. NO. 305] ACT Apex1 Asp148Glu ACGTTGGATGCACCTCTTGATTGCT ACGTTGGATGACCCGGCCTTCCTGA G/T TTCCC [SEQ. ID. NO. 306] TCATG [SEQ. ID. NO.
  • ACG IL-10 -1082 A/G ACGTTGGATGATTCCATGGAGGCTG ACGTTGGATGGACAACACTACTAAG GATAG [SEQ. ID. NO. 308] GCTTC [SEQ. ID. NO. 309]
  • CGF Connective Tissue Growth Factor
  • MCL2 Mannose Binding Lectin 161 G/A Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • NBS1 NBS1 Gln185Glu G/C Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • Arginase 1 (Arg1) Intron 1 C/T Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • IGF2R Insulin-Like Growth Factor II Receptor
  • APE1 Apex Nuclease 1
  • APE1 Asp148Glu T/G Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • Table 12 provides a summary of the protective and susceptibility polymorphisms determined for lung cancer.
  • Protective polymorphisms were assigned a score of ⁇ 1 while susceptibility polymorphisms were assigned a score of +1. For each subject, a net score was then calculated according to the presence of susceptibility and protective genotypes. This produced a linear spread of values, as shown in Table 14. When assessed as a range between ⁇ 2 to +4, a linear relationship as depicted in FIG. 4 was observed. This analysis indicates that for subjects with a net score of ⁇ 2 or less, there was a minimal risk of having lung cancer. For subjects with a net score of ⁇ 1, there was an approximately one in ten risk of having lung cancer. In contrast, for subjects with a net score of 4+ or greater, the risk was markedly increased to over 70% (see Table 19 and FIG. 4 ).
  • the protective polymorphisms are assigned a negative value while the susceptibility polymorphisms are assigned a positive value.
  • the precise value or sign given to each one is not critical, as long as it is consistent between the types of polymorphisms.
  • the methods of the invention allow the determination of risk of disease to be assessed.
  • a simple scoring system in which each polymorphism in a category (i.e. protective or susceptibility) is assigned the same value allows the combined effects of all potentially relevant polymorphisms to be factored into the analysis.
  • the methods of the invention utilize a scoring system with adjustment (weighting) for the magnitude of the effect of each individual polymorphism, and again allow all polymorphisms to be simultaneously analyzed.
  • analyses can utilise path analysis and/or Monte-Carlo analysis where the non-genetic and genetic factors can be analyzed.
  • the benefit of a net susceptibility score having been determined for a subject is that it provides the opportunity for early prophylactic and/or therapeutic intervention.
  • Such intervention can be as simple as communicating the net susceptibility score to the subject together with an explanation of the implications of that score. This alone can cause a lifestyle or occupational change, with the resultant beneficial effect for the subject.
  • Table 21 below presents representative examples of polymorphisms in linkage disequilibrium with the polymorphisms specified herein. Examples of such polymorphisms can be located using public databases, such as that available online at world wide web dot hapmap dot org. Specified polymorphisms are indicated in the columns marked SNP NAME. Unique identifiers are indicated in the columns marked RS NUMBER.
  • the present invention is directed to methods for assessing a subject's risk of developing a disease.
  • the methods include the analysis of polymorphisms herein shown to be associated with increased or decreased risk of developing a disease, or the analysis of results obtained from such an analysis, and the determination of a net risk score. Methods of treating subjects at risk of developing a disease herein described are also provided. Additional information regarding the above material, or subparts thereof, can be found in U.S. patent application Ser. No. 10/479,525, filed Jun. 16, 2004; and PCT Application No. PCT/NZ02/00106, filed Jun. 5, 2002, which further designates New Zealand Application No. 512169, filed Jun. 5, 2001; New Zealand Application No. 513016, filed Jul. 17, 2001, and New Zealand Application No.
  • any of the terms “comprising”, “consisting essentially of”, and “consisting of” can be replaced with either of the other two terms in the specification, thus indicating additional examples, having different scope, of various alternative embodiments of the invention.
  • the terms “comprising”, “including”, containing”, etc. are to be read expansively and without limitation.
  • the methods and processes illustratively described herein suitably can be practiced in differing orders of steps, and that they are not necessarily restricted to the orders of steps indicated herein or in the claims. It is also that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise.
  • a reference to “a host cell” includes a plurality (for example, a culture or population) of such host cells, and so forth.
  • a host cell includes a plurality (for example, a culture or population) of such host cells, and so forth.
  • the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein.
  • the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by the Applicant.

Abstract

The present invention provides methods for the assessment of diseases that result from the combined or interactive effects of two or more genetic variants, and in particular for diagnosing risk of developing such diseases in subjects using an analysis of genetic polymorphisms. Methods for the derivation of a net score indicative of a subject's risk of developing a disease are provided.

Description

    RELATED APPLICATIONS
  • This application claims priority to New Zealand Application Nos. 540249, filed May 20, 2005 and 541842, filed Aug. 15, 2005, both of which are incorporated by reference in their entireties.
  • FIELD OF THE INVENTION
  • The present invention is concerned with methods for the assessment of diseases that result from the combined or interactive effects of two or more genetic variants, and in particular for diagnosing risk of developing such diseases in subjects using an analysis of genetic polymorphisms.
  • BACKGROUND OF THE INVENTION
  • Diseases that result from the combined or interactive effects of two or more genetic variants, with or without environmental factors, are called complex diseases and include cancer, coronary artery disease, diabetes, stroke, and chronic obstructive pulmonary disease (COPD). Although combining non-genetic risk factors to determine a risk level of outcome has been in applied to coronary artery disease, (by combining individual factors such as blood pressure, gender, fasting cholesterol, and smoking status), there are no such methods in combining the effects of multiple genetic factors with non-genetic factors. There is a growing realization that the complex diseases, for which examples are given above, may result from the combined effects of common genetic variants or polymorphisms rather than mutations which are rare (believed to be present in less than 1% of the general population). Moreover, these relatively common polymorphisms can confer either susceptibility and/or protective effects on the development of these diseases. In addition, the likelihood that these polymorphisms are actually expressed (termed penetrance) as a disease or clinical manifestation requires a quantum of environmental exposure before such a genetic tendency can be clinically detected.
  • SUMMARY OF THE INVENTION
  • Recent studies have identified a number of genetic variants or polymorphisms that confer susceptibility to protection from COPD, occupational COPD (OCOPD), and lung cancer. The biological basis of just how these polymorphisms interact or combine to determine risk remains unclear.
  • Surprisingly, it has now been found that an assessment approach which determines a subject's net score following the balancing of the number of polymorphisms associated with protection from a disease against the number of polymorphisms associated with susceptibility to that disease present in the subject is indicative of that subject's risk quotient. Furthermore, it has presently been determined that this approach is widely applicable, on a disease-by-disease basis.
  • It is broadly to this approach to risk assessment that the present invention is directed.
  • Accordingly, in a first aspect, the present invention provides a method of assessing a subject's risk of developing a disease which includes:
      • analysing a biological sample from said subject for the presence or absence of protective polymorphisms and for the presence or absence of susceptibility polymorphisms, wherein said protective and susceptibility polymorphisms are associated with said disease;
      • assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa;
      • calculating a net score for said subject, said net score representing the balance between the combined value of the protective polymorphisms and the combined value of the susceptibility polymorphisms present in the subject sample;
      • wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
  • The value assigned to each protective polymorphism can be the same or can be different. The value assigned to each susceptibility polymorphism can be the same or can be different, with either each protective polymorphism having a negative value and each susceptibility polymorphism having a positive value, or vice versa. When the disease is a lung disease, the protective polymorphisms analysed can be selected from one or more of the group consisting of: +760GG or +760CG within the gene encoding superoxide dismutase 3 (SOD3); −1296TT within the promoter of the gene encoding tissue inhibitor of metalloproteinase 3 (TIMP3); CC (homozygous P allele) within codon 10 of the gene encoding transforming growth factor beta (TGFβ); 2G2G within the promoter of the gene encoding metalloproteinase 1 (MMP1); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
  • Linkage disequilibrium is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present implies the presence of the other. (Reich, D. E. et al. Linkage disequilibrium in the human genome. Nature 411:199-204 (2001), herein incorporated by reference in its entirety).
  • Preferably, all polymorphisms of the group are analysed.
  • Preferably, the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: −82AA within the promoter of the gene encoding human macrophage elastase (MMP12); −1562CT or −1562TT within the promoter of the gene encoding metalloproteinase 9 (MMP9); 1237AG or 1237AA (Tt or tt allele genotypes) within the 3′ region of the gene encoding a1-antitrypsin (a1AT); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
  • Preferably, all polymorphisms of the group are analysed.
  • In one embodiment each protective polymorphism is assigned a value of −1 and each susceptibility polymorphism is assigned a value of +1.
  • In another embodiment each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of −1.
  • When the disease is COPD, the protective polymorphisms analysed can be selected from one or more of the group consisting of: −765 CC or CG in the promoter of the gene encoding cyclooxygenase 2 (COX2); Arg 130 Gln AA in the gene encoding Interleukin-13 (IL-13); Asp 298 Glu TT in the gene encoding nitric oxide synthase 3 (NOS3); Lys 420 Thr AA or AC in the gene encoding vitamin binding protein (VDBP); Glu 416 Asp TT or TG in the gene encoding VDBP; Ile 105 Val AA in the gene encoding glutathione S-transferase (GSTP1); MS in the gene encoding a 1-antitrypsin (a 1 AT); the +489 GG geneotype in the gene encoding Tissue Necrosis factor a (TNFa); the −308 GG geneotype in the gene encoding TNFa; the C89Y AA or AG geneotype in the gene encodoing SMAD3; the 161 GG genotype in the gene encodoing Mannose binding lectin 2 (MBL2); the −1903 AA genotype in the gene encoding Chymase 1 (CMA1); the Arg 197 Gln AA genotype in the gene encoding N-Acetyl transferase 2 (NAT2); the His 139 Arg GG genotype in the gene encoding Microsomal epoxide hydrolase (MEH); the −366 AA or AG genotype in the gene encoding 5 Lipo-oxygenase (ALOX5); the HOM T2437C TT genotype in the gene encoding Heat Shock Protein 70 (HSP 70); the exon 1 + 49 CT or TT genotype in the gene encoding Elafin; the Gln 27 Glu GG genotype in the gene encoding 132 Adrenergic receptor (ADBR); the −1607 1G1G or 1G2G genotype in the promoter of the gene encoding Matrix Metalloproteinase 1 (MMP1); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms. Preferably, all polymorphisms of the group are analysed.
  • Preferably, the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: Arg 16 Gly GG in the gene encoding β2-adrenoreceptor (ADRB2); 105 AA in the gene encoding Interleukin-18 (IL-18); −133 CC in the promoter of the gene encoding IL-18; −675 5G5G in the promoter of the gene encoding plasminogen activator inhibitor 1 (PAI-1); −1055 TT in the promoter of the gene encoding IL-13; 874 TT in the gene encoding interferon gamma (IFN?); the +489 AA or AG genotype in the gene encoding TNFa; the −308 AA or AG genotype in the gene encoding TNFa; the C89Y GG genotype in the gene encoding SMAD3; the E469K GG genotype in the gene encoding Intracellular Adhesion molecule 1 (ICAM1); the Gly 881 Arg GC or CC genotype in the gene encoding Caspase (NOD2); the −511 GG genotype in the gene encoding IL1B; the Tyr 113 His TT genotype in the gene encoding MEH; the −366 GG genotype in the gene encoding ALOX5; the HOM T2437C CC or CT genotype in the gene encoding HSP 70; the +13924 AA genotype in the gene encoding Chloride Channel Calcium-activated 1 (CLCA1); the −159 CC genotype in the gene encoding Monocyte differentiation antigen CD-14 (CD-14); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
  • Preferably, all polymorphisms of the group are analysed.
  • In one embodiment each protective polymorphism is assigned a value of −1 and each susceptibility polymorphism is assigned a value of +1.
  • In one embodiment each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of −1.
  • When the disease is OCOPD, the protective polymorphisms analysed can be selected from one or more of the group consisting of: −765 CC or CG in the promoter of the gene encoding COX2; −251 AA In the promoter of the gene encoding interleukin-8 (IL-8); Lys 420 Thr AA in the gene encoding VDBP; Glu 416 Asp TT or TG in the gene encoding VDBP; exon 3 T/C RR in the gene encoding microsomal epoxide hydrolase (MEH); Arg 312 Gln AG or GG in the gene encoding SOD3; MS or SS in the gene encoding a1AT; Asp 299 Gly AG or GG in the gene encoding toll-like receptor 4 (TLR4); Gln 27 Glu CC in the gene encoding ADRB2; −518 AA in the gene encoding IL-11; Asp 298 Glu TT in the gene encoding NOS3; or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
  • Preferably, all polymorphisms of the group are analysed.
  • Preferably, the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: −765 GG in the promoter of the gene encoding COX2; 105 AA in the gene encoding IL-18; −133 CC in the promoter of the gene encoding IL-18; −675 5G5G in the promoter of the gene encoding PAI-1; Lys 420 Thr CC in the gene encoding VDBP; Glu 416 Asp GG in the gene encoding VDBP; Ile 105 Val GG in the gene encoding GSTP1; Arg 312 Gln AA in the gene encoding SOD3; −1055 TT in the promoter of the gene encoding IL-13; 3′ 1237 Tt or tt in the gene encoding a 1AT; −1607 2G2G in the promoter of the gene encoding MMP1; or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
  • Preferably, all polymorphisms of the group are analysed.
  • In one embodiment each protective polymorphism is assigned a value of −1 and each susceptibility polymorphism is assigned a value of +1.
  • In one embodiment each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of −1.
  • When the disease is lung cancer, the protective polymorphisms analysed can be selected from one or more of the group consisting of: the Asp 298 Glu TT genotype in the gene encoding NOS3; the Arg 312 Gln CG or GG genotype in the gene encoding SOD3; the Asn 357 Ser AG or GG genotype in the gene encoding MMP12; the 105 AC or CC genotype in the gene encoding IL-18; the −133 CG or GG genotype in the gene encoding IL-18; the −765 CC or CG genotype in the promoter of the gene encoding COX2; the −221 TT genotype in the gene encoding Mucin 5AC (MUC5AC); the intron 1 C/T TT genotype in the gene encoding Arginase 1 (Arg1); the Leu252Val GG genotype in the gene encoding Insulin-like growth factor II receptor (IGF2R); the −1082 GG genotype in the gene encoding Interleukin 10 (IL-10); the −251 AA genotype in the gene encoding Interleukin 8 (IL-8); the Arg 399 Gln AA genotype in the X-ray repair complementing defective in Chinese hamster 1 (XRCC1) gene; the A870G GG genotype in the gene encoding cyclin D (CCND1); the −751 GG genotype in the promoter of the xeroderma pigmentosum complementation group D (XPD) gene; the Ile 462 Val AG or GG genotype in the gene encoding cytochrome P450 1A1 (CYP1A1); the Ser 326 Cys GG genotype in the gene encoding 8-Oxoguanine DNA glycolase (OGG1); the Phe 257 Ser CC genotype in the gene encoding REV1; or one or more polymorphisms in linkage disequilibrium with any one or more of these polymorphisms.
  • Preferably, all polymorphisms of the group are analysed.
  • Preferably, the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: the −786 TT genotype in the promoter of the gene encoding NOS3; the Ala 15 Thr GG genotype in the gene encoding anti-chymotrypsin (ACT); the 105 AA genotype in the gene encoding IL-18; the −133 CC genotype in the promoter of the gene encoding IL-18; the 874 AA genotype in the gene encoding IFN?; the −765 GG genotype in the promoter of the gene encoding COX2; the −447 CC or GC genotype in the gene encoding Connective tissue growth factor (CTGF); and the +161 AA or AG genotype in the gene encoding MBL2; −511 GG genotype in the gene encoding IL-1B; the A-670G AA genotype in the gene encoding FAS (Apo-1/CD95); the Arg 197 Gln GG genotype in the gene encoding N-acetyltransferase 2 (NAT2); the Ile462 Val AA genotype in the gene encoding CYP1A1; the 1019 G/C Pst I CC or CG genotype in the gene encoding cytochrome P450 2E1 (CYP2E1); the C/T Rsa I TT or TC genotype in the gene encoding CYP2E1; the GSTM null genotype in the gene encoding GSTM; the −1607 2G/2G genotype in the promoter of the gene encoding MMP1; the Gln 185 Glu CC genotype in the gene encoding Nibrin (NBS1); the Asp 148 Glu GG genotype in the gene encoding Apex nuclease (APE1); or one or more polymorphisms in linkage disequilibrium with any one or more of these polymorphisms.
  • Preferably, all polymorphisms of the group are analysed.
  • In one embodiment each protective polymorphism is assigned a value of −1 and each susceptibility polymorphism is assigned a value of +1.
  • In one embodiment each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of −1.
  • In various embodiments the subject is or has been a smoker.
  • Preferably, the methods of the invention are performed in conjunction with an analysis of one or more risk factors, including one or more epidemiological risk factors, associated with the risk of developing a lung disease including COPD, emphysema, OCOPD, and lung cancer. Such epidemiological risk factors include but are not limited to smoking or exposure to tobacco smoke, age, sex, and familial history.
  • In another aspect, the invention provides a method of determining a subject's risk of developing a disease, said method comprising
      • obtaining the result of one or more analyses of a sample from said subject to determine the presence or absence of protective polymorphisms and the presence or absence of susceptibility polymorphisms, and wherein said protective and susceptibility polymorphisms are associated with said disease;
      • assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa;
      • calculating a net score for said subject, said net score representing the balance between the combined value of the protective polymorphisms and the combined value of the susceptibility polymorphisms present in the subject sample;
      • wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
  • In a further aspect the present invention provides a method for assessing the risk of a subject developing a disease which includes
      • determining a net score for said subject in accordance with the methods of the invention described above, in combination with a score based on the presence or absence of one or more epidemiological risk factors,
      • wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased predisposition and/or susceptibility to said disease.
  • In another aspect, the present invention provides a kit for assessing a subject's risk of developing a disease, said kit comprising a means of analysing a sample from said subject for the presence or absence of one or more protective polymorphisms and one or more susceptibility polymorphisms as described herein.
  • In yet a further aspect, the present invention provides a method of prophylactic or therapeutic intervention in relation to a subject having a net susceptibility score for a disease as determined by a method as defined above which includes the steps of communicating to said subject said net susceptibility score, and advising on changes to the subject's lifestyle that could reduce the risk of developing said disease.
  • In still a further aspect, the present invention provides a method of treatment of a subject to decrease to the risk of developing a disease through alteration of the net score for said subject as determined by a method as defined above, wherein said method of treatment includes reversing, genotypically or phenotypically, the presence and/or functional effect of one or more susceptibility polymorphisms associated with said disease; and/or replicating and/or mimicking, genotypically or phenotypically, the presence and/or functional effect of one or more protective polymorphisms associated with said disease.
  • BRIEF DESCRIPTION OF FIGURES
  • FIG. 1: depicts a graph showing combined frequencies of the presence or absence of selected protective genotypes in the COPD subjects and in resistant smokers.
  • FIG. 2: depicts a graph showing net scores for protective and susceptibility polymorphisms in COPD subjects.
  • FIG. 3: depicts a graph showing net scores for protective and susceptibility polymorphisms in OCOPD subjects.
  • FIG. 4: depicts a graph showing net scores for protective and susceptibility polymorphisms in subjects with lung cancer.
  • FIG. 5: depicts a graph showing net scores for protective and susceptibility polymorphisms in subjects with lung cancer.
  • DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • There is a need for a method for assessing a subject's risk of developing a disease using genetic (and optionally non-genetic) risk factors. In some embodiments, it is an object of the present invention to go some way towards meeting this need and/or to provide the public with a useful choice.
  • The present invention is directed to methods for the assessment of the genetic risk quotient of a particular subject with respect to a particular disease. The methods rely upon the recognition that for many (if not all) diseases there exist genetic polymorphisms which fall into two categories—namely those indicative of a reduced risk of developing a particular disease (which can be termed “protective polymorphisms” or “protective SNPs”) and those indicative of an increased risk of developing a particular disease (which can be termed “susceptibility polymorphisms” or “susceptibility SNPs”).
  • As used herein, the phrase “risk of developing [a] disease” means the likelihood that a subject to whom the risk applies will develop the disease, and includes predisposition to, and potential onset of the disease. Accordingly, the phrase “increased risk of developing [a] disease” means that a subject having such an increased risk possesses an hereditary inclination or tendency to develop the disease. This does not mean that such a person will actually develop the disease at any time, merely that he or she has a greater likelihood of developing the disease compared to the general population of individuals that either does not possess a polymorphism associated with increased disease risk, or does possess a polymorphism associated with decreased disease risk. Subjects with an increased risk of developing the disease include those with a predisposition to the disease, for example in the case of COPD, a tendency or prediliction regardless of their lung function at the time of assessment, for example, a subject who is genetically inclined to COPD but who has normal lung function, those at potential risk, for example in the case of COPD, subjects with a tendency to mildly reduced lung function who are likely to go on to suffer COPD if they keep smoking, and subjects with potential onset of the disease, for example in the case of COPD, subjects who have a tendency to poor lung function on spirometry etc., consistent with COPD at the time of assessment.
  • Similarly, the phrase “decreased risk of developing [a] disease” means that a subject having such a decreased risk possesses an hereditary disinclination or reduced tendency to develop the disease. This does not mean that such a person will not develop the disease at any time, merely that he or she has a decreased likelihood of developing the disease compared to the general population of individuals that either does possess one or more polymorphisms associated with increased disease risk, or does not possess a polymorphism associated with decreased disease risk.
  • It will be understood that in the context of the present invention the term “polymorphism” means the occurrence together in the same population at a rate greater than that attributable to random mutation (usually greater than 1%) of two or more alternate forms (such as alleles or genetic markers) of a chromosomal locus that differ in nucleotide sequence or have variable numbers of repeated nucleotide units. See www.ornl.gov/sci/techresources/Human_Genome/publicat/97pr/09gloss.html#p. Accordingly, the term “polymorphisms” is used herein contemplates genetic variations, including single nucleotide substitutions, insertions and deletions of nucleotides, repetitive sequences (such as microsatellites), and the total or partial absence of genes (eg. null mutations). As used herein, the term “polymorphisms” also includes genotypes and haplotypes. A genotype is the genetic composition at a specific locus or set of loci. A haplotype is a set of closely linked genetic markers present on one chromosome which are not easily separable by recombination, tend to be inherited together, and can be in linkage disequilibrium. A haplotype can be identified by patterns of polymorphisms such as SNPs. Similarly, the term “single nucleotide polymorphism” or “SNP” in the context of the present invention includes single base nucleotide substitutions and short deletion and insertion polymorphisms. It will further be understood that the term “disease” is used herein in its widest possible sense, and includes conditions which can be considered disorders and/or illnesses which have a genetic basis or to which the genetic makeup of the subject contributes.
  • Using case-control studies, the frequencies of several genetic variants (polymorphisms) of candidate genes have been compared in disease sufferers, for example, in chronic obstructive pulmonary disease (COPD) sufferers, in occupational chronic obstructive pulmonary disease (OCOPD) sufferers, and in lung cancer sufferers, and in control subjects not suffering from the relevant disease, for example smokers without lung cancer and with normal lung function. The majority of these candidate genes have confirmed (or likely) functional effects on gene expression or protein function.
  • In various specific embodiments, the frequencies of polymorphisms between blood donor controls, resistant subjects and those with COPD, the frequencies of polymorphisms between blood donor controls, resistant subjects and those with OCOPD, and the frequencies of polymorphisms between blood donor controls, resistant subjects and those with lung cancer, have been compared. This has resulted in both protective and susceptibility polymorphisms being identified for each disease.
  • The surprising finding relevant to this invention is that a combined analysis of protective and susceptibility polymorphisms discriminatory for a given disease yields a result that is indicative of that subject's risk quotient for that disease. This approach is widely applicable, on a disease-by-disease basis.
  • The present invention identifies methods of assessing the risk of a subject developing a disease which includes determining in said subject the presence or absence of protective and susceptibility polymorphisms associated with said disease. A net score for said subject is derived, said score representing the balance between the combined value of the protective polymorphisms present in said subject and the combined value of the susceptibility polymorphisms present in said subject. A net protective score is predictive of a reduced risk of developing said disease, and a net susceptibility score is predictive of an increased risk of developing said disease.
  • Within each category (protective polymorphisms, susceptibility polymorphisms, respectively) the polymorphisms can each be assigned the same value. For example, in the analyses presented in the Examples herein, each protective polymorphism associated with a given disease is assigned a value of +1, and each susceptibility polymorphism is assigned a value of −1. Alternatively, polymorphisms discriminatory for a disease within the same category can each be assigned a different value to reflect their discriminatory value for said disease. For example, a polymorphism highly discriminatory of risk of developing a disease can be assigned a high weighting, for example a polymorphism with a high Odd's ratio can be considered highly discriminatory of disease, and can be assigned a high weighting.
  • Accordingly, in a first aspect, the present invention provides a method of assessing a subject's risk of developing a disease which includes:
  • analysing a biological sample from said subject for the presence or absence of protective polymorphisms and for the presence or absence of susceptibility polymorphisms, wherein said protective and susceptibility polymorphisms are associated with said disease;
  • assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa;
  • calculating a net score for said subject, said net score representing the balance between the combined value of the protective polymorphisms and the combined value of the susceptibility polymorphisms present in the subject sample;
  • wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
  • The subject sample can have already been analysed for the presence or absence of one or more protective or susceptibility polymorphisms, and the method includes the steps of
      • assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa;
      • calculating a net score for said subject, said net score representing the balance between the combined value of the protective polymorphisms and the combined value of the susceptibility polymorphisms present in the subject sample;
      • wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
  • In one embodiment described herein in Example 1, 17 susceptibility genetic polymorphisms and 19 protective genetic polymorphisms identified as discriminatory for COPD were analysed using methods of the invention. These analyses can be used to determine the risk quotient of any subject for COPD, and in particular to identify subjects at greater risk of developing lung cancer.
  • In another embodiment described herein in Example 2, 11 susceptibility genetic polymorphisms and 11 protective genetic polymorphisms identified as discriminatory for OCOPD are analysed using methods of the invention. These analyses can be used to determine the risk quotient of any subject for OCOPD, and in particular to identify subjects at greater risk of developing OCOPD.
  • In a further embodiment described herein in Example 3, 19 susceptibility genetic polymorphisms and 17 protective genetic polymorphisms identified as discriminatory for lung cancer are analysed using methods of the invention. These analyses can be used to determine the risk quotient of any subject for lung cancer, and in particular to identify subjects at greater risk of developing lung cancer.
  • Susceptibility and protective polymorphisms can readily be identified for other diseases using approaches similar to those described in the Examples, as well as in PCT International Application No. PCT/NZ02/00106 (published as WO 02/099134 and herein incorporated by reference in its entirety) via which four susceptibility and three protective polymorphisms discriminatory for lung disease were identified.
  • The one or more polymorphisms can be detected directly or by detection of one or more polymorphisms which are in linkage disequilibrium with said one or more polymorphisms. As discussed above, linkage disequilibrium is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present implies the presence of the other. (Reich D E et al; Linkage disequilibrium in the human genome, Nature 2001, 411:199-204.)
  • Examples of polymorphisms reported to be in linkage disequilibrium are presented herein, and include the Interleukin-18 −133 C/G and 105 A/C polymorphisms, and the Vitamin D binding protein Glu 416 Asp and Lys 420 Thr polymorphisms, as shown below.
  • LD
    rs Alleles between Phenotype
    Gene SNPs numbers in LD alleles in COPD
    Interleukin- IL18 −133 rs360721 C allele Strong LD CC
    18 C/G susceptible
    IL18 105 rs549908 A allele AA
    A/C susceptible
    Vitamin D VDBP rs4588 A allele Strong LD AA/AC
    binding Lys 420 protective
    protein Thr
    VDBP rs7041 T allele TT/TG
    Glu 416 protective
    Asp
  • It will be apparent that polymorphsisms in linkage disequilibrium with one or more other polymorphism associated with increased or decreased risk of developing COPD, emphysema, or both COPD and emphysema will also provide utility as biomarkers for risk of developing COPD, emphysema, or both COPD and emphysema. The data presented herein shows that the frequency for SNPs in linkage disequilibrium is very similar. Accordingly, these genetically linked SNPs can be utilized in combined polymorphism analyses to derive a level of risk comparable to that calculated from the original SNP.
  • It will therefore be apparent that one or more polymorphisms in linkage disequilibrium with the polymorphisms specified herein can be identified, for example, using public data bases. Examples of such polymorphisms reported to be in linkage disequilibrium with the polymorphisms specified herein are presented herein in Table 21.
  • The methods of the invention are primarily reliant on genetic information such as that derived from methods suitable to the detection and identification of single nucleotide polymorphisms (SNPs) associated with the specific disease for which a risk assessment is desired. In some embodiments, a SNP is a single base change or point mutation resulting in genetic variation between individuals. SNPs occur in the human genome approximately once every 100 to 300 bases, and can occur in coding or non-coding regions. Due to the redundancy of the genetic code, a SNP in the coding region may or may not change the amino acid sequence of a protein product. A SNP in a non-coding region can, for example, alter gene expression by, for example, modifying control regions such as promoters, transcription factor binding sites, processing sites, ribosomal binding sites, and affect gene transcription, processing, and translation.
  • SNPs can facilitate large-scale association genetics studies, and there has recently been great interest in SNP discovery and detection. SNPs show great promise as markers for a number of phenotypic traits (including latent traits), such as for example, disease propensity and severity, wellness propensity, and drug responsiveness including, for example, susceptibility to adverse drug reactions. Knowledge of the association of a particular SNP with a phenotypic trait, coupled with the knowledge of whether an individual has said particular SNP, can enable the targeting of diagnostic, preventative and therapeutic applications to allow better disease management, to enhance understanding of disease states and to ultimately facilitate the discovery of more effective treatments, such as personalised treatment regimens.
  • Indeed, a number of databases have been constructed of known SNPs, and for some such SNPs, the biological effect associated with a SNP. For example, the NCBI SNP database “dbSNP” is incorporated into NCBI's Entrez system and can be queried using the same approach as the other Entrez databases such as PubMed and GenBank. This database has records for over 1.5 million SNPs mapped onto the human genome sequence. Each dbSNP entry includes the sequence context of the polymorphism (i.e., the surrounding sequence), the occurrence frequency of the polymorphism (by population or individual), and the experimental method(s), protocols, and conditions used to assay the variation, and can include information associating a SNP with a particular phenotypic trait.
  • At least in part because of the potential impact on health and wellness, there has been and continues to be a great deal of effort to develop methods that reliably and rapidly identify SNPs. This is no trivial task, at least in part because of the complexity of human genomic DNA, with a haploid genome of 3×109 base pairs, and the associated sensitivity and discriminatory requirements.
  • Genotyping approaches to detect SNPs well-known in the art include DNA sequencing, methods that require allele specific hybridization of primers or probes, allele specific incorporation of nucleotides to primers bound close to or adjacent to the polymorphisms (often referred to as “single base extension”, or “minisequencing”), allele-specific ligation (joining) of oligonucleotides (ligation chain reaction or ligation padlock probes), allele-specific cleavage of oligonucleotides or PCR products by restriction enzymes (restriction fragment length polymorphisms analysis or RFLP) or chemical or other agents, resolution of allele-dependent differences in electrophoretic or chromatographic mobilities, by structure specific enzymes including invasive structure specific enzymes, or mass spectrometry. Analysis of amino acid variation is also possible where the SNP lies in a coding region and results in an amino acid change.
  • DNA sequencing allows the direct determination and identification of SNPs. The benefits in specificity and accuracy are generally outweighed for screening purposes by the difficulties inherent in whole genome, or even targeted subgenome, sequencing.
  • Mini-sequencing involves allowing a primer to hybridize to the DNA sequence adjacent to the SNP site on the test sample under investigation. The primer is extended by one nucleotide using all four differentially tagged fluorescent dideoxynucleotides (A,C,G, or T), and a DNA polymerase. Only one of the four nucleotides (homozygous case) or two of the four nucleotides (heterozygous case) is incorporated. The base that is incorporated is complementary to the nucleotide at the SNP position.
  • A number of methods currently used for SNP detection involve site-specific and/or allele-specific hybridisation (Matsuzaki, H. et al. Genome Res. 14:414-425 (2004); Matsuzaki, H. et al. Nat. Methods 1:109-111 (2004); Sethi, A. A. et al. Clin. Chem. 50(2):443-446 (2004), each of the foregoing which is herein incorporated by reference in its entirety). These methods are largely reliant on the discriminatory binding of oligonucleotides to target sequences containing the SNP of interest. The techniques of Affymetrix (Santa Clara, Calif.) and Nanogen Inc. (San Diego, Calif.) are particularly well-known, and utilize the fact that DNA duplexes containing single base mismatches are much less stable than duplexes that are perfectly base-paired. The presence of a matched duplex is detected by fluorescence.
  • The majority of methods to detect or identify SNPs by site-specific hybridisation require target amplification by methods such as PCR to increase sensitivity and specificity (see, for example U.S. Pat. No. 5,679,524, PCT publication WO 98/59066, PCT publication WO 95/12607, each of the foregoing which is herein incorporated by reference in its entirety). US Application 20050059030 (incorporated herein in its entirety) describes a method for detecting a single nucleotide polymorphism in total human DNA without prior amplification or complexity reduction to selectively enrich for the target sequence, and without the aid of any enzymatic reaction. The method utilises a single-step hybridization involving two hybridization events: hybridization of a first portion of the target sequence to a capture probe, and hybridization of a second portion of said target sequence to a detection probe. Both hybridization events happen in the same reaction, and the order in which hybridisation occurs is not critical.
  • US Application 20050042608 (herein incorporated by reference in its entirety) describes a modification of the method of electrochemical detection of nucleic acid hybridization of Thorp et al. (U.S. Pat. No. 5,871,918, herein incorporated by reference in its entirety). Briefly, capture probes are designed, each of which has a different SNP base and a sequence of probe bases on each side of the SNP base. The probe bases are complementary to the corresponding target sequence adjacent to the SNP site. Each capture probe is immobilized on a different electrode having a non-conductive outer layer on a conductive working surface of a substrate. The extent of hybridization between each capture probe and the nucleic acid target is detected by detecting the oxidation-reduction reaction at each electrode, utilizing a transition metal complex. These differences in the oxidation rates at the different electrodes are used to determine whether the selected nucleic acid target has a single nucleotide polymorphism at the selected SNP site.
  • The technique of Lynx Therapeutics (Hayward, Calif.) using MEGATYPE™ technology can genotype very large numbers of SNPs simultaneously from small or large pools of genomic material. This technology uses fluorescently labeled probes and compares the collected genomes of two populations, enabling detection and recovery of DNA fragments spanning SNPs that distinguish the two populations, without requiring prior SNP mapping or knowledge.
  • A number of other methods for detecting and identifying SNPs exist. These include the use of mass spectrometry, for example, to measure probes that hybridize to the SNP (Ross, P. L. et al. Discrimination of single-nucleotide polymorphisms in human DNA using peptide nucleic acid probes detected by MALDI-TOF mass spectrometry. Anal. Chem. 69, 4197-4202 (1997), herein incorporated by reference in its entirety). This technique varies in how rapidly it can be performed, from a few samples per day to a high throughput of 40,000 SNPs per day, using mass code tags. A preferred example is the use of mass spectrometric determination of a nucleic acid sequence which includes the polymorphisms of the invention, for example, which includes the promoter of the COX2 gene or a complementary sequence. Such mass spectrometric methods are known to those skilled in the art, and the genotyping methods of the invention are amenable to adaptation for the mass spectrometric detection of the polymorphisms of the invention, for example, the COX2 promoter polymorphisms of the invention.
  • SNPs can also be determined by ligation-bit analysis. This analysis requires two primers that hybridize to a target with a one nucleotide gap between the primers. Each of the four nucleotides is added to a separate reaction mixture containing DNA polymerase, ligase, target DNA and the primers. The polymerase adds a nucleotide to the 3′ end of the first primer that is complementary to the SNP, and the ligase then ligates the two adjacent primers together. Upon heating of the sample, if ligation has occurred, the now larger primer will remain hybridized and a signal, for example, fluorescence, can be detected. A further discussion of these methods can be found in U.S. Pat. Nos. 5,919,626; 5,945,283; 5,242,794; and 5,952,174 (each of the foregoing which is herein incorporated by reference in its entirety).
  • U.S. Pat. No. 6,821,733 (herein incorporated by reference in its entirety) describes methods to detect differences in the sequence of two nucleic acid molecules that includes the steps of: contacting two nucleic acids under conditions that allow the formation of a four-way complex and branch migration; contacting the four-way complex with a tracer molecule and a detection molecule under conditions in which the detection molecule is capable of binding the tracer molecule or the four-way complex; and determining binding of the tracer molecule to the detection molecule before and after exposure to the four-way complex. Competition of the four-way complex with the tracer molecule for binding to the detection molecule indicates a difference between the two nucleic acids.
  • Protein- and proteomics-based approaches are also suitable for polymorphism detection and analysis. Polymorphisms which result in or are associated with variation in expressed proteins can be detected directly by analysing said proteins. This typically requires separation of the various proteins within a sample, by, for example, gel electrophoresis or HPLC, and identification of said proteins or peptides derived therefrom, for example by NMR or protein sequencing such as chemical sequencing or more prevalently mass spectrometry. Proteomic methodologies are well known in the art, and have great potential for automation. For example, integrated systems, such as the ProteomIQ™ system from Proteome Systems, provide high throughput platforms for proteome analysis combining sample preparation, protein separation, image acquisition and analysis, protein processing, mass spectrometry and bioinformatics technologies.
  • The majority of proteomic methods of protein identification utilise mass spectrometry, including ion trap mass spectrometry, liquid chromatography (LC) and LC/MSn mass spectrometry, gas chromatography (GC) mass spectroscopy, Fourier transform-ion cyclotron resonance-mass spectrometer (FT-MS), MALDI-TOF mass spectrometry, and ESI mass spectrometry, and their derivatives. Mass spectrometric methods are also useful in the determination of post-translational modification of proteins, such as phosphorylation or glycosylation, and thus have utility in determining polymorphisms that result in or are associated with variation in post-translational modifications of proteins.
  • Associated technologies are also well known, and include, for example, protein processing devices such as the “Chemical Inkjet Printer” comprising piezoelectric printing technology that allows in situ enzymatic or chemical digestion of protein samples electroblotted from 2-D PAGE gels to membranes by jetting the enzyme or chemical directly onto the selected protein spots (Sloane, A. J. et al. High throughput peptide mass fingerprinting and protein macroarray analysis using chemical printing strategies. Mol Cell Proteomics 1(7):490-9 (2002), herein incorporated by reference in its entirety). After in-situ digestion and incubation of the proteins, the membrane can be placed directly into the mass spectrometer for peptide analysis.
  • A large number of methods reliant on the conformational variability of nucleic acids have been developed to detect SNPs.
  • For example, Single Strand Conformational Polymorphism (SSCP, Orita et al., PNAS 86:2766-2770 (1989), herein incorporated by reference in its entirety) is a method reliant on the ability of single-stranded nucleic acids to form secondary structure in solution under certain conditions. The secondary structure depends on the base composition and can be altered by a single nucleotide substitution, causing differences in electrophoretic mobility under nondenaturing conditions. The various polymorphs are typically detected by autoradiography when radioactively labelled, by silver staining of bands, by hybridisation with detectably labelled probe fragments or the use of fluorescent PCR primers which are subsequently detected, for example by an automated DNA sequencer.
  • Modifications of SSCP are well known in the art, and include the use of differing gel running conditions, such as for example differing temperature, or the addition of additives, and different gel matrices. Other variations on SSCP are well known to the skilled artisan, including, RNA-SSCP (Gasparini, P. et al. Scanning the first part of the neurofibromatosis type 1 gene by RNA-SSCP: identification of three novel mutations and of two new polymorphisms. Hum Genet. 97(4):492-5 (1996), herein incorporated by reference in its entirety), restriction endonuclease fingerprinting-SSCP (Liu, Q. et al. Restriction endonuclease fingerprinting (REF): a sensitive method for screening mutations in long, contiguous segments of DNA. Biotechniques 18(3):470-7 (1995), herein incorporated by reference in its entirety), dideoxy fingerprinting (a hybrid between dideoxy sequencing and SSCP) (Sarkar, G. et al. Dideoxy fingerprinting (ddF): a rapid and efficient screen for the presence of mutations. Genomics 13:441-443 (1992), herein incorporated by reference in its entirety), bi-directional dideoxy fingerprinting (in which the dideoxy termination reaction is performed simultaneously with two opposing primers) (Liu, Q. et al. Bi-directional dideoxy fingerprinting (Bi-ddF): a rapid method for quantitative detection of mutations in genomic regions of 300-600 bp. Hum Mol. Genet. 5(1):107-14 (1996), herein incorporated by reference in its entirety), and Fluorescent PCR-SSCP (in which PCR products are internally labelled with multiple fluorescent dyes, can be digested with restriction enzymes, followed by SSCP, and analysed on an automated DNA sequencer able to detect the fluorescent dyes) (Makino, R. et al. F-SSCP: fluorescence-based polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) analysis. PCR Methods Appl. 2(1):10-13 (1992), herein incorporated by reference in its entirety).
  • Other methods which utilise the varying mobility of different nucleic acid structures include Denaturing Gradient Gel Electrophoresis (DGGE) (Cariello, N. F. et al. Resolution of a missense mutant in human genomic DNA by denaturing gradient gel electrophoresis and direct sequencing using in vitro DNA amplification: HPRT Munich. Am J Hum Genet. 42(5):726-34 (1988), herein incorporated by reference in its entirety), Temperature Gradient Gel Electrophoresis (TGGE) (Riesner, D. et al. Temperature-gradient gel electrophoresis for the detection of polymorphic DNA and for quantitative polymerase chain reaction. Electrophoresis. 13:632-6 (1992), herein incorporated by reference in its entirety), and Heteroduplex Analysis (HET) (Keen, J. et al. Rapid detection of single base mismatches as heteroduplexes on Hydrolink gels. Trends Genet. 7(1):5 (1991), herein, incorporated by reference in its entirety). Here, variation in the dissociation of double stranded DNA (for example, due to base-pair mismatches) results in a change in electrophoretic mobility. These mobility shifts are used to detect nucleotide variations.
  • Denaturing High Pressure Liquid Chromatography (HPLC) is yet a further method utilised to detect SNPs, using HPLC methods well-known in the art as an alternative to the separation methods described above (such as gel electophoresis) to detect, for example, homoduplexes and heteroduplexes which elute from the HPLC column at different rates, thereby enabling detection of mismatch nucleotides and thus SNPs (Giordano, M. et al. Identification by denaturing high-performance liquid chromatography of numerous polymorphisms in a candidate region for multiple sclerosis susceptibility. Genomics 56(3):247-53 (1999), herein incorporated by reference in its entirety).
  • Yet further methods to detect SNPs rely on the differing susceptibility of single stranded and double stranded nucleic acids to cleavage by various agents, including chemical cleavage agents and nucleolytic enzymes. For example, cleavage of mismatches within RNA:DNA heteroduplexes by RNase A, of heteroduplexes by, for example bacteriophage T4 endonuclease YII or T7 endonuclease I, of the 5′ end of the hairpin loops at the junction between single stranded and double stranded DNA by cleavase I, and the modification of mispaired nucleotides within heteroduplexes by chemical agents commonly used in Maxam-Gilbert sequencing chemistry, are all well known in the art.
  • Further examples include the Protein Translation Test (PTT), used to resolve stop codons generated by variations which lead to a premature termination of translation and to protein products of reduced size, and the use of mismatch binding proteins (Moore, W. et al. Mutation detection in the breast cancer gene BRCA1 using the protein truncation test. Mol. Biotechnol. 14(2):89-97 (2000), herein incorporated by reference in its entirety). Variations are detected by binding of, for example, the MutS protein, a component of Escherichia coli DNA mismatch repair system, or the human hMSH2 and GTBP proteins, to double stranded DNA heteroduplexes containing mismatched bases. DNA duplexes are then incubated with the mismatch binding protein, and variations are detected by mobility shift assay. For example, a simple assay is based on the fact that the binding of the mismatch binding protein to the heteroduplex protects the heteroduplex from exonuclease degradation.
  • Those skilled in the art will know that a particular SNP, particularly when it occurs in a regulatory region of a gene such as a promoter, can be associated with altered expression of a gene. Altered expression of a gene can also result when the SNP is located in the coding region of a protein-encoding gene, for example where the SNP is associated with codons of varying usage and thus with tRNAs of differing abundance. Such altered expression can be determined by methods well known in the art, and can thereby be employed to detect such SNPs. Similarly, where a SNP occurs in the coding region of a gene and results in a non-synonomous amino acid substitution, such substitution can result in a change in the function of the gene product. Similarly, in cases where the gene product is an RNA, such SNPs can result in a change of function in the RNA gene product. Any such change in function, for example as assessed in an activity or functionality assay, can be employed to detect such SNPs.
  • The above methods of detecting and identifying SNPs are amenable to use in the methods of the invention.
  • In practicing the present invention to assess the risk a particular subject faces with respect to a particular disease, that subject will be assessed to determine the presence or absence of polymorphisms (preferably SNPs) which are either associated with protection from the disease or susceptibility to the disease.
  • In order to detect and identify SNPs in accordance with the invention, a sample containing material to be tested is obtained from the subject. The sample can be any sample potentially containing the target SNPs (or target polypeptides, as the case may be) and obtained from any bodily fluid (blood, urine, saliva, etc) biopsies or other tissue preparations.
  • DNA or RNA can be isolated from the sample according to any of a number of methods well known in the art. For example, methods of purification of nucleic acids are described in Tijssen; Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with nucleic acid probes Part 1: Theory and Nucleic acid preparation, Elsevier, New York, N.Y. 1993, as well as in Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular Cloning Manual 1989 (each of the foregoing which is herein incorporated by reference in its entirety).
  • Upon detection of the presence or absence of the polymorphisms tested for, the critical step is to determine a net susceptibility score for the subject. This score will represent the balance between the combined value of the protective polymorphisms present and the total value of the susceptibility polymorphisms present, with a net protective score (i.e., a greater weight of protective polymorphisms present than susceptibility polymorphisms) being predictive of a reduced risk of developing the disease in question. The reverse is true where there is a net susceptibility score. To calculate where the balance lies, the individual polymorphisms are assigned a value. In the simplest embodiment, each polymorphisms within a category (i.e. protective or susceptibility) is assigned an equal value, with each protective polymorphism being −1 and each susceptibility polymorphism being +1 (or vice versa). It is however contemplated that the values assigned to individual polymorphisms within a category can differ, with some polymorphisms being assigned a value that reflects their predictive or discriminatory value. For example, one particularly strong protective polymorphism can have a value of −2, whereas another more weakly protective polymorphism can have a value of −0.75.
  • The net score, and the associated predictive outcome in terms of the risk of the subject developing a particular disease, can be represented in a number of ways. One example is as a graph as more particularly exemplified herein.
  • Another example is a simple numerical score (eg +2 to represent a subject with a net susceptibility score or −2 to represent a subject with a net protective score). In each case, the result is communicated to the subject with an explanation of what that result means to that subject. Preferably, advice on ways the subject can change their lifestyle so as to reduce the risk of developing the disease is also communicated to the subject.
  • It will be appreciated that the methods of the invention can be performed in conjunction with an analysis of other risk factors known to be associated with a disease, such as COPD, emphysema, OCOPD, or lung cancer. Such risk factors include epidemiological risk factors associated with an increased risk of developing the disease. Such risk factors include, but are not limited to smoking and/or exposure to tobacco smoke, age, sex and familial history. These risk factors can be used to augment an analysis of one or more polymorphisms as herein described when assessing a subject's risk of developing a disease such as COPD, emphysema, OCOPD, or lung cancer.
  • The predictive methods of the invention allow a number of therapeutic interventions and/or treatment regimens to be assessed for suitability and implemented for a given subject, depending upon the disease and the overall risk quotient. The simplest of these can be the provision to a subject with a net susceptibility score of motivation to implement a lifestyle change, for example, in the case of OCOPD, to reduce exposure to aero-pollutants, for example, by an occupational change or by the use of safety equipment in the work place. Similarly where the subject is a current smoker, the methods of the invention can provide motivation to quit smoking. In this latter case, a ‘quit smoking’ program can be followed, which can include the use of anti-smoking medicaments (such as nicotine patches and the like) as well as anti-addiction medicaments.
  • Other therapeutic interventions can involve altering the balance between protective and susceptibility polymorphisms towards a protective state (such as by neutralizing or reversing a susceptibility polymorphism). The manner of therapeutic intervention or treatment will be predicated by the nature of the polymorphism(s) and the biological effect of said polymorphism(s). For example, where a susceptibility polymorphism is associated with a change in the expression of a gene, intervention or treatment is preferably directed to the restoration of normal expression of said gene, by, for example, administration of an agent capable of modulating the expression of said gene. Where a polymorphism, such as a SNP allele or genotype, is associated with decreased expression of a gene, therapy can involve administration of an agent capable of increasing the expression of said gene, and conversely, where a polymorphism is associated with increased expression of a gene, therapy can involve administration of an agent capable of decreasing the expression of said gene. Methods useful for the modulation of gene expression are well known in the art. For example, in situations were a polymorphism is associated with upregulated expression of a gene, therapy utilising, for example, RNAi or antisense methodologies can be implemented to decrease the abundance of mRNA and so decrease the expression of said gene. Alternatively, therapy can involve methods directed to, for example, modulating the activity of the product of said gene, thereby compensating for the abnormal expression of said gene.
  • Where a susceptibility polymorphism is associated with decreased gene product function or decreased levels of expression of a gene product, therapeutic intervention or treatment can involve augmenting or replacing of said function, or supplementing the amount of gene product within the subject for example, by administration of said gene product or a functional analogue thereof. For example, where a polymorphism is associated with decreased enzyme function, therapy can involve administration of active enzyme or an enzyme analogue to the subject. Similarly, where a polymorphism is associated with increased gene product function, therapeutic intervention or treatment can involve reduction of said function, for example, by administration of an inhibitor of said gene product or an agent capable of decreasing the level of said gene product in the subject. For example, where a polymorphism is associated with increased enzyme function, therapy can involve administration of an enzyme inhibitor to the subject.
  • Likewise, when a protective polymorphism is associated with upregulation of a particular gene or expression of an enzyme or other protein, therapies can be directed to mimic such upregulation or expression in an individual lacking the resistive genotype, and/or delivery of such enzyme or other protein to such individual Further, when a protective polymorphism is associated with downregulation of a particular gene, or with diminished or eliminated expression of an enzyme or other protein, desirable therapies can be directed to mimicking such conditions in an individual that lacks the protective genotype.
  • EXAMPLES
  • The invention will now be described in more detail, with reference to non-limiting examples.
  • Example 1 Case Association Study—COPD Methods Subject Recruitment
  • Subjects of European descent who had smoked a minimum of fifteen pack years and diagnosed by a physician with chronic obstructive pulmonary disease (COPD) were recruited. Subjects met the following criteria: were over 50 years old and had developed symptoms of breathlessness after 40 years of age, had a Forced expiratory volume in one second (FEV1) as a percentage of predicted <70% and a FEV1/FVC ratio (Forced expiratory volume in one second/Forced vital capacity) of <79% (measured using American Thoracic Society criteria). Two hundred and ninety-four subjects were recruited, of these 58% were male, the mean FEV1/FVC (±95% confidence limits) was 51% (49-53), mean FEV1 as a percentage of predicted was 43 (41-45). Mean age, cigarettes per day and pack year history was 65 yrs (64-66), 24 cigarettes/day (22-25) and 50 pack years (41-55) respectively. Two hundred and seventeen European subjects who had smoked a minimum of twenty pack years and who had never suffered breathlessness and had not been diagnosed with an obstructive lung disease in the past, in particular childhood asthma or chronic obstructive lung disease, were also studied. This control group was recruited through clubs for the elderly and consisted of 63% male, the mean FEV1/FVC (95% CI) was 82% (81-83), mean FEV1 as a percentage of predicted was 96 (95-97). Mean age, cigarettes per day and pack year history was 59 yrs (57-61), 24 cigarettes/day (22-26) and 42 pack years (39-45) respectively. Using a PCR based method [1, incorporated herein in its entirety by reference], all subjects were genotyped for the α1-antitrypsin mutations (S and Z alleles) and those with the ZZ allele were excluded. The COPD and resistant smoker cohorts were matched for subjects with the MZ genotype (5% in each cohort). 190 European blood donors (smoking status unknown) were recruited consecutively through local blood donor services. Sixty-three percent were men and their mean age was 50 years. On regression analysis, the age difference and pack years difference observed between COPD sufferers and resistant smokers was found not to determine FEV or COPD.
  • This study shows that polymorphisms found in greater frequency in COPD patients compared to controls (and/or resistant smokers) can reflect an increased susceptibility to the development of impaired lung function and COPD. Similarly, polymorphisms found in greater frequency in resistant smokers compared to susceptible smokers (COPD patients and/or controls) can reflect a protective role.
  • Summary of Characteristics for the COPD, Resistant Smoker and Healthy Blood Donors
  • Parameter COPD Resistant smokers
    Median (IQR) N = 294 N = 217 Differences
    % male 58% 63% ns
    Age (yrs) 65 (64-66) 59 (57-61) P < 0.05
    Pack years 50 (46-53) 42 (39-45) P < 0.05
    Cigarettes/day 24 (22-25) 24 (22-26) ns
    FEV1 (L)  1.6 (0.7-2.5)  2.9 (2.8-3.0) P < 0.05
    FEV1 % predict 43 (41-45) 96% (95-97)   P < 0.05
    FEV1/FVC 51 (49-53) 82 (81-83) P < 0.05

