US20090130692A1

US20090130692A1 - Use of microproteins as tryptase

Info

Publication number: US20090130692A1
Application number: US11/663,435
Authority: US
Inventors: Harald Kolmar; Christian Sommerhoff; Alexander Wentzel
Original assignee: NascaCell Technologies AG
Current assignee: NascaCell Technologies AG; Biontech SE
Priority date: 2004-09-21
Filing date: 2005-09-19
Publication date: 2009-05-21
Also published as: US8278262B2; AU2005287557B2; EP1793847A2; AU2005287557A1; EP2314308A1; WO2006032436A3; WO2006032436A2; CA2580881A1

Abstract

Disclosed are uses of microproteins preferably microproteins forming a cystine knot (i.e. belonging to the family of inhibitor cystine knot (ICK) polypeptides) or polynucleotides encoding said microproteins for the preparation of a pharmaceutical composition for treating or preventing a disease that can be treated or prevented by inhibiting the activity of tryptase as well as corresponding methods of treatment. Also disclosed are uses of the microproteins for inhibiting tryptase activity, for purifying tryptase, as a carrier molecule for tryptase and for deleting or quantifying tryptase in a sample, including corresponding diagnostic applications. Furthermore disclosed are fusion proteins comprising an inactive barnase as well as fusion proteins comprising barnase and a microprotein. Also encompassed are nucleic acid molecules encoding such a fusion protein, as well as corresponding vectors, host cells, preparation methods and uses of the fusion protein. Moreover, the present application discloses a crystal of a microprotein fused with barnase, preferably inactive barnase. The disclosure also refers to corresponding preparation methods for the crystal, structure analysis methods using the crystal data storage media comprising the structure data obtained, as well as to in silico methods using the structure data for characterizing the binding of microproteins to target molecules. Furthermore, disclosed are pharmaceutical compositions comprising the crystal and corresponding medical uses.

Description

The present application relates to the use of microproteins, preferably microproteins forming a cystine knot (i.e. belonging to the family of inhibitor cystine knot (ICK) polypeptides), or polynucleotides encoding said microproteins for the preparation of a pharmaceutical composition for treating or preventing a disease that can be treated or prevented by inhibiting the activity of tryptase as well as to corresponding methods of treatment. The present invention also relates to uses of the microproteins for inhibiting tryptase activity, for purifying tryptase, as a carrier molecule for tryptase and for detecting or quantifying tryptase in a sample, including corresponding diagnostic applications. The present invention furthermore relates to fusion proteins comprising an inactive barnase as well as to fusion proteins comprising barnase and a microprotein. Also encompassed by the present invention are nucleic acid molecules encoding such a fusion protein, as well as corresponding vectors, host cells, preparation methods and uses of the fusion protein. Moreover, the present invention relates to a crystal of a microprotein fused with barnase, preferably inactive barnase. The present invention also refers to corresponding preparation methods for the crystal, structure analysis methods using the crystal, data storage media comprising the structure data obtained, as well as to in silico methods using the structure data for characterizing the binding of microproteins to target molecules. Furthermore, the invention relates to pharmaceutical compositions comprising the crystal and corresponding medical uses.
Asthma is a complex disease involving multiple biochemical mediators for both its acute and chronic manifestations. Increasingly, asthma is recognized as an inflammatory disorder (see, e.g., Hood, et al., 1984). Asthma is frequently characterized by progressive development of hyperresponsiveness of the trachea and bronchi to both immunospecific allergens and chemical or physical stimuli. The hyperresponsiveness of asthmatic bronchiolar tissue is thought to result from chronic inflammation reactions, which irritate and damage the epithelium lining the airway wall and promote pathological thickening of the underlying tissue. Bronchial biopsy studies have indicated that even patients with mild asthma have features of inflammation in the airway wall.
One initiator of the inflammatory sequence is an allergic response to inhaled allergens. Leukocytes carrying IgE receptors, mast cells and basophils, but also monocytes, macrophages, and eosinophils, are present in the epithelium and underlying smooth muscle tissues of bronchi where they are activated initially by binding of specific inhaled antigens to the IgE receptors. Activated mast cells release a number of preformed or primary chemical mediators of the inflammatory response and enzymes. Furthermore, numerous secondary mediators of inflammation are generated in situ by enzymatic reactions of activated mast cells, including superoxide and lipid derived mediators. In addition, several large molecules are released by degranulation of mast cells: proteoglycans, peroxidase, arylsulfatase B, and notably the proteases tryptase and chymotryptic proteinase (chymase).
This release of compounds from mast cells probably accounts for the early bronchiolar constrictor response that occurs in susceptible individuals after exposure to airborne allergens. The early asthmatic reaction is maximal at around fifteen minutes after allergen exposure; recovery occurs over the ensuing one to two hours. In 25-35% of individuals, the early asthmatic reaction is followed by a further decline in respiratory function which begins within a few hours and is maximal between six and twelve hours post-exposure. This late asthmatic reaction is accompanied by a marked increase in the number of inflammatory cells infiltrating bronchiolar smooth muscle and epithelial tissues, and spilling into the airways. These cells include eosinophils, neutrophils, and lymphocytes, all of which are attracted to the site by release of mast cell derived chemotactic agents. The infiltrating cells themselves become activated during the late reaction phase. The late asthmatic response is believed to be a secondary inflammatory reaction mediated in part by the secretory activity of macrophages.
Human tryptase is a serine proteinase which is the predominant protein present in human mast cells. The term tryptase covers four closely related enzymes (α, I, II/β, III; possessing 90 to 98% sequence identity) (Miller et al. 1989; Vanderslice et al., 1990).
Tryptase is the major secretory protease of human mast cells and is proposed to be involved in neuropeptide processing and tissue inflammation. Mature human tryptase is a tetrameric glycosylated molecule, is heparin-associated and composed of heterogenous, catalytically active subunits (see, e.g., Vanderslice et al., 1990; Miller et al., 1989, 1990, Sommerhoff et al., 1999).
Tryptase is stored in mast cell secretory granules. After mast cell activation, human tryptase can be found in various biologic fluids. Tryptase levels in lung lavage fluid obtained from atopic asthmatics increase after endobronchial allergen challenge. Some smokers of cigarettes have striking elevations of bronchoalveolar lavage fluid tryptase levels compared to nonsmoker control groups, a finding that provides some support for the hypothesis that release of proteinases from activated mast cells could contribute to lung destruction in smoker's emphysema, (Kalenderian, et al., Chest 94:119-123, 1988). In addition, tryptase has been shown to be a potent mitogen for fibroblasts, suggesting its involvement in pulmonary fibrosis and interstitial lung diseases (Ruoss et al., 1991).
Tryptase has been implicated in a variety of biological processes, including degradation of vasodilating and bronchorelaxing neuropepudes (see Caughey, et al., 1988; Franconi, et al., 1989; and Tam, et al. 1990) and modulation of bronchial responsiveness to histamine (see Sekizawa, et al., 1989) and psoriasis. These studies suggest that tryptase possibly increases bronchoconstriction in asthma by destroying bronchodilating peptides.
Elevated levels of mast-cell tryptase have been found

- in the plasma of patients with mastocytosis, after systemic anaphylaxis (Schwartz et al., 1987, 1989).
- in the duodenal mucosa of psoriasis patients (Michaelsson et al., 1997).
- in bronchoalveolar lavage fluid of patients with asthma (Broide et al., 1991; Wenzel et al., 1988), interstitial lung diseases (Walls et al., 1991), and after antigen challenge of allergic patients (Castells & Schwartz 1988).
- in the skin blister fluid after cutaneous antigen challenge in patients with atopic and allergic skin disease (Shalit et al., 1990; Atkins et al., 1990; Brockow et al., 2002).
- in nasal lavage fluid after local antigen challenge of patients with seasonal allergic rhinitis (Juliusson et al., 1991; Howarth, 1995)
- in the crevicular fluid of patients with gingivitis and periodontitis (Cox & Eley, 1989) and in the lesional skin of patients with psoriasis (Michaelsson et al., 1997).
- in the mucosa of the ileum and colon of patients with inflammatory bowel disease (IBD), which was accompanied by great changes of the content in mast cells such as dramatically increased expression of TNFalpha, IL-16 and substance P. The evidence of mast cell degranulation was found in the wall of intestine from patients with IBD with immunohistochemistry technique. The highly elevated histamine and tryptase levels were detected in mucosa of patients with IBD, strongly suggesting that mast cell degranulation is involved in the pathogenesis of IBD (He, 2004).
- in myeloblasts in patients with acute myeloid leukaemia (AML) that produce significant amounts of tryptase(s). In these patients, myeloblasts express alpha-tryptase mRNA in excess over beta-tryptase mRNA, and secrete the respective protein (=pro-alpha-tryptase) in a constitutive manner (Sperr et al., 2001, 2002).

Human tryptase is inhibited by small molecular weight substances (e.g. leupeptin and diisopropyl fluorophosphate). Divalent cations, such as calcium, and benzamidine and its derivatives are competitive inhibitors of human mast cell tryptase (Schwartz, 1994). Several low-molecular-weight compounds have been described as tryptase inhibitors in the patent literature (summarized in Newhouse 2002). However, none of the compounds have made their way into later stage clinical trials. This is explained by undesired side reactions, insufficient selectivity, high toxicity, low stability and/or low bioavailability of the different inhibitor compounds described (Newhouse 2002).
Although tryptase has trypsin-like properties, most protein-based inhibitors do not inhibit it. Although having trypsin-like properties, it is a characteristic of human tryptase not to be inhibited by potent trypsin inhibitors such as bovine pancreatic trypsin inhibitor (Di Marco & Priestle, 1997). Endogenous inhibitors that target the catalytic sites of mast cell tryptase have yet to be reported. Human tryptase activity is inhibited by lactoferrin and myeloperoxidase (both neutrophil-derived) and by antithrombin-III, all of which antagonise the glycosaminoglycans (heparin or chondroitin sulfate) that stabilize the mast cell tryptase (MCT) tetramer (Alter et al., 1990; Cregar et al., 1999; Elrod et al., 1997). The only two known protein-based human tryptase inhibitors which inhibit tryptase via tight binding to its active site are the leech derived tryptase Inhibitor (LDTI) and the tick-derived protease inhibitor protein (rTdPI) (WO 95/03333 and WO 01/05832). LDTI is a 46 residue protein, where two LDTI monomers interact with one tryptase tetramer. A recombinant form of this Kazal-type protein has been found to efficiently inhibit 2 of the 4 catalytic sites of the tetrameric tryptase (Stubbs et al., 1997; Auerswald et al., 1994; Sommerhoff et al., 1994) with a Ki of 1.4 nM, while the remaining two sites are inhibited with Ki values of 560 and 10,000 nM, respectively. The efficient binding of only two catalytic sites out of four in the tryptase tetramer has so far prevented any therapeutic uses of LDTI.
Thus, it would be desirable to provide further inhibitors to tryptase, especially for therapeutic purposes. In case of proteinacious inhibitors, it would be furthermore desirable to provide the inhibitor in crystalline form so as to facilitate structure analysis and have a basis for studying and improving tryptase binding. In addition, it would be desirable to provide corresponding means and methods that may be useful for improving the production of such inhibitors or crystals thereof.
In view of the above explanations, it is clear that there is still an on-going need for efficient inhibitors of tryptase. Thus, the technical problem underlying the present invention is to make available further tryptase inhibitors that can be used to prevent or treat diseases that can be prevented or treated by inhibiting tryptase activity. Preferably, such inhibitors should overcome drawbacks associated with tryptase inhibitors of the prior art such as undesired side reactions, insufficient selectivity, high toxicity, low stability, low bioavailability and/or insufficient binding affinity.
This technical problem is solved by the provision of the embodiments as characterized in the claims.
Accordingly, the present invention relates to the use of a microprotein or a polynucleotide encoding said microprotein for the preparation of a pharmaceutical composition for treating or preventing a disease that can be treated or prevented by inhibiting the activity of tryptase.
The present invention is based on the surprising finding that microproteins are capable of efficiently binding tryptase. This is shown for many exemplary specimens in Example 3, infra. Three of the microproteins of the invention were furthermore positively tested for tryptase selectivity (see Table 2 in Example 3, infa). Thus, the use of the present invention refers to the use of microproteins which are capable of significantly inhibiting the activity of tryptase. Preferably, the microproteins are able to bind all four catalytic sites of the tryptase tetramer. The provision of the present invention, i.e. the recognition that microproteins can be used to inhibit tryptase in particular for therapeutic purposes, overcomes disadvantages that are known for low-molecular weight tryptase inhibitors (see, e.g., Newhouse, 2002). For instance, such small molecules may show a toxic effect to the organism to which they are applied due to a relatively low binding specificity causing binding to molecules other than tryptase. Compared to the small molecules, microproteins show a larger interaction surface so that a more selective binding can be expected for them. Furthermore, protein-based binding molecules typically have a lower dissociation rate constant than low-molecular weight molecules, thus, binding for a longer time to the target and therefore having more advantageous binding properties.
In addition, a further advantage over low-molecular weight tryptase inhibitors lies in the fact that microproteins can be expected not to be able to cross the membrane barrier. This prevents microproteins from binding to tryptase stored within mast cells which may potentially influence the physiological state of the mast cell negatively. Small molecules, by contrast, can often cross membranes. Moreover, especially cystine knot proteins are notoriously stable against enzymic or thermal degradation.
The term “microprotein” generally refers to polypeptides with a relatively small size of not more than 50 amino acids and a defined structure based on intra-molecular disulfide bonds. Microproteins are typically highly stable and resistant to heat, pH and proteolytic degradation. The current knowledge on microproteins, in particular in regard to their structure and occurrence, is for instance reviewed in Craik (2001); Pallaghy (1994); and Craik (J. Mol. Biol. 294 (1999), 1327-1336).
In a preferred embodiment, the microprotein in the use of the invention comprises at least six cysteine residues, of which six cysteine residues are connected via disulphide bonds so as to form a cystine knot.
Such microproteins are also known as inhibitor cystine knot (ICK) polypeptides and are also called like that in the following explanations.
The term “cystine knot” refers to a three-dimensional structure formed by the ICK polypeptides which are characterized by a small triple β-sheet which is stabilized by a three-disulfide bond framework which comprises an embedded ring formed by two disulphide bonds and their connecting backbone segments, through which a third disulfide bond is threaded. Preferably, the cystine knot is formed by six conserved cysteine residues and the connecting backbone segments, wherein the first disulfide bond is between the first and the fourth cysteine residue, the second disulfide bond between the second and the fifth cysteine residue and the third disulfide bond between the third and the sixth cysteine residue, the third disulfide bond being threaded through the ring formed by the other two disulfide bonds and their connecting backbone segments. FIG. 11 shows an example of a corresponding cystine knot forming microprotein. If considered suitable, a disulfide bond may be replaced by a chemical equivalent thereof which likewise ensures the formation of the overall topology of a cystine knot. For testing whether a given microprotein has formed the correct cystine knot, a skilled person can determine which cystine residues are connected with one another. This can, for instance, be done according to techniques described in Gorasson (J. Biol. Chem. 278 (2003), 48188-48196) and Horn (J. Biol. Chem. 279 (2004), 35867-35878). Microproteins with a cystine knot are for instance described in Craik (2001); Pallaghy (1994); and Craik (J. Mol. Biol. 294 (1999), 1327-1336).
The microproteins for use in connection with the present invention may have a peptide backbone with an open or a circular conformation. The open conformation preferably refers to microproteins with an amino-group at the N-terminus and a carboxyl-group at the C-terminus. However, any modifications of the termini, along with what a skilled person envisages based on the state of the art in peptide chemistry, is also contemplated, as long as the resulting microprotein shows tryptase-inhibiting activity. In the closed conformation, the ends of the peptide backbone of the microproteins are connected, preferably via a covalent bond, more preferably via an amide (i.e. peptide) bond. Microproteins with a closed conformation having a cystine knot topology are known in the prior art as “cyclotides” and their knot as “cyclic cystine knot (CCK)”. Such cyclotides are for instance described in WO 01/27147 and Craik (Curr. Opinion in Drug Discovery & Development 5 (2002), 251-260).
It is furthermore preferred that the microproteins for use in the present invention comprise the amino acid motif CX₃-CX₄-CX_4-7-CX₁-CX_4-5-CX_5-7(SEQ ID NO: 18), with X meaning independently from each other any amino acid residue. C means, in accordance with the standard nomenclature, cysteine. Preferably, the amino acids X are not cysteine. It is furthermore preferred that the cysteine residues C in that sequence form a cystine knot as defined above.
In accordance with a further preferred embodiment of the invention, the microprotein has a length of between 28 and 40 amino acids.
It has been shown in experiments conducted in connection with the present invention that microproteins not exceeding a certain maximum size show a particularly good performance, especially in regard to the capacity to bind all four catalytic sites of the tryptase tetramer. Accordingly, it is particularly preferred that the microproteins for use in connection with the present invention have a length of up to 35 amino acids, more preferably of up to 32 amino acids, and most preferably of up to 30 amino acids.
Furthermore, it is preferred that the microprotein for use in connection with the present invention and in accordance with the aforementioned definitions comprises an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence depicted in any one of SEQ ID NOs: 1 to 15;
(b) the amino acid sequence depicted in SEQ ID NO: 16 or 17;
(c) a fragment of the amino acid sequence of (a) or (b), said fragment being capable of inhibiting tryptase activity; and
(d) a functional equivalent in which at least one residue of the amino acid sequence or of the fragment of any one of (a) to (c) is substituted, added and/or deleted, said functional equivalent being capable of inhibiting tryptase activity.

The microproteins defined under (a) having the amino acid sequence of any one of SEQ ID NOs: 1 to 13 have been shown experimentally to efficiently inhibit tryptase (see Example 3 and Table 1, infra). Their use is therefore particularly preferred in connection with the present invention. The nucleotide sequence of a particularly preferred microprotein is shown in FIG. 5 (SEQ ID NO: 20). In addition, it is particularly preferred that the microprotein for use in connection with the present invention comprises the amino acid sequence of any one of SEQ ID NOs: 1, 14 and 15. These are the amino acid sequences of the microproteins McoTI-I, McoTI-II and McoTI-III described in Hernandez (2000).
The consensus sequence of SEQ ID NO: 16 referred to under (b) has been derived from the amino acid sequence of the microprotein MCoTI-KKV (SEQ ID NO: 7) which showed to have the highest tryptase inhibiting activity among the microproteins tested. It is conceived that at positions 1, 2, 8, 11, 12, 14 and 15 of SEQ ID NO: 16 amino acid residues lysine (K) or arginine (R) may reside interchangeably. The consensus sequence referred to under SEQ ID NO: 17 differs from that of SEQ ID NO: 16 in its C-terminal part.
The present invention also refers to the use of microproteins comprising a fragment of an amino acid sequence as defined in (a) or (b), provided said fragment has tryptase-inhibiting activity. The term “fragment” has a clear meaning to a person skilled in the art and refers to a partial continuous sequence of amino acid residues within the amino acid sequence with reference to which the fragment is defined. Thus, compared to the reference amino acid sequence, the fragment lacks at least one amino acid residue at the N-terminus, at the C-terminus or at both termini. In the case of a circular reference sequence, the fragment lacks at least one amino acid residue at one position of said sequence, whereby the fragment may be circular or linear. Preferably, the fragment retains the six conserved cysteine residues and, by their presence, is capable of forming the cystine knot topology.
The term “functional equivalent” refers to variants of a microprotein as defined in any one of (a) to (c), in which at least one residue of the amino acid sequence or the fragment of any one of (a) to (c) is substituted, added and/or deleted, said variant being capable of inhibiting tryptase activity. Preferably, the functional equivalent has an amino acid sequence which comprises six cysteine residues which are connected via disulfide bonds so as to form a cystine knot.
A functional fragment for use in the present invention may for example be a polypeptide which is encoded by a polynucleotide the complementary strand of which hybridises with a nucleotide sequence encoding a microprotein as defined in any one of (a) to (c), wherein said polypeptide has the activity of inhibiting tryptase activity.
In this context, the term “hybridization” means hybridization under conventional hybridization conditions, preferably under stringent conditions, as for instance described in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, N.Y., USA. In an especially preferred embodiment, the term “hybridization” means that hybridization occurs under the following conditions:

Hybridization buffer: 2×SSC; 10×Denhardt solution (Fikoll 400+PEG+BSA; ratio 1:1:1); 0.1% SDS; 5 mM EDTA; 50 mM Na₂HPO₄;
- 250 μg/ml of herring sperm DNA; 50 μg/ml of tRNA;
- or
- 0.25 M of sodium phosphate buffer, pH 7.2;
- 1 mM EDTA
- 7% SDS
Hybridization temperature T=60° C.
Washing buffer: 2×SSC; 0.1% SDS
Washing temperature T=60° C.

Polynucleotides encoding a functional equivalent which hybridize with a nucleotide sequence encoding a microprotein as defined in any one of (a) to (c) can, in principle, be derived from any organism expressing such a protein or can encode modified versions thereof. Such hybridizing polynucleotides can for instance be isolated from genomic libraries or cDNA libraries of bacteria, fungi, plants or animals.
Such hybridizing polynucleotides may be identified and isolated by using the polynucleotides encoding the microproteins described herein or parts or reverse complements thereof, for instance by hybridization according to standard methods (see for instance Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, N.Y., USA).
Such hybridizing polynucleotides also comprise fragments, derivatives and allelic variants of one of the polynucleotides encoding a microprotein as defined in any one of (a) to (c), as long as the polynucleotide encodes a polypeptide being capable of inhibiting tryptase. In this context, the term “derivative” means that the sequences of these polynucleotides differ from the sequence of one of the polynucleotides encoding a microprotein as defined supra in one or more positions and show a high degree of homology to these sequences, preferably within sequence ranges that are essential for protein function. Particularly preferred is that the derivative encodes an amino acid sequence comprising six cysteine residues which are connected via disulfide bonds so as to form a cystine knot.
The property of a polynucleotide to hybridize a nucleotide sequence may likewise mean that the polynucleotide encodes a polypeptide, which has a homology, that is to say a sequence identity, of at least 30%, preferably of at least 40%, more preferably of at least 50%, even more preferably of at least 60% and particularly preferred of at least 70%, especially preferred of at least 80% and even more preferred of at least 90% to the amino acid sequence of a microprotein as defined in any one of (a) to (c), supra. Moreover, the property of a polynucleotide to hybridize a nucleotide sequence may mean that the polynucleotides has a homology, that is to say a sequence identity, of at least 40%, preferably of at least 50%, more preferably of at least 60%, even more preferably of more than 65%, in particular of at least 70%, especially preferred of at least 80%, in particular of at least 90% and even more preferred of at least 95% when compared to a nucleotide sequence encoding a microprotein as defined in any one of (a) to (c), supra.
Preferably, the degree of homology is determined by comparing the respective sequence with the amino acid sequence of any one of SEQ ID NOs: 1 to 17. When the sequences which are compared do not have the same length, the degree of homology preferably refers to the percentage of amino acid residues or nucleotide residues in the shorter sequence which are identical to the respective residues in the longer sequence. The degree of homology can be determined conventionally using known computer programs such as the DNAstar program with the ClustalW analysis. This program can be obtained from DNASTAR, Inc., 1228 South Park Street, Madison, Wis. 53715 or from DNASTAR, Ltd., Abacus House, West Ealing, London W13 0AS UK (support@dnastar.com) and is accessible at the server of the EMBL outstation.
When using the Clustal analysis method to determine whether a particular sequence is, for instance, 80% identical to a reference sequence the settings are preferably as follows: Matrix: blosum 30; Open gap penalty: 10.0; Extend gap penalty: 0.05; Delay divergent: 40; Gap separation distance: 8 for comparisons of amino acid sequences. For nucleotide sequence comparisons, the Extend gap penalty is preferably set to 5.0.
Preferably, the degree of homology of, the hybridizing polynucleotide is calculated over the complete length of its coding sequence. It is furthermore preferred that such a hybridizing polynucleotide, and in particular the coding sequence comprised therein, has a length of at least 75 nucleotides and preferably at least 100 nucleotides.
Preferably, sequences hybridizing to a polynucleotide encoding a microprotein for use in connection with the invention comprise a region of homology of at least 90%, preferably of at least 93%, more preferably of at least 95%, still more preferably of at least 98% and particularly preferred of at least 99% identity to a polynucleotide encoding a specifically disclosed microprotein, wherein this region of homology has a length of at least 75 nucleotides and preferably of at least 100 nucleotides. Homology, moreover, means that there is a functional and/or structural equivalence between the compared polynucleotides or the polypeptides encoded thereby. Polynucleotides which are homologous to the above-described molecules and represent derivatives of these molecules are normally variations of these molecules having the same biological function. They may be either naturally occurring variations, preferably orthologs of a polynucleotide encoding a microprotein as defined in any one of (a) to (c), supra, for instance sequences from other alleles, varieties, species, etc., or may comprise mutations, wherein said mutations may have formed naturally or may have been produced by deliberate mutagenesis. The variants, for instance allelic variants, may be naturally occurring variants or variants produced by chemical synthesis or variants produced by recombinant DNA techniques or combinations thereof. Deviations from the polynucleotides encoding the above-described specific microproteins may have been produced, e.g., by deletion, substitution, insertion and/or recombination, e.g. by the fusion of portions of two or more different microproteins. Modification of nucleic acids, which can be effected to either DNA or RNA, can be carried out according to standard techniques known to the person skilled in the art (e.g. Sambrook and Russell, “Molecular Cloning, A Laboratory Manual”; CSH Press, Cold Spring Harbor, 2001 or Higgins and Hames (eds.) “Protein expression. A Practical Approach.” Practical Approach Series No. 202. Oxford University Press, 1999). Preferably, amplification of DNA is accomplished by using polymerase chain reaction (PCR) and the modification is used by appropriate choice of primer oligonucleotides, containing e.g. mutations in respect to the template sequence (see, e.g. Landt, Gene 96 (1990), 125-128). The polypeptides being variants of the concrete microproteins disclosed herein possess certain characteristics they have in common with said microproteins. These include for instance biological activity, molecular weight, immunological reactivity, conformation, etc., and physical properties, such as for instance the migration behavior in gel electrophoreses, chromatographic behavior, sedimentation coefficients, solubility, spectroscopic properties, stability, pH optimum, temperature optimum etc.
The biological activity of the microproteins for use in connection with the invention, in particular the activity of inhibiting tryptase can be tested by methods as described in the prior art and in the Examples.
A suitable assay for tryptase inhibition activity is described in Example 3. The calculation of the apparent Ki-values (also designated Ki_app) which are indicative for the tryptase inhibiting activity of a given microprotein may be conducted according to Morrison (1969). This calculation is described in further detail for the analogous measurement of trypsin inhibition in Example 4. Typically, microproteins encompassed by the uses of the present invention have a tryptase inhibiting activity with a Ki of not more than 1 mM, preferably not more than 0.5 mM, more preferably not more than 0.2 mM, still more preferably not more than 0.1 mM, further preferred not more than 0.05 mM, particularly preferred not more than 0.02 mM, especially preferred not more than 0.005 mM. Most preferred is a Ki of not more than 0.002 mM. It is understood that the values determined in the activity assays may vary within an error range typical for the particular assay system applied, preferably within a range of +/−20%, further preferred with +/−10% and particularly preferred within 5%.
It is further preferred that a microprotein for use in connection with the present invention additionally shows an inhibitory activity on trypsin. As is outlined in Example 4 (infra), a test for trypsin inhibition may be indicative for the formation of the correct folding topology. A suitable trypsin inhibition assay is described in Example 4 (infra) which is based on the methods described in Van Nostrand (1990) and Sinha (1991). Preferably, the microproteins for use in connection with the present invention show a Ki for trypsin in the range of not more than 1 nM and preferably of not more than 0.5 nM. Advantageously, in view of a high selectivity for tryptase which may be desirable for therapeutic applications, it is preferred that the microproteins for the uses of the invention show a comparatively low inhibitory activity with regard to other proteases, such as trypsin or blood co-aggulation factors.
The term “tryptasen” includes the four closely related enzymes so far known which are α-, I-, II/β- and III-tryptase sharing a sequence identity between 90 and 98% (Miller, 1998; Vanderslice, 1990). Tryptase is the major secretory protease of human mast cells and is proposed to be involved in neuropeptide processing and tissue inflammation. Mature human tryptase is a tetrameric glycosylated molecule, is heparin-associated and composed of heterogenous, catalytically active subunits (see, e.g. Vanderslice et al., 1990; Miller et al., 1989, Sommerhoff et al., 1999). Tryptase is stored in mast cell secretory granules. After mast cell activation, human tryptase can be found in various biologic fluids. In connection with the present invention, the preferred target of the microproteins is mast cell tryptase, more preferably β-tryptase or α-tryptase.
The microproteins for use in connection with the present invention may consist solely of amino acids, preferably naturally occurring amino acids. However, encompassed are also microproteins which are derivatized in accordance with techniques familiar to one skilled in peptide and polypeptide chemistry. Such derivatives may for instance include the replacement of one or more amino acids with analogues such as chemically modified amino acids, the cyclisation at the N- and C-termini or conjugation with functional moieties that may for instance improve the therapeutical effect of the microproteins. The inclusion of derivatized moieties may, e.g., improve the stability, solubility, the biological half life or absorption of the polypeptide. The moieties may also reduce or eliminate any undesirable side effects of the microprotein. An overview for suitable moieties can be found, e.g., in Remington's Pharmaceutical Sciences by E. W. Martin (18^thed., Mack Publishing Co., Easton, Pa. (1990)). Polyethylene glycol (PEG) is an example for such a chemical moiety which may be used for the preparation of therapeutic proteins. The attachment of PEG to proteins has been shown to protect them against proteolysis (Sada et al., J. Fermentation Bioengineering 71 (1991), 137-139). Various methods are available for the attachment of certain PEG moieties to proteins (for review see: Abuchowski et al., in “Enzymes as Drugs”; Hoicerberg and Roberts, eds. (1981), 367-383). Generally, PEG molecules are connected to the protein via a reactive group found on the protein. Amino groups, e.g. on lysines or the amino terminus of the protein are convenient for this attachment among others. Further chemical modifications which may be used for preparing therapeutically useful microproteins include the addition of cross-linking reagents such as glutaraldehyde, the addition of alcohols such as glycol or ethanol or the addition of sulhydroxide-blocking or modifying reagents such as phosphorylation, acetylation, oxidation, glucosylation, ribosylation of side chain residues, binding of heavy metal atoms and/or up to 10 N-terminal or C-terminal additional amino acid residues. Preferably, the latter residues are histidines or more preferably the residues RGS-(His)₆.
A further suitable derivatisation may be the fusion with one or more additional amino acid sequences. In such fusion proteins, the additional amino acid sequence may be linked to the microprotein sequence by covalent or non-covalent bonds, preferably peptide bonds. The linkage can be based on genetic fusion according to methods known in the art or can, for instance, be performed by chemical cross-linking as described in, e.g., WO 94/04686. The additional amino acid sequence may preferably be linked by a flexible linker, advantageously a polypeptide linker, wherein said polypeptide linker may comprise plural, hydrophilic, peptide-bonded amino acids of a length sufficient to span the distance between the C-terminal end of the tertiary structure formed by the additional sequence and the N-terminal end of the microprotein or vice versa. The fusion protein may comprise a cleavable linker or cleavage site for proteinases (e.g., CNBr cleavage or thrombin cleavage site; see Example 4, supra).
Furthermore, said additional amino acid sequence typically has a predefined specificity or function, e.g., nuclear localization signals, transactivating domains, DNA-binding domains, hormone-binding domains, protein tags (GST, GFP, h-myc peptide, FLAG, HA peptide).
In a preferred embodiment, the microprotein is fused to barnase, preferably to inactive barnase.
“Barnase” is an extracellular ribonuclease from Bacillus amyloliquefaciens (Fersht, 1993; Paddon, 1987). It has been shown in connection with the present invention that the fusion of a microprotein to barnase can bring about a number of advantages. In particular, when the microprotein is produced recombinantly by the expression in a host cell, such as E. coli, the fused barnase moiety has solubilizing effect. This may greatly reduce or completely avoid the need to isolate the expressed microprotein from inclusion bodies and to subsequently oxidize it to obtain the active disulphide-bonded conformation. Further advantages lie in the possibility to use barstar-barnase affinity for purifying the expressed microprotein from the crude extract (see Example 5, infra) as well as in the feasibility to crystallize the fusion protein and to analyze the three-dimensional structure by using the known barnase structure as an input for a facilitated structure modeling (see Example 6).
If the barnase fusion is constructed using an active barnase, it may be necessary to co-express the barnase inhibitor barstar in sufficient amount since otherwise the barnase has a lethal effect on the host cell (Martsev, 2004). In view of this, it may be preferable to use an inactive mutant of barnase such as the one having His-102 replaced by Ala (see Example 4, infra). Thereby, the advantages connected with barnase fusions are maintained, while it is not necessary to additionally co-express barstar.
The microprotein for use in connection with the present invention may, e.g., be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). For the provision of the microprotein via recombinant expression, an overview of different expression systems is for instance contained in Methods in Enzymology 153 (1987), 385-516, in Bitter et al. (Methods in Enzymology 153 (1987), 516-544) and in Sawers et al. (Applied Microbiology and Biotechnology 46 (1996), 1-9), Billman-Jacobe (Current Opinion in Biotechnology 7 (1996), 500-4), Hockney (Trends in Biotechnology 12 (1994), 456-463), Griffiths et al., (Methods in Molecular Biology 75 (1997), 427-440). An overview of yeast expression systems is for instance given by Hensing et al. (Antonie van Leuwenhoek 67 (1995), 261-279), Bussineau et al. (Developments in Biological Standardization 83 (1994), 13-19), Gellissen et al. (Antonie van Leuwenhoek 62 (1992), 79-93, Fleer (Current Opinion in Biotechnology 3 (1992), 486-496), Vedvick (Current Opinion in Biotechnology 2 (1991), 742-745) and Buckholz (Bio/Technology 9 (1991), 1067-1072).
Expression vectors have been widely described in the literature. As a rule, they contain not only a selection marker gene and a replication-origin ensuring replication in the host selected, but also a bacterial or viral promoter, and in most cases a termination signal for transcription. Between the promoter and the termination signal there is in general at least one restriction site or a polylinker which enables the insertion of a coding DNA sequence.
It is possible to use promoters ensuring constitutive expression of the gene and inducible promoters which permit a deliberate control of the expression of the gene. Bacterial and viral promoter sequences possessing these properties are described in detail in the literature. Regulatory sequences for the expression in microorganisms (for instance E. coli, S. cerevisiae) are sufficiently described in the literature. Promoters permitting a particularly high expression of a downstream sequence are for instance the T7 promoter (Studier et al., Methods in Enzymology 185 (1990), 60-89), lacUV5, trp, trp-lacUV5 (DeBoer et al., in Rodríguez and Chamberlin (Eds), Promoters, Structure and Function; Praeger, New York, (1982), 462-481; DeBoer et al., Proc. Natl. Aced. Sci. USA (1983), 21-25), Ip1, rac (Boros et al., Gene 42 (1986), 97-100). Inducible promoters are preferably used for the synthesis of proteins. These promoters often lead to higher protein yields than do constitutive promoters. In order to obtain an optimum amount of protein, a two-stage process is often used. First, the host cells are cultured under optimum conditions up to a relatively high cell density. In the second step, transcription is induced depending on the type of promoter used. In this regard, a tac promoter is particularly suitable which can be induced by lactose or IPTG (=isopropyl-β-D-thiogalactopyranoside) (deBoer et al., Proc. Natl. Acad. Sci. USA 80 (1983), 21-25). Termination signals for transcription are also described in the literature.
Transformation or transfection of suitable host cells can be carried out according to one of the methods mentioned above. The host cell is cultured in nutrient media meeting the requirements of the particular host cell used, in particular in respect of the pH value, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements etc. The microprotein can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
Depending upon the host employed in a recombinant production procedure, the expressed polypeptide may be glycosylated or may be non-glycosylated. The polypeptide may also include an initial methionine amino acid residue.
Preferably, the microprotein is first recombinantly produced as a fusion protein, advantageously with barnase, and then released from the fusion partner by cleavage at the fusion linkage and subsequent separation.
Likewise, the microprotein may be produced by any suitable standard peptide synthesis procedure as described in the art (see, e.g., Merrifield, Methods Enzymol. 289 (1997), 3-13; Hancock, Mol. Biotechnol. 4 (1995), 73-86; and Merrifield, Adv. Enzymol. Relat. Areas Mol. Biol. 32 (1969), 221-296), such as for instance that used in Example 1 (infra).
For administration to a subject, the microprotein may be formulated as a pharmaceutical composition. Such pharmaceutical compositions comprise a therapeutically effective amount of the microprotein and, optionally, a pharmaceutically acceptable carrier. The pharmaceutical composition may be administered with a physiologically acceptable carrier to a patient, as described herein. In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency or other generally recognized pharmacopoeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin (see supra). Such compositions will contain a therapeutically effective amount of the aforementioned microprotein, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.
In another preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilised powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration. The pharmaceutical composition for use in connection with the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
In vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. Preferably, the pharmaceutical composition is administered directly or in combination with an adjuvant.
In the context of the present invention the term “subject” means an individual in need of inhibiting the activity of tryptase. Preferably, the subject is a vertebrate, even more preferred a mammal, particularly preferred a human.
The term “administered” means administration of a therapeutically effective dose of the aforementioned pharmaceutical composition comprising the microprotein to an individual. By “therapeutically effective amount” is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As is known in the art and described above, adjustments for systemic versus localized delivery, age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art.
The methods are applicable to both human therapy and veterinary applications. The compounds described herein having the desired therapeutic activity may be administered in a physiologically acceptable carrier to a patient, as described herein. Depending upon the manner of introduction, the compounds may be formulated in a variety of ways as discussed below. The concentration of therapeutically active compound in the formulation may vary from about 0.1-100 wt %. The agents may be administered alone or in combination with other treatments. The administration of the pharmaceutical composition can be done in a variety of ways as discussed above, including, but not limited to, orally, subcutaneously, intravenously, intra-arterial, intranodal, intramedullary, intrathecal, intraventricular, intranasally, intrabronchial, transdermally, intranodally, intrarectally, intraperitoneally, intramuscularly, intrapulmonary, vaginally, rectally, or intraocularly. In some instances, for example, in the treatment of wounds and inflammation, the pharmaceutically effective agent may be directly applied as a solution dry spray.
The attending physician and clinical factors will determine the dosage regimen. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. A typical dose can be, for example, in the range of 0.001 to 1000 μg; however, doses below or above this exemplary range are envisioned, especially considering the aforementioned factors.
The dosages are preferably given once a week, however, during progression of the treatment the dosages can be given in much longer time intervals and in need can be given in much shorter time intervals, e.g., daily. In a preferred case the immune response is monitored using methods known to those skilled in the art and dosages are optimized, e.g., in time, amount and/or composition. Progress can be monitored by periodic assessment. The pharmaceutical composition may be administered locally or systemically. Administration will preferably be parenterally, e.g., intravenously. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
In a preferred embodiment, the pharmaceutical composition is formulated as an aerosol for inhalation.
In a further preferred embodiment, the pharmaceutical composition is formulated for the oral route of administration.
In a preferred embodiment, the present invention refers to the-above-described use, wherein the microprotein is administered to the patient in the form of a gene delivery vector which expresses the microprotein. Furthermore preferred is that the cells are transformed with the vector ex vivo and the transformed cells are administered to the patient.
According to these embodiments, the pharmaceutical composition for use in connection with the present invention is a vector comprising and capable of expressing a polynucleotide encoding a microprotein as described above. Such a vector can be an expression vector and/or a gene delivery vector. Expression vectors are in this context meant for use in ex vivo gene therapy techniques, i.e. suitable host cells are transfected outside the body and then administered to the subject. Gene delivery vectors are referred to herein as vectors suited for in vivo gene therapeutic applications, i.e. the vector is directly administered to the subject, either systemically or locally. The vector referred to herein may only consist of nucleic acid or may be complexed with additional compounds that enhance, for instance, transfer into the target cell, targeting, stability and/or bioavailability, e.g. in the circulatory system. Examples of such additional compounds are lipidic substances, polycations, membrane-disruptive peptides or other compounds, antibodies or fragments thereof or receptor-binding molecules specifically recognizing the target cell, etc. Expression or gene delivery vectors may preferably be derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses or bovine papilloma virus, and may be used for delivery into a targeted cell population, e.g. into cells of the respiratory tract. Methods which are well known to those skilled in the art can be used to construct recombinant expression or gene delivery vectors; see, for example, the techniques described in Sambrook and Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (2001) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1989). Alternatively, the vectors can be reconstituted into liposomes for delivery to target cells. The vectors containing the a microprotein-encoding polynucleotide can be transferred into a host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment or electroporation may be used for other cellular hosts (see Sambrook, supra).
Suitable vectors and methods for ex-vivo or in-vivo gene therapy are described in the literature and are known to the person skilled in the art; see, e.g., Giordano, Nature Medicine 2 (1996), 534-539; Schaper, Circ. Res. 79 (1996), 911-919; Anderson, Science 256 (1992), 808-813; Isner, Lancet 348 (1996), 370-374; Muhlhauser, Circ. Res. 77 (1995), 1077-1086; Wang, Nature Medicine 2 (1996), 714-716; WO 94/29469; WO 97/00957 or Schaper, Current Opinion in Biotechnology 7 (1996), 635-640, and references cited therein. The vectors for use in this embodiment of the invention may be designed for direct introduction or for introduction via liposomes or viral vectors (e.g. adenoviral, retroviral) into the cell. Preferred gene delivery vectors include baclovirus-, adenovirus- and vaccinia virus-based vectors. These are preferrably non-replication competent.
The use of the present invention preferably refers to a disease selected from the group consisting of asthma, inflammation, psoriasis, pulmonary fibrosis, an interstitial lung disease, rheumatoid arthritis, gingivitis, peridontitis, an allergic reaction, allergic rhinitis, osteoarthritis, atherosclerosis, angiogenesis, multiple sclerosis and cancer.
Due to their capacity to inhibit tryptase, the microproteins described herein-above can be utilized according to the present invention in order to prevent or treat diseases or conditions in which tryptase is a pathology-mediating agent. This refers in particular to mast cell-mediated inflammatory disorders. One aspect in this context especially refers to inflammatory diseases associated with the respiratory tract, such as asthma, psoriasis or allergic rhinitis. It is in particular contemplated to use microproteins for preventing or treating the late phase bronchoconstriction and airway hyperresponsiveness associated with chronic asthma. In addition, the use of the present invention refers to the treating of other types of immunomediated inflammatory disorders, such as psoriasis, rheumatoid arthritis, conjunctivitis as well as inflammatory bowel disease. A further preferred use refers to the use of microproteins against acute myeloid leukemia (AML) where it has been shown that the myeloblasts of these patients express alpha-tryptase in excess over beta-tryptase and secrete pro-alpha-tryptase constitutively (Sperr, 2001, 2002). The present invention also includes the use of the above-described microproteins as anti-inflammatory agents. In this function, the microprotein may be a component of creams for topical administration, e.g., to insect, snake or scorpion bites, or to skin affected by dermatitis.
In a further aspect, the present invention relates to a method for the treatment of an individual in need of inhibiting the activity of tryptase comprising administering to said individual an effective amount of a pharmaceutical composition comprising the microprotein as defined above or a polynucleotide encoding said microprotein and, optionally, a pharmaceutically acceptable carrier.
With regard to this embodiment, the above explanations, in particular concerning the formulation of pharmaceutical compositions, mode of administration and diseases, likewise apply.
In accordance with the aforesaid, the present invention also refers to the use of the microprotein as defined above or a polynucleotide encoding said microprotein for inhibiting tryptase activity. This embodiment may refer to tryptase inhibition in vivo or in vitro, preferably in vitro.
Another embodiment of the present invention relates to the use of the microprotein as defined above for purifying tryptase.
For this purpose, the microprotein is preferably bound to a solid support. The term “purifying” includes in this context also removing, isolating or extracting tryptase. The support may comprise any suitable inert material and includes gels, magnetic and other beads, microspheres, binding columns and resins. For carrying out the present embodiment, standard protocols for affinity purification of proteins known to a skilled person are applicable.
In a further aspect, the present invention relates to the use of the microprotein as defined above as a carrier molecule for tryptase or a derivative thereof.
This application may in particular refer to the use of the microprotein as a carrier molecule for tryptase and tryptase-related compounds, such as in creams, oils, powders or pills, to provide slow release of the bound components.
Also, the present invention relates to the use of microproteins as defined above for detecting and/or quantifying tryptase in a sample.
The quantification of tryptase levels, preferably human mast cell tryptase levels may, for example, be applicable for blood, nasal lavage fluids, tissues or food products. In connection with this application, the microproteins may be employed together with means of detection (for example radiolabel, antibodies, enzymes such as alkaline phosphatases, peroxidases and luciferases) that allow the accurate quantification of tryptase in the sample to be tested. Accordingly, the present invention refers to corresponding kits comprising one or more microproteins and, preferably, suitable detection means. Such kits may resemble radioimmunoassay or ELISA kits, with the proteins of the invention acting as binding molecules, instead of antibodies directed against tryptase. The detection of tryptase may in particular be used for the detection of mast cells.
Any technique common to the art may be used in a detection method according to the present embodiment and may comprise immunocytochemical and histological techniques, in which the microprotein may be used in combination with antisera (such as anti-McoTI-II antisera), or in which the molecule is directly coupled to a label or dye, such as a fluorescent dye, e.g. FITC. In another embodiment, the microprotein may be fused either genetically or synthetically to another protein such as an alkaline phosphatase, luciferase or peroxidase in order to facilitate its detection. Other methods to detect tryptase-containing cells or samples may involve blotting techniques (Towbin et al, 1979), gel retardation, affinity chromatography, or any of the other suitable methods that are used in the art.
Moreover, the present invention relates to a method for diagnosing a disorder associated with an aberrant abundance of tryptase in a given cell, tissue, organ or organism, comprising

(a) contacting a sample from said cell, tissue, organ or organism with a microprotein as defined above under conditions allowing binding between tryptase and the microprotein;
(b) determining the amount of the microprotein bound to tryptase; and
(c) diagnosing a disorder when the determined amount is above or below a standard amount.