    Means and 95% confidence limits
    Cyclo-oxygenase 2 (COX2) −765 G/C Promoter Polymorphism and a1-antitrypsin Genotyping
  • Genomic DNA was extracted from whole blood samples [2, herein incorporated by reference in its entirety]. The Cyclo-oxygenase 2 −765 polymorphism was determined by minor modifications of a previously published method [3, herein incorporated by reference in its entirety]. The PCR reaction was carried out in a total volume of 25 ul and contained 20 ng genomic DNA, 500 pmol forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl2 and 1 unit of polymerase (Life Technologies). Cycling times were incubations for 3 min at 95° C. followed by 33 cycles of 50 s at 94° C., 60 s at 66° C. and 60 s at 72° C. A final elongation of 10 min at 72° C. then followed. 4 ul of PCR products were visualised by ultraviolet trans-illumination of a 3% agarose gel stained with ethidium bromide. An aliquot of 3 ul of amplification product was digested for 1 hr with 4 units of AciI (Roche Diagnostics, New Zealand) at 37° C. Digested products were separated on a 2.5% agarose gel run for 2.0 hours at 80 mV with TBE buffer. The products were visualised against a 123 bp ladder using ultraviolet transillumination after ethidium bromide staining. Using a PCR based method referenced above [1, herein incorporated by reference in its entirety], all COPD and resistant smoker subjects were genotyped for the α1-antitrypsin S and Z alleles.
  • Other Polymorphism Genotyping
  • Genomic DNA was extracted from whole blood samples [2]. Purified genomic DNA was aliquoted (10 ng/ul concentration) into 96 well plates and genotyped on a Sequenom™ system (Sequenom™ Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser) using the following sequences, amplification conditions and methods.
  • The following conditions were used for the PCR multiplex reaction: final concentrations were for 10× Buffer 15 mM MgCl2 1.25×, 25 mM MgCl2 1.625 mM, dNTP mix 25 mM 500 uM, primers 4 uM 100 nM, Taq polymerase (Qiagen hot start) 0.15 U/reaction, Genomic DNA 10 ng/ul. Cycling times were 95° C. for 15 mM, (5° C. for 15 s, 56° C. 30 s, 72° C. 30 s for 45 cycles with a prolonged extension time of 3 min to finish. Shrimp alkaline phosphotase (SAP) treatment was used (2 ul to 5 ul per PCR reaction) incubated at 35° C. for 30 min and extension reaction (add 2 ul to 7 ul after SAP treatment) with the following volumes per reaction of: water, 0.76 ul; hME 10× termination buffer, 0.2 ul; hME primer (10 uM), 1 ul; MassEXTEND enzyme, 0.04 ul.
  • Sequenom Conditions for the Polymorphisms Genotyping—1
  • SNP_ID TERM WELL 2nd-PCRP 1st-PCRP
    Vitamin ACT W1 ACGTTGGATGGCTTGTTAACCAGCTTTGCC ACGTTGGATGTTTTTCAGACTGGCAGAGCG [SEQ. ID. NO. 2]
    DBP-420 [SEQ. ID. NO. 1]
    Vitamin ACT W1 ACGTTGGATGTTTTTCAGACTGGCAGAGCG ACGTTGGATGGCTTGTTAACCAGCTTTGCC [SEQ. ID. NO. 4]
    DBP-416 [SEQ. ID. NO. 3]
    IL13 C- ACT W2 ACGTTGGATGCATGTCGCCTTTTCCTGCTC ACGTTGGATGCAACACCCAACAGGCAAATG [SEQ. ID. NO. 6]
    1055T [SEQ. ID. NO. 5]
    GSTP1- ACT W2 ACGTTGGATGTGGTGGACATGGTGAATGAC ACGTTGGATGTGGTGCAGATGCTCACATAG [SEQ. ID. NO. 8]
    105 [SEQ. ID. NO. 7]
    PAI1 G- ACT W2 ACGTTGGATGCACAGAGAGAGTCTGGACAC ACGTTGGATGCTCTTGGTCTTTCCCTCATC [SEQ. ID. NO. 10]
    675G [SEQ. ID. NO. 9]
    NOS3- ACT W3 ACGTTGGATGACAGCTCTGCATTCAGCACG ACGTTGGATGAGTCAATCCCTTTGGTGCTC [SEQ. ID. NO. 12]
    298 [SEQ. ID. NO. 11]
    IL13- ACT W3 ACGTTGGATGGTTTTCCAGCTTGCATGTCC ACGTTGGATGCAATAGTCAGGTCCTGTCTC [SEQ. ID. NO. 14]
    Arg130Gln [SEQ. ID. NO. 13]
    ADRB2- ACT W3 ACGTTGGATGGAACGGCAGCGCCTTCTTG ACGTTGGATGACTTGGCAATGGCTGTGATG [SEQ. ID. NO. 16]
    Arg16Gly [SEQ. ID. NO. 15]
    IFNG- CGT W5 ACGTTGGATGCAGACATTCACAATTGATTT ACGTTGGATGGATAGTTCCAAACATGTGCG [SEQ. ID. NO. 18]
    A874T [SEQ. ID. NO. 17]
    IL18-C- ACT W6 ACGTTGGATGGGGTATTCATAAGCTGAAAC ACGTTGGATGCCTTCAAGTTCAGTGGTCAG [SEQ. ID. NO. 20]
    133G [SEQ. ID. NO. 19]
    IL18- ACT W8 ACGTTGGATGGGTCAATGAAGAGAACTTGG ACGTTGGATGAATGTTTATTGTAGAAAACC [SEQ. ID. NO. 22]
    A105C [SEQ. ID. NO. 21]
  • Sequenom Conditions for the Polymorphisms Genotyping—2
  • SNP_ID AMP_LEN UP_CONF MP_CONF Tm(NN) PcGC PWARN UEP_DIR
    Vitamin DBP - 420 99 99.7 99.7 46.2 53.3 ML R
    Vitamin DBP - 416 99 99.7 99.7 45.5 33.3 M F
    IL13 C-1055T 112 97.5 80 48.2 60 L R
    GSTP1 - 105 107 99.4 80 49.9 52.9 F
    PAI1 G-675G 109 97.9 80 59.3 66.7 g F
    NOS3 -298 186 98.1 65 61.2 63.2 F
    IL13-Arg130Gln 171 99.3 65 55.1 47.6 F
    ADRB2- Arg16Gly 187 88.2 65 65.1 58.3 F
    IFNG - A874T 112 75.3 81.2 45.6 27.3 F
    IL18- C-133G 112 93.5 74.3 41.8 46.7 L F
    IL18- A105C 121 67.2 74.3 48.9 40 R
  • Sequenom Conditions for the Polymorphisms Genotyping—3
  • SNP_ID UEP_MASS UEP_SEQ EXT1_CALL EXT1_MASS
    Vitamin DBP - 420 4518.9 AGCTTTGCCAGTTCC [SEQ. ID. NO. 23] A 4807.1
    Vitamin DBP - 416 5524.6 AAAAGCAAAATTGCCTGA [SEQ. ID. NO. 24] T 5812.8
    IL13 C-1055T 4405.9 TCCTGCTCTTCCCTC [SEQ. ID. NO. 25] T 4703.1
    GSTP1 - 105 5099.3 ACCTCCGCTGCAAATAC [SEQ. ID. NO. 26] A 5396.5
    PAI1 G-675G 5620.6 GAGTCTGGACACGTGGGG [SEQ. ID. NO. 27] DEL 5917.9
    NOS3 -298 5813.8 TGCTGCAGGCCCCAGATGA [SEQ. ID. NO. 28] T 6102
    IL13-Arg130Gln 6470.2 AGAAACTTTTTCGCGAGGGAC [SEQ. ID. NO. 29] A 6767.4
    ADRB2- Arg16Gly 7264.7 AGCGCCTTCTTGCTGGCACCCAAT [SEQ. ID. NO. 30] A 7561.9
    IFNG - A874T 6639.4 TCTTACAACACAAAATCAAATC [SEQ. ID. NO. 31] T 6927.6
    IL18- C-133G 4592 AGCTGAAACTTCTGG [SEQ. ID. NO. 32] C 4865.2
    IL18- A105C 6085 TCAAGCTTGCCAAAGTAATC [SEQ. ID. NO. 33] A 6373.2
  • Sequenom Conditions for the Polymorphisms Genotyping—4
  • SNP_ID EXT1_SEQ EXT2_CALL EXT2_MASS EXT2_SEQ 1stPAUSE
    Vitamin AGCTTTGCCAGTTCCT [SEQ. ID. NO. 34] C 5136.4 AGCTTTGCCAGTTCCGT 4848.2
    DBP - 420 [SEQ. ID. NO. 35]
    Vitamin AAAAGCAAAATTGCCTGAT [SEQ. ID. NO. 36] G 6456.2 AAAAGCAAAATTGCCTGAGGC 5853.9
    DBP-416 [SEQ. ID. NO. 37]
    IL13 C- TCCTGCTCTTCCCTCA [SEQ. ID. NO. 38] C 5023.3 TCCTGCTCTTCCCTCGT 4735.1
    1055T [SEQ. ID. NO. 39]
    GSTP1- ACCTCCGCTGCAAATACA [SEQ. ID. NO. 40] G 5716.7 ACCTCCGCTGCAAATACGT 5428.5
    105 [SEQ. ID. NO. 41]
    PAI1 G- GAGTCTGGACACGTGGGGA [SEQ. ID. NO. 42] G 6247.1 GAGTCTGGACACGTGGGGGA 5949.9
    675G [SEQ. ID. NO. 43]
    NOS3- TGCTGCAGGCCCCAGATGAT [SEQ. ID. NO. G 6416.2 TGCTGCAGGCCCCAGATGAGC 6143
    298 44] [SEQ. ID. NO. 45]
    IL13- AGAAACTTTTTCGCGAGGGACA G 7416.8 AGAAACTTTTTCGCGAGGGACGGT 6799.4
    Arg130Gln [SEQ. ID. NO. 46] [SEQ. ID. NO. 47]
    ADRB2- AGCGCCTTCTTGCTGGCACCCAATA G 8220.3 AGCGCCTTCTTGCTGGCACCCAATGGA 7593.9
    Arg16Gly [SEQ. ID. NO. 48] [SEQ. ID. NO. 49]
    IFNG- TCTTACAACACAAAATCAAATCT A 7225.8 TCTTACAACACAAAATCAAATCAC 6952.6
    A874T [SEQ. ID. NO. 50] [SEQ. ID. NO. 51]
    IL18- C- AGCTGAAACTTCTGGC [SEQ. ID. NO. 52] G 5218.4 AGCTGAAACTTCTGGGA 4921.2
    133G [SEQ. ID. NO. 53]
    IL18- TCAAGCTTGCCAAAGTAATCT C 7040.6 TCAAGCTTGCCAAAGTAATCGGA 6414.2
    A105C [SEQ. ID. NO. 54] [SEQ. ID. NO. 55]
  • Sequenom Conditions for the Polymorphisms Genotyping—5
  • SNP_ID 2nd-PCRP 1st-PCRP
    Lipoxygenase5- ACGTTGGATGGAAGTCAGAGATGATGGCAG ACGTTGGATGATGAATCCTGGACCCAAGAC
    366G/A [SEQ. ID. NO. 56] [SEQ. ID. NO. 57]
    TNFalpha+489G/A ACGTTGGATGGAAAGATGTGCGCTGATAGG ACGTTGGATGGCCACATCTCTTTCTGCATC
    [SEQ. ID. NO. 58] [SEQ. ID. NO. 59]
    SMAD3C89Y ACGTTGGATGTTGCAGGTGTCCCATCGGAA [SEQ. ID. NO. 60] ACGTTGGATGTAGCTCGTGGTGGCTGTGCA
    [SEQ. ID. NO. 61]
    CaspaseGly881ArgG/C ACGTTGGATGGTGATCACCCAAGGCTTCAG [SEQ. ID. NO. 62] ACGTTGGATGGTCTGTTGACTCTTTTGGCC
    [SEQ. ID. NO. 63]
    MBL2+161G/A ACGTTGGATGGTAGCTCTCCAGGCATCAAC [SEQ. ID. NO. 64] ACGTTGGATGGTACCTGGTTCCCCCTTTTC
    [SEQ. ID. NO. 65]
    HSP70-HOM2437T/C ACGTTGGATGTGATCTTGTTCACCTTGCCG [SEQ. ID. NO. 66] ACGTTGGATGAGATCGAGGTGACGTTTGAC
    [SEQ. ID. NO. 67]
    CD14-159C/T ACGTTGGATGAGACACAGAACCCTAGATGC [SEQ. ID. NO. 68] ACGTTGGATGGCAATGAAGGATGTTTCAGG
    [SEQ. ID. NO. 69]
    Chymase1-1903G/A ACGTTGGATGTAAGACAGCTCCACAGCATC [SEQ. ID. NO. 70] ACGTTGGATGTTCCATTTCCTCACCCTCAG
    [SEQ. ID. NO. 71]
    TNFalpha-308G/A ACGTTGGATGGATTTGTGTGTAGGACCCTG [SEQ. ID. NO. 72] ACGTTGGATGGGTCCCCAAAAGAAATGGAG
    [SEQ. ID. NO. 73]
    CLCA1+13924T/A ACGTTGGATGGGATTGGAGAACAAACTCAC [SEQ. ID. NO. 74] ACGTTGGATGGGCAGCTGTTACACCAAAAG
    [SEQ. ID. NO. 75]
    MEHTyr113HisT/C ACGTTGGATGCTGGCGTTTTGCAAACATAC [SEQ. ID. NO. 76] ACGTTGGATGTTGACTGGAAGAAGCAGGTG
    [SEQ. ID. NO. 77]
    NAT2Arg197GlnG/A ACGTTGGATGCCTGCCAAAGAAGAAACACC [SEQ. ID. NO. 78] ACGTTGGATGACGTCTGCAGGTATGTATTC
    [SEQ. ID. NO. 79]
    MEHHis139ArgG/A ACGTTGGATGACTTCATCCACGTGAAGCCC [SEQ. ID. NO. 80] ACGTTGGATGAAACTCGTAGAAAGAGCCGG
    [SEQ. ID. NO. 81]
    IL-1B-511A/G ACGTTGGATGATTTTCTCCTCAGAGGCTCC [SEQ. ID. NO. 82] ACGTTGGATGTGTCTGTATTGAGGGTGTGG
    [SEQ. ID. NO. 83]
    ADRB2Gln27GluC/G ACGTTGGATGTTGCTGGCACCCAATGGAAG [SEQ. ID. NO. 84] ACGTTGGATGATGAGAGACATGACGATGCC
    [SEQ. ID. NO. 85]
    ICAM1E469KA/G ACGTTGGATGACTCACAGAGCACATTCACG [SEQ. ID. NO. 86] ACGTTGGATGTGTCACTCGAGATCTTGAGG
    [SEQ. ID. NO. 87]
  • Sequenom Conditions for the Polymorphisms Genotyping—6
  • SNP_ID AMP_LEN UP_CONF MP_CONF Tm(NN) PcGC UEP_DIR
    Lipoxygenase5-366G/A 104 99.6 73.4 59 70.6 F
    TNFalpha + 489G/A 96 99.6 73.4 45.5 38.9 F
    SMAD3C89Y 107 87.3 71.7 45.7 47.1 F
    CaspaseGly881ArgG/C 111 97.2 81 52.9 58.8 R
    MBL2 + 161G/A 99 96.8 81 50.3 52.9 F
    HSP70-HOM2437T/C 107 99.3 81 62.2 65 R
    CD14-159C/T 92 98 76.7 53.3 50 F
    Chymase1-1903G/A 105 99.6 76.7 53.6 39.1 R
    TNFalpha-308G/A 100 99.7 81.6 59.9 70.6 R
    CLCA1 + 13924T/A 101 98 98 45.3 36.8 R
    MEHTyr113HisT/C 103 97.7 82.2 48.7 42.1 R
    NAT2Arg197GlnG/A 115 97.4 70 48.5 36.4 F
    MEHHis139ArgG/A 115 96.7 77.8 66 82.4 F
    IL-1B-511A/G 111 99.2 83 46 47.1 R
    ADRB2Gln27GluC/G 118 96.6 80 52.2 66.7 F
    ICAM1E469KA/G 115 98.8 95.8 51.5 52.9 R
  • Sequenom Conditions for the Polymorphisms Genotyping—7
  • SNP_ID UEP_MASS UEP_SEQ EXT1_CALL EXT1_MASS
    Lipoxygenase5-366G/A 5209.4 GTGCCTGTGCTGGGCTC [SEQ. ID. NO. 88] A 5506.6
    TNFalpha+489G/A 5638.7 GGATGGAGAGAAAAAAAC [SEQ. ID. NO. 89] A 5935.9
    SMAD3C89Y 5056.3 CCCTCATGTCATCTACT [SEQ. ID. NO. 90] A 5353.5
    CaspaseGly881ArgG/C 5097.3 GTCACCCACTCTGTTGC [SEQ. ID. NO. 91] G 5370.5
    MBL2+161G/A 5299.5 CAAAGATGGGCGTGATG [SEQ. ID. NO. 92] A 5596.7
    HSP70-HOM2437T/C 6026.9 CCTTGCCGGTGCTCTTGTCC [SEQ. ID. NO. 93] T 6324.1
    CD14-159C/T 6068 CAGAATCCTTCCTGTTACGG [SEQ. ID. NO. 94] C 6341.1
    Chymase1-1903G/A 6973.6 TCCACCAAGACTTAAGTTTTGCT [SEQ. ID. NO. 95] G 7246.7
    TNFalpha-308G/A 5156.4 GAGGCTGAACCCCGTCC [SEQ. ID. NO. 96] G 5429.5
    CLCA1+13924T/A 5759.8 CTTTTTCATAGAGTCCTGT [SEQ. ID. NO. 97] A 6048
    MEHTyr113HisT/C 5913.9 TTAGTCTTGAAGTGAGGGT [SEQ. ID. NO. 98] T 6211.1
    NAT2Arg197GlnG/A 6635.3 TACTTATTTACGCTTGAACCTC [SEQ. ID. NO. 99] A 6932.5
    MEHHis139ArgG/A 5117.3 CCAGCTGCCCGCAGGCC [SEQ. ID. NO. 100] A 5414.5
    IL-1B-511A/G 5203.4 AATTGACAGAGAGCTCC [SEQ. ID. NO. 101] G 5476.6
    ADRB2Gln27GluC/G 4547 CACGACGTCACGCAG [SEQ. ID. NO. 102] C 4820.2
    ICAM1E469KA/G 5090.3 CACATTCACGGTCACCT [SEQ. ID. NO. 103] G 5363.5
  • Sequenom Conditions for the Polymorphisms Genotyping—8
  • EXT2 EXT2 1st
    SNP_ID EXT1_SEQ CALL MASS EXT2_SEQ PAUSE
    Lipoxygenase5- GTGCCTGTGCTGGGCTCA G 5826.8 GTGCCTGTGCTGGGCTCGT [SEQ. ID. NO. 105] 5538.6
    366G/A [SEQ. ID. NO. 104]
    TNFalpha+489G/A GGATGGAGAGAAAAAAACA G 6256.1 GGATGGAGAGAAAAAAACGT [SEQ. ID. NO. 107] 5967.9
    [SEQ. ID. NO. 106]
    SMAD3C89Y CCCTCATGTCATCTACTA G 5658.7 CCCTCATGTCATCTACTGC [SEQ. ID. NO. 109] 5385.5
    [SEQ. ID. NO. 108]
    CaspaseGly881ArgG/C GTCACCCACTCTGTTGCC C 5699.7 GTCACCCACTCTGTTGCGC [SEQ. ID. NO. 111] 5426.5
    [SEQ. ID. NO. 110]
    MBL2+161G/A CAAAGATGGGCGTGATGA G 5901.9 CAAAGATGGGCGTGATGGC [SEQ. ID. NO. 113] 5628.7
    [SEQ. ID. NO. 112]
    HSP70-HOM2437T/C CCTTGCCGGTGCTCTTGTCCA C 6644.3 CCTTGCCGGTGCTCTTGTCCGT 6356.1
    [SEQ. ID. NO. 114] [SEQ. ID. NO. 115]
    CD14-159C/T CAGAATCCTTCCTGTTACGGC T 6645.3 CAGAATCCTTCCTGTTACGGTC [SEQ. ID. NO. 117] 6372.2
    [SEQ. ID. NO. 116]
    Chymase1-1903G/A TCCACCAAGACTTAAGTTTTGCTC A 7550.9 TCCACCAAGACTTAAGTTTTGCTTC 7277.8
    [SEQ. ID. NO. 118] [SEQ. ID. NO. 119]
    TNFalpha-308G/A GAGGCTGAACCCCGTCCC A 5733.7 GAGGCTGAACCCCGTCCTC [SEQ. ID. NO. 121] 5460.6
    [SEQ. ID. NO. 120]
    CLCA1+13924T/A CTTTTTCATAGAGTCCTGTT T 6659.4 CTTTTTCATAGAGTCCTGTAAC [SEQ. ID. NO. 123] 6073
    [SEQ. ID. NO. 122]
    MEHTyr113HisT/C TTAGTCTTGAAGTGAGGGTA C 6531.3 TTAGTCTTGAAGTGAGGGTGT [SEQ. ID. NO. 125] 6243.1
    [SEQ. ID. NO. 124]
    NAT2Arg197GlnG/A TACTTATTTACGCTTGAACCTCA G 7261.8 TACTTATTTACGCTTGAACCTCGA 6964.5
    [SEQ. ID. NO. 126] [SEQ. ID. NO. 127]
    MEHHis139ArgG/A CCAGCTGCCCGCAGGCCA G 5734.7 CCAGCTGCCCGCAGGCCGT [SEQ. ID. NO. 129] 5446.5
    [SEQ. ID. NO. 128]
    IL-1B-511A/G AATTGACAGAGAGCTCCC A 5820.8 AATTGACAGAGAGCTCCTG [SEQ. ID. NO. 131] 5507.6
    [SEQ. ID. NO. 130]
    ADRB2Gln27GluC/G CACGACGTCACGCAGC G 5173.4 CACGACGTCACGCAGGA [SEQ. ID. NO. 133] 4876.2
    [SEQ. ID. NO. 132]
    ICAM1E469KA/G CACATTCACGGTCACCTC A 5707.7 CACATTCACGGTCACCTTG [SEQ. ID. NO. 135] 5394.5
    [SEQ. ID. NO. 134]
  • Results
  • Frequencies of individual polymorphisms are as follows:
  • TABLE 1
    Polymorphism allele and genotype frequencies in the COPD patients and resistant smokers.
    Cyclo-oxygenase 2 −765 G/C
    Allele* Genotype
    Frequency C G CC CG GG
    Controls n = 94 (%) 27 (14%) 161 (86%)  3 (3%) 21 (22%)  70 (75%)
    COPD n = 202 (%) 59 (15%) 345 (85%)  6 (3%) 47 (23%) 149 (74%)
    Resistant n = 172 (%) 852 (25%) 259 (75%) 141 (8%) 57 (33%) 101 (59%)
    Beta2-adrenoreceptor Arg 16 Gly
    Allele* Genotype
    Frequency A G AA AG GG
    Controls n = 182 (%) 152 (42%) 212 (58%) 26 (14%) 100 (55%) 56 (31%)
    COPD n = 236 (%) 164 (34%) 308 (66%) 34 (14%)  96 (41%) 1063 (45%)
    Resistant n = 190 (%) 135 (36%) 245 (64%) 34 (18%)  67 (35%)  894 (47%)
    Interleukin 18 105 A/C
    Allele* Genotype
    Frequency C A CC AC AA
    Controls n = 184 (%) 118 (32%) 250 (68%)  22 (12%) 74 (40%)   88 (48%)
    COPD n = 240 (%) 122 (25%) 3776 (75%) 21 (9%) 80 (33%) 1395, 7 (58%)
    Resistant n = 196 (%) 113 (29%) 277 (71%) 16 (8%) 81 (41%)   99 (50%)
    Interleukin 18 −133 C/G
    Allele* Genotype
    Frequency G C GG GC CC
    Controls n = 187 (%) 120 (32%) 254 (68%)  23 (12%) 74 (40%)  90 (48%)
    COPD n = 238 123 (26%) 3539 (74%) 21 (9%) 81 (34%) 1368 (57%)
    Resistant n = 195 (%) 113 (29%) 277 (71%) 16 (8%) 81 (42%)  98 (50%)
    Plasminogen activator inhibitor 1 −675 4G/5G
    Allele* Genotype
    Frequency 5G 4G 5G5G 5G4G 4G4G
    Controls n = 186 (%) 158 (42%) 214 (58%)    31 (17%)  96 (52%)    59 (32%)
    COPD n = 237 (%) 21912 (46%) 255 (54%) 5410,11 (23%) 111 (47%)    72 (30%)
    Resistant n = 194 (%) 152 (39%) 236 (61%)    31 (16%)  90 (46%) 7310,11 (38%)
    Nitric oxide synthase 3 Asp 298 Glu (T/G)
    Allele* Genotype
    Frequency T G TT TG GG
    Controls n = 183 (%) 108 (30%) 258 (70%) 13 (7%)   82 (45%)  88 (48%)
    COPD n = 238 (%) 159 (42%) 317 (58%) 25 (10%) 109 (47%) 104 (43%)
    Resistant n = 194 (%) 136 (35%) 252 (65%) 2813 (15%)  80 (41%)  86 (44%)
    Vitamin D Binding Protein Lys 420 Thr (A/C)
    Allele* Genotype
    Frequency A C AA AC CC
    Controls n = 189 (%) 113 (30%) 265 (70%) 17 (9%)  79 (42%)  93 (49%)
    COPD n = 250 (%) 147 (29%) 353 (71%) 24 (10%) 99 (40%) 127 (50%)
    Resistant n = 195 (%) 14015 (36%) 250 (64%) 2514 (13%) 9014 (46%)  80 (41%)
    Vitamin D Binding Protein Glu 416 Asp (T/G)
    Allele* Genotype
    Frequency T G TT TG GG
    Controls n = 188 (%) 162 (43%) 214 (57%) 35 (19%) 92 (49%) 61 (32%)
    COPD n = 240 (%) 230 (48%) 250 (52%) 57 (24%) 116 (48%) 67 (28%)
    Resistant n = 197 (%) 19317 (49%) 201 (51%) 4316 (22%) 10716 (54%) 47 (24%)
    Glutathione S Transferase P1 Ile 105 Val (A/G)
    Allele* Genotype
    Frequency A G AA AG GG
    Controls n = 185 (%) 232 (63%) 138 (37%) 70 (38%)  92 (50%) 23 (12%)
    COPD n = 238 (%) 310 (65%) 166 (35%) 96 (40%) 118 (50%) 24 (10%)
    Resistant n = 194 (%) 26919 (69%) 119 (31%) 9118 (47%)  87 (45%) 16 (8%) 
    Interferon-gamma 874 A/T
    Allele* Genotype
    Frequency A T AA AT TT
    Controls n = 186 (%) 183 (49%) 189 (51%) 37 (20%) 109 (58%) 40 (22%)
    COPD n = 235 (%) 244 (52%) 226 (48%) 6420 (27%) 116 (49%) 55 (24%)
    Resistant n = 193 (%) 208 (54%) 178 (46%) 51 (27%) 106 (55%) 36 (18%)
    Interleukin-13 Arg 130 Gln (G/A)
    Allele* Genotype
    Frequency A G AA AG GG
    Controls n = 184 (%) 67 (18%) 301 (82%) 3 (2%) 61 (33%) 120 (65%)
    COPD n = 237 (%) 86 (18%) 388 (82%) 8 (3%) 70 (30%) 159 (67%)
    Resistant n = 194 (%) 74 (19%) 314 (81%) 921 (5%) 56 (28%) 129 (67%)
    Interleukin-13 −1055 C/T
    Allele* Genotype
    Frequency T C TT TC CC
    Controls n = 182 (%) 65 (18%) 299 (82%) 5 (3%) 55 (30%) 122 (67%)
    COPD n = 234 (%) 94 (20%) 374 (80%) 822 (4%) 78 (33%) 148 (63%)
    Resistant n = 192 (%) 72 (19%) 312 (81%) 2 (1%) 68 (35%) 122 (64%)
    a1-antitrypsin S
    Allele* Genotype
    Frequency M S MM MS SS
    COPD n = 202 (%) 391 (97%) 13 (3%) 189 (94%) 13 (6%)  0 (0%)
    Resistant n = 189 (%) 350 (93%) 28 (7%) 162 (85%) 2623 (14%) 123 (1%)
    *number of chromosomes (2n)Genotype
      • 1. Genotype. CC/CG vs GG for resistant vs COPD, Odds ratio (OR)=1.98, 95% confidence limits 1.3-3.1, χ2 (Yates corrected)=8.82, p=0.003, CC/CG=protective for COPD
      • 2. Allele. C vs G for resistant vs COPD, Odds ratio (OR)=1.92, 95% confidence limits 1.3-2.8, χ2 (Yates corrected)=11.56, p<0.001, C=protective for COPD
      • 3. Genotype. GG vs AG/AA for COPD vs controls, Odds ratio (OR)=1.83, 95% confidence limits 1.2-2.8, χ2 (Yates corrected)=8.1, p=0.004, GG=susceptible to COPD (depending on the presence of other snps)
      • 4. Genotype. GG vs AG/AA for resistant vs controls, Odds ratio (OR)=1.98, 95% confidence limits 1.3-3.1, χ2 (Yates corrected)=9.43, p=0.002 GG=resistance (depending on the presence of other snps)
      • 5. Genotype. AA vs AC/CC for COPD vs controls, Odds ratio (OR)=1.50, 95% confidence limits 1.0-2.3, χ2 (Yates uncorrected)=4.26, p=0.04, AA=susceptible to COPD
      • 6. Allele. A vs C for COPD vs control, Odds ratio (OR)=1.46, 95% confidence limits 1.1-2.0, χ2 (Yates corrected)=5.76, p=0.02
      • 7. Genotype. AA vs AC/CC for COPD vs resistant, Odds ratio (OR)=1.35, 95% confidence limits 0.9-2.0, χ2 (Yates uncorrected)=2.39, p=0.12 (trend),
        • AA=susceptible to COPD
      • 8. Genotype. CC vs CG/GG for COPD vs controls, Odds ratio (OR)=1.44, 95% confidence limits 1.0-2.2, χ2 (Yates corrected)=3.4, p=0.06, CC=susceptible to COPD
      • 9. Allele. C vs G for COPD vs control, Odds ratio (OR)=1.36, 95% confidence limits 1.0-1.9, χ2 (Yates corrected)=53.7, p=0.05, C=susceptible to COPD
      • 10. Genotype. 5G5G vs rest for COPD vs resistant, Odds ratio (OR)=1.55, 95% confidence limits 0.9-2.6, χ2 (Yates uncorrected)=3.12, p=0.08, 5G5G=susceptible to COPD
      • 11. Genotype. 5G5G vs rest for COPD vs control, Odds ratio (OR)=1.48, 95% confidence limits 0.9-2.5, χ2 (Yates uncorrected)=2.43, p=0.12, 5G5G=susceptible to COPD
      • 12. Allele. 5G vs 4G for COPD vs resistant, Odds ratio (OR)=1.33, 95% confidence limits 1.0-1.8, χ2 (Yates corrected)=4.02, p=0.05, 5G=susceptible to COPD
      • 13. Genotype. TT vs TG/GG for resistant vs controls, Odds ratio (OR)=2.2, 95% confidence limits 1.0-4.7, χ2 (Yates corrected)=4.49, p=0.03, TT genotype=protective for COPD
      • 14. Genotype. AA/AC vs CC for resistant vs COPD, Odds ratio (OR)=1.39, 95% confidence limits 0.9-2.1, χ2 (Yates uncorrected)=2.59, p=0.10, AA/AC genotype=protective for COPD
      • 15. Allele. A vs C for resistant vs COPD, Odds ratio (OR)=1.34, 95% confidence limits 1.0-1.8, χ2 (Yates corrected)=3.94, p=0.05, A allele=protective for COPD
      • 16. Genotype. TT/TG vs GG for resistant vs controls, Odds ratio (OR)=1.53, 95% confidence limits 1.0-2.5, χ2 (Yates uncorrected)=3.52, p=0.06, TT/TG genotype=protective for COPD
      • 17. Allele. T vs G for resistant vs control, Odds ratio (OR)=1.27, 95% confidence limits 1.0-1.7, χ2 (Yates corrected)=2.69, p=0.1, T allele=protective for COPD
      • 18. Genotype. AA vs AG/GG for resistant vs controls, Odds ratio (OR)=1.45, 95% confidence limits 0.9-2.2, χ2 (Yates uncorrected)=3.19, p=0.07, AA genotype=protective for COPD
      • 19. Allele. A vs G for resistant vs control, Odds ratio (OR)=1.34, 95% confidence limits 1.0-1.8, χ2 (Yates uncorrected)=3.71, p=0.05, A allele=protective for COPD
      • 20. Genotype. AA vs AT/TT for COPD vs controls, Odds ratio (OR)=1.51, 95% confidence limits 0.9-2.5, χ2 (Yates uncorrected)=3.07, p=0.08, AA genotype=susceptible to COPD
      • 21. Genotype. AA vs AG/GG for resistant vs controls, Odds ratio (OR)=2.94, 95% confidence limits 0.7-14.0, χ2 (Yates uncorrected)=2.78, p=0.09, AA genotype=protective for COPD
      • 22. Genotype. TT vs TC/CC for COPD vs resistant, Odds ratio (OR)=6.03, 95% confidence limits 1.1-42, χ2 (Yates corrected)=4.9, p=0.03, TT=susceptible to COPD
      • 23. Genotype. MS/SS vs MM for Resistant vs COPD, Odds ratio (OR)=2.42, 95% confidence limits 1.2-5.1, χ2 (Yates corrected)=5.7, p=0.01, S=protective for COPD
    Tissue Necrosis Factor α +489 G/A Polymorphism Allele and Genotype Frequency in the COPD Patients and Resistant Smokers.
  • 1. Allele* 2. Genotype
    Frequency A G AA AG GG
    COPD 54 (11%) 430 (89%) 5 (2%) 44 (18%) 193 (80%)
    n = 242 (%)
    Resistant 27 (7%)  347 (93%) 1 (1%) 25 (13%) 161 (86%)
    n = 187 (%)
    *number of chromosomes (2n)
      • 1. Genotype. AA/AG vs GG for COPD vs resistant, Odds ratio (OR)=1.57, 95% confidence limits 0.9-2.7, χ2 (Yates corrected)=2.52, p=0.11,
        • AA/AG=susceptible (GG=protective)
      • 2. Allele. A vs G for COPD vs resistant, Odds ratio (OR)=1.61, 95% confidence limits 1.0-2.7, χ2 (Yates corrected)=3.38, p=0.07,
        • A=susceptible
    Tissue Necrosis Factor α −308 G/A Polymorphism Allele and Genotype Frequency in the COPD Patients and Resistant Smokers.
  • 3. Allele* 4. Genotype
    Frequency A G AA AG GG
    COPD 90 (19%) 394 (81%) 6 (2%) 78 (32%) 158 (65%)
    n = 242 (%)
    Resistant 58 (15%) 322 (85%) 3 (2%) 52 (27%) 135 (71%)
    n = 190 (%)
    *number of chromosomes (2n)
      • 1. Genotype. GG vs AG/AA for COPD vs resistant, Odds ratio (OR)=0.77, 95% confidence limits 0.5-1.2, χ2 (Yates uncorrected)=1.62, p=0.20,
        • GG=protective (AA/AG=susceptible) trend
      • 2. Allele. A vs G for COPD vs resistant, Odds ratio (OR)=1.3, 95% confidence limits 0.9-1.9, χ2 (Yates uncorrected)=1.7, p=0.20,
        • A=susceptible trend
    SMAD3 C89Y Polymorphism Allele and Genotype Frequency in the COPD Patients and Resistant Smokers.
  • 5. Allele* 6. Genotype
    Frequency A G AA AG GG
    COPD n = 250 (%) 2 (1%) 498 (99%) 0 (0%) 2 (1%) 248 (99%)
    Resistant n = 196 6 (2%) 386 (98%) 0 (0%) 6 (3%) 190 (97%)
    (%)
    *number of chromosomes (2n)
      • 1. Genotype. AA/AG vs GG for COPD vs resistant, Odds ratio (OR)=0.26, 95% confidence limits 0.04-1.4, χ2 (Yates uncorrected)=3.19, p=0.07,
        • AA/AG=protective (GG susceptible)
          Intracellular Adhesion Molecule 1 (ICAM1) A/G E469K (rs5498) Polymorphism Allele and Genotype Frequency in COPD Patients and Resistant Smokers.
  • 7. Allele* 8. Genotype
    Frequency A G AA AG GG
    COPD 259 (54%) 225 (46%) 73 (30%) 113 (47%) 56 (23%)
    n = 242 (%)
    Resistant 217 (60%) 147 (40%) 64 (35%)  89 (49%) 29 (16%)
    n = 182 (%)
    *number of chromosomes (2n)
      • 1. Genotype. GG vs AG/GG for COPD vs resistant, Odds ratio (OR)=1.60, 95% confidence limits 0.9-2.7, χ2 (Yates corrected)=3.37, p=0.07,
        • GG=susceptibility
      • 2. Allele. G vs A for COPD vs resistant, Odds ratio (OR)=1.3, 95% confidence limits 1.0-1.7, χ2 (Yates corrected)=2.90, p=0.09
    Caspase (NOD2) Gly881Arg Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
  • 9. Allele* 10. Genotype
    Frequency G C GG GC CC
    COPD n = 247 486 (98%)   8 (2%) 239 (97%) 8 (3%) 0 (0%)
    Resistant n = 195 388 (99.5%) 2 0.5%) 193 (99%) 2 (1%) 0 (0%)
    (%)
    *number of chromosomes (2n)
      • 1. Genotype. CC/CG vs GG for COPD vs resistant, Odds ratio (OR)=3.2, 95% confidence limits 0.6-22, χ2 (Yates uncorrected)=2.41, p=0.11 (1-tailed),
        • GC/CC=susceptibility (trend)
    Mannose Binding Lectin 2(MBL2) +161 G/A Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
  • 11. Allele* 12. Genotype
    Frequency A G AA AG GG
    COPD n = 218 110 (25%) 326 (75%) 6 (3%) 98 (45%) 114 (52%)
    (%)
    Resistant  66 (18%) 300 (82%) 6 (3%) 54 (30%) 123 (67%)
    n = 183 (%)
    *number of chromosomes (2n)
      • 1. Genotype. GG vs rest for COPD vs resistant, Odds ratio (OR)=0.53, 95% confidence limits 0.4-0.80, χ2 (Yates uncorrected)=8.55, p=0.003,
        • GG=protective
    Chymase 1 (CMA1)-1903 G/A Promoter Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
  • 13. Allele* 14. Genotype
    Frequency A G AA AG GG
    COPD 259 (54%) 219 (46%) 67 (28%) 125 (52%) 47 (20%)
    n = 239 (%)
    Resistant 209 (58%) 153 (42%) 63 (35%)  83 (46%) 35 (19%)
    n = 181 (%)
    *number of chromosomes (2n)
      • 1. Genotype. AA vs AG/GG for COPD vs resistant, Odds ratio (OR)=0.73, 95% confidence limits 0.5-1.1, χ2 (Yates corrected)=1.91, p=0.17,
        • AA genotype=protective trend
    N- Acetyltransferase 2 Arg 197 Gln G/A Polymorphism Allele and Genotype Frequencies in COPD and Resistant Smokers.
  • 15. Allele* 16. Genotype
    Frequency A G AA AG GG
    COPD 136 (28%) 358 (72%) 14 (6%)  108 (44%) 125 (50%)
    n = 247 (%)
    Resistant 125 (32%) 267 (68%) 21 (11%)  83 (42%)  92 (47%)
    n = 196 (%)
    *number of chromosomes (2n)
      • 1. Genotype. AA vs AG/GG for COPD vs resistant, Odds ratio (OR)=0.50, 95% confidence limits 0.2-1.0, χ2 (Yates uncorrected)=3.82, p=0.05,
        • AA genotype=protective
    Interleukin 1B (IL-1B) −511 A/G Polymorphism Allele and Genotype Frequencies in COPD and Resistant Smokers.
  • 17. Allele* 18. Genotype
    Frequency A G AA AG GG
    COPD 160 (32%) 336 (68%) 31 (13%) 98 (40%) 119 (48%)
    n = 248 (%)
    Resistant 142 (36%) 248 (64%) 27 (14%) 88 (45%)  80 (41%)
    n = 195 (%)
    *number of chromosomes (2n)
      • 1. Genotype. GG vs AA/AG for COPD vs resistant, Odds ratio (OR)=1.3, 95% confidence limits 0.9-2.0, χ2 (Yates corrected)=1.86, p=0.17,
        • GG genotype=susceptible trend
    Microsomal Epoxide Hydrolase (MEH) Tyr 113 His T/C (Exon 3) Polymorphism Allele and Genotype Frequency in COPD and Resistant Smokers.
  • 19. Allele* 20. Genotype
    Frequency C T CC CT TT
    COPD 137 (28%) 361 (72%) 18 (7%)  101 (41%) 130 (52%)
    n = 249 (%)
    Resistant 130 (34%) 258 (66%) 19 (10%)  92 (47%)  83 (43%)
    n = 194 (%)
    *number of chromosomes (2n)
      • 1. Genotype. TT vs CT/CC for COPD vs resistant, Odds ratio (OR)=1.5, 95% confidence limits 1.0-2.2, χ2 (Yates corrected)=3.51, p=0.06,
        • TT genotype=susceptible
    Microsomal Epoxide Hydrolase (MEH) His 139 Arg A/G (Exon 4) Polymorphism Allele and Genotype Frequency in COPD and Resistant Smokers.
  • 21. Allele* 22. Genotype
    Frequency A G AA AG GG
    COPD n = 238 372 (78%) 104 (22%) 148 (62%) 76 (32%) 14 (6%)
    (%)
    Resistant 277 (77%)  81 (23%) 114 (64%) 49 (27%) 16 (9%)
    n = 179 (%)
    *number of chromosomes (2n)
      • 1. Genotype. GG vs AA/AG for COPD vs resistant, Odds ratio (OR)=0.64, 95% confidence limits 0.3-1.4, χ2 (Yates uncorrected)=1.43, p=0.23,
        • GG genotype=protective (trend)
    Lipo-Oxygenase −366 G/A Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
  • 23. Allele* 24. Genotype
    Frequency A G AA AG GG
    COPD n = 247 21 (4%) 473 (96%) 1 (0.5%) 19 (7.5%) 227 (92%)
    (%)
    Resistant 25 (7%) 359 (93%) 0 (0%)   25 (13%)  167 (87%)
    n = 192 (%)
    *number of chromosomes (2n)
      • 1. Genotype. AA/AG vs GG for COPD vs resistant, Odds ratio (OR)=0.60, 95% confidence limits 0.3-1.1, χ2 (Yates corrected)=2.34, p=0.12,
        • AA/AG genotype=protective (GG susceptible) trend
    Heat Shock Protein 70 (HSP 70) HOM T2437C Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
  • 25. Allele* 26. Genotype
    Frequency C T CC CT TT
    COPD n = 199 (%) 127 271 5 (3%) 117 (59%) 77 (39%)
    (32%) (68%)
    Resistant n = 166  78 254 4 (2%)  70 (42%) 92 (56%)
    (%) (23%) (77%)
    *number of chromosomes (2n)
      • 1. Genotype. CC/CT vs TT for COPD vs resistant, Odds ratio (OR)=2.0, 95% confidence limits 1.3-3.1, χ2 (Yates uncorrected)=9.52, p=0.002,
        • CC/CT genotype=susceptible (TT=protective)
    Chloride Channel Calcium-Activated 1 (CLCA1) +13924 T/A Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
  • 27. Allele* 28. Genotype
    Frequency A T AA AT TT
    COPD n = 224 282 166 84 (38%) 114 (51%) 26 (12%)
    (%) (63%) (37%)
    Resistant n = 158 178 138 42 (27%)  94 (59%) 22 (14%)
    (%) (56%) (44%)
    *number of chromosomes (2n)
      • 1. Genotype. AA vs AT/TT for COPD vs resistant, Odds ratio (OR)=1.7, 95% confidence limits 1.0-2.7, χ2 (Yates corrected)=4.51, p=0.03,
        • AA=susceptible
    Monocyte Differentiation Antigen CD-14 −159 Promoter Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
  • 29. Allele* 30. Genotype
    Frequency C T CC CT TT
    COPD n = 240 268 212 77 (32%) 114 (48%) 49 (20%)
    (%) (56%) (44%)
    Resistant n = 180 182 178 46 (25%)  90 (50%) 44 (24%)
    (%) (51%) (49%)
    *number of chromosomes (2n)
      • 1. Genotype CC vs CT/TT for COPD vs Resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.9-2.2, χ2 (Yates uncorrected)=2.12, p=0.15,
        • CC=susceptible (trend)
    Elafin +49 C/T Polymorphism Allele and Genotype Frequencies in the COPD Patients, Resistant Smokers and Controls.
  • 31. Allele* 32. Genotype
    Frequency C T CC CT TT
    COPD n = 144 (%) 247 41 105 (73%) 37 (26%) 2 (1%)
    (86%) (14%)
    Resistant n = 75 121 29  49 (65%) 23 (31%) 3 (4%)
    (%) (81%) (19%)
    *number of chromosomes (2n)
      • 1. Genotype. CT/TT vs CC for COPD vs resistant, Odds ratio (OR)=0.70, 95%
      • confidence limits=0.4-1.3, χ2 (Yates uncorrected)=1.36, p=0.24,
        • CT/TT genotype=protective (trend only)
      • 2. Allele: T vs C for COPD vs resistant, Odds ratio (OR)=0.69, 95% confidence limits=0.4-1.2, χ2 (Yates uncorrected)=1.91, p=0.17,
        • T genotype=protective (trend only)
    Beta2-Adrenoreceptor Gln 27 Glu Polymorphism Allele and Genotype Frequency in the COPD Patients, Resistant Smokers and Controls.
  • 33. Allele* 34. Genotype
    Frequency C G CC CG GG
    Controls
    204 168 57 (31%) 89 (48%) 39 (21%)
    n = 185 (%) (55%) (45%)
    COPD n = 238 268 208 67 (28%) 134 (56%)  37 (16%)
    (%) (56%) (44%)
    Resistant 220 170 64 (33%) 92 (47%) 39 (20%)
    n = 195 (%) (56%) (44%)
    *number of chromosomes (2n)
      • 1. Genotype. GG vs CG/CC for COPD vs resistant, Odds ratio (OR)=0.74, 95% confidence limits=0.4-1.2, χ2 (Yates uncorrected)=1.47, p=0.23,
        • GG=protective (trend)
      • 2. Genotype. GG vs CG/CC for COPD vs controls, Odds ratio (OR)=0.69, 95% confidence limits=0.4-1.2, χ2 (Yates uncorrected)=2.16, p=0.14,
        • GG=protective (trend)
    Maxtrix Metalloproteinase 1 (MMP1) −1607 1G/2G Polymorphism Allele and Genotype Frequencies in COPD Patients, Resistant Smokers and Controls.
  • 35. Allele* 36. Genotype
    Frequency 1G 2G 1G1G 1G2G 2G2G
    Controls n = 174 214 134 68 (39%) 78 (45%) 28 (16%)
    (%) (61%) (39%)
    COPD n = 217 182 252 47 (22%) 88 (41%) 82 (38%)
    (%) (42%) (58%)
    Resistant n = 187 186 188 46 (25%) 94 (50%) 47 (25%)
    (%) (50%) (50%)
    *number of chromosomes (2n)
    • 1. Genotype. 1G1G vs rest for COPD vs controls, Odds ratio (OR)=0.43, 95% confidence limits 0.3-0.7, ?2 (Yates uncorrected)=13.3, p=0.0003
      • 1G1G genotype=protective
    • 2. Allele. 1G vs 2G for COPD vs controls, Odds ration (OR)=0.45, 95% confidence limits 0.3-0.6, ?2 (Yates corrected)=28.8, p<0.0001,
      • 1G=protective
    • 3. Genotype. 1G1G/1G2G vs rest for COPD vs resistant smokers, Odds ratio (OR)=0.55, 95% confidence limits 0.4-0.9, ?2 (Yates uncorrected)=6.83, p=0.009
      • 1G1G/162G genotypes=protective
    • 4. Allele. 1G vs 2G for COPD vs resistant smokers, Odds ratio (OR)=0.73, 95% confidence limits 0.6-1.0, ?2 (Yates corrected)=4.61, p=0.03,
      • 1G=protective
    • 5. Genotype. 2G2G vs 1G1G/1G2G for COPD vs controls, Odds ratio (OR)=3.17, 95% confidence limits 1.9-5.3, ?2 (Yates uncorrected)=21.4, p<0.0001
      • 2G2G genotype=susceptible
    • 6. Allele. 2G vs 1G for COPD vs controls, Odds ratio (OR)=2.2, 95% confidence limits 1.6-3.0, ?2 (Yates corrected)=28.8, p<0.00001,
      • 2G=susceptible
    • 7. Genotype. 2G2G vs 1G1G/1G2G for COPD vs resistant, Odds ratio (OR)=1.81, 95% confidence limits 1.2-2.9, ?2 (Yates uncorrected)=6.83, p=0.009
      • 2G2G genotype=susceptible
    • 8. Allele. 2G vs 1G for COPD vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 1.0-1.8, ?2 (Yates corrected)=4.61, p=0.0.03,
      • 2G=susceptible
  • Table 2 below provides a summary of the protective and susceptibility polymorphisms determined for COPD.
  • TABLE 2
    Summary of protective and susceptibility polymorphisms for COPD
    Gene Polymorphism Role
    Cyclo-oxygenase 2 (COX2) COX2 −765 G/C CC/CG protective
    β2-adrenoreceptor (ADBR) ADBR Arg16Gly GG susceptible
    Interleukin-18 (IL18) IL18 −133 C/G CC susceptible
    Interleukin-18 (IL18) IL18 105 A/C AA susceptible
    Plasminogen activator inhibitor 1 (PAI-1) PAI-1 −675 4G/5G 5G5G susceptible
    Nitric Oxide synthase 3 (NOS3) NOS3 298 Asp/Glu TT protective
    Vitamin D Binding Protein (VDBP) VDBP Lys 420 Thr AA/AC protective
    Vitamin D Binding Protein (VDBP) VDBP Glu 416 Asp TT/TG protective
    Glutathione S Transferase (GSTP-1) GSTP1 Ile105Val AA protective
    Interferon ? (IFN-?) IFN-? 874 A/T AA susceptible
    Interleukin-13 (IL13) IL13 Arg 130 Gln AA protective
    Interleukin-13 (IL13) Il13 −1055C/T TT susceptible
    a1-antitrypsin (a1-AT) a1-AT S allele MS protective
    Tissue Necrosis Factor α TNFa TNFa +489 G/A AA/AG
    susceptible
    GG protective
    Tissue Necrosis Factor α TNFa TNFa −308 G/A GG protective
    AA/AG
    susceptible
    SMAD3 SMAD3 C89Y AG AA/AG protective
    GG susceptible
    Intracellular adhesion molecule 1 ICAM1 E469K GG susceptible
    (ICAM1) A/G
    Caspase (NOD2) NOD2 Gly 881Arg GC/CC susceptible
    G/C
    Mannose binding lectin 2 (MBL2) MBL2 161 G/A GG protective
    Chymase 1 (CMA1) CMA1 −1903 G/A AA protective
    N-Acetyl transferase 2 (NAT2) NAT2 Arg 197 Gln AA protective
    G/A
    Interleukin 1B (IL1B) (IL1B) −511 A/G GG susceptible
    Microsomal epoxide hydrolase (MEH) MEH Tyr 113 His TT susceptible
    T/C
    Microsomal epoxide hydrolase (MEH) MEH His 139 Arg GG protective
    G/A
    5 Lipo-oxygenase (ALOX5) ALOX5 −366 G/A AA/AG protective
    GG susceptible
    Heat Shock Protein 70 (HSP 70) HSP 70 HOM CC/CT susceptible
    T2437C TT protective
    Chloride Channel Calcium-activated 1 CLCA1 +13924 AA susceptible
    (CLCA1) T/A
    Monocyte differentiation antigen CD-14 CD-14 −159 C/T CC susceptible
    Elafin Elafin Exon 1 +49 CT/TT protective
    C/T
    B2-adrenergic receptor (ADBR) ADBR Gln 27 Glu GG protective
    C/G
    Matrix metalloproteinase 1 (MMP1) MMP1 −1607 1G1G/1G2G
    1G/2G protective
  • The combined frequencies of the presence or absence of the selected protective genotypes COX2 (−765) CC/CG, β2 adreno-receptor AA, Interleukin-13 AA, Nitic Oxide Synthase 3 TT, and Vitamin D Binding Protein AA observed in the COPD subjects and in resistant smokers is presented below in Table 3.
  • TABLE 3
    Combined frequencies of the presence or absence of selected protective
    genotypes in COPD subjects and in resistant smokers.
    Number of protective
    polymorphisms
    Cohorts
    0 1 =2 Total
    COPD 136 (54%) 100 (40%) 16 (7%)  252
    Resistant smokers  79 (40%)  83 (42%) 34 (17%) 196
    % of smokers with COPD 136/215 100/183 16/50
    (63%) (55%) (32%)
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 vs 2+, Resist vs COPD 16.43 0.0003
    2+ vs 0-1, Resist vs COPD 3.1 1.6-6.1 12.36 0.0004
    1+ vs 0, Resist vs COPD 1.74 1.2-2.6 7.71 0.006
  • The combined frequencies of the presence or absence of the selected susceptibility genotypes Interleukin-18 105 AA, PAI-1 −675 5G5G, Interleukin-13 −1055 TT, and Interferon-? −874 AA observed in the COPD subjects and in resistant smokers is presented below in Table 4.
  • TABLE 4
    Combined frequencies of the presence or absence of selected
    susceptibility genotypes in the COPD subjects and in resistant smokers.
    Number of protective
    polymorphisms
    Cohorts
    0 1 =2 Total
    COPD 66 (26%) 113 (45%) 73 (29%) 252
    Resistant smokers 69 (35%)  92 (47%) 35 (18%) 196
    % of smokers with 66/135 113/205 73/108
    COPD (49%) (55%) (68%)
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 vs 2+, COPD vs Resist 8.72 0.01
    2+ vs 0-1, COPD vs Resist 1.9 1.2-3.0 6.84 0.009
    1+ vs 0, COPD vs Resist 1.5 1.0-3.5 3.84 0.05
  • The combined frequencies of the presence or absence of the protective genotypes COX2 (−765) CC/CG, Interleukin-13 AA, Nitic Oxide Synthase 3 TT, Vitamin D Binding Protein AA/AC, GSTP1 AA, and a1-antitypsin MS/SS, observed in the COPD subjects and in resistant smokers is presented below in Table 5 and in FIG. 1.
  • TABLE 5
    Combined frequencies of the presence or absence of selected protective
    genotypes in the COPD subjects and in resistant smokers.
    Number of protective
    polymorphisms
    Cohorts
    0 1 =2 Total
    COPD 51 (19%) 64 (24%) 150 (57%) 265
    Resistant smokers 16 (8%)  56 (27%) 133 (65%) 205
    % of smokers with COPD 51/76 64/120 150/283
    (76%) (53%) (53%)
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 vs 2+, Resist vs COPD 12.14 0.0005
    1+ vs 0, Resist vs COPD 2.82 1.5-5.3 11.46 0.0004
  • Protective polymorphisms were assigned a score of +1 while susceptibility polymorphisms were assigned a score of −1. For each subject, a net score was then calculated according to the presence of susceptibility and protective genotypes. This produced a linear spread of values. When assessed as a range between −3 to +3, a linear relationship as depicted in FIG. 2 was observed. This analysis indicates that for subjects with a net score of −2 or less, there was a 70% or greater risk of having COPD. In contrast, for subjects with a net score of 2+ or greater the risk was approximately 40% (see FIG. 2).
  • In an analysis in which the value of a given polymorphism was weighted based on the Odd's ratio for that polymorphism (generated by comparing its frequency between resistant and COPD subjects), a linear relationship was again observed. This analysis allowed for the distinction of smokers at high or low risk of having COPD.
  • I. Example 2 Case Association Study—OCOPD Methods Subject Recruitment
  • Subjects of European decent who had been exposed to chronic smoking (minimum 15 pack years) and aero-pollutants in the work place (noxious dusts or fumes) were identified from respiratory clinics. After spirometric testing those with occupational chronic obstructive pulmonary disease (OCOPD) with forced expiratory volume in one second (FEV1) as a percentage of predicted <70% and a FEV1/FVC ratio (Forced expiratory volume in one second/Forced vital capacity) of <79% (measured using American Thoracic Society criteria) were recruited. One hundred and thirty-nine subjects were recruited, of these 70% were male, the mean FEV1/FVC (±Standard Deviation) was 54% (SD 15), mean FEV1 as a percentage of predicted was 46 (SD 19). Mean age, cigarettes per day, and pack year history was 62 yrs (SD 9), 25 cigarettes/day (SD 16) and 53 pack years (SD 31), respectively. One hundred and twelve European subjects who had smoked a minimum of fifteen pack years and similarly been exposed in the work place to potentially noxious dusts or fumes were also studied. This control group was recruited through community studies of lung function and were 81% male; the mean FEV1/FVC (SD) was 81% (SD 8), and mean FEV1 as a percentage of predicted was 96 (SD 10). Mean age, cigarettes per day and pack year history was 58 yrs (SD 11), 26 cigarettes/day (SD 14) and 45 pack years (SD 28), respectively. Using a PCR based method [1], all subjects were genotyped for the α1-antitrypsin mutations (M, S and Z alleles) and those with the ZZ allele were excluded. The OCOPD and resistant smoker cohorts were matched for subjects with the MZ genotype (6% in each cohort). They were also matched for age started smoking (mean 16 yr) and aged stopped smoking (mid fifties). 190 European blood donors (smoking and occupational exposure status unknown) were recruited consecutively through local blood donor services. Sixty-three percent were men and their mean age was 50 years. On regression analysis, the age difference and pack years difference observed between OCOPD sufferers and resistant smokers was found not to determine FEV or OCOPD.
  • Summary of Characteristics for the OCOPD and Exposed Resistant Smoker Cohorts.
  • Parameter OCOPD Exposed resistant
    Mean (SD) (N = 139) smokers (N = 112) Differences
    % male 70% 81% P < 0.05
    Age (yrs) 62 (9)  58 (11) ns
    Pack years 53 (31) 45 (28) P < 0.05
    Cigarettes/day 25 (16) 26 (14) ns
    FEV1 (L) 1.3 (0.7) 3.0 (0.7) P < 0.05
    FEV1 % predict 46 (19) 96% (10)   P < 0.05
    FEV1/FVC 54 (15) 81 (8)  P < 0.05
  • Means and 1SD
  • Cyclooxygenase 2 (COX2) −765 G/C Promoter Polymorphism and a1-Antitrypsin Genotyping
  • Genomic DNA was extracted from whole blood samples [2]. The COX2 −765 polymorphism was determined by minor modifications of a previously published method [3]. The PCR reaction was carried out in a total volume of 25 ul and contained 20 ng genomic DNA, 500 pmol forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl2 and 1 unit of Taq polymerase (Life Technologies). Cycling times were incubations for 3 min at 95° C. followed by 33 cycles of 50 s at 94° C., 60 s at 66° C. and 60 s at 72° C. A final elongation of 10 min at 72° C. then followed. 4 ul of PCR products were visualised by ultraviolet trans-illumination of a 6% agarose gel stained with ethidium bromide. An aliquot of 3 ul of amplification product was digested for 1 hr with 4 units of AciI (Roche Diagnostics, New Zealand) at 37° C. Digested products were separated on a 2.5% agarose gel run for 2.0 hrs at 80 mV with TBE buffer and visualised using ultraviolet transillumination after ethidium bromide staining against a 123 bp ladder. Using a PCR based method discussed above [3], all smoking subjects were genotyped for the α1-antitrypsin M, S and Z alleles.
  • Genotyping of the Superoxide Dismutase 3 Arg 312 Gln Polymorphism
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [4, herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions. The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 10 pmol forward and reverse primers, 0.1 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl2 and 0.5 unit of Taq polymerase (Qiagen). Aliquots of amplification product were digested for 4 hrs with 5 U of the relevant restriction enzymes (Roche Diagnostics, New Zealand) at designated temperatures and conditions. Digested products were separated on 8% polyacrylamide gels (49:1, Sigma). The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
  • Genotyping of the Microsomal Epoxide Hydrolase Exon 3 TC Polymorphism
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [5, herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions. The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Cycling conditions consisted of 94° C. 60 s, 56° C. 20 s, 72° C. 20 s for 38 cycles with an extended last extension of 3 min. Aliquots of amplification product were digested for 4 hrs with 5 U of the relevant restriction enzymes Eco RV (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 8% polyacrylamide gels (49:1, Sigma). The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
  • Genotyping of the 3′ 1237 G/A (T/T) Polymorphism of the a1-Antitrypsin Gene
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [Sandford A J et al., [6], each of which is herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward and reverse prime sequences were 5′-CTACCAGGAATGGCCTTGTCC-3′ [SEQ.ID.NO.136] and 5′-CTCTCAGGTCTGGTGTCATCC-3′ [SEQ.ID.NO.137]. Cycling conditions consisted of 94 C 60 s, 56 C 20 s, 72 C 20 s for 38 cycles with an extended last extension of 3 min. Aliquots of amplification product were digested for 4 hrs with 2 Units of the restriction enzymes Taq 1 (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 3% agarose. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
  • Genotyping of the Asp 299 Gly Polymorphism of the Toll-Like Receptor 4 Gene
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [6]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward and reverse prime sequences were 5′-GATTAGCATACTTAGACTACTACCTCCATG-3′ [SEQ.ID.NO.138] and 5′-GATCAACTTCTGAAAAAGCATTCCCAC-3′ [SEQ.ID.NO.139]. Cycling conditions consisted of 94° C. 30 s, 55° C. 30 s, 72° C. 30 s for 30 cycles with an extended last extension of 3 min. Aliquots of amplification product were digested for 4 hrs with 2 U of the restriction enzyme Nco I (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 3% agarose gel. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
  • Genotyping of the −1607 1G2G Polymorphism of the Matrix Metalloproteinase 1 Gene
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [Dunleavey L, et al]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 200 mM dNTPs, 20 mM Tris-HCL (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward and reverse prime sequences were 3′ TCGTGAGAATGTCTTCCCATT-3′ [SEQ.ID.NO.140] and 5′-TCTTGGATTGATTTGAGATAAGTGAAATC-3′ [SEQ.ID.NO.141]. Cycling conditions consisted of 94 C 60 s, 55 C 30 s, 72 C 30 s for 35 cycles with an extended last extension of 3 min. Aliquots of amplification product were digested for 4 hrs with 6 Units of the restriction enzymes XmnI (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 6% polyacrylamide gel. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
  • Other Polymorphism Genotyping
  • Genomic DNA was extracted from whole blood samples [4]. Purified genomic DNA was aliquoted (10 ng/ul concentration) into 96 well plates and genotyped on a Sequenom™ system (Sequenom™ Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser) using the sequences, amplification conditions and methods described below.
  • The following conditions were used for the PCR multiplex reaction: final concentrations were for 10× Buffer 15 mM MgCl2 1.25×, 25 mM MgCl2 1.625 mM, dNTP mix 25 mM 500 uM, primers 4 uM 100 nM, Taq polymerase (Quiagen hot start) 0.15 u/reaction, Genomic DNA 10 ng/ul. Cycling times were 95° C. for 15 min, (5° C. for 15 s, 56° C. 30 s, 72° C. 30 s for 45 cycles with a prolonged extension time of 3 min to finish. We used shrimp alkaline phosphotase (SAP) treatment (2 ul to 5 ul PCR reaction) incubated at 35° C. for 30 min and extension reaction (add 2 ul to 7 ul after SAP treatment) with the following volumes per reaction of water 0.76 ul, hME 10× termination buffer 0.2 ul, hME primer (10 uM) 1 ul, MassEXTEND enzyme 0.04 ul.
  • Sequenom Conditions for the Polymorphisms Genotyping—1
  • SNP_ID TERM WELL 2nd-PCRP 1st-PCRP
    VDBP - 420 ACT W1 ACGTTGGATGGCTTGTTAACCAGCTT ACGTTGGATGTTTTTCAGACTGGCAG
    TGCC [SEQ. ID. NO. 142] AGCG [SEQ. ID. NO. 143]
    VDBP - 416 ACT W1 ACGTTGGATGTTTTTCAGACTGGCAG ACGTTGGATGGCTTGTTAACCAGCTTT
    AGCG [SEQ. ID. NO. 144] GCC [SEQ. ID. NO. 145]
    ADRB2- ACT W2 ACGTTGGATGTTGCTGGCACCCAATG ACGTTGGATGATGAGAGACATGACGA
    Gln27Glu GAAG [SEQ. ID. NO. 146] TGCC [SEQ. ID. NO. 147]
    GSTP1 -105 ACT W2 ACGTTGGATGTGGTGGACATGGTGAA ACGTTGGATGTGGTGCAGATGCTCAC
    TGAC [SEQ. ID. NO. 148] ATAG [SEQ. ID. NO. 149]
    PAI1 G-675G ACT W2 ACGTTGGATGCACAGAGAGAGTCTGG ACGTTGGATGCTCTTGGTCTTTCCCTC
    ACAC [SEQ. ID. NO. 150] ATC
    [SEQ. ID. NO. 151]
    IL-11 G518A ACT W3 ACGTTGGATGCCTCTGATCCTCTTTGC ACGTTGGATGAAGAGGGAGTGGAAG
    TTC [SEQ. ID. NO. 152] GGAAG [SEQ. ID. NO. 153]
    NOS3 - 298 ACT W3 ACGTTGGATGACAGCTCTGCATTCAG ACGTTGGATGAGTCAATCCCTTTGGT
    CACG [SEQ. ID. NO. 154] GCTC [SEQ. ID. NO. 155]
    IL-8 A-251T CGT W5 ACGTTGGATGACTGAAGCTCCACAAT ACGTTGGATGGCCACTCTAGTACTAT
    TTGG [SEQ. ID. NO. 156] ATCTG [SEQ. ID. NO. 157]
    IL-18 C-133G ACT W6 ACGTTGGATGGGGTATTCATAAGCTG ACGTTGGATGCCTTCAAGTTCAGTGG
    AAAC [SEQ. ID. NO. 158] TCAG [SEQ. ID. NO. 159]
    IL-18 A105C ACT W8 ACGTTGGATGGGTCAATGAAGAGAA ACGTTGGATGAATGTTTATTGTAGAA
    CTTGG [SEQ. ID. NO. 160] AACC [SEQ. ID. NO. 161]
  • Sequenom Conditions for the Polymorphisms Genotyping—2
  • SNP_ID AMP_LEN UP_CONF MP_CONF Tm(NN) PcGC PWARN UEP_DIR
    VDBP - 420 99 99.7 99.7 46.2 53.3 ML R
    VDBP - 416 99 99.7 99.7 45.5 33.3 M F
    ADRB2-Gln27Glu 118 96.6 80 52.2 66.7 L F
    GSTP1 -105 107 99.4 80 49.9 52.9 F
    PAI1 G-675G 109 97.9 80 59.3 66.7 g F
    IL-11 G518A 169 97.5 65 52.9 52.6 s F
    NOS3 - 298 186 98.1 65 61.2 63.2 F
    IL-8 A-251T 119 92.6 81.2 45.9 28.6 R
    IL-18 C-133G 112 93.5 74.3 41.8 46.7 L F
    IL-18 A105C 121 67.2 74.3 48.9 40 R
  • Sequenom Conditions for the Polymorphisms Genotyping—3
  • SNP_ID UEP_MASS UEP_SEQ EXT1_CALL EXT1_MASS
    VDBP - 420 4518.9 AGCTTTGCCAGTTCC[SEQ. ID. NO. 162] A 4807.1
    VDBP - 416 5524.6 AAAAGCAAAATTGCCTGA[SEQ. ID. NO. T 5812.8
    163]
    ADRB2- 4547 CACGACGTCACGCAG[SEQ. ID. NO. 164] C 4820.2
    Gln27Glu
    GSTP1 -105 5099.3 ACCTCCGCTGCAAATAC[SEQ. ID. NO. 165] A 5396.5
    PAI1 G-675G 5620.6 GAGTCTGGACACGTGGGG[SEQ. ID. NO. DEL 5917.9
    166]
    IL-11 G518A 5705.7 TCCATCTCTGTGGATCTCC[SEQ. ID. NO. A 6002.9
    167]
    NOS3 - 298 5813.8 TGCTGCAGGCCCCAGATGA[SEQ. ID. NO. T 6102
    168]
    IL-8 A-251T 6428.2 CACAATTTGGTGAATTATCAA[SEQ. ID. A 6716.4
    NO. 169]
    IL-18 C-133G 4592 AGCTGAAACTTCTGG[SEQ. ID. NO. 170] C 4865.2
    IL-18 A105C 6085 TCAAGCTTGCCAAAGTAATC[SEQ. ID. A 6373.2
    NO. 171]
  • Sequenom Conditions for the Polymorphisms Genotyping—4
  • SNP_ID EXT1_SEQ EXT2_CALL EXT2_MASS EXT2_SEQ 1stPAUSE
    VDBP - 420 AGCTTTGCCAGTTCCT C 5136.4 AGCTTTGCCAGTTCCGT 4848.2
    [SEQ. ID. NO. 172] [SEQ. ID. NO. 173]
    VDBP - 416 AAAAGCAAAATTGCCTGA G 6456.2 AAAAGCAAAATTGCCTGAG 5853.9
    T [SEQ. ID. NO. 174] GC [SEQ. ID. NO. 175]
    ADRB2- CACGACGTCACGCAGC G 5173.4 CACGACGTCACGCAGGA 4876.2
    Gln27Glu [SEQ. ID. NO. 176] [SEQ. ID. NO. 177]
    GSTP1 -105 ACCTCCGCTGCAAATACA G 5716.7 ACCTCCGCTGCAAATACGT 5428.5
    [SEQ. ID. NO. 178] [SEQ. ID. NO. 179]
    PAI1 G-675G GAGTCTGGACACGTGGGG G 6247.1 GAGTCTGGACACGTGGGGG 5949.9
    A [SEQ. ID. NO. 180] A [SEQ. ID. NO. 181]
    IL-11 G518A TCCATCTCTGTGGATCTCC G 6323.1 TCCATCTCTGTGGATCTCC 6034.9
    A [SEQ. ID. NO. 182] GT [SEQ. ID. NO. 183]
    NOS3 - 298 TGCTGCAGGCCCCAGATG G 6416.2 TGCTGCAGGCCCCAGATGA 6143
    AT [SEQ. ID. NO. 184] GC [SEQ. ID. NO. 185]
    IL-8 A-251T CACAATTTGGTGAATTAT T 7029.6 CACAATTTGGTGAATTATC 6741.4
    CAAT [SEQ. ID. NO. 186] AAAT [SEQ. ID. NO. 187]
    IL-18 C-133G AGCTGAAACTTCTGGC G 5218.4 AGCTGAAACTTCTGGGA 4921.2
    [SEQ. ID. NO. 188] [SEQ. ID. NO. 189]
    IL-18 A105C TCAAGCTTGCCAAAGTAA C 7040.6 TCAAGCTTGCCAAAGTAAT 6414.2
    TCT [SEQ. ID. NO. 190] CGGA[SEQ. ID. NO. 191]
  • Results
  • Frequencies of individual polymorphisms are as follows:
  • TABLE 6
    Polymorphism allele and genotype frequency in the OCOPD patients,
    exposed resistant smokers and controls.
    Cyclo-oxygenase 2 −765 G/C
    Allele* Genotype
    Frequency C G CC CG GG
    Controls n = 95 (%) 27 (14%) 161 (86%) 3 (3%) 21 (22%) 70 (75%)
    OCOPD n = 82 (%) 22 (13%) 1424 (87%) 2 (2%) 18 (22%) 623 (76%)
    Resistant n = 87 (%) 422 (24%) 132 (76%) 61 (7%) 301 (34%) 51 (59%)
    Glutathione S Transferase P1 Ile 105 Val (A/G)
    Allele* Genotype
    Frequency A G AA AG GG
    Controls n = 186 (%) 234 (63%) 138 (37%)  71 (38%) 92 (50%) 23 (12%)
    OCOPD n = 123 (%) 159 (65%) 87 (36%) 52 (42%) 55 (45%) 165 (13%)
    Resistant n = 98 (%) 136 (69%) 60 (31%) 44 (45%) 48 (49%) 6 (6%)
    Interleukin 18 105 C/A
    Allele* Genotype
    Frequency C A CC AC AA
    Controls n = 185 (%) 119 (32%)  251 (68%) 22 (12%) 75 (40%)   88 (48%)
    OCOPD n = 122 (%) 62 (25%) 182 (75%) 12 (10%) 38 (31%) 726,7 (59%)
    Resistant n = 98 (%) 60 (31%) 136 (69%)  6 (6%) 48 (49%)   44 (45%)
    Interleukin 18 −133 G/C
    Allele* Genotype
    Frequency G C GG GC CC
    Controls n = 188 (%) 121 (32%)  255 (68%) 23 (12%) 75 (40%)   90 (48%)
    OCOPD n = 122 62 (25%) 182 (75%) 12 (10%) 38 (31%) 728,9 (59%)
    Resistant n = 97 (%) 60 (31%) 134 (69%) 6 (6%) 48 (50%)   43 (44%)
    Interleukin 8 −251 A/T
    Allele* Genotype
    Frequency A T AA AT TT
    Controls n = 188 (%) 175 (47%) 201 (53%) 39 (21%) 97 (52%) 52 (28%)
    OCOPD n = 116 101 (44%) 131 (56%) 21 (18%) 59 (51%) 36 (31%)
    Resistant n = 93 (%) 9411 (50%)   92 (49%) 2610 (28%) 42 (45%) 25 (27%)
    Vitamin D Binding Protein Lys 420 Thr (A/C)
    Allele* Genotype
    Frequency A C AA AC CC
    Controls n = 189 (%) 113 (30%) 265 (70%) 17 (9%)  79 (42%) 93 (49%)
    OCOPD n = 122 (%) 62 (25%) 182 (75%) 5 (4%) 52 (43%) 6514 (53%)
    Resistant n = 99 (%)  7313 (37%) 125 (63%) 1212 (12%) 49 (50%) 38 (38%)
    Vitamin D Binding Protein Glu 416 Asp (T/G)
    Allele* Genotype
    Frequency T G TT TG GG
    Controls n = 189 (%) 163 (43%) 215 (57%) 35 (19%) 93 (49%) 61 (32%)
    OCOPD n = 122 (%) 109 (45%) 135 (55%) 25 (21%) 59 (48%) 3817 (31%)
    Resistant n = 99 (%) 10316 (52%)  95 (48%) 2315 (23%) 5715 (58%) 19 (19%)
    Microsomal epxoide hydrolase R/r Exon 3 T/C
    Allele* Genotype
    Frequency r R rr Rr RR
    Controls n = 184 (%) 228 (62%) 140 (38%)  77 (42%) 74 (40%) 33 (18%)
    OCOPD n = 98 (%) 144 (74%) 52 (26%) 55 (56%) 34 (35%) 9 (9%)
    Resistant n = 102 (%) 135 (66%) 69 (34%) 52 (51%) 31 (30%) 1918 (19%)
    Super oxide dismutase 3 Arg 312 Gln
    Allele* Genotype
    Frequency A G AA AG GG
    Controls n = 190 (%) 371 (98%) 9 (2%) 183 (96%)  5 (3%) 2 (1%)
    OCOPD n = 100 (%) 19920 (99%) 1 (1%) 99 (99%) 1 (1%) 0 (0%)
    Resistant n = 102 (%) 193 (95%) 1120 (5%)  92 (90%) 919 (9%) 119 (1%)
    a1-antitrypsin S
    Allele* Genotype
    Frequency M S MM MS SS
    OCOPD n = 88 (%) 171 (97%) 5 (3%) 83 (94%) 5 (6%) 0 (0%)
    Resistant n = 94 (%) 175 (93%) 1322 (7%) 81 (86%) 1321 (14%) 0 (0%)
    Toll-like receptor 4 Asp 299 Gly A/G
    Allele* Genotype
    Frequency A G AA AG GG
    OCOPD n = 60 (%) 117 (98%) 1 (2%) 58 (98%) 1 (2%) 0 (0%)
    Resistant n = 34 (%)  65 (96%) 3 (4%) 31 (91%) 323 (9%) 0 (0%)
    Beta2-adrenoreceptor Gln 27 Glu
    Allele* Genotype
    Frequency C G CC CG GG
    Controls n = 186 (%) 204 (55%) 168 (45%) 57 (31%) 90 (48%) 39 (21%)
    OCOPD n = 122 (%) 129 (53%) 115 (47%) 32 (26%) 65 (53%) 25 (21%)
    Resistant n = 99 (%) 117 (59%)  81 (41%) 3824 (38%) 41 (41%) 20 (20%)
    Interleukin 11 (IL-11) −518 G/A
    Allele* Genotype
    Frequency A G AA AG GG
    OCOPD n = 119 (%) 110 (46%) 128 (54%) 22 (19%) 66 (55%) 31 (26%)
    Resistant n = 98 (%) 103 (53%)  93 (47%) 2625 (27%) 51 (52%) 21 (21%)
    Interleukin-13 −1055 C/T
    Allele* Genotype
    Frequency T C TT TC CC
    Controls n = 182 (%) 65 (18%) 299 (82%) 5 (3%) 55 (30%) 122 (67%) 
    OCOPD n = 121 (%) 53 (22%) 189 (78%) 526 (4%) 43 (36%) 73 (60%)
    Resistant n = 97 (%) 31 (16%) 163 (84%) 1 (1%) 29 (30%) 67 (69%)
    Plasminogen activator inhibitor 1 −675 4G/5G
    Allele* Genotype
    Frequency 5G 4G 5G5G 5G4G 4G4G
    Controls n = 186 (%) 158 (42%) 214 (58%) 31 (17%) 96 (52%) 59 (32%)
    OCOPD n = 122 (%) 11528 (47%) 129 (53%) 2927 (24%) 57 (47%) 36 (30%)
    Resistant n = 98 (%) 76 (39%) 120 (61%) 14 (14%) 48 (49%) 36 (37%)
    Nitric oxide synthase 3 Asp 298 Glu (T/G)
    Allele* Genotype
    Frequency T G TT TG GG
    Controls n = 183 (%) 108 (30%)  258 (70%)    13 (7%) 82 (45%) 88 (48%)
    OCOPD n = 120 (%) 71 (30%) 169 (70%)    10 (8%) 51 (43%) 59 (49%)
    Resistant n = 99 (%) 71 (36%) 127 (64%) 1529,30 (15%) 41 (41%) 43 (43%)
    a1-antitrypsin 3′ 1237 G/A (T/t)
    Allele* Genotype
    Frequency T t TT Tt tt
    Controls n = 178 (%) 345 (97%) 11 (3%)  167 (94%)  11 (6%)  0 (0%)
    COPD n = 61 (%) 109 (89%) 13 (11%)32 50 (82%)  9 (15%)31 2 (3%)31