In this context, the microprotein may be used in the form of a diagnostic composition which optionally comprises suitable means for detection. The microproteins described above can be utilized in liquid phase or bound to a solid phase carrier. Corresponding affinity assays may be carried out either in a competitive or a non-competitive fashion. Such affinity assays may be devised in a way analogous to the radioimmunoassay (RIA), the sandwich (immunometric assay) or the Western blot assay. The microproteins can be bound to many different carriers or used to isolate cells specifically bound to said polypeptides. Examples of well-known carriers include glass, polystyrene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dextran, nylon, amyloses, natural and modified celluloses, polyacrylamides, agaroses, and magnetite. The nature of the carrier can be either soluble or insoluble.
There are many different labels and methods of labeling known to those of ordinary skill in the art. Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, colloidal metals, fluorescent compounds, chemiluminescent compounds, and bioluminescent compounds.
The term “aberrant abundance” refers to a concentration of tryptase in a given cell, tissue, organ or organism which is significantly below or above a standard concentration of tryptase for said cell, tissue, organ or organism of a healthy individual so that it is associated with a disease to be diagnosed, preferably one of the diseases mentioned above. Preferably, the tryptase concentration when aberrantly abundant is reduced to not more than 75%, preferably not more than 50%, more preferably not more than 25%, and particularly preferred to not more than 10% of the standard concentration. Alternatively, the tryptase concentration in the aberrant state is preferably increased to at least 150%, more preferably to at least 200% and still further preferred to at least 500% of the standard concentration.
According to the above, the present invention also refers to the use of the microproteins as defined above or a polynucleotide encoding said microprotein for diagnosing a disease related to an aberrant expression of tryptase.
In a further aspect, the present invention also refers to a kit comprising a microprotein as defined above and a manual for carrying out the above-defined diagnostic method or the corresponding use and, optionally, means of detection or a standard tryptase sample.
The components of the kit of the present invention may be packaged in containers such as vials, optionally in buffers and/or solutions. If appropriate, one or more of said components may be packaged in one and the same container. Additionally or alternatively, one or more of said components may be adsorbed to a solid support such as, e.g., a nitrocellulose filter or nylon membrane, or to the well of a microtitre-plate.
A further embodiment of the present invention relates to a fusion protein comprising an inactive barnase.
The advantages of using a fusion protein comprising an inactive barnase have already been mentioned above in connection with the production of microprotein fusions. Accordingly, the fusion of a given protein to be expressed to inactive barnase can be summarized as follows:

(i) Fusion with barnase may lead to an improved solubility of the protein to be expressed. This may be explained by a chaperone-like effect the barnase has on its fusion partner. It is of, note that this effect is observed irrespective of whether the barnase is fused to the N- or to the C-terminus of the fusion partner. The solubilizing function of barnase may facilitate the recombinant production of a desired protein, in particular when it is to be expressed in the cytoplasm of a host organism, wherein the host organism preferably is a microorganism, advantageously a bacterium, such as E. coli. For instance, the problem of resolving inclusion bodies concomitant with a subsequent renaturation of the expressed protein may be overcome by using a barnase fusion. The useful effect of improving solubility of expressed proteins is already described for active barnase (Martsev, 2004).
(ii) A particular improvement associated with the use of inactive barnase compared to an active one lies in the fact that the experimental requirements for the expression of the fusion protein are significantly reduced because it is no longer necessary to co-express the barnase inhibitor barstar. Without its co-expression, barnase activity has a lethal effect on the host cell (Martsev, 2004). Inactive barnase is already known in the art, e.g. from Jucovic (1995). However, it could not have been foreseen whether an inactivated barnase would show the advantages of the active barnase in a fusion protein expression. This, however, has been shown convincingly in the experiments described in Examples 2 and 4, infra. The barnase fusion clones mentioned in Martsev (2004) to bear functionally significant mutations in the barnase module are preferably no subject-matter of the present invention.
(iii) A further surprising advantage of a fusion with inactive barnase is the fact that the expression product of this fusion can easily be recovered from the crude preparation by applying the strong binding interaction between barnase and barstar. Such an approach has not yet been described for barnase fusions in general. In addition, it would have been uncertain whether inactivated barnase would indeed work in an affinity chromatography with barstar as binding moiety. However, this has convincingly been proven in the experiment described in Example 5, infra.
(iv) Furthermore, based on the barnase moiety within the fusion protein, the fusion protein can be combined non-covalently, but nevertheless stably under physiological conditions with a second fusion protein which comprises barstar. Thereby, bi- or multivalent functions, such as for instance multiple microproteins, can be combined within one structure. This principle is described in Deyev (2003).

In a further aspect, the present invention also relates to fusion proteins comprising barnase and a microprotein. Preferably, said barnase is inactive.
Microproteins are known to a person skilled in the art. Preferred microproteins are in this context those which have been defined above in connection with the tryptase inhibiting function of microproteins.
With regard to the microprotein-barnase fusions, the same applies in regard to advantages as that outlined above under (i) to (iv). In addition, these fusion proteins also have the advantage of generally facilitating the recombinant expression of microproteins which, without the fusion to barnase, might not be expressible at all or only to an unsatisfactory extent. Furthermore, the barnase fusion may also facilitate the elucidation of the three-dimensional structure of a crystal from the microprotein. This aspect is described in more detail further below.
With regard to the construction principles and ways of production of the fusion proteins of the invention, it is herewith referred to corresponding standard techniques known to a person skilled in the art and, in particular, to the above explanations concerning fusion proteins set out in connection with the aspect of the invention concerning the therapeutical use of microproteins for inhibiting tryptase. It is preferred that the fusion proteins of the invention contain a cleavable linker between the barnase and the other portion so that the two portions may be readily separated from one another after expression. Corresponding linker sequences are well-known to the skilled person and examples thereof are mentioned herein. Furthermore, it is contemplated that the fusion protein of the invention may contain additional amino acid sequences along with the particular function the user intends.
A preferred embodiment of the present invention relates to nucleic acid molecules comprising a nucleotide sequence encoding the above-defined fusion protein of the invention.
The nucleic acid molecules of the invention can be any type of polynucleotide, e.g. DNA molecules or RNA molecules or combinations thereof. These polynucleotides can be obtained by any suitable technique known in the art, they, for instance, may be produced synthetically or by recombinant techniques, in vivo or in vitro, such as PCR. Such polynucleotides may comprise any modification thereof that is known in the state of the art (see, e.g., U.S. Pat. No. 5,525,711, U.S. Pat. No. 4,711,955, U.S. Pat. No. 5,792,608 or EP 302175 for examples of modifications). Such polynucleotides may be single- or double-stranded, linear or circular, without any size limitation. Preferably, the nucleic acid molecules are DNA, cDNA or mRNA.
The nucleic acid molecule encoding a fusion protein of the invention will generally be a recombinant nucleic molecule. The term “recombinant nucleic acid molecule” refers to any nucleic acid molecule that has been produced by a technique useful for artificially combining nucleic acid molecules or parts thereof that were beforehand not connected as in the resulting recombinant nucleic acid molecule. Suitable techniques are for example available from the prior art, as represented by Sambrook and Russell, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (2001) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1989).
In a preferred embodiment, the nucleic acid molecule comprised in the recombinant nucleic acid molecule is operably linked to expression control sequences allowing expression in prokaryotic or eukaryotic cells. Suitable expression control sequences include promoters that are applicable in the target host organism. Such promoters are well known to the person skilled in the art for diverse hosts from the kingdoms of prokaryotic and eukaryotic organisms and are described in literature. For example, such promoters can be isolated from naturally occurring genes or can be synthetic or chimeric promoters. Likewise, the promoter can already be present in the target genome and may be linked to the coding sequence by a suitable technique known in the art, such as for example homologous recombination.
The present invention also relates to vectors, particularly plasmids, cosmids, viruses and bacteriophages used conventionally in genetic engineering, that comprise a nucleic acid molecule of the invention.
In a preferred embodiment of the invention, the vectors of the invention are suitable for the transformation of fungal cells, plant cells, cells of microorganisms or animal cells, in particular mammalian cells. Preferably, such vectors are suitable for the transformation of microorganisms, such as yeast or bacteria, in particular of E. coli. Methods which are well known to those skilled in the art can be used to construct recombinant vectors; see, for example, the techniques described in Sambrook and Russell, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (2001) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1989). Alternatively, the vectors may be liposomes into which the recombinant nucleic acid molecules of the invention can be reconstituted for delivery to target cells.
Advantageously, the nucleic acid molecules contained in the vectors and encoding a fusion protein of the invention are operably linked to one or more expression of the fusion protein in a host cell.
The expression of the nucleic acid molecules of the invention in prokaryotic or eukaryotic cells, for instance in Escherichia coli, may be interesting because it permits a more precise characterization of the biological activities of the proteins encoded by these molecules. In addition, it is possible to insert different additional mutations into the nucleic acid molecules by methods usual in molecular biology (see for instance Sambrook and Russell, 2001, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), leading to the synthesis of proteins possibly having modified biological properties. In this regard, it is on one hand possible to produce deletion mutants in which nucleic acid molecules are produced by progressive deletions from the 5′ or 3′ end of the coding DNA sequence, and said nucleic acid molecules lead to the synthesis of correspondingly shortened proteins. On the other hand, the introduction of point mutations is also conceivable at positions at which a modification of the amino acid sequence for instance influences the biological activity of the protein.
For genetic engineering in prokaryotic cells, the nucleic acid molecules of the invention or parts of these molecules can be introduced into plasmids which permit mutagenesis or sequence modification by recombination of DNA sequences. Standard methods (see Sambrook and Russell, 2001, Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, NY, USA) allow base exchanges to be performed or natural or synthetic sequences to be added. DNA fragments can be connected to each other by applying adapters and linkers to the fragments. Moreover, engineering measures which provide suitable restriction sites or remove surplus DNA or restriction sites can be used. In those cases, in which insertions, deletions or substitutions are possible, in vitro mutagenesis, “primer repair”, restriction or ligation can be used. In general, a sequence analysis, restriction analysis and other methods of biochemistry and molecular biology are carried out as analysis methods.
In a further embodiment, the invention relates to a method for producing cells capable of expressing a fusion protein according to the invention comprising genetically engineering cells with an above-described nucleic acid molecule, recombinant nucleic acid molecule or vector of the invention. Encompassed by the present invention are likewise cells obtainable by this method.
Another embodiment of the invention relates to host cells, in particular prokaryotic or eukaryotic cells, genetically engineered with an above-described nucleic acid molecule or vector of the invention, and to cells descended from such transformed cells and containing said nucleic acid molecule or vector of the invention and to cells obtainable by the above-mentioned method.
In a preferred embodiment the host cell is genetically engineered in such a way that it contains a nucleic acid molecule stably integrated into the genome. More preferably the nucleic acid molecule can be expressed so as to lead to the production of the encoded fusion protein.
An overview of different expression systems is for instance contained in Methods in Enzymology 153 (1987), 385-516, in Bitter et al. (Methods in Enzymology 153 (1987), 516-544) and in Sawers et al. (Applied Microbiology and Biotechnology 46 (1996), 1-9), Billman-Jacobe (Current Opinion in Biotechnology 7 (1996), 500-4), Hockney (Trends in Biotechnology 12 (1994), 456-463), Griffiths et al., (Methods in Molecular Biology 75 (1997), 427-440). An overview of yeast expression systems is for instance given by Hensing et al. (Antoine von Leuwenhoek 67 (1995), 261-279), Bussineau (Developments in Biological Standardization 83 (1994), 13-19), Gellissen et al. (Antoine van Leuwenhoek 62 (1992), 79-93, Fleer (Current Opinion in Biotechnology 3 (1992), 486-496), Vedvick (Current Opinion in Biotechnology 2 (1991), 742-745) and Buckholz (Bio/Technology 9 (1991), 1067-1072).
Expression vectors have been widely described in the literature. As a rule, they contain not only a selection marker gene and a replication origin ensuring replication in the host selected, but also a bacterial or viral promoter and, in most cases, a termination signal for transcription. Between the promoter and the termination signal there is in general at least one restriction site or a polylinker which enables the insertion of a coding nucleotide sequence. It is possible to use promoters ensuring constitutive expression of the gene and inducible promoters which permit a deliberate control of the expression of the gene. Bacterial and viral promoter sequences possessing these properties are described in detail in the literature. Regulatory sequences for the expression in microorganisms (for instance E. coli, S. cerevisiae) are sufficiently described in the literature. Promoters permitting a particularly high expression of a downstream sequence are for instance the T7 promoter (Studier et al., Methods in Enzymology 185 (1990), 60-89), lacUV5, trp, trp-lacUV5 (DeBoer et al., in Rodriguez and Chamberlin (Eds), Promoters, Structure and Function; Praeger, New York, (1982), 462-481; DeBoer et al., Proc. Natl. Acad. Sci. USA (1983), 21-25), Ip1, rac (Boros et al., Gene 42 (1986), 97-100). Inducible promoters are preferably used for the synthesis of proteins. These promoters often lead to higher protein yields than do constitutive promoters. In order to obtain an optimum amount of protein, a two-stage process is often used. First, the host cells are cultured under optimum conditions up to a relatively high cell density. In the second step, transcription is induced depending on the type of promoter used. In this regard, a tac promoter is particularly suitable which can be induced by lactose of IPTG (isopropyl-β-D-thiogalactopyranoside) (deBoer et al., Proc. Natl. Acad. Sci. USA 80 (1983), 21-25). Termination signals for transcription are also described in the literature.
The transformation of the host cell with a nucleic acid molecule or vector according to the invention can be carried out by standard methods, as for instance described in Sambrook and Russell, (Molecular Cloning: A Laboratory Manual (2001), Cold Spring Harbor Press, New York; Methods in Yeast Genetics, A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, 1990). The host cell is cultured in nutrient media meeting the requirements of the particular host cell used, in particular in respect of the pH value, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements etc. The protein according to the present invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromography and lectin chromatography. Depending on whether the protein is expressed intra- or extracellularly, the protein can be recovered from the cultured cells and/or from the supernatant of the medium. Protein refolding steps can be used, as necessary, in completing configuration of the protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
Accordingly, a further embodiment of the invention relates to a method for preparing a fusion protein comprising culturing the above-described host cells under conditions that the fusion protein encoded by the nucleic acid molecule with which said host cell is genetically engineered is expressed; and recovering the fusion protein from the culture.
In a particular preferred embodiment, the method of the invention for preparing a fusion protein comprises a step in which the fusion protein is purified by way of binding the barnase moiety of the fusion protein to barstar.
This application is in line with the above explanations according to which it is an advantageous property of the fusion protein of the invention that it can be purified by making use of the strong, but reversible binding activity between barnase and barstar. The feasibility of this principle has been demonstrated in Example 5, infra.
Moreover, the present invention relates to a fusion protein obtainable by the method for its production as described above.
The fusion protein of the present invention may be glycosylated or may be non-glycosylated.
The fusion protein of the invention may also include an initial methionine amino acid residue. The fusion protein according to the invention may be further modified to contain additional chemical moieties not normally part of the protein. Those derivatized moieties may, e.g., improve the stability, solubility, the biological half life or absorption of the protein. The moieties may also reduce or eliminate any undesirable side effects of the protein and the like. An overview for these moieties can be found, e.g., in Remington's Pharmaceutical Sciences (18^thedition, Mack Publishing Co., Easton, Pa. (1990)). Particular examples of suitable protein modifications are described above.
The present invention relates in a further embodiment to a method of detecting or purifying the fusion protein of the invention comprising the step of contacting the fusion protein with barstar. Preferably, in this method, barstar is immobilized. For immobilization any conceivable solid support may be used along with the particular intended application, and may include any suitable inert material such as gels, magnetic or other beads, microspheres, binding columns and resins. For detection purposes, barstar may preferably be coupled to a detectable moiety. Corresponding suitable moieties are described in the literature and examples are given above in connection with tryptase-detection and corresponding diagnostic methods.
Detection as well as purification may be carried out in accordance with techniques familiar to a skilled person.
Furthermore, the present invention also relates to the use of the fusion proteins of the invention for producing a crystal of said fusion protein.
In a further aspect, the present invention relates to a crystal of a microprotein fused with barnase.
The provision of the crystal of the invention is connected with a number of improvements over the prior art. For instance, the presence of the barnase in the microprotein fusion facilitates easy crystallizing of microproteins, apparently because barnase is good to crystallize. Heretofore, it was only in rare cases possible to achieve the crystallization of a solitary microprotein, i.e. without a bound target protein (e.g. trypsin) (Thaimattam, Acta Crystallogr. D. Biol. Crystallogr. 58 (2002), 1448-1461). The co-crystallization of a microprotein together with bound trypsin has been reported by Chakraborty (2001), Zhu (J. Protein Chem. 18 (1999), 505), Ay (Acta Crystallogr. D 59 (2003), 247) and Bode (FEBS L. 242 (1989), 285). Often crystallization of a microprotein is hampered because a target protein is not available in sufficient amounts or does not undergo crystallization. These difficulties have been overcome by the provision of the crystal of the invention since a solitary microprotein was shown to be well amenable to crystallization when it is fused to barnase (see Example 6, infra).
Moreover, it was surprisingly found that the presence of the barnase in the crystal does not influence the structure analysis of the fused microprotein.
A further advantage of the fusion to barnase lies in the fact that the already known barnase structure (Baudet, J. Mol. Biol. 219 (1991), 123-132; Martin, Acta Crystallogr. D. Biol. Crystallogr. 55 (1999), 386-398) may be utilized as a starting point for modelling the structure of the whole fusion protein, and thereby of the microprotein. The barnase structure data can be entered into the algorithm applied for determining the structure of the crystallized fusion protein. Thus, it is possible to resolve the structure of the microprotein without having any previous knowledge on its structure, because the diffraction data of the crystal can be interpreted starting from the known barnase structure.
The microprotein structure retrievable from the crystal of the invention may be of use for analyzing the topology of the binding site to the target molecule. Based on the information obtainable from such an analysis, it may for example be possible to optimize the binding of a microprotein by introducing chemical modifications in the structure of the microprotein, e.g. by changing one or more amino acid residues in the binding site. This has already been successfully practiced, for instance, with the microprotein EETI-II in connection with its inhibitory activity upon porcine pancreatic elastase (Hilpert, J. Biol. Chem. 278 (2003), 24986-24993).
Additionally, the elucidation of the microprotein structure promoted by the provision of the crystal of the invention may be beneficial for the construction of graftings onto microproteins. Microproteins are generally considered as being good carriers for peptide functions, such as peptides having a therapeutical effect. The introduction of such peptide sequences, also called “grafting”, into sites not essential for folding of the microprotein may for instance improve stability and bioavailability of the peptide in the subject to whom it is administered. Corresponding microprotein grafting approaches are for example described in WO 01/27147 and WO 01/34829. By the elucidation of the microprotein structure based on the crystal of the invention, the design of such grafting constructs may be improved. For example, the selection of suitable sites for introducing such a peptide into a microprotein may now be done more specifically. Also, microproteins comprising a grafted peptide may likewise be contained in a crystal of the invention and therefore their structure can be directly determined. This may, for example, yield a further optimization of the peptide display and target binding by rational design methods.
Such specific interventions are now greatly facilitated by the provision of the crystals of the invention and corresponding methods for producing them. A further advantage of the use of a fusion to barnase is the fact that this fusion protein can be readily purified by affinity chromatography using barstar as binding moiety.
The crystal of the invention may harbor any microprotein known to a person skilled in the art. Preferably, it is a microprotein defined above in connection with the uses of the microproteins for inhibiting tryptase. In a particularly preferred embodiment, the microprotein-barnase fusion contained in the crystal comprises the amino acid sequence set forth in SEQ ID NO: 19. It is furthermore preferred that the barnase contained in the crystal of the invention is inactive. In accordance with the explanations given further above, the use of an inactive barnase has the advantage that the co-expression of barstar can be omitted.
In a preferred embodiment, the crystal of the present invention belongs to space group C222₁. Furthermore, it is preferred that the crystal of the invention, has the unit cell dimensions of a=73.981 Å, b=217.820 Å and c=58.322 Å, α=β=γ=90°. A particularly preferred crystal of the invention has the crystal coordinates as depicted in Table 6, infra. Also preferred is a crystal the coordinates of which differ from the coordinates in Table 6 by a root mean square deviation of the C-alpha atoms by less than 3 Å, preferably by less than 2 Å and further preferred by less than 1 Å. Most preferably the crystal of the invention is obtainable by the method described in Example 6.
The term “crystal” as used herein refers to an ordered state of matter. Since it cannot be excluded that the crystallized proteins are not purified to homogeneity, corresponding impurities may be contained in the crystal. Even highly purified proteins may still be heterogeneous due to modifications, the binding of ligands or other effects. In addition, proteins are generally crystallized from complex solutions that may include not only the target molecule but also buffers, salts, precipitating agents and water. It is important to note that protein crystals are composed not only of protein, but also of a large percentage of solvents molecules, in particular water. The proportion of these other compounds within the crystal may vary from 30 to even 90%. Frequently, heterogeneous masses serve as nucleation centers and the crystals simply grow around them. The skilled person knows that some crystals diffract better than others. Crystals may vary in size from a barely observable 20 mm to 1 or more millimeters. Crystals useful for X-ray analysis are typically single, 0.05 mm or larger, and free of cracks and defects. However, advances in technology may allow analyzing increasingly smaller crystals.
The term “coordinate” as used herein, refers to the information of the three-dimensional organization of the atoms contained in the crystal of the invention which contribute to the protein structure. A common format for coordinate files is the so-called “PDP file format” (PDB=Protein Data Bank, http://www.pdb.org/) which is organized according to the instructions and guidelines given by the Research Collaboratory for Structural Bioinformatics (H. M. Berman, J. Westbrook, Z. Feng, G. Gilliland, T. N. Bhat, H. Weissig, I. N. Shindyalov, P. E. Bourne: Nucleic Acids Research, 28 pp. 235-242 (2000)) and which allows a graphical representation by programs such as O (Jones et al. Acta Crystallogr. 1991, 47:110-111), rasmol (Trends Biochem Sci. 1995: 20(9):374), moiscript (Kraulis, P. (1991), J. Appl. Cryst. 24, 946-950), bobscript or Pymol (Delano, W. L. (2002), The PyMOL Molecular Graphics System, DeLano Scientific, San Carlos, Calif., USA).
The term “root mean square deviation” (RMSD) is used as a mean of comparing two closely related structures and relates to a deviation in the distance between related atoms of the two structures after structurally minimizing this distance in an alignment. Related proteins with closely related structures will be characterized by relatively low RMSD values whereas more changes will result in an increase of the RMSD value.
Another aspect of the present invention refers to a method of preparing the crystal of the invention comprising the steps of:

(a) providing an aqueous solution comprising a microprotein fused with barnase;
(b) providing a reservoir solution comprising a precipitating agent;
(c) mixing a volume of said aqueous solution with a volume of said reservoir solution thereby forming a mixed volume; and
(d) crystallizing at least a portion of said mixed volume.

The growth of crystals may be effected according to standard protein crystallisation procedures described in the literature such as in DeLucas (J. Struct. Biol. 142 (2003), 188-206), Chemov (J. Struct. Biol. 142 (2003), 3-21), and McPherson (Structure 3 (1995), 759-768). In a preferred embodiment, the crystals are grown according to the method described in Example 6 (infra). Each of the steps identified in this protocol may be further and separately refined, as it will be apparent to the skilled practitioner.
The protein provided for crystallization should be sufficiently purified. Preparation and purification can be done according to conventional protocols such as those mentioned above in connection with expression techniques and vectors. Typically, a microorganism is transformed with an expression vector containing one or more copies of the gene encoding the respective microprotein-barnase fusion protein. The microorganisms, typically bacteria, may be grown under conditions that allow an optimized expression of the fusion protein. If the fusion protein is exported into the medium, it can be conveniently purified from the culture supernatant. Otherwise, the host cell has to be disrupted as the first step of the purification process. After recovery of a crude mixture from the cell culture, the fusion protein may be purified by using a combination of various purification steps. Some of these purification steps may be repeated, if appropriate. The fusion protein present in the crude extract is advantageously purified by employing a method comprising an affinity purification step. Such an affinity purification step may make use of the barnase-barstar binding interaction as already described above and in Example 5 (infra) in further detail. Alternatively, for example, antibodies raised against the microprotein or barnase may be used for the purification, wherein said antibodies (or fragments thereof) are preferentially coupled to a column material. Suitable antibodies may be obtained by conventional immunization protocols such as described, for example, in Harlowe and Lane, “Antibodies, A Laboratory Manual”, CHS Press, 1988, Cold Spring Harbor. The affinity purification step may be combined with gel filtration and/or anion exchange chromatography steps, before or after the affinity purification step. The purification protocol may further comprise one or more dialysis steps. The order of purification steps is preferably selected as described in Example 4 or 5.
The reservoir solution may be provided with suitable ingredients in accordance with standard crystallization techniques. The conditions for crystallization are provided by the reservoir solution which generally contains at least one compound selected from the group consisting of a buffer, a salt and a precipitant. The buffer is preferably MES, however, it may be replaced by any other buffer with a similar buffer capacity and pK_I. The term “salt” refers to charged molecules composed of cation and anion and which are held together by ionic interactions. Preferably said salt contains molecules selected from the group consisting of Mg, Ca, Na, Cl, Br, I, Rb, P, S, K, Mn, Zn, Cu, B, Mo, Se, Si, Co, J, V, Ni, wherein these molecules are in their charged state and contain one or more counterions. The reservoir solution may additionally contain a detergent which is preferably selected from the group consisting of Triton X-100, NP 40 C₁₂E₉, Cl₂E₈, n-Dodecyl-β-D-maltoside, sucrose monolaurate, CTAB, Deoxy-BigChap, n-decyl-β-D-maltoside, Nony-β-D-glucoside, DDAO, n-Octanoylsucrose, MEGA-8, MEGA-9, IPTG, HEGA-8, HEGA-9, CHAPS, CHAPSO, BAM, CYMAL-2, C₁₄E₈, TWEEN and Brij59. The reservoir solution may further contain a reducing agent such as one selected from the group consisting of DTE, β-mercaptoethanol, cysteine and GSH.
Preferably, the reservoir solution comprises at least one compound selected from the group consisting of HEPES, NaCl, PEG 100, PEG 200, PEG 400, PEG 500, PEG 600, PEG 800, PEG 1000, PEG 2000, PEG 3000, PEG 4000, PEG 5000, PEG 6000, PEG 7000, PEG 8000, ammonium sulphate, ammonium acetate, sodium sulphate, organic solvents, isopropanol, citrate buffer, Tris buffer, cacodylate buffer, MES-buffer, dithiothreitol, octylglycopyranoside and uranylacetate.
As a preferred ingredience, the reservoir solution may contain PEG 400, advantageously at a concentration between 5 and 10%, more preferably at 7%. Further preferred ingrediences are ammonium sulphate, preferably at a concentration of 1 to 2 M, more preferably at 1.3 M, as well as MES buffer. Further preferred is that the reservoir solution has a pH between 6 and 7, preferably of 6.5. Crystallization is preferably carried out according to the sitting drop method, but other methods such as the hanging drop method are not excluded from the scope of the present invention. Generally, grown crystals may be cryoprotected prior to undergoing X-ray diffraction studies. Before freezing, e.g. in liquid nitrogen, the crystal is typically contacted with a cryprotectant such as a liquor containing 25% glycerol or a PEG and isopropanol-containing solution.
The person skilled in the art knows that additional factors such as temperature may be crucial for crystal formation. These and other conditions of crystallization as well as strategies to optimise conditions of crystallization are known by a skilled person and can be retrieved from the literature such as “Crystallization of Biological Macromolecules” by Alexander McPherson (Cold Spring Harbor Laboratory; 1st edition (1999).
The invention furthermore pertains to a crystal obtainable by the above-described method for preparing a crystal.
In a further embodiment, the invention relates to a method for determining the three-dimensional structure of a microprotein, comprising the steps of:

(a) performing an X-ray diffraction analysis of a crystal of a microprotein fused with barnase;
(b) computationally processing the diffraction data obtained in step (a) in order to determine the three-dimensional structure of the crystal components and thereby to obtain crystal coordinates; and
(c) storing the obtained crystal coordinates on a data storage medium.

Preferably, step (b) further comprises to use data on the three-dimensional structure of barnase not being fused to the microprotein for modelling the structure of the barnase moiety within the fusion protein. Thereby it is possible to elucidate the microprotein's structure without any previous knowledge thereon. The barnase structure data is retrievable, e.g. from the RCSB PDB Web site (protein data bank, repository for the processing and distribution of 3-D biological macromolecular structure data) WWW.rcsb.org, entry 1A2P.
Preferentially, the crystal used in the method of the present embodiment is a crystal of the invention as defined above.
X-ray diffraction may be performed on a beamline such as the DESY beamline BW6. Data may be further processed with XDS (W. Kabsch, J. Appl. Cryst. 21, 67 (1988)) and scaled with XCALE (Kabsch, 1993). Further refinement is possible by applying CNS (A. T. Brünger et al. Acta Cryst D 54, 905 (1998)). The structure can finally be solved with, for example, AmoRe (J. Navaza, Acta Crystallogr. A 50, 157 (1994)) and analysed with Xfit (D. E. McRee, J. Struct. Biol. 125, 156 (1999)) while structure validatation may be performed with PROCHECK (R. A. Laskowski, M. W. MacArthur, J. Appl. Crystallogr. 26, 283 (1993)) and WHATCHECK (R. W. W. Hooft, G. Vriend, C. Sander, E. E. Abola, Nature 381, 272 (1996)). The final map containing the atomic coordinates of the constituents of the crystal may be stored on a data carrier, typically the data is stored in PDB format or in x-plor format, both of which are known to the person skilled in the art. However, crystal coordinates may as well be stored in simple tables or text files.
In a preferred embodiment of the present invention, the method for structure determination comprises additional steps of computer modelling, wherein computer modelling may include the step of (a) using virtual-screening tools for the search of compounds that bind to the microprotein; (b) using homology-modelling tools that search for compounds similar to known microprotein ligands and that make molecular contacts to the binding sites of the microprotein under investigation; (c) using molecular-modelling algorithms that allow an estimation of the binding affinities of compounds to the microprotein; or (d) using ligand construction tools that build up organic molecules that fit into the ligand binding site of the target molecule of the microprotein, such as tryptase or other proteases.
The design of molecules with particular structural relationships to part of a protein molecule are well established and described in the literature (see for example Cochran, A. G. (2000), Chem. Biol. 7, 85-94; Grzybowski, B. A., Ishchenko, A. V., Shimada, J., Shakhnovich, E. I. (2002), Acc. Chem. Res. 35, 261-269; Velasquez-Campoy, A., Kiso, Y., Freire, E. (2001), Arch. Biochem. Biophys. 380, 169-175; D'Aquino, J. A., Freire, E., Amzel, L. M. (2000), Proteins: Struc. Func. Genet. Suppl. 4, 93-107.). Any of these so-called “molecular modelling” methods for rational drug design can be used to find a ligand to a microprotein or a ligand to the microprotein target molecule that behaves analogously or similar to the microprotein. Most of these molecular modelling methods take into consideration the shape, charge distribution and the distribution of hydrophobic groups, ionic groups and hydrogen bonds in the site of interest of the protein molecule. Using this information, that can be derived from the crystal structure of proteins and protein-ligand complexes, these methods either suggest improvements to existing proposed molecules, construct new molecules on their own that are expected to have good binding affinity, screen through virtual compound libraries for such molecules, or otherwise support the interactive design of new drug compounds in silico. Programs such as GOLD (G. Jones, et al., Development and J. Mol. Biol., 267, 727-748 (1997)); FLEXX (B. Kramer et al., Structure, Functions, and Genetics, Vol. 37, pp. 228-241, 1999); FLEXE (M. Rarey et al., JMB, 261, 470-489 (1996)) DOCK (Kuntz, I. D. Science 257: 1078-1082, 1992); AUTODOCK (Morris et al., (1998), J. Computational Chemistry, 19: 1639-1662) are virtual screening programs designed to calculate the binding position and conformation as well as the corresponding binding energy of an organic compound to a protein. These programs are specially trimmed to allow a great number of “dockings”, that is calculations of the conformation with the highest binding energy of a compound to a binding site, per time unit. In this context, binding energy is not always a real value, but can be statistically related to a real binding energy through a validation procedure. These methods lead to molecules, termed here “hits” that have to be assessed by experimental biochemical, structural-biological, molecular-biological or physiological methods for their expected biological activity. Positively assayed molecules may thus constitute potential lead candidates for the design of bio-active compounds.
The terms “molecular modeling” and “molecular modeling techniques” refer to techniques that generate one or more 3D models of a ligand binding site or other structural feature of a macromolecule. Molecular modelling techniques can be performed manually, with the aid of a computer, or with a combination of these. Molecular modelling techniques can be applied to the atomic coordinates of a crystal of the present invention to derive a range of 3D models and to investigate the structure of ligand binding sites. A variety of molecular modelling methods are available to the skilled person for use in this regard (see e.g., G. Klebe and H. Gohlke, Angew. Chem. Int. Ed. 2002, 41, 2644-2676; Jun Zeng: Combinatorial Chemistry & High Throughput Screening, 2000, 3, 355-362 355; Andrea G Cochran, Current Opinion in Chemical Biology 2001, 5:654-659). At the simplest level, visual inspection of a computer model of the structure of a microprotein-barnase fusion can be used, in association with manual docking of models of functional groups into its binding pockets. Software for implementing molecular modelling techniques may also be used. Typical suites of software include CERIUS2 (available from Molecular Simulations Inc (http://www.msi.com/)), SYBYL (available from Tripos Inc; http://www.tripos.com), AMBER (available from Oxford Molecular; http://www.oxmol.co.uk/), HYPERCHEM (available from Hypercube Inc; (http://www.hyper.com/), INSIGHT II (available from Molecular Simulations Inc; http://www.msi.com/), CATALYST (available from Molecular Simulations Inc; http://www.msi.com/), CHEMSITE (available from Pyramid Learning; http://www.chemsite.org/), QUANTA (available from Molecular Simulations Inc; http://www.msi.com/). These packages implement many different algorithms that may be used according to the invention (e.g. CHARMm molecular mechanics). Their uses in the methods of the invention include, but are not limited to: (a) interactive modelling of the structure with concurrent geometry optimization (e.g., QUANTA); (b) molecular dynamics simulation of microprotein structures (e.g. CHARMM, AMBER); (c) normal mode dynamics simulation of microprotein structures (e.g. CHARMM). Modelling may include one or more steps of energy minimization with standard molecular mechanics force fields, such as those used in CHARMM and AMBER. These molecular modelling techniques allow the construction of structural models that can be used for in silico drug design and modeling.
Moreover, elucidation of the structure of another crystal according to the present invention but being different from the specific MCoTi-II-barnase crystal described herein (Example 6) may be facilitated by employing the three-dimensional structure of said specific crystal as a search model to locate the structure of the further microprotein-barnase fusion in its own crystal unit cell by rotation and translation searches. In particular, if a given microprotein-barnase fusion having a structure similar to MCoTi-II-barnase has been crystallized and X-ray diffraction data have been produced, the molecular replacement method can be applied. In this method, the three-dimensional structure of MCoTi-II-barnase is used as a search model to locate the unknown structure of the microprotein-barnase fusion in its own crystal unit cell by rotation and translation searches. This may avoid the cumbersome search for heavy atom derivatives.
Generally, the method of “molecular replacement” is applicable if the crystal structure of one protein A is known and if crystals of a homologous protein B have been obtained. X-ray diffraction data of crystals of protein B are collected and the three-dimensional model of protein A is used to search for its orientation (“rotation”) and position (“translation”) in the crystal unit cell or protein B, utilizing the X-ray diffraction data of the latter. If the search has been successful as indicated by certain correlation coefficients, the model of protein A may be refined against the X-ray data of the homologous protein B until convergence is achieved as indicated by the crystallographic reliability (R)-factor. As a result, the three-dimensional structure of protein B can be obtained.
In a further aspect, the present invention relates to the use of the crystal of the invention as defined above or structure data obtainable therefrom for designing or identifying a compound as a drug. Preferably, said drug is capable of inhibiting a serine protease, preferentially a tryptase.
In accordance with the above explanations in connection with the method of the invention for identifying the three-dimensional structure of a microprotein, the structure data may be used to design or identify new drugs which have the same target as the microprotein, but shows pharmacological advantages such as an improved selectivity or degradation within the body. Thereby, the three-dimensional structure of the microprotein allows identifying points of contact with the target molecule. Based on these data, a drug having the desired characteristics may be designed or identified, by applying computational means, as referred to above. In some cases, it may be advantageous to develop new ligands de novo, i.e. not on the basis and as a modification of a pre-existing compound. The term “de novo compound design” refers to a process whereby the binding pocket of the target macromolecule are determined, and its surfaces are used as a platform or basis for the rational design of compounds that will interact with those surfaces. The molecular modeling steps used in the methods of the invention may use the atomic coordinates of a crystal of the present invention and models or structures derived therefrom, to determine binding surfaces. In particular, the present invention also refers to structures, i.e. PDB-files, of a microprotein. Any such structure will preferably reveal van der Waals contacts, electrostatic interactions, and/or hydrogen bonding opportunities. Said binding surfaces will typically be used by grid-based techniques (e.g. GRID, CERIUS.sup.2; Goodford (1985) J. Med. Chem. 28: 849-857) and/or multiple copy simultaneous search (MCSS) techniques to map favorable interaction positions for functional groups. This preferably reveals positions in the binding pocket sites of the microprotein for interactions such as, but not limited to, those with protons, hydroxyl groups, amine groups, hydrophobic groups (e.g. methyl, ethyl, benzyl) and/or divalent cations. Based on this information, scaffolds may be generated which mimic the structure of the binding sites of the microprotein. These may comprise functional groups which are chemical groups that interact with one or more sites on an interaction surface of a macromolecule. Once functional groups which can interact with specific sites at the target molecule of the microprotein have been identified, they can be linked so as to form a single compound using either bridging fragments with the correct size and geometry or frameworks which can support the functional groups at favorable orientations, thereby providing a desired drug or lead compound for this. Whilst linking of functional groups in this way can be done manually, perhaps with the help of software such as QUANTA or SYBYL, the following software may be used for assistance: HOOK, which links multiple functional groups with molecular templates taken from a database, and/or CAVEAT, which designs linking units to constrain acyclic molecules. Other computer-based approaches to de novo compound design that can be used with the atomic coordinates of the present invention include LUDI (Bohm (1992) J. Comp. Aided Molec. Design 6: 593-606, SPROUT (available from http://chem.leeds.ac.uk/ICAMS/SPROUT.html) and LEAPFROG (available from Tripos Inc; http://www.tripos.com). Suitable in silico libraries include the Available Chemical Directory (MDL Inc), the Derwent World Drug Index (WDI), BioByteMasterFile, the National Cancer Institute database (NCI), and the Maybridge catalog. Compounds in these in silico libraries can also be screened for their ability to mimic the binding sites of the microprotein by using their respective atomic coordinates in automated docking algorithms.
Furthermore, the microprotein structure date may also be used for screening a compound that binds to a microprotein. An automated docking algorithm is one which permits the prediction of interactions of a number of compounds with a molecule having a given atomic structure. Suitable docking algorithms include: DOCK (Kuntz et al. (1982) J. Mol. Biol. 161: 269-288), AUTODOCK (Goodsell et al. (1990) Proteins: Structure, Function and Genetics 8: 195-202), MOE-DOCK (available from Chemical Computing Group Inc; http://www.chemcomp.com/) or FLEXX (available from Tripos Inc; http://www.tripos.com). Docking algorithms can also be used to verify interactions with ligands designed de novo.
The present invention further relates to a machine-readable data storage medium comprising the structure data of the crystal of the invention and which, when read by an appropriate machine, can be used to display a three-dimensional representation of the microprotein contained in the crystal or a portion thereof. Preferably, such a data storage medium is obtainable by the above-described method for determining the three-dimensional structure of a microprotein. The storage medium in which the structure may be provided is preferably random-access memory (RAM), but may also be read-only memory (ROM, e.g. a CDROM or DVD), a diskette or a hard drive. The storage medium may be local to the computer, or may be remote (e.g. a networked storage medium, including the internet). The recorded data are preferably the atomic co-ordinates as shown in Table 6. Any suitable computer can be used according to the present invention for representing or further processing the data recorded on the medium.
It is another aspect of the present invention to provide a device comprising (a) the above-defined machine-readable data storage medium; and (b) a computer program for the display of the 3-dimensional microprotein model; and optionally (c) software for the evaluation of potential ligands or, processed forms of the microprotein such as peptidomimetics.
It is yet another aspect of the present invention to provide the use of the device of the present invention for modelling a ligand to or a drug analogous to the microprotein.
In accordance with the above explanations, the present invention also refers to a method of identifying a compound capable of binding to a microprotein comprising the steps of:

(a) performing a fitting reaction by computational means between a microprotein and a candidate compound using the structure data of the microprotein obtainable from the crystal of the invention and structure data of said compound; and
(b) determining whether the candidate compound is capable of binding the microprotein based on the data obtained in the fitting reaction.

Suitable methods for identifying a compound capable of binding microprotein have already been outlined in connection with the use of the present invention for designing or identifying a drug.
In a preferred embodiment, the present method also encompasses developing a ligand which comprises the step of modifying an identified ligand to alter, add or eliminate a portion thereof suspected of interacting with a binding site of the microprotein, thereby increasing or decreasing the affinity of the ligand to the binding site.
Accordingly, the present invention additionally relates to the use of the crystal of the invention or structure data obtainable therefrom or the data storage medium of the invention for identifying a compound capable of binding to a microprotein.
In a further aspect, the present invention refers to a method for optimizing the binding activity of a microprotein to a target molecule comprising the steps of:

(a) determining by computational means one or more residues of the microprotein which participate in the binding interaction with the target molecule using structure data of the microprotein obtainable from a crystal according to the invention and structure data of the target molecule; and
(b) modifying in the microprotein one or more of said determined residues so as to optimize the binding activity of the microprotein to the target molecule.

Particularly preferred is that the structure data of the microprotein and the target molecule are obtained from a crystallized co-complex of said microprotein and target molecule.
It is furthermore preferred that the structure data of the microprotein the binding activity of which is to be optimized is obtained by computationally superimposing its structure on the structure data of another microprotein's crystal, which is preferably a crystal according to the present invention.
For this embodiment of the present invention, suitable techniques of the rational design may be applied. These are generally known to a person skilled in the art. “Optimizing” may refer to an increase or a decrease of the binding affinity to a given target molecule, as can be expressed for example by Ki-values (see supra), preferably an increase is meant. Alternatively, or in addition, “optimizing” may for example refer to an increased or decreased, preferably increased, selectivity for the target molecule. For example, the selectivity for β-tryptase may be increased by enhancing the binding affinity for this enzyme and concomittantly decreasing the affinity to other target molecules to which the microprotein under investigation shows significant binding, such as trypsin or other tryptase isoforms. In accordance with the present embodiment, the binding affinity of the microprotein can be significantly increased, preferably by orders of magnitude, by a series of rational measures known to the person skilled in the art. These include the modification of the microprotein with chemical groups so as to reduce their degrees of freedom lost upon binding to the target molecule site or the introduction of more potent electrostatic or hydrophobic binding groups.
Particularly preferred is to carry out the present embodiment, as follows:
In cases where the three-dimensional structure of the target and the ligand microprotein is known or, most preferably, where the structure of the co-complex of both compounds is known, predictions can be made to optimize the binding of the microprotein. As an illustration, it is herewith reported that for the McoETi tryptase inhibitor, the structure of McoETi was superimposed onto the structure of the EETI-II microprotein in complex with trypsin as is retrievable from the protein data bank www.rcsb.org, entry 1H9H. Next, the tryptase structure was superimposed to trypsin, making use of the software Insight II (Accelrys). As a result, a model of McoETI binding to tryptase was obtained. As expected, it was found that the side chain of lysine residue 5 contacts the catalytic serine 195 OH. Interestingly, the active site of tryptase contains a number of acidic residues and some of the basic residues of the McoETI inhibitor loop together with the two adjacent arginines seem to contribute to binding. Hence, a number of variants have been made, where either additional lysines were introduced at the amino-terminus or internal lysine/arginine residues were systematically replaced by alanine. By performing rational design in this way, a substantial improvement of affinity was thus achieved (see Table 1, infra). In this way, the microproteins depicted in Table 1 (infra) under items 8, 18, 19 and 20 (i.e. SEQ ID Nos: 4, 11, 12 and 13) have been produced.
According to the above, the present invention also relates to the use of the crystal of the invention or structure data derivable therefrom for optimizing the three-dimensional structure of said microprotein with respect to its binding and/or inhibiting activity to a target molecule, said target molecule preferably being a tryptase.
These pharmaceutical compositions may be formulated in an analogous manner as it is described above for the microprotein. A skilled person is aware of suitable ways for formulating proteinaceous compounds provided in crystallized form. The use of protein crystals in medicine is for example described in Gappa (Tissue Eng. 7 (2001), 35-44) and Brader (Nat. Biotechnol. 20 (2002), 800-804).
Accordingly, the present invention also relates to the use of a crystal of the invention for the preparation of a pharmaceutical composition for treating or preventing a disease that can be treated or prevented by inhibiting the activity of tryptase. Preferably, the disease is selected from the group consisting of asthma, inflammation, psoriasis, pulmonary fibrosis, an interstitial lung disease, rheumatoid arthritis, gingivitis, peridontitis, an allergic reaction, allergic rhinitis, osteoarthritis, atherosclerosis, angiogenesis, multiple sclerosis or cancer.
These and other embodiments are disclosed and encompassed by the description and examples of the present invention. Further literature concerning any one of the methods, uses and compounds to be employed in accordance with the present invention may be retrieved from public libraries, using for example electronic devices. For example the public database “Medline” may be utilized which is available on the Internet, for example under http://www.ncbi.nim.nih.gov/PubMed/medline.html. Further databases and addresses, such as http://www.ncbi.nim.nih.gov/, http://www.infobiogen.fr/, http://www.fmi.ch/biology/research_tools.html, http://www.tigr.org/, are known to the person skilled in the art and can also be obtained using, e.g., http://www.google.de. An overview of patent information in biotechnology and a survey of relevant sources of patent information useful for retrospective searching and for current awareness is given in Berks, TIBTECH 12 (1994), 352-364.
Furthermore, the term “and/or” when occurring herein includes the meaning of “and”, “or” and “all or any other combination of the elements connected by said term”.

The present invention is further described by reference to the following non-limiting figures and examples.