    Resistant n = 35 (%)  67 (96%) 3 (4%) 32 (91%) 3 (9%) 0 (0%)
    Matrix metalloproteinase 1 −1607 1G/2G
    Allele* Genotype
    Frequency 1G 2G 1G1G 1G2G 2G2G
    Controls n = 174 (%) 214 (61%)  134 (39%) 68 (39%) 78 (45%) 28 (16%)
    COPD n = 93 (%) 90 (48%)  96 (52%)34 24 (26%) 42 (45%) 27 (29%)33
    Resistant n = 94 (%) 99 (53%)  89 (47%) 25 (27%) 49 (52%) 20(21%)
    *number of chromosomes (2n)
      • 1. Genotype. CC/CG vs GG for resistant vs OCOPD, Odds ratio (OR)=2.2, 95% confidence limits=1.1-4.8, χ2 (Yates corrected)=4.76, P=1.03, CC/CG=protective
      • 2. Allele. C vs G for resistant vs OCOPD, Odds ratio (OR)=2.1, 95% confidence limits 1.1-3.8, χ2 (Yates corrected)=5.65, p=0.02. C=protective
      • 3. Genotype. GG vs CG/CC for OCOPD vs resistant, Odds ratio (OR)=0.5, 95% confidence limits=0.2-0.9, χ2 (Yates corrected)=4.76, P=0.03. GG=susceptible
      • 4. Allele. G vs C for OCOPD vs resistant, Odds ratio (OR)=0.5, 95% confidence limits 0.3-0.9, χ2 (Yates corrected)=5.65, p=0.02. G=susceptible
      • 5. Genotype. GG vs AG/AA for OCOPD vs resistant, Odds ratio (OR)=2.3, 95% confidence limits=0.8-6.9, χ2 (Yates uncorrected)=2.88, p=0.09. GG genotype=susceptible
      • 6. Genotype. AA vs AC/CC for OCOPD vs resistant, Odds ratio (OR)=1.8, 95% confidence limits=1.0-3.1, χ2 (Yates corrected)=3.8, p=0.05. AA=susceptibility
      • 7. Genotype. AA vs AC/CC for OCOPD vs controls, Odds ratio (OR)=1.6, 95% confidence limits 1.0-2.6, χ2 (Yates uncorrected)=3.86, p=0.05. AA=susceptibility
      • 8. Genotype. CC vs CG/GG for OCOPD vs controls, Odds ratio (OR)=1.6, 95% confidence limits=1.0-2.6, χ2 (Yates uncorrected)=3.68, p=0.05. CC=susceptibility
      • 9. Genotype. CC vs CG/GG for OCOPD vs resistant, Odds ratio (OR)=1.8, 95% confidence limits 1.0-3.2, χ2 (Yates corrected)=4.10, p=0.04. CC=susceptibility
      • 10. Genotype. AA vs AT/TT for OCOPD vs resistant, Odds ratio (OR)=1.8, 95% confidence limits=0.9-3.6, χ2 (Yates uncorrected)=2.88, p=0.09. AA=protective
      • 11. Allele. A vs T for OCOPD vs resistant, Odds ratio (OR)=1.3, 95% confidence limits=0.9-2.0, χ2 (Yates uncorrected)=2.3, p=0.15. A=protective
      • 12. Genotype. AA vs AC/CC for resistant vs OCOPD, Odds ratio (OR)=3.2, 95% confidence limits=1.0-11.0, χ2 (Yates corrected)=3.89, p=0.05. AA genotype=protective
      • 13. Allele. A vs C for resistant vs OCOPD, Odds ratio (OR)=1.7, 95% confidence limits 1.1-2.6, χ2 (Yates corrected)=6.24, p=0.01. A allele=protective
      • 14. Genotype. CC vs AC/AA for OCOPD vs resistant, Odds ratio (OR)=1.8, 95% confidence limits=1.0-3.3, χ2 (Yates corrected)=4.29, p=0.04. CC genotype=susceptibility
      • 15. Genotype. TT/TG vs GG for resistant vs OCOPD, Odds ratio (OR)=1.9, 95% confidence limits=1.0-38, χ2 (Yates uncorrected)=4.08, p=0.04. TT/TG genotype=protective
      • 16. Allele. T vs G for resistant vs OCOPD, Odds ratio (OR)=1.3, 95% confidence limits 0.9-2.0, χ2 (Yates uncorrected)=2.36, p=0.12. A allele=protective
      • 17. Genotype. GG vs TT/TG for OCOPD vs resistant, Odds ratio (OR)=0.5, 95% confidence limits=0.3-1.0, χ2 (Yates uncorrected)=4.1, p=0.04. GG genotype=susceptible
      • 18. Genotype. RR vs Rr/rr for resistant vs OCOPD, Odds ratio (OR)=2.3, 95% confidence limits=0.9-5.8, χ2 (Yates uncorrected)=3.7, p=0.05, RR genotype=protective
      • 19. Genotype. AG/GG vs AA for resistant vs OCOPD, Odds ratio (OR)=10.8, 95% confidence limits=1.4-229, χ2 (Yates corrected)=5.99 p=0.01. AG/GG genotype=protective, AA susceptible
      • 20. Allele. G vs A for resistant vs OCOPD, Odds ratio (OR)=11.3, 95% confidence limits 1.5-237, χ2 (Yates corrected)=6.77, p=0.001. G allele=protective, A susceptible
      • 21. Genotype. MS vs MM for Resistant vs OCOPD, Odds ratio (OR)=2.7, 95% confidence limits 0.8-9.0, χ2 (Yates uncorrected)=3.4, p=0.07.
        • MS=protective
      • 22. Allele: S vs M allele for resistant vs OCOPD, Odds ratio (OR)=2.5, 95% confidence limits 0.8-8.4, χ2 (Yates uncorrected)=3.24, p=0.07.
      • 23. Genotype AG vs AA in resistant vs OCOPD, Odd's Ratio (OR)=5.61, 95% confidence limits 0.5-146, χ2 (Yates uncorrected)=2.66, p=0.10. AG=protective
      • 24. Genotype. CC vs CG/GG for resistant vs OOCOPD, Odds ratio (OR)=1.75, 95% confidence limits=1.0-3.2, χ2 (Yates uncorrected)=3.73, p=0.05. CC=protective
      • 25. Genotype: AA vs AG/GG for resistant vs OCOPD, Odd's Ratio (OR)=1.6, 95% confidence limits 0.8-32, χ2 (Yates uncorrected)=2.02, p=0.16. AA=protective
      • 26. Genotype. TT vs TC/CC for OCOPD vs resistant, Odds ratio (OR)=6.03, 95% confidence limits 1.1-42, χ2 (Yates corrected)=4.9, p=0.03. TT=susceptible
      • 27. Genotype. 5G5G vs rest for OCOPD vs resistant, Odds ratio (OR)=1.9, 95% confidence limits 0.9-4.0, χ2 (Yates uncorrected)=3.11, p=0.08. 5G5G=susceptible
      • 28. Allele. 50 vs 4G for OCOPD vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.9-2.1, χ2 (Yates corrected)=3.1, p=0.08. 5G=susceptible
      • 29. Genotype. TT vs TG/GG for resistant vs controls, Odds ratio (OR)=2.3, 95% confidence limits 1.0-5.5, χ2 (Yates corrected)=3.80, p=0.05. TT genotype=protective
      • 30. Genotype. TT vs TG/GG for resistant vs OCOPD, Odds ratio (OR)=1.9, 95% confidence limits 0.8-5.0, χ2 (Yates uncorrected)=2.49, p=0.11. TT genotype=protective
      • 31. Genotype: Tt/tt vs TT for COPD vs controls, Odd's Ratio (OR)=3.34, 95% confidence limits 1.3-8.9, χ2 (Yates corrected)=6.28, p=0.01. Tt/tt susceptible to OCOPD
      • 32. Allele: t vs T for COPD vs controls, Odd's Ratio (OR)=2.5, 95% confidence limits 1.0-6.3, χ2 (Yates corrected)=4.1, p=0.04. t=susceptible to OCOPD
      • 33. Genotype. 2G2G vs 1G1G/1G2G for COPD vs controls, Odds ratio (OR)=2.1, 95% confidence limits 1.1-4.1, χ2 (Yates corrected)=5.44, p=0.02. 2G2G genotype=susceptible for OCOPD
      • 34. Allele. 2G vs 1G for COPD vs controls, Odds ratio (OR)=1.7, 95% confidence limits 1.2-2.5, χ2 (Yates corrected)=7.97, p=0.005. 2G=susceptible for OCOPD
  • Table 7 below provides a summary of the protective and susceptibility polymorphisms determined for OCOPD.
  • TABLE 7
    Summary of protective and susceptibility polymorphisms for OCOPD
    Gene Polymorphism Role
    Cyclo-oxygenase (Cox) 2 Cox 2 −765 G/C CC/CG protective
    GG susceptible
    β2-adrenoreceptor (ADRB2) ADRB2 Gln 27Glu CC protective
    Interleukin-18 (IL-18) IL-18 −133 C/G CC susceptible
    Interleukin-18 (IL-18) IL-18 105 A/C AA susceptible
    Plasminogen activator PAI-1 −675 4G/5G 5G5G
    inhibitor 1 (PAI-1) susceptible
    Nitric Oxide synthase 3 (NOS3) NOS3 298 Asp/Glu TT protective
    Vitamin D Binding Protein VDBR Lys 420 Thr AA protective
    (VDBR) CC susceptible
    Vitamin D Binding Protein VDBP Glu 416 Asp TT/TG protective
    (VDBR) GG susceptible
    Glutathione S Transferase GSTP1 Ile105Val GG susceptible
    (GSTP1)
    Superoxide dismutase 3 (SOD3) SOD3 Arg 312 Gln AG/GG
    protective
    AA susceptible
    a1-antitrypsin (a1AT) a1AT 3′ 1237 G/A Tt/tt susceptible
    (T/t)
    a1-antitrypsin (a1AT) a1AT S allele MS protective
    Toll-like receptor 4 (TLR4) TLR4 Asp 299 Gly AG/GG
    A/G protective
    Interleukin-8 (IL-8) IL-8 −251 A/T AA protective
    Interleukin 11 (IL-11) IL-11 −518 G/A AA protective
    Microsomal epoxide MEH Exon 3 T/C RR protective
    hydrolase (MEH) (r/R)
    Interleukin 13 (IL-13) IL-13 −1055 C/T TT susceptible
    Matrix Metalloproteinase 1 MMP1 −1607 2G2G susceptible
    (MMP1) 1G/2G
  • The combined frequencies of the presence or absence of the selected protective genotypes COX2 −765 CC/CG, NOS3 298 TT, a 1AT MS/SS, SOD3 AG/GG, MEH Exon 3 RR, and VDBP 420 AA observed in the OCOPD subjects and in resistant smokers is presented below in Table 8.
  • TABLE 8
    Combined frequencies of the presence or absence of protective genotypes
    in OCOPD subjects and in resistant smokers.
    Number of protective polymorphisms
    Cohorts
    0 1 =2 Total
    OCOPD 34 (27%) 51 (41%) 39 (32%) 124
    Resistant 20 (19%) 31 (30%) 53 (51%) 104
    smokers
    % of 34/54 (63%)   51/82 (62%)   39/92 (42%)  
    smokers with
    OCOPD
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 · vs 2+, Resist vs OCOPD 16.2 0.003
    2+ vs 0-1, Resist vs OCOPD 2.3 1.3-4.0 8.15 0.004
    0 vs 2+, OCOPD vs Resist 2.3 1.1-4.9 4.97 0.03
  • The combined frequencies of the presence or absence of the selected susceptibility genotypes MMP1−1607 2G2G, GSTP1 105 GG, PAI-1-675 5G5G, IL-13 −1055 TT, and VDBP 416 GG, observed in the OCOPD subjects and in resistant smokers is presented below in Table 9.
  • TABLE 9
    Combined frequencies of the presence or absence of selected susceptibility
    genotypes in OCOPD subjects and in resistant smokers.
    Number of protective polymorphisms
    Cohorts
    0 1 =2 Total
    OCOPD 45 (36%) 55 (44%) 24 (20%) 124
    Resistant 55 (54%) 37 (37%) 9 (9%) 101
    smokers
    % of 45/100 (45%)    55/92 (60%)   24/33 (73%)  
    smokers with
    OCOPD
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 vs 2+, OCOPD vs Resist 9.1 0.01
    2+ vs 0-1, OCOPD vs Resist 2.5 1.0-6.0 4.05 0.04
    0+ vs 1-2+, Resist vs OCOPD 2.1 1.2-3.7 6.72 0.01
  • Protective polymorphisms were assigned a score of +1 while susceptibility polymorphisms were assigned a score of −1. For each subject, a net score was then calculated according to the presence of susceptibility and protective genotypes. This produced a linear spread of values, as shown in Table 10. When assessed as a range between −2 to +3, a linear relationship as depicted in FIG. 3 was observed. This analysis indicates that for subjects with a net score of −1 or less, there was an approximately 70% or greater risk of having OCOPD. In contrast, for subjects with a net score of 2+ or greater, the risk was approximately 25% (see FIG. 3). As a point of clarification, it is noted that FIG. 3 depicts the sum of the protective and susceptibility polymorphisms combined, rather than simply the sum of the protective polymorphisms in one graph and the sum of the susceptibility polymorphisms in another graph. Thus, the SNP score can be negative if there are only susceptibility polymorphisms, positive, if there are only protective polymorphisms, or either positive or negative, depending upon the relative numbers of protective to susceptibility polymorphisms.
  • TABLE 10
    Combined presence or absence of protective
    and susceptibility polymorphisms
    Score combining protective and
    susceptibility polymorphisms
    −2 −1 0 1 2 3
    OCOPD n = 124 8 28 33 39 11 5
    Resistant n = 101 2 11 23 27 23 15
    % OCOPD 80% 72% 59% 59% 32% 25%
  • II. Example 3 Case Association Study—Lung Cancer Methods Subject Recruitment
  • Subjects of European decent who had smoked a minimum of fifteen pack years and diagnosed with lung cancer were recruited. Subjects met the following criteria: diagnosed with lung cancer based on radiological and histological grounds, including primary lung cancers with histological types of small cell lung cancer, squamous cell lung cancer, adenocarinoma of the lung, non-small cell cancer (where histological markers can not distinguish the subtype) and broncho-alveolar carcinoma. Subjects can be of any age and at any stage of treatment after the diagnosis had been confirmed. One hundred and nine subjects were recruited, of these 58% were male, the mean FEV1/FVC (±95% confidence limits) was 51% (49-53), mean FEV1 as a percentage of predicted was 43 (41-45). Mean age, cigarettes per day and pack year history was 65 yrs (64-66), 24 cigarettes/day (22-25) and 50 pack years (41-55) respectively. Two hundred and seventeen European subjects who had smoked a minimum of twenty pack years and who had never suffered breathlessness and had not been diagnosed with an obstructive lung disease or lung cancer in the past were also studied. This control group was recruited through clubs for the elderly and consisted of 63% male, the mean FEV1/FVC (95% CI) was 82% (81-83), mean FEV1 as a percentage of predicted was 96 (95-97). Mean age, cigarettes per day and pack year history was 59 yrs (57-61), 24 cigarettes/day (22-26) and 42 pack years (39-45) respectively. Using a PCR based method [1], all subjects were genotyped for the α1-antitrypsin mutations (S and Z alleles) and those with the ZZ allele were excluded. 190 European blood donors (smoking status unknown) were recruited consecutively through local blood donor services. Sixty-three percent were men and their mean age was 50 years. On regression analysis, the age difference and pack years difference observed between lung cancer sufferers and resistant smokers was found not to determine FEV or lung cancer.
  • This study shows that polymorphisms found in greater frequency in lung cancer patients compared to resistant smokers can reflect an increased susceptibility to the development of lung cancer. Similarly, polymorphisms found in greater frequency in resistant smokers compared to lung cancer can reflect a protective role.
  • Summary of Characteristics.
  • Parameter Lung Cancer Resistant smokers
    Median (IQR) N = 109 N = 200 Differences
    % male 52% 64% ns
    Age (yrs) 68 (11) 60 (12) P < 0.05
    Pack years 40 (31) 43 (25) P < 0.05
    Cigarettes/day 18 (11) 24 (12) ns
    FEV1 (L) 1.7 (0.6) 2.8 (0.7) P < 0.05
    FEV1 % predict 67 (22) 96% (10)    P < 0.05
    FEV1/FVC 59 (14) 82 (8)  P < 0.05
  • Means and 95% confidence limits
  • Glutathione S-Transferase Null Polymorphisms Genotyping
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [7, herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for our own laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 200 mM dNTPs, 20 mM Tris-HCL (pH 8.4), 50 mM KCl, 2.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward, internal (GSTM4) and reverse prime sequences were 5′ CTGCCCTACTTGATTGATGG-3′ [SEQ.ID.NO.192], 5′ ATCTTCTCCTCTTCTGTCTC-3′ [SEQ.ID.NO.193] and 5′-TTCTGGATTGTAGCAGATCA-3′ [SEQ.ID.NO.194]. Cycling conditions consisted of 94 C 60 s, 59 C 30 s, 72 C 30 s for 35 cycles with an extended last extension of 3 min. Digested products were separated on 3% agarose gel. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
  • Cyclooxygenase 2 Polymorphisms Genotyping
  • Genomic DNA was extracted from whole blood samples (Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular Cloning Manual. 1989). The Cyclo-oxygenase 2 −765 polymorphism was determined by minor modifications of a previously published method (Papafili A, et al., 2002, incorporated in its entirety herein by reference)). The PCR reaction was carried out in a total volume of 25 ul and contained 20 ng genomic DNA, 500 pmol forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl2 and 1 unit of polymerase (Life Technologies). Cycling times were incubations for 3 min at 95° C. followed by 33 cycles of 50 s at 94° C., 60 s at 66° C. and 60 s at 72° C. A final elongation of 10 min at 72° C. then followed. 4 ul of PCR products were visualised by ultraviolet trans-illumination of a 3% agarose gel stained with ethidium bromide. An aliquot of 3 ul of amplification product was digested for 1 hr with 4 units of AciI (Roche Diagnostics, New Zealand) at 37° C. Digested products were separated on a 2.5% agarose gel run for 2.0 hours at 80 mV with TBE buffer. The products were visualised against a 123 bp ladder using ultraviolet transillumination after ethidium bromide staining.
  • Matrix Metalloproteinase 1 −1607 1G/2G Polymorphisms Genotyping
  • Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described (Dunleavey, L. et al. Rapid genotype analysis of the matrix metalloproteinase-1 gene 1G/2G polymorphism that is associated with risk of cancer. Matrix Biol. 19(2):175-7 (2000), herein incorporated by reference in its entirety). Genotyping was done using minor modifications of the above protocol optimised for our own laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 200 mM dNTPs, 20 mM Tris-HCL (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward and reverse prime sequences were 3′ TCGTGAGAATGTCTTCCCATT-3′ [SEQ.ID.NO.195] and 5′-TCTTGGATTGATTTGAGATAAGTGAAATC-3′[SEQ.ID.NO.196]. Cycling conditions consisted of 94 C 60 s, 55 C 30 s, 72 C 30 s for 35 cycles with an extended last extension of 3 min Aliquots of amplification product were digested for 4 hrs with 6 Units of the restriction enzymes XmnI (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 6% polyacrylamide gel. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
  • Polymorphism Genotyping Using the Sequenom Autoflex Mass Spectrometer
  • Genomic DNA was extracted from whole blood samples [2]. Purified genomic DNA was aliquoted (10 ng/ul concentration) into 96 well plates and genotyped on a Sequenom™ system (Sequenom™ Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser) using the following sequences, amplification conditions and methods. The following conditions were used for the PCR multiplex reaction: final concentrations were for 10× Buffer 15 mM MgCl2 1.25×, 25 mM MgCl2 1.625 mM, dNTP mix 25 mM 500 uM, primers 4 uM 100 nM, Taq polymerase (Quiagen hot start) 0.15 U/reaction, Genomic DNA 10 ng/ul. Cycling times were 95° C. for 15 min, (5° C. for 15 s, 56° C. 30 s, 72° C. 30 s for 45 cycles with a prolonged extension time of 3 min to finish. We used shrimp alkaline phosphotase (SAP) treatment (2 ul to 5 ul per PCR reaction) incubated at 35° C. for 30 min and extension reaction (add 2 ul to 7 ul after SAP treatment) with the following volumes per reaction of: water, 0.76 ul; hME 10× termination buffer, 0.2 ul; hME primer (10 uM), 1 ul; MassEXTEND enzyme, 0.04 ul.
  • Sequenom Conditions for the Polymorphisms Genotyping—1
  • TERM SNP_ID 2nd-PCRP 1st-PCRP
    ACT CYP2E1_1019G/CPst1 ACGTTGGATGAAACCAGAGGGAAGCAAAGG ACGTTGGATGTCATTGGTTGTGCTGCACCT
    [SEQ. ID. NO. 197] [SEQ. ID. NO. 198]
    ACT XPD-751 G/T ACGTTGGATGCACCAGGAACCGTTTATGGC ACGTTGGATGAGCAGCTAGAATCAGAGGAG
    [SEQ. ID. NO. 199] [SEQ. ID. NO. 200]
    ACT IL-18 105 A/C ACGTTGGATGGTCAATGAAGAGAACTTGGTC ACGTTGGATGAATGTTTATTGTAGAAAACC
    [SEQ. ID. NO. 201] [SEQ. ID. NO. 202]
    ACT IL-18-133 G/C ACGTTGGATGGGGTATTCATAAGCTGAAAC ACGTTGGATGCCTTCAAGTTCAGTGGTCAG
    [SEQ. ID. NO. 203] [SEQ. ID. NO. 204]
    ACT CYP 1A1 Ile462Val ACGTTGGATGGTGATTATCTTTGGCATGGG ACGTTGGATGGGATAGCCAGGAAGAGAAAG
    [SEQ. ID. NO. 205] [SEQ. ID. NO. 206]
    ACT MMP12 Asn 357 Ser A/G ACGTTGGATGCCCTATTTCTTTGTCTTCAC ACGTTGGATGCTTGGGATAATTTGGCTCTG
    [SEQ. ID. NO. 207] [SEQ. ID. NO. 208]
    ACT OGG1 Ser 326 Cys G/C ACGTTGGATGGGAACCCTTTCTGCGCTTTG ACGTTGGATGCCTACAGGTGCTGTTCAGTG
    [SEQ. ID. NO. 209] [SEQ. ID. NO. 210]
    ACT NAT2 Arg 197 Gln A/G ACGTTGGATGCCTGCCAAAGAAGAAACACC ACGTTGGATGACGTCTGCAGGTATGTATTC
    [SEQ. ID. NO. 211] [SEQ. ID. NO. 212]
    ACT CYP2E1_C/T Rsa1 ACGTTGGATGGTTCTTAATTCATAGGTTGC ACGTTGGATGCTTCATTTCTCATCATATTTTC
    [SEQ. ID. NO. 213] [SEQ. ID. NO. 214]
    ACG CCND1 A870G ACGTTGGATGTAGGTGTCTCCCCCTGTAAG ACGTTGGATGTCCTCTCCAGAGTGATCAAG
    [SEQ. ID. NO. 215] [SEQ. ID. NO. 216]
    ACG ILB1-511 A/G ACGTTGGATGATTTTCTCCTCAGAGGCTCC ACGTTGGATGTGTCTGTATTGAGGGTGTGG
    [SEQ. ID. NO. 217] [SEQ. ID. NO. 218]
    ACG FAS_A-670G ACGTTGGATGTTGTGGCTGCAACATGAGAG ACGTTGGATGCTATGGCGCAACATCTGTAC
    [SEQ. ID. NO. 219] [SEQ. ID. NO. 220]
    ACG NOS3-786 T/C ACGTTGGATGACTGTAGTTTCCCTAGTCCC ACGTTGGATGAGTCAGCAGAGAGACTAGGG
    [SEQ. ID. NO. 221] [SEQ. ID. NO. 222]
    ACT ACT_Ala15Thr ACGTTGGATGGAGTTGAGAATGGAGAGAATG ACGTTGGATGTCAAGTGGGCTGTTAGGGTG
    [SEQ. ID. NO. 223] [SEQ. ID. NO. 224]
    ACT SOD3 Arg 312 Gln ACGTTGGATGTGCTGCGTGGTGGGCGTGTG ACGTTGGATGGGCCTTGCACTCGCTCTCG
    [SEQ. ID. NO. 225] [SEQ. ID. NO. 226]
    ACT NOS3 Asp 298 Glu ACGTTGGATGAAACGGTCGCTTCGACGTGC ACGTTGGATGACCTCAAGGACCAGCTCGG
    [SEQ. ID. NO. 227] [SEQ. ID. NO. 228]
    CGT IL-8-251 A/T ACGTTGGATGACTGAAGCTCCACAATTTGG ACGTTGGATGGCCACTCTAGTACTATATCTG
    [SEQ. ID. NO. 229] [SEQ. ID. NO. 230]
    CGT IFN gamma 874 A/T ACGTTGGATGCAGACATTCACAATTGATTT ACGTTGGATGGATAGTTCCAAACATGTGCG
    [SEQ. ID. NO. 231] [SEQ. ID. NO. 232]
    ACT XRCC1 Arg 399 Gln G/A ACGTTGGATGTAAGGAGTGGGTGCTGGACT ACGTTGGATGAGGATAAGGAGCAGGGTTGG
    [SEQ. ID. NO. 233] [SEQ. ID. NO. 234]
  • Sequenom Conditions for the Polymorphisms Genotyping—2
  • SNP_ID AMP_LEN UP_CONF MP_CONF Tm(NN) PcGC PWARN UEP_DIR UEP_MASS
    CYP2E1_1019G/CPst 1 119 95.2 71.3 46.7 47.1 F 5256.4
    XPD -751 G/T 113 97.6 71.3 49.8 47.4 F 5689.7
    IL-18 105 A/C 120 65.6 71.3 49.8 36.4 R 6702.4
    IL-18 -133 G/C 112 93.5 81.3 47.1 42.1 F 5811.8
    CYP 1A1 Ile462Val 102 98.2 81.3 55.6 55 F 6222.1
    MMP12 Asn 357 Ser A/G 95 92.6 81.3 48 30.4 F 7070.6
    OGG1 Ser 326 Cys G/C 99 96.5 82.2 58.9 70.6 R 5227.4
    NAT2 Arg 197 Gln A/G 115 97.4 70 48.5 36.4 F 6635.3
    CYP2E1_C/T Rsa1 105 62.8 77.8 46.4 26.1 R 7018.6
    CCND1 A870G 106 98.1 83 45.8 47.1 R 5034.3
    ILB1 -511 A/G 111 99.2 83 46 47.1 R 5203.4
    FAS_A-670G 103 99.2 83 54.4 50 R 6166
    NOS3 -786 T/C 114 97.5 83 61.8 61.9 F 6358.1
    ACT_Ala15Thr 118 93.4 68.2 45.2 47.1 F 5136.4
    SOD3 Arg 312 Gln 119 63.2 68.2 55.5 57.9 F 5855.8
    NOS3 Asp 298 Glu 113 82.2 68.2 65.4 66.7 F 6432.2
    IL-8 -251 A/T 119 92.6 75.8 45.9 28.6 R 6428.2
    IFN gamma 874 A/T 112 75.3 75.8 46.4 26.1 F 6943.6
    XRCC1 Arg 399 Gln G/A 109 93.6 93.6 66.8 82.4 F 5099.3
  • Sequenom Conditions for the Polymorphisms Genotyping—3
  • EXT1 EXT1 EXT2
    SNP_ID UEP_SEQ CALL MASS EXT1_SEQ CALL
    CYP2E1_1019G/CPst1 TTCTTGGTTCAGGAGAG C 5529.6 TTCTTGGTTCAGGAGAGC G
    [SEQ. ID. NO. 235] [SEQ. ID. NO. 236]
    XPD-751 G/T GCAATCTGCTCTATCCTCT T 5977.9 GCAATCTGCTCTATCCTCTT G
    [SEQ. ID. NO. 237] [SEQ. ID. NO. 238]
    IL-18 105 A/C ATTCAAGCTTGCCAAAGTAATC A 6990.6 ATTCAAGCTTGCCAAAGTAAT C
    [SEQ. ID. NO. 239] CT [SEQ. ID. NO. 240]
    IL-18 -133 G/C CATAAGCTGAAACTTCTGG C 6085 CATAAGCTGAAACTTCTGGC G
    [SEQ. ID. NO. 241] [SEQ. ID. NO. 242]
    CYP 1A1 Ile462Val GGAAGTGTATCGGTGAGACC A 6519.3 GGAAGTGTATCGGTGAGACC G
    [SEQ. ID. NO. 243] A [SEQ. ID. NO. 244]
    MMP12 Asn 357 Ser TGACAAATACTGGTTAATTAGCA A 7367.8 TGACAAATACTGGTTAATTAG G
    A/G [SEQ. ID. NO. 245] CAA [SEQ. ID. NO. 246]
    OGG1 Ser 326 Cys GCTCCTGAGCATGGCGG G 5500.6 GCTCCTGAGCATGGCGGC C
    G/C [SEQ. ID. NO. 247] [SEQ. ID. NO. 248]
    NAT2 Arg 197 Gln TACTTATTTACGCTTGAACCTC A 6932.5 TACTTATTTACGCTTGAACCT G
    A/G [SEQ. ID. NO. 249] CA [SEQ. ID. NO. 250]
    CYP2E1_C/T Rsa1 CTTAATTCATAGGTTGCAATTTT T 7315.8 CTTAATTCATAGGTTGCAATT C
    [SEQ. ID. NO. 251] TTA [SEQ. ID. NO. 252]
    CCND1 A870G ACATCACCCTCACTTAC[SEQ. ID. G 5307.5 ACATCACCCTCACTTACC A
    NO. 253] [SEQ. ID. NO. 254]
    ILB1 -511 A/G AATTGACAGAGAGCTCC G 5476.6 AATTGACAGAGAGCTCCC A
    [SEQ. ID. NO. 255] [SEQ. ID. NO. 256]
    FAS_A-670G ATGAGAGGCTCACAGACGTT G 6439.2 ATGAGAGGCTCACAGACGTT A
    [SEQ. ID. NO. 257] C [SEQ. ID. NO. 258]
    NOS3-786 T/C GGCATCAAGCTCTTCCCTGGC C 6631.3 GGCATCAAGCTCTTCCCTGG T
    [SEQ. ID. NO. 259] CC [SEQ. ID. NO. 260]
    ACT_Ala15Thr GAATGTTACCTCTCCTG[SEQ. ID. A 5433.6 GAATGTTACCTCTCCTGA G
    NO. 261] [SEQ. ID. NO. 262]
    SOD3 Arg 312 Gln GCACTCAGAGCGCAAGAAG C 6129 GCACTCAGAGCGCAAGAAGC G
    [SEQ. ID. NO. 263] [SEQ. ID. NO. 264]
    NOS3 Asp 298 Glu GCTGCTGCAGGCCCCAGATGA T 6720.4 GCTGCTGCAGGCCCCAGATG G
    [SEQ. ID. NO. 265] AT [SEQ. ID. NO. 266]
    IL-8 -251 A/T CACAATTTGGTGAATTATCAA A 6716.4 CACAATTTGGTGAATTATCAA T
    [SEQ. ID. NO. 267] T [SEQ. ID. NO. 268]
    IFN gamma 874 A/T TTCTTACAACACAAAATCAAATC T 7231.8 TTCTTACAACACAAAATCAAA A
    [SEQ. ID. NO. 269] TCT [SEQ. ID. NO. 270]
    XRCC1 Arg 399 Gln TCGGCGGCTGCCCTCCC A 5396.5 TCGGCGGCTGCCCTCCCA G
    G/A [SEQ. ID. NO. 271] [SEQ. ID. NO. 272]
  • Sequenom Conditions for the Polymorphisms Genotyping—4
  • SNP_ID EXT2_MASS EXT2_SEQ 1stPAUSE
    CYP2E1_1019G/CPst1 5873.8 TTCTTGGTTCAGGAGAGGT[SEQ. ID. NO. 273] 5585.6
    XPD -751 G/T 6292.1 GCAATCTGCTCTATCCTCTGC[SEQ. ID. NO. 274] 6018.9
    IL-18 105 A/C 7658 ATTCAAGCTTGCCAAAGTAATCGGA[SEQ. ID. 7031.6
    NO. 275]
    IL-18 -133 G/C 6438.2 CATAAGCTGAAACTTCTGGGA[SEQ. ID. NO. 6141
    276]
    CYP 1A1 Ile462Val 6839.5 GGAAGTGTATCGGTGAGACCGT[SEQ. ID. NO. 6551.3
    277]
    MMP12 Asn 357 Ser A/G 7688 TGACAAATACTGGTTAATTAGCAGT[SEQ. ID. 7399.8
    NO. 278]
    OGG1 Ser 326 Cys G/C 5853.8 GCTCCTGAGCATGGCGGGA[SEQ. ID. NO. 279] 5556.6
    NAT2 Arg 197 Gln A/G 7261.8 TACTTATTTACGCTTGAACCTCGA[SEQ. ID. 6964.5
    NO. 280]
    CYP2E1_C/T Rsa1 7636 CTTAATTCATAGGTTGCAATTTTGT[SEQ. ID. 7347.8
    NO. 281]
    CCND1 A870G 5651.7 ACATCACCCTCACTTACTG[SEQ. ID. NO. 282] 5338.5
    ILB1 -511 A/G 5820.8 AATTGACAGAGAGCTCCTG[SEQ. ID. NO. 283] 5507.6
    FAS_A-670G 6743.4 ATGAGAGGCTCACAGACGTTTC[SEQ. ID. NO. 6470.2
    284]
    NOS3-786 T/C 6975.5 GGCATCAAGCTCTTCCCTGGCTG[SEQ. ID. 6662.3
    NO. 285]
    ACT_Ala15Thr 5738.7 GAATGTTACCTCTCCTGGC[SEQ. ID. NO. 286] 5465.6
    SOD3 Arg 312 Gln 7116.6 GCACTCAGAGCGCAAGAAGGGGC[SEQ. ID. 6185
    NO. 287]
    NOS3 Asp 298 Glu 7034.6 GCTGCTGCAGGCCCCAGATGAGC[SEQ. ID. 6761.4
    NO. 288]
    IL-8 -251 A/T 7029.6 CACAATTTGGTGAATTATCAAAT[SEQ. ID. NO. 6741.4
    289]
    IFN gamma 874 A/T 7530 TTCTTACAACACAAAATCAAATCAC[SEQ. ID. 7256.8
    NO. 290]
    XRCC1 Arg 399 Gln G/A 6054.9 TCGGCGGCTGCCCTCCCGGA[SEQ. ID. NO. 5428.5
    291]
  • Sequenom Conditions for the Polymorphisms Genotyping—5
  • TERM SNP_ID 2nd-PCRP 1st-PCRP
    ACT CTGF-447G/C ACGTTGGATGAGGTAGCTGAAGAG ACGTTGGATGGCCTATAGCCTCTAA
    GCAAAC [SEQ. ID. NO. 292] AACGC [SEQ. ID. NO. 293]
    ACT NBS1 Gln185Glu ACGTTGGATGCTTTCAATTTGTGGA ACGTTGGATGTGTGCACTCATTTGT
    G/C GGCTG [SEQ. ID. NO. 294] GGACG [SEQ. ID. NO. 295]
    ACT MBL2 161 G/A ACGTTGGATGGTAGCTCTCCAGGCA ACGTTGGATGGTACCTGGTTCCCCC
    TCAAC [SEQ. ID. NO. 296] TTTTC [SEQ. ID. NO. 297]
    ACT IGF2R Leu252Val ACGTTGGATGACACCAGGCGTTTGA ACGTTGGATGAAAAACGCCAACAGC
    C/G TGTTG [SEQ. ID. NO. 298] ATCGG [SEQ. ID. NO. 299]
    ACT MUC5AC -221 C/T ACGTTGGATGAGGCGGAGATGGGT ACGTTGGATGAGTCTAGGGTGGGG
    GTGTC [SEQ. ID. NO. 300] TATGTG [SEQ. ID. NO. 301]
    ACT Arg1 intron1 C/T ACGTTGGATGATGTGTGGATTCACA ACGTTGGATGGGGTTGGCAACTCTA
    GCTCG [SEQ. ID. NO. 302] AAAGG [SEQ. ID. NO. 303]
    ACT REV1 Phe257Ser ACGTTGGATGCTCTGAAATCAGTGC ACGTTGGATGATGGTCAACAGTGTT
    C/T TGCTC [SEQ. ID. NO. 304] GCCAG [SEQ. ID. NO. 305]
    ACT Apex1 Asp148Glu ACGTTGGATGCACCTCTTGATTGCT ACGTTGGATGACCCGGCCTTCCTGA
    G/T TTCCC [SEQ. ID. NO. 306] TCATG [SEQ. ID. NO. 307]
    ACG IL-10 -1082 A/G ACGTTGGATGATTCCATGGAGGCTG ACGTTGGATGGACAACACTACTAAG
    GATAG [SEQ. ID. NO. 308] GCTTC [SEQ. ID. NO. 309]
  • Sequenom Conditions for the Polymorphisms Genotyping—6
  • SNP_ID AMP_LEN UP_CONF MP_CONF Tm(NN) PcGC PWARN UEP_DIR UEP_MASS
    CTGF-447G/C 119 98.2 65 52 52.9 R 5090.3
    NBS1 Gln185Glu G/C 118 97 65 51 52.9 R 5192.4
    MBL2 161 G/A 99 96.8 65 50.3 52.9 F 5299.5
    IGF2R Leu252Val C/G 114 98.5 67.8 68.6 82.4 F 5206.4
    MUC5AC -221 C/T 119 81.8 67.8 56.9 64.7 g R 5273.4
    Arg1 intron1 C/T 102 99.6 67.8 53.3 52.6 R 5932.9
    REV1 Phe257Ser C/T 105 99.6 67.8 57.5 55 R 6003.9
    Apex1 Asp148Glu G/T 114 92.9 67.8 46.8 35 F 6113
    IL-10 -1082 A/G 107 98 68.8 51.2 58.8 R 4977.2
  • Sequenom Conditions for the Polymorphisms Genotyping—7
  • SNP_ID UEP_SEQ EXT1_CALL EXT1_MASS EXT1_SEQ
    CTGF-447G/C AAAAGGTTTCTCCCCCC G 5363.5 AAAAGGTTTCTCCCCCCC
    [SEQ. ID. NO. 310] [SEQ. ID. NO. 311]
    NBS1 Gln185Glu AGGCTGCTTCTTGGACT G 5465.6 AGGCTGCTTCTTGGACTC
    G/C [SEQ. ID. NO. 312] [SEQ. ID. NO. 313]
    MBL2 161 G/A CAAAGATGGGCGTGATG A 5596.7 CAAAGATGGGCGTGATGA
    [SEQ. ID. NO. 314] [SEQ. ID. NO. 315]
    IGF2R Leu252Val GCCAGCCCCGGGACGGA C 5479.6 GCCAGCCCCGGGACGGA
    C/G [SEQ. ID. NO. 316] C [SEQ. ID. NO. 317]
    MUC5AC -221 ATGGGTGTGTCTGCCGG T 5570.6 ATGGGTGTGTCTGCCGGA
    C/T [SEQ. ID. NO. 318] [SEQ. ID. NO. 319]
    Arg1 intron1 C/T GGCTGTAAGGAAATCTGGG T 6230.1 GGCTGTAAGGAAATCTGG
    [SEQ. ID. NO. 320] GA [SEQ. ID. NO. 321]
    REV1 Phe257Ser CCTTATCCTCCTCCTGGGAA T 6301.1 CCTTATCCTCCTCCTGGG
    C/T [SEQ. ID. NO. 322] AAA [SEQ. ID. NO. 323]
    Apex1 Asp148Glu TGTTTCATTTCTATAGGCGA T 6401.2 TGTTTCATTTCTATAGGCG
    G/T [SEQ. ID. NO. 324] AT [SEQ. ID. NO. 325]
    IL-10 -1082 A/G CCTATCCCTACTTCCCC G 5250.4 CCTATCCCTACTTCCCCC
    [SEQ. ID. NO. 326] [SEQ. ID. NO. 327]

    Sequenom conditions for the polymorphisms Genotyping—8
  • SNP_ID EXT2_CALL EXT2_MASS EXT2_SEQ 1stPAUSE
    CTGF-447G/C C 5716.7 AAAAGGTTTCTCCCCCCGA 5419.5
    [SEQ. ID. NO. 328]
    NBS1 Gln185Glu C 5818.8 AGGCTGCTTCTTGGACTGA 5521.6
    G/C [SEQ. ID. NO. 329]
    MBL2 161 G/A G 5901.9 CAAAGATGGGCGTGATGGC 5628.7
    [SEQ. ID. NO. 330]
    IGF2R Leu252Val G 5823.8 GCCAGCCCCGGGACGGAGT 5535.6
    C/G [SEQ. ID. NO. 331]
    MUC5AC -221 C/T C 5890.8 ATGGGTGTGTCTGCCGGGT 5602.6
    [SEQ. ID. NO. 332]
    Arg1 intron1 C/T C 6879.5 GGCTGTAAGGAAATCTGGGGGT 6262.1
    [SEQ. ID. NO. 333]
    REV1 Phe257Ser C 6630.3 CCTTATCCTCCTCCTGGGAAGA 6333.1
    C/T [SEQ. ID. NO. 334]
    Apex1 Asp148Glu G 7068.6 TGTTTCATTTCTATAGGCGAGGA 6442.2
    G/T [SEQ. ID. NO. 335]
    IL-10 -1082 A/G A 5858.8 CCTATCCCTACTTCCCCTTC 5281.4
    [SEQ. ID. NO. 336]
  • Results
  • Frequencies of individual polymorphisms are as follows:
  • TABLE 11
    Polymorphism allele and genotype frequencies in the Lung cancer
    patients, resistant smokers and controls.
    Nitric oxide synthase 3 Asp 298 Glu (T/G)
    Allele* Genotype
    Frequency T G TT TG GG
    Controls n = 183 (%) 108 (30%) 258 (70%) 13 (7%) 82 (45%) 88 (48%)
    Lung Cancer n = 107 (%) 71 (33%) 143 (67%) 9 (8%) 53 (50%) 45 (42%)
    Resistant n = 198 (%) 135 (34%) 261 (66%) 281.2 (14%) 79 (40%) 91 (46%)
    Nitric oxide synthase 3 −786 T/C
    Allele* Genotype
    Frequency C T CC CT TT
    Controls n = 183 (%)
    Lung Cancer n = 107 (%) 82 (38%) 132 (62%) 16 (15%) 50 (47%) 413 (38%)
    Resistant n = 198 (%) 166 (42%) 228 (58%) 31 (16%) 104 (53%) 62 (31%)
    Super oxide dismutase 3 Arg 312 Gln C/G
    Allele* Genotype
    Frequency C G CC CG GG
    Controls n = 190 (%) 371 (98%) 9 (2%) 183 (96%) 5 (3%) 2 (1%)
    Lung Cancer n = 104 (%) 208 (100%) 0 (0%) 104 (100%) 0 (0%) 0 (0%)
    Resistant n = 182 (%) 390 (98%) 10 (3%) 191 (95%) 84 (4%) 14 (1%)
    XRCC1 Arg 399 Gln A/G
    Allele* Genotype
    Frequency A G AA AG GG
    Controls n = 190 (%)
    Lung Cancer n = 103 (%) 68 (33%) 138 (67%) 4 (4%) 60 (58%) 39 (38%)
    Resistant n = 193 (%) 132 (34%) 254 (66%) 185 (9%) 96 (50%) 79 (41%)
    Interleukin 8 −251 A/T
    Allele* Genotype
    Frequency A T AA AT TT
    Controls n = 188 (%) 175 (47%) 201 (53%) 39 (21%) 97 (52%) 52 (28%)
    Lung Cancer n = 90 68 (38%) 112 (62%) 6 (7%) 56 (52%) 28 (31%)
    Resistant n = 199 (%) 1927 (48%) 206 (52%) 456 (23%) 102 (51%) 52 (26%)
    Anti-chymotrypsin Ala −15 Thr
    Allele* Genotype
    Frequency A G AA AG GG
    Lung Cancer n = 108 99 (46%) 1179 (54%) 24 (22%) 51 (47%) 338 (31%)
    Resistant n = 196 (%) 207 (53%) 185 (47%) 52 (27%) 103 (53%) 41 (21%)
    Cyclin D1 A 870 G
    Lung Cancer n = 107 109 (51%) 105 (49%) 2511 (23%) 59 (55%) 23 (21%)
    Resistant n = 199 (%) 188 (47%) 210 (53%) 45 (23%) 98 (49%) 5610 (28%)
    Interleukin 1B −511 A/G
    Lung Cancer n = 107 64 (30%) 150 (70%) 12 (11%) 40 (37%) 5512 (51%)
    Resistant n = 198 (%) 143 (36%) 253 (64%) 23 (12%) 97 (49%) 78 (39%)
    FAS (Apo-1/CD 95) A −670 G
    Lung Cancer n = 106 12114 (57%) 91 (43%) 3213 (30%) 57 (54%) 17 (16%)
    Resistant n = 198 (%) 202 (51%) 194 (49%) 45 (23%) 112 (57%) 41 (21%)
    XPD 751 T/G
    Allele* Genotype
    Frequency G T GG TG TT
    Lung Cancer n = 108 72 (33%) 144 (66%) 11 (10%) 50 (46%) 47 (44%)
    Resistant n = 197 (%) 147 (37%) 247 (63%) 3115 (16%) 85 (43%) 81 (41%)
    Cytochrome P450 1A1 Ile 462 Val G/A
    Allele* Genotype
    Frequency G A GG AG AA
    Lung Cancer n = 109 5 (2%) 213 (98%) 0 (0%) 5 (5%) 10416 (95%)
    Resistant n = 199 (%) 20 (5%) 378 (95%) 1316 (1%) 1816 (9%) 1802 (90%)
    MMP12 Asn 357 Ser
    Lung Cancer n = 109 8 (4%) 210 (96%) 1 (1%) 6 (5%) 102 (94%)
    Resistant n = 199 (%) 21 (5%) 377 (95%) 017 (0%) 2117 (11%) 178 (89%)
    8-oxoguanine DNA glycosylase Ser 326 Cys C/G
    Allele* Genotype
    Frequency G C GG CG CC
    Lung Cancer n = 109 40 (18%) 178 (82%) 2 (2%) 36 (33%) 71 (65%)
    Resistant n = 199 (%) 100 (25%) 298 (75%) 1418 (7%) 72 (36%) 113 (57%)
    N-Acetyltransferase 2 Arg 197 Gln G/A
    Allele* Genotype
    Frequency A G AA AG GG
    Lung Cancer n = 106 55 (26%) 157 (74%) 9 (8%) 37 (35%) 6019 (57%)
    Resistant n = 195 (%) 122 (31%) 268 (69%) 17 (9%) 88 (45%) 90 (46%)
    Cytochrome P450 2E1 1019 G/C Pst1
    Allele* Genotype
    Frequency C G CC CG GG
    Lung Cancer n = 109 10 (5%) 208 (95%) 0 (0%) 1020 (9%) 99 (91%)
    Resistant n = 197 (%) 11 (3%) 383 (97%) 0 (0%) 11 (6%) 186 (94%)
    Cytochrome P450 2E1 C/T Rsa I
    Allele* Genotype
    Frequency T C TT TC CC
    Lung Cancer n = 108 11 (5%) 205 (95%) 0 (0%) 1121 (10%) 97 (90%)
    Resistant n = 198 (%) 11 (3%) 385 (97%) 0 (0%) 11 (6%) 187 (94%)
    Interleukin 18 105 A/C
    Allele* Genotype
    Frequency C A CC AC AA
    Lung Cancer n = 107 50 (23%) 164 (77%) 8 (8%) 34 (33%) 6522 (61%)
    Resistant n = 200 (%) 116 (29%) 284 (71%) 1722 (9%) 8222 (41%) 101 (50%)
    Interleukin 18 −133 C/G
    Allele* Genotype
    Frequency G C GG CG CC
    Lung Cancer n = 109 52 (24%) 166 (76%) 8 (7%) 36 (33%) 6523 (60%)
    Resistant n = 198 (%) 117 (30%) 279 (70%) 1723 (9%) 8323 (42%) 98 (49%)
    Glutathione S-Transferase M null
    Allele*
    Frequency Null Wild
    Controls n = 178 75 (42%) 103 (58%)
    Lung Cancer n = 107 6724 (58%) 48 (42%)
    Resistant n = 182 100 (55%) 82 (45%)
    Interferon-gamma 874 A/T
    Allele* Genotype
    Frequency A T AA AT TT
    Controls n = 186 (%) 183 (49%) 189 (51%) 37 (20%) 109 (58%) 40 (22%)
    Lung cancer n = 106 (%) 116 (55%) 96 (45%) 3425,26 (32%) 48 (45%) 24 (23%)
    Resistant n = 196 (%) 209 (53%) 183 (47%) 50 (26%) 109 (56%) 37 (19%)
    Cyclooxygenase −765 C/G
    Allele* Genotype
    Frequency C G CC CG GG
    Controls n = 95 (%) 27 (14%) 161 (86%) 3 (3%) 21 (22%) 70 (75%)
    Lung Cancer n = 109 (%) 34 (16%) 184 (84%)30 5 (5%27) 24 (22%)27 80 (73%)29
    Resistant n = 158 (%) 75 (24%)28 241 (76%) 11 (7%) 53 (34%) 94 (59%)
    Matrix metalloproteinase 1 −1607 1G/2G
    Allele* Genotype
    Frequency 1G 2G 1G1G 1G2G 2G2G
    Controls n = 174 214 (61%) 134 (39%) 68 (39%) 78 (45%) 28 (16%)
    (%)
    Lung Cancer n = 67 58 (43%) 76 (57%)32 13 (19%) 32 (48%) 22 (33%)31
    (%)
    Resistant n = 171 167 (49%) 175 (51%) 41 (24%) 85 (50%) 45 (26%)
    (%)
    *number of chromosomes (2n)
      • 1. Genotype. TT vs TG/GG for resistant vs lung cancer, Odds ratio (OR)=1.8, 95% confidence limits 0.8-4.3, χ2 (Yates uncorrected)=2.14, p=0.14, TT genotype=protective
      • 2. Genotype. TT vs TG/GG for resistant vs controls, Odds ratio (OR)=2.2, 95% confidence limits 1.0-4.6, χ2 (Yates corrected)=4.2, p=0.04, TT genotype=protective
      • 3. Genotype. TT vs CC/CT for Lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.8-2.3, χ2 (Yates uncorrected)=1.45, p=0.23, TT genotype=susceptible
      • 4. Genotype CG/GG vs CC for resistant vs lung cancer, Yates uncorrected=3.38, P=0.07 and Fisher's Two tailed test, P=0.03. CG/GG=protective
      • 5. Genotype. AA vs AG/GG for resistant vs lung cancer, Odds ratio (OR)=2.6, 95% confidence limits 0.8-9.2, χ2 (Yates uncorrected)=2.89, p=0.09. AA genotype=protective
      • 6. Genotype. AA vs AT/TT for resistant vs lung cancer, Odds ratio (OR)=4.1, 95% confidence limits=1.6=11.2, χ2 (Yates corrected)=9.8, p=0.002, AA=protective
      • 7. Allele. A vs T for resistant smokers vs lung cancer, Odds ratio (OR)=1.5, 95% confidence limits 1.0-2.2, χ2 (Yates corrected)=5.07, p=0.02, A=protective
      • 8. Genotype. GG vs AA/AG for Lung cancer vs resistant, Odds ratio (OR)=1.7, 95% confidence limits=0.9-2.9, χ2 (Yates uncorrected)=3.51, p=0.06, GG=susceptible
      • 9. Allele. G vs A for lung cancer vs resistant smokers, Odds ratio (OR)=1.3, 95% confidence limits 0.9-1.9, χ2 (Yates uncorrected)=2.71, p=0.10,
        • G=susceptible
      • 10. Genotype. GG vs AG/AA for Resistant vs lung cancer, Odds ratio (OR)=1.4, 95% confidence limits=0.8-2.6, χ2 (Yates uncorrected)=1.6, p=0.20, GG=protective
      • 11. Genotype. AG/AA vs GG for Lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits=0.8-2.6, χ2 (Yates uncorrected)=1.6, p=0.20, AA=susceptible
      • 12. Genotype. GG vs AA/AG for Lung cancer vs resistant, Odds ratio (OR)=1.6, 95% confidence limits=1-2.7, χ2 (Yates uncorrected)=4.07, p=0.04, GG=susceptible
      • 13. Genotype. AA vs AG/GG for Lung cancer vs resistant, Odds ratio (OR)=1.5, 95% confidence limits=0.8-2.6, χ2 (Yates uncorrected)=2.03, p=0.15, AA=susceptible
      • 14. Allele. A vs G for Lung cancer vs resistant, Odds ratio (OR)=1.3, 95% confidence limits 0.9-1.8, χ2 (Yates uncorrected)=2.04, p=0.15, A=susceptible
      • 15. Genotype. GG vs TG/TT for Resistant vs lung cancer, Odds ratio (OR)=1.7, 95% confidence limits=0.8-3.7, χ2 (Yates uncorrected)=1.81, p=0.18, GG=protective
      • 16. Genotype. AG/GG vs AA for Resistant vs lung cancer, Odds ratio (OR)=2.2, 95% confidence limits=0.7-6.9, χ2 (Yates uncorrected)=2.41, p=0.12, GG/AG=protective, AA=susceptible
      • 17. Genotype. GG/AG vs AA for Resistant vs COPD, Odds ratio (OR)=1.7, 95% confidence limits=0.7-4.6, χ2 (Yates uncorrected)=1.45, p=0.23, GG/AG=protective
      • 18. Genotype. GG vs CG/CC for Resistant vs lung cancer, Odds ratio (OR)=4.0, 95% confidence limits=0.9-26.3, χ2 (Yates uncorrected)=3.87, p=0.05, GG=protective
      • 19. Genotype. GG vs AG/AA for Lung cancer vs resistant, Odds ratio (OR)=1.5, 95% confidence limits=0.9-2.5, χ2 (Yates uncorrected)=3.0, p=0.08, GG=susceptible
      • 20. Genotype. CG vs GG for Lung cancer and resistant, Odds ratio (OR)=1.7, 95% confidence limits=0.7-4.5, χ2 (Yates uncorrected)=1.42, p=0.23, CG=susceptible
      • 21. Genotype. TC vs CC for Lung cancer and resistant, Odds ratio (OR)=1.9, 95% confidence limits=0.8-5.0, χ2 (Yates uncorrected)=2.24, p=0.13, TC=susceptible
      • 22. Genotype. AA vs AC/CC for Lung cancer and resistant, Odds ratio (OR)=1.6, 95% confidence limits=1.0-2.6, χ2 (Yates uncorrected)=3.51, p=0.06, AA=susceptible, AC/CC protective
      • 23. Genotype. CC vs CG/GG for Lung cancer and resistant, Odds ratio (OR)=1.5, 95% confidence limits=0.9-2.5, χ2 (Yates uncorrected)=2.90, p=0.09, CC=susceptible, CG/GG protective
      • 24. Genotype. Null vs wild for Lung cancer and controls, Odds ratio (OR)=1.92, 95% confidence limits=1.2-3.2, χ2 (Yates corrected)=6.64, p=0.01, Null=susceptible
      • 25. Genotype. AA vs AT/TT for lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.8-2.4, χ2 (Yates uncorrected)=1.48, p=0.22, AA genotype=susceptible
      • 26. Genotype. AA vs AT/TT for lung cancer vs controls, Odds ratio (OR)=1.9, 95% confidence limits 1.1-3.4, χ2 (Yates corrected)=5.45, p=0.02, AA genotype=susceptible to lung cancer
      • 27. Genotype. CC/CG vs GG for Lung cancer vs resistant, Odds ratio (OR)=0.53, 95% confidence limits=0.3-0.9, χ2 (Yates corrected)=4.9, P=0.03 CC/CG=protective
      • 28. Allele. C vs G for Lung cancer vs resistant, Odds ratio (OR)=0.59, 95% confidence limits 0.4-0.9, χ2 (Yates corrected)=4.8, p=0.03, C=protective
      • 29. Genotype. GG vs CG/CC for Lung cancer vs resistant, Odds ratio (OR)=1.88, 95% confidence limits=1.1-3.3, χ2 (Yates corrected)=4.9, P=0.03 GG=susceptible (when compared against resistant smokers but not controls)
      • 30. Allele. G vs C for Lung cancer vs resistant, Odds ratio (OR)=1.7, 95% confidence limits 1.1-2.7, χ2 (Yates corrected)=4.8, p=0.03, G=susceptible (when compared against resistant smokers but not controls)
      • 31. Genotype. 2G2G vs 1G1G/1G2G for Lung cancer vs controls, Odds ratio (OR)=2.55, 95% confidence limits 1.3-5.1, χ2 (Yates corrected)=7.3, p=0.007 2G2G genotype=susceptible
      • 32. Allele. 2G vs 1G for Lung cancer vs controls, Odds ratio (OR)=2.1, 95% confidence limits 1.4-3.2, χ2 (Yates corrected)=12.3, p=0.0004, 2G=susceptible
    Connective Tissue Growth Factor (CTGF) −447 G/C Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • 37. Allele* 38. Genotype
    Frequency G C GG GC CC
    Lung cancer n = 109 201 17  92 17 0
    (%) (92%) (8%) (84%) (16%) (0%)
    Resistant n = 200 379 21 179 21 0
    (%) (95%) (5%) (90%) (10%) (0%)
    *number of chromosomes (2n)
      • 1. Genotype. GC/CC vs GG for lung cancer vs resistant, Odds ratio (OR)=1.6, 95% confidence limits 0.8-3.3, χ2 (Yates uncorrected)=1.70, p=0.19, GC/CC genotype=susceptibility (trend)
    Mucin 5AC (Muc5AC)-221 C/T Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • 39. Allele* 40. Genotype
    Frequency C T CC CT TT
    Lung cancer n = 109 177 41  73 31  5
    (%) (81%) (19%) (67%) (28%) (5%)
    Resistant n = 195 296 94 119 58 18
    (%) (76%) (24%) (61%) (30%) (9%)
    *number of chromosomes (2n)
      • 1. Genotype. TT vs CC/CT for lung cancer vs resistant, Odds ratio (OR)=0.47, 95% confidence limits 0.2-1.4, χ2 (Yates uncorrected)=2.16, p=0.14, TT genotype=protective (trend)
    Mannose Binding Lectin (MBL2) 161 G/A Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • 41. Allele* 42. Genotype
    Frequency G A GG AG AA
    Lung cancer n = 105 173 37  71 31 3
    (%) (82%) (18%) (67%) (30%) (3%)
    Resistant n = 197 338 56 147 44 6
    (%) (86%) (14%) (75%) (22%) (3%)
    *number of chromosomes (2n)
      • 1. Genotype. AG/AA vs GG for lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.8-2.4, χ2 (Yates uncorrected)=1.67, p=0.20, AG/AA genotype=susceptibility (trend)
    Nibrin (NBS1) Gln185Glu G/C Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • 43. Allele* 44. Genotype
    Frequency G C GG GC CC
    Lung cancer n = 109 150  68  54 42 13
    (%) (69%) (31%) (50%) (39%) (12%)
    Resistant n = 199 295 103 107 81 11
    (%) (74%) (26%) (54%) (41%)  (6%)
    *number of chromosomes (2n)
      • 1. Genotype. CC vs CG/GG for lung cancer vs resistant, Odds ratio (OR)=2.3, 95% confidence limits 0.9-5.8, χ2 (Yates uncorrected)=4.01, p=0.05, CC genotype=susceptibility
    Arginase 1 (Arg1) Intron 1 C/T Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • 45. Allele* 46. Genotype
    Frequency C T CC CT TT
    Lung cancer n = 105 137  73 45 47 13
    (%) (65%) (35%) (43%) (45%) (12%)
    Resistant n = 180 203 157 65 73 42
    (%) (56%) (44%) (36%) (41%) (23%)
    *number of chromosomes (2n)
      • 1. Genotype. TT vs CC/CT for lung cancer vs resistant, Odds ratio (OR)=0.46, 95% confidence limits 0.2-0.95, χ2 (Yates uncorrected)=5.11, p=0.02, TT genotype=protective
      • 2. Allele. T vs C for lung cancer vs resistant, Odds ratio (OR)=0.69, 95% confidence limits 0.5-1.0, χ2 (Yates corrected)=3.96, p=0.05, T allele=protective
    REV1 Phe257Ser C/T Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • 47. Allele* 48. Genotype
    Frequency C T CC CT TT
    Lung cancer n = 109 129 89 39 51 19
    (%) (59%) (41%) (36%) (47%) (17%)
    Resistant n = 192 242 142 83 76 33
    (%) (63%) (37%) (43%) (40%) (17%)
    *number of chromosomes (2n)
      • 1. Genotype. CC vs CT/TT for lung cancer vs resistant, Odds ratio (OR)=0.73, 95% confidence limits 0.4-1.2, χ2 (Yates uncorrected)=1.6, p=0.20, CC genotype=protective (trend)
    Insulin-Like Growth Factor II Receptor (IGF2R) Leu252Val C/G Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • 49. Allele* 50. Genotype
    Frequency C G CC CG GG
    Lung cancer n = 109 190 28  82 26 1
    (%) (87%) (13%) (75%) (24%) (1%)
    Resistant n = 198 342 54 150 42 6
    (%) (86%) (14%) (76%) (21%) (3%)
    *number of chromosomes (2n)
      • 1. Genotype. GG vs CC/CG for lung cancer vs resistant, Odds ratio (OR)=0.30, 95% confidence limits 0.01-2.5, χ2 (Yates uncorrected)=1.41, p=0.22 (1-tailed t-test), GG genotype=protective (trend)
    Apex Nuclease (APE1) Asp148Glu T/G Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
  • 51. Allele* 52. Genotype
    Frequency T G TT TG GG
    Lung cancer n = 109 124  94 39 46 24
    (%) (57%) (43%) (36%) (42%) (22%)
    Resistant n = 192 229 155 69 91 32
    (%) (60%) (40%) (36%) (47%) (17%)
    *number of chromosomes (2n)
      • 1. Genotype. GG vs TT/TG for lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.8-2.7, χ2 (Yates uncorrected)=1.3, p=0.25, GG genotype=susceptibility (trend)
        Interleukin 10 (IL-10)-1082 A/G polymorphism allele and genotype frequencies in the lung cancer and resistant smokers.
  • 53. Allele* 54. Genotype
    Frequency G C GG GC CC
    Lung cancer n = 98 91 105 16 59 23
    (%) (46%) (54%) (16%) (60%) (24%)
    Resistant n = 196 174 218 40 94 62
    (%) (44%) (56%) (20%) (48%) (32%)
    *number of chromosomes (2n)
      • 1. Genotype. GG vs GC/CC for lung cancer vs resistant, Odds ratio (OR)=0.66, 95% confidence limits 0.4-1.2, χ2 (Yates uncorrected)=2.12, p=0.15, GG genotype=protective (trend)
  • Table 12 below provides a summary of the protective and susceptibility polymorphisms determined for lung cancer.
  • TABLE 12
    Summary of protective and susceptibility polymorphisms in Lung Cancer
    patients relative to resistant smokers (with normal lung function)
    Gene Polymorphism Role
    Nitric Oxide synthase 3 (NOS3) NOS3 Asp 298 Glu TT protective
    Nitric Oxide synthase 3 (NOS3) NOS3 −786 T/C TT susceptible
    Superoxide dismutase 3 (SOD3) SOD3 Arg 312 Gln CG/GG protective
    XRCC1 XRCC1 Arg 399 Gln G/A AA protective
    Interleukin-8 (IL-8) IL-8 −251 A/T AA protective
    Anti-chymotrypsin (ACT) ACT Ala 15 Thr GG susceptible
    Cyclin D (CCND1) CCND1 A870G GG protective
    AA susceptible
    Interleukin 1B (IL-1B) IL-1B −511 A/G GG susceptible
    FAS (Apo-1/CD95) FAS A-670G AA susceptible
    XPD XPD −751 G/T GG protective
    CYP 1A1 CYP 1A1 Ile 462 Val GG/AG protective
    A/G AA susceptible
    Matrix metalloproteinase 12 MMP12 Asn 357 Ser GG/AG protective
    (MMP12) A/G
    8-Oxoguanine DNA glycolase OGG1 Ser 326 Cys G/C GG protective
    (OGG1)
    N-acetyltransferase 2 (NAT2) NAT2 Arg 197 Gln A/G GG susceptible
    CYP2E1 CYP2E1 1019 G/C Pst I CC/CG
    susceptible
    CYP2E1 CYP2E1 C/T Rsa I TT/TC
    susceptible
    Interleukin-18 (IL-18) IL-18 105 A/C AC/CC protective
    AA susceptible
    Interleukin-18 (IL-18) IL-18 −133 G/C CG/GG protective
    CC susceptible
    Glutathione S-transferase M GSTM null Null susceptible
    Interferon gamma (IFN?) IFN? 874 A/T AA susceptible
    Cyclo-oxygenase 2 (COX2) COX2 −765 G/C CC/CG protective
    GG susceptible
    Matrix metalloproteinase 1 (MMP1) MMP −1607 1G/2G 2G2G susceptible
    Connective tissue growth factor CTGF −447 G/C GC/CC
    (CTGF) susceptible
    Mucin 5AC (MUC5AC) MUC5AC −221 C/T TT protective
    Mannose binding lectin 2 (MBL2) MBL2 +161 G/A AG/AA
    susceptible
    Nibrin (NBS1) NBS1 Gln185Glu G/C CC susceptible
    Arginase 1 (Arg1) Arg1 intron 1 C/T TT protective
    REV1 REV1 Phe257Ser C/T CC protective
    Insulin-like growth factor II receptor IGF2R Leu252Val C/G GG protective
    (IGF2R)
    Apex nuclease (Apex or APE1)) Apex Asp148Glu G/T GG susceptible
    Interleukin 10 (IL-10) IL-10 −1082 A/G GG protective
  • The combined frequencies of the presence or absence of the selected protective genotypes CYP1A1 GG/AG, OGG1 GG, CCND1 GG, NOS3 298 TT, IL-8 AA, and XRCC1 AA observed in the subjects with lung cancer and in resistant smokers is presented below in Table 13.
  • TABLE 13
    Combined frequencies of the presence or absence of selected protective
    genotypes in subjects with lung cancer and in resistant smokers.
    Number of protective
    polymorphisms
    Cohorts
    0 1 =2 Total
    Lung Cancer 66 (61%) 37 (34%) 6 (6%) 109
    Resistant smokers 71 (36%) 86 (43%) 42 (21%) 199
    % of smokers with Lung 66/137 37/123 6/42
    cancer (48%) (30%) (14%)
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 vs 2+, Resist vs Lung 22.3 <0.0001
    cancer
    2+ vs 0-1, Resist vs Lung cancer 4.6 1.8-12.5 11.87 0.0005
    0 vs 2+, Lung cancer vs Resist 2.8 1.7-4.6  16.7 <0.0001
  • The combined frequencies of the presence or absence of the selected susceptibility genotypes CYP2E1 1019 CC/CG, FAS AA, IL-1B GG, and ACT 15 GG, observed in the subjects with lung cancer and in resistant smokers is presented below in Table 14.
  • TABLE 14
    Combined frequencies of the presence or absence of selected susceptibility
    genotypes in subjects with lung cancer and in resistant smokers.
    Number of susceptibility
    polymorphisms
    Cohorts
    0 1 =2 Total
    Lung Cancer 21 (19%) 52 (48%) 35 (33%) 108
    Resistant smokers 71 (36%) 85 (43%) 42 (21%) 198
    % of smokers with 21/92 52/137 35/77
    COPD (23%) (38%) (45%)
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 vs 2+, 10.2 0.006
    Lung cancer vs Resist
    2+ vs 0-1, Lung cancer vs Resist 1.8 1.0-3.1 4.1 0.04
    0+ vs 1-2+, Resist vs COPD 2.3 1.3-4.2 8.2 0.004
  • The combined frequencies of the presence or absence of the selected protective genotypes CYP1A1 GG/AG, OGG1 GG, CCND1 GG, NOS3 298 TT, SOD3 CG/GG, XPD GG, MMP12 GG/AG, and XRCC1 AA observed in the subjects with lung cancer and in resistant smokers is presented below in Table 15.
  • TABLE 15
    Combined frequencies of the presence or absence of selected protective
    genotypes in subjects with lung cancer and in resistant smokers.
    Number of protective
    polymorphisms n = 8
    Cohorts 0 1 =2 Total
    Lung Cancer 54 (50%) 50 (46%) 5 (4%) 109
    Resistant smokers 67 (34%) 83 (42%) 50 (25%) 199
    % of smokers with Lung 54/121 50/133 5/55
    cancer (45%) (38%) (9%)
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 vs 2+, Resist vs Lung 21.5 <0.0001
    cancer
    2+ vs 0-1, Resist vs Lung cancer 6.9 2.5-20.5 18.7 <0.0001
    0 vs 2+, Lung cancer vs Resist 2.0 1.2-3.2  6.96 0.008
  • The combined frequencies of the presence or absence of the selected susceptibility genotypes CYP2E1 1019 CC/CG, FAS AA, IL-1B GG, ACT 15 GG, NAT2 GG, IL-18 105 AA, and IFN? AA, observed in the subjects with lung cancer and in resistant smokers is presented below in Table 16.
  • TABLE 16
    Combined frequencies of the presence or absence of selected susceptibility
    genotypes in subjects with lung cancer and in resistant smokers.
    Number of susceptibility
    polymorphisms n = 7
    Cohorts 1 2 =3 Total
    Lung Cancer 16 (15%) 35 (32%) 58 (53%) 109
    Resistant smokers 65 (33%) 66 (33%) 69 (34%) 200
    % of smokers with 16/81 35/101 58/127
    COPD (20%) (35%) (46%)
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 vs 2+, Lung cancer 14.6 0.0007
    vs Resist
    3+ vs 1-2, Lung cancer vs Resist 2.2 1.3-5.6 9.4 0.002
    1 vs 2-3+, Resist vs COPD 2.8 1.5-5.4 10.7 0.001
  • The combined frequencies of the presence or absence of the selected protective genotypes CYP1A1 GG/AG, OGG1 GG, CCND1 GG, NOS3 298 TT, IL-8 AA, XRCC1 AA, and Cox 2 −765 CC/CG, observed in the subjects with lung cancer and in resistant smokers is presented below in Table 17.
  • TABLE 17
    Combined frequencies of the presence or absence of protective genotypes
    in the exposed smoking subjects (Lung cancer subjects and resistant
    smokers).
    Number of protective
    genotypes
    Cohorts
    0 1 =2 Total
    Lung Cancer 45 (40%) 50 (43%) 19 (17%) 114
    Resistant smokers 47 (23%) 79 (40%) 74 (37%) 200
    % of smokers with Lung 45/92 50/129 19/93
    cancer (49%) (39%) (20%)
    Comparison Odd's ratio 95% CI ?2 P value
    0 vs 1 vs 2+, Resist vs Lung 16.8 0.0002
    cancer
    2+ vs 0-1, Resist vs Lung cancer 2.94 1.6-5.4 13.44 0.0002
    0 vs 2+, Lung cancer vs Resist 2.12 1.3-3.6 8.2 0.004
  • The combined frequencies of the presence or absence of the selected susceptibility genotypes CYP2E1 1019 CC/CG, FAS AA, IL-B1 GG, ACT 15 GG, and MMP1 2G2G, observed in the subjects with lung cancer and in resistant smokers is presented below in Table 18.
  • TABLE 18
    Combined frequencies of the presence or absence of susceptibility
    genotypes in the exposed smoking subjects (Lung cancer subjects and
    resistant smokers).
    Number of susceptibility
    genotypes
    Cohorts 0-1 2-3 4-6 Total
    Lung Cancer 13 (12%) 66 (61%) 30 (28%) 109
    Resistant smokers 54 (27%) 113 (56%) 33 (17%) 200
    % of smokers with 13/67 66/179 30/63
    COPD (19%) (37%) (48%)
    Comparison Odd's ratio 95% CI ?2 P value
    0-1 vs 2-3 vs 4-6, 11.8 0.003
    Lung cancer vs Resist
    4-6 vs rest, Lung cancer vs 1.9 1.0-3.5 4.6 0.03
    Resist
    0-1 vs rest, Resist vs COPD 2.7 1.4-5.6 8.6 0.003
  • Protective polymorphisms were assigned a score of −1 while susceptibility polymorphisms were assigned a score of +1. For each subject, a net score was then calculated according to the presence of susceptibility and protective genotypes. This produced a linear spread of values, as shown in Table 14. When assessed as a range between −2 to +4, a linear relationship as depicted in FIG. 4 was observed. This analysis indicates that for subjects with a net score of −2 or less, there was a minimal risk of having lung cancer. For subjects with a net score of −1, there was an approximately one in ten risk of having lung cancer. In contrast, for subjects with a net score of 4+ or greater, the risk was markedly increased to over 70% (see Table 19 and FIG. 4). It is noted that for FIG. 4, unlike the data presented in FIG. 3, the protective polymorphisms are assigned a negative value while the susceptibility polymorphisms are assigned a positive value. The precise value or sign given to each one is not critical, as long as it is consistent between the types of polymorphisms.
  • TABLE 19
    Combined presence or absence of protective and susceptibility polymorphisms
    Score combining protective (−1) and susceptibility (+1) polymorphisms
    −2 −1 0 1 2 3 4+
    Lung cancer 0 (0%) 2 (2%) 10 (9%)  21 (19%) 38 (35%) 23 (21%) 15 (14%)
    N = 109 (%)
    Resistant smokers 6 (3%) 21 (11%) 39 (20%) 51 (26%) 52 (26%) 25 (13%) 6 (3%)
    N = 200 (%)
    % Lung cancer 0% 9% 20% 29% 42% 48% 71%
  • A further combined analysis was performed using a greater number of polymorphisms. Again, this produced a linear spread of values (Table 20). When assessed as a range between −3 to +5, a linear relationship as depicted in FIG. 5 was observed. This analysis indicates that for subjects with a net score of −2 or less, there was a minimal risk of having lung cancer. In contrast, for subjects with a net score of 5+ or greater, the risk was markedly increased to 80% (see Table 20 and FIG. 5).
  • TABLE 20
    Combined presence or absence of protective and susceptibility polymorphisms
    SNP score for Lung cancer according to the presence of
    protective(−1) and susceptibility (+1) genotypes for all smokers
    Cohorts <−3 −2 −1 0 1 2 3 4 5+
    Lung cancer 0 (0%)  1 (1%)  3 (3%) 10 (9%)  25 (23%) 32 (29%) 20 (18%) 14 (13%) 4 (4%)  