The Figures show:

FIG. 1 depicts the amino acid sequences of the McoTI-II cyclotide (SEQ ID NO: 22) (A), of an open chain variant of McoTi-II called McoTi-o (SEQ ID NO: 1) (B) and of a hybrid consisting of the aminoterminal part of McoTi-o and the ICK peptide EETI-II called McoEeTi (SEQ ID NO: 23) (C).

FIG. 2 shows a HPLC profile of crude linear peptide McoTI-o. Peak 3: linear target peptide. As products from incomplete coupling were detected: peak 1: missing Pro; peak 2: missing TyrCys; peak 4: additional ^tBu group.

FIG. 3 is a profile of an HPLC purification of McoTi-o after oxidation of cysteine residues. The elution time and the absorption of the effluent at 217 nm are given on the abscissa and the ordinate, respectively. Peak 1 indicates the folded peptide McoTI-o, peak 2 a mixture of not complete or proper folded intermediates.

FIG. 4 illustrates the barnase′-ICK peptide fusion construct design. (A) Schematic representation of the plasmid pBar100 harboring the barnase′ gene that leads to the expression of the enzymatically inactive H102A variant; f1, replication origin; cat, chloramphenicol resistance marker; tetR, tetracycline repressor encoding gene; colE1, colE1 replication origin; tac, tac promotor sequence; phoAs, alkaline phosphatase periplasmic signal sequence; ICK, ICK peptide encoding sequence. (B) DNA and protein sequence of the barnase′-ICK peptide fusion. The exchanged amino acid at position #102 of barnase (H102A) is indicated in bold letters. In the pBar100 series of expression vectors, a single methionine codon resides at the junction of barnase′ and ICK peptide coding sequence that can be used for chemical cleavage of the fusion protein with cyanogen bromide. The pBar100Throm vector encodes in addition a thrombin recognition site (LVPRGS).

FIG. 5 depicts the nucleotide and corresponding amino acid sequence of a synthetic rMcoEeTi hybrid gene (SEQ ID NOs: 20 and 21).

FIG. 6 represents a schematic outline of ICK peptide production and purification as described in Example 2. As a first step, the bacterial liquid culture of E. coli cells containing the respective pBar vector is acidified with glacial acidic acid which results in the release of the barnase′-ICK peptide fusion into the culture medium. The filtrated culture supernatant is subjected to a combined cation exchange/reverse-phase HPLC chromatography. To obtain pure fusion protein, a second cation exchange chromatography is performed after solubilization in 0.1 M Tris-HCl pH 7.8 containing 8 M urea and dialysis against 50 mM ammonium acetate. Cleavage of the fusion with CNBr or thrombin results in the release of the ICK peptide from the barnase′ carrier and the ICK peptide is isolated by RP-HPLC.

FIG. 7: displays an SDS-PAGE analysis of the purification of rMcoEeTi described in Example 2. M: Protein molecular weight marker (MBI Fermentas) with sizes indicated in kDa.; lane 1: culture supernatant (1.6 ml, precipitated with TCA); lane 2: culture supernatant after acidification (1.6 ml, precipitated with TCA); lane 3: purified barnase′-ThromMcoEeTI fusion protein; lane 4: fusion protein after overnight cleavage with thrombin.

FIG. 8: shows an HPLC analysis of the barnase′-McoEeTI (A) and the barnase′-EETI-II M7I (B) peptide fusion prior to cleavage (upper trace) and after cleavage with CNBr or thrombin, respectively (lower trace). The experimentally determined molecular mass of the respective ICK peptide is given together with the calculated molecular mass (indicated in parentheses).

FIG. 9 shows the result of an assay for the inhibition of human tryptase by McoTi-KKV. Tryptase (0.2 nM) was preincubated with McoTi-KVV (0-34 nM) at 37 degree C. for 60 min, and the reaction was initiated by the addition of substrate tos-Gly-Pro-Arg-AMC. The residual steady state velocities were measured over 10 min and are expressed in % of the activity measured in the absence of the inhibitor.

FIG. 10 shows the result of an assay for the inhibition of human tryptase by McoEeTI. Tryptase (0.2 nM) was preincubated with MCoEeTI (0-1950 nM) at 37 degree C. for 60 min, and the reaction was initiated by the addition of substrate tos-Gly-Pro-Arg-AMC. The residual steady state velocities were measured over 10 min and are expressed in % of the activity measured in the absence of the inhibitor.

FIG. 11 shows the amino acid sequence and three-dimensional structure of the ICK peptide EETI-II (SEQ ID NO: 24), a trypsin inhibitor from Ecballium elaterium (Chiche, 1989). The ribbon representation of the secondary structure elements of mature EETI-II was drawn with the program PYMOL (http://www.pymol.org). Disulfide bonds are shown as sticks. Cysteine linkage is also indicated in the amino acid sequence, where the inhibitor loop is marked in bold letters.

FIG. 12 is a depiction of an SDS-PAGE onto which samples were loaded taken during a purification of a barnase′ fusion protein using barstar in the affinity column (see Example 5). S: Sample prior to column application; FT: Flow-through of sample applied to the column; W1: Wash 1; W2: Wash 2; W3: Wash 3; E1: Elution fraction 1; E2: Elution fraction 2; R1: Regeneration solution 1; and R2: Regeneration solution 2.

FIG. 13 shows a crystal of the barnase-MCoTi-II fusion used for data collection (see Example 6). Scale bat is 1 mm.

FIG. 14 illustrates the effect of crystal annealing. In house diffraction data before (left) and after (right) annealing recorded from the same crystal in approximately the same orientation. After annealing, spots are less smeared out and visible to higher resolution.

FIG. 15 shows the packing of the barnase-MCoTi-II crystal. Barnase and MCoTi-II of the first molecule are shown in blue and orange, respectively. Barnase and MCoTi-II of the second molecule are shown in green and yellow, respectively. FIG. 15A shows the packing of barnase as obtained by the molecular replacement. The C-terminal residue of barnase is shown in spheres. FIG. 15B shows the large solvent channels in the barnase-MCoTi-II crystal.

FIG. 16 gives an overall view of the barnase-MCoTi-II monomer. Barnase is shown with β-strands in blue and α-helices in red. The linker sequence (SSSM) is coloured orange, MCoTi-II is shown in green.

FIG. 17 presents an overlay of the two monomers of barnase-MCoTi-II in the asymmetric unit shown in red and blue. The monomers were aligned on the barnase. The Figure illustrates that the difference between the two monomers is due to a rigid body movement of barnase (lower left) and MCoTi-II (upper right) relative to one another around residues of the linker.

FIG. 18 presents an overlay of MCoTi-II from the two crystallographically independent molecules A (green) and molecule B (blue). In both monomers, Lys 10 is coordinated by a PEG molecule (shown in ball-and-stick representation), but the positioning of the PEG is different on both molecules.

FIG. 19 shows MCoTi-II from the A monomer in cartoon representation. Side chains of cysteines and Lys 10 are shown in ball-and stick representation. A PEG molecule is located next to the side chain of Lys 10 with its oxygens in hydrogen bonding distance to the terminal amino group of Lys 10.

FIG. 20 presents an overlay of the MCoTi-II monomer with the first state of the MCoTi-II NMR ensembles 1HA9 (A), 1IB9 (B) and with the high resolution crystal structure of the squash-type trypsin inhibitor MCTI-I (C). MCoTi-II is shown in green in all panels.

The following Examples illustrate the invention:

EXPERIMENTAL SET-UP

Molecular Biological Techniques

Unless stated otherwise in the Examples, all recombinant DNA techniques are performed according to protocols as described in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, N.Y., USA or in Volumes 1 and 2 of Ausubel et al. (1994), Current Protocols in Molecular Biology, Current Protocols.

Example 1

Chemical Synthesis of Open Chain McoTI

Materials and Methods

All the chemicals used were of the highest grade available. Solvents were of analytical grade and used as supplied. N_α-Fmoc protected amino acids were used with the following side-chain protecting groups: t-Bu (Asp, Tyr), Boc (Lys), Trt (Cys, Asn), Pbf (Arg). Pseudo-proline dipeptide Fmoc-Asp(O^tBu)-Ser(ψ^Me,Me)pro-OH was purchased from Calbiochem-Novabiochem GmbH. ESI mass spectra were measured with a TSQ 700 Finnegan spectrometer. High-resolution ESI mass spectra were recorded with a Bruker APEX-Q III 7T. HPLC were performed on a Pharmacia Äcta basic system using YMC J'sphere ODS H-80, RP C-18 columns for preparative runs (250×4.6 mm, 4 μm, 80 Å) and for the analytical samples (250×4.6 μm, 80 Å).

Synthesis of the Linear McoTI-o

The linear peptide McoTi-o (see FIG. 1B; SEQ ID NO: 1) was assembled using a combination of automated and manual Fmoc-assisted SPPS on PEG-type amide NovaSyn® TGR resin (Calbiochem-NovaBiochem GmbH) with a loading capacity of 0.23 mmol/g. The C-terminal glycine (5 equiv. respective to resin loading) was activated by HATU/DIEA (5 equiv. and 10 equiv., respectively) and attached without pre-activation onto the resin within six hours. The loading with the first amino acid was determined UV-spectroscopically by monitoring of Fmoc deprotection (Chan et al., 2000). Chain elongation was performed using the Applied Biosystems peptide synthesizer ABI 433. Starting from 0.435 g (0.1 mmol) of amide resin, FastMoc 0.1 MPP CondMon mode with conditional monitoring was used for all amino acid cycles including pseudo-proline dipeptide, except cysteine. After pre-swelling first in DCM, then in NMP, each amino acid cycle has been programmed to include basically 16 min Fmoc deprotection with conditional conductivity monitoring, 8 min activation with HBTU/HOBt/DIEA; and 30 min coupling. Depending on the Fmoc-monitoring, additional 20 min of Fmoc deprotection and 50 min coupling followed by acetic anhydride capping were added to the regular cycles automatically.
Cysteine was coupled manually in DCM/NMP using the standard DIC/HOBt protocol (Albericio et al., 2000). The peptide-resin was transferred from the peptide synthesizer reaction vessel into an SPPS reactor and treated by nitrogen bubbling in the presence of activated cysteine until a negative Kaiser test was obtained. Then the resin was thoroughly washed with NMP and DCM and transferred back to the peptide synthesizer reaction vessel.
Cleavage of the peptide from the resin was achieved using TFA/DTT/TIS/anisole (23:1:0.5:0.5 v:w:v:v, 5 mL per 200 mg peptide-resin). The resin was gently shaken for 2.5 h, filtered, washed with TFA (3×1 mL). The combined filtrates were concentrated in vacuo, and the peptide was precipitated with MTBE. The peptide was centrifuged, washed with MTBE, dried, dissolved in water containing 0.1% TFA, and lyophilized. The crude, reduced peptide (18 mg, 66.6% calculated using the program of the ABI 433 peptide synthesizer) was purified using preparative RP-HPLC. The gradients of 0.1% TFA-water (eluent A) and 90% acetonitrile-0.1% TFA (eluent B) were employed with a flow rate of 10 ml/min within 30 min. The linear peptide was characterized by ESI mass spectrometry as well as by high-resolution ESI-FT-ICR-MS.

Folding Procedure

Oxidation of the linear McoTI-o to the cystine knot was performed by dissolving the reduced lyophilized peptide in 50 μl 10 mM HCl per mg of peptide followed by addition of NH₄HCO₃(200 mM, pH 9.1) to a final concentration of 1-1.5 mg/ml (Wentzel et al., 1999). The reaction mixture was incubated overnight in a PET container under vigorous shaking at room temperature. Purification of folded peptide was done by RP-HPLC using Phenomenex C₁₈columns (analytical: 250×4.60 mm; preparative: 250×10.00 mm). Conditions were as follows: Eluent A: H₂O containing 0.1% TFA, eluent B: 50% acetonitrile, 50% 2-propanol containing 0.1% (v/v) TFA. A linear gradient of 10-37% B was performed with flow rates of 1 ml/min for analytical purposes and 3.5 ml/min for preparative runs, respectively. With monitoring at 217 nm the oxidized peptide-containing fraction was collected and lyophilized. Successful oxidation was confirmed by ESI mass spectrometry and by measurement of inhibitory activity against trypsin, which is strictly dependent on correct disulfide bond formation (Wentzel et al., 1999).

Example 2

Recombinant Production in E. coli of McoEeTi

Construction of Expression Vector pBar100-McoETI
Two halves of the coding sequence for Bacillus amyloliquefaciens RNAse (Barnase) were separately PCR amplified with Taq polymerase (Eppendorf) using Bacillus amyloliquefaciens DNA and the primer pairs Barnase-up (5′-CCGGCGATGGCCATGGATGCACAG GTTATCAACACGTTTG-3′; SEQ ID NO: 25) and Barmitte-lo (5′-GTTCGTCCGCTTTTGCCCGGAAGT TTGCCTTCCCTGTTTGAG-3′; SEQ ID NO: 26) and Barmitte-up (5′-CTTCCGGGCAAAAGCGGACGAAC-3′; SEQ ID NO: 27) and Barnase-lo (5′-GAATTCGGTCTGA TTTTTGTAAAGGTCTGATAATGG GCCGTTGTTTTGTA-3′; SEQ ID NO: 28), respectively. The two halves of the resulting barnase′ coding sequence were combined by PCR using the oligonucleotide pair Barnase-up and Barnase-lo. This barnase′ PCR product was digested with Nco I and EcoR I and ligated with similarly cleaved pET22b (Novagen). From this vector, the barnase gene was PCR amplified using the primers bar′-Nhe-up (5′ GCGCACTAGTGCTAGCGATCTCGATCCCGCGAA 3′; SEQ ID NO: 29) and bar′-Sma-lo (5′ CTGTCCCGGGCGAATTCGGTCTGATTTTTGTAA AGGTCTGAT-AGGCGTCCGTTGTTTTG 3′; SEQ ID NO: 30), cleaved with Nhe I and Sma I and ligated into similarly cleaved pASK21-CKSend (Christmann et al., 1999). The resulting barnase′-EETI-II expression cassette was excised with Aat II and Pst I and ligated into similarly cleaved pMT416 (Hartley, 1988). The resulting plasmid contains a phoA leader sequence and the barnase′ gene under tac promotor control (Hartley, 1988). This expression cassette was then transplanted by cleavage with Ecl 136 II and Xba I and ligation into similarly cleaved pASKInt200, a derivate of pASKInt100 (Wentzel et al., 2001) that lacks the tetR promotor, to give pASKBarInt200. This plasmid was finally cleaved with Sap I and Sma I and overlapping DNA ends were filled up using T4 DNA Polymerase (MBI Fermentas). Blunt end ligation of the vector fragment resulted in pBar100-EETI-II M7I. The nucleotide and corresponding amino acid sequence of rMcoEeTi is shown in FIG. 5 and SEQ ID NOs: 20 and 21.
For construction of plasmid pBar100-McoEeTI, the McoEeTI gene was assembled with synthetic oligonucleotides cotiup2 (5′ GCATGCGCTCTTC-TAACTGCATATGCGG GCCCAACGGTTACTGCGGTTCCGGATCC 3′; SEQ ID NO: 31), cotilink (5′ CGTCGACATTTTTTCAG GATTTTCGGGCAAACACCA-CCGTCGGATCCGGAACCGCAG 3′; SEQ ID NO: 32) and cotilo (5′GCATGCGCTCTTCTGCAAGCACCCGGGCAGTCGGAGTCACGTCGACA-TTTTTTCAGG 3′; SEQ ID NO: 33) by polymerase chain reaction, assembled in vector pMalp-2 (New England BioLabs) and transplanted by cleavage with NcoI and Bsp120 I to similarly cleaved cloning vector pASKBar100-EETI-II M7I (see also FIG. 4).

Expression of Fusion Genes

The steps of expressing, purifying and cleaning the fusion protein are schematically outlined in FIG. 6. E. coli strain 71-18 [F′ lacl^q(lacZ.M15) proA+B+.(lac-proAB) supE thi1] (source B. Müller-Hill) containing helper plasmid pRep4 (Qiagen) was transformed with pBar100-McoEeTI by electroporation and grown in 50 ml dYT liquid media containing 25 μg/ml chloramphenicol and 37.5 μg/ml kanamycin overnight at 37° C. This culture was then used to inoculate 5 l of TB medium containing 25 μg/ml chloramphenicol and 37.5 μg/ml kanamycin in a 5 l fermenter (Bioengineering). Fermentation was performed at 30° C. At an O.D.₆₀₀of 3-5 IPTG was added to a final concentration of 1 mM. After overnight incubation, the bacterial liquid culture was cooled to 4° C. and 55 ml of glacial acetic acid per liter of cell culture was added under continuous stirring. Acidification of the culture results in additional release of barnase′ fusion protein into the medium (Hartley, 1988). Stirring was continued for another 15 min followed by centrifugation at 4000 rpm for 60 min at 4° C. Insoluble particles were removed by filtration.

Purification of Fusion Proteins

The filtered culture supernatant was diluted 5-fold with H₂O and applied to a Perseptive HS20 cation exchance column (1.0×10 cm, 7.6 ml bed volume) mounted to a Vision™ BioCad workstation (PerSeptive Biosystems) at 8 ml/min. Elution was performed with a gradient ranging from 0 to 0.5 M NaCl. Peak fractions ranging from 166 mM to 500 mM NaCl were directly applied to a Perseptive R2 reversed phase column. After washing with H₂O/0.1% (v/v) TFA, the fusion protein was eluted from the column using a gradient from 5 to 50% acetonitrile/0.1% (v/v) TFA. Fusion protein containing fractions were combined and lyophilized. The fusion protein peptides was dissolved in 0.1 M Tris-HCl pH 7.8 containing 8 M urea, dialyzed overnight against 50 mM ammonium acetate and further purified by Perseptive HS20 cation exchance chromatography. Elution was performed with a gradient ranging from 90 to 330 mM NaCl. Barnase-McoETi containing fractions were dialysed against 50 mM ammonium acetate and lyophilised.

Thrombin Cleavage of Fusion Proteins

Lyophilized proteins were solubilized in 20 mM Tris-HCl pH 8.45, 150 mM NaCl and 2.5 mM CaCl₂and 1 unit of thrombin from human plasma (Sigma, T-7009) per mg of fusion protein was added. The reaction was incubated overnight at 37° C. and analysed by SDS polyacrylamide gel electrophoresis (FIG. 7) or reversed phase HPLC using a Phenomenex C₁₈column (Synergi 4u Hydro-RP 80A; 250×4.60 mm). Buffer A: H₂O containing 0.1% (v/v) trifluoroacetic add, buffer B acetonitrile containing 0.1% (v/v) trifluoroacetic acid. A linear gradient ranging from 10-37% buffer B was run at flow rate of 1 ml/min. Chromatography was monitored at 217 nm (FIG. 8). ICK peptide containing fractions were collected and lyophilized. The expected molecular mass of the McoETi peptide (3168.75) was confirmed by ESI mass spectrometry.

Example 3

Determination of Trypsin and Tryptase Inhibitory Activity

Titration of the Inhibitor

The concentration of inhibitory active inhibitor was determined by titration with trypsin. Therefore, bovine pancreatic trypsin was standardised by active-site titration using p-Nitrophenyl p′-guanidinobenzoate (Chase & Shaw, 1970). The concentration of active inhibitor was calculated assuming a 1:1 interaction between the inhibitor and trypsin.

Determination of Equilibrium Constants:

Apparent equilibrium dissociation constants (Ki_app) for the complexes of the inhibitor with trypsin and tryptase were determined essentially as described by Bieth (Bull. Eur. Physiopathol. Respir. 16 (Suppl.) (1980), 183-197). Briefly, increasing concentrations of an inhibitor were incubated with a constant concentration of an enzyme. Substrate was then added, and the residual enzyme activity measured. Ki_app-values were calculated by fitting the steady state velocities to the equation for tight binding inhibitors (Morrison, 1969) using non-linear regression analysis. FIGS. 9 and 10 show tryptase inhibition curves for the microproteins McoTi-KKV and McoEeTi taken according to the above-described method.
In the following Table 1, an overview is provided of microproteins that have been produced in accordance with the procedure described in Example 1 or 2. Note that the microproteins for which neither “Barnase-Fusion” nor “Chemical Synthesis” is indicated have been expressed as a barnase fusion and the microprotein afterwards cleaved off by CNBr and purified.
Microproteins showing an inhibitory activity upon tryptase of above a Ki_appof 1 mM can in principle not be considered as having a therapeutic utility. In some cases, the measurement of the inhibitory effect on tryptase apparently showed no activity at all. In other cases, there was inhibitory activity, however, only above a Ki_appof 1 mM.


			Barnase-	Chemical		Kiapp [82 mol/l]-	Kiapp [μmol/l]-
No.	Substance	New Nomenclature	Fusion	Synthesis	Sequence	Trypsin	β3-Tryptase

1	SE-MC-K	SE-MC		x	GVCPKILKKCRRDSDCPG	0.0003	0.02
					ACICRGNGYCG
					(SEQ ID NO: 1)

2	SE-MA-0	SE-MC-TR-010		x	GVCPAILKKCRRDSDCPG	no inhibition	110
					ACICRGNGYCG
					(SEQ_ID NO:34)

3	SE-MG-0	SE-MG			GVCPKILKKCRRDSDCLA	0.0003	0.1
					GCVCGPNGFCGS
					(SEQ ID NO:2)

4	SE-BMG-0	SE-MG (Bar)	x		Barnase′-	0.0002	0.1
					SSSMGVCPKILKKCRRDS
					DCLAGCVCGPNGFCGS
					(SEQ ID NO:3)

5	SE-BME		x		Barnase′-	no inhibition	no inhibition
					SSSMGIEGREERICPLIW
					MECKRDSDCLAGCVCGPN
					GFCGS
					(SEQ ID NO:35)

6	SE-EM-0	SE-ET			GCPRILIRCKQDSDCLAG	0.0001	1.3
					CVCGPNGFCGS
					(SEQ ID NO:36)

7	MCoEeTI-2R-10	SE-MG-TR-010 (Bar)	x		Barnase′-	0.03	no inhibition*
					SSSMGVCPRNRCKCRRDS
					DCLAGCVCGPNGCGS
					(SEQ ID NO:37)

8	MCoEeTI-3R-3	SE-MG-TR-020 (Bar)	x		Barnase′-	0.0002	0.03
					SSSMGVCPRILRRCRRDS
					DCLAGCVCGPNGFCGS
					(SEQ ID NO:4)

9	MCoEeTI-QRT-7	SE-MG-TR-030 (Bar)	x		Barnase′-	0.001	no inhibition*
					SSSMGVCPRNRQRCRRDS
					DCLAGCVCTNNKFCGS
					(SEQ ID NO:38)

10	MCoEeTI-KKV-1	SE-MG-TR-040 (Bar)	x		Ba′-	0.0002	0.02
					SSSMGKKVGVCPKILKKC
					RRDSDCLAGCVCGPNGFC
					GS
					(SEQ ID NO:5)

11	MCoEeTI-ARD-2	SE-MG-TR-050 (Bar)	x		Barnase′-	0.0002	no inhibition*
					SSSMGVCPKILKACARDS
					DCLAGCVCGPNGFCGS
					(SEQ ID NO:39)

12	MCoEeTI-LKA-7	SE-MG-TR-060 (Bar)	x		Bar′-	0.0002	no inhibition*
					SSSMGVCPKILKACRRDS
					DCLAGCVCGPNGFCGS
					(SEQ ID NO:40)

13	MCoEeTI-T-1	SE-MG-TR-080 (Bar)	x		Barnase′-	0.0001	0.15
					SSSMGVCPKILKKCRRDS
					DCLAGCVCTNNKFCGS
					(SEQ ID NO:6)

14	MCoTI-KKV	SE-MC-TR-020		x	KKVGVCPKILKKCRRDSD	0.0004	0.002
					CPGACICRGNGYCG
					(SEQ ID NO:7)

15	MCoTI-R	SE-MC-TR-030		x	GVCPRILKKCRRDSDCPG	0.0008	0.02
					ACICRGNGYCG
					(SEQ tD NO:8)

16	MCoEeTI	SE-MG-TR-090			GSVCPKILKKCRRDSDCL	≈0.00003	0.20
					AGCVCGPNGFCGS
					(SEQ ID NO:9)

17	MCoTI-LAKC	SE-MC-TR-040		x	GVCPKILAKCRRDSDCPG	0.0002	0.1
					ACICRGNGYCG
					(SEQ ID NO:10)

18	MCoTI-LKAC	SE-MC-TR-050		x	GVCPKILKACRRDSDCPG	0.0004	0.03
					ACICRGNGYCG
					(SEQ ID NO:11)

19	MCoTI-LRKC	SE-MC-TR-060		x	GVCPKILRKCRRDSDCPG	0.0005	0.01
					ACICRGNGYCG
					(SEQ ID NO: 12)

20	MCoTI-LKRC	SE-MC-TR-070		x	GVCPKILKRCRRDSDCPG	0.0004	0.01
					ACICRGNGYCG
					(SEQ ID NO:13)

21	MCoTI-AlaG	SE-MC-TR-080		x	GVCP(AlaG)ILKKCRRD	1	≈10
					SDCPGACICRGNGYCG
					(SEQ ID NO:41)

22	MCoEeTI-ARDs	SE-MG-TR-110 (Bar)	x		Barnase′-
					SSSMGVCPKILKKCARDS
					DCLAGCVCGPNGFCGS
					(SEQ ID NO:42)

23	MCoEeTI-RAD	SE-MG-TR-120 (Bar)	x		Barnase′-
					SSSMGVCPKILKKCRADS
					DCLAGCVCGPNGFCGS
					(SEQ ID NO:43)

24	MCoEeTI-KKV-	SE-MG-TR-130 (Bar)	x		Barnase′-
	3R				SSSMGKKVCPRILRRCRR
					DSDCLAGCVCGPNGFCGS
					(SEQ ID NO:44)

Table 1 gives an overview of the microproteins produced and tested in connection with the present invention.
*, at 0.5 μM protein concentration.

Three microproteins, among which the best inhibiting one (i.e. SE-MC-TR-020), were tested for tryptase selectivity. The results of these binding assays are shown in Table 2. As can be seen, SE-MC-TR-020 has a good selectivity for tryptase and does not inhibit other proteases apart from trypsin, or only to a significantly reduced degree when compared to tryptase inhibition.

	TABLE 2

	K_iapp[nM]

Protease				SE-MC-TR-	SE-MC-
Family	Protease	Species	SE-MG	020	TR-030

Tryptase	β-III	Human		100	2	20
	β-Ia	Human	70	3	40
	β-II	Human	70	4	40
	ST2	Sheep	4000	100	1000
Pankreas	Trypsin	Porcine	0.3	0.4	0.8
proteases
	Chymotrypsin	Porcine	>1000	>1000	>1000
	Elastase	Porcine	>1000	>1000	>1000
Koagulation	Thrombin	Human	>1000	>1000	>1000
	Faktor XA	Human	>1000	>1000	>1000
Fibrinolysis	Plasmin	Human	~600	~400	>1000
	tPA	Human	>1000	>1000	>1000
Neutrophiles	Elastase	Human	>1000	>1000	>1000
	Cathepsin G	Human	>1000	>1000	>1000
Kallikreines	pK1	Human	>1000	>1000	>1000
	hK3	Human	>1000	>1000	~100

Example 4

Recombinant Production of Microproteins Fused to Barnase, Using the Barnase Moiety as a Purification Handle

Materials and Methods

Enzymes were obtained from NEB or MBI Fermentas. All chemicals used were of the highest grade available. Solvents were of analytical grade and used as supplied. ESI mass spectra were measured with a TSQ 700 Finnegan spectrometer. Liquid chromatography was performed on a Vision BioCad workstation (PerSeptive Biosystems). RP-HPLC was done on a Kontron or an Äcta (Pharmacia Biotech) basic HPLC system.
Construction of pBar100 Vectors
A schematic representation of expression vector pBar100 vector and additional sequence information of the construct is given in FIG. 4. Plasmids pBar100-EETI-II M7I, pBar100-EETI-II, pBar100-McoEeTI and pBar100ThromMcoEeTI were constructed as follows: The 5′ and the 3′ half of the barnase coding sequence were separately PCR amplified with Taq polymerase (Eppendorf) using Bacillus amyloliquefaciens DNA and the primer pairs barnase-up (5′-CCGGCGATGGCCATGGATGCACAG GTTATCAACACGTTTG-3′; SEQ ID NO: 45), barmitte-lo (5′-GTTCGTCCGCTTTTGCCCGGAAGT TTGCCTTCCCTGTTTGAG-3′; SEQ ID NO: 46) and barmitte-up (5′-CTTCCGGGCAAAAGCGGACGAAC-3′; SEQ ID NO: 47), barnase-lo (5′-GAATTCGGTCTGA TTTTTGTAAAGGTCTGATAATGG GCCGTGTTTTGTA-3′; SEQ ID NO: 48), respectively. Oligonucleotides were designed such that a Sma I site at codon #63 is eliminated and active site histidine codon #102 is converted to alanine. This mutation leads to an inactivation of the ribonuclease activity of the resulting barnase′ protein (Jucovic, 1995).
The two halfs of the barnase′ coding sequence were combined by PCR using the oligonucleotide pair barnase-up and barnase-lo. The resulting barnase′ PCR product was digested with Nco I and EcoR I and ligated with similarly cleaved pET22b (Novagen). From this vector, the barnase gene was PCR amplified using the primers bar′-Nhe-up (5′ GCGCACTAGTGCTAGCGATCTCGATCCCGCGAA 3′; SEQ ID NO: 49) and bar′-Sma-lo (5′ CTGTCCCGGGCGAATTCGGTCTGATTTTTGTAA AGGTCTGATAGGCGTCCGTTGTTTTG 3′; SEQ ID NO: 50), cleaved with Nhe I and Sma I and ligated into similarly cleaved pASK21-CK^send(Christmann, 1999). The resulting barnase-EETI-II expression cassette was excised with Aat II and Pst I and ligated into similarly cleaved pMT416 (Hartley, 1988) kindly provided by L. Leveneki (University of Marburg, Germany). The resulting plasmid contains a phoA leader sequence and the barnase′ gene under tac promotor control (Hartley, 1988). This expression cassette was then transplanted by cleavage with Ecl 136 II and Xba I and ligation into similarly cleaved pASKInt200, a derivate of pASKInt100 (Wentzel, 2001) that lacks the tetR promoter, to give pASKBarInt200. The resulting plasmid was finally cleaved with Sap I and Sma I and overlapping DNA ends were filled up using T4 DNA polymerase (MBI Fermentas). Blunt end ligation of the vector fragment resulted in pBar100-EETI-II M7I.
pBar100-EETI-II M7I was used as a template for the construction of pBar100-EETI-II. To this end, the EETI-II encoding gene was PCR amplified from pBar100-EETI-II M7I with primers Nco-XA-eti-up (5′ GACTCCGGCCATGGGGATCGAGGGAAGGGGGTGCCC GCGCATTCTGATGCGCTGCAAACAGGACTC 3′; SEQ ID NO: 51) and cat-hind-mittelo (CCACAAGCTTGAAAACGTTTCAG, SEQ ID NO: 52). The resulting product was cleaved with Nco I and Hind III and ligated into similarly digested pBar100-EETI-II M7I. For construction of plasmid pBar100-McoEeTI, the McoEeTI gene was assembled with synthetic oligonucleotides cotiup2 (5′ GCATGCGCTCTTCTAACTGCATATGCGGGCCCAACGGTTACTGCGGTTCCGGAT CC 3′; SEQ ID NO: 53), cotilink (5′ CGTCGACATTTTTTCAG GATTTTCGGGCAAACACCACCGTCGGATCCGGAACCGCAG 3′; SEQ ID NO: 54) and cotilo (5′GCATGCGCTCTTCTGCAAGCACCCGGGCAGTCGGAGTCA-CGTCGACATTTTTTCAGG 3′; SEQ ID NO: 55) by polymerase chain reaction, assembled in vector pMalp-2 (New England BioLabs) and transplanted by cleavage with NcoI and Bsp120 I to similarly cleaved cloning vector pASKBar100-EETI-II M7I.
Plasmid pBar100-ThromMcoEeTI was constructed as described above for pBar100-EETI-II using pBar100-McoEeTI as a template and primers NcoThromMCoTi-up (5′ AGCTCTTCCATGGGGCTGGTTCCGCGTGGGTCCGTTGCCCGAAAATCCTGAAA AAATG 3′; SEQ ID NO: 56), which encodes a thrombin protease recognition sequence, and cat-hind-mittelo (SEQ ID NO: 52).

Fusion Protein Production

E. coli strain 71-18 [F′ lacl^qlacZΔM15 proA⁺B⁺ Δlac-proAB supE thi1] (source B. Müller-Hill) containing helper plasmid pRep4 (Qiagen) which contains a lac1 gene was transformed with pBar100-EETI-II M7I, pBar100-EETI-II, pBar100-McoEeTI and pBar100-ThromMcoEeTI, respectively by electroporation and grown overnight at 37° C. in 50 ml rich media containing 25 μg/ml chloramphenicol and 37.5 μg/ml kanamycin. This culture was then used to inoculate 5 l of TB medium containing 25 μg/ml chloramphenicol and 37.5 μg/ml kanamycin in a 5 I fermenter (Bioengineering) or 1 l of TB medium in a 1 I fermenter (Biostat M, Braun Biotech). TB medium contains 12 g bacto-tryptone, 24 g bacto-yeast extract, 4 ml glycerol and 100 ml of a sterile solution of 0.17 M KH₂PO₄, 0.72 M K₂HPO₄per liter. Fermentation was performed at 30° C. At an O.D.₆₀₀of 3 to 5, IPTG was added to a final concentration of 1 mM. After overnight incubation, the bacterial liquid culture was cooled to 4° C. and 55 ml of glacial acetic acid per liter of cell culture was added under continuous stirring. Acidification of the culture results in release of barnase′ fusion protein into the medium (Hartley, 1988). Stirring was continued for another 15 min followed by centrifugation at 4000 rpm for 60 min at 4° C. Insoluble particles were removed by filtration.

Purification of Fusion Proteins

The filtered culture supernatant was diluted 5-fold with H₂O and applied to a Perseptive HS20 cation exchance chromatography column (1.0×10 cm, 7.6 ml bed volume) mounted to a Vision BioCad workstation (PerSeptive Biosystems) at a flow rate of 8 ml/min. Elution was performed with a gradient ranging from 0 to 0.5 M NaCl. Peak fractions from 166 mM to 500 mM NaCl were directly applied to a Perseptive R2 reverse-phase column. After washing with H₂O/0.1% (v/v) TFA, the fusion protein was eluted from the column using a gradient from 5% (v/v) to 50% acetonitrile/0.1% (v/v) TFA. Fusion protein containing fractions were combined and lyophilized. For the purification of barnase′-ThromMcoEeTI, the fusion protein was pre-adsorbed to phosphocellulose prior to cation exchange chromatography as described (Hartley, 1972). Briefly, phosphocellulose P11 (Whatman) was treated with 0.5 N NaOH, H₂O, 0.5 N H₂SO₄and 0.1 M Na-citrate as described and added to the acidified culture supernant (0.25 g/l liquid culture). After stirring at room temperature for 30 min, the phosphocellulose was filled into a 15×4 cm column, washed with 0.01 M ammonium acetate and the bound proteins were eluted with 2 M ammonium acetate. The protein solution was further concentrated with a rotation evaporator, lyophilized and re-solubilized in 25 mM Na-acetate pH 5.0 containing 8 M urea and applied to the combined cation exchange/reverse-phase HPLC (see above). Finally, lyophilized fusion protein was re-solubilized in 0.1 M Tris-HCl pH 7.8 containing 8 M urea, dialyzed overnight against 50 mM ammonium acetate and re-applied to the HS20 cation exchance column. Elution was performed with a gradient ranging from 90 to 330 mM NaCl.

CNBr Cleavage of Fusion Proteins

Lyophilized proteins were solubilized in 20 μl 70% formic acid per milligram of protein. Per milligram of fusion protein 0.6 μl of 5 M cyanogen bromide solution (Fluka) was added. After overnight incubation in a Teflon vial with a screw cap, the sample was either lyophilized or diluted 1:10 with 5% acetonitrile containing 0.1% (v/v) H₂O/TFA and directly used for RP-HPLC.

Thrombin Cleavage of Fusion Proteins

Lyophilized proteins were solubilized in 20 mM Tris-HCl pH 8.45, 150 mM NaCl and 2.5 mM CaCl₂and 1 unit of thrombin from human plasma (Sigma, T-7009) per milligram of fusion protein was added. The reaction was incubated overnight at 37° C. and analysed by SDS polyacrylamide gel electrophoresis or RP-HPLC.

Purification of ICK Peptides

For separation of cleaved ICK peptide variants from the barnase′ carrier protein standard RP-HPLC was performed on a Kontron or an Äcta (Pharmacia Biotech) basic HPLC system using a Phenomenex C₁₈column (Synergi 4u Hydro-RP 80Å; 250×4.60 mm). Buffer A: H₂O containing 0.1% (v/v) trifluoroacetic acid, buffer B: acetonitrile containing 0.1% (v/v) trifluoroacetic acid. Linear gradients of 10-37% buffer B were run with flow rates of 1 ml/min. Chromatography was monitored at 217 nm, ICK peptide containing fractions were collected and lyophilized.

Determination of K_IValues

The inhibitory activity of the protein variants was measured according to van Nostrand et al. (1990) and Sinha et al. (1991). The remaining activity of bovine trypsin (Serva) was determined after incubation with the respective inhibitor for 10 min at 37° C. by monitoring hydrolysis of the chromogenic substrate Boc-Leu-Gly-Arg-pNA (Bachem, solubilized in Me₂SO) at 405 nm. Assays were performed in a final volume of 100 μl in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM CaCl₂at 37° C. containing 5 nM of trypsin, 1.5 nM substrate and varying amounts of inhibitor (10⁻¹⁰-10⁻⁶M). For calculation of K_lapp-values, v_maxvalues were determined and the curve fitting tool of SigmaPlot (Jandel Scientific) was applied on the basis of the following formula, that describes the case of competitive tight binding inhibitors (Morrison, 1969):
$\frac{v_{1}}{v_{0}} = 1 - \frac{[E_{t}] + [I_{t}] + K_{iapp} - {{([E_{t}] + [I_{t}] + K_{iapp})}^{2} - 4 [E_{t}] \cdot [I_{t}]}^{\frac{1}{2}}}{2 [E_{t}]}$
v_i=v_maxvalue of inhibited reaction
v_o=v_maxvalue of uninhibited reaction
[E_t]=total enzyme concentration (free and in complex)
[I_t]=total inhibitor concentration (free and in complex)
K_lapp=apparent dissociation constant of the enzyme-inhibitor complex.

Results and Discussion

Choice of Carrier Protein and Production Strategy

Barnase, an extracellular ribonuclease from Bacillus amyloliquefaciens is a well-characterized enzyme which has been extensively used in structure-function studies Fersht, 1993; Paddon, 1987). Barnase is a relatively small protein with a M_rof approximately 12300 that can be produced in Escherichia coli via secretion into the periplasmic space and the culture medium in yields up to 100 mg of bacterial liquid culture (Hartley, 1988). It is composed of only 110 amino acid residues, contains no cysteine residues that might negatively interfere with disulfide bond formation of the fused ICK peptide and in addition it also contains no CNBr cleavable methionine residue. Furthermore, barnase can easily be purified by cation exchange chromatography (Hartley, 1988). To abolish the intrinsic RNAse activity of barnase we have constructed an enzymatically inactive variant (Jucovic, 1995) where the active site residue histidine #102 is replaced by alanine to give barnase′. Expression vector pBar100 which is shown in FIG. 4A contains the barnase′ gene under tac promoter control and the respective ICK peptide coding sequence that was placed in frame to the barnase′ gene together with a short linker sequence (FIG. 4B).

Fusion Protein Production and Purification

Four different ICK peptide variants have been successfully expressed in E. coli via fusion to barnase′ that are derived from the Ecballium elaterium trypsin inhibitor EETI-II (Chiche, 1989). McoEeTI is a hybrid ICK peptide that is composed of the 13 aminoterminal residues of EETI-II and the 16 carboxyterminal residues of the Momordica cochinchinensis trypsin inhibitor McoTI-II (Hernandez, 2000). Sequences and yields of purified cystine knot protein variants are shown in Table 3.

TABLE 3

ICK peptides expressed as fusions to barnase′.

		Fusion protein	Kiapp^b
ICK peptide	Peptide sequence	yield^a[mg]	[M]

EETI-II M7I	GCPRILIRCKQDSDCLAGCVCGPNGFCGS		12	n.d.
	(SEQ ID NO:57)

EETI-II	GCPPILMRCKQDSDCLAGCVCGPNGFCGS	6.7	9.0 +− 4.2 × 10-9
	(SEQ ID NO:58)

McoEeTI	GVCPRILKKCRRDSDCLAGCVCGPNGFCGS	24.3	7.1 +− 0.9 × 10-8
	(SEQ ID NO:23)

ThromMcoEeTI	GSVCPRILKKCRRDSDCLAGCVCGPNGFCGS	7.4	n.d.
	(SEQ ID NO:59)

^ayield corresponds to the amount of purified fusion protein obtained from 11 E. coli culture.
^binhibition constants were determined by incubation of varying amounts of the respective ICK peptide with trypsin and monitoring the residual trypsin activity using the trypsin substrate Boc-Leu-Gly-Arg-pNA (Wentzel, 1999).
n.d.: not determined.

The underlying strategy for expression and purification is outlined in FIG. 6. Barnase′-ICK fusion proteins are directed into the periplasm of the host cell, where folding of the fusion protein and intramolecular disulfide bond formation of the ICK peptide can occur in the oxidative extracellular milieu. Acidification of the culture with glacial acidic acid results in the complete release of the barnase′-fusions from the periplasmic space into the culture medium (Hartley, 1988) (FIG. 7). The diluted culture medium is applied to cation exchange chromatography as a first purification step. Alternatively, to reduce the sample volume, the fusion protein can be pre-adsorbed to phosphocellulose followed by batch elution with ammonium acetate and lyophilization (Hartley, 1972) (data not shown). Subsequent RP-HPLC results in the removal of small peptides derived from tryptone and yeast extract of the culture medium. On average, 12 mg fusion protein have been obtained from 1 liter of bacterial liquid culture (Table 3). No efforts have been made yet to enhance protein yield via optimization of fermentation conditions towards high cell densities or by placing the barnase′ gene under control of a promoter that is stronger than the tac promoter used in these studies.
It is important to check whether the cystine knot peptides obtained are fully oxidized and contain the desired three pairs of disulfide bonds, where the first cysteine residue in the sequence is connected to the fourth, the second to the fifth, and the third to the sixth (FIG. 11). The ICK peptides of this study are trypsin Inhibitors and inhibition of trypsin activity can be used as a sensitive probe of correct folding, since correct disulfide connectivity is strictly required for high affinity trypsin binding (Wetzel, 1999). As can be seen in Table 3, both EETI-II and McoEeTI act as inhibitors of bovine trypsin as barnase′ fusion proteins and display strong inhibitory activity.

Fusion Protein Cleavage and Isolation of the ICK Peptides

A unique methionine residue was introduced at the junction of barnase′ and the respective ICK peptide. As a consequence, the ICK peptide can be released from the fusion protein by cyanogen bromide cleavage. As can be seen in FIG. 8B, the released ICK peptide elutes from a C18 column at lower acetonitrile concentrations than the barnase′ carrier, from which it can easily be separated. After overnight incubation of the fusion protein with CNBr in 70% formic acid at least 80% of the fusion was completely cleaved as judged by gel electrophoresis (data not shown). The expected molecular mass of the resulting fully oxidized cystine knot protein was confirmed by ESI-MS (FIG. 8B).
CNBr cleavage cannot be applied for the removal of the barnase′ carrier if the particular ICK peptide to be processed contains internal methionine residues as it is the case for the EETI-II ICK peptide. To have an alternative to CNBr cleavage at a methionine residue, expression vector pBar100ThromMcoEeTI was constructed, which gives rise to the synthesis of a fusion protein with a recognition sequence for the site-specific protease thrombin at the junction of barnase′ and the ICK peptide McoEeTI. Thrombin cleavage was performed in 20 mM Tris-HCl buffer pH 8.45 containing 150 mM NaCl and 2.5 mM CaCl₂at 37° C. and was almost complete after overnight incubation (FIG. 7) The ICK peptide was isolated by reverse-phase HPLC and the expected molecular mass of Throm-McoEeTI was confirmed by ESI-MS (FIG. 8A).

Conclusions and Outlook

Peptides of the inhibitor cystine knot family share a common architecture that is defined by a combination of three intramolecular disulfide bonds. These interesting molecules show diverse biological activities including for example neurotoxins (Narasimhan, 1994) and enzyme inhibitors (Hamato, 1995; Chakraborty, 2001). Because of their enormous intrinsic stability and the possibility to apply methods of molecular evolution for the isolation of variants with predefined binding capabilities (Wentzel, 1999; Baggio, 2002), cystine knot proteins are considered to be ideal scaffolds for drug design (Craik, 2001). We have devised an expression and purification strategy that is based on ICK peptide synthesis via fusion to barnase′. Expression of functional barnase is lethal to the host cell and requires co-expression of the barnase inhibitor, barstar (Hartley, 1988). Our approach to use an enzymatically inactive variant obviates this necessity and may in addition allow one to purify the barnase′ fusion in a simple single step procedure via affinity chromatography on immobilized barstar, provided that the barnase H102A active site variant retains sufficient affinity to bind the inhibitor (see also Example 5, infra).
Recently, barnase fusions of antibody V_Ldomains and single chain Fv fragments have been described (Martsev, 2004; Deyev, 2003). A solubilizing effect of barnase was observed both in vitro and in vivo, which was explained by a chaperone-like role that barnase may exert on the fused antibody domain (Martsev, 2004). It appears as if barnase′ fusion generally supports folding and correct disulfide bond formation of the fused ICK peptide since we have also successfully expressed a number of other cystine knot peptides having a sequence different to that of the EETI-II and McoEeTI peptides shown in this Example. For these, we observed similar expression levels and high yields of folded peptides forming a cystine knot (see Example 3, supra).
In conclusion, the fusion protein system described here using barnase′ as a carrier for secretion and export and as a convenient purification handle allows for the production of folded cystine knot proteins that can be directly used for biological assays. If required, the barnase′ moiety can be removed, for example by chemical cleavage with cyanogen bromide or enzymatic cleavage with thrombin and the disulfide-bond containing ICK peptide can be isolated without the requirement of in vitro oxidation which often becomes the yield limiting step of cystine knot peptide production (Martsev, 2004).