    N = 109
    Resistant smokers 3 (2%) 12 (6%) 16 (8%) 34 (17%) 58 29%)  48 (24%) 21 (11%) 7 (4%) 1 (0.5%)
    N = 200
    % Lung cancer 0% 7% 16% 23% 30% 40% 49% 67% 80%
  • DISCUSSION
  • The methods of the invention allow the determination of risk of disease to be assessed. For example, a simple scoring system in which each polymorphism in a category (i.e. protective or susceptibility) is assigned the same value allows the combined effects of all potentially relevant polymorphisms to be factored into the analysis. In other embodiments, the methods of the invention utilize a scoring system with adjustment (weighting) for the magnitude of the effect of each individual polymorphism, and again allow all polymorphisms to be simultaneously analyzed.
  • In other embodiments, analyses can utilise path analysis and/or Monte-Carlo analysis where the non-genetic and genetic factors can be analyzed.
  • Similar results were observed in comparing the presence or absence of susceptibility and resistant polymorphisms in smokers with OCOPD, and in smokers with lung cancer and resistant smokers.
  • The benefit of a net susceptibility score, having been determined for a subject is that it provides the opportunity for early prophylactic and/or therapeutic intervention. Such intervention can be as simple as communicating the net susceptibility score to the subject together with an explanation of the implications of that score. This alone can cause a lifestyle or occupational change, with the resultant beneficial effect for the subject.
  • Other, more direct approaches to prophylaxis or therapy can also be followed. These can include pharmaceutical or other medicaments being administered directed at favourably altering the net score of the subject together with other such approaches as discussed herein.
  • Table 21 below presents representative examples of polymorphisms in linkage disequilibrium with the polymorphisms specified herein. Examples of such polymorphisms can be located using public databases, such as that available online at world wide web dot hapmap dot org. Specified polymorphisms are indicated in the columns marked SNP NAME. Unique identifiers are indicated in the columns marked RS NUMBER.
  • TABLE 21
    Polymorphisms reported to be in linkage disequilibrium (unless stated) with examples of specified
    polymorphism.
    SNP NAME RS NUMBER SNP NAME RS NUMBER SNP NAME RS NUMBER
    COX2 SNPs rs6684912 rs5277
    rs7527769 rs2745559 rs2066823
    rs7550380 rs12042763 rs4648263
    rs2206594 rs4648250 rs4987012
    rs6687495 rs4648251 rs20428
    rs6681231 rs2223626 rs20429
    rs13376484 rs689462 rs4648264
    rs12064238 rs4648253 rs4648265
    rs10911911 rs689465 rs4648266
    rs12743673 rs12027712 rs4648267
    rs10911910 rs689466 rs11567824
    rs12743516 rs2745558 rs4648268
    rs10911909 rs3918304 rs4648269
    rs1119066 rs20415 rs4648270
    rs1119065 rs20416 rs12759220
    rs1119064 rs4648254 rs20430
    rs10798053 rs11567815 rs4648271
    rs12409744 −765G > C rs20417 rs11567825
    rs10911908 rs4648256 rs4648273
    rs10911907 rs20419 rs16825748
    rs7416022 rs2734779 rs4648274
    rs2745561 rs20420 rs16825745
    rs10911906 rs20422 rs20432
    rs2734776 rs20423 rs20433
    rs2734777 rs5270 rs3218622
    rs12084433 rs20424 rs2066826
    rs2734778 rs5271 rs5278
    rs2745560 rs4648257 rs4648276
    rs2223627 rs11567819 rs20434
    rs2383517 rs3134591 rs3218623
    rs4295848 rs3134592 rs3218624
    rs4428839 rs20426 rs5279
    rs4609389 rs4648258 rs4648278
    rs4428838 rs11567820 rs13306034
    rs12131210 rs2745557 rs2853803
    rs2179555 rs11567821 rs4648279
    rs2143417 rs4648259 rs4648281
    rs2143416 rs4648260 rs4648282
    rs11583191 rs4648261 rs11567826
    rs2383516 rs4648262 rs4648283
    rs2383515 rs11567822 rs4648284
    rs10911905 rs11567823 rs4648285
    rs10911904 rs2066824 rs11567827
    rs20427 rs4648286
    rs4648287 rs1042719 rs5744244
    rs5272 rs3729944 rs360722
    rs4648288 rs3730182 rs5023207
    rs5273 rs1042720 rs5744246
    rs5274 rs6879202 rs5744247
    rs3218625 rs3777124 −133 C/G rs360721
    rs4648289 rs1803051 rs4988359
    rs4648290 rs8192451 rs12721559
    rs1051896 rs4987255 rs5744248
    rs5275 rs3177007 rs5744249
    1ADRB SNPs rs1126871 rs5744250
    rs2082382 rs6885272 rs5744251
    rs2082394 rs6889528 rs100000356
    rs2082395 rs4521458 rs1834481
    rs9325119 rs10463409 rs17215057
    rs9325120 rs7702861 rs5744253
    rs12189018 IL-18 SNPs rs5744254
    rs11168066 rs187238 rs5744255
    rs11959615 rs5744228 rs5744256
    rs11958940 rs360718 rs5744257
    rs4705270 rs360717 rs360720
    rs10079142 rs5744229 rs5744258
    rs9325121 rs100000353 rs5744259
    rs11746634 rs5744231 rs5744260
    rs11168067 rs5744232 rs5744261
    rs9325122 rs7106524 105 A/C rs549908
    rs11957351 rs189667 PAI-1 SNPs
    rs11948371 rs12290658 rs6465787
    rs11960649 rs12271175 rs7788533
    rs1432622 rs11606049 rs6975620
    rs1432623 rs360716 rs6956010
    rs11168068 rs360715 rs12534508
    rs17778257 rs360714 rs4729664
    rs2400706 rs2043055 rs2527316
    rs2895795 rs5744233 rs2854235
    rs2400707 rs795467 rs10228765
    rs2053044 rs12270240 rs2854225
    rs17108803 rs100000354 rs2854226
    rs12654778 rs4937113 rs2227707
    rs11168070 rs100000355 rs2227631
    rs11959427 rs360723 −675 4G/5G No rs
    rs1042711 rs5744237 NOS3 SNPs
    rs1801704 rs5744238 rs2373962
    Arg16Gly rs1042713 rs5744239 rs2373961
    rs1042714 rs7932965 rs6951150
    rs1042717 rs11214103 rs13238512
    rs1800888 rs5744241 rs10247107
    rs1042718 rs5744242 rs10276930
    rs3729943 rs5744243 rs10277237
    rs12703107 rs9282804 rs2282679
    rs6946340 Asp298Glu rs1799983 rs2282680
    rs6946091 VDBP SNPs rs705117
    rs6946415 rs222035 rs2070741
    rs10952296 rs222036 rs2070742
    rs13309715 rs16846943 rs6821541
    rs10952297 rs7668653 rs222048
    rs7784943 rs1491720 rs432031
    rs11771443 rs16845007 rs432035
    rs2243310 rs17830803 rs222049
    rs1800783 Glu416Asp rs7041 rs222050
    rs3918155 Lys420Thr rs4588 rs12510584
    rs3918156 rs3737553 rs17467825
    rs2566519 rs9016 GSTP1 SNPs
    rs3918157 rs1352846 rs656652
    rs3918158 rs222039 rs625978
    rs3918159 rs3775154 rs6591251
    rs2566516 rs222040 rs12278098
    rs3918225 rs843005 rs612020
    rs3918160 rs222041 rs12284337
    rs1800779 rs7672977 rs12574108
    rs2243311 rs705121 rs6591252
    rs3918161 rs11723621 rs597717
    rs10952298 rs2298850 rs688489
    rs2070744 rs705120 rs597297
    rs3918226 rs2298851 rs6591253
    rs3918162 rs844806 rs6591254
    rs3918163 rs1491709 rs7927381
    rs3918164 rs705119 rs7940813
    rs3918165 rs6845925 rs593055
    rs1800781 rs12640255 rs7927657
    rs13310854 rs12644050 rs614080
    rs13310763 rs6845869 rs7941395
    rs2853797 rs12640179 rs7941648
    rs13311166 rs222042 rs7945035
    rs13310774 rs3187319 rs2370141
    rs2853798 rs222043 rs2370142
    rs11974098 rs842999 rs7949394
    rs3918166 rs222044 rs7949587
    rs3730001 rs222045 rs6591255
    rs3918167 rs16846912 rs8191430
    rs3918168 rs222046 rs6591256
    rs3918169 rs705118 rs8191431
    rs3918170 rs222047 rs8191432
    rs3793342 rs13142062 rs7109914
    rs3793341 rs843000 rs4147580
    rs1549758 rs3755967 rs8191436
    rs1007311 rs1491710 rs8191437
    rs9282803 rs2282678 rs17593068
    rs8191438 rs2069718 rs7145047
    rs8191439 rs3087272 rs7141735
    rs8191440 rs2069719 rs11558264
    rs8191441 rs9282708 rs6647
    rs1079719 rs2069720 rs8350
    rs1871041 rs1042274 rs2230075
    rs4147581 rs2069721 rs1049800
    rs8191444 rs2069734 S allele rs17580
    rs8191445 rs2069722 rs2854258
    rs2370143 rs2234687 rs2753937
    rs8191446 rs7957366 rs2749547
    rs3891249 rs2069723 rs1243162
    rs8191447 rs2069724 rs2753938
    rs12796085 rs2069725 rs2070709
    rs8191448 rs4394909 rs17090719
    rs762803 rs2069726 rs11846959
    rs8191449 rs2069727 rs1802962
    Ile105Val rs947894 IL-13 SNPs rs2749521
    rs4986948 −1055 C/T rs1800925 rs2753939
    rs675554 rs11575055 rs1802959
    rs749174 rs2069755 rs1802961
    rs8191450 rs2069741 rs1050469
    rs743679 rs2069742 Z allele no rs
    rs1799811 rs2069743 rs1050520
    rs11553890 rs2069756 rs12077
    rs4986949 rs3212142 rs12233
    rs8191451 rs2066960 rs13170
    rs1871042 rs1295687 rs1303
    rs11553892 rs3212145 rs1802960
    rs4891 rs2069744 rs1243163
    rs6413486 rs2069745 rs2073333
    rs5031031 rs2069746 rs1243164
    rs947895 rs2069747 rs7144409
    IFN-SNPs rs2069748 rs7142803
    rs2069707 rs1295686 rs1243165
    rs3814242 Arg130Gln rs20541 rs1051052
    rs2069709 rs2069749 rs1243166
    rs2069710 rs1295685 rs11628917
    rs2069711 rs848 rs11832
    rs2069712 rs2069750 rs9944155
    874 A/T rs2430561 rs847 1237 G/A rs11568814
    rs2069713 a1-antitrypsin rs877081
    SNPs
    rs1861494 rs709932 rs877082
    rs2234685 rs11558261 rs877083
    rs1861493 rs20546 rs877084
    rs2069714 rs11558263 rs875989
    rs2069715 F1028580 rs9944117
    rs2069716 rs7145770 rs1884546
    rs2069717 rs2239652 rs1884547
    rs1885065 rs2735442 rs8046608
    rs1884548 rs2569693 rs5743264
    rs1243167 rs281439 rs5743266
    rs17751614 rs281440 rs2076752
    rs1884549 rs2569694 rs5743267
    rs1243168 rs11575073 rs8061316
    rs17090693 rs2569695 rs8061636
    rs17824597 rs2075741 rs16948754
    TNFa SNPs rs11575074 rs7206340
    rs1799964 rs2569696 rs2076753
    rs1800630 rs2735439 rs2067085
    rs1799724 rs2569697 rs16948755
    +489 G/A rs1800610 rs2075742 rs2111235
    rs3093662 rs2569698 rs2111234
    rs3093664 rs11669397 rs7190413
    −308 G/A rs1800629 (1) rs901886 rs7206582
    SMAD3 SNPs rs885742 rs8045009
    C89Y C89Y no rs (2) rs2569699 rs6500328
    ICAM1 rs1056538 rs7500036
    rs1799969 rs11549918 rs8057341
    rs5493 rs2569700 rs12918060
    rs5030381 rs2228615 rs7204911
    rs5494 rs2569701 rs7500826
    rs3093033 rs2569702 rs4785449
    rs5495 rs2735440 rs12922299
    rs1801714 rs2569703 rs11649521
    rs13306429 rs10418913 rs13339578
    rs2071441 rs1056536 rs17221417
    rs5496 rs2569704 rs13331327
    rs5497 rs11673661 rs11642482
    rs13306430 rs2569705 rs11642646
    E469K rs5498 rs10402760 rs17312836
    rs5030400 rs2569706 rs5743268
    rs2071440 rs2569707 rs5743269
    rs5499 rs2735441 rs5743270
    rs3093032 rs2436545 rs12925051
    rs1057981 rs2436546 rs12929565
    rs5500 rs2916060 rs13380733
    rs5501 rs2916059 rs13380741
    rs5030383 rs2916058 rs11647841
    rs281436 rs2569708 rs10451131
    rs923366 rs12972990 rs2066842
    rs281437 rs735747 rs5743271
    rs3093030 rs885743 rs7498256
    rs5030384 NOD2 SNPs rs5743272
    rs5030385 rs4785224 rs5743273
    rs3810159 rs5743261 rs2076754
    rs281438 rs5743262 rs2066843
    rs3093029 rs5743263 rs1078327
    rs5743274 rs11645386 rs1031101
    rs1861759 rs7187857 rs10824795
    rs5743275 rs8061960 rs10824794
    rs5743276 rs5743294 rs920725
    rs2066844 rs2357791 rs7916582
    rs5743277 rs7359452 rs920724
    rs5743278 rs7203344 rs16933335
    rs6413461 rs5743295 rs11003125
    rs3813758 rs5743296 rs7100749
    rs5743279 rs3135499 rs11003124
    rs5743280 rs5743297 rs7084554
    rs5743281 rs5743298 rs7096206
    rs4785225 rs5743299 rs11003123
    rs16948773 rs3135500 rs11575988
    rs9931711 rs5743300 rs11575989
    rs17313265 rs8056611 rs7095891
    rs11646168 rs2357792 rs4647963
    rs9925315 rs12600253 rs8179079
    rs5743284 rs12598306 rs5030737
    rs5743285 rs7205423 161 G/A rs1800450
    rs751271 rs718226 rs1800451
    rs748855 MBL2 SNPs rs12246310
    rs1861758 rs7899547 rs12255312
    rs13332952 rs10824797 rs11003122
    rs7198979 rs11003131 rs1982267
    rs1861757 rs930506 rs1982266
    rs7203691 rs930505 rs4935047
    rs5743286 rs11003130 rs4935046
    rs5743287 rs2384044 rs10824793
    rs10521209 rs2384045 rs1838066
    Gly881Arg rs2066845 rs5027257 rs1838065
    rs5743289 rs2384046 rs930509
    rs8063130 rs12263867 rs930508
    rs2076756 rs11003129 rs930507
    rs12920425 rs12221393 CMA1 SNPs
    rs12920040 rs2165811 rs1956920
    rs12920558 rs12782244 rs1956921
    rs12919099 rs11003128 −1903 G/A rs1800875
    rs12920721 rs17664818 rs1800876
    rs2076755 rs7475766 rs3759635
    rs5743290 rs10824796 rs1956922
    rs5743291 rs16933417 rs1956923
    rs11642651 rs2165810 NAT2 SNPs
    rs1861756 rs11003127 rs11780272
    rs749910 rs3925313 rs2101857
    rs4990643 rs7094151 rs13363820
    rs1077861 rs7071882 rs6984200
    rs5743292 rs12264958 rs13277605
    rs9921146 rs11003126 rs9987109
    rs7820330 rs7596849 −366 G/A rs9550373
    rs7460995 rs4848306 rs11542984
    rs2087852 rs3087257 rs4769055
    rs2101684 rs7556811 rs17074937
    rs7011792 rs7556903 rs9671065
    rs1390358 rs6743438 rs9579645
    rs923796 rs6743427 rs9579646
    rs4546703 rs6761336 rs4075131
    rs4634684 rs6761335 rs4075132
    rs2410556 rs6743338 rs9315043
    rs11996129 rs6761245 rs9315044
    rs4621844 rs6761237 rs4597169
    rs11785247 rs6743330 rs9578037
    rs1115783 rs6743326 rs9578196
    rs1115784 rs6743322 rs4293222
    rs1961456 rs6761220 rs10507391
    rs1112005 rs6761218 rs12429692
    rs11782802 rs5021469 rs4769871
    rs973874 rs6710598 rs4769872
    rs1495744 rs1143623 rs4769873
    rs7832071 rs1143624 rs12430051
    rs1805158 rs2708920 rs9315045
    rs1801279 rs1143625 rs9670278
    rs1041983 rs2853545 rs4503649
    rs1801280 rs2708921 rs9508832
    rs4986996 rs1143626 rs9670460
    rs12720065 rs3087258 rs3885907
    rs4986997 C-511T rs16944 rs3922435
    rs1799929 rs3917346 rs9551957
    Arg197Gln rs1799930 rs4986962 rs12018461
    rs1208 rs1143627 rs9551958
    rs1799931 MEH SNPs rs10467440
    rs2552 Tyr113His rs1051740 (2) rs12017304
    rs4646247 His139Arg rs2234922 (2) rs9551959
    rs971473 ALOX5AP SNPs rs11617473
    rs721398 rs4076128 rs11147438
    IL-1B SNPs rs9508830 rs10162089
    rs10169916 rs4073259 rs9551960
    rs13009179 rs4073260 rs9285075
    rs4849127 rs11616333 rs12431114
    rs4849126 rs4073261 rs4254165
    rs7558108 rs4075474 rs4360791
    rs13032029 rs4075473 rs17612031
    rs13013349 rs9670115 rs3803277
    rs12623093 rs9315042 rs3803278
    rs3087255 rs3809376 rs12429469
    rs3087256 rs12877064 rs17612099
    rs6721954 rs9508831 rs9550576
    rs12621220 rs9670503 rs4356336
    rs4584668 rs2075800 rs2734714
    rs4238137 CLCA1 SNPs rs6661730
    rs17612127 rs2791519 rs2753377
    rs4147063 rs2791518 rs2753378
    rs4147064 rs5744302 rs2145412
    rs4147062 rs1321697 rs2180762
    rs9315046 rs2753338 rs1005569
    rs9506352 rs2791517 rs5744325
    rs9670531 rs5744303 rs5744326
    rs9671182 rs2734706 rs1985554
    rs9315047 rs2753345 rs1985555
    rs17690694 rs2753347 rs100000102
    rs9652070 rs2753348 rs100000103
    rs17074966 rs2753349 rs1969719
    rs4387455 rs5744304 rs2390102
    rs4254166 rs5744305 rs5744329
    rs4075692 rs1358826 rs1407142
    rs17690748 rs2753359 rs2753384
    rs9671124 rs5744306 rs2753385
    rs9671125 rs2734711 rs5744330
    rs9741436 rs5744307 rs5744331
    rs9578197 rs2734712 rs926064
    rs4769056 rs2753361 rs926065
    rs11147439 rs2753364 rs926066
    rs12721459 rs1555389 rs926067
    rs4769874 rs2753365 rs2753386
    HSP70 HOM SNPs rs100000100 rs2180764
    rs1043618 rs100000101 rs2734689
    rs11576009 rs5744310 rs5744332
    rs11557922 rs5744311 rs5744333
    rs11576010 rs5744312 rs11161837
    rs1008438 rs4656114 rs5744335
    rs11576011 rs5744313 rs2038485
    rs4713489 rs2753367 rs3765989
    rs16867582 rs4656115 rs2734690
    rs12526722 rs2734713 rs5744336
    rs6933097 rs5744314 rs2734691
    rs12213612 rs5744315 rs2734692
    rs481825 rs5744316 rs5744337
    rs7757853 rs5744317 rs5744338
    rs7757496 rs5744318 rs2734694
    rs9469057 rs926063 rs5744339
    rs12182397 rs5744319 rs100000104
    rs16867580 rs5744320 rs2791515
    rs2075799 rs5744321 rs4656116
    rs482145 rs5744322 rs5744342
    rs2227957 rs5744323 rs5744343
    T2437C rs2227956 rs5744324 rs2180761
    rs2227955 rs2791516 rs5744344
    rs5744345 rs5744443 rs6032038
    rs1358825 rs5744444 rs6032039
    rs2145410 rs3138074 rs2267863
    rs2734695 rs13166911 rs6124692
    rs5744346 rs2563310 +49 C/T No rs
    rs5744347 rs2569193 rs17333103
    rs100000105 rs2569192 rs17333180
    rs5744349 rs5744446 rs1983649
    rs4655913 rs5744447 rs16989785
    rs1321696 rs5744448 rs17424356
    rs5744352 rs3138076 rs6017500
    rs11583355 rs12519656 rs6032040
    rs100000106 rs5744449 rs6017501
    rs1321695 rs2915863 rs2664581
    +13924 T/A rs1321694 rs3138078 rs17424474
    rs2791514 rs6875483 rs17333381
    rs2734696 rs2569191 rs1053826
    rs5744354 rs5744451 rs2664533
    rs2791513 rs5744452 rs1053831
    rs2753332 rs100000098 rs2664520
    rs2791512 rs17118968 rs2267864
    rs2791511 rs5744455 rs13038355
    rs2734697 −159 C/T rs2569190 rs13043296
    CD14 SNPs rs2569189 rs13039213
    rs6877461 rs2563303 rs6104049
    rs3822356 rs3138079 rs13043503
    rs6877437 rs2228049 rs6104050
    rs12153256 rs13763 rs17424578
    rs11554680 rs11556179 rs17424613
    rs12109040 rs4914 rs6017502
    rs12517200 Elafin SNPs rs6094101
    rs5744430 rs2868237 rs6130778
    rs5744431 rs4632412 rs6130779
    rs100000092 rs7347427 rs6104051
    rs5744433 rs6032032 rs6104052
    rs100000093 rs10854230 ADBR2 SNPs
    rs4912717 rs7347426 rs2082382
    rs100000094 rs8183548 rs2082394
    rs100000095 rs6104047 rs2082395
    rs100000096 rs6513967 rs9325119
    rs6864930 rs13038813 rs9325120
    rs100000097 rs8118673 rs12189018
    rs6864583 rs7346463 rs11168066
    rs6864580 rs7362841 rs11959615
    rs6889418 rs13042694 rs11958940
    rs6889416 rs13038342 rs4705270
    rs5744440 rs7363327 rs10079142
    rs5744441 rs6073668 rs9325121
    rs5744442 rs13044826 rs11746634
    rs11168067 rs1800468 rs542603
    rs9325122 rs4987025 rs574939
    rs11957351 rs1800469 rs573764
    rs11948371 rs11466314 rs7102189
    rs11960649 rs12977628 rs575727
    rs1432622 rs12977601 rs552306
    rs1432623 rs12985978 rs634607
    rs11168068 rs11466315 rs12286876
    rs17778257 rs11551223 rs12285331
    rs2400706 rs11551226 rs519806
    rs2895795 rs11466316 rs12283571
    rs2400707 rs13306706 rs2839969
    rs2053044 rs13306707 rs2000609
    rs17108803 rs13306708 rs7125865
    rs12654778 rs9282871 rs570662
    rs11168070 Leu10Pro rs1982073 rs11225427
    rs11959427 rs1800471 rs484915
    rs1042711 rs13447341 rs470307
    rs1801704 rs11466318 rs2408490
    rs1042713 rs12976890 rs12279710
    Gln27Glu rs1042714 rs12978333 rs685265
    rs1042717 rs10420084 rs7107224
    rs1800888 rs10418010 rs1155764
    rs1042718 rs12983775 rs534191
    SOD3 SNPs rs12462166 rs509332
    Arg213Gly rs1799895 (2) rs2241715 rs12283759
    TGFB1 SNPs rs9749548 rs2105581
    rs1529717 rs7258445 rs470206
    rs1046909 rs11466320 rs533621
    rs2241712 rs11466321 −1607 G/GG rs1799750
    rs2241713 rs8108052 rs470211
    rs2241714 rs6508976 rs470146
    rs11673525 rs8108632 rs2075847
    rs2873369 rs11466324 rs473509
    rs11083617 rs2241716 rs498186
    rs11083616 rs2241717 GSTM1
    polymorphism
    rs4803458 rs2288873 Null Null allele No rs (2)
    rs11670143 rs12973435 MMP9 SNPs
    rs1982072 rs2014015 rs11696804
    rs11668109 rs1989457 rs6104416
    rs13345981 rs10406816 rs3933239
    rs11666933 rs8102918 rs3933240
    rs11466310 rs4803455 rs6094237
    rs11466311 MMP1 SNPs rs11697325
    rs2317130 rs529381 rs6130988
    rs4803457 rs1144396 rs6073983
    rs3087453 rs504875 rs6130989
    rs1800820 rs526215 rs6130990
    rs1054797 rs12280880 rs10211842
    rs6073984 rs8125587 TIMP3 SNPs
    rs6073985 rs3918253 rs5754289
    rs8121146 rs2274755 rs5754290
    rs6032620 rs2664538 rs9606994
    rs11698788 rs3918254 rs7285034
    rs6032621 rs6130993 rs13433582
    rs6065912 rs3918255 rs1962223
    rs6104417 rs2236416 rs8137129
    rs3848720 rs6130994 rs1807471
    rs13040272 rs3918256 rs7290885
    rs6104418 rs3918281 rs5749511
    rs3848721 rs3787268 rs11703366
    rs3848722 rs3918257 rs4990774
    rs6104419 rs6017725 −1296 T/C rs9619311
    rs4810482 rs6032623 rs2234921
    rs3761157 rs3918258 rs2234920
    rs3761158 rs2250889 rs16991235
    rs3761159 rs3918259 rs4638893
    rs8113877 rs3918260 rs12169569
    rs6065913 rs13969 rs5998639
    rs6104420 rs6104427 rs7284166
    rs6104421 rs6104428 rs5749512
    rs3918240 rs2274756
    rs6104422 rs6017726
    rs3918278 rs3918261
    rs3918241 rs6032624
    −1562 C/T rs3918242 rs3918262
    rs3918243 rs3918263
    rs3918279 rs3918264
    rs3918280 rs6130995
    rs4578914 rs6130996
    rs6017724 rs3918265
    rs3918244 rs3918266
    rs3918245 rs3918267
    rs6130992 rs6073987
    rs3918247 rs6073988
    rs3918248 rs3918282
    rs3918249 rs1802909
    rs6104423 rs13925
    rs6104424 rs20544
    rs6104425 rs1056628
    rs6104426 rs1802908
    rs3918250 rs2664517
    rs1805089 rs9509
    rs3918251 rs3918268
    rs13040572 rs3918269
    rs13040580 rs3918270
    rs3918252 MMP12 SNPs
    rs8125581 −82 A/G rs2276109 (2)
    (1 = no other SNPs reported to be in LD, 2 = no other SNPS reported to be in LD)
  • INDUSTRIAL APPLICATION
  • The present invention is directed to methods for assessing a subject's risk of developing a disease. The methods include the analysis of polymorphisms herein shown to be associated with increased or decreased risk of developing a disease, or the analysis of results obtained from such an analysis, and the determination of a net risk score. Methods of treating subjects at risk of developing a disease herein described are also provided. Additional information regarding the above material, or subparts thereof, can be found in U.S. patent application Ser. No. 10/479,525, filed Jun. 16, 2004; and PCT Application No. PCT/NZ02/00106, filed Jun. 5, 2002, which further designates New Zealand Application No. 512169, filed Jun. 5, 2001; New Zealand Application No. 513016, filed Jul. 17, 2001, and New Zealand Application No. 514275, filed Sep. 18, 2001, all of which are incorporated by reference in their entireties. Additional information can also be found in PCT application Nos. ______ and ______, filed May 10, 2006, entitled “Methods and Compositions for Assessment of Pulmonary Function and Disorders” and “Methods of Analysis of Polymorphisms and Uses Thereof” respectively, having Agent Reference Nos. 542813JBM and 542814JBM respectively, both of which are incorporated in their entireties by reference. PCT Application Agent Reference No. 542813JBM claims priority to: NZ application No. 539934, filed May 10, 2005; NZ application No. 541935, filed Aug. 19, 2005; and JP application No. 2005-360523, filed Dec. 14, 2005, all of which are incorporated by reference in their entireties. PCT Application Agent Reference No. 542814JBM claims priority to: NZ application No. 540249, filed May 20, 2005; and NZ application No. 541842, filed Aug. 15, 2005, all of which are incorporated in their entireties by reference. Additional information can also be found in U.S. Pat. No. ______, filed concurrently with the instant application, entitled “Methods and Compositions for Assessment of Pulmonary Function and Disorders”, attorney docket No; SGENZ.013AUS, incorporated by reference in its entirety.
  • PUBLICATIONS
    • 1. Sandford A J, et al., 1999. Z and S mutations of the α1-antitrypsin gene and the risk of chronic obstructive pulmonary disease. Am J Respir Cell Mol. Biol. 20; 287-291.
    • 2. Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular Cloning Manual. 1989.
    • 3. Papafili A, et al., 2002. Common promoter variant in cyclooxygenase-2 represses gene expression. Arterioscler Thromb Vasc Biol. 20; 1631-1635.
    • 4. Ukkola, O., Erkkilä, P. H., Savolainen, M. J. & Kesäniemi, Y. A. 2001. Lack of association between polymorphisms of catalase, copper zinc superoxide dismutase (SOD), extracellular SOD and endothelial nitric oxide synthase genes and macroangiopathy in patients with type 2 diabetes mellitus. J Int Med 249; 451-459.
    • 5. Smith C A D & Harrison D J, 1997. Association between polymorphism in gene for microsomal epoxide hydrolase and susceptibility to emphysema. Lancet. 350; 630-633.
    • 6. Lorenz E, et al., 2001. Determination of the TLR4 genotype using allele-specific PRC. Biotechniques. 31; 22-24.
    • 7. Cantlay A M, Smith C A, Wallace W A, Yap P L, Lamb D, Harrison D J. Heterogeneous expression and polymorphic genotype of glutathione S-transferases in human lung. Thorax. 1994, 49(10):1010-4.
  • All patents, publications, scientific articles, and other documents and materials referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced document and material is hereby incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Any and all materials and information from any such patents, publications, scientific articles, web sites, electronically available information, and other referenced materials or documents can be physically incorporated into this specification.
  • The specific methods and compositions described herein are representative of various embodiments or preferred embodiments and are exemplary only and not intended as limitations on the scope of the invention. Other objects, aspects, examples and embodiments will occur to those skilled in the art upon consideration of this specification, and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably can be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. Thus, for example, in each instance herein, in embodiments or examples of the present invention, any of the terms “comprising”, “consisting essentially of”, and “consisting of” can be replaced with either of the other two terms in the specification, thus indicating additional examples, having different scope, of various alternative embodiments of the invention. Also, the terms “comprising”, “including”, containing”, etc. are to be read expansively and without limitation. The methods and processes illustratively described herein suitably can be practiced in differing orders of steps, and that they are not necessarily restricted to the orders of steps indicated herein or in the claims. It is also that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to “a host cell” includes a plurality (for example, a culture or population) of such host cells, and so forth. Under no circumstances may the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein. Under no circumstances may the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by the Applicant.
  • The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed can be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended indicative claims.
  • The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
  • Other embodiments are within the following indicative claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

Claims (7)

1. A method of assessing a subject's risk of developing a disease which comprises:
analysing a biological sample from said subject for the presence or absence of a protective polymorphism and for the presence or absence of a susceptibility polymorphism, wherein said protective polymorphism and said susceptibility polymorphism are associated with said disease;
assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa;
calculating a net score for said subject, said net score representing the balance between the combined value of the protective polymorphism and the combined value of the susceptibility polymorphism present in the subject sample;
wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
2. A method according to claim 1 wherein the value assigned to each protective polymorphism is the same.
3.-25. (canceled)
26. A method of determining a subject's risk of developing a disease, said method comprising:
obtaining the result of one or more analyses of a sample from said subject to determine a presence or absence of a protective polymorphism and a presence or absence of a susceptibility polymorphism, and wherein said protective and susceptibility polymorphisms are associated with said disease;
assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa; and
calculating a net score for said subject, said net score representing a balance between a combined value of the protective polymorphism and a combined value of the susceptibility polymorphism present in the subject sample,
wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
27. (canceled)
28. A method of treatment of a subject to decrease a risk of developing a disease through alteration of the net score for said subject as determined by a method as defined above, wherein said method of treatment comprises:
reversing, genotypically or phenotypically, the presence and/or functional effect of one or more susceptibility polymorphisms associated with said disease; and/or
replicating and/or mimicking, genotypically or phenotypically, the presence and/or functional effect of one or more protective polymorphisms associated with said disease
3) a) reversing, genotypically or phenotypically, the presence, functional effect, or presence and functional effect of one or more susceptibility polymorphisms associated with said disease and
b) replicating, mimicking, or replicating and mimicking, genotypically or phenotypically, the presence, functional effect, or presence and functional effect of one or more protective polymorphisms associated with said disease.
29. (canceled)
US13/049,612 2005-05-20 2011-03-16 Methods of analysis of polymorphisms and uses thereof Abandoned US20110182872A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US13/049,612 US20110182872A1 (en) 2005-05-20 2011-03-16 Methods of analysis of polymorphisms and uses thereof
US13/903,913 US20130345287A1 (en) 2005-05-20 2013-05-28 Methods of analysis of polymorphisms and uses thereof