Example 5

Purification of Microprotein-Barnase Fusion Using Immobilized Barstar

Barstar was purified as described (Jones et al., 1993, FEBS Lett. 331, p. 165). The purified protein was covalently immobilized to a Affi-gel matrix (BioRad). To this end, 20 mg of Barstar in PBS buffer was coupled to 1 ml AffiGel (BioRad) as described by the manufacturer. To show that Barnase can be purified by affinity chromatography via binding to immobilized barstar, the column was equilibrated with 50 mM ammonium acetate pH 7. A sample solution (S) containing the fusion protein consisting of barnase′ (the inactive mutant of barnase; see Example 3, supra) and the cystine knot microprotein SE-MG in PBS-buffer was applied to the column. The flow through (FT) was collected for analysis. The column was washed three times with 2.5 ml 50 mM ammonium acetate (W1, W2, W3). Bound protein was eluted by applying two times 2.5 ml 50 mM ammonium acetate, 8 M urea to the column (E1, E2). By addition of urea, both barstar and barnase are denatured and the barnase elutes from the column. The column was regenerated with 5 ml 50 mM ammonium acetate pH 7, 4 M urea (R1) followed by 5 ml 50 mM ammonium acetate pH 7 (R2). Aliquots of each fraction were analysed by SDS-polyacrylamide gel electrophoresis (see FIG. 12). The column could be reused at least three times (not shown).
The results of this experiment prove that tight interaction between barnase and barstar can be applied in order to purify fusion proteins comprising barnase. It is of particular note that this experiment has been carried out using an inactive variant of barnase. This means that the corresponding fusion protein can advantageously be expressed without the co-expression of barstar as it is described in the prior art to be necessary to avoid death of the host cell (see, e.g., Martsev, 2004; Deyev, 2003).

Example 6

Crystallization of a Microprotein and Structure Analysis

Protein Crystallization and Data Collection

Initial screening using Jena Bioscience screens yielded small crystals under several conditions. Condition C3 from screen 6 (2 M ammonium sulphate, 5% PEG 400, 01.M MES pH 6.5) was further optimised and crystals used for data collection were grown by the sitting drop method at 4° C. with 1.3 M ammonium sulphate, 7% PEG 400 (v/v), 0.1 M MES pH 6.5 as reservoir solution. Droplets were mixed from 8 ml protein (30 mg/ml) and 4 ml reservoir solution. Crystals were plate shaped and grew over several weeks to a final size of about 500×500×35 mm (FIG. 13). Typically, stacks of plates were obtained, that had to be broken apart to isolate single plates for data collection. For cryoprotection crystals were immersed in mother liquor containing 25% glycerol and flash frozen in liquid nitrogen. Before data collection, crystals were annealed three times by blocking the cryo stream for several seconds. Annealing improved spot shape and resolution (FIG. 14). Data were collected to a resolution of 1.3 Å at DESY beamline BW6 at 100 K and a wavelength of 1.050 Å using a MarCCD detector. Data were processed with XDS and scaled with XSCALE (Kabsch 1993). Data statistics are given in Table 4. The raw data are given in PDB format in Table 6.

Structure Solution and Refinement

Initial phases were determined using in-house data to 2.9 Å by molecular replacement as implemented in the program EPMR (Kissinger, Gehlhaar et al. 1999) using a monomer of barnase (PDB ID 1A2P) as search model. Matthews probability predicted the asymmetric unit to most likely contain three molecules based on all entries in the PDB or four molecules given the resolution of the crystal (Kantardjieff and Rupp 2003). The search for three molecules in the asymmetric unit in EPMR yielded the highest correlation coefficient and lowest R factor upon placing the second molecule, while adding a third molecule gave worse results. Packing was checked in 0 (Jones, Zou et al. 1991). Barnase monomers packed against each other with their C-terminus pointing towards empty space available to the MCoTi-II part of the fusion protein (FIG. 15A). This indicated a correct solution and means that the crystals actually contain only 2 molecules per asymmetric unit. Accordingly, the Matthew's coefficient is 3.76 and the solvent content 67.3% (FIG. 15B), which is very unusual for crystals diffracting to 1.3 Å. Rigid body refinement of barnase was carried out in Refmac (Winn, Murshudov et al. 2003) followed by restrained refinement. An attempt to place the MCoTi-II part by molecular replacement using EPMR with barnase fixed and one state of the MCoTi-II NMR structure (PDB ID 1HA9) as search model failed. Hence, the MCoTi-II part was built manually using the initial 2.9 Å data. The model refined at 2.9 Å was used later for refinement with the high resolution data set keeping the free R set. ARP/wARP was used for finding water molecules. The current model contains all residues of the fusion protein, 477 water molecules, 2 PEG molecules, 6 sulfate ions and 3 glycerol molecules. Each barnase and each MCoTi-II was defined as a separate group for TLS refinement in REFMAC. Statistics of refinement are given in Table 4. Structure analysis, fitting of homologous structures and calculation of rmsds was carried out in Swiss PDB Viewer (Guex and Peitsch 1997). Figures were rendered in PyMol (DeLano 2002).

Results

A variant of the squash trypsin inhibitor MCoTi-II, which naturally occurs as a cyclic peptide in Momordica cochinchinensis (spiny bitter cucumber), was crystallized as a fusion protein with a catalytically inactive mutant of barnase, barnase′ (see Example 4, supra). The fusion protein (SEQ ID NO: 17) had been recombinantly expressed in E. coli and purified to homogeneity (Example 4, supra). The structure of the fusion protein (FIG. 16) was solved at a resolution of 1.3 Å by molecular replacement using the barnase wild-type structure as search model. There are two molecules of the fusion protein in the asymmetric unit. The two molecules can be aligned with an rmsd of 0.71 Å for 572 backbone atoms and an rmsd of 0.85 for all atoms (FIG. 17). The difference is mainly caused by a rigid body movement of barnase and MCoTi-II relative to one another, as the individual domains in the fusion protein can be overlaid with considerably lower rmsd (FIG. 18) 0.3 Å for 120 backbone atoms in MCoTi-II and 0.34 Å for 436 backbone atoms in barnase (see Table 5). The two proteins are joined by a four residue linker (SSSM) which allows for this flexibility. In both molecules of the asymmetric unit, a PEG molecule is found near Lys 10 of MCoTi-II (FIGS. 18 and 19). By analogy with the crystal structure of the complex formed between bovine beta-trypsin and MCTI-A, another squash-type trypsin inhibitor, Lys10 is the residue, which is inserted into the active site of trypsin. Although in different overall orientation, the PEGs in both molecules adopt a conformation similar to crown ethers, positioning four to six oxygens favourably for hydrogen bond formation. Lys 10 is among the residues varying most between the two MCoTi-II monomers. The largest differences are in residues Gly6 to Leu12 and around Pro29. When overlaid with the first states of two NMR structures available in the PDB (1HA9 and 1IB9) and with the crystal structure of MCTI-I (1F2S), another squashtype trypsin inhibitor, the agreement is best with the crystal structure of MCTI-I (FIG. 20).
Table 4 provides an overview of the data statistics for data collection and refinement statistics carried out when analyzing the crystal structure of fusion protein McoTi-II-barnase′


Data collection
Space group	C222₁
Cell dimensions	a = 73.981, b = 217.820,
	c = 58.322
	α = β = γ = 90°.
Resolution range (Å)	40-1.3 (1.4-1.3)
Measured reflections	356629 (59959)
Unique reflections	114401 (2246)
Completeness (%)	98.7 (98.1)
R_ivm	3.9 (41.8)
I/σI	14.01 (2.42)
Refinement
Atoms
Protein	2292
Water	477
PEG, sulfate, glycerol	94
R_cryst/R_free(%)¹⁾	18.7/20.8
R.m.s. deviation from ideal
Bonds (Å)	0.008
Angles (°)	1.569
Most favored/additionally allowed Φ, ψ (%)	91/9

¹⁾The test set comprised 2292 reflections (2%).

Table 5 is a comparison of the two crystallographically independent fusion proteins contained in the asymmetrical unit of the McoTi-II-barnase′ fusion


		# of atoms
		(bb = backbone
Molecules compared	Rmsd (Å)	a = all atoms)

Fusion protein	0.71	572
	0.85	1102
Barnase	0.34	436
	0.51	867
MCoTi-II	0.3	120
	0.79	209

Table 6 (next pages) depicts the raw data obtained by X-ray diffraction structure analysis of the McoTi-II-barnase′ crystal described herein. The data is in PDB format. The two monomers contained in the asymmetrical unit are annoted in the data set as “A” and “B”. The coordinates of barnase′ including linker have order numbers 1-114, those of the microprotein portion 115-144.


HEADER	----	XX-XXX-XX xxxx
COMPND	---
REMARK	3

REMARK	3	REFINEMENT.
REMARK	3	PROGRAM	: REFMAC 5.1.24
REMARK	3	AUTHORS	: MURSHUDOV, VAGIN, DODSON
REMARK
	3

REMARK	3	REFINEMENT TARGET: MAXIMUM LIKELIHOOD
REMARK
	3
REMARK	3	DATA USED IN REFINEMENT.

REMARK	3	RESOLUTION RANGE HIGH	(ANGSTROMS)	: 1.90
REMARK	3	RESOLUTION RANGE LOW	(ANGSTROMS)	: 19.28
REMARK	3	DATA CUTOFF	(SIGMA(F))	: NONE

REMARK

	3	COMPLETENESS FOR RANGE	(%)	: 100.00
REMARK	3	NUMBER OF REFLECTIONS		: 35284
REMARK	3

REMARK

3

FIT TO DATA USED IN REFINEMENT.

REMARK	3	CROSS-VALIDATION METHOD	: THROUGHOUT
REMARK	3	FREE R VALUE TEST SET SELECTION	: RANDOM

REMARK	3	R VALUE	(WORKING + TEST SET)	: 0.18176
REMARK	3	R VALUE	(WORKING SET)	: 0.17918

REMARK

3

FREE R VALUE

: 0.23111

REMARK

3

FREE R VALUE TEST SET SIZE

(%)

: 5.0

REMARK	3	FREE R VALUE TEST SET COUNT	: 1858
REMARK	3

REMARK

3

FIT IN THE HIGHEST RESOLUTION BIN.

REMARK	3	TOTAL NUMBER OF BINS USED	:	20
REMARK	3	BIN RESOLUTION RANGE HIGH	:	1.900
REMARK	3	BIN RESOLUTION RANGE LOW	:	1.949

REMARK	3	REFLECTION IN BIN	(WORKING SET)	:	2544
REMARK	3	BIN R VALUE	(WORKING SET)	:	0.320

REMARK	3	BIN FREE R VALUE SET COUNT	:	134
REMARK	3	BIN FREE R VALUE	:	0.358
REMARK	3

REMARK

3

NUMBER OF NON-HYDROGEN ATOMS USED IN REFINEMENT.

REMARK	3	ALL ATOMS	: 2666
REMARK	3
REMARK	3	B VALUES.

REMARK	3	FROM WILSON PLOT	(A**2)	: NULL
REMARK
	3	MEAN B VALUE	(OVERALL, A**2)	: 13.186

REMARK	3	OVERALL ANISOTROPIC B VALUE.
REMARK	3	B11 (A**2) : 1.01
REMARK	3	B22 (A**2) : −1.55
REMARK	3	B33 (A**2) : 0.54
REMARK	3	B12 (A**2) : 0.00
REMARK	3	B13 (A**2) : 0.00
REMARK	3	B23 (A**2) : 0.00
REMARK	3
REMARK	3	ESTIMATED OVERALL COORDINATE ERROR.

REMARK	3	ESU BASED ON R VALUE	(A)	: 0.114
REMARK	3	ESU BASED ON FREE R VALUE	(A)	: 0.123
REMARK	3	ESU BASED ON MAXIMUM LIKELIHOOD	(A)	: 0.090
REMARK	3	ESU FOR B VALUES BASED ON MAXIMUM LIKELIHOOD	(A**2)	: 3.289
REMARK	3

REMARK

3

CORRELATION COEFFICIENTS.

REMARK	3	CORRELATION COEFFICIENT FO-FC	: 0.947
REMARK	3	CORRELATION COEFFICIENT FO-FC FREE	: 0.916
REMARK	3

REMARK

3

RMS DEVIATIONS FROM IDEAL VALUES

COUNT

RMS

WEIGHT

REMARK	3	BOND LENGTHS REFINED ATOMS	(A):	2298;	0.029;	0.021
REMARK	3	BOND LENGTHS OTHERS	(A):	2000;	0.002;	0.020
REMARK	3	BOND ANGLES REFINED ATOMS	(DEGREES):	3096;	3.569;	1.965
REMARK	3	BOND ANGLES OTHERS	(DEGREES):	4678;	1.425;	3.000
REMARK	3	TORSION ANGLES, PERIOD 1	(DEGREES):	284;	6.563;	5.000
REMARK	3	CHIRAL-CENTER RESTRAINTS	(A**3):	322;	0.442;	0.200

REMARK	3	GENERAL PLANES REFINED ATOMS	(A):	2540;	0.021;	0.020
REMARK	3	GENERAL PLANES OTHERS	(A):	478;	0.019;	0.020
REMARK	3	NON-BONDED CONTACTS REFINED ATOMS	(A):	493;	0.216;	0.300
REMARK	3	NON-BONDED CONTACTS OTHERS	(A):	2588;	0.275;	0.300
REMARK	3	NON-BONDED TORSION OTHERS	(A):	1402;	0.109;	0.500
REMARK	3	H-BOND (X...Y) REFINED ATOMS	(A):	474;	0.292;	0.500
REMARK	3	SYMMETRY VDW REFINED ATOMS	(A):	11;	0.190;	0.300
REMARK	3	SYMMETRY VDW OTHERS	(A):	59;	0.269;	0.300
REMARK	3	SYMMETRY H-BOND REFINED ATOMS	(A):	44;	0.277;	0.500
REMARK	3

REMARK

3

ISOTROPIC THERMAL FACTOR RESTRAINTS.

COUNT

RMS

WEIGHT

REMARK	3	MAIN-CHAIN BOND REFINED ATOMS	(A**2):	1410;	1.920;	2.000
REMARK	3	MAIN-CHAIN ANGLE REFINED ATOMS	(A**2):	2254;	2.794;	3.000
REMARK	3	SIDE-CHAIN BOND REFINED ATOMS	(A**2):	888;	2.293;	2.000
REMARK	3	SIDE-CHAIN ANGLE REFINED ATOMS	(A**2):	842;	3.356;	3.000
REMARK	3

REMARK	3	NCS RESTRAINTS STATISTICS
REMARK	3	NUMBER OF NCS GROUPS: NULL
REMARK	3
REMARK	3
REMARK	3	TLS DETAILS
REMARK	3	NUMBER OF TLS GROUPS : 4
REMARK	3
REMARK	3	TLS GROUP : 1
REMARK	3	NUMBER OF COMPONENTS GROUP : 1

REMARK	3	COMPONENTS	C SSSEQI TO	C SSSEQI
REMARK	3	RESIDUE RANGE :	A 2	A 110

REMARK

3

ORIGIN FOR THE GROUP (A): 9.5430 68.2450 26.2250

REMARK	3	T TENSOR
REMARK	3	T11:	0.0557	T22:	0.1193
REMARK	3	T33:	0.1386	T12:	0.0268
REMARK	3	T13:	−0.0867	T23:	−0.0367
REMARK	3	L TENSOR
REMARK	3	L11:	2.3675	L22:	1.2064
REMARK	3	L33:	1.0960	L12:	0.8409
REMARK	3	L13:	0.7086	L23:	0.1284
REMARK	3	S TENSOR
REMARK	3	S11:	−0.1261	S12:	−0.1671	S13:	0.2670
REMARK	3	S21:	0.0795	S22:	−0.0329	S23:	0.0422
REMARK	3	S31:	−0.1451	S32:	−0.0618	S33:	0.1590
REMARK	3

REMARK	3	TLS GROUP : 2
REMARK	3	NUMBER OF COMPONENTS GROUP : 1

REMARK	3	COMPONENTS	C SSSEQI TO	C SSSEQI
REMARK	3	RESIDUE RANGE :	A 115	A 144

REMARK

3

ORIGIN FOR THE GROUP (A): 12.2140 42.0860 17.9500

REMARK	3	T TENSOR
REMARK	3	T11:	0.0566	T22:	0.1455
REMARK	3	T33:	0.1138	T12:	0.0113
REMARK	3	T13:	0.0248	T23:	0.0103
REMARK	3	L TENSOR
REMARK	3	L11:	2.3057	L22:	5.5183
REMARK	3	L33:	2.7772	L12:	1.8588
REMARK	3	L13:	−0.9244	L23:	−2.0762
REMARK	3	S TENSOR
REMARK	3	S11:	−0.3277	S12:	−0.0677	S13:	−0.0462
REMARK	3	S21:	0.0131	S22:	0.1046	S23:	−0.3114
REMARK	3	S31:	0.2482	S32:	0.1350	S33:	0.2231
REMARK	3

REMARK	3	TLS GROUP : 3
REMARK	3	NUMBER OF COMPONENTS GROUP : 1

REMARK	3	COMPONENTS	C SSSEQI TO	C SSSEQI
REMARK	3	RESIDUE RANGE :	B 2	B 110

REMARK

3

ORIGIN FOR THE GROUP (A): 8.1830 15.5270 27.3540

REMARK	3	T TENSOR
REMARK	3	T11:	0.1252	T22:	0.1062
REMARK	3	T33:	0.0617	T12:	−0.0050
REMARK	3	T13:	0.0228	T23:	0.0100
REMARK	3	L TENSOR
REMARK	3	L11:	0.5175	L22:	2.2632
REMARK	3	L33:	2.3909	L12:	−0.0338
REMARK	3	L13:	−0.0735	L23:	−1.3985
REMARK	3	S TENSOR
REMARK	3	S11:	0.0663	S12:	−0.0226	S13:	−0.0235
REMARK	3	S21:	0.1096	S22:	−0.1191	S23:	−0.2038
REMARK	3	S31:	0.1755	S32:	0.0797	S33:	0.0529
REMARK	3

REMARK	3	TLS GROUP : 4
REMARK	3	NUMBER OF COMPONENTS GROUP : 1

REMARK	3	COMPONENTS	C SSSEQI TO	C SSSEQI
REMARK	3	RESIDUE RANGE :	B 115	B 144

REMARK

3

ORIGIN FOR THE GROUP (A): −1.2080 42.0850 26.2740

REMARK	3	T TENSOR
REMARK	3	T11:	0.0583	T22:	0.1343
REMARK	3	T33:	0.0798	T12:	0.0154
REMARK	3	T13:	0.0490	T23:	−0.0002
REMARK	3	L TENSOR
REMARK	3	L11:	4.7339	L22:	6.5857
REMARK	3	L33:	2.7012	L12:	−0.8531
REMARK	3	L13:	1.2150	L23:	0.2365
REMARK	3	S TENSOR
REMARK	3	S11:	−0.2007	S12:	−0.3160	S13:	0.1082
REMARK	3	S21:	0.3828	S22:	0.0444	S23:	0.1488
REMARK	3	S31:	−0.1538	S32:	0.0224	S33:	0.1563
REMARK	3
REMARK	3

REMARK	3	BULK SOLVENT MODELLING.
REMARK	3	METHOD USED : BABINET MODEL WITH MASK
REMARK	3	PARAMETERS FOR MASK CALCULATION

REMARK	3	VDW PROBE RADIUS	: 1.40
REMARK	3	ION PROBE RADIUS	: 0.80
REMARK	3	SHRINKAGE RADIUS	: 0.80
REMARK	3

REMARK	3	OTHER REFINEMENT REMARKS:
REMARK	3	HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS
REMARK	3

CISPEP	1	GLN	A	2	VAL	A	3	0.00
SSBOND	1	CYS	A	117	CYS	A	134
SSBOND	2	CYS	A	124	CYS	A	136
SSBOND	3	CYS	A	130	CYS	A	142
SSBOND	4	CYS	B	117	CYS	B	134
SSBOND	5	CYS	B	124	CYS	B	136
SSBOND	6	CYS	B	130	CYS	B	142

CRYST1

73.640

216.650

58.160

90.00

C 2 2 21

SCALE1	0.013580	0.000000	0.000000
SCALE2	0.000000	0.004616	0.000000
SCALE3	0.000000	0.000000	0.017194

ATOM	1	N	GLN	A	2	22.714	65.533	17.841	1.00	51.42	N
ATOM	3	CA	GLN	A	2	23.297	65.293	16.498	1.00	52.25	C
ATOM	5	CB	GLN	A	2	23.615	63.798	16.334	1.00	54.95	C
ATOM	8	CG	GLN	A	2	25.085	63.453	16.110	1.00	57.21	C
ATOM	11	CD	GLN	A	2	25.383	62.940	14.662	1.00	59.28	C
ATOM	12	OE1	GLN	A	2	24.475	62.435	13.953	1.00	59.58	O
ATOM	13	NE2	GLN	A	2	26.667	63.055	14.238	1.00	59.05	N
ATOM	16	C	GLN	A	2	22.329	65.811	15.433	1.00	48.06	C
ATOM	17	O	GLN	A	2	22.618	65.730	14.219	1.00	49.79	O
ATOM	20	N	VAL	A	3	21.234	66.449	15.853	1.00	41.37	N
ATOM	22	CA	VAL	A	3	20.732	66.626	17.234	1.00	34.29	C
ATOM	24	CB	VAL	A	3	20.931	68.077	17.865	1.00	36.02	C
ATOM	26	CG1	VAL	A	3	19.746	68.645	18.566	1.00	35.76	C
ATOM	30	CG2	VAL	A	3	22.043	68.143	18.980	1.00	38.59	C
ATOM	34	C	VAL	A	3	19.240	66.436	16.849	1.00	25.30	C
ATOM	35	O	VAL	A	3	18.798	67.055	15.915	1.00	25.57	O
ATOM	36	N	ILE	A	4	18.489	65.685	17.631	1.00	14.79	N
ATOM	38	CA	ILE	A	4	17.032	65.562	17.436	1.00	9.63	C
ATOM	40	CB	ILE	A	4	16.733	64.041	17.614	1.00	10.11	C
ATOM	42	CG1	ILE	A	4	17.699	63.151	16.725	1.00	12.96	C
ATOM	45	CD1	ILE	A	4	17.501	61.602	16.749	1.00	15.54	C
ATOM	49	CG2	ILE	A	4	15.401	63.628	17.280	1.00	11.19	C
ATOM	53	C	ILE	A	4	16.259	66.398	18.463	1.00	9.80	C
ATOM	54	O	ILE	A	4	16.006	66.065	19.634	1.00	15.16	O
ATOM	55	N	ASN	A	5	15.703	67.414	17.886	1.00	11.17	N
ATOM	57	CA	ASN	A	5	15.339	68.738	18.336	1.00	12.63	C
ATOM	59	CB	ASN	A	5	16.186	69.932	17.409	1.00	11.32	C
ATOM	62	CG	ASN	A	5	16.346	70.863	18.372	1.00	17.03	C
ATOM	63	OD1	ASN	A	5	16.974	71.871	18.477	1.00	21.67	O
ATOM	64	ND2	ASN	A	5	15.869	70.160	19.472	1.00	20.49	N
ATOM	67	C	ASN	A	5	13.896	69.048	17.860	1.00	11.85	C
ATOM	68	O	ASN	A	5	13.354	70.061	18.270	1.00	8.88	O
ATOM	69	N	THR	A	6	13.521	68.490	16.731	1.00	11.41	N
ATOM	71	CA	THR	A	6	12.252	68.817	16.131	1.00	12.37	C
ATOM	73	CB	THR	A	6	12.284	68.692	14.624	1.00	14.14	C
ATOM	75	OG1	THR	A	6	12.544	67.323	14.245	1.00	13.81	O
ATOM	77	CG2	THR	A	6	13.475	69.517	14.095	1.00	15.31	C
ATOM	81	C	THR	A	6	11.029	68.075	16.682	1.00	12.95	C
ATOM	82	O	THR	A	6	11.163	66.971	17.180	1.00	9.25	O
ATOM	83	N	PHE	A	7	9.844	68.629	16.409	1.00	11.85	N
ATOM	85	CA	PHE	A	7	8.609	68.029	16.838	1.00	11.89	C
ATOM	87	CB	PHE	A	7	7.388	68.783	16.372	1.00	13.02	C
ATOM	90	CG	PHE	A	7	7.092	70.038	17.167	1.00	12.66	C
ATOM	91	CD1	PHE	A	7	6.661	69.949	18.523	1.00	11.60	C
ATOM	93	CE1	PHE	A	7	6.522	71.133	19.245	1.00	11.80	C
ATOM	95	CZ	PHE	A	7	6.788	72.375	18.623	1.00	9.66	C
ATOM	97	CE2	PHE	A	7	7.164	72.444	17.311	1.00	12.14	C
ATOM	99	CD2	PHE	A	7	7.393	71.295	16.613	1.00	11.78	C
ATOM	101	C	PHE	A	7	8.539	66.601	16.283	1.00	10.82	C
ATOM	102	O	PHE	A	7	8.203	65.682	17.077	1.00	10.87	O
ATOM	103	N	ASP	A	8	8.725	66.458	14.955	1.00	8.74	N
ATOM	105	CA	ASP	A	8	8.624	65.165	14.254	1.00	8.34	C
ATOM	107	CB	ASP	A	8	8.552	65.307	12.761	1.00	8.38	C
ATOM	110	CG	ASP	A	8	7.181	65.848	12.385	1.00	8.22	C
ATOM	111	OD1	ASP	A	8	6.157	65.350	12.901	1.00	8.55	O
ATOM	112	OD2	ASP	A	8	7.076	66.792	11.570	1.00	8.62	O
ATOM	113	C	ASP	A	8	9.761	64.248	14.650	1.00	9.81	C
ATOM	114	O	ASP	A	8	9.629	63.060	14.898	1.00	6.21	O
ATOM	115	N	GLY	A	9	10.927	64.821	14.778	1.00	8.66	N
ATOM	117	CA	GLY	A	9	11.972	63.899	15.115	1.00	8.43	C
ATOM	120	C	GLY	A	9	11.842	63.372	16.545	1.00	9.71	C
ATOM	121	O	GLY	A	9	12.204	62.235	16.774	1.00	11.69	O
ATOM	122	N	VAL	A	10	11.526	64.228	17.505	1.00	7.35	N
ATOM	124	CA	VAL	A	10	11.445	63.809	18.896	1.00	6.20	C
ATOM	126	CB	VAL	A	10	11.403	64.969	19.833	1.00	8.73	C
ATOM	128	CG1	VAL	A	10	11.229	64.568	21.311	1.00	8.03	C
ATOM	132	CG2	VAL	A	10	12.672	65.808	19.621	1.00	8.63	C
ATOM	136	C	VAL	A	10	10.187	62.955	18.973	1.00	8.44	C
ATOM	137	O	VAL	A	10	10.165	61.921	19.547	1.00	9.75	O
ATOM	138	N	ALA	A	11	9.145	63.249	18.235	1.00	8.06	N
ATOM	140	CA	ALA	A	11	7.956	62.404	18.296	1.00	6.38	C
ATOM	142	CB	ALA	A	11	6.871	63.013	17.484	1.00	7.54	C
ATOM	146	C	ALA	A	11	8.223	60.997	17.795	1.00	8.53	C
ATOM	147	O	ALA	A	11	7.773	59.998	18.394	1.00	8.60	O
ATOM	148	N	ASP	A	12	8.905	60.912	16.653	1.00	10.14	N
ATOM	150	CA	ASP	A	12	9.201	59.571	16.151	1.00	8.94	C
ATOM	152	CB	ASP	A	12	9.841	59.678	14.813	1.00	7.64	C
ATOM	155	CG	ASP	A	12	8.919	60.189	13.703	1.00	10.41	C
ATOM	156	OD1	ASP	A	12	7.683	60.170	13.869	1.00	12.37	O
ATOM	157	OD2	ASP	A	12	9.417	60.663	12.675	1.00	9.96	O
ATOM	158	C	ASP	A	12	10.084	58.849	17.163	1.00	9.46	C
ATOM	159	O	ASP	A	12	9.976	57.640	17.320	1.00	8.43	O
ATOM	160	N	TYR	A	13	11.142	59.531	17.599	1.00	9.27	N
ATOM	162	CA	TYR	A	13	12.082	58.969	18.538	1.00	8.06	C
ATOM	164	CB	TYR	A	13	13.273	59.911	18.868	1.00	8.94	C
ATOM	167	CG	TYR	A	13	14.422	59.228	19.526	1.00	7.46	C
ATOM	168	CD1	TYR	A	13	14.454	58.988	20.878	1.00	7.54	C
ATOM	170	CE1	TYR	A	13	15.513	58.373	21.475	1.00	7.44	C
ATOM	172	CZ	TYR	A	13	16.661	58.039	20.738	1.00	9.30	C
ATOM	173	OH	TYR	A	13	17.767	57.465	21.340	1.00	12.39	O
ATOM	175	CE2	TYR	A	13	16.705	58.335	19.414	1.00	9.34	C
ATOM	177	CD2	TYR	A	13	15.574	58.883	18.787	1.00	7.69	C
ATOM	179	C	TYR	A	13	11.416	58.397	19.783	1.00	11.59	C
ATOM	180	O	TYR	A	13	11.725	57.223	20.139	1.00	11.48	O
ATOM	181	N	LEU	A	14	10.496	59.177	20.357	1.00	9.26	N
ATOM	183	CA	LEU	A	14	9.752	58.756	21.573	1.00	10.40	C
ATOM	185	CB	LEU	A	14	8.804	59.847	22.009	1.00	10.03	C
ATOM	188	CG	LEU	A	14	9.544	60.946	22.748	1.00	10.37	C
ATOM	190	CD1	LEU	A	14	8.744	62.140	22.732	1.00	10.65	C
ATOM	194	CD2	LEU	A	14	9.956	60.569	24.104	1.00	9.47	C
ATOM	198	C	LEU	A	14	8.964	57.490	21.225	1.00	9.22	C
ATOM	199	O	LEU	A	14	8.879	56.536	21.962	1.00	8.39	O
ATOM	200	N	GLN	A	15	8.169	57.576	20.148	1.00	6.72	N
ATOM	202	CA	GLN	A	15	7.420	56.409	19.768	1.00	8.38	C
ATOM	204	CB	GLN	A	15	6.320	56.771	18.708	1.00	5.44	C
ATOM	207	CG	GLN	A	15	5.426	57.873	19.269	1.00	7.39	C
ATOM	210	CD	GLN	A	15	4.151	57.906	18.454	1.00	11.03	C
ATOM	211	OE1	GLN	A	15	4.189	57.833	17.224	1.00	10.64	O
ATOM	212	NE2	GLN	A	15	3.026	57.918	19.120	1.00	8.47	N
ATOM	215	C	GLN	A	15	8.180	55.150	19.370	1.00	6.72	C
ATOM	216	O	GLN	A	15	7.634	54.043	19.664	1.00	9.19	O
ATOM	217	N	THR	A	16	9.400	55.270	18.868	1.00	6.36	N
ATOM	219	CA	THR	A	16	10.178	54.114	18.658	1.00	6.80	C
ATOM	221	CB	THR	A	16	11.254	54.550	17.647	1.00	9.04	C
ATOM	223	OG1	THR	A	16	10.557	55.015	16.509	1.00	7.21	O
ATOM	225	CG2	THR	A	16	12.063	53.377	17.151	1.00	8.26	C
ATOM	229	C	THR	A	16	10.782	53.490	19.924	1.00	7.67	C
ATOM	230	O	THR	A	16	10.765	52.278	20.163	1.00	7.74	O
ATOM	231	N	TYR	A	17	11.577	54.349	20.551	1.00	10.58	N
ATOM	233	CA	TYR	A	17	12.373	53.971	21.706	1.00	8.90	C
ATOM	235	CB	TYR	A	17	13.663	54.748	21.646	1.00	10.32	C
ATOM	238	CG	TYR	A	17	14.368	54.411	20.386	1.00	10.81	C
ATOM	239	CD1	TYR	A	17	14.456	55.350	19.366	1.00	10.23	C
ATOM	241	CE1	TYR	A	17	15.098	55.069	18.144	1.00	11.90	C
ATOM	243	CZ	TYR	A	17	15.689	53.811	17.935	1.00	14.28	C
ATOM	244	OH	TYR	A	17	16.254	53.477	16.702	1.00	10.14	O
ATOM	246	CE2	TYR	A	17	15.619	52.827	18.981	1.00	15.09	C
ATOM	248	CD2	TYR	A	17	14.874	53.126	20.198	1.00	12.77	C
ATOM	250	C	TYR	A	17	11.812	54.155	23.088	1.00	9.09	C
ATOM	251	O	TYR	A	17	12.393	53.597	23.993	1.00	8.25	O
ATOM	252	N	HIS	A	18	10.744	54.926	23.201	1.00	8.12	N
ATOM	254	CA	HIS	A	18	10.096	55.214	24.508	1.00	10.80	C
ATOM	256	CB	HIS	A	18	9.635	53.948	25.185	1.00	8.03	C
ATOM	259	CG	HIS	A	18	8.345	53.390	24.684	1.00	8.19	C
ATOM	260	ND1	HIS	A	18	7.755	53.675	23.466	1.00	11.32	N
ATOM	262	CE1	HIS	A	18	6.644	52.958	23.315	1.00	7.41	C
ATOM	264	NE2	HIS	A	18	6.516	52.210	24.401	1.00	9.71	N
ATOM	266	CD2	HIS	A	18	7.598	52.410	25.220	1.00	7.11	C
ATOM	268	C	HIS	A	18	10.945	55.950	25.536	1.00	9.81	C
ATOM	269	O	HIS	A	18	11.005	55.597	26.692	1.00	10.04	O
ATOM	270	N	LYS	A	19	11.799	56.783	25.001	1.00	11.80	N
ATOM	272	CA	LYS	A	19	12.712	57.645	25.737	1.00	12.16	C
ATOM	274	CB	LYS	A	19	14.025	56.952	26.188	1.00	13.25	C
ATOM	277	CG	LYS	A	19	14.911	56.337	25.134	1.00	14.23	C
ATOM	280	CD	LYS	A	19	16.081	55.623	25.742	1.00	18.80	C
ATOM	283	CE	LYS	A	19	16.757	54.993	24.442	1.00	19.86	C
ATOM	286	NZ	LYS	A	19	18.114	54.638	24.964	1.00	21.92	N
ATOM	290	C	LYS	A	19	13.036	58.804	24.789	1.00	14.37	C
ATOM	291	O	LYS	A	19	12.850	58.709	23.596	1.00	12.39	O
ATOM	292	N	LEU	A	20	13.512	59.902	25.369	1.00	13.18	N
ATOM	294	CA	LEU	A	20	13.955	61.071	24.623	1.00	12.39	C
ATOM	296	CB	LEU	A	20	13.959	62.266	25.581	1.00	11.63	C
ATOM	299	CG	LEU	A	20	12.572	62.858	25.874	1.00	12.36	C
ATOM	301	CD1	LEU	A	20	12.842	63.805	27.067	1.00	14.63	C
ATOM	305	CD2	LEU	A	20	12.006	63.572	24.678	1.00	12.86	C
ATOM	309	C	LEU	A	20	15.282	60.747	24.083	1.00	8.62	C
ATOM	310	O	LEU	A	20	16.027	59.887	24.673	1.00	11.07	O
ATOM	311	N	PRO	A	21	15.669	61.396	22.978	1.00	7.66	N
ATOM	312	CA	PRO	A	21	17.030	61.185	22.536	1.00	11.67	C
ATOM	314	CB	PRO	A	21	17.153	62.065	21.298	1.00	13.63	C
ATOM	317	CG	PRO	A	21	15.921	62.790	21.172	1.00	12.59	C
ATOM	320	CD	PRO	A	21	14.933	62.257	22.050	1.00	11.31	C
ATOM	323	C	PRO	A	21	18.066	61.784	23.470	1.00	13.18	C
ATOM	324	O	PRO	A	21	17.658	62.525	24.351	1.00	10.88	O
ATOM	325	N	ASP	A	22	19.333	61.502	23.188	1.00	15.40	N
ATOM	327	CA	ASP	A	22	20.443	61.785	24.122	1.00	17.57	C
ATOM	329	CB	ASP	A	22	21.662	61.062	23.593	1.00	24.41	C
ATOM	332	CG	ASP	A	22	21.513	59.510	23.725	1.00	31.16	C
ATOM	333	OD1	ASP	A	22	20.568	59.028	24.453	1.00	32.54	O
ATOM	334	OD2	ASP	A	22	22.254	58.691	23.046	1.00	35.54	O
ATOM	335	C	ASP	A	22	20.810	63.259	24.412	1.00	16.73	C
ATOM	336	O	ASP	A	22	21.558	63.592	25.341	1.00	13.24	O
ATOM	337	N	ASN	A	23	20.170	64.169	23.684	1.00	13.14	N
ATOM	339	CA	ASN	A	23	20.316	65.548	23.904	1.00	12.64	C
ATOM	341	CB	ASN	A	23	20.273	66.304	22.595	1.00	13.51	C
ATOM	344	CG	ASN	A	23	18.946	66.065	21.843	1.00	12.48	C
ATOM	345	OD1	ASN	A	23	18.757	64.931	21.412	1.00	14.44	O
ATOM	346	ND2	ASN	A	23	18.107	67.103	21.605	1.00	11.53	N
ATOM	349	C	ASN	A	23	19.407	66.138	24.931	1.00	12.26	C
ATOM	350	O	ASN	A	23	19.483	67.323	25.099	1.00	12.57	O
ATOM	351	N	TYR	A	24	18.532	65.358	25.568	1.00	13.29	N
ATOM	353	CA	TYR	A	24	17.668	65.811	26.648	1.00	10.21	C
ATOM	355	CB	TYR	A	24	16.312	65.214	26.465	1.00	10.68	C
ATOM	358	CG	TYR	A	24	15.655	65.918	25.280	1.00	10.21	C
ATOM	359	CD1	TYR	A	24	14.960	67.105	25.486	1.00	11.90	C
ATOM	361	CE1	TYR	A	24	14.371	67.769	24.470	1.00	12.10	C
ATOM	363	CZ	TYR	A	24	14.359	67.244	23.188	1.00	9.06	C
ATOM	364	OH	TYR	A	24	13.856	67.954	22.080	1.00	9.96	O
ATOM	366	CE2	TYR	A	24	14.989	66.015	22.966	1.00	11.14	C
ATOM	368	CD2	TYR	A	24	15.701	65.379	23.959	1.00	11.66	C
ATOM	370	C	TYR	A	24	18.209	65.569	28.048	1.00	12.21	C
ATOM	371	O	TYR	A	24	18.776	64.512	28.261	1.00	10.15	O
ATOM	372	N	ILE	A	25	18.012	66.559	28.917	1.00	9.70	N
ATOM	374	CA	ILE	A	25	18.206	66.459	30.306	1.00	11.83	C
ATOM	376	CB	ILE	A	25	19.506	67.213	30.728	1.00	11.40	C
ATOM	378	CG1	ILE	A	25	19.440	68.693	30.416	1.00	9.91	C
ATOM	381	CD1	ILE	A	25	20.762	69.389	30.853	1.00	10.20	C
ATOM	385	CG2	ILE	A	25	20.708	66.655	30.035	1.00	11.11	C
ATOM	389	C	ILE	A	25	17.027	67.000	30.988	1.00	11.74	C
ATOM	390	O	ILE	A	25	16.385	67.972	30.528	1.00	8.70	O
ATOM	391	N	THR	A	26	16.734	66.404	32.127	1.00	11.03	N
ATOM	393	CA	THR	A	26	15.652	67.030	32.872	1.00	9.56	C
ATOM	395	CB	THR	A	26	15.130	66.092	33.987	1.00	11.31	C
ATOM	397	OG1	THR	A	26	16.152	65.889	34.971	1.00	10.67	O
ATOM	399	CG2	THR	A	26	14.797	64.684	33.576	1.00	12.02	C
ATOM	403	C	THR	A	26	15.942	68.370	33.479	1.00	11.08	C
ATOM	404	O	THR	A	26	17.095	68.793	33.616	1.00	14.78	O
ATOM	405	N	LYS	A	27	14.906	68.974	34.062	1.00	13.18	N
ATOM	407	CA	LYS	A	27	15.031	70.284	34.711	1.00	15.98	C
ATOM	409	CB	LYS	A	27	13.708	70.925	35.272	1.00	17.62	C
ATOM	412	CG	LYS	A	27	12.763	71.828	34.349	1.00	25.05	C
ATOM	415	CD	LYS	A	27	11.112	71.441	34.443	1.00	26.12	C
ATOM	418	CE	LYS	A	27	10.193	71.244	33.189	1.00	27.01	C
ATOM	421	NZ	LYS	A	27	9.557	72.396	32.193	1.00	26.80	N
ATOM	425	C	LYS	A	27	16.068	70.157	35.809	1.00	13.27	C
ATOM	426	O	LYS	A	27	16.999	70.916	35.857	1.00	14.27	O
ATOM	427	N	SER	A	28	15.877	69.187	36.707	1.00	9.50	N
ATOM	429	CA	SER	A	28	16.734	68.983	37.841	1.00	10.56	C
ATOM	431	CB	SER	A	28	16.099	67.834	38.613	1.00	11.46	C
ATOM	434	OG	SER	A	28	15.088	68.316	39.454	1.00	9.88	O
ATOM	436	C	SER	A	28	18.135	68.602	37.415	1.00	9.36	C
ATOM	437	O	SER	A	28	19.085	69.048	38.030	1.00	6.96	O
ATOM	438	N	GLU	A	29	18.255	67.802	36.373	1.00	11.20	N
ATOM	440	CA	GLU	A	29	19.645	67.503	35.960	1.00	12.45	C
ATOM	442	CB	GLU	A	29	19.714	66.495	34.796	1.00	14.00	C
ATOM	445	CG	GLU	A	29	19.473	65.002	35.018	1.00	19.06	C
ATOM	448	CD	GLU	A	29	19.686	64.358	33.618	1.00	21.71	C
ATOM	449	OE1	GLU	A	29	20.911	64.341	33.214	1.00	25.61	O
ATOM	450	OE2	GLU	A	29	18.719	64.383	32.868	1.00	15.51	O
ATOM	451	C	GLU	A	29	20.303	68.763	35.454	1.00	8.44	C
ATOM	452	O	GLU	A	29	21.504	69.019	35.698	1.00	10.70	O
ATOM	453	N	ALA	A	30	19.563	69.564	34.720	1.00	7.23	N
ATOM	455	CA	ALA	A	30	20.122	70.807	34.135	1.00	7.75	C
ATOM	457	CB	ALA	A	30	19.039	71.472	33.362	1.00	9.55	C
ATOM	461	C	ALA	A	30	20.596	71.777	35.251	1.00	8.76	C
ATOM	462	O	ALA	A	30	21.699	72.300	35.197	1.00	11.39	O
ATOM	463	N	GLN	A	31	19.833	71.804	36.339	1.00	9.29	N
ATOM	465	CA	GLN	A	31	20.103	72.676	37.441	1.00	11.25	C
ATOM	467	CB	GLN	A	31	18.966	72.692	38.463	1.00	11.04	C
ATOM	470	CG	GLN	A	31	17.718	73.425	37.952	1.00	14.12	C
ATOM	473	CD	GLN	A	31	16.494	73.253	38.898	1.00	19.64	C
ATOM	474	OE1	GLN	A	31	16.506	72.345	39.712	1.00	23.07	O
ATOM	475	NE2	GLN	A	31	15.471	74.101	38.819	1.00	20.34	N
ATOM	478	C	GLN	A	31	21.429	72.201	38.077	1.00	9.02	C
ATOM	479	O	GLN	A	31	22.183	73.029	38.506	1.00	11.78	O
ATOM	480	N	ALA	A	32	21.561	70.901	38.279	1.00	10.18	N
ATOM	482	CA	ALA	A	32	22.677	70.236	38.989	1.00	11.47	C
ATOM	484	CB	ALA	A	32	22.481	68.753	39.034	1.00	12.44	C
ATOM	488	C	ALA	A	32	23.870	70.518	38.116	1.00	13.28	C
ATOM	489	O	ALA	A	32	24.914	70.888	38.646	1.00	11.93	O
ATOM	490	N	LEU	A	33	23.662	70.518	36.792	1.00	13.42	N
ATOM	492	CA	LEU	A	33	24.793	70.844	35.892	1.00	14.02	C
ATOM	494	CB	LEU	A	33	24.534	70.318	34.443	1.00	15.03	C
ATOM	497	CG	LEU	A	33	24.448	68.788	34.388	1.00	16.07	C
ATOM	499	CD1	LEU	A	33	23.979	68.378	32.994	1.00	18.21	C
ATOM	503	CD2	LEU	A	33	25.736	68.108	34.800	1.00	18.74	C
ATOM	507	C	LEU	A	33	25.104	72.313	35.800	1.00	11.26	C
ATOM	508	O	LEU	A	33	26.052	72.707	35.094	1.00	14.47	O
ATOM	509	N	GLY	A	34	24.303	73.160	36.434	1.00	10.53	N
ATOM	511	CA	GLY	A	34	24.621	74.592	36.558	1.00	9.48	C
ATOM	514	C	GLY	A	34	23.644	75.540	35.935	1.00	9.94	C
ATOM	515	O	GLY	A	34	23.762	76.720	36.109	1.00	11.20	O
ATOM	516	N	TRP	A	35	22.552	75.045	35.343	1.00	8.51	N
ATOM	518	CA	TRP	A	35	21.516	75.886	34.712	1.00	10.37	C
ATOM	520	CB	TRP	A	35	20.516	75.006	33.978	1.00	9.49	C
ATOM	523	CG	TRP	A	35	19.403	75.797	33.464	1.00	10.46	C
ATOM	524	CD1	TRP	A	35	19.413	76.830	32.588	1.00	10.67	C
ATOM	526	NE1	TRP	A	35	18.126	77.221	32.338	1.00	10.69	N
ATOM	528	CE2	TRP	A	35	17.276	76.364	32.953	1.00	10.95	C
ATOM	529	CD2	TRP	A	35	18.055	75.494	33.714	1.00	11.03	C
ATOM	530	CE3	TRP	A	35	17.421	74.517	34.474	1.00	12.02	C
ATOM	532	CZ3	TRP	A	35	16.043	74.477	34.433	1.00	16.19	C
ATOM	534	CH2	TRP	A	35	15.298	75.423	33.759	1.00	14.45	C
ATOM	536	CZ2	TRP	A	35	15.912	76.386	33.026	1.00	13.57	C
ATOM	538	C	TRP	A	35	20.759	76.563	35.769	1.00	11.80	C
ATOM	539	O	TRP	A	35	20.480	75.978	36.787	1.00	13.46	O
ATOM	540	N	VAL	A	36	20.642	77.854	35.568	1.00	13.51	N
ATOM	542	CA	VAL	A	36	19.850	78.721	36.411	1.00	14.52	C
ATOM	544	CB	VAL	A	36	20.709	79.850	37.056	1.00	14.17	C
ATOM	546	CG1	VAL	A	36	19.720	80.804	37.721	1.00	14.44	C
ATOM	550	CG2	VAL	A	36	21.728	79.251	37.936	1.00	15.02	C
ATOM	554	C	VAL	A	36	18.845	79.361	35.471	1.00	14.86	C
ATOM	555	O	VAL	A	36	19.280	80.072	34.565	1.00	14.15	O
ATOM	556	N	ALA	A	37	17.552	79.152	35.681	1.00	16.80	N
ATOM	558	CA	ALA	A	37	16.602	79.612	34.642	1.00	19.03	C
ATOM	560	CB	ALA	A	37	15.185	79.302	35.065	1.00	19.86	C
ATOM	564	C	ALA	A	37	16.761	81.111	34.322	1.00	21.10	C
ATOM	565	O	ALA	A	37	16.893	81.598	33.201	1.00	22.32	O
ATOM	566	N	SER	A	38	16.864	81.921	35.342	1.00	21.48	N
ATOM	568	CA	SER	A	38	16.846	83.354	35.069	1.00	21.38	C
ATOM	570	CB	SER	A	38	16.521	84.067	36.372	1.00	19.41	C
ATOM	573	OG	SER	A	38	17.599	83.864	37.277	1.00	17.79	O
ATOM	575	C	SER	A	38	18.165	83.861	34.440	1.00	22.75	C
ATOM	576	O	SER	A	38	18.301	85.070	34.290	1.00	24.55	O
ATOM	577	N	LYS	A	39	19.210	83.047	34.266	1.00	21.17	N
ATOM	579	CA	LYS	A	39	20.406	83.423	33.529	1.00	21.64	C
ATOM	581	CB	LYS	A	39	21.725	82.845	34.110	1.00	24.13	C
ATOM	584	CG	LYS	A	39	22.192	83.242	35.464	1.00	26.02	C
ATOM	587	CD	LYS	A	39	23.733	83.693	35.579	1.00	28.80	C
ATOM	590	CE	LYS	A	39	24.843	82.596	35.622	1.00	29.09	C
ATOM	593	NZ	LYS	A	39	26.213	83.289	35.676	1.00	27.36	N
ATOM	597	C	LYS	A	39	20.403	83.022	32.048	1.00	19.45	C
ATOM	598	O	LYS	A	39	21.295	83.409	31.286	1.00	20.46	O
ATOM	599	N	GLY	A	40	19.470	82.199	31.602	1.00	15.53	N
ATOM	601	CA	GLY	A	40	19.449	81.892	30.173	1.00	16.20	C
ATOM	604	C	GLY	A	40	20.691	81.083	29.799	1.00	14.65	C
ATOM	605	O	GLY	A	40	21.128	81.158	28.663	1.00	14.14	O
ATOM	606	N	ASN	A	41	21.246	80.304	30.737	1.00	13.48	N
ATOM	608	CA	ASN	A	41	22.602	79.734	30.524	1.00	12.48	C
ATOM	610	CB	ASN	A	41	23.431	80.019	31.766	1.00	11.98	C
ATOM	613	CG	ASN	A	41	23.007	79.186	33.011	1.00	12.56	C
ATOM	614	OD1	ASN	A	41	21.840	78.779	33.155	1.00	10.26	O
ATOM	615	ND2	ASN	A	41	23.956	79.002	33.944	1.00	9.96	N
ATOM	618	C	ASN	A	41	22.632	78.213	30.191	1.00	11.89	C
ATOM	619	O	ASN	A	41	23.673	77.509	30.256	1.00	14.37	O
ATOM	620	N	LEU	A	42	21.514	77.703	29.710	1.00	12.36	N
ATOM	622	CA	LEU	A	42	21.402	76.226	29.582	1.00	12.49	C
ATOM	624	CB	LEU	A	42	20.084	75.745	29.009	1.00	10.42	C
ATOM	627	CG	LEU	A	42	19.937	74.236	28.890	1.00	11.23	C
ATOM	629	CD1	LEU	A	42	20.038	73.626	30.265	1.00	12.26	C
ATOM	633	CD2	LEU	A	42	18.518	74.008	28.264	1.00	11.52	C
ATOM	637	C	LEU	A	42	22.519	75.702	28.653	1.00	11.43	C
ATOM	638	O	LEU	A	42	23.242	74.740	28.955	1.00	9.65	O
ATOM	639	N	ALA	A	43	22.647	76.369	27.522	1.00	10.58	N
ATOM	641	CA	ALA	A	43	23.583	75.901	26.544	1.00	10.42	C
ATOM	643	CB	ALA	A	43	23.235	76.524	25.214	1.00	12.50	C
ATOM	647	C	ALA	A	43	25.004	76.298	26.884	1.00	12.63	C
ATOM	648	O	ALA	A	43	25.954	75.777	26.273	1.00	10.33	O
ATOM	649	N	ASP	A	44	25.173	77.151	27.882	1.00	11.19	N
ATOM	651	CA	ASP	A	44	26.547	77.343	28.254	1.00	12.65	C
ATOM	653	CB	ASP	A	44	26.698	78.658	28.997	1.00	13.47	C
ATOM	656	CG	ASP	A	44	26.281	79.841	28.157	1.00	15.50	C
ATOM	657	OD1	ASP	A	44	26.671	79.946	26.990	1.00	13.20	O
ATOM	658	OD2	ASP	A	44	25.532	80.690	28.634	1.00	19.68	O
ATOM	659	C	ASP	A	44	26.966	76.197	29.189	1.00	13.99	C
ATOM	660	O	ASP	A	44	28.062	75.754	29.121	1.00	11.77	O
ATOM	661	N	VAL	A	45	26.076	75.730	30.064	1.00	12.97	N
ATOM	663	CA	VAL	A	45	26.468	74.688	30.983	1.00	8.34	C
ATOM	665	CB	VAL	A	45	25.779	74.756	32.343	1.00	9.15	C
ATOM	667	CG1	VAL	A	45	26.054	76.076	33.087	1.00	11.49	C
ATOM	671	CG2	VAL	A	45	24.267	74.554	32.247	1.00	7.95	C
ATOM	675	C	VAL	A	45	26.299	73.328	30.373	1.00	8.80	C
ATOM	676	O	VAL	A	45	26.934	72.410	30.809	1.00	8.81	O
ATOM	677	N	ALA	A	46	25.474	73.205	29.359	1.00	8.48	N
ATOM	679	CA	ALA	A	46	25.183	71.921	28.744	1.00	10.55	C
ATOM	681	CB	ALA	A	46	23.884	71.323	29.281	1.00	9.59	C
ATOM	685	C	ALA	A	46	25.117	72.035	27.257	1.00	9.69	C
ATOM	686	O	ALA	A	46	24.005	72.015	26.706	1.00	8.90	O
ATOM	687	N	PRO	A	47	26.247	72.282	26.617	1.00	11.83	N
ATOM	688	CA	PRO	A	47	26.241	72.537	25.155	1.00	12.60	C
ATOM	690	CB	PRO	A	47	27.722	72.459	24.751	1.00	12.43	C
ATOM	693	CG	PRO	A	47	28.426	73.045	25.923	1.00	12.70	C
ATOM	696	CD	PRO	A	47	27.605	72.438	27.159	1.00	12.26	C
ATOM	699	C	PRO	A	47	25.458	71.487	24.393	1.00	11.89	C
ATOM	700	O	PRO	A	47	25.723	70.339	24.669	1.00	14.14	O
ATOM	701	N	GLY	A	48	24.579	71.821	23.457	1.00	11.22	N
ATOM	703	CA	GLY	A	48	23.812	70.835	22.738	1.00	12.82	C
ATOM	706	C	GLY	A	48	22.614	70.235	23.430	1.00	13.24	C
ATOM	707	O	GLY	A	48	21.888	69.530	22.788	1.00	9.40	O
ATOM	708	N	LYS	A	49	22.376	70.531	24.694	1.00	13.30	N
ATOM	710	CA	LYS	A	49	21.263	69.942	25.439	1.00	11.44	C
ATOM	712	CB	LYS	A	49	21.695	69.461	26.844	1.00	10.85	C
ATOM	715	CG	LYS	A	49	22.941	68.549	26.822	1.00	11.14	C
ATOM	718	CD	LYS	A	49	22.764	67.266	26.000	1.00	13.18	C
ATOM	721	CE	LYS	A	49	24.006	66.318	26.094	1.00	15.17	C
ATOM	724	NZ	LYS	A	49	23.634	64.958	25.791	1.00	15.55	N
ATOM	728	C	LYS	A	49	20.044	70.839	25.492	1.00	12.76	C
ATOM	729	O	LYS	A	49	20.112	72.030	25.213	1.00	14.86	O
ATOM	730	N	SER	A	50	18.913	70.163	25.630	1.00	10.73	N
ATOM	732	CA	SER	A	50	17.619	70.741	25.875	1.00	7.36	C
ATOM	734	CB	SER	A	50	16.736	70.450	24.697	1.00	8.47	C
ATOM	737	OG	SER	A	50	17.234	70.891	23.425	1.00	8.66	O
ATOM	739	C	SER	A	50	17.026	70.165	27.140	1.00	11.33	C
ATOM	740	O	SER	A	50	17.261	68.990	27.459	1.00	13.01	O
ATOM	741	N	ILE	A	51	16.097	70.924	27.762	1.00	11.26	N
ATOM	743	CA	ILE	A	51	15.379	70.391	28.867	1.00	10.46	C
ATOM	745	CB	ILE	A	51	14.534	71.580	29.537	1.00	13.60	C
ATOM	747	CG1	ILE	A	51	15.343	72.572	30.368	1.00	14.63	C
ATOM	750	CD1	ILE	A	51	16.482	72.131	30.836	1.00	14.11	C
ATOM	754	CG2	ILE	A	51	13.746	70.994	30.651	1.00	13.76	C
ATOM	758	C	ILE	A	51	14.324	69.432	28.370	1.00	9.40	C
ATOM	759	O	ILE	A	51	13.584	69.744	27.406	1.00	10.07	O
ATOM	760	N	GLY	A	52	14.145	68.308	29.068	1.00	7.01	N
ATOM	762	CA	GLY	A	52	13.082	67.410	28.665	1.00	11.07	C
ATOM	765	C	GLY	A	52	13.076	66.192	29.552	1.00	9.40	C
ATOM	766	O	GLY	A	52	13.998	65.806	30.274	1.00	10.01	O
ATOM	767	N	GLY	A	53	11.854	65.731	29.690	1.00	7.49	N
ATOM	769	CA	GLY	A	53	11.526	64.546	30.398	1.00	7.92	C
ATOM	772	C	GLY	A	53	10.708	64.622	31.623	1.00	9.77	C
ATOM	773	O	GLY	A	53	10.445	63.577	32.196	1.00	10.62	O
ATOM	774	N	ASP	A	54	10.367	65.820	32.046	1.00	11.61	N
ATOM	776	CA	ASP	A	54	9.672	65.998	33.300	1.00	9.49	C
ATOM	778	CB	ASP	A	54	9.877	67.375	33.845	1.00	11.50	C
ATOM	781	CG	ASP	A	54	11.409	67.642	34.138	1.00	14.34	C
ATOM	782	OD1	ASP	A	54	11.970	66.760	34.820	1.00	16.87	O
ATOM	783	OD2	ASP	A	54	12.053	68.563	33.625	1.00	9.69	O
ATOM	784	C	ASP	A	54	8.205	65.732	33.154	1.00	10.32	C
ATOM	785	O	ASP	A	54	7.671	65.938	32.090	1.00	8.97	O
ATOM	786	N	ILE	A	55	7.556	65.472	34.266	1.00	9.81	N
ATOM	788	CA	ILE	A	55	6.112	65.406	34.259	1.00	12.28	C
ATOM	790	CB	ILE	A	55	5.632	64.968	35.646	1.00	11.93	C
ATOM	792	CG1	ILE	A	55	5.794	63.507	35.611	1.00	15.09	C
ATOM	795	CD1	ILE	A	55	6.656	63.222	36.568	1.00	19.15	C
ATOM	799	CG2	ILE	A	55	4.080	65.112	35.721	1.00	13.77	C
ATOM	803	C	ILE	A	55	5.456	66.735	33.987	1.00	12.40	C
ATOM	804	O	ILE	A	55	5.821	67.753	34.489	1.00	12.96	O
ATOM	805	N	PHE	A	56	4.494	66.722	33.104	1.00	12.87	N
ATOM	807	CA	PHE	A	56	3.594	67.817	32.876	1.00	14.48	C
ATOM	809	CB	PHE	A	56	3.292	67.952	31.372	1.00	15.22	C
ATOM	812	CG	PHE	A	56	2.394	69.048	31.061	1.00	13.94	C
ATOM	813	CD1	PHE	A	56	2.756	70.358	31.243	1.00	14.54	C
ATOM	815	CE1	PHE	A	56	1.835	71.387	30.916	1.00	14.29	C
ATOM	817	CZ	PHE	A	56	0.550	71.078	30.557	1.00	15.46	C
ATOM	819	CE2	PHE	A	56	0.226	69.794	30.283	1.00	14.32	C
ATOM	821	CD2	PHE	A	56	1.111	68.779	30.589	1.00	17.12	C
ATOM	823	C	PHE	A	56	2.315	67.389	33.561	1.00	14.02	C
ATOM	824	O	PHE	A	56	1.619	66.341	33.309	1.00	14.15	O
ATOM	825	N	SER	A	57	1.999	68.276	34.478	1.00	14.80	N
ATOM	827	CA	SER	A	57	0.886	68.019	35.361	1.00	16.86	C
ATOM	829	CB	SER	A	57	1.077	68.915	36.606	1.00	19.01	C
ATOM	832	OG	SER	A	57	0.349	70.078	36.232	1.00	23.78	O
ATOM	834	C	SER	A	57	−0.490	68.175	34.686	1.00	14.80	C
ATOM	835	O	SER	A	57	−1.423	67.551	35.126	1.00	13.55	O
ATOM	836	N	ASN	A	58	−0.639	68.880	33.566	1.00	14.70	N
ATOM	838	CA	ASN	A	58	−1.909	68.934	32.798	1.00	13.86	C
ATOM	840	CB	ASN	A	58	−2.305	67.579	32.253	1.00	12.61	C
ATOM	843	CG	ASN	A	58	−3.415	67.687	31.230	1.00	12.21	C
ATOM	844	OD1	ASN	A	58	−3.457	68.669	30.508	1.00	14.42	O
ATOM	845	ND2	ASN	A	58	−4.234	66.664	31.077	1.00	10.60	N
ATOM	848	C	ASN	A	58	−3.061	69.513	33.640	1.00	16.38	C
ATOM	849	O	ASN	A	58	−4.238	69.071	33.529	1.00	15.38	O
ATOM	850	N	ARG	A	59	−2.648	70.538	34.401	1.00	18.42	N
ATOM	852	CA	ARG	A	59	−3.475	71.224	35.413	1.00	23.61	C
ATOM	854	CB	ARG	A	59	−2.735	72.444	36.041	1.00	26.92	C
ATOM	857	CG	ARG	A	59	−2.301	72.317	37.549	1.00	32.22	C
ATOM	860	CD	ARG	A	59	−1.041	73.159	38.035	1.00	35.70	C
ATOM	863	NE	ARG	A	59	0.042	72.323	38.633	1.00	39.31	N
ATOM	865	CZ	ARG	A	59	1.377	72.328	38.378	1.00	41.80	C
ATOM	866	NH1	ARG	A	59	1.975	73.090	37.445	1.00	42.97	N
ATOM	869	NH2	ARG	A	59	2.145	71.456	39.033	1.00	41.96	N
ATOM	872	C	ARG	A	59	−4.808	71.680	34.787	1.00	20.35	C
ATOM	873	O	ARG	A	59	−5.877	71.410	35.299	1.00	24.33	O
ATOM	874	N	GLU	A	60	−4.731	72.368	33.665	1.00	19.25	N
ATOM	876	CA	GLU	A	60	−5.905	72.954	32.977	1.00	20.37	C
ATOM	878	CB	GLU	A	60	−5.385	74.077	32.036	1.00	23.39	C
ATOM	881	CG	GLU	A	60	−4.458	75.170	32.640	1.00	26.33	C
ATOM	884	CD	GLU	A	60	−4.214	76.380	31.668	1.00	30.05	C
ATOM	885	OE1	GLU	A	60	−5.095	77.283	31.635	1.00	31.61	O
ATOM	886	OE2	GLU	A	60	−3.236	76.514	30.835	1.00	30.87	O
ATOM	887	C	GLU	A	60	−6.709	71.902	32.209	1.00	16.43	C
ATOM	888	O	GLU	A	60	−7.791	72.180	31.655	1.00	17.87	O
ATOM	889	N	GLY	A	61	−6.229	70.661	32.169	1.00	15.60	N
ATOM	891	CA	GLY	A	61	−6.946	69.555	31.558	1.00	14.04	C
ATOM	894	C	GLY	A	61	−7.052	69.738	30.057	1.00	13.71	C
ATOM	895	O	GLY	A	61	−7.874	69.132	29.405	1.00	11.69	O
ATOM	896	N	LYS	A	62	−6.209	70.566	29.473	1.00	14.43	N
ATOM	898	CA	LYS	A	62	−6.166	70.684	28.018	1.00	15.74	C
ATOM	900	CB	LYS	A	62	−5.296	71.872	27.609	1.00	16.93	C
ATOM	903	CG	LYS	A	62	−5.987	73.225	27.903	1.00	18.53	C
ATOM	906	CD	LYS	A	62	−5.027	74.380	28.045	1.00	18.80	C
ATOM	909	CE	LYS	A	62	−5.824	75.691	28.420	1.00	19.77	C
ATOM	912	NZ	LYS	A	62	−4.845	76.708	28.828	1.00	20.13	N
ATOM	916	C	LYS	A	62	−5.702	69.470	27.267	1.00	16.16	C
ATOM	917	O	LYS	A	62	−6.122	69.221	26.138	1.00	17.96	O
ATOM	918	N	LEU	A	63	−4.817	68.680	27.844	1.00	15.98	N
ATOM	920	CA	LEU	A	63	−4.536	67.419	27.210	1.00	14.10	C
ATOM	922	CB	LEU	A	63	−3.202	67.029	27.637	1.00	15.14	C
ATOM	925	CG	LEU	A	63	−2.182	67.945	27.006	1.00	18.20	C
ATOM	927	CD1	LEU	A	63	−0.936	67.468	27.771	1.00	17.41	C
ATOM	931	CD2	LEU	A	63	−1.957	67.758	25.449	1.00	18.52	C
ATOM	935	C	LEU	A	63	−5.494	66.341	27.686	1.00	15.09	C
ATOM	936	O	LEU	A	63	−5.976	66.439	28.819	1.00	11.32	O
ATOM	937	N	PRO	A	64	−5.941	65.420	26.829	1.00	12.99	N
ATOM	938	CA	PRO	A	64	−6.831	64.396	27.386	1.00	15.31	C
ATOM	940	CB	PRO	A	64	−7.160	63.478	26.232	1.00	14.87	C
ATOM	943	CG	PRO	A	64	−6.007	63.679	25.152	1.00	15.10	C
ATOM	946	CD	PRO	A	64	−5.456	65.079	25.495	1.00	14.91	C
ATOM	949	C	PRO	A	64	−6.345	63.488	28.528	1.00	15.62	C
ATOM	950	O	PRO	A	64	−5.276	62.915	28.427	1.00	15.46	O
ATOM	951	N	GLY	A	65	−7.239	63.267	29.472	1.00	17.38	N
ATOM	953	CA	GLY	A	65	−6.995	62.584	30.724	1.00	19.51	C
ATOM	956	C	GLY	A	65	−7.455	61.157	30.634	1.00	19.61	C
ATOM	957	O	GLY	A	65	−8.458	60.920	29.978	1.00	18.11	O
ATOM	958	N	LYS	A	66	−6.798	60.211	31.308	1.00	21.09	N
ATOM	960	CA	LYS	A	66	−7.378	58.848	31.254	1.00	23.49	C
ATOM	962	CB	LYS	A	66	−6.770	57.952	30.182	1.00	25.72	C
ATOM	965	CG	LYS	A	66	−7.570	56.786	29.647	1.00	28.00	C
ATOM	968	CD	LYS	A	66	−6.737	55.758	28.714	1.00	29.97	C
ATOM	971	CE	LYS	A	66	−7.418	54.358	28.638	1.00	30.91	C
ATOM	974	NZ	LYS	A	66	−7.560	53.792	27.285	1.00	31.32	N
ATOM	978	C	LYS	A	66	−6.901	58.312	32.524	1.00	23.01	C
ATOM	979	O	LYS	A	66	−5.834	58.738	32.962	1.00	22.45	O
ATOM	980	N	SER	A	67	−7.622	57.331	33.061	1.00	21.46	N
ATOM	982	CA	SER	A	67	−7.136	56.739	34.323	1.00	21.32	C
ATOM	984	CB	SER	A	67	−8.240	55.791	34.802	1.00	24.97	C
ATOM	987	OG	SER	A	67	−7.681	55.050	35.861	1.00	27.07	O
ATOM	989	C	SER	A	67	−5.787	55.980	34.098	1.00	18.02	C
ATOM	990	O	SER	A	67	−5.592	55.247	33.116	1.00	19.08	O
ATOM	991	N	GLY	A	68	−4.800	56.276	34.899	1.00	14.53	N
ATOM	993	CA	GLY	A	68	−3.446	55.766	34.748	1.00	14.52	C
ATOM	996	C	GLY	A	68	−2.518	56.476	33.766	1.00	11.70	C
ATOM	997	O	GLY	A	68	−1.377	56.160	33.668	1.00	11.23	O
ATOM	998	N	ARG	A	69	−2.997	57.470	33.062	1.00	12.48	N
ATOM	1000	CA	ARG	A	69	−2.153	58.194	32.121	1.00	12.39	C
ATOM	1002	CB	ARG	A	69	−3.080	58.611	30.974	1.00	10.55	C
ATOM	1005	CG	ARG	A	69	−2.345	59.529	30.015	1.00	12.38	C
ATOM	1008	CD	ARG	A	69	−3.161	60.232	28.957	1.00	13.48	C
ATOM	1011	NE	ARG	A	69	−3.600	59.225	27.992	1.00	13.13	N
ATOM	1013	CZ	ARG	A	69	−4.757	59.251	27.381	1.00	15.18	C
ATOM	1014	NH1	ARG	A	69	−5.675	60.230	27.544	1.00	13.45	N
ATOM	1017	NH2	ARG	A	69	−5.086	58.182	26.639	1.00	15.98	N
ATOM	1020	C	ARG	A	69	−1.486	59.400	32.714	1.00	10.39	C
ATOM	1021	O	ARG	A	69	−2.146	60.226	33.368	1.00	13.47	O
ATOM	1022	N	THR	A	70	−0.184	59.494	32.567	1.00	9.24	N
ATOM	1024	CA	THR	A	70	0.531	60.610	32.964	1.00	10.73	C
ATOM	1026	CB	THR	A	70	1.641	60.202	33.945	1.00	15.19	C
ATOM	1028	OG1	THR	A	70	2.094	58.921	33.584	1.00	18.14	O
ATOM	1030	CG2	THR	A	70	1.016	59.865	35.338	1.00	17.68	C
ATOM	1034	C	THR	A	70	1.091	61.251	31.715	1.00	11.07	C
ATOM	1035	O	THR	A	70	1.206	60.564	30.704	1.00	9.88	O
ATOM	1036	N	TRP	A	71	1.639	62.466	31.834	1.00	9.15	N
ATOM	1038	CA	TRP	A	71	2.141	63.188	30.673	1.00	9.48	C
ATOM	1040	CB	TRP	A	71	1.238	64.391	30.336	1.00	9.88	C
ATOM	1043	CG	TRP	A	71	−0.079	64.100	29.723	1.00	10.12	C
ATOM	1044	CD1	TRP	A	71	−1.244	63.942	30.410	1.00	9.86	C
ATOM	1046	NE1	TRP	A	71	−2.246	63.682	29.513	1.00	13.26	N
ATOM	1048	CE2	TRP	A	71	−1.707	63.641	28.245	1.00	10.61	C
ATOM	1049	CD2	TRP	A	71	−0.379	63.953	28.342	1.00	8.98	C
ATOM	1050	CE3	TRP	A	71	0.398	63.946	27.152	1.00	10.37	C
ATOM	1052	CZ3	TRP	A	71	−0.162	63.667	25.981	1.00	8.20	C
ATOM	1054	CH2	TRP	A	71	−1.485	63.405	25.876	1.00	10.45	C
ATOM	1056	CZ2	TRP	A	71	−2.293	63.358	27.006	1.00	11.14	C
ATOM	1058	C	TRP	A	71	3.527	63.726	31.033	1.00	10.14	C
ATOM	1059	O	TRP	A	71	3.738	64.165	32.188	1.00	8.24	O
ATOM	1060	N	ARG	A	72	4.385	63.889	30.029	1.00	8.38	N
ATOM	1062	CA	ARG	A	72	5.687	64.373	30.238	1.00	9.32	C
ATOM	1064	CB	ARG	A	72	6.717	63.216	30.167	1.00	11.31	C
ATOM	1067	CG	ARG	A	72	6.993	62.457	31.497	1.00	13.27	C
ATOM	1070	CD	ARG	A	72	7.894	61.261	31.445	1.00	13.70	C
ATOM	1073	NE	ARG	A	72	7.765	60.444	32.612	1.00	16.16	N
ATOM	1075	CZ	ARG	A	72	8.301	60.753	33.805	1.00	20.44	C
ATOM	1076	NH1	ARG	A	72	9.077	61.831	33.985	1.00	17.83	N
ATOM	1079	NH2	ARG	A	72	8.008	60.008	34.861	1.00	21.24	N
ATOM	1082	C	ARG	A	72	5.905	65.353	29.118	1.00	10.57	C
ATOM	1083	O	ARG	A	72	5.276	65.342	28.063	1.00	12.04	O
ATOM	1084	N	GLU	A	73	6.918	66.176	29.292	1.00	12.14	N
ATOM	1086	CA	GLU	A	73	7.159	67.189	28.257	1.00	12.34	C
ATOM	1088	CB	GLU	A	73	6.705	68.554	28.815	1.00	13.21	C
ATOM	1091	CG	GLU	A	73	7.474	68.977	30.056	1.00	11.26	C
ATOM	1094	CD	GLU	A	73	7.316	70.435	30.333	1.00	12.31	C
ATOM	1095	OE1	GLU	A	73	7.794	71.274	29.566	1.00	14.70	O
ATOM	1096	OE2	GLU	A	73	6.628	70.788	31.316	1.00	17.26	O
ATOM	1097	C	GLU	A	73	8.621	67.330	27.931	1.00	11.97	C
ATOM	1098	O	GLU	A	73	9.498	66.851	28.673	1.00	10.83	O
ATOM	1099	N	ALA	A	74	8.920	67.876	26.764	1.00	11.65	N
ATOM	1101	CA	ALA	A	74	10.303	68.128	26.423	1.00	9.14	C
ATOM	1103	CB	ALA	A	74	10.934	67.030	25.740	1.00	7.95	C
ATOM	1107	C	ALA	A	74	10.313	69.384	25.559	1.00	10.16	C
ATOM	1108	O	ALA	A	74	9.341	69.674	24.900	1.00	13.65	O
ATOM	1109	N	ASP	A	75	11.402	70.174	25.667	1.00	9.31	N
ATOM	1111	CA	ASP	A	75	11.577	71.351	24.833	1.00	8.31	C
ATOM	1113	CB	ASP	A	75	12.737	72.217	25.364	1.00	8.64	C
ATOM	1116	CG	ASP	A	75	12.404	72.980	26.649	1.00	9.50	C
ATOM	1117	OD1	ASP	A	75	11.471	72.519	27.347	1.00	11.90	O
ATOM	1118	OD2	ASP	A	75	13.015	74.057	26.968	1.00	14.38	O
ATOM	1119	C	ASP	A	75	11.904	70.993	23.414	1.00	7.79	C
ATOM	1120	O	ASP	A	75	12.755	70.147	23.183	1.00	8.59	O
ATOM	1121	N	ILE	A	76	11.279	71.673	22.447	1.00	11.70	N
ATOM	1123	CA	ILE	A	76	11.618	71.533	21.068	1.00	11.46	C
ATOM	1125	CB	ILE	A	76	10.285	71.222	20.407	1.00	12.87	C
ATOM	1127	CG1	ILE	A	76	9.829	69.860	20.914	1.00	13.71	C
ATOM	1130	CD1	ILE	A	76	10.590	68.697	20.238	1.00	11.84	C
ATOM	1134	CG2	ILE	A	76	10.407	71.190	18.939	1.00	12.63	C
ATOM	1138	C	ILE	A	76	12.130	72.855	20.595	1.00	11.92	C
ATOM	1139	O	ILE	A	76	11.713	73.953	21.039	1.00	11.71	O
ATOM	1140	N	ASN	A	77	12.929	72.701	19.563	1.00	10.75	N
ATOM	1142	CA	ASN	A	77	13.606	73.727	18.759	1.00	11.46	C
ATOM	1144	CB	ASN	A	77	12.614	74.609	18.043	1.00	12.26	C
ATOM	1147	CG	ASN	A	77	11.806	73.898	17.003	1.00	11.68	C
ATOM	1148	OD1	ASN	A	77	12.299	73.103	16.183	1.00	12.28	O
ATOM	1149	ND2	ASN	A	77	10.549	74.329	16.919	1.00	11.36	N
ATOM	1152	C	ASN	A	77	14.607	74.614	19.557	1.00	11.79	C
ATOM	1153	O	ASN	A	77	14.834	75.788	19.262	1.00	15.08	O
ATOM	1154	N	TYR	A	78	15.059	74.083	20.655	1.00	8.82	N
ATOM	1156	CA	TYR	A	78	15.853	74.919	21.572	1.00	12.79	C
ATOM	1158	CB	TYR	A	78	15.783	74.407	23.024	1.00	11.72	C
ATOM	1161	CG	TYR	A	78	16.794	75.115	23.878	1.00	12.22	C
ATOM	1162	CD1	TYR	A	78	16.509	76.414	24.352	1.00	12.36	C
ATOM	1164	CE1	TYR	A	78	17.467	77.153	25.060	1.00	9.98	C
ATOM	1166	CZ	TYR	A	78	18.672	76.533	25.448	1.00	10.27	C
ATOM	1167	OH	TYR	A	78	19.622	77.324	26.132	1.00	5.54	O
ATOM	1169	CE2	TYR	A	78	18.975	75.269	24.957	1.00	10.03	C
ATOM	1171	CD2	TYR	A	78	17.993	74.516	24.210	1.00	10.21	C
ATOM	1173	C	TYR	A	78	17.252	74.731	21.065	1.00	12.05	C
ATOM	1174	O	TYR	A	78	17.672	73.633	20.748	1.00	13.73	O
ATOM	1175	N	THR	A	79	18.004	75.793	20.946	1.00	13.40	N
ATOM	1177	CA	THR	A	79	19.414	75.608	20.674	1.00	14.31	C
ATOM	1179	CB	THR	A	79	19.869	76.190	19.342	1.00	17.06	C
ATOM	1181	OG1	THR	A	79	19.411	77.531	19.282	1.00	19.07	O
ATOM	1183	CG2	THR	A	79	19.086	75.686	18.246	1.00	17.91	C
ATOM	1187	C	THR	A	79	20.225	76.294	21.792	1.00	15.43	C
ATOM	1188	O	THR	A	79	21.186	75.669	22.306	1.00	10.46	O
ATOM	1189	N	SER	A	80	19.972	77.563	22.081	1.00	15.52	N
ATOM	1191	CA	SER	A	80	20.640	78.312	23.169	1.00	12.87	C
ATOM	1193	CB	SER	A	80	21.973	78.925	22.719	1.00	15.98	C
ATOM	1196	OG	SER	A	80	21.837	79.840	21.699	1.00	14.14	O
ATOM	1198	C	SER	A	80	19.864	79.500	23.677	1.00	12.72	C
ATOM	1199	O	SER	A	80	18.930	79.946	22.960	1.00	10.08	O
ATOM	1200	N	GLY	A	81	20.375	80.144	24.745	1.00	10.93	N
ATOM	1202	CA	GLY	A	81	19.645	81.253	25.352	1.00	13.73	C
ATOM	1205	C	GLY	A	81	18.495	80.776	26.227	1.00	12.83	C
ATOM	1206	O	GLY	A	81	18.544	79.680	26.738	1.00	13.82	O
ATOM	1207	N	PHE	A	82	17.545	81.650	26.484	1.00	13.00	N
ATOM	1209	CA	PHE	A	82	16.395	81.365	27.314	1.00	13.93	C
ATOM	1211	CB	PHE	A	82	15.515	82.598	27.558	1.00	14.16	C
ATOM	1214	CG	PHE	A	82	16.223	83.611	28.473	1.00	17.70	C
ATOM	1215	CD1	PHE	A	82	16.312	83.392	29.863	1.00	16.63	C
ATOM	1217	CE1	PHE	A	82	16.977	84.300	30.671	1.00	18.98	C
ATOM	1219	CZ	PHE	A	82	17.696	85.376	30.113	1.00	18.91	C
ATOM	1221	CE2	PHE	A	82	17.645	85.629	28.745	1.00	19.29	C
ATOM	1223	CD2	PHE	A	82	16.931	84.676	27.914	1.00	20.12	C
ATOM	1225	C	PHE	A	82	15.618	80.300	26.564	1.00	14.38	C
ATOM	1226	O	PHE	A	82	15.784	80.111	25.357	1.00	11.55	O
ATOM	1227	N	ARG	A	83	14.815	79.548	27.299	1.00	14.65	N
ATOM	1229	CA	ARG	A	83	13.906	78.568	26.648	1.00	13.87	C
ATOM	1231	CB	ARG	A	83	13.285	77.699	27.778	1.00	14.41	C
ATOM	1234	CG	ARG	A	83	14.287	76.834	28.511	1.00	12.33	C
ATOM	1237	CD	ARG	A	83	13.749	76.304	29.814	1.00	14.68	C
ATOM	1240	NE	ARG	A	83	12.799	75.237	29.520	1.00	15.04	N
ATOM	1242	CZ	ARG	A	83	11.848	74.782	30.335	1.00	18.82	C
ATOM	1243	NH1	ARG	A	83	11.698	75.249	31.591	1.00	19.87	N
ATOM	1246	NH2	ARG	A	83	11.000	73.846	29.896	1.00	14.39	N
ATOM	1249	C	ARG	A	83	12.865	79.267	25.827	1.00	12.96	C
ATOM	1250	O	ARG	A	83	12.495	80.387	26.099	1.00	10.42	O
ATOM	1251	N	ASN	A	84	12.289	78.576	24.851	1.00	13.03	N
ATOM	1253	CA	ASN	A	84	11.323	79.134	23.959	1.00	13.01	C
ATOM	1255	CB	ASN	A	84	11.742	78.687	22.560	1.00	12.53	C
ATOM	1258	CG	ASN	A	84	11.750	77.170	22.374	1.00	12.31	C
ATOM	1259	OD1	ASN	A	84	11.008	76.464	23.075	1.00	9.23	O
ATOM	1260	ND2	ASN	A	84	12.484	76.678	21.338	1.00	10.53	N
ATOM	1263	C	ASN	A	84	9.966	78.652	24.436	1.00	11.61	C
ATOM	1264	O	ASN	A	84	9.901	78.122	25.523	1.00	10.55	O
ATOM	1265	N	SER	A	85	8.981	78.746	23.580	1.00	11.49	N
ATOM	1267	CA	SER	A	85	7.587	78.334	23.820	1.00	12.14	C
ATOM	1269	CB	SER	A	85	6.672	79.458	23.268	1.00	12.72	C
ATOM	1272	OG	SER	A	85	6.979	80.668	23.991	1.00	15.95	O
ATOM	1274	C	SER	A	85	7.183	76.990	23.312	1.00	10.02	C
ATOM	1275	O	SER	A	85	6.000	76.636	23.266	1.00	12.61	O
ATOM	1276	N	ASP	A	86	8.124	76.267	22.739	1.00	10.38	N
ATOM	1278	CA	ASP	A	86	7.807	75.024	21.992	1.00	12.12	C
ATOM	1280	CB	ASP	A	86	8.722	74.836	20.753	1.00	10.98	C
ATOM	1283	CG	ASP	A	86	8.434	75.862	19.673	1.00	11.98	C
ATOM	1284	OD1	ASP	A	86	7.319	76.457	19.720	1.00	17.86	O
ATOM	1285	OD2	ASP	A	86	9.278	76.215	18.820	1.00	15.19	O
ATOM	1286	C	ASP	A	86	8.001	73.810	22.869	1.00	13.31	C
ATOM	1287	O	ASP	A	86	9.112	73.636	23.348	1.00	11.28	O
ATOM	1288	N	ARG	A	87	7.014	72.937	23.016	1.00	12.84	N
ATOM	1290	CA	ARG	A	87	7.255	71.747	23.867	1.00	12.00	C
ATOM	1292	CB	ARG	A	87	6.505	71.952	25.193	1.00	11.15	C
ATOM	1295	CG	ARG	A	87	6.899	73.103	26.000	1.00	12.23	C
ATOM	1298	CD	ARG	A	87	8.318	72.972	26.588	1.00	12.58	C
ATOM	1301	NE	ARG	A	87	8.677	74.154	27.329	1.00	11.57	N
ATOM	1303	CZ	ARG	A	87	9.343	75.184	26.833	1.00	12.24	C
ATOM	1304	NH1	ARG	A	87	9.763	75.273	25.583	1.00	10.06	N
ATOM	1307	NH2	ARG	A	87	9.599	76.167	27.669	1.00	14.03	N
ATOM	1310	C	ARG	A	87	6.512	70.600	23.165	1.00	11.13	C
ATOM	1311	O	ARG	A	87	5.416	70.798	22.610	1.00	11.33	O
ATOM	1312	N	ILE	A	88	7.093	69.399	23.231	1.00	13.28	N
ATOM	1314	CA	ILE	A	88	6.374	68.184	22.818	1.00	11.08	C
ATOM	1316	CB	ILE	A	88	7.271	67.247	22.097	1.00	11.24	C
ATOM	1318	CG1	ILE	A	88	6.492	66.079	21.388	1.00	12.25	C
ATOM	1321	CD1	ILE	A	88	7.496	65.321	20.368	1.00	12.64	C
ATOM	1325	CG2	ILE	A	88	8.343	66.729	22.879	1.00	12.59	C
ATOM	1329	C	ILE	A	88	5.833	67.536	24.067	1.00	11.22	C
ATOM	1330	O	ILE	A	88	6.473	67.617	25.116	1.00	10.61	O
ATOM	1331	N	LEU	A	89	4.607	67.018	24.031	1.00	11.36	N
ATOM	1333	CA	LEU	A	89	4.013	66.418	25.233	1.00	7.65	C
ATOM	1335	CB	LEU	A	89	2.676	67.053	25.495	1.00	10.94	C
ATOM	1338	CG	LEU	A	89	2.648	68.432	26.158	1.00	13.79	C
ATOM	1340	CD1	LEU	A	89	3.199	68.234	27.549	1.00	10.56	C
ATOM	1344	CD2	LEU	A	89	3.612	69.415	25.636	1.00	15.11	C
ATOM	1348	C	LEU	A	89	3.710	64.952	24.885	1.00	8.75	C
ATOM	1349	O	LEU	A	89	3.147	64.655	23.793	1.00	9.80	O
ATOM	1350	N	TYR	A	90	4.136	64.000	25.721	1.00	9.87	N
ATOM	1352	CA	TYR	A	90	3.927	62.607	25.370	1.00	7.26	C
ATOM	1354	CB	TYR	A	90	5.260	62.014	24.875	1.00	8.09	C
ATOM	1357	CG	TYR	A	90	6.383	62.142	25.902	1.00	7.48	C
ATOM	1358	CD1	TYR	A	90	7.188	63.276	25.937	1.00	10.00	C
ATOM	1360	CE1	TYR	A	90	8.334	63.339	26.814	1.00	9.09	C
ATOM	1362	CZ	TYR	A	90	8.740	62.238	27.462	1.00	10.59	C
ATOM	1363	OH	TYR	A	90	9.855	62.410	28.240	1.00	8.93	O
ATOM	1365	CE2	TYR	A	90	7.993	61.064	27.410	1.00	9.27	C
ATOM	1367	CD2	TYR	A	90	6.880	61.023	26.507	1.00	8.29	C
ATOM	1369	C	TYR	A	90	3.343	61.906	26.563	1.00	6.89	C
ATOM	1370	O	TYR	A	90	3.700	62.186	27.732	1.00	6.04	O
ATOM	1371	N	SER	A	91	2.368	61.039	26.288	1.00	6.48	N
ATOM	1373	CA	SER	A	91	1.711	60.417	27.421	1.00	7.31	C
ATOM	1375	CB	SER	A	91	0.253	60.198	27.184	1.00	8.94	C
ATOM	1378	OG	SER	A	91	0.034	59.301	26.095	1.00	8.89	O
ATOM	1380	C	SER	A	91	2.252	59.043	27.718	1.00	8.33	C
ATOM	1381	O	SER	A	91	3.011	58.478	26.933	1.00	11.09	O
ATOM	1382	N	SER	A	92	1.899	58.477	28.863	1.00	9.72	N
ATOM	1384	CA	SER	A	92	2.390	57.161	29.299	1.00	9.97	C
ATOM	1386	CB	SER	A	92	2.074	56.942	30.818	1.00	11.10	C
ATOM	1389	OG	SER	A	92	0.656	57.088	30.900	1.00	8.24	O
ATOM	1391	C	SER	A	92	1.817	56.051	28.374	1.00	11.05	C
ATOM	1392	O	SER	A	92	2.383	55.007	28.335	1.00	10.47	O
ATOM	1393	N	ASP	A	93	0.798	56.316	27.543	1.00	9.26	N
ATOM	1395	CA	ASP	A	93	0.286	55.419	26.559	1.00	11.54	C
ATOM	1397	CB	ASP	A	93	−1.228	55.144	26.689	1.00	11.21	C
ATOM	1400	CG	ASP	A	93	−2.095	56.428	26.740	1.00	12.30	C
ATOM	1401	OD1	ASP	A	93	−3.343	56.275	26.563	1.00	11.48	O
ATOM	1402	OD2	ASP	A	93	−1.664	57.550	27.003	1.00	11.90	O
ATOM	1403	C	ASP	A	93	0.673	55.946	25.176	1.00	10.07	C
ATOM	1404	O	ASP	A	93	0.104	55.590	24.162	1.00	11.29	O
ATOM	1405	N	TRP	A	94	1.674	56.837	25.143	1.00	11.35	N
ATOM	1407	CA	TRP	A	94	2.197	57.300	23.899	1.00	10.73	C
ATOM	1409	CB	TRP	A	94	3.016	56.177	23.212	1.00	11.67	C
ATOM	1412	CG	TRP	A	94	3.921	55.528	24.202	1.00	11.04	C
ATOM	1413	CD1	TRP	A	94	3.591	54.410	25.005	1.00	7.89	C
ATOM	1415	NE1	TRP	A	94	4.628	54.240	25.903	1.00	10.25	N
ATOM	1417	CE2	TRP	A	94	5.574	55.213	25.732	1.00	7.45	C
ATOM	1418	CD2	TRP	A	94	5.114	56.099	24.764	1.00	7.97	C
ATOM	1419	CE3	TRP	A	94	5.941	57.157	24.388	1.00	10.30	C
ATOM	1421	CZ3	TRP	A	94	7.056	57.427	25.166	1.00	12.75	C
ATOM	1423	CH2	TRP	A	94	7.458	56.540	26.199	1.00	11.02	C
ATOM	1425	CZ2	TRP	A	94	6.655	55.477	26.550	1.00	7.10	C
ATOM	1427	C	TRP	A	94	1.474	58.105	22.846	1.00	10.80	C
ATOM	1428	O	TRP	A	94	1.820	57.930	21.666	1.00	12.07	O
ATOM	1429	N	LEU	A	95	0.493	58.902	23.240	1.00	12.80	N
ATOM	1431	CA	LEU	A	95	−0.057	59.966	22.440	1.00	11.32	C
ATOM	1433	CB	LEU	A	95	−1.187	60.616	23.203	1.00	12.25	C
ATOM	1436	CG	LEU	A	95	−2.329	59.624	23.549	1.00	13.74	C
ATOM	1438	CD1	LEU	A	95	−3.386	60.269	24.382	1.00	15.01	C
ATOM	1442	CD2	LEU	A	95	−2.918	59.103	22.351	1.00	12.90	C
ATOM	1446	C	LEU	A	95	1.050	61.020	22.438	1.00	12.56	C
ATOM	1447	O	LEU	A	95	1.802	61.072	23.397	1.00	11.37	O
ATOM	1448	N	ILE	A	96	1.130	61.821	21.382	1.00	10.65	N
ATOM	1450	CA	ILE	A	96	2.115	62.885	21.249	1.00	10.60	C
ATOM	1452	CB	ILE	A	96	3.185	62.608	20.202	1.00	9.27	C
ATOM	1454	CG1	ILE	A	96	3.887	61.268	20.383	1.00	9.17	C
ATOM	1457	CD1	ILE	A	96	4.677	61.085	21.606	1.00	6.17	C
ATOM	1461	CG2	ILE	A	96	4.263	63.708	20.223	1.00	10.74	C
ATOM	1465	C	ILE	A	96	1.365	64.113	20.885	1.00	13.34	C
ATOM	1466	O	ILE	A	96	0.580	64.133	19.898	1.00	11.17	O
ATOM	1467	N	TYR	A	97	1.507	65.142	21.698	1.00	10.99	N
ATOM	1469	CA	TYR	A	97	0.948	66.448	21.389	1.00	10.40	C
ATOM	1471	CB	TYR	A	97	−0.071	66.827	22.457	1.00	9.13	C
ATOM	1474	CG	TYR	A	97	−1.476	66.205	22.338	1.00	11.66	C
ATOM	1475	CD1	TYR	A	97	−1.685	64.842	22.516	1.00	10.97	C
ATOM	1477	CE1	TYR	A	97	−2.954	64.364	22.408	1.00	10.97	C
ATOM	1479	CZ	TYR	A	97	−4.022	65.180	22.159	1.00	9.89	C
ATOM	1480	OH	TYR	A	97	−5.198	64.549	22.083	1.00	12.29	O
ATOM	1482	CE2	TYR	A	97	−3.858	66.528	21.939	1.00	8.64	C
ATOM	1484	CD2	TYR	A	97	−2.565	66.987	21.999	1.00	9.70	C
ATOM	1486	C	TYR	A	97	2.111	67.484	21.432	1.00	9.53	C
ATOM	1487	O	TYR	A	97	3.248	67.144	21.660	1.00	14.36	O
ATOM	1488	N	LYS	A	98	1.871	68.645	20.840	1.00	11.28	N
ATOM	1490	CA	LYS	A	98	2.723	69.809	20.826	1.00	8.69	C
ATOM	1492	CB	LYS	A	98	3.322	70.137	19.432	1.00	10.99	C
ATOM	1495	CG	LYS	A	98	2.287	70.453	18.429	1.00	11.17	C
ATOM	1498	CD	LYS	A	98	2.737	70.559	17.046	1.00	12.80	C
ATOM	1501	CE	LYS	A	98	3.596	71.735	16.780	1.00	14.37	C
ATOM	1504	NZ	LYS	A	98	3.792	72.136	15.359	1.00	11.80	N
ATOM	1508	C	LYS	A	98	1.962	71.062	21.287	1.00	9.67	C
ATOM	1509	O	LYS	A	98	0.705	71.178	21.200	1.00	10.69	O
ATOM	1510	N	THR	A	99	2.802	71.949	21.791	1.00	11.10	N
ATOM	1512	CA	THR	A	99	2.478	73.322	22.083	1.00	11.12	C
ATOM	1514	CB	THR	A	99	2.279	73.630	23.530	1.00	11.10	C
ATOM	1516	OG1	THR	A	99	1.848	75.009	23.663	1.00	12.60	O
ATOM	1518	CG2	THR	A	99	3.664	73.409	24.231	1.00	14.35	C
ATOM	1522	C	THR	A	99	3.531	74.204	21.466	1.00	9.24	C
ATOM	1523	O	THR	A	99	4.699	73.886	21.462	1.00	12.21	O
ATOM	1524	N	THR	A	100	3.142	75.275	20.791	1.00	10.21	N
ATOM	1526	CA	THR	A	100	4.085	76.343	20.391	1.00	7.68	C
ATOM	1528	CB	THR	A	100	4.035	76.517	18.912	1.00	8.62	C
ATOM	1530	OG1	THR	A	100	2.746	76.881	18.484	1.00	6.34	O
ATOM	1532	CG2	THR	A	100	4.131	75.258	18.267	1.00	10.31	C
ATOM	1536	C	THR	A	100	3.816	77.679	21.115	1.00	10.03	C
ATOM	1537	O	THR	A	100	4.344	78.734	20.713	1.00	8.97	O
ATOM	1538	N	ASP	A	101	2.888	77.679	22.099	1.00	12.17	N
ATOM	1540	CA	ASP	A	101	2.480	78.926	22.827	1.00	11.94	C
ATOM	1542	CB	ASP	A	101	1.111	79.438	22.366	1.00	12.53	C
ATOM	1545	CG	ASP	A	101	0.017	78.428	22.586	1.00	12.67	C
ATOM	1546	OD1	ASP	A	101	0.248	77.401	23.288	1.00	8.36	O
ATOM	1547	OD2	ASP	A	101	−1.154	78.592	22.146	1.00	16.13	O
ATOM	1548	C	ASP	A	101	2.637	78.764	24.353	1.00	12.93	C
ATOM	1549	O	ASP	A	101	1.823	79.275	25.139	1.00	13.24	O
ATOM	1550	N	ALA	A	102	3.625	77.957	24.771	1.00	11.21	N
ATOM	1552	CA	ALA	A	102	3.961	77.793	26.197	1.00	13.13	C
ATOM	1554	CB	ALA	A	102	4.537	79.124	26.793	1.00	15.01	C
ATOM	1558	C	ALA	A	102	2.768	77.206	26.945	1.00	12.35	C
ATOM	1559	O	ALA	A	102	2.301	77.790	27.907	1.00	8.75	O
ATOM	1560	N	TYR	A	103	2.246	76.082	26.425	1.00	8.76	N
ATOM	1562	CA	TYR	A	103	1.140	75.333	27.104	1.00	12.19	C
ATOM	1564	CB	TYR	A	103	1.476	75.002	28.562	1.00	15.30	C
ATOM	1567	CG	TYR	A	103	2.919	74.643	28.825	1.00	14.89	C
ATOM	1568	CD1	TYR	A	103	3.379	73.369	28.624	1.00	16.53	C
ATOM	1570	CE1	TYR	A	103	4.731	73.030	28.872	1.00	15.54	C
ATOM	1572	CZ	TYR	A	103	5.578	73.972	29.301	1.00	14.65	C
ATOM	1573	OH	TYR	A	103	6.856	73.644	29.477	1.00	10.93	O
ATOM	1575	CE2	TYR	A	103	5.166	75.245	29.529	1.00	17.37	C
ATOM	1577	CD2	TYR	A	103	3.819	75.586	29.288	1.00	17.19	C
ATOM	1579	C	TYR	A	103	−0.261	75.975	27.097	1.00	14.30	C
ATOM	1580	O	TYR	A	103	−1.242	75.482	27.722	1.00	11.25	O
ATOM	1581	N	GLN	A	104	−0.401	77.056	26.344	1.00	15.15	N
ATOM	1583	CA	GLN	A	104	−1.727	77.638	26.300	1.00	16.77	C
ATOM	1585	CB	GLN	A	104	−1.639	79.064	25.757	1.00	20.34	C
ATOM	1588	CG	GLN	A	104	−0.796	80.074	26.634	1.00	25.22	C
ATOM	1591	CD	GLN	A	104	−0.824	81.541	26.069	1.00	28.73	C
ATOM	1592	OE1	GLN	A	104	−1.846	82.229	26.191	1.00	29.45	O
ATOM	1593	NE2	GLN	A	104	0.280	81.975	25.393	1.00	30.51	N
ATOM	1596	C	GLN	A	104	−2.675	76.767	25.445	1.00	14.55	C
ATOM	1597	O	GLN	A	104	−3.878	76.706	25.696	1.00	15.19	O
ATOM	1598	N	THR	A	105	−2.185	76.259	24.328	1.00	12.62	N
ATOM	1600	CA	THR	A	105	−3.004	75.402	23.422	1.00	11.08	C
ATOM	1602	CB	THR	A	105	−3.509	76.107	22.187	1.00	10.97	C
ATOM	1604	OG1	THR	A	105	−2.423	76.595	21.389	1.00	11.27	O
ATOM	1606	CG2	THR	A	105	−4.288	77.422	22.549	1.00	11.24	C
ATOM	1610	C	THR	A	105	−2.092	74.272	22.929	1.00	12.45	C
ATOM	1611	O	THR	A	105	−0.851	74.392	22.878	1.00	11.77	O
ATOM	1612	N	PHE	A	106	−2.745	73.162	22.581	1.00	12.46	N
ATOM	1614	CA	PHE	A	106	−2.052	71.958	22.188	1.00	13.94	C
ATOM	1616	CB	PHE	A	106	−2.241	70.958	23.300	1.00	15.04	C
ATOM	1619	CG	PHE	A	106	−1.644	71.393	24.580	1.00	17.01	C
ATOM	1620	CD1	PHE	A	106	−0.348	71.055	24.876	1.00	17.25	C
ATOM	1622	CE1	PHE	A	106	0.203	71.431	26.083	1.00	19.41	C
ATOM	1624	CZ	PHE	A	106	−0.596	72.104	27.017	1.00	18.42	C
ATOM	1626	CE2	PHE	A	106	−1.924	72.363	26.748	1.00	17.27	C
ATOM	1628	CD2	PHE	A	106	−2.426	72.041	25.525	1.00	18.01	C
ATOM	1630	C	PHE	A	106	−2.624	71.412	20.915	1.00	12.39	C
ATOM	1631	O	PHE	A	106	−3.806	71.598	20.631	1.00	10.59	O
ATOM	1632	N	THR	A	107	−1.790	70.681	20.182	1.00	8.23	N
ATOM	1634	CA	THR	A	107	−2.252	70.110	18.939	1.00	8.80	C
ATOM	1636	CB	THR	A	107	−1.544	70.769	17.737	1.00	8.29	C
ATOM	1638	OG1	THR	A	107	−1.941	72.116	17.663	1.00	6.57	O
ATOM	1640	CG2	THR	A	107	−1.888	70.188	16.328	1.00	9.11	C
ATOM	1644	C	THR	A	107	−1.722	68.685	18.979	1.00	9.08	C
ATOM	1645	O	THR	A	107	−0.526	68.448	19.214	1.00	8.70	O
ATOM	1646	N	LYS	A	108	−2.644	67.752	18.641	1.00	7.72	N
ATOM	1648	CA	LYS	A	108	−2.313	66.334	18.620	1.00	10.16	C
ATOM	1650	CB	LYS	A	108	−3.567	65.422	18.581	1.00	9.16	C
ATOM	1653	CG	LYS	A	108	−3.278	63.953	18.663	1.00	7.26	C
ATOM	1656	CD	LYS	A	108	−4.645	63.226	18.826	1.00	8.61	C
ATOM	1659	CE	LYS	A	108	−4.416	61.782	18.664	1.00	11.16	C
ATOM	1662	NZ	LYS	A	108	−5.542	60.906	19.154	1.00	5.13	N
ATOM	1666	C	LYS	A	108	−1.515	66.072	17.398	1.00	8.51	C
ATOM	1667	O	LYS	A	108	−1.983	66.354	16.308	1.00	10.06	O
ATOM	1668	N	ILE	A	109	−0.374	65.450	17.573	1.00	7.29	N
ATOM	1670	CA	ILE	A	109	0.458	65.093	16.441	1.00	10.46	C
ATOM	1672	CB	ILE	A	109	1.838	65.833	16.410	1.00	8.44	C
ATOM	1674	CG1	ILE	A	109	2.710	65.557	17.634	1.00	10.16	C
ATOM	1677	CD1	ILE	A	109	4.081	66.272	17.332	1.00	7.91	C
ATOM	1681	CG2	ILE	A	109	1.599	67.357	16.199	1.00	12.74	C
ATOM	1685	C	ILE	A	109	0.773	63.629	16.184	1.00	12.02	C
ATOM	1686	O	ILE	A	109	1.414	63.338	15.178	1.00	8.52	O
ATOM	1687	N	ARG	A	110	0.572	62.794	17.193	1.00	13.26	N
ATOM	1689	CA	ARG	A	110	0.591	61.359	16.992	1.00	13.26	C
ATOM	1691	CB	ARG	A	110	1.890	60.663	17.316	1.00	11.90	C
ATOM	1694	CG	ARG	A	110	3.052	61.153	16.489	1.00	11.81	C
ATOM	1697	CD	ARG	A	110	3.152	60.822	15.016	1.00	9.75	C
ATOM	1700	NE	ARG	A	110	4.549	61.145	14.559	1.00	5.77	N
ATOM	1702	CZ	ARG	A	110	4.863	62.377	14.133	1.00	5.92	C
ATOM	1703	NH1	ARG	A	110	3.983	63.411	14.119	1.00	8.31	N
ATOM	1706	NH2	ARG	A	110	6.026	62.568	13.645	1.00	5.94	N
ATOM	1709	C	ARG	A	110	−0.519	60.667	17.721	1.00	11.42	C
ATOM	1710	O	ARG	A	110	−0.696	61.007	18.840	1.00	8.70	O
ATOM	1711	N	SER	A	111	−1.209	59.704	17.091	1.00	14.26	N
ATOM	1713	CA	SER	A	111	−1.958	58.641	17.754	1.00	17.02	C
ATOM	1715	CB	SER	A	111	−2.724	57.712	16.723	1.00	20.16	C
ATOM	1718	OG	SER	A	111	−3.743	58.582	16.265	1.00	21.74	O
ATOM	1720	C	SER	A	111	−0.919	57.829	18.544	1.00	14.70	C
ATOM	1721	O	SER	A	111	0.273	57.836	18.212	1.00	16.86	O
ATOM	1722	N	SER	A	112	−1.445	57.078	19.469	1.00	15.33	N
ATOM	1724	CA	SER	A	112	−0.660	56.086	20.204	1.00	16.21	C
ATOM	1726	CB	SER	A	112	−1.475	55.242	21.153	1.00	16.36	C
ATOM	1729	OG	SER	A	112	−0.683	54.311	21.872	1.00	15.39	O
ATOM	1731	C	SER	A	112	−0.040	55.123	19.269	1.00	16.70	C
ATOM	1732	O	SER	A	112	−0.684	54.627	18.315	1.00	20.34	O
ATOM	1733	N	SER	A	113	1.299	54.994	19.419	1.00	17.37	N
ATOM	1735	CA	SER	A	113	2.086	53.975	18.751	1.00	15.72	C
ATOM	1737	CB	SER	A	113	3.506	54.569	18.467	1.00	16.57	C
ATOM	1740	OG	SER	A	113	3.954	54.927	19.739	1.00	16.43	O
ATOM	1742	C	SER	A	113	2.165	52.631	19.489	1.00	14.13	C
ATOM	1743	O	SER	A	113	2.698	51.694	18.980	1.00	15.35	O
ATOM	1744	N	MET	A	114	1.461	52.409	20.599	1.00	13.09	N
ATOM	1746	CA	MET	A	114	1.406	51.112	21.222	1.00	12.38	C
ATOM	1748	CB	MET	A	114	0.459	51.169	22.415	1.00	15.07	C
ATOM	1751	CG	MET	A	114	1.178	52.022	23.536	1.00	19.87	C
ATOM	1754	SD	MET	A	114	0.264	52.200	25.023	1.00	21.07	S
ATOM	1755	CE	MET	A	114	0.298	50.494	25.805	1.00	23.70	C
ATOM	1759	C	MET	A	114	0.886	50.017	20.327	1.00	15.06	C
ATOM	1760	O	MET	A	114	−0.020	50.332	19.607	1.00	15.11	O
ATOM	1761	N	GLY	A	115	1.654	48.922	20.220	1.00	9.36	N
ATOM	1763	CA	GLY	A	115	1.268	47.835	19.378	1.00	10.49	C
ATOM	1766	C	GLY	A	115	1.949	47.868	18.035	1.00	10.29	C
ATOM	1767	O	GLY	A	115	1.864	46.856	17.297	1.00	10.82	O
ATOM	1768	N	VAL	A	116	2.505	49.022	17.688	1.00	7.02	N
ATOM	1770	CA	VAL	A	116	3.178	49.172	16.391	1.00	9.43	C
ATOM	1772	CB	VAL	A	116	3.052	50.614	15.783	1.00	10.47	C
ATOM	1774	CG1	VAL	A	116	3.941	50.829	14.510	1.00	10.78	C
ATOM	1778	CG2	VAL	A	116	1.642	51.035	15.568	1.00	10.20	C
ATOM	1782	C	VAL	A	116	4.655	48.797	16.548	1.00	8.38	C
ATOM	1783	O	VAL	A	116	5.294	49.372	17.399	1.00	10.29	O
ATOM	1784	N	CYS	A	117	5.229	47.931	15.688	1.00	5.54	N
ATOM	1786	CA	CYS	A	117	6.624	47.576	15.832	1.00	6.25	C
ATOM	1788	CB	CYS	A	117	6.677	46.052	15.502	1.00	5.28	C
ATOM	1791	SG	CYS	A	117	8.354	45.441	15.452	1.00	8.44	S
ATOM	1792	C	CYS	A	117	7.411	48.304	14.769	1.00	9.64	C
ATOM	1793	O	CYS	A	117	7.075	48.159	13.586	1.00	10.64	O
ATOM	1794	N	PRO	A	118	8.347	49.144	15.166	1.00	9.31	N
ATOM	1795	CA	PRO	A	118	9.143	49.923	14.228	1.00	10.70	C
ATOM	1797	CB	PRO	A	118	10.164	50.594	15.173	1.00	8.88	C
ATOM	1800	CG	PRO	A	118	9.315	50.725	16.437	1.00	10.00	C
ATOM	1803	CD	PRO	A	118	8.747	49.349	16.572	1.00	6.82	C
ATOM	1806	C	PRO	A	118	9.838	48.934	13.269	1.00	10.27	C
ATOM	1807	O	PRO	A	118	10.321	47.864	13.627	1.00	10.68	O
ATOM	1808	N	LYS	A	119	10.089	49.409	12.064	1.00	12.58	N
ATOM	1810	CA	LYS	A	119	10.829	48.643	11.060	1.00	12.76	C
ATOM	1812	CB	LYS	A	119	10.568	49.228	9.653	1.00	15.68	C
ATOM	1815	CG	LYS	A	119	11.272	48.555	8.463	1.00	16.64	C
ATOM	1818	CD	LYS	A	119	11.111	46.997	8.542	1.00	18.87	C
ATOM	1821	CE	LYS	A	119	9.842	46.280	7.993	1.00	18.06	C
ATOM	1824	NZ	LYS	A	119	9.763	44.824	8.359	1.00	17.21	N
ATOM	1828	C	LYS	A	119	12.298	48.788	11.359	1.00	14.02	C
ATOM	1829	O	LYS	A	119	13.043	49.620	10.835	1.00	15.49	O
ATOM	1830	N	ILE	A	120	12.769	47.964	12.290	1.00	13.51	N
ATOM	1832	CA	ILE	A	120	14.178	48.094	12.694	1.00	9.14	C
ATOM	1834	CB	ILE	A	120	14.248	48.834	14.049	1.00	11.23	C
ATOM	1836	CG1	ILE	A	120	14.036	50.319	13.716	1.00	13.36	C
ATOM	1839	CD1	ILE	A	120	14.146	51.261	14.818	1.00	11.19	C
ATOM	1843	CG2	ILE	A	120	15.702	48.607	14.704	1.00	11.91	C
ATOM	1847	C	ILE	A	120	14.643	46.647	12.985	1.00	9.77	C
ATOM	1848	O	ILE	A	120	13.918	45.854	13.625	1.00	9.24	O
ATOM	1849	N	LEU	A	121	15.794	46.275	12.450	1.00	9.71	N
ATOM	1851	CA	LEU	A	121	16.298	44.919	12.478	1.00	11.68	C
ATOM	1853	CB	LEU	A	121	17.380	44.869	11.407	1.00	15.05	C
ATOM	1856	CG	LEU	A	121	17.667	43.536	10.800	1.00	18.59	C
ATOM	1858	CD1	LEU	A	121	16.393	42.688	10.319	1.00	20.06	C
ATOM	1862	CD2	LEU	A	121	18.691	43.933	9.706	1.00	21.03	C
ATOM	1866	C	LEU	A	121	16.944	44.749	13.830	1.00	13.87	C
ATOM	1867	O	LEU	A	121	17.821	45.527	14.222	1.00	12.91	O
ATOM	1868	N	LYS	A	122	16.425	43.790	14.582	1.00	13.07	N
ATOM	1870	CA	LYS	A	122	16.842	43.595	15.962	1.00	13.86	C
ATOM	1872	CB	LYS	A	122	15.956	44.394	16.954	1.00	14.08	C
ATOM	1875	CG	LYS	A	122	16.400	44.389	18.454	1.00	19.57	C
ATOM	1878	CD	LYS	A	122	17.852	44.689	18.809	1.00	21.48	C
ATOM	1881	CE	LYS	A	122	18.343	44.220	20.262	1.00	24.39	C
ATOM	1884	NZ	LYS	A	122	19.234	42.945	20.283	1.00	22.59	N
ATOM	1888	C	LYS	A	122	16.860	42.115	16.279	1.00	9.69	C
ATOM	1889	O	LYS	A	122	15.856	41.522	16.259	1.00	10.32	O
ATOM	1890	N	LYS	A	123	17.944	41.530	16.778	1.00	7.24	N
ATOM	1892	CA	LYS	A	123	17.910	40.161	17.158	1.00	7.74	C
ATOM	1894	CB	LYS	A	123	19.343	39.669	17.314	1.00	8.85	C
ATOM	1897	CG	LYS	A	123	20.025	39.680	15.990	1.00	9.77	C
ATOM	1900	CD	LYS	A	123	21.433	39.034	16.157	1.00	13.94	C
ATOM	1903	CE	LYS	A	123	21.966	38.563	14.829	1.00	17.19	C
ATOM	1906	NZ	LYS	A	123	22.187	39.772	13.984	1.00	16.89	N
ATOM	1910	C	LYS	A	123	17.318	40.061	18.540	1.00	8.95	C
ATOM	1911	O	LYS	A	123	17.459	40.947	19.394	1.00	7.12	O
ATOM	1912	N	CYS	A	124	16.709	38.917	18.791	1.00	10.81	N
ATOM	1914	CA	CYS	A	124	16.102	38.662	20.074	1.00	10.25	C
ATOM	1916	CB	CYS	A	124	14.679	39.198	20.074	1.00	9.54	C
ATOM	1919	SG	CYS	A	124	13.811	38.420	18.689	1.00	8.73	S
ATOM	1920	C	CYS	A	124	16.097	37.162	20.431	1.00	10.85	C
ATOM	1921	O	CYS	A	124	16.179	36.263	19.594	1.00	9.26	O
ATOM	1922	N	ARG	A	125	15.845	36.927	21.706	1.00	12.03	N
ATOM	1924	CA	ARG	A	125	15.494	35.602	22.261	1.00	14.18	C
ATOM	1926	CB	ARG	A	125	16.547	35.142	23.312	1.00	18.03	C
ATOM	1929	CG	ARG	A	125	17.839	34.572	22.673	1.00	23.34	C
ATOM	1932	CD	ARG	A	125	19.191	34.637	23.511	1.00	28.34	C
ATOM	1935	NE	ARG	A	125	20.180	33.556	23.222	1.00	31.12	N
ATOM	1937	CZ	ARG	A	125	19.928	32.262	23.506	1.00	34.85	C
ATOM	1938	NH1	ARG	A	125	18.765	31.934	24.100	1.00	37.06	N
ATOM	1941	NH2	ARG	A	125	20.787	31.281	23.235	1.00	35.19	N
ATOM	1944	C	ARG	A	125	14.066	35.670	22.883	1.00	12.22	C
ATOM	1945	O	ARG	A	125	13.409	34.674	22.927	1.00	7.31	O
ATOM	1946	N	ARG	A	126	13.522	36.830	23.240	1.00	12.86	N
ATOM	1948	CA	ARG	A	126	12.234	36.928	23.840	1.00	14.85	C
ATOM	1950	CB	ARG	A	126	12.297	36.637	25.331	1.00	17.94	C
ATOM	1953	CG	ARG	A	126	13.257	37.535	26.061	1.00	19.22	C
ATOM	1956	CD	ARG	A	126	13.090	37.583	27.592	1.00	23.45	C
ATOM	1959	NE	ARG	A	126	11.702	37.396	28.055	1.00	26.65	N
ATOM	1961	CZ	ARG	A	126	11.341	36.720	29.159	1.00	29.80	C
ATOM	1962	NH1	ARG	A	126	12.190	36.104	29.976	1.00	29.40	N
ATOM	1965	NH2	ARG	A	126	10.054	36.585	29.456	1.00	31.54	N
ATOM	1968	C	ARG	A	126	11.723	38.301	23.507	1.00	13.43	C
ATOM	1969	O	ARG	A	126	12.499	39.161	23.074	1.00	11.02	O
ATOM	1970	N	ASP	A	127	10.432	38.511	23.751	1.00	8.99	N
ATOM	1972	CA	ASP	A	127	9.815	39.799	23.369	1.00	9.96	C
ATOM	1974	CB	ASP	A	127	8.301	39.815	23.730	1.00	9.55	C
ATOM	1977	CG	ASP	A	127	7.539	38.785	22.893	1.00	10.42	C
ATOM	1978	OD1	ASP	A	127	6.398	38.465	23.319	1.00	8.22	O
ATOM	1979	OD2	ASP	A	127	8.157	38.107	21.987	1.00	9.63	O
ATOM	1980	C	ASP	A	127	10.507	41.011	23.967	1.00	6.95	C
ATOM	1981	O	ASP	A	127	10.617	42.050	23.351	1.00	4.94	O
ATOM	1982	N	SER	A	128	10.916	40.905	25.209	1.00	9.26	N
ATOM	1984	CA	SER	A	128	11.467	42.058	25.882	1.00	10.08	C
ATOM	1986	CB	SER	A	128	11.599	41.822	27.397	1.00	12.52	C
ATOM	1989	OG	SER	A	128	12.320	40.648	27.732	1.00	11.88	O
ATOM	1991	C	SER	A	128	12.779	42.492	25.315	1.00	9.99	C
ATOM	1992	O	SER	A	128	13.299	43.506	25.763	1.00	9.39	O
ATOM	1993	N	ASP	A	129	13.332	41.713	24.389	1.00	9.66	N
ATOM	1995	CA	ASP	A	129	14.612	42.072	23.757	1.00	8.80	C
ATOM	1997	CB	ASP	A	129	15.291	40.884	23.196	1.00	7.88	C
ATOM	2000	CG	ASP	A	129	15.869	39.997	24.229	1.00	9.83	C
ATOM	2001	OD1	ASP	A	129	16.317	40.424	25.331	1.00	12.63	O
ATOM	2002	OD2	ASP	A	129	16.023	38.817	23.895	1.00	7.97	O
ATOM	2003	C	ASP	A	129	14.247	42.999	22.580	1.00	10.66	C
ATOM	2004	O	ASP	A	129	15.044	43.734	22.035	1.00	9.95	O
ATOM	2005	N	CYS	A	130	12.966	43.125	22.304	1.00	9.69	N
ATOM	2007	CA	CYS	A	130	12.596	43.961	21.202	1.00	10.40	C
ATOM	2009	CB	CYS	A	130	11.546	43.241	20.368	1.00	10.66	C
ATOM	2012	SG	CYS	A	130	11.959	41.602	19.702	1.00	10.81	S
ATOM	2013	C	CYS	A	130	11.939	45.265	21.648	1.00	9.65	C
ATOM	2014	O	CYS	A	130	11.417	45.435	22.752	1.00	12.43	O
ATOM	2015	N	LEU	A	131	11.768	46.141	20.680	1.00	8.80	N
ATOM	2017	CA	LEU	A	131	11.162	47.419	20.905	1.00	9.00	C
ATOM	2019	CB	LEU	A	131	11.232	48.250	19.620	1.00	9.08	C
ATOM	2022	CG	LEU	A	131	12.641	48.674	19.336	1.00	7.59	C
ATOM	2024	CD1	LEU	A	131	12.884	49.341	18.066	1.00	8.36	C
ATOM	2028	CD2	LEU	A	131	13.314	49.481	20.457	1.00	9.67	C
ATOM	2032	C	LEU	A	131	9.692	47.224	21.237	1.00	8.20	C
ATOM	2033	O	LEU	A	131	9.069	46.252	20.882	1.00	9.52	O
ATOM	2034	N	ALA	A	132	9.123	48.267	21.809	1.00	5.72	N
ATOM	2036	CA	ALA	A	132	7.712	48.167	22.036	1.00	6.14	C
ATOM	2038	CB	ALA	A	132	7.272	49.392	22.713	1.00	4.65	C
ATOM	2042	C	ALA	A	132	6.907	47.955	20.754	1.00	5.20	C
ATOM	2043	O	ALA	A	132	7.109	48.660	19.731	1.00	7.05	O
ATOM	2044	N	GLY	A	133	5.836	47.158	20.890	1.00	7.26	N
ATOM	2046	CA	GLY	A	133	4.986	46.833	19.773	1.00	6.59	C
ATOM	2049	C	GLY	A	133	5.551	45.630	18.983	1.00	7.38	C
ATOM	2050	O	GLY	A	133	4.854	45.143	18.095	1.00	7.56	O
ATOM	2051	N	CYS	A	134	6.715	45.096	19.316	1.00	6.87	N
ATOM	2053	CA	CYS	A	134	7.395	44.072	18.598	1.00	6.03	C
ATOM	2055	CB	CYS	A	134	8.849	44.449	18.295	1.00	7.35	C
ATOM	2058	SG	CYS	A	134	9.007	45.911	17.270	1.00	8.44	S
ATOM	2059	C	CYS	A	134	7.412	42.795	19.456	1.00	7.86	C
ATOM	2060	O	CYS	A	134	7.613	42.827	20.697	1.00	7.10	O
ATOM	2061	N	VAL	A	135	7.563	41.673	18.743	1.00	8.68	N
ATOM	2063	CA	VAL	A	135	7.636	40.395	19.396	1.00	11.71	C
ATOM	2065	CB	VAL	A	135	6.326	39.568	19.330	1.00	12.59	C
ATOM	2067	CG1	VAL	A	135	5.239	40.261	20.132	1.00	12.03	C
ATOM	2071	CG2	VAL	A	135	5.942	39.183	17.931	1.00	11.54	C
ATOM	2075	C	VAL	A	135	8.754	39.610	18.731	1.00	12.89	C
ATOM	2076	O	VAL	A	135	9.193	39.949	17.638	1.00	15.44	O
ATOM	2077	N	CYS	A	136	9.347	38.690	19.514	1.00	12.32	N
ATOM	2079	CA	CYS	A	136	10.425	37.864	19.038	1.00	9.14	C
ATOM	2081	CB	CYS	A	136	11.351	37.414	20.162	1.00	9.24	C
ATOM	2084	SG	CYS	A	136	12.853	36.730	19.489	1.00	9.57	S
ATOM	2085	C	CYS	A	136	9.877	36.721	18.191	1.00	9.81	C
ATOM	2086	O	CYS	A	136	8.999	35.948	18.560	1.00	10.22	O
ATOM	2087	N	GLY	A	137	10.384	36.666	16.958	1.00	11.30	N
ATOM	2089	CA	GLY	A	137	9.914	35.695	15.948	1.00	11.53	C
ATOM	2092	C	GLY	A	137	10.704	34.425	15.986	1.00	10.87	C
ATOM	2093	O	GLY	A	137	11.594	34.309	16.806	1.00	10.53	O
ATOM	2094	N	PRO	A	138	10.362	33.432	15.175	1.00	10.27	N
ATOM	2095	CA	PRO	A	138	11.060	32.150	15.353	1.00	10.62	C
ATOM	2097	CB	PRO	A	138	10.114	31.148	14.663	1.00	11.02	C
ATOM	2100	CG	PRO	A	138	9.523	32.010	13.541	1.00	9.49	C
ATOM	2103	CD	PRO	A	138	9.185	33.314	14.275	1.00	9.58	C
ATOM	2106	C	PRO	A	138	12.461	32.121	14.789	1.00	10.49	C
ATOM	2107	O	PRO	A	138	13.013	31.031	14.849	1.00	7.78	O
ATOM	2108	N	ASN	A	139	12.955	33.188	14.131	1.00	10.69	N
ATOM	2110	CA	ASN	A	139	14.279	33.178	13.637	1.00	8.04	C
ATOM	2112	CB	ASN	A	139	14.355	33.625	12.201	1.00	8.85	C
ATOM	2115	CG	ASN	A	139	14.099	32.486	11.250	1.00	11.43	C
ATOM	2116	OD1	ASN	A	139	13.582	31.405	11.673	1.00	12.02	O
ATOM	2117	ND2	ASN	A	139	14.506	32.691	9.974	1.00	8.01	N
ATOM	2120	C	ASN	A	139	15.231	34.047	14.428	1.00	10.21	C
ATOM	2121	O	ASN	A	139	16.365	34.344	14.006	1.00	11.74	O
ATOM	2122	N	GLY	A	140	14.815	34.372	15.607	1.00	9.67	N
ATOM	2124	CA	GLY	A	140	15.589	35.221	16.463	1.00	10.04	C
ATOM	2127	C	GLY	A	140	15.547	36.669	15.998	1.00	10.48	C
ATOM	2128	O	GLY	A	140	16.426	37.390	16.407	1.00	9.32	O
ATOM	2129	N	PHE	A	141	14.528	37.111	15.260	1.00	10.21	N
ATOM	2131	CA	PHE	A	141	14.453	38.536	14.939	1.00	10.80	C
ATOM	2133	CB	PHE	A	141	14.723	38.821	13.455	1.00	10.24	C
ATOM	2136	CG	PHE	A	141	16.147	38.733	13.087	1.00	10.69	C
ATOM	2137	CD1	PHE	A	141	16.931	39.862	13.114	1.00	11.83	C
ATOM	2139	CE1	PHE	A	141	18.217	39.837	12.812	1.00	10.05	C
ATOM	2141	CZ	PHE	A	141	18.775	38.651	12.386	1.00	7.45	C
ATOM	2143	CE2	PHE	A	141	18.049	37.509	12.410	1.00	6.60	C
ATOM	2145	CD2	PHE	A	141	16.752	37.523	12.759	1.00	9.67	C
ATOM	2147	C	PHE	A	141	13.132	39.101	15.382	1.00	11.58	C
ATOM	2148	O	PHE	A	141	12.080	38.398	15.451	1.00	14.86	O
ATOM	2149	N	CYS	A	142	13.184	40.385	15.742	1.00	10.60	N
ATOM	2151	CA	CYS	A	142	11.979	41.109	16.147	1.00	10.20	C
ATOM	2153	CB	CYS	A	142	12.321	42.364	16.941	1.00	10.04	C
ATOM	2156	SG	CYS	A	142	13.395	42.150	18.391	1.00	8.87	S
ATOM	2157	C	CYS	A	142	11.030	41.473	15.017	1.00	9.93	C
ATOM	2158	O	CYS	A	142	11.490	41.746	13.959	1.00	12.30	O
ATOM	2159	N	GLY	A	143	9.690	41.467	15.215	1.00	6.38	N
ATOM	2161	CA	GLY	A	143	8.764	41.871	14.194	1.00	8.97	C
ATOM	2164	C	GLY	A	143	7.380	42.086	14.827	1.00	9.03	C
ATOM	2165	O	GLY	A	143	7.277	42.013	16.034	1.00	4.04	O
ATOM	2166	N	SER	A	144	6.399	42.455	14.038	1.00	6.51	N
ATOM	2168	CA	SER	A	144	5.072	42.806	14.519	1.00	8.21	C
ATOM	2170	CB	SER	A	144	4.211	43.276	13.280	1.00	6.85	C
ATOM	2173	OG	SER	A	144	4.868	44.313	12.534	1.00	8.90	O
ATOM	2175	C	SER	A	144	4.545	41.514	15.054	1.00	11.77	C
ATOM	2176	O	SER	A	144	4.836	40.367	14.657	1.00	13.97	O
ATOM	2177	OXT	SER	A	144	3.644	41.553	15.871	1.00	17.62	O
ATOM	2178	N	GLN	B	2	−7.652	18.523	35.984	1.00	47.13	N
ATOM	2180	CA	GLN	B	2	−6.606	19.347	36.701	1.00	46.13	C
ATOM	2182	CB	GLN	B	2	−6.839	19.145	38.193	1.00	48.68	C
ATOM	2185	CG	GLN	B	2	−8.350	19.427	38.618	1.00	51.28	C
ATOM	2188	CD	GLN	B	2	−9.116	18.300	39.436	1.00	53.84	C
ATOM	2189	OE1	GLN	B	2	−9.170	18.307	40.693	1.00	55.09	O
ATOM	2190	NE2	GLN	B	2	−9.777	17.382	38.706	1.00	54.79	N
ATOM	2193	C	GLN	B	2	−5.133	19.105	36.229	1.00	42.32	C
ATOM	2194	O	GLN	B	2	−4.350	20.059	36.029	1.00	40.81	O
ATOM	2197	N	VAL	B	3	−4.756	17.840	35.983	1.00	36.38	N
ATOM	2199	CA	VAL	B	3	−3.433	17.513	35.386	1.00	29.41	C
ATOM	2201	CB	VAL	B	3	−3.025	16.089	35.713	1.00	30.90	C
ATOM	2203	CG1	VAL	B	3	−2.293	15.320	34.648	1.00	29.79	C
ATOM	2207	CG2	VAL	B	3	−2.305	16.044	37.089	1.00	32.67	C
ATOM	2211	C	VAL	B		3	−3.532	17.692	33.876	1.00	22.75	C
ATOM	2212	O	VAL	B	3	−4.500	17.320	33.231	1.00	20.09	O
ATOM	2213	N	ILE	B	4	−2.494	18.302	33.309	1.00	17.63	N
ATOM	2215	CA	ILE	B	4	−2.374	18.510	31.862	1.00	14.01	C
ATOM	2217	CB	ILE	B	4	−2.148	19.960	31.544	1.00	13.99	C
ATOM	2219	CG1	ILE	B	4	−3.252	20.848	32.157	1.00	15.54	C
ATOM	2222	CD1	ILE	B	4	−3.042	22.418	31.823	1.00	14.33	C
ATOM	2226	CG2	ILE	B	4	−2.030	20.158	30.050	1.00	12.10	C
ATOM	2230	C	ILE	B	4	−1.247	17.645	31.388	1.00	11.29	C
ATOM	2231	O	ILE	B	4	−0.065	17.851	31.711	1.00	12.25	O
ATOM	2232	N	ASN	B	5	−1.642	16.591	30.683	1.00	10.98	N
ATOM	2234	CA	ASN	B	5	−0.749	15.581	30.162	1.00	7.79	C
ATOM	2236	CB	ASN	B	5	−0.427	14.539	31.159	1.00	7.24	C
ATOM	2239	CG	ASN	B	5	−1.512	13.458	31.336	1.00	9.99	C
ATOM	2240	OD1	ASN	B	5	−1.283	12.447	32.020	1.00	14.44	O
ATOM	2241	ND2	ASN	B	5	−2.679	13.706	30.877	1.00	5.64	N
ATOM	2244	C	ASN	B	5	−1.121	14.874	28.892	1.00	9.61	C
ATOM	2245	O	ASN	B	5	−0.656	13.757	28.698	1.00	11.34	O
ATOM	2246	N	THR	B	6	−1.998	15.447	28.088	1.00	9.86	N
ATOM	2248	CA	THR	B	6	−2.366	14.887	26.817	1.00	8.91	C
ATOM	2250	CB	THR	B	6	−3.818	15.075	26.457	1.00	6.42	C
ATOM	2252	OG1	THR	B	6	−4.741	14.395	27.429	1.00	14.51	O
ATOM	2254	CG2	THR	B	6	−4.110	16.432	26.411	1.00	2.00	C
ATOM	2258	C	THR	B	6	−1.455	15.671	25.807	1.00	10.95	C
ATOM	2259	O	THR	B	6	−0.921	16.748	26.054	1.00	9.64	O
ATOM	2260	N	PHE	B		7	−1.292	15.106	24.618	1.00	10.00	N
ATOM	2262	CA	PHE	B	7	−0.470	15.699	23.620	1.00	8.08	C
ATOM	2264	CB	PHE	B	7	−0.499	14.884	22.342	1.00	8.24	C
ATOM	2267	CG	PHE	B	7	0.343	13.605	22.376	1.00	9.14	C
ATOM	2268	CD1	PHE	B	7	1.714	13.666	22.366	1.00	10.72	C
ATOM	2270	CE1	PHE	B	7	2.478	12.542	22.402	1.00	12.63	C
ATOM	2272	CZ	PHE	B	7	1.929	11.326	22.385	1.00	11.51	C
ATOM	2274	CE2	PHE	B	7	0.539	11.202	22.442	1.00	11.44	C
ATOM	2276	CD2	PHE	B	7	−0.263	12.356	22.468	1.00	10.83	C
ATOM	2278	C	PHE	B	7	−1.049	17.081	23.251	1.00	8.06	C
ATOM	2279	O	PHE	B	7	−0.322	18.035	23.253	1.00	7.93	O
ATOM	2280	N	ASP	B	8	−2.321	17.256	22.965	1.00	6.86	N
ATOM	2282	CA	ASP	B	8	−2.830	18.561	22.606	1.00	10.26	C
ATOM	2284	CB	ASP	B	8	−4.203	18.473	22.030	1.00	8.76	C
ATOM	2287	CG	ASP	B	8	−4.155	17.842	20.692	1.00	9.13	C
ATOM	2288	OD1	ASP	B	8	−3.323	18.263	19.835	1.00	6.14	O
ATOM	2289	OD2	ASP	B	8	−4.933	16.909	20.455	1.00	9.55	O
ATOM	2290	C	ASP	B	8	−2.934	19.510	23.798	1.00	10.29	C
ATOM	2291	O	ASP	B	8	−2.685	20.697	23.630	1.00	11.56	O
ATOM	2292	N	GLY	B	9	−3.087	18.980	25.007	1.00	7.29	N
ATOM	2294	CA	GLY	B	9	−3.174	19.910	26.104	1.00	8.84	C
ATOM	2297	C	GLY	B	9	−1.801	20.412	26.478	1.00	9.08	C
ATOM	2298	O	GLY	B	9	−1.625	21.602	26.761	1.00	8.49	O
ATOM	2299	N	VAL	B	10	−0.795	19.565	26.363	1.00	10.58	N
ATOM	2301	CA	VAL	B	10	0.591	20.016	26.620	1.00	8.31	C
ATOM	2303	CB	VAL	B	10	1.507	18.863	27.007	1.00	9.15	C
ATOM	2305	CG1	VAL	B	10	2.903	19.389	27.165	1.00	11.22	C
ATOM	2309	CG2	VAL	B	10	1.009	18.122	28.215	1.00	11.83	C
ATOM	2313	C	VAL	B	10	1.040	20.954	25.527	1.00	9.51	C
ATOM	2314	O	VAL	B	10	1.647	21.983	25.807	1.00	9.75	O
ATOM	2315	N	ALA	B	11	0.772	20.592	24.273	1.00	7.97	N
ATOM	2317	CA	ALA	B	11	1.113	21.452	23.161	1.00	9.12	C
ATOM	2319	CB	ALA	B	11	0.636	20.894	21.831	1.00	9.88	C
ATOM	2323	C	ALA	B	11	0.580	22.870	23.301	1.00	7.14	C
ATOM	2324	O	ALA	B	11	1.305	23.856	23.113	1.00	9.85	O
ATOM	2325	N	ASP	B	12	−0.691	22.975	23.599	1.00	9.02	N
ATOM	2327	CA	ASP	B	12	−1.289	24.252	23.744	1.00	10.56	C
ATOM	2329	CB	ASP	B	12	−2.792	24.074	24.009	1.00	8.87	C
ATOM	2332	CG	ASP	B	12	−3.522	23.540	22.769	1.00	9.50	C
ATOM	2333	OD1	ASP	B	12	−2.930	23.532	21.660	1.00	7.65	O
ATOM	2334	OD2	ASP	B	12	−4.768	23.257	22.802	1.00	9.59	O
ATOM	2335	C	ASP	B	12	−0.679	25.010	24.937	1.00	9.51	C
ATOM	2336	O	ASP	B	12	−0.483	26.212	24.813	1.00	13.07	O
ATOM	2337	N	TYR	B	13	−0.468	24.333	26.037	1.00	9.80	N
ATOM	2339	CA	TYR	B	13	0.066	24.973	27.238	1.00	7.80	C
ATOM	2341	CB	TYR	B	13	0.160	24.034	28.450	1.00	7.41	C
ATOM	2344	CG	TYR	B	13	0.391	24.735	29.769	1.00	8.08	C
ATOM	2345	CD1	TYR	B	13	1.654	24.907	30.268	1.00	9.81	C
ATOM	2347	CE1	TYR	B	13	1.923	25.538	31.426	1.00	9.09	C
ATOM	2349	CZ	TYR	B	13	0.882	25.868	32.302	1.00	13.91	C
ATOM	2350	OH	TYR	B	13	1.212	26.448	33.525	1.00	14.39	O
ATOM	2352	CE2	TYR	B	13	−0.458	25.581	31.903	1.00	10.49	C
ATOM	2354	CD2	TYR	B	13	−0.675	25.032	30.614	1.00	10.89	C
ATOM	2356	C	TYR	B	13	1.483	25.494	26.973	1.00	7.88	C
ATOM	2357	O	TYR	B	13	1.824	26.617	27.388	1.00	8.81	O
ATOM	2358	N	LEU	B	14	2.309	24.624	26.447	1.00	10.94	N
ATOM	2360	CA	LEU	B	14	3.638	25.014	25.990	1.00	7.43	C
ATOM	2362	CB	LEU	B	14	4.233	23.858	25.220	1.00	9.68	C
ATOM	2365	CG	LEU	B		14	4.871	22.796	26.149	1.00	10.03	C
ATOM	2367	CD1	LEU	B	14	5.122	21.584	25.320	1.00	10.85	C
ATOM	2371	CD2	LEU	B	14	6.178	23.145	26.903	1.00	9.85	C
ATOM	2375	C	LEU	B	14	3.652	26.252	25.101	1.00	11.17	C
ATOM	2376	O	LEU	B	14	4.475	27.159	25.320	1.00	10.57	O
ATOM	2377	N	GLN	B	15	2.822	26.232	24.039	1.00	9.73	N
ATOM	2379	CA	GLN	B	15	2.747	27.313	23.081	1.00	10.80	C
ATOM	2381	CB	GLN	B	15	1.999	26.859	21.797	1.00	8.56	C
ATOM	2384	CG	GLN	B	15	2.875	25.924	20.916	1.00	10.28	C
ATOM	2387	CD	GLN	B	15	2.426	25.805	19.520	1.00	8.91	C
ATOM	2388	OE1	GLN	B	15	1.240	25.938	19.325	1.00	9.29	O
ATOM	2389	NE2	GLN	B	15	3.323	25.676	18.500	1.00	3.81	N
ATOM	2392	C	GLN	B	15	2.186	28.597	23.639	1.00	10.08	C
ATOM	2393	O	GLN	B	15	2.541	29.651	23.182	1.00	11.20	O
ATOM	2394	N	THR	B	16	1.380	28.476	24.676	1.00	9.09	N
ATOM	2396	CA	THR	B	16	0.794	29.547	25.357	1.00	9.13	C
ATOM	2398	CB	THR	B	16	−0.534	29.194	25.979	1.00	7.00	C
ATOM	2400	OG1	THR	B	16	−1.481	28.772	25.021	1.00	10.11	O
ATOM	2402	CG2	THR	B	16	−1.142	30.399	26.664	1.00	8.72	C
ATOM	2406	C	THR	B	16	1.736	30.206	26.395	1.00	7.73	C
ATOM	2407	O	THR	B	16	1.955	31.388	26.349	1.00	6.63	O
ATOM	2408	N	TYR	B	17	2.408	29.398	27.172	1.00	10.27	N
ATOM	2410	CA	TYR	B	17	3.082	29.809	28.377	1.00	11.55	C
ATOM	2412	CB	TYR	B	17	2.524	29.271	29.697	1.00	11.67	C
ATOM	2415	CG	TYR	B	17	1.052	29.571	29.949	1.00	11.49	C
ATOM	2416	CD1	TYR	B	17	0.063	28.567	29.778	1.00	12.82	C
ATOM	2418	CE1	TYR	B	17	−1.313	28.791	30.003	1.00	11.99	C
ATOM	2420	CZ	TYR	B	17	−1.685	30.091	30.334	1.00	12.14	C
ATOM	2421	OH	TYR	B	17	−2.996	30.316	30.522	1.00	12.20	O
ATOM	2423	CE2	TYR	B	17	−0.737	31.122	30.513	1.00	12.43	C
ATOM	2425	CD2	TYR	B	17	0.635	30.828	30.373	1.00	11.40	C
ATOM	2427	C	TYR	B	17	4.538	29.590	28.297	1.00	11.47	C
ATOM	2428	O	TYR	B	17	5.234	30.053	29.222	1.00	11.44	O
ATOM	2429	N	HIS	B		18	5.004	28.864	27.292	1.00	12.19	N
ATOM	2431	CA	HIS	B		18	6.454	28.628	27.117	1.00	14.05	C
ATOM	2433	CB	HIS	B	18	7.244	29.935	26.791	1.00	17.67	C
ATOM	2436	CG	HIS	B		18	6.897	30.535	25.469	1.00	24.43	C
ATOM	2437	ND1	HIS	B		18	5.709	31.119	25.214	1.00	36.04	N
ATOM	2439	CE1	HIS	B		18	5.598	31.493	23.944	1.00	34.79	C
ATOM	2441	NE2	HIS	B		18	6.714	31.244	23.366	1.00	25.22	N
ATOM	2443	CD2	HIS	B		18	7.500	30.600	24.282	1.00	30.50	C
ATOM	2445	C	HIS	B		18	7.135	27.925	28.303	1.00	13.17	C
ATOM	2446	O	HIS	B		18	8.278	28.237	28.732	1.00	9.99	O
ATOM	2447	N	LYS	B	19	6.359	27.047	28.905	1.00	11.45	N
ATOM	2449	CA	LYS	B	19	6.879	26.163	29.940	1.00	15.06	C
ATOM	2451	CB	LYS	B	19	6.989	26.910	31.307	1.00	15.74	C
ATOM	2454	CG	LYS	B	19	5.637	27.434	31.872	1.00	18.65	C
ATOM	2457	CD	LYS	B	19	5.833	28.453	33.009	1.00	21.85	C
ATOM	2460	CE	LYS	B	19	4.569	28.960	33.644	1.00	24.72	C
ATOM	2463	NZ	LYS	B	19	4.799	29.547	35.077	1.00	28.63	N
ATOM	2467	C	LYS	B	19	5.897	25.010	30.086	1.00	12.64	C
ATOM	2468	O	LYS	B	19	4.781	25.064	29.648	1.00	13.23	O
ATOM	2469	N	LEU	B		20	6.335	23.888	30.616	1.00	13.20	N
ATOM	2471	CA	LEU	B	20	5.414	22.809	30.925	1.00	10.09	C
ATOM	2473	CB	LEU	B	20	6.204	21.566	31.307	1.00	11.80	C
ATOM	2476	CG	LEU	B		20	7.128	21.060	30.215	1.00	11.10	C
ATOM	2478	CD1	LEU	B		20	8.164	20.025	30.597	1.00	13.97	C
ATOM	2482	CD2	LEU	B	20	6.205	20.302	29.184	1.00	12.08	C
ATOM	2486	C	LEU	B	20	4.530	23.131	32.047	1.00	10.11	C
ATOM	2487	O	LEU	B		20	4.832	23.921	32.929	1.00	11.78	O
ATOM	2488	N	PRO	B	21	3.380	22.493	32.024	1.00	11.42	N
ATOM	2489	CA	PRO	B	21	2.484	22.546	33.162	1.00	11.59	C
ATOM	2491	CB	PRO	B	21	1.421	21.465	32.816	1.00	13.68	C
ATOM	2494	CG	PRO	B	21	1.603	21.065	31.465	1.00	15.49	C
ATOM	2497	CD	PRO	B	21	2.840	21.697	30.918	1.00	12.52	C
ATOM	2500	C	PRO	B	21	3.197	22.133	34.490	1.00	11.12	C
ATOM	2501	O	PRO	B	21	4.193	21.367	34.474	1.00	9.47	O
ATOM	2502	N	ASP	B	22	2.542	22.447	35.582	1.00	10.82	N
ATOM	2504	CA	ASP	B	22	3.111	22.219	36.896	1.00	16.29	C
ATOM	2506	CB	ASP	B	22	2.227	22.925	37.937	1.00	19.70	C
ATOM	2509	CG	ASP	B	22	2.415	24.383	37.824	1.00	25.42	C
ATOM	2510	OD1	ASP	B	22	1.646	25.091	38.504	1.00	28.81	O
ATOM	2511	OD2	ASP	B	22	3.315	24.931	37.119	1.00	25.63	O
ATOM	2512	C	ASP	B	22	3.273	20.786	37.356	1.00	15.34	C
ATOM	2513	O	ASP	B	22	3.754	20.552	38.484	1.00	16.59	O
ATOM	2514	N	ASN	B	23	2.590	19.898	36.633	1.00	13.56	N
ATOM	2516	CA	ASN	B	23	2.646	18.495	36.907	1.00	11.91	C
ATOM	2518	CB	ASN	B	23	1.416	17.759	36.509	1.00	12.29	C
ATOM	2521	CG	ASN	B	23	1.057	17.932	35.001	1.00	13.95	C
ATOM	2522	OD1	ASN	B	23	1.049	16.967	34.196	1.00	14.77	O
ATOM	2523	ND2	ASN	B	23	0.582	19.128	34.684	1.00	14.82	N
ATOM	2526	C	ASN	B	23	3.849	17.836	36.358	1.00	11.72	C
ATOM	2527	O	ASN	B	23	3.966	16.596	36.447	1.00	14.87	O
ATOM	2528	N	TYR	B	24	4.781	18.628	35.847	1.00	10.27	N
ATOM	2530	CA	TYR	B	24	5.980	18.036	35.240	1.00	10.75	C
ATOM	2532	CB	TYR	B	24	6.294	18.529	33.842	1.00	10.64	C
ATOM	2535	CG	TYR	B	24	5.428	17.929	32.790	1.00	10.75	C
ATOM	2536	CD1	TYR	B	24	5.774	16.719	32.234	1.00	9.86	C
ATOM	2538	CE1	TYR	B	24	4.897	16.041	31.364	1.00	10.65	C
ATOM	2540	CZ	TYR	B	24	3.750	16.640	31.010	1.00	9.17	C
ATOM	2541	OH	TYR	B	24	2.926	16.023	30.114	1.00	10.54	O
ATOM	2543	CE2	TYR	B	24	3.393	17.873	31.556	1.00	7.66	C
ATOM	2545	CD2	TYR	B	24	4.211	18.537	32.448	1.00	7.74	C
ATOM	2547	C	TYR	B	24	7.237	18.279	36.101	1.00	11.32	C
ATOM	2548	O	TYR	B	24	7.282	19.342	36.700	1.00	12.80	O
ATOM	2549	N	ILE	B	25	8.156	17.313	36.205	1.00	11.07	N
ATOM	2551	CA	ILE	B	25	9.469	17.534	36.882	1.00	11.11	C
ATOM	2553	CB	ILE	B	25	9.525	16.893	38.258	1.00	12.23	C
ATOM	2555	CG1	ILE	B	25	9.303	15.401	38.162	1.00	12.51	C
ATOM	2558	CD1	ILE	B	25	9.362	14.819	39.651	1.00	13.73	C
ATOM	2562	CG2	ILE	B	25	8.615	17.678	39.189	1.00	14.66	C
ATOM	2566	C	ILE	B	25	10.516	16.855	36.018	1.00	11.19	C
ATOM	2567	O	ILE	B	25	10.145	15.932	35.223	1.00	12.24	O
ATOM	2568	N	THR	B	26	11.731	17.382	36.073	1.00	11.68	N
ATOM	2570	CA	THR	B	26	12.787	16.862	35.229	1.00	13.65	C
ATOM	2572	CB	THR	B	26	14.052	17.739	35.301	1.00	14.60	C
ATOM	2574	OG1	THR	B	26	14.575	17.871	36.623	1.00	11.50	O
ATOM	2576	CG2	THR	B	26	13.809	19.193	34.703	1.00	15.85	C
ATOM	2580	C	THR	B	26	13.192	15.474	35.761	1.00	14.64	C
ATOM	2581	O	THR	B	26	12.920	15.113	36.936	1.00	12.25	O
ATOM	2582	N	LYS	B	27	14.006	14.793	34.963	1.00	11.43	N
ATOM	2584	CA	LYS	B	27	14.638	13.598	35.489	1.00	12.47	C
ATOM	2586	CB	LYS	B	27	15.419	12.810	34.447	1.00	14.64	C
ATOM	2589	CG	LYS	B	27	14.517	12.122	33.412	1.00	18.35	C
ATOM	2592	CD	LYS	B	27	15.265	11.145	32.477	1.00	19.42	C
ATOM	2595	CE	LYS	B	27	16.129	11.984	31.542	1.00	21.43	C
ATOM	2598	NZ	LYS	B	27	15.335	12.839	30.547	1.00	18.82	N
ATOM	2602	C	LYS	B	27	15.473	13.808	36.707	1.00	11.01	C
ATOM	2603	O	LYS	B	27	15.316	13.002	37.640	1.00	9.61	O
ATOM	2604	N	SER	B	28	16.387	14.758	36.704	1.00	10.20	N
ATOM	2606	CA	SER	B	28	17.128	15.013	37.953	1.00	11.99	C
ATOM	2608	CB	SER	B	28	18.136	16.166	38.038	1.00	14.58	C
ATOM	2611	OG	SER	B	28	18.647	16.119	36.754	1.00	19.83	O
ATOM	2613	C	SER	B	28	16.234	15.291	39.135	1.00	11.22	C
ATOM	2614	O	SER	B	28	16.524	14.831	40.264	1.00	10.00	O
ATOM	2615	N	GLU	B	29	15.239	16.103	38.896	1.00	10.23	N
ATOM	2617	CA	GLU	B	29	14.316	16.394	39.989	1.00	11.87	C
ATOM	2619	CB	GLU	B	29	13.293	17.461	39.653	1.00	15.30	C
ATOM	2622	CG	GLU	B	29	13.879	18.873	39.597	1.00	17.38	C
ATOM	2625	CD	GLU	B	29	12.942	19.806	38.872	1.00	19.55	C
ATOM	2626	OE1	GLU	B	29	13.272	21.005	38.905	1.00	23.69	O
ATOM	2627	OE2	GLU	B	29	11.953	19.376	38.212	1.00	19.38	O
ATOM	2628	C	GLU	B	29	13.540	15.156	40.499	1.00	10.57	C
ATOM	2629	O	GLU	B	29	13.466	15.001	41.690	1.00	10.87	O
ATOM	2630	N	ALA	B	30	13.102	14.234	39.664	1.00	8.31	N
ATOM	2632	CA	ALA	B	30	12.557	12.968	40.051	1.00	10.34	C
ATOM	2634	CB	ALA	B	30	11.966	12.319	38.860	1.00	10.98	C
ATOM	2638	C	ALA	B	30	13.604	12.060	40.741	1.00	10.90	C
ATOM	2639	O	ALA	B	30	13.222	11.576	41.816	1.00	10.18	O
ATOM	2640	N	GLN	B	31	14.870	11.974	40.286	1.00	12.79	N
ATOM	2642	CA	GLN	B	31	15.934	11.215	40.895	1.00	14.39	C
ATOM	2644	CB	GLN	B	31	17.277	11.212	40.156	1.00	19.96	C
ATOM	2647	CG	GLN	B	31	17.216	10.729	38.640	1.00	24.22	C
ATOM	2650	CD	GLN	B	31	18.537	10.673	37.723	1.00	28.13	C
ATOM	2651	OE1	GLN	B	31	19.059	11.660	37.122	1.00	29.70	O
ATOM	2652	NE2	GLN	B	31	18.981	9.434	37.520	1.00	28.68	N
ATOM	2655	C	GLN	B	31	16.083	11.788	42.279	1.00	13.00	C
ATOM	2656	O	GLN	B	31	16.267	10.994	43.172	1.00	11.92	O
ATOM	2657	N	ALA	B	32	15.955	13.100	42.484	1.00	12.98	N
ATOM	2659	CA	ALA	B	32	16.197	13.648	43.825	1.00	13.91	C
ATOM	2661	CB	ALA	B	32	16.409	15.140	43.846	1.00	15.00	C
ATOM	2665	C	ALA	B	32	15.136	13.268	44.853	1.00	13.28	C
ATOM	2666	O	ALA	B	32	15.340	13.205	46.067	1.00	14.55	O
ATOM	2667	N	LEU	B	33	13.983	12.906	44.331	1.00	13.14	N
ATOM	2669	CA	LEU	B	33	12.881	12.507	45.171	1.00	12.01	C
ATOM	2671	CB	LEU	B	33	11.565	12.938	44.511	1.00	13.86	C
ATOM	2674	CG	LEU	B	33	11.274	14.421	44.500	1.00	15.58	C
ATOM	2676	CD1	LEU	B	33	10.166	14.775	43.483	1.00	15.99	C
ATOM	2680	CD2	LEU	B	33	10.908	14.822	46.002	1.00	17.33	C
ATOM	2684	C	LEU	B	33	12.903	11.024	45.362	1.00	12.31	C
ATOM	2685	O	LEU	B	33	12.048	10.518	46.123	1.00	11.39	O
ATOM	2686	N	GLY	B	34	13.843	10.325	44.702	1.00	10.75	N
ATOM	2688	CA	GLY	B	34	14.004	8.877	44.841	1.00	11.57	C
ATOM	2691	C	GLY	B	34	13.539	7.995	43.709	1.00	13.21	C
ATOM	2692	O	GLY	B	34	13.566	6.772	43.704	1.00	11.37	O
ATOM	2693	N	TRP	B	35	13.097	8.673	42.658	1.00	12.54	N
ATOM	2695	CA	TRP	B	35	12.875	8.003	41.406	1.00	14.11	C
ATOM	2697	CB	TRP	B	35	12.401	8.916	40.272	1.00	13.66	C
ATOM	2700	CG	TRP	B	35	12.205	8.174	38.906	1.00	13.56	C
ATOM	2701	CD1	TRP	B	35	11.337	7.122	38.634	1.00	15.31	C
ATOM	2703	NE1	TRP	B	35	11.394	6.748	37.311	1.00	13.91	N
ATOM	2705	CE2	TRP	B	35	12.381	7.499	36.720	1.00	14.38	C
ATOM	2706	CD2	TRP	B	35	12.925	8.375	37.714	1.00	13.95	C
ATOM	2707	CE3	TRP	B	35	13.899	9.305	37.322	1.00	14.84	C
ATOM	2709	CZ3	TRP	B	35	14.410	9.260	36.029	1.00	13.69	C
ATOM	2711	CH2	TRP	B	35	13.893	8.324	35.067	1.00	13.19	C
ATOM	2713	CZ2	TRP	B	35	12.887	7.448	35.416	1.00	14.36	C
ATOM	2715	C	TRP	B	35	14.115	7.243	40.896	1.00	14.04	C
ATOM	2716	O	TRP	B	35	15.190	7.801	40.716	1.00	15.29	O
ATOM	2717	N	VAL	B	36	13.881	6.010	40.477	1.00	13.88	N
ATOM	2719	CA	VAL	B	36	14.938	5.224	39.851	1.00	15.14	C
ATOM	2721	CB	VAL	B	36	15.528	4.160	40.879	1.00	16.48	C
ATOM	2723	CG1	VAL	B	36	16.548	3.157	40.227	1.00	16.99	C
ATOM	2727	CG2	VAL	B	36	16.171	4.808	42.113	1.00	17.44	C
ATOM	2731	C	VAL	B	36	14.267	4.521	38.670	1.00	14.82	C
ATOM	2732	O	VAL	B	36	13.314	3.811	38.897	1.00	12.15	O
ATOM	2733	N	ALA	B	37	14.782	4.608	37.446	1.00	16.44	N
ATOM	2735	CA	ALA	B	37	14.068	3.997	36.306	1.00	18.37	C
ATOM	2737	CB	ALA	B	37	14.815	4.224	35.074	1.00	18.92	C
ATOM	2741	C	ALA	B	37	13.684	2.542	36.399	1.00	20.89	C
ATOM	2742	O	ALA	B	37	12.480	2.155	36.213	1.00	24.01	O
ATOM	2743	N	SER	B	38	14.664	1.698	36.699	1.00	22.10	N
ATOM	2745	CA	SER	B	38	14.283	0.259	36.837	1.00	22.69	C
ATOM	2747	CB	SER	B	38	15.559	−0.554	37.100	1.00	21.57	C
ATOM	2750	OG	SER	B	38	16.227	−0.185	38.313	1.00	22.63	O
ATOM	2752	C	SER	B	38	13.211	−0.060	37.961	1.00	22.94	C
ATOM	2753	O	SER	B	38	12.833	−1.217	38.223	1.00	22.63	O
ATOM	2754	N	LYS	B	39	12.802	0.929	38.751	1.00	20.18	N
ATOM	2756	CA	LYS	B	39	11.882	0.673	39.846	1.00	20.50	C
ATOM	2758	CB	LYS	B	39	12.320	1.320	41.183	1.00	21.23	C
ATOM	2761	CG	LYS	B	39	13.561	0.765	41.893	1.00	24.77	C
ATOM	2764	CD	LYS	B	39	13.538	1.201	43.423	1.00	28.33	C
ATOM	2767	CE	LYS	B	39	14.880	1.154	44.242	1.00	29.68	C
ATOM	2770	NZ	LYS	B	39	15.134	2.247	45.316	1.00	28.89	N
ATOM	2774	C	LYS	B	39	10.403	0.992	39.492	1.00	17.00	C
ATOM	2775	O	LYS	B	39	9.506	0.664	40.253	1.00	13.44	O
ATOM	2776	N	GLY	B	40	10.178	1.681	38.387	1.00	14.62	N
ATOM	2778	CA	GLY	B	40	8.861	2.155	37.995	1.00	13.91	C
ATOM	2781	C	GLY	B	40	8.100	2.925	39.085	1.00	14.90	C
ATOM	2782	O	GLY	B	40	6.841	2.864	39.180	1.00	13.49	O
ATOM	2783	N	ASN	B	41	8.846	3.662	39.919	1.00	12.54	N
ATOM	2785	CA	ASN	B	41	8.311	4.283	41.124	1.00	12.94	C
ATOM	2787	CB	ASN	B	41	9.245	3.914	42.277	1.00	12.00	C
ATOM	2790	CG	ASN	B	41	10.602	4.641	42.160	1.00	11.23	C
ATOM	2791	OD1	ASN	B	41	11.063	5.011	41.079	1.00	10.63	O
ATOM	2792	ND2	ASN	B	41	11.235	4.830	43.312	1.00	10.22	N
ATOM	2795	C	ASN	B	41	8.030	5.836	41.123	1.00	11.22	C
ATOM	2796	O	ASN	B	41	8.079	6.456	42.186	1.00	13.26	O
ATOM	2797	N	LEU	B	42	7.855	6.431	39.942	1.00	13.90	N
ATOM	2799	CA	LEU	B	42	7.820	7.901	39.808	1.00	13.55	C
ATOM	2801	CB	LEU	B	42	7.718	8.373	38.389	1.00	14.14	C
ATOM	2804	CG	LEU	B	42	7.483	9.856	38.161	1.00	13.84	C
ATOM	2806	CD1	LEU	B	42	8.631	10.589	38.839	1.00	14.77	C
ATOM	2810	CD2	LEU	B	42	7.361	10.199	36.694	1.00	15.89	C
ATOM	2814	C	LEU	B	42	6.595	8.359	40.621	1.00	12.12	C
ATOM	2815	O	LEU	B	42	6.728	9.265	41.412	1.00	11.43	O
ATOM	2816	N	ALA	B	43	5.458	7.694	40.471	1.00	15.11	N
ATOM	2818	CA	ALA	B	43	4.210	8.094	41.091	1.00	16.61	C
ATOM	2820	CB	ALA	B	43	3.000	7.567	40.368	1.00	16.87	C
ATOM	2824	C	ALA	B	43	4.147	7.827	42.567	1.00	16.65	C
ATOM	2825	O	ALA	B	43	3.317	8.440	43.242	1.00	15.47	O
ATOM	2826	N	ASP	B	44	5.027	6.965	43.055	1.00	18.19	N
ATOM	2828	CA	ASP	B	44	5.135	6.790	44.497	1.00	19.89	C
ATOM	2830	CB	ASP	B	44	5.853	5.480	44.884	1.00	24.16	C
ATOM	2833	CG	ASP	B	44	5.218	4.261	44.280	1.00	27.36	C
ATOM	2834	OD1	ASP	B	44	4.018	4.065	44.502	1.00	30.60	O
ATOM	2835	OD2	ASP	B	44	5.786	3.464	43.507	1.00	30.35	O
ATOM	2836	C	ASP	B	44	5.942	7.921	45.115	1.00	17.87	C
ATOM	2837	O	ASP	B	44	5.640	8.343	46.217	1.00	18.04	O
ATOM	2838	N	VAL	B	45	6.999	8.399	44.440	1.00	15.56	N
ATOM	2840	CA	VAL	B	45	7.785	9.445	45.099	1.00	12.84	C
ATOM	2842	CB	VAL	B	45	9.255	9.309	44.795	1.00	14.45	C
ATOM	2844	CG1	VAL	B	45	9.727	7.915	45.156	1.00	16.75	C
ATOM	2848	CG2	VAL	B	45	9.571	9.462	43.280	1.00	13.91	C
ATOM	2852	C	VAL	B	45	7.389	10.830	44.658	1.00	12.95	C
ATOM	2853	O	VAL	B	45	7.815	11.800	45.278	1.00	12.61	O
ATOM	2854	N	ALA	B	46	6.672	10.937	43.529	1.00	11.48	N
ATOM	2856	CA	ALA	B	46	6.202	12.235	43.022	1.00	13.03	C
ATOM	2858	CB	ALA	B	46	7.091	12.748	41.873	1.00	12.22	C
ATOM	2862	C	ALA	B	46	4.760	12.084	42.499	1.00	11.88	C
ATOM	2863	O	ALA	B	46	4.468	12.032	41.324	1.00	14.30	O
ATOM	2864	N	PRO	B	47	3.838	12.052	43.426	1.00	13.53	N
ATOM	2865	CA	PRO	B	47	2.496	11.645	43.052	1.00	14.04	C
ATOM	2867	CB	PRO	B	47	1.741	11.717	44.404	1.00	14.16	C
ATOM	2870	CG	PRO	B	47	2.822	11.473	45.404	1.00	15.19	C
ATOM	2873	CD	PRO	B	47	4.046	12.158	44.894	1.00	15.11	C
ATOM	2876	C	PRO	B	47	1.920	12.675	42.107	1.00	13.57	C
ATOM	2877	O	PRO	B	47	2.089	13.855	42.339	1.00	14.43	O
ATOM	2878	N	GLY	B	48	1.333	12.257	40.997	1.00	13.92	N
ATOM	2880	CA	GLY	B	48	0.699	13.206	40.107	1.00	11.07	C
ATOM	2883	C	GLY	B	48	1.615	13.814	39.081	1.00	12.05	C
ATOM	2884	O	GLY	B	48	1.148	14.637	38.248	1.00	14.31	O
ATOM	2885	N	LYS	B	49	2.915	13.550	39.263	1.00	9.92	N
ATOM	2887	CA	LYS	B	49	3.885	14.055	38.328	1.00	9.15	C
ATOM	2889	CB	LYS	B	49	5.107	14.440	39.118	1.00	8.77	C
ATOM	2892	CG	LYS	B	49	4.764	15.397	40.227	1.00	10.89	C
ATOM	2895	CD	LYS	B	49	4.328	16.788	39.963	1.00	13.20	C
ATOM	2898	CE	LYS	B	49	4.423	17.615	41.294	1.00	15.89	C
ATOM	2901	NZ	LYS	B	49	4.288	18.964	40.734	1.00	18.50	N
ATOM	2905	C	LYS	B	49	4.295	13.129	37.237	1.00	11.64	C
ATOM	2906	O	LYS	B	49	3.919	11.969	37.234	1.00	11.93	O
ATOM	2907	N	SER	B	50	4.798	13.760	36.175	1.00	13.66	N
ATOM	2909	CA	SER	B	50	5.296	13.128	34.984	1.00	12.63	C
ATOM	2911	CB	SER	B	50	4.473	13.411	33.703	1.00	12.14	C
ATOM	2914	OG	SER	B	50	3.118	12.953	33.793	1.00	9.72	O
ATOM	2916	C	SER	B	50	6.698	13.748	34.777	1.00	13.09	C
ATOM	2917	O	SER	B	50	6.917	14.924	35.064	1.00	10.65	O
ATOM	2918	N	ILE	B	51	7.584	12.935	34.212	1.00	10.44	N
ATOM	2920	CA	ILE	B	51	8.850	13.427	33.834	1.00	11.52	C
ATOM	2922	CB	ILE	B	51	9.737	12.216	33.416	1.00	13.32	C
ATOM	2924	CG1	ILE	B	51	10.153	11.244	34.558	1.00	13.81	C
ATOM	2927	CD1	ILE	B	51	10.718	12.028	35.481	1.00	15.55	C
ATOM	2931	CG2	ILE	B	51	10.996	12.720	32.766	1.00	9.34	C
ATOM	2935	C	ILE	B	51	8.731	14.313	32.525	1.00	12.05	C
ATOM	2936	O	ILE	B	51	8.047	14.016	31.561	1.00	12.48	O
ATOM	2937	N	GLY	B	52	9.345	15.474	32.534	1.00	12.14	N
ATOM	2939	CA	GLY	B	52	9.413	16.324	31.357	1.00	11.66	C
ATOM	2942	C	GLY	B	52	10.335	17.490	31.576	1.00	12.77	C
ATOM	2943	O	GLY	B	52	10.646	17.884	32.723	1.00	10.85	O
ATOM	2944	N	GLY	B	53	10.697	18.089	30.445	1.00	10.59	N
ATOM	2946	CA	GLY	B	53	11.507	19.295	30.437	1.00	13.12	C
ATOM	2949	C	GLY	B	53	12.956	19.111	30.057	1.00	13.01	C
ATOM	2950	O	GLY	B	53	13.711	20.073	29.916	1.00	12.93	O
ATOM	2951	N	ASP	B	54	13.396	17.870	30.032	1.00	11.51	N
ATOM	2953	CA	ASP	B	54	14.787	17.675	29.793	1.00	13.36	C
ATOM	2955	CB	ASP	B	54	15.291	16.320	30.214	1.00	14.97	C
ATOM	2958	CG	ASP	B	54	15.028	16.059	31.664	1.00	17.99	C
ATOM	2959	OD1	ASP	B	54	15.442	16.921	32.461	1.00	17.16	O
ATOM	2960	OD2	ASP	B	54	14.309	15.092	32.022	1.00	16.58	O
ATOM	2961	C	ASP	B	54	15.066	17.807	28.306	1.00	14.77	C
ATOM	2962	O	ASP	B	54	14.227	17.691	27.416	1.00	12.24	O
ATOM	2963	N	ILE	B	55	16.316	18.144	28.050	1.00	13.38	N
ATOM	2965	CA	ILE	B	55	16.798	18.205	26.667	1.00	13.79	C
ATOM	2967	CB	ILE	B	55	18.301	18.698	26.674	1.00	13.55	C
ATOM	2969	CG1	ILE	B	55	18.318	20.169	27.096	1.00	14.46	C
ATOM	2972	CD1	ILE	B	55	18.098	21.020	25.908	1.00	17.36	C
ATOM	2976	CG2	ILE	B	55	19.033	18.502	25.271	1.00	13.32	C
ATOM	2980	C	ILE	B	55	16.757	16.887	25.926	1.00	13.67	C
ATOM	2981	O	ILE	B	55	17.117	15.856	26.515	1.00	11.34	O
ATOM	2982	N	PHE	B	56	16.372	16.956	24.652	1.00	12.37	N
ATOM	2984	CA	PHE	B	56	16.420	15.781	23.781	1.00	14.85	C
ATOM	2986	CB	PHE	B	56	15.066	15.540	23.131	1.00	14.98	C
ATOM	2989	CG	PHE	B	56	15.045	14.462	22.122	1.00	14.15	C
ATOM	2990	CD1	PHE	B	56	15.094	13.163	22.492	1.00	16.41	C
ATOM	2992	CE1	PHE	B	56	15.080	12.101	21.579	1.00	15.50	C
ATOM	2994	CZ	PHE	B	56	14.954	12.359	20.275	1.00	17.62	C
ATOM	2996	CE2	PHE	B	56	14.937	13.684	19.815	1.00	17.52	C
ATOM	2998	CD2	PHE	B	56	14.927	14.754	20.797	1.00	17.22	C
ATOM	3000	C	PHE	B	56	17.495	16.046	22.751	1.00	16.47	C
ATOM	3001	O	PHE	B	56	17.319	16.988	21.993	1.00	17.74	O
ATOM	3002	N	SER	B	57	18.612	15.311	22.739	1.00	16.03	N
ATOM	3004	CA	SER	B	57	19.710	15.647	21.856	1.00	19.63	C
ATOM	3006	CB	SER	B	57	20.865	14.712	22.157	1.00	21.92	C
ATOM	3009	OG	SER	B	57	20.198	13.480	21.883	1.00	28.28	O
ATOM	3011	C	SER	B	57	19.377	15.424	20.380	1.00	19.52	C
ATOM	3012	O	SER	B	57	20.000	16.032	19.536	1.00	19.22	O
ATOM	3013	N	ASN	B	58	18.403	14.613	19.985	1.00	19.47	N
ATOM	3015	CA	ASN	B	58	18.061	14.614	18.532	1.00	19.30	C
ATOM	3017	CB	ASN	B	58	17.625	15.998	17.965	1.00	16.59	C
ATOM	3020	CG	ASN	B	58	16.947	15.904	16.623	1.00	14.55	C
ATOM	3021	OD1	ASN	B	58	16.192	14.958	16.347	1.00	10.91	O
ATOM	3022	ND2	ASN	B	58	17.143	16.939	15.797	1.00	13.94	N
ATOM	3025	C	ASN	B	58	19.192	14.060	17.696	1.00	21.21	C
ATOM	3026	O	ASN	B	58	19.395	14.477	16.557	1.00	18.51	O
ATOM	3027	N	ARG	B	59	19.879	13.089	18.291	1.00	25.14	N
ATOM	3029	CA	ARG	B	59	21.127	12.526	17.763	1.00	29.09	C
ATOM	3031	CB	ARG	B	59	21.680	11.481	18.820	1.00	33.53	C
ATOM	3034	CG	ARG	B	59	22.910	11.914	19.812	1.00	37.93	C
ATOM	3037	CD	ARG	B	59	23.254	11.163	21.216	1.00	40.80	C
ATOM	3040	NE	ARG	B	59	22.131	10.714	22.100	1.00	43.15	N
ATOM	3042	CZ	ARG	B	59	21.898	10.960	23.418	1.00	44.23	C
ATOM	3043	NH1	ARG	B	59	22.695	11.724	24.163	1.00	44.03	N
ATOM	3046	NH2	ARG	B	59	20.789	10.467	23.981	1.00	44.52	N
ATOM	3049	C	ARG	B	59	20.826	11.953	16.339	1.00	27.38	C
ATOM	3050	O	ARG	B	59	21.563	12.155	15.376	1.00	24.38	O
ATOM	3051	N	GLU	B	60	19.714	11.230	16.180	1.00	26.08	N
ATOM	3053	CA	GLU	B	60	19.389	10.662	14.876	1.00	25.44	C
ATOM	3055	CB	GLU	B	60	18.314	9.610	15.037	1.00	28.90	C
ATOM	3058	CG	GLU	B	60	18.542	8.639	16.184	1.00	33.14	C
ATOM	3061	CD	GLU	B	60	17.717	7.366	16.041	1.00	36.08	C
ATOM	3062	OE1	GLU	B	60	16.456	7.363	16.154	1.00	38.14	O
ATOM	3063	OE2	GLU	B	60	18.366	6.340	15.766	1.00	40.88	O
ATOM	3064	C	GLU	B	60	18.962	11.652	13.795	1.00	21.86	C
ATOM	3065	O	GLU	B	60	18.647	11.282	12.668	1.00	20.52	O
ATOM	3066	N	GLY	B	61	18.749	12.897	14.174	1.00	17.18	N
ATOM	3068	CA	GLY	B	61	18.395	13.868	13.195	1.00	15.80	C
ATOM	3071	C	GLY	B	61	16.964	13.696	12.721	1.00	14.53	C
ATOM	3072	O	GLY	B	61	16.660	14.211	11.681	1.00	10.59	O
ATOM	3073	N	LYS	B	62	16.111	12.944	13.380	1.00	13.39	N
ATOM	3075	CA	LYS	B	62	14.725	12.841	12.896	1.00	16.33	C
ATOM	3077	CB	LYS	B	62	14.036	11.690	13.652	1.00	17.63	C
ATOM	3080	CG	LYS	B	62	14.428	10.354	13.017	1.00	19.36	C
ATOM	3083	CD	LYS	B	62	14.161	9.185	14.019	1.00	19.12	C
ATOM	3086	CE	LYS	B	62	14.686	7.875	13.322	1.00	19.49	C
ATOM	3089	NZ	LYS	B	62	14.351	6.710	14.216	1.00	16.20	N
ATOM	3093	C	LYS	B	62	13.829	14.062	13.083	1.00	16.26	C
ATOM	3094	O	LYS	B	62	12.833	14.214	12.382	1.00	16.49	O
ATOM	3095	N	LEU	B	63	14.135	14.915	14.054	1.00	13.74	N
ATOM	3097	CA	LEU	B	63	13.442	16.167	14.120	1.00	14.01	C
ATOM	3099	CB	LEU	B	63	13.322	16.685	15.525	1.00	13.34	C
ATOM	3102	CG	LEU	B	63	12.510	15.779	16.426	1.00	14.81	C
ATOM	3104	CD1	LEU	B	63	12.665	16.074	17.911	1.00	14.43	C
ATOM	3108	CD2	LEU	B	63	10.991	15.726	15.995	1.00	14.13	C
ATOM	3112	C	LEU	B	63	14.242	17.186	13.315	1.00	15.51	C
ATOM	3113	O	LEU	B	63	15.480	17.144	13.327	1.00	10.44	O
ATOM	3114	N	PRO	B	64	13.572	18.214	12.783	1.00	14.48	N
ATOM	3115	CA	PRO	B	64	14.317	19.202	12.007	1.00	16.32	C
ATOM	3117	CB	PRO	B	64	13.199	20.032	11.353	1.00	16.04	C
ATOM	3120	CG	PRO	B	64	12.037	19.914	12.287	1.00	17.22	C
ATOM	3123	CD	PRO	B	64	12.165	18.574	12.919	1.00	16.49	C
ATOM	3126	C	PRO	B	64	15.157	20.030	12.963	1.00	15.25	C
ATOM	3127	O	PRO	B	64	14.728	20.446	14.048	1.00	13.62	O
ATOM	3128	N	GLY	B	65	16.358	20.297	12.528	1.00	14.61	N
ATOM	3130	CA	GLY	B	65	17.285	21.088	13.297	1.00	15.69	C
ATOM	3133	C	GLY	B	65	17.804	22.369	12.670	1.00	15.21	C
ATOM	3134	O	GLY	B	65	17.764	22.459	11.472	1.00	14.39	O
ATOM	3135	N	LYS	B	66	18.119	23.404	13.447	1.00	10.95	N
ATOM	3137	CA	LYS	B	66	18.781	24.548	12.841	1.00	13.11	C
ATOM	3139	CB	LYS	B	66	17.791	25.562	12.322	1.00	12.82	C
ATOM	3142	CG	LYS	B	66	17.007	26.296	13.407	1.00	13.39	C
ATOM	3145	CD	LYS	B	66	16.013	27.309	12.776	1.00	13.95	C
ATOM	3148	CE	LYS	B	66	15.176	28.166	13.786	1.00	16.36	C
ATOM	3151	NZ	LYS	B	66	14.165	29.115	13.158	1.00	11.77	N
ATOM	3155	C	LYS	B	66	19.614	25.165	13.933	1.00	14.09	C
ATOM	3156	O	LYS	B	66	19.343	24.994	15.142	1.00	12.00	O
ATOM	3157	N	SER	B	67	20.616	25.912	13.509	1.00	14.90	N
ATOM	3159	CA	SER	B	67	21.466	26.548	14.492	1.00	15.76	C
ATOM	3161	CB	SER	B	67	22.546	27.250	13.640	1.00	20.81	C
ATOM	3164	OG	SER	B	67	22.716	28.501	14.270	1.00	25.41	O
ATOM	3166	C	SER	B	67	20.676	27.446	15.495	1.00	15.12	C
ATOM	3167	O	SER	B	67	19.716	28.121	15.161	1.00	12.04	O
ATOM	3168	N	GLY	B	68	21.006	27.309	16.780	1.00	14.59	N
ATOM	3170	CA	GLY	B	68	20.321	27.923	17.881	1.00	15.20	C
ATOM	3173	C	GLY	B	68	19.087	27.131	18.370	1.00	16.18	C
ATOM	3174	O	GLY	B	68	18.508	27.506	19.432	1.00	16.23	O
ATOM	3175	N	ARG	B	69	18.602	26.098	17.644	1.00	12.19	N
ATOM	3177	CA	ARG	B	69	17.300	25.498	18.109	1.00	11.38	C
ATOM	3179	CB	ARG	B	69	16.581	24.937	16.919	1.00	11.11	C
ATOM	3182	CG	ARG	B	69	15.380	24.063	17.328	1.00	10.07	C
ATOM	3185	CD	ARG	B	69	14.825	23.413	16.057	1.00	10.96	C
ATOM	3188	NE	ARG	B	69	13.998	24.352	15.316	1.00	11.66	N
ATOM	3190	CZ	ARG	B	69	13.644	24.264	14.049	1.00	11.42	C
ATOM	3191	NH1	ARG	B	69	14.074	23.229	13.293	1.00	13.20	N
ATOM	3194	NH2	ARG	B	69	12.965	25.285	13.515	1.00	12.11	N
ATOM	3197	C	ARG	B	69	17.612	24.241	18.979	1.00	11.99	C
ATOM	3198	O	ARG	B	69	18.424	23.428	18.567	1.00	12.40	O
ATOM	3199	N	THR	B	70	17.037	24.125	20.169	1.00	13.86	N
ATOM	3201	CA	THR	B	70	17.180	22.979	20.966	1.00	13.56	C
ATOM	3203	CB	THR	B	70	17.851	23.241	22.332	1.00	15.52	C
ATOM	3205	OG1	THR	B	70	17.244	24.348	22.902	1.00	18.34	O
ATOM	3207	CG2	THR	B	70	19.246	23.871	22.193	1.00	14.51	C
ATOM	3211	C	THR	B	70	15.853	22.374	21.154	1.00	14.51	C
ATOM	3212	O	THR	B	70	14.787	23.010	21.002	1.00	13.92	O
ATOM	3213	N	TRP	B	71	15.943	21.072	21.403	1.00	11.24	N
ATOM	3215	CA	TRP	B	71	14.698	20.359	21.574	1.00	10.75	C
ATOM	3217	CB	TRP	B	71	14.701	19.142	20.651	1.00	10.35	C
ATOM	3220	CG	TRP	B	71	14.455	19.476	19.315	1.00	9.15	C
ATOM	3221	CD1	TRP	B	71	15.385	19.661	18.348	1.00	10.42	C
ATOM	3223	NE1	TRP	B	71	14.764	19.960	17.162	1.00	8.90	N
ATOM	3225	CE2	TRP	B	71	13.405	19.886	17.349	1.00	9.90	C
ATOM	3226	CD2	TRP	B	71	13.176	19.664	18.707	1.00	8.92	C
ATOM	3227	CE3	TRP	B	71	11.850	19.587	19.162	1.00	8.43	C
ATOM	3229	CZ3	TRP	B	71	10.798	19.818	18.226	1.00	9.38	C
ATOM	3231	CH2	TRP	B	71	11.090	20.155	16.909	1.00	10.00	C
ATOM	3233	CZ2	TRP	B	71	12.402	20.134	16.460	1.00	10.24	C
ATOM	3235	C	TRP	B	71	14.522	19.900	23.013	1.00	11.11	C
ATOM	3236	O	TRP	B	71	15.525	19.432	23.608	1.00	12.14	O
ATOM	3237	N	ARG	B	72	13.281	19.824	23.522	1.00	8.93	N
ATOM	3239	CA	ARG	B	72	13.148	19.254	24.831	1.00	8.99	C
ATOM	3241	CB	ARG	B	72	12.781	20.436	25.772	1.00	10.59	C
ATOM	3244	CG	ARG	B	72	14.049	21.172	26.206	1.00	10.47	C
ATOM	3247	CD	ARG	B	72	13.698	22.350	27.185	1.00	13.16	C
ATOM	3250	NE	ARG	B	72	14.829	23.234	27.457	1.00	17.14	N
ATOM	3252	CZ	ARG	B	72	15.765	23.008	28.396	1.00	21.76	C
ATOM	3253	NH1	ARG	B	72	15.799	21.977	29.248	1.00	19.74	N
ATOM	3256	NH2	ARG	B	72	16.755	23.874	28.474	1.00	24.92	N
ATOM	3259	C	ARG	B	72	11.981	18.317	24.711	1.00	11.55	C
ATOM	3260	O	ARG	B	72	11.309	18.298	23.723	1.00	9.98	O
ATOM	3261	N	GLU	B	73	11.805	17.467	25.705	1.00	11.24	N
ATOM	3263	CA	GLU	B	73	10.800	16.416	25.686	1.00	11.94	C
ATOM	3265	CB	GLU	B	73	11.461	15.059	25.499	1.00	11.99	C
ATOM	3268	CG	GLU	B	73	12.550	14.639	26.507	1.00	12.70	C
ATOM	3271	CD	GLU	B	73	12.781	13.157	26.547	1.00	13.39	C
ATOM	3272	OE1	GLU	B	73	11.866	12.343	26.858	1.00	14.56	O
ATOM	3273	OE2	GLU	B	73	13.883	12.799	26.099	1.00	15.23	O
ATOM	3274	C	GLU	B	73	10.039	16.368	27.041	1.00	12.76	C
ATOM	3275	O	GLU	B	73	10.496	16.946	28.045	1.00	10.99	O
ATOM	3276	N	ALA	B	74	8.830	15.836	26.985	1.00	10.61	N
ATOM	3278	CA	ALA	B	74	8.102	15.625	28.176	1.00	9.54	C
ATOM	3280	CB	ALA	B	74	7.150	16.788	28.479	1.00	12.29	C
ATOM	3284	C	ALA	B	74	7.222	14.372	27.940	1.00	10.03	C
ATOM	3285	O	ALA	B	74	6.814	14.034	26.786	1.00	8.68	O
ATOM	3286	N	ASP	B	75	6.938	13.688	29.038	1.00	10.21	N
ATOM	3288	CA	ASP	B	75	6.139	12.457	28.976	1.00	10.00	C
ATOM	3290	CB	ASP	B	75	6.316	11.625	30.287	1.00	10.62	C
ATOM	3293	CG	ASP	B	75	7.582	10.826	30.281	1.00	11.53	C
ATOM	3294	OD1	ASP	B	75	8.535	11.138	29.497	1.00	10.00	O
ATOM	3295	OD2	ASP	B	75	7.689	9.813	31.005	1.00	8.42	O
ATOM	3296	C	ASP	B	75	4.694	12.806	28.893	1.00	10.82	C
ATOM	3297	O	ASP	B	75	4.156	13.698	29.619	1.00	10.82	O
ATOM	3298	N	ILE	B	76	4.017	12.065	28.004	1.00	10.07	N
ATOM	3300	CA	ILE	B	76	2.593	12.248	27.773	1.00	10.81	C
ATOM	3302	CB	ILE	B	76	2.402	12.577	26.295	1.00	11.34	C
ATOM	3304	CG1	ILE	B	76	3.067	13.908	25.924	1.00	11.79	C
ATOM	3307	CD1	ILE	B	76	2.244	15.072	26.633	1.00	9.59	C
ATOM	3311	CG2	ILE	B	76	0.913	12.450	25.934	1.00	11.30	C
ATOM	3315	C	ILE	B	76	1.899	10.939	28.162	1.00	11.44	C
ATOM	3316	O	ILE	B	76	2.447	9.834	28.008	1.00	12.67	O
ATOM	3317	N	ASN	B	77	0.671	11.137	28.634	1.00	11.47	N
ATOM	3319	CA	ASN	B	77	−0.308	10.132	28.985	1.00	11.42	C
ATOM	3321	CB	ASN	B	77	−0.718	9.193	27.842	1.00	10.13	C
ATOM	3324	CG	ASN	B	77	−1.413	9.887	26.689	1.00	10.02	C
ATOM	3325	OD1	ASN	B	77	−2.277	10.816	26.849	1.00	10.14	O
ATOM	3326	ND2	ASN	B	77	−1.086	9.387	25.484	1.00	5.55	N
ATOM	3329	C	ASN	B	77	0.203	9.321	30.171	1.00	10.23	C
ATOM	3330	O	ASN	B	77	−0.293	8.237	30.365	1.00	8.49	O
ATOM	3331	N	TYR	B	78	1.223	9.787	30.881	1.00	10.59	N
ATOM	3333	CA	TYR	B	78	1.713	9.110	32.078	1.00	10.50	C
ATOM	3335	CB	TYR	B	78	3.165	9.533	32.418	1.00	13.30	C
ATOM	3338	CG	TYR	B	78	3.677	8.796	33.651	1.00	11.64	C
ATOM	3339	CD1	TYR	B	78	4.238	7.543	33.513	1.00	9.95	C
ATOM	3341	CE1	TYR	B	78	4.523	6.798	34.604	1.00	10.12	C
ATOM	3343	CZ	TYR	B	78	4.536	7.399	35.866	1.00	13.58	C
ATOM	3344	OH	TYR	B	78	4.921	6.680	37.002	1.00	11.86	O
ATOM	3346	CE2	TYR	B	78	4.018	8.680	36.038	1.00	13.35	C
ATOM	3348	CD2	TYR	B	78	3.609	9.363	34.905	1.00	13.98	C
ATOM	3350	C	TYR	B	78	0.830	9.346	33.299	1.00	13.49	C
ATOM	3351	O	TYR	B	78	0.502	10.501	33.576	1.00	12.46	O
ATOM	3352	N	THR	B	79	0.501	8.269	34.029	1.00	15.53	N
ATOM	3354	CA	THR	B	79	−0.174	8.403	35.311	1.00	16.93	C
ATOM	3356	CB	THR	B	79	−1.630	7.862	35.308	1.00	19.69	C
ATOM	3358	OG1	THR	B	79	−1.566	6.566	34.809	1.00	22.41	O
ATOM	3360	CG2	THR	B	79	−2.524	8.426	34.198	1.00	20.10	C
ATOM	3364	C	THR	B	79	0.608	7.691	36.442	1.00	16.57	C
ATOM	3365	O	THR	B	79	0.936	8.345	37.437	1.00	17.72	O
ATOM	3366	N	SER	B	80	1.012	6.438	36.273	1.00	14.71	N
ATOM	3368	CA	SER	B	80	1.693	5.684	37.324	1.00	17.33	C
ATOM	3370	CB	SER	B	80	0.768	5.182	38.478	1.00	17.59	C
ATOM	3373	OG	SER	B	80	−0.117	4.227	37.922	1.00	16.70	O
ATOM	3375	C	SER	B	80	2.403	4.483	36.751	1.00	14.92	C
ATOM	3376	O	SER	B	80	2.137	4.104	35.610	1.00	16.85	O
ATOM	3377	N	GLY	B	81	3.424	4.035	37.455	1.00	11.29	N
ATOM	3379	CA	GLY	B	81	4.109	2.836	37.041	1.00	12.87	C
ATOM	3382	C	GLY	B	81	5.316	3.161	36.204	1.00	12.63	C
ATOM	3383	O	GLY	B	81	5.829	4.265	36.295	1.00	10.91	O
ATOM	3384	N	PHE	B	82	5.668	2.273	35.289	1.00	14.08	N
ATOM	3386	CA	PHE	B	82	6.868	2.483	34.496	1.00	15.62	C
ATOM	3388	CB	PHE	B	82	7.451	1.210	33.794	1.00	16.18	C
ATOM	3391	CG	PHE	B	82	8.098	0.281	34.762	1.00	16.15	C
ATOM	3392	CD1	PHE	B	82	9.459	0.374	35.054	1.00	16.99	C
ATOM	3394	CE1	PHE	B	82	9.997	−0.460	36.018	1.00	17.27	C
ATOM	3396	CZ	PHE	B	82	9.161	−1.307	36.716	1.00	17.12	C
ATOM	3398	CE2	PHE	B	82	7.825	−1.460	36.320	1.00	16.78	C
ATOM	3400	CD2	PHE	B	82	7.305	−0.598	35.425	1.00	16.65	C
ATOM	3402	C	PHE	B	82	6.430	3.554	33.479	1.00	15.75	C
ATOM	3403	O	PHE	B	82	5.176	3.654	33.215	1.00	13.08	O
ATOM	3404	N	ARG	B	83	7.447	4.202	32.872	1.00	14.73	N
ATOM	3406	CA	ARG	B	83	7.168	5.264	31.864	1.00	14.03	C
ATOM	3408	CB	ARG	B	83	8.423	6.104	31.539	1.00	14.15	C
ATOM	3411	CG	ARG	B	83	8.896	6.789	32.802	1.00	12.57	C
ATOM	3414	CD	ARG	B	83	10.241	7.476	32.590	1.00	12.77	C
ATOM	3417	NE	ARG	B	83	10.149	8.493	31.525	1.00	12.31	N
ATOM	3419	CZ	ARG	B	83	11.192	9.088	30.968	1.00	13.30	C
ATOM	3420	NH1	ARG	B	83	12.330	8.569	31.242	1.00	12.84	N
ATOM	3423	NH2	ARG	B	83	11.094	10.007	29.995	1.00	13.50	N
ATOM	3426	C	ARG	B	83	6.746	4.523	30.603	1.00	14.98	C
ATOM	3427	O	ARG	B	83	7.169	3.385	30.333	1.00	13.79	O
ATOM	3428	N	ASN	B	84	5.827	5.172	29.929	1.00	13.06	N
ATOM	3430	CA	ASN	B	84	5.339	4.760	28.643	1.00	11.13	C
ATOM	3432	CB	ASN	B	84	3.862	5.136	28.564	1.00	9.88	C
ATOM	3435	CG	ASN	B	84	3.674	6.630	28.364	1.00	9.84	C
ATOM	3436	OD1	ASN	B	84	4.576	7.309	27.879	1.00	7.46	O
ATOM	3437	ND2	ASN	B	84	2.519	7.159	28.767	1.00	6.81	N
ATOM	3440	C	ASN	B	84	6.196	5.228	27.438	1.00	11.63	C
ATOM	3441	O	ASN	B	84	7.363	5.692	27.557	1.00	9.56	O
ATOM	3442	N	SER	B	85	5.646	5.064	26.239	1.00	8.08	N
ATOM	3444	CA	SER	B	85	6.395	5.370	25.021	1.00	11.21	C
ATOM	3446	CB	SER	B	85	6.078	4.253	23.981	1.00	11.13	C
ATOM	3449	OG	SER	B	85	6.861	3.227	24.572	1.00	16.57	O
ATOM	3451	C	SER	B	85	5.939	6.686	24.380	1.00	11.05	C
ATOM	3452	O	SER	B	85	6.348	7.024	23.288	1.00	12.31	O
ATOM	3453	N	ASP	B	86	5.041	7.414	25.025	1.00	12.04	N
ATOM	3455	CA	ASP	B	86	4.571	8.722	24.546	1.00	12.16	C
ATOM	3457	CB	ASP	B	86	3.114	8.874	24.995	1.00	14.37	C
ATOM	3460	CG	ASP	B	86	2.139	7.826	24.420	1.00	14.78	C
ATOM	3461	OD1	ASP	B	86	2.352	7.224	23.339	1.00	13.22	O
ATOM	3462	OD2	ASP	B	86	0.980	7.698	24.922	1.00	14.32	O
ATOM	3463	C	ASP	B	86	5.378	9.959	25.004	1.00	12.30	C
ATOM	3464	O	ASP	B	86	5.651	10.258	26.176	1.00	8.45	O
ATOM	3465	N	ARG	B	87	5.768	10.782	24.048	1.00	9.98	N
ATOM	3467	CA	ARG	B	87	6.458	11.956	24.434	1.00	11.52	C
ATOM	3469	CB	ARG	B	87	7.965	11.817	24.224	1.00	10.41	C
ATOM	3472	CG	ARG	B	87	8.570	10.637	24.919	1.00	10.56	C
ATOM	3475	CD	ARG	B	87	8.766	10.836	26.460	1.00	11.53	C
ATOM	3478	NE	ARG	B	87	9.441	9.647	26.971	1.00	15.77	N
ATOM	3480	CZ	ARG	B	87	8.853	8.594	27.512	1.00	15.46	C
ATOM	3481	NH1	ARG	B	87	7.551	8.577	27.527	1.00	14.29	N
ATOM	3484	NH2	ARG	B	87	9.539	7.514	27.917	1.00	16.26	N
ATOM	3487	C	ARG	B	87	6.017	13.076	23.494	1.00	12.84	C
ATOM	3488	O	ARG	B	87	5.953	12.916	22.285	1.00	10.06	O
ATOM	3489	N	ILE	B	88	5.998	14.277	24.058	1.00	11.60	N
ATOM	3491	CA	ILE	B	88	5.895	15.516	23.290	1.00	19.61	C
ATOM	3493	CB	ILE	B	88	4.870	16.429	24.022	1.00	12.82	C
ATOM	3495	CG1	ILE	B	88	4.509	17.594	23.128	1.00	15.21	C
ATOM	3498	CD1	ILE	B	88	3.329	18.393	23.515	1.00	17.41	C
ATOM	3502	CG2	ILE	B	88	5.283	16.835	25.342	1.00	13.80	C
ATOM	3506	C	ILE	B	88	7.320	16.076	23.152	1.00	10.33	C
ATOM	3507	O	ILE	B	88	8.086	16.084	24.108	1.00	10.89	O
ATOM	3508	N	LEU	B	89	7.641	16.574	21.972	1.00	7.50	N
ATOM	3510	CA	LEU	B	89	8.899	17.219	21.665	1.00	10.76	C
ATOM	3512	CB	LEU	B	89	9.582	16.550	20.473	1.00	11.08	C
ATOM	3515	CG	LEU	B	89	10.371	15.310	20.923	1.00	15.57	C
ATOM	3517	CD1	LEU	B	89	9.513	14.253	21.509	1.00	16.83	C
ATOM	3521	CD2	LEU	B	89	11.614	15.587	21.738	1.00	14.08	C
ATOM	3525	C	LEU	B	89	8.605	18.664	21.313	1.00	10.88	C
ATOM	3526	O	LEU	B	89	7.825	18.955	20.448	1.00	14.16	O
ATOM	3527	N	TYR	B	90	9.384	19.561	21.879	1.00	12.66	N
ATOM	3529	CA	TYR	B	90	9.184	20.975	21.689	1.00	11.30	C
ATOM	3531	CB	TYR	B	90	8.419	21.593	22.845	1.00	7.36	C
ATOM	3534	CG	TYR	B	90	8.855	21.506	24.237	1.00	8.59	C
ATOM	3535	CD1	TYR	B	90	8.753	20.356	24.947	1.00	11.37	C
ATOM	3537	CE1	TYR	B	90	9.142	20.289	26.252	1.00	10.53	C
ATOM	3539	CZ	TYR	B	90	9.662	21.424	26.890	1.00	11.48	C
ATOM	3540	OH	TYR	B	90	10.100	21.305	28.179	1.00	12.87	O
ATOM	3542	CE2	TYR	B	90	9.917	22.587	26.157	1.00	10.68	C
ATOM	3544	CD2	TYR	B	90	9.482	22.600	24.856	1.00	11.87	C
ATOM	3546	C	TYR	B	90	10.506	21.669	21.549	1.00	9.65	C
ATOM	3547	O	TYR	B	90	11.449	21.401	22.255	1.00	10.81	O
ATOM	3548	N	SER	B	91	10.542	22.570	20.573	1.00	9.62	N
ATOM	3550	CA	SER	B	91	11.779	23.283	20.183	1.00	9.56	C
ATOM	3552	CB	SER	B	91	11.885	23.361	18.667	1.00	7.45	C
ATOM	3555	OG	SER	B	91	10.990	24.322	18.077	1.00	11.78	O
ATOM	3557	C	SER	B	91	11.825	24.653	20.865	1.00	9.77	C
ATOM	3558	O	SER	B	91	10.806	25.180	21.252	1.00	10.48	O
ATOM	3559	N	SER	B	92	12.985	25.262	20.857	1.00	9.65	N
ATOM	3561	CA	SER	B	92	13.204	26.591	21.398	1.00	12.16	C
ATOM	3563	CB	SER	B	92	14.709	26.982	21.486	1.00	13.12	C
ATOM	3566	OG	SER	B	92	15.548	26.350	20.538	1.00	14.59	O
ATOM	3568	C	SER	B	92	12.576	27.644	20.544	1.00	11.62	C
ATOM	3569	O	SER	B	92	12.301	28.677	21.116	1.00	16.48	O
ATOM	3570	N	ASP	B	93	12.147	27.359	19.324	1.00	12.20	N
ATOM	3572	CA	ASP	B	93	11.293	28.188	18.525	1.00	12.09	C
ATOM	3574	CB	ASP	B	93	11.975	28.503	17.199	1.00	14.08	C
ATOM	3577	CG	ASP	B	93	12.197	27.261	16.309	1.00	16.23	C
ATOM	3578	OD1	ASP	B	93	12.367	26.109	16.806	1.00	12.90	O
ATOM	3579	OD2	ASP	B	93	12.125	27.398	15.051	1.00	17.42	O
ATOM	3580	C	ASP	B	93	9.817	27.694	18.452	1.00	12.38	C
ATOM	3581	O	ASP	B	93	8.979	28.180	17.657	1.00	14.03	O
ATOM	3582	N	TRP	B	94	9.488	26.774	19.347	1.00	10.13	N
ATOM	3584	CA	TRP	B	94	8.143	26.320	19.634	1.00	11.78	C
ATOM	3586	CB	TRP	B	94	7.312	27.516	20.139	1.00	10.64	C
ATOM	3589	CG	TRP	B	94	7.947	28.062	21.403	1.00	9.63	C
ATOM	3590	CD1	TRP	B	94	8.580	29.206	21.514	1.00	10.05	C
ATOM	3592	NE1	TRP	B	94	9.136	29.332	22.769	1.00	10.83	N
ATOM	3594	CE2	TRP	B	94	8.827	28.239	23.524	1.00	12.03	C
ATOM	3595	CD2	TRP	B	94	8.153	27.354	22.674	1.00	11.33	C
ATOM	3596	CE3	TRP	B	94	7.634	26.176	23.225	1.00	12.54	C
ATOM	3598	CZ3	TRP	B	94	7.860	25.884	24.533	1.00	11.99	C
ATOM	3600	CH2	TRP	B	94	8.672	26.741	25.311	1.00	13.56	C
ATOM	3602	CZ2	TRP	B	94	9.146	27.922	24.840	1.00	13.00	C
ATOM	3604	C	TRP	B	94	7.386	25.540	18.572	1.00	12.51	C
ATOM	3605	O	TRP	B	94	6.141	25.744	18.387	1.00	12.94	O
ATOM	3606	N	LEU	B	95	8.149	24.826	17.774	1.00	10.29	N
ATOM	3608	CA	LEU	B	95	7.617	23.705	17.007	1.00	10.18	C
ATOM	3610	CB	LEU	B	95	8.689	23.029	16.168	1.00	9.75	C
ATOM	3613	CG	LEU	B	95	9.283	23.906	15.153	1.00	12.77	C
ATOM	3615	CD1	LEU	B	95	10.356	23.156	14.444	1.00	14.04	C
ATOM	3619	CD2	LEU	B	95	8.234	24.220	14.093	1.00	15.77	C
ATOM	3623	C	LEU	B	95	7.230	22.636	18.046	1.00	11.53	C
ATOM	3624	O	LEU	B	95	7.882	22.490	19.086	1.00	9.60	O
ATOM	3625	N	ILE	B	96	6.152	21.909	17.786	1.00	11.73	N
ATOM	3627	CA	ILE	B	96	5.683	20.822	18.656	1.00	7.10	C
ATOM	3629	CB	ILE	B	96	4.329	21.102	19.314	1.00	10.09	C
ATOM	3631	CG1	ILE	B	96	4.196	22.430	20.048	1.00	10.16	C
ATOM	3634	CD1	ILE	B	96	5.269	22.658	21.147	1.00	13.15	C
ATOM	3638	CG2	ILE	B	96	4.062	19.932	20.259	1.00	10.19	C
ATOM	3642	C	ILE	B	96	5.520	19.563	17.766	1.00	11.41	C
ATOM	3643	O	ILE	B	96	4.788	19.544	16.705	1.00	10.52	O
ATOM	3644	N	TYR	B	97	6.191	18.500	18.209	1.00	9.29	N
ATOM	3646	CA	TYR	B	97	6.092	17.186	17.649	1.00	10.84	C
ATOM	3648	CB	TYR	B	97	7.387	16.767	17.041	1.00	11.78	C
ATOM	3651	CG	TYR	B	97	7.812	17.398	15.692	1.00	8.80	C
ATOM	3652	CD1	TYR	B	97	8.072	18.744	15.580	1.00	7.50	C
ATOM	3654	CE1	TYR	B	97	8.426	19.267	14.297	1.00	10.82	C
ATOM	3656	CZ	TYR	B	97	8.496	18.470	13.186	1.00	9.25	C
ATOM	3657	OH	TYR	B	97	8.777	19.025	11.997	1.00	11.39	O
ATOM	3659	CE2	TYR	B	97	8.176	17.146	13.256	1.00	8.97	C
ATOM	3661	CD2	TYR	B	97	7.856	16.633	14.508	1.00	11.39	C
ATOM	3663	C	TYR	B	97	5.699	16.185	18.783	1.00	11.17	C
ATOM	3664	O	TYR	B	97	5.774	16.472	20.038	1.00	11.86	O
ATOM	3665	N	LYS	B	98	5.252	15.038	18.298	1.00	9.43	N
ATOM	3667	CA	LYS	B	98	4.912	13.885	19.152	1.00	8.78	C
ATOM	3669	CB	LYS	B	98	3.388	13.706	19.208	1.00	8.94	C
ATOM	3672	CG	LYS	B	98	2.805	13.227	17.865	1.00	8.95	C
ATOM	3675	CD	LYS	B	98	1.316	12.827	17.890	1.00	11.21	C
ATOM	3678	CE	LYS	B	98	0.869	11.736	18.861	1.00	9.75	C
ATOM	3681	NZ	LYS	B	98	−0.569	11.508	18.832	1.00	10.33	N
ATOM	3685	C	LYS	B	98	5.599	12.617	18.681	1.00	10.84	C
ATOM	3686	O	LYS	B	98	5.933	12.460	17.487	1.00	11.21	O
ATOM	3687	N	THR	B	99	5.838	11.708	19.621	1.00	10.22	N
ATOM	3689	CA	THR	B	99	6.150	10.334	19.318	1.00	9.66	C
ATOM	3691	CB	THR	B	99	7.710	10.123	19.463	1.00	12.67	C
ATOM	3693	OG1	THR	B	99	8.050	8.733	19.259	1.00	14.62	O
ATOM	3695	CG2	THR	B	99	8.189	10.437	20.914	1.00	13.45	C
ATOM	3699	C	THR	B	99	5.340	9.493	20.252	1.00	10.54	C
ATOM	3700	O	THR	B	99	5.108	9.906	21.420	1.00	13.14	O
ATOM	3701	N	THR	B	100	4.784	8.413	19.688	1.00	11.05	N
ATOM	3703	CA	THR	B	100	4.122	7.347	20.395	1.00	10.71	C
ATOM	3705	CB	THR	B	100	2.688	7.046	19.838	1.00	12.11	C
ATOM	3707	OG1	THR	B	100	2.831	6.710	18.481	1.00	10.59	O
ATOM	3709	CG2	THR	B	100	1.831	8.385	19.771	1.00	9.70	C
ATOM	3713	C	THR	B	100	4.937	6.064	20.345	1.00	12.36	C
ATOM	3714	O	THR	B	100	4.463	5.051	20.882	1.00	9.43	O
ATOM	3715	N	ASP	B	101	6.147	6.064	19.768	1.00	11.48	N
ATOM	3717	CA	ASP	B	101	6.919	4.832	19.728	1.00	8.19	C
ATOM	3719	CB	ASP	B	101	6.931	4.333	18.253	1.00	9.42	C
ATOM	3722	CG	ASP	B	101	7.531	5.287	17.362	1.00	8.26	C
ATOM	3723	OD1	ASP	B	101	8.060	6.361	17.787	1.00	6.48	O
ATOM	3724	OD2	ASP	B	101	7.486	5.084	16.155	1.00	10.50	O
ATOM	3725	C	ASP	B	101	8.325	5.020	20.327	1.00	8.62	C
ATOM	3726	O	ASP	B	101	9.314	4.494	19.794	1.00	9.42	O
ATOM	3727	N	ALA	B	102	8.421	5.759	21.427	1.00	9.30	N
ATOM	3729	CA	ALA	B	102	9.684	5.959	22.146	1.00	8.92	C
ATOM	3731	CB	ALA	B	102	10.089	4.648	22.840	1.00	11.73	C
ATOM	3735	C	ALA	B	102	10.765	6.437	21.191	1.00	10.14	C
ATOM	3736	O	ALA	B	102	11.768	5.787	20.910	1.00	8.75	O
ATOM	3737	N	TYR	B	103	10.482	7.555	20.538	1.00	11.44	N
ATOM	3739	CA	TYR	B	103	11.508	8.278	19.720	1.00	11.53	C
ATOM	3741	CB	TYR	B	103	12.783	8.619	20.551	1.00	12.19	C
ATOM	3744	CG	TYR	B	103	12.597	8.999	22.025	1.00	12.00	C
ATOM	3745	CD1	TYR	B	103	12.282	10.315	22.398	1.00	13.42	C
ATOM	3747	CE1	TYR	B	103	12.129	10.692	23.733	1.00	10.35	C
ATOM	3749	CZ	TYR	B	103	12.307	9.737	24.714	1.00	12.04	C
ATOM	3750	OH	TYR	B	103	12.173	10.143	26.013	1.00	15.78	O
ATOM	3752	CE2	TYR	B	103	12.639	8.441	24.401	1.00	12.70	C
ATOM	3754	CD2	TYR	B	103	12.826	8.081	23.042	1.00	11.77	C
ATOM	3756	C	TYR	B	103	11.972	7.654	18.464	1.00	10.04	C
ATOM	3757	O	TYR	B	103	12.923	8.127	17.850	1.00	12.44	O
ATOM	3758	N	GLN	B	104	11.204	6.715	17.915	1.00	11.02	N
ATOM	3760	CA	GLN	B	104	11.661	6.200	16.655	1.00	11.75	C
ATOM	3762	CB	GLN	B	104	11.260	4.776	16.530	1.00	14.48	C
ATOM	3765	CG	GLN	B	104	11.996	3.789	17.446	1.00	18.18	C
ATOM	3768	CD	GLN	B	104	11.192	2.511	17.191	1.00	21.14	C
ATOM	3769	OE1	GLN	B	104	11.534	1.628	16.363	1.00	22.36	O
ATOM	3770	NE2	GLN	B	104	10.010	2.494	17.829	1.00	22.11	N
ATOM	3773	C	GLN	B	104	11.055	6.964	15.486	1.00	12.44	C
ATOM	3774	O	GLN	B	104	11.678	7.042	14.422	1.00	9.27	O
ATOM	3775	N	THR	B	105	9.805	7.402	15.648	1.00	10.73	N
ATOM	3777	CA	THR	B	105	9.231	8.256	14.622	1.00	12.47	C
ATOM	3779	CB	THR	B	105	8.302	7.521	13.660	1.00	12.84	C
ATOM	3781	OG1	THR	B	105	7.148	7.143	14.391	1.00	9.11	O
ATOM	3783	CG2	THR	B	105	8.971	6.206	13.051	1.00	13.18	C
ATOM	3787	C	THR	B	105	8.509	9.447	15.241	1.00	13.88	C
ATOM	3788	O	THR	B	105	8.150	9.366	16.412	1.00	10.75	O
ATOM	3789	N	PHE	B	106	8.458	10.577	14.513	1.00	11.94	N
ATOM	3791	CA	PHE	B	106	7.786	11.715	15.142	1.00	13.81	C
ATOM	3793	CB	PHE	B	106	8.804	12.815	15.394	1.00	12.48	C
ATOM	3796	CG	PHE	B	106	9.843	12.441	16.370	1.00	10.42	C
ATOM	3797	CD1	PHE	B	106	9.657	12.688	17.722	1.00	10.90	C
ATOM	3799	CE1	PHE	B	106	10.547	12.287	18.640	1.00	12.22	C
ATOM	3801	CZ	PHE	B	106	11.703	11.615	18.228	1.00	12.53	C
ATOM	3803	CE2	PHE	B	106	11.879	11.316	16.847	1.00	10.73	C
ATOM	3805	CD2	PHE	B	106	10.956	11.764	15.949	1.00	9.20	C
ATOM	3807	C	PHE	B	106	6.734	12.247	14.183	1.00	12.03	C
ATOM	3808	O	PHE	B	106	6.966	12.165	13.011	1.00	12.66	O
ATOM	3809	N	THR	B	107	5.745	12.961	14.690	1.00	10.03	N
ATOM	3811	CA	THR	B	107	4.715	13.610	13.897	1.00	12.09	C
ATOM	3813	CB	THR	B	107	3.327	12.936	14.011	1.00	10.99	C
ATOM	3815	OG1	THR	B	107	2.231	13.621	13.261	1.00	13.44	O
ATOM	3817	CG2	THR	B	107	3.534	11.546	13.696	1.00	6.47	C
ATOM	3821	C	THR	B	107	4.587	15.061	14.349	1.00	10.62	C
ATOM	3822	O	THR	B	107	4.529	15.328	15.516	1.00	11.81	O
ATOM	3823	N	LYS	B	108	4.675	15.981	13.414	1.00	8.19	N
ATOM	3825	CA	LYS	B	108	4.638	17.363	13.780	1.00	6.78	C
ATOM	3827	CB	LYS	B	108	4.980	18.239	12.589	1.00	6.97	C
ATOM	3830	CG	LYS	B	108	4.758	19.786	12.770	1.00	8.64	C
ATOM	3833	CD	LYS	B	108	5.346	20.499	11.468	1.00	10.24	C
ATOM	3836	CE	LYS	B	108	5.516	21.949	11.654	1.00	9.99	C
ATOM	3839	NZ	LYS	B	108	6.376	22.605	10.559	1.00	7.56	N
ATOM	3843	C	LYS	B	108	3.185	17.602	14.082	1.00	6.60	C
ATOM	3844	O	LYS	B	108	2.340	17.285	13.216	1.00	6.51	O
ATOM	3845	N	ILE	B	109	2.891	18.177	15.252	1.00	7.61	N
ATOM	3847	CA	ILE	B	109	1.503	18.514	15.573	1.00	8.50	C
ATOM	3849	CB	ILE	B	109	1.015	17.742	16.849	1.00	9.03	C
ATOM	3851	CG1	ILE	B	109	1.990	18.037	18.017	1.00	8.97	C
ATOM	3854	CD1	ILE	B	109	1.318	17.512	19.330	1.00	7.70	C
ATOM	3858	CG2	ILE	B	109	1.045	16.280	16.573	1.00	8.27	C
ATOM	3862	C	ILE	B	109	1.235	20.014	15.852	1.00	9.66	C
ATOM	3863	O	ILE	B	109	0.088	20.353	16.058	1.00	11.91	O
ATOM	3864	N	ARG	B	110	2.253	20.866	15.820	1.00	8.83	N
ATOM	3866	CA	ARG	B	110	2.081	22.304	15.741	1.00	10.67	C
ATOM	3868	CB	ARG	B	110	2.001	23.106	17.075	1.00	9.40	C
ATOM	3871	CG	ARG	B	110	1.019	22.512	18.056	1.00	10.12	C
ATOM	3874	CD	ARG	B	110	−0.428	22.908	17.699	1.00	10.77	C
ATOM	3877	NE	ARG	B	110	−1.329	22.540	18.795	1.00	11.62	N
ATOM	3879	CZ	ARG	B	110	−1.885	21.356	19.014	1.00	10.50	C
ATOM	3880	NH1	ARG	B	110	−1.591	20.279	18.255	1.00	11.81	N
ATOM	3883	NH2	ARG	B	110	−2.671	21.248	20.061	1.00	13.24	N
ATOM	3886	C	ARG	B	110	3.156	22.952	14.909	1.00	11.39	C
ATOM	3887	O	ARG	B	110	4.293	22.627	15.119	1.00	9.56	O
ATOM	3888	N	SER	B	111	2.761	23.904	14.047	1.00	17.56	N
ATOM	3890	CA	SER	B	111	3.817	24.837	13.596	1.00	18.65	C
ATOM	3892	CB	SER	B	111	3.127	25.831	12.616	1.00	22.08	C
ATOM	3895	OG	SER	B	111	2.761	25.073	11.470	1.00	26.67	O
ATOM	3897	C	SER	B	111	4.330	25.682	14.763	1.00	19.94	C
ATOM	3898	O	SER	B	111	3.671	25.834	15.796	1.00	15.06	O
ATOM	3899	N	SER	B	112	5.413	26.431	14.518	1.00	16.03	N
ATOM	3901	CA	SER	B	112	5.894	27.372	15.454	1.00	16.28	C
ATOM	3903	CB	SER	B	112	7.111	28.164	14.987	1.00	17.02	C
ATOM	3906	OG	SER	B	112	7.529	29.153	15.859	1.00	20.34	O
ATOM	3908	C	SER	B	112	4.787	28.364	15.753	1.00	16.25	C
ATOM	3909	O	SER	B	112	4.290	28.999	14.870	1.00	15.95	O
ATOM	3910	N	SER	B	113	4.640	28.635	17.041	1.00	16.88	N
ATOM	3912	CA	SER	B	113	3.731	29.682	17.470	1.00	17.97	C
ATOM	3914	CB	SER	B	113	3.003	29.096	18.670	1.00	17.19	C
ATOM	3917	OG	SER	B	113	3.823	28.684	19.766	1.00	16.21	O
ATOM	3919	C	SER	B	113	4.457	30.939	17.914	1.00	17.85	C
ATOM	3920	O	SER	B	113	3.821	31.813	18.516	1.00	14.91	O
ATOM	3921	N	MET	B	114	5.771	30.898	17.685	1.00	16.90	N
ATOM	3923	CA	MET	B	114	6.546	31.955	18.261	1.00	19.52	C
ATOM	3925	CB	MET	B	114	8.034	31.609	18.110	1.00	19.35	C
ATOM	3928	CG	MET	B	114	8.865	32.525	18.911	1.00	20.21	C
ATOM	3931	SD	MET	B	114	10.507	31.849	19.144	1.00	22.34	S
ATOM	3932	CE	MET	B	114	11.231	33.131	19.753	1.00	22.35	C
ATOM	3936	C	MET	B	114	6.240	33.293	17.655	1.00	14.52	C
ATOM	3937	O	MET	B	114	6.246	33.425	16.397	1.00	17.95	O
ATOM	3938	N	GLY	B	115	5.853	34.241	18.487	1.00	12.58	N
ATOM	3940	CA	GLY	B	115	5.367	35.478	17.896	1.00	10.36	C
ATOM	3943	C	GLY	B	115	3.889	35.607	17.733	1.00	10.90	C
ATOM	3944	O	GLY	B	115	3.455	36.659	17.290	1.00	9.54	O
ATOM	3945	N	VAL	B	116	3.106	34.578	18.070	1.00	8.88	N
ATOM	3947	CA	VAL	B	116	1.685	34.684	17.836	1.00	6.16	C
ATOM	3949	CB	VAL	B	116	1.192	33.347	17.222	1.00	8.93	C
ATOM	3951	CG1	VAL	B	116	−0.277	33.381	16.954	1.00	12.38	C
ATOM	3955	CG2	VAL	B	116	1.831	33.118	15.887	1.00	9.12	C
ATOM	3959	C	VAL	B	116	1.084	34.836	19.201	1.00	8.87	C
ATOM	3960	O	VAL	B	116	1.393	34.087	20.135	1.00	6.19	O
ATOM	3961	N	CYS	B	117	0.053	35.687	19.290	1.00	10.78	N
ATOM	3963	CA	CYS	B	117	−0.424	36.085	20.603	1.00	9.89	C
ATOM	3965	CB	CYS	B	117	−0.726	37.600	20.576	1.00	11.75	C
ATOM	3968	SG	CYS	B	117	−1.669	38.165	22.037	1.00	10.46	S
ATOM	3969	C	CYS	B	117	−1.676	35.307	21.025	1.00	11.58	C
ATOM	3970	O	CYS	B	117	−2.592	35.281	20.309	1.00	11.90	O
ATOM	3971	N	PRO	B	118	−1.677	34.581	22.146	1.00	12.58	N
ATOM	3972	CA	PRO	B	118	−2.804	33.780	22.592	1.00	13.53	C
ATOM	3974	CB	PRO	B	118	−2.317	33.153	23.909	1.00	13.68	C
ATOM	3977	CG	PRO	B	118	−0.851	33.125	23.783	1.00	13.54	C
ATOM	3980	CD	PRO	B	118	−0.466	34.285	22.923	1.00	12.24	C
ATOM	3983	C	PRO	B	118	−3.925	34.758	23.014	1.00	15.56	C
ATOM	3984	O	PRO	B	118	−3.691	35.809	23.599	1.00	11.88	O
ATOM	3985	N	LYS	B	119	−5.144	34.341	22.695	1.00	15.70	N
ATOM	3987	CA	LYS	B	119	−6.297	35.135	23.045	1.00	17.01	C
ATOM	3989	CB	LYS	B	119	−7.383	34.887	22.004	1.00	22.58	C
ATOM	3992	CG	LYS	B	119	−7.327	36.025	20.935	1.00	25.28	C
ATOM	3995	CD	LYS	B	119	−7.787	35.752	19.474	1.00	28.00	C
ATOM	3998	CE	LYS	B	119	−7.749	37.101	18.625	1.00	27.82	C
ATOM	4001	NZ	LYS	B	119	−9.270	37.120	18.547	1.00	33.30	N
ATOM	4005	C	LYS	B	119	−6.695	34.843	24.483	1.00	14.78	C
ATOM	4006	O	LYS	B	119	−7.488	33.952	24.745	1.00	14.72	O
ATOM	4007	N	ILE	B	120	−6.139	35.660	25.388	1.00	13.92	N
ATOM	4009	CA	ILE	B	120	−6.426	35.657	26.829	1.00	13.11	C
ATOM	4011	CB	ILE	B	120	−5.480	34.905	27.638	1.00	13.03	C
ATOM	4013	CG1	ILE	B	120	−5.391	33.465	27.084	1.00	13.72	C
ATOM	4016	CD1	ILE	B	120	−4.475	32.514	27.909	1.00	15.32	C
ATOM	4020	CG2	ILE	B	120	−5.836	35.055	29.195	1.00	13.02	C
ATOM	4024	C	ILE	B	120	−6.460	37.114	27.256	1.00	14.74	C
ATOM	4025	O	ILE	B	120	−5.460	37.769	27.127	1.00	13.53	O
ATOM	4026	N	ILE	B	121	−7.643	37.640	27.540	1.00	10.64	N
ATOM	4028	CA	LEU	B	121	−7.707	39.052	27.854	1.00	12.46	C
ATOM	4030	CB	LEU	B	121	−9.146	39.417	28.156	1.00	12.34	C
ATOM	4033	CG	LEU	B	121	−9.636	40.815	28.565	1.00	12.97	C
ATOM	4035	CD1	LEU	B	121	−9.438	41.591	27.278	1.00	13.00	C
ATOM	4039	CD2	LEU	B	121	−11.102	40.869	28.910	1.00	14.52	C
ATOM	4043	C	LEU	B	121	−6.882	39.419	29.071	1.00	11.66	C
ATOM	4044	O	LEU	B	121	−7.171	38.974	30.186	1.00	17.63	O
ATOM	4045	N	LYS	B	122	−6.036	40.414	28.943	1.00	12.56	N
ATOM	4047	CA	LYS	B	122	−5.174	40.807	30.076	1.00	12.21	C
ATOM	4049	CB	LYS	B	122	−3.875	39.996	29.854	1.00	14.60	C
ATOM	4052	CG	LYS	B	122	−2.683	40.335	30.676	1.00	18.10	C
ATOM	4055	CD	LYS	B	122	−3.084	40.179	32.127	1.00	20.56	C
ATOM	4058	CE	LYS	B	122	−1.789	40.064	32.976	1.00	23.92	C
ATOM	4061	NZ	LYS	B	122	−2.311	39.634	34.336	1.00	28.08	N
ATOM	4065	C	LYS	B	122	−4.898	42.321	29.881	1.00	11.03	C
ATOM	4066	O	LYS	B	122	−4.457	42.765	28.795	1.00	12.51	O
ATOM	4067	N	LYS	B	123	−4.977	43.071	30.962	1.00	9.09	N
ATOM	4069	CA	LYS	B	123	−4.695	44.494	30.960	1.00	10.54	C
ATOM	4071	CB	LYS	B	123	−5.098	45.144	32.316	1.00	13.28	C
ATOM	4074	CG	LYS	B	123	−6.591	45.411	32.338	1.00	18.06	C
ATOM	4077	CD	LYS	B	123	−7.163	46.077	33.657	1.00	19.84	C
ATOM	4080	CE	LYS	B	123	−8.710	46.448	33.621	1.00	21.27	C
ATOM	4083	NZ	LYS	B	123	−9.164	47.071	34.941	1.00	22.45	N
ATOM	4087	C	LYS	B	123	−3.165	44.612	30.948	1.00	11.75	C
ATOM	4088	O	LYS	B	123	−2.444	43.790	31.522	1.00	11.87	O
ATOM	4089	N	CYS	B	124	−2.678	45.719	30.408	1.00	10.18	N
ATOM	4091	CA	CYS	B	124	−1.269	45.987	30.396	1.00	8.52	C
ATOM	4093	CB	CYS	B	124	−0.601	45.310	29.211	1.00	9.48	C
ATOM	4096	SG	CYS	B	124	−1.433	45.749	27.654	1.00	10.30	S
ATOM	4097	C	CYS	B	124	−0.982	47.449	30.306	1.00	10.61	C
ATOM	4098	O	CYS	B	124	−1.829	48.242	29.905	1.00	9.26	O
ATOM	4099	N	ARG	B	125	0.284	47.748	30.607	1.00	11.40	N
ATOM	4101	CA	ARG	B	125	0.849	49.061	30.435	1.00	11.65	C
ATOM	4103	CB	ARG	B	125	1.347	49.611	31.780	1.00	15.50	C
ATOM	4106	CG	ARG	B	125	0.223	50.109	32.599	1.00	19.98	C
ATOM	4109	CD	ARG	B	125	0.813	50.748	33.851	1.00	24.00	C
ATOM	4112	NE	ARG	B	125	0.168	51.936	34.448	1.00	31.02	N
ATOM	4114	CZ	ARG	B	125	0.243	52.222	35.802	1.00	33.95	C
ATOM	4115	NH1	ARG	B	125	0.932	51.414	36.632	1.00	35.25	N
ATOM	4118	NH2	ARG	B	125	−0.328	53.293	36.385	1.00	34.45	N
ATOM	4121	C	ARG	B	125	1.984	48.994	29.427	1.00	9.67	C
ATOM	4122	O	ARG	B	125	2.250	49.965	28.726	1.00	10.41	O
ATOM	4123	N	ARG	B	126	2.688	47.872	29.345	1.00	7.73	N
ATOM	4125	CA	ARG	B	126	3.725	47.692	28.332	1.00	9.47	C
ATOM	4127	CB	ARG	B	126	5.117	48.052	29.000	1.00	12.34	C
ATOM	4130	CG	ARG	B	126	5.383	47.318	30.299	1.00	14.67	C
ATOM	4133	CD	ARG	B	126	6.628	47.869	31.019	1.00	15.55	C
ATOM	4136	NE	ARG	B	126	7.789	47.510	30.169	1.00	18.94	N
ATOM	4138	CZ	ARG	B	126	9.025	48.071	30.290	1.00	23.10	C
ATOM	4139	NH1	ARG	B	126	9.273	48.985	31.232	1.00	21.13	N
ATOM	4142	NH2	ARG	B	126	10.058	47.720	29.495	1.00	24.42	N
ATOM	4145	C	ARG	B	126	3.745	46.218	27.935	1.00	9.85	C
ATOM	4146	O	ARG	B	126	3.088	45.331	28.499	1.00	11.71	O
ATOM	4147	N	ASP	B	127	4.535	45.914	26.928	1.00	8.60	N
ATOM	4149	CA	ASP	B	127	4.497	44.553	26.371	1.00	9.89	C
ATOM	4151	CB	ASP	B	127	5.457	44.441	25.194	1.00	9.11	C
ATOM	4154	CG	ASP	B	127	5.114	45.420	24.054	1.00	11.38	C
ATOM	4155	OD1	ASP	B	127	4.013	46.027	24.051	1.00	7.79	O
ATOM	4156	OD2	ASP	B	127	5.990	45.632	23.156	1.00	9.54	O
ATOM	4157	C	ASP	B	127	4.814	43.402	27.338	1.00	8.70	C
ATOM	4158	O	ASP	B	127	4.234	42.332	27.204	1.00	6.87	O
ATOM	4159	N	SER	B	128	5.820	43.613	28.182	1.00	7.27	N
ATOM	4161	CA	SER	B	128	6.115	42.632	29.156	1.00	7.62	C
ATOM	4163	CB	SER	B	128	7.436	42.945	29.874	1.00	6.31	C
ATOM	4166	OG	SER	B	128	7.355	44.167	30.597	1.00	5.17	O
ATOM	4168	C	SER	B	128	5.031	42.266	30.191	1.00	7.45	C
ATOM	4169	O	SER	B	128	5.215	41.316	30.948	1.00	9.76	O
ATOM	4170	N	ASP	B	129	3.906	42.945	30.227	1.00	6.64	N
ATOM	4172	CA	ASP	B	129	2.845	42.526	31.076	1.00	5.36	C
ATOM	4174	CB	ASP	B	129	1.875	43.651	31.314	1.00	6.34	C
ATOM	4177	CG	ASP	B	129	2.481	44.812	32.036	1.00	6.51	C
ATOM	4178	OD1	ASP	B	129	2.069	45.984	31.794	1.00	8.78	O
ATOM	4179	OD2	ASP	B	129	3.267	44.674	32.939	1.00	6.56	O
ATOM	4180	C	ASP	B	129	2.032	41.489	30.333	1.00	6.90	C
ATOM	4181	O	ASP	B	129	1.201	40.847	30.961	1.00	9.35	O
ATOM	4182	N	CYS	B	130	2.361	41.241	29.064	1.00	8.72	N
ATOM	4184	CA	CYS	B	130	1.662	40.266	28.283	1.00	11.71	C
ATOM	4186	CB	CYS	B	130	1.347	40.888	26.943	1.00	9.14	C
ATOM	4189	SG	CYS	B	130	0.439	42.509	26.939	1.00	9.10	S
ATOM	4190	C	CYS	B	130	2.368	38.973	28.024	1.00	10.38	C
ATOM	4191	O	CYS	B	130	3.571	38.914	28.083	1.00	14.55	O
ATOM	4192	N	LEU	B	131	1.610	37.961	27.661	1.00	11.47	N
ATOM	4194	CA	LEU	B	131	2.153	36.691	27.206	1.00	12.37	C
ATOM	4196	CB	LEU	B	131	1.016	35.770	26.768	1.00	15.31	C
ATOM	4199	CG	LEU	B	131	0.146	35.345	27.951	1.00	16.72	C
ATOM	4201	CD1	LEU	B	131	−1.022	34.671	27.445	1.00	15.47	C
ATOM	4205	CD2	LEU	B	131	0.869	34.400	28.946	1.00	19.03	C
ATOM	4209	C	LEU	B	131	3.075	36.867	25.979	1.00	10.63	C
ATOM	4210	O	LEU	B	131	3.076	37.898	25.337	1.00	9.90	O
ATOM	4211	N	ALA	B	132	4.034	35.970	25.865	1.00	11.14	N
ATOM	4213	CA	ALA	B	132	4.919	35.829	24.726	1.00	8.75	C
ATOM	4215	CB	ALA	B	132	5.620	34.574	24.801	1.00	10.07	C
ATOM	4219	C	ALA	B	132	4.084	35.899	23.441	1.00	9.76	C
ATOM	4220	O	ALA	B	132	2.971	35.444	23.362	1.00	8.80	O
ATOM	4221	N	GLY	B	133	4.458	36.741	22.506	1.00	9.65	N
ATOM	4223	CA	GLY	B	133	3.751	36.937	21.247	1.00	10.68	C
ATOM	4226	C	GLY	B	133	2.702	38.018	21.306	1.00	12.09	C
ATOM	4227	O	GLY	B	133	2.216	38.349	20.251	1.00	9.81	O
ATOM	4228	N	CYS	B	134	2.450	38.606	22.488	1.00	12.02	N
ATOM	4230	CA	CYS	B	134	1.546	39.680	22.637	1.00	11.04	C
ATOM	4232	CB	CYS	B	134	0.570	39.306	23.730	1.00	12.03	C
ATOM	4235	SG	CYS	B	134	−0.369	37.779	23.515	1.00	12.63	S
ATOM	4236	C	CYS	B	134	2.277	40.964	23.014	1.00	9.59	C
ATOM	4237	O	CYS	B	134	3.365	41.040	23.589	1.00	7.88	O
ATOM	4238	N	VAL	B	135	1.627	42.040	22.604	1.00	9.26	N
ATOM	4240	CA	VAL	B	135	2.034	43.417	22.845	1.00	8.42	C
ATOM	4242	CB	VAL	B	135	2.512	44.137	21.572	1.00	9.70	C
ATOM	4244	CG1	VAL	B	135	3.695	43.379	21.044	1.00	7.35	C
ATOM	4248	CG2	VAL	B	135	1.409	44.224	20.498	1.00	10.12	C
ATOM	4252	C	VAL	B	135	0.863	44.238	23.405	1.00	10.16	C
ATOM	4253	O	VAL	B	135	−0.243	43.826	23.365	1.00	10.36	O
ATOM	4254	N	CYS	B	136	1.193	45.237	24.198	1.00	9.32	N
ATOM	4256	CA	CYS	B	136	0.230	46.046	24.823	1.00	8.81	C
ATOM	4258	CB	CYS	B	136	0.855	46.732