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
NZ54024905 2005-05-20
NZ540249 2005-05-20
NZ541842 2005-08-15
NZ54184205 2005-08-15
US11/432,770 US7933722B2 (en) 2005-05-20 2006-05-10 Methods of analysis of polymorphisms and uses thereof
US13/049,612 US20110182872A1 (en) 2005-05-20 2011-03-16 Methods of analysis of polymorphisms and uses thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US11/432,770 Continuation US7933722B2 (en) 2005-05-20 2006-05-10 Methods of analysis of polymorphisms and uses thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/903,913 Continuation US20130345287A1 (en) 2005-05-20 2013-05-28 Methods of analysis of polymorphisms and uses thereof

Publications (1)

Publication Number Publication Date
US20110182872A1 true US20110182872A1 (en) 2011-07-28

Family

ID=37431471

Family Applications (3)

Application Number Title Priority Date Filing Date
US11/432,770 Expired - Fee Related US7933722B2 (en) 2005-05-20 2006-05-10 Methods of analysis of polymorphisms and uses thereof
US13/049,612 Abandoned US20110182872A1 (en) 2005-05-20 2011-03-16 Methods of analysis of polymorphisms and uses thereof
US13/903,913 Abandoned US20130345287A1 (en) 2005-05-20 2013-05-28 Methods of analysis of polymorphisms and uses thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US11/432,770 Expired - Fee Related US7933722B2 (en) 2005-05-20 2006-05-10 Methods of analysis of polymorphisms and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13/903,913 Abandoned US20130345287A1 (en) 2005-05-20 2013-05-28 Methods of analysis of polymorphisms and uses thereof

Country Status (4)

Country Link
US (3) US7933722B2 (en)
EP (1) EP1888779A4 (en)
AU (1) AU2006248189A1 (en)
WO (1) WO2006123943A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018013509A1 (en) * 2016-07-11 2018-01-18 Arizona Board Of Regents On Behalf Of The University Of Arizona Compositions and methods for diagnosing and treating arrhythmias

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1896607A4 (en) * 2005-05-10 2009-12-16 Synergenz Bioscience Ltd Methods and compositions for assessment of pulmonary function and disorders
EP1888777A4 (en) 2005-05-19 2008-11-26 Synergenz Bioscience Ltd Methods and compositions for assessment of pulmonary function and disorders
EP1888779A4 (en) 2005-05-20 2009-06-10 Synergenz Bioscience Ltd Methods of analysis of polymorphisms and uses thereof
BRPI0614394A2 (en) * 2005-08-06 2011-03-29 Boehringer Ingelheim Int use of tiotropium salts
ME01205B (en) * 2006-01-04 2013-03-20 Boehringer Ingelheim Int Use of tiotropium salts in the treatment of moderate persistent asthma
EP2074224A4 (en) * 2006-10-17 2010-07-21 Synergenz Bioscience Ltd Methods and compositions for assessment of pulmonary function and disorders
KR101119417B1 (en) 2006-11-30 2012-04-12 아크레이 가부시키가이샤 Primer set for amplification of obesity gene, reagent for amplification of obesity gene comprising the primer set, and use of the primer set
ES2337115B2 (en) * 2007-09-26 2011-01-24 Universidade De Santiago De Compostela METHOD FOR DETECTION OF THE RISK OF DEVELOPING VITREORRETINOPATIAPROLIFERANTE (VRP).
WO2009073167A2 (en) * 2007-12-03 2009-06-11 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Identification and diagnosis of pulmonary fibrosis using mucin genes, and related methods and compositions
EP2443258A4 (en) * 2009-06-19 2013-12-18 Synergenz Bioscience Ltd Methods and compositions for assessment of pulmonary function and disorders
CN102010898B (en) * 2010-06-08 2013-04-24 广州益善生物技术有限公司 EPHX1 (Microsomal epoxide hydrolase, mEH, EPHX1) gene detection specific primer and liquid phase chip
CN102021237B (en) * 2010-06-08 2013-08-28 广州益善生物技术有限公司 Liquid phase chip and specificity primer for SNP detection of CYP4F2 and EPHX1 genes
ES2583688T3 (en) * 2011-03-11 2016-09-21 F. Hoffmann-La Roche Ag FEN1 as a marker of chronic obstructive pulmonary disease (COPD)
CN103430027B (en) * 2011-03-11 2015-05-20 霍夫曼-拉罗奇有限公司 Apex1 as marker for chronic obstructive pulmonary disease (COPD)

Citations (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4829052A (en) * 1986-06-11 1989-05-09 Monsanto Company Serine protease inhibitors
US5455262A (en) * 1993-10-06 1995-10-03 Florida State University Mercaptosulfide metalloproteinase inhibitors
US5674754A (en) * 1992-10-29 1997-10-07 Bayer Corporation Diagnostic assay for latent matrix metallo-proteinase No. 9 and use thereof in the diagnosis of rheumatoid and inflammatory arthritis and inflammatory bowel disease
US5727662A (en) * 1996-02-05 1998-03-17 Monroe Auto Equipment Company Thermal expansion compensation device for shock absorbers
US5773430A (en) * 1997-03-13 1998-06-30 Research Foundation Of State University Of New York Serine proteinase inhibitory activity by hydrophobic tetracycline
US5837492A (en) * 1995-12-18 1998-11-17 Myriad Genetics, Inc. Chromosome 13-linked breast cancer susceptibility gene
US5840698A (en) * 1994-10-27 1998-11-24 Affymax Technologies N.V. Inhibitors of collagenase-1 and stormelysin-I metalloproteases, pharmaceutical compositions comprising same and methods of their use
US5844108A (en) * 1990-06-22 1998-12-01 Roche Molecular Systems, Inc. Primers targeted to NAT2 gene for detection of poor metabolizers of drugs
US5851983A (en) * 1987-12-28 1998-12-22 Teijin Limited Elastase inhibitory polypeptide and process for production thereof by recombinant gene technology
US5932579A (en) * 1996-06-18 1999-08-03 Affymax Technologies N.V. Collagenase-1 and stromelysin-1 inhibitors, pharmaceutical compositions comprising same and methods of their use
US5935852A (en) * 1997-07-03 1999-08-10 Genetics Institute, Inc. DNA molecules encoding mammalian cerberus-like proteins
US6022893A (en) * 1995-08-08 2000-02-08 Ono Pharmaceutical Co., Ltd. Hydroxamic acid derivatives
US6033857A (en) * 1995-12-18 2000-03-07 Myriad Genetics, Inc. Chromosome 13-linked breast cancer susceptibility gene
US6057297A (en) * 1996-08-06 2000-05-02 Polifarma S.P.A. Inhibitor compounds of zinc-dependent metalloproteinases associated with pathological conditions, and therapeutic use thereof
US6057292A (en) * 1995-09-21 2000-05-02 Genentech, Inc. Method for inhibiting growth hormone action
US6060283A (en) * 1996-06-27 2000-05-09 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Genomic DNA encoding human interleukin-18 (IL-18, interferon-γ inducing factor)
US6117869A (en) * 1998-08-04 2000-09-12 Warner-Lambert Company Compounds for and methods of inhibiting matrix metalloproteinases
US6171798B1 (en) * 1998-03-27 2001-01-09 Affymetrix, Inc. P53-regulated genes
US6184022B1 (en) * 1993-11-30 2001-02-06 Fuji Yakuhin Kogyo Kabushiki Kaisha Metalloproteinase and encoding DNA therefor
US6183963B1 (en) * 1998-10-23 2001-02-06 Signalgene Detection of CYP1A1, CYP3A4, CYP2D6 and NAT2 variants by PCR-allele-specific oligonucleotide (ASO) assay
US6187587B1 (en) * 2000-03-02 2001-02-13 Isis Pharmaceuticals, Inc. Antisense inhibition of e2f transcription factor 1 expression
US6211209B1 (en) * 1997-08-08 2001-04-03 Warner-Lambert Company Method of inhibiting connective tissue degradation
US6268142B1 (en) * 1997-05-29 2001-07-31 Interleukin Genetics, Inc. Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
US6346385B1 (en) * 1997-12-16 2002-02-12 Teijin Limited Analysis of predisposition based on human airway trypsin protease gene polymorphism
US6387615B2 (en) * 1997-04-11 2002-05-14 Isis Innovation Limited Methods and materials for the diagnosis or prognosis of asthma
US20020197646A1 (en) * 2001-02-14 2002-12-26 Nogee Lawrence M. Single nucleotide polymorphisms associated with interstitial lung disease
US6610510B1 (en) * 1997-04-29 2003-08-26 Regeneron Pharmaceuticals, Inc. Morphogenic proteins
US6673549B1 (en) * 2000-10-12 2004-01-06 Incyte Corporation Genes expressed in C3A liver cell cultures treated with steroids
US6677442B1 (en) * 1999-10-29 2004-01-13 University Of Kentucky Research Foundation Nucleic acid encoding human REV1 protein
US6716581B2 (en) * 2000-03-31 2004-04-06 University Of Southern California Manganese superoxide dismutase gene polymorphism for predicting cancer susceptibility
US20040106120A1 (en) * 2000-11-30 2004-06-03 Rachid Tazi-Ahnini Diagnosis and treatment of disease
US20040219548A1 (en) * 2001-06-05 2004-11-04 Young Robert Peter Method and compositions for assessment of pulmonary function and disorders
US20040241714A1 (en) * 2003-02-04 2004-12-02 Branch Robert A. Methods of assessment of drug metabolizing enzymes
US20050064454A1 (en) * 2000-06-05 2005-03-24 Young Paul E. Cancer gene determination and therapeutic screening using signature gene sets
US20050196754A1 (en) * 2000-03-31 2005-09-08 Drmanac Radoje T. Novel nucleic acids and polypeptides
US20050272054A1 (en) * 2003-11-26 2005-12-08 Applera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
US20050282198A1 (en) * 1997-05-29 2005-12-22 Interleukin Genetics, Inc. Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
US7054758B2 (en) * 2001-01-30 2006-05-30 Sciona Limited Computer-assisted means for assessing lifestyle risk factors
US20060122373A1 (en) * 1997-04-04 2006-06-08 Millennium Pharmaceuticals, Inc. Delta3, FTHMA-070, Tango85, Tango77, SPOIL,NEOKINE, Tango129 and integrin alpha subunit protein and nucleic acid molecules and uses thereof
US20060269946A1 (en) * 2005-05-10 2006-11-30 Young Robert P Methods and compositions for assessment of pulmonary function and disorders
US20060275808A1 (en) * 2005-05-20 2006-12-07 Young Robert P Methods of analysis of polymorphisms and uses thereof
US20060281114A1 (en) * 2005-05-19 2006-12-14 Young Robert P Methods and compositions for assessment of pulmonary function and disorders
US20070099202A1 (en) * 2005-05-19 2007-05-03 Young Robert P Methods and compositions for assessment of pulmonary function and disorders

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5242794A (en) 1984-12-13 1993-09-07 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US5827662A (en) 1989-06-23 1998-10-27 The Trustees Of The University Of Pennsylvania Methods for detecting genetic mutations resulting in protease inhibitor insufficiencies
CA2175695A1 (en) 1993-11-03 1995-05-11 Philip Goelet Single nucleotide polymorphisms and their use in genetic analysis
ATE247716T1 (en) 1994-02-07 2003-09-15 Beckman Coulter Inc LIGASE/POLYMERASE-MEDIATED ANALYSIS OF GENETIC ELEMENTS OF SINGLE NUCLEOTIDE POLYMORPHISMS AND THEIR USE IN GENETIC ANALYSIS
US5871918A (en) 1996-06-20 1999-02-16 The University Of North Carolina At Chapel Hill Electrochemical detection of nucleic acid hybridization
US5945283A (en) 1995-12-18 1999-08-31 Washington University Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer
US6008017A (en) 1997-01-02 1999-12-28 Smithkline Beecham Corporation Human cardiac/brain tolloid-like protein
US5919626A (en) 1997-06-06 1999-07-06 Orchid Bio Computer, Inc. Attachment of unmodified nucleic acids to silanized solid phase surfaces
AU8162498A (en) 1997-06-25 1999-01-04 Orchid Biosciences, Inc. Methods for the detection of multiple single nucleotide polymorphisms in a single reaction
WO2000060117A2 (en) 1999-04-02 2000-10-12 Interleukin Genetics, Inc. Prediction of risk of interstitial lung disease
GB0113266D0 (en) 2001-05-31 2001-07-25 Bayer Ag Genes and proteins for prevention prediction diagnosis prognosis and treatment of chronic lung disease
US20020182606A1 (en) 2001-06-04 2002-12-05 Xanthon, Inc. Detection of single nucleotide polymorphisms
US6821733B2 (en) 2002-02-07 2004-11-23 Panomics, Inc. Methods and compositions for detecting differences between nucleic acids
US20050059030A1 (en) 2002-12-12 2005-03-17 Nanosphere, Inc. Direct SNP detection with unamplified DNA
JP4505838B2 (en) 2004-05-18 2010-07-21 アークレイ株式会社 Method for detecting NAT2 * 6 mutation and nucleic acid probe and kit therefor

Patent Citations (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4829052A (en) * 1986-06-11 1989-05-09 Monsanto Company Serine protease inhibitors
US5851983A (en) * 1987-12-28 1998-12-22 Teijin Limited Elastase inhibitory polypeptide and process for production thereof by recombinant gene technology
US5844108A (en) * 1990-06-22 1998-12-01 Roche Molecular Systems, Inc. Primers targeted to NAT2 gene for detection of poor metabolizers of drugs
US5674754A (en) * 1992-10-29 1997-10-07 Bayer Corporation Diagnostic assay for latent matrix metallo-proteinase No. 9 and use thereof in the diagnosis of rheumatoid and inflammatory arthritis and inflammatory bowel disease
US5455262A (en) * 1993-10-06 1995-10-03 Florida State University Mercaptosulfide metalloproteinase inhibitors
US6184022B1 (en) * 1993-11-30 2001-02-06 Fuji Yakuhin Kogyo Kabushiki Kaisha Metalloproteinase and encoding DNA therefor
US5840698A (en) * 1994-10-27 1998-11-24 Affymax Technologies N.V. Inhibitors of collagenase-1 and stormelysin-I metalloproteases, pharmaceutical compositions comprising same and methods of their use
US6022893A (en) * 1995-08-08 2000-02-08 Ono Pharmaceutical Co., Ltd. Hydroxamic acid derivatives
US6057292A (en) * 1995-09-21 2000-05-02 Genentech, Inc. Method for inhibiting growth hormone action
US6033857A (en) * 1995-12-18 2000-03-07 Myriad Genetics, Inc. Chromosome 13-linked breast cancer susceptibility gene
US5837492A (en) * 1995-12-18 1998-11-17 Myriad Genetics, Inc. Chromosome 13-linked breast cancer susceptibility gene
US5727662A (en) * 1996-02-05 1998-03-17 Monroe Auto Equipment Company Thermal expansion compensation device for shock absorbers
US5932579A (en) * 1996-06-18 1999-08-03 Affymax Technologies N.V. Collagenase-1 and stromelysin-1 inhibitors, pharmaceutical compositions comprising same and methods of their use
US6060283A (en) * 1996-06-27 2000-05-09 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Genomic DNA encoding human interleukin-18 (IL-18, interferon-γ inducing factor)
US6057297A (en) * 1996-08-06 2000-05-02 Polifarma S.P.A. Inhibitor compounds of zinc-dependent metalloproteinases associated with pathological conditions, and therapeutic use thereof
US5773430A (en) * 1997-03-13 1998-06-30 Research Foundation Of State University Of New York Serine proteinase inhibitory activity by hydrophobic tetracycline
US20060122373A1 (en) * 1997-04-04 2006-06-08 Millennium Pharmaceuticals, Inc. Delta3, FTHMA-070, Tango85, Tango77, SPOIL,NEOKINE, Tango129 and integrin alpha subunit protein and nucleic acid molecules and uses thereof
US6387615B2 (en) * 1997-04-11 2002-05-14 Isis Innovation Limited Methods and materials for the diagnosis or prognosis of asthma
US6610510B1 (en) * 1997-04-29 2003-08-26 Regeneron Pharmaceuticals, Inc. Morphogenic proteins
US6268142B1 (en) * 1997-05-29 2001-07-31 Interleukin Genetics, Inc. Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
US20050282198A1 (en) * 1997-05-29 2005-12-22 Interleukin Genetics, Inc. Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
US20040152124A1 (en) * 1997-05-29 2004-08-05 Duff Gordon W. Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
US6706478B2 (en) * 1997-05-29 2004-03-16 Interleukin Genetics, Inc. Diagnostics and therapeutics for diseases associated with an IL-1 inflammatory haplotype
US5935852A (en) * 1997-07-03 1999-08-10 Genetics Institute, Inc. DNA molecules encoding mammalian cerberus-like proteins
US6211209B1 (en) * 1997-08-08 2001-04-03 Warner-Lambert Company Method of inhibiting connective tissue degradation
US6346385B1 (en) * 1997-12-16 2002-02-12 Teijin Limited Analysis of predisposition based on human airway trypsin protease gene polymorphism
US6171798B1 (en) * 1998-03-27 2001-01-09 Affymetrix, Inc. P53-regulated genes
US6117869A (en) * 1998-08-04 2000-09-12 Warner-Lambert Company Compounds for and methods of inhibiting matrix metalloproteinases
US6183963B1 (en) * 1998-10-23 2001-02-06 Signalgene Detection of CYP1A1, CYP3A4, CYP2D6 and NAT2 variants by PCR-allele-specific oligonucleotide (ASO) assay
US6677442B1 (en) * 1999-10-29 2004-01-13 University Of Kentucky Research Foundation Nucleic acid encoding human REV1 protein
US6187587B1 (en) * 2000-03-02 2001-02-13 Isis Pharmaceuticals, Inc. Antisense inhibition of e2f transcription factor 1 expression
US6716581B2 (en) * 2000-03-31 2004-04-06 University Of Southern California Manganese superoxide dismutase gene polymorphism for predicting cancer susceptibility
US20050196754A1 (en) * 2000-03-31 2005-09-08 Drmanac Radoje T. Novel nucleic acids and polypeptides
US20050064454A1 (en) * 2000-06-05 2005-03-24 Young Paul E. Cancer gene determination and therapeutic screening using signature gene sets
US6673549B1 (en) * 2000-10-12 2004-01-06 Incyte Corporation Genes expressed in C3A liver cell cultures treated with steroids
US20040106120A1 (en) * 2000-11-30 2004-06-03 Rachid Tazi-Ahnini Diagnosis and treatment of disease
US7054758B2 (en) * 2001-01-30 2006-05-30 Sciona Limited Computer-assisted means for assessing lifestyle risk factors
US20020197646A1 (en) * 2001-02-14 2002-12-26 Nogee Lawrence M. Single nucleotide polymorphisms associated with interstitial lung disease
US20040219548A1 (en) * 2001-06-05 2004-11-04 Young Robert Peter Method and compositions for assessment of pulmonary function and disorders
US20040241714A1 (en) * 2003-02-04 2004-12-02 Branch Robert A. Methods of assessment of drug metabolizing enzymes
US20050272054A1 (en) * 2003-11-26 2005-12-08 Applera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
US20060269946A1 (en) * 2005-05-10 2006-11-30 Young Robert P Methods and compositions for assessment of pulmonary function and disorders
US20060281114A1 (en) * 2005-05-19 2006-12-14 Young Robert P Methods and compositions for assessment of pulmonary function and disorders
US20070099202A1 (en) * 2005-05-19 2007-05-03 Young Robert P Methods and compositions for assessment of pulmonary function and disorders
US20060275808A1 (en) * 2005-05-20 2006-12-07 Young Robert P Methods of analysis of polymorphisms and uses thereof

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018013509A1 (en) * 2016-07-11 2018-01-18 Arizona Board Of Regents On Behalf Of The University Of Arizona Compositions and methods for diagnosing and treating arrhythmias
US11091795B2 (en) 2016-07-11 2021-08-17 Arizona Board Of Regents On Behalf Of The University Of Arizona Compositions and methods for diagnosing and treating arrhythmias

Also Published As

Publication number Publication date
US20130345287A1 (en) 2013-12-26
WO2006123943A1 (en) 2006-11-23
EP1888779A4 (en) 2009-06-10
EP1888779A1 (en) 2008-02-20
US7933722B2 (en) 2011-04-26
AU2006248189A1 (en) 2006-11-23
US20060275808A1 (en) 2006-12-07

Similar Documents

Publication Publication Date Title
US7933722B2 (en) Methods of analysis of polymorphisms and uses thereof
US8076065B2 (en) Methods and compositions for assessment of pulmonary function and disorders
US20080195327A1 (en) Methods of Analysis of Polymorphisms and Uses Thereof
US20120282621A1 (en) Methods and compositions for assessment of pulmonary function and disorders
US20100267025A1 (en) Methods and compositions for the assessment of cardiovascular function and disorders
US20060281114A1 (en) Methods and compositions for assessment of pulmonary function and disorders
US20160076104A1 (en) Methods and compositions for assessment of pulmonary function and disorders
US20120165214A1 (en) Methods and compositions for assessment of pulmonary function and disorders
US20130281319A1 (en) Methods and compositions for assessment of pulmonary function and disorders
AU2017265006A1 (en) Methods of analysis of polymorphisms and uses thereof
AU2012203045A1 (en) Methods Of Analysis Of Polymorphisms And Uses Thereof
MX2007013926A (en) Methods and compositions for assessment of pulmonary function and disorders.
US20100285973A1 (en) Methods and compositions for assessment of pulmonary function and disorders

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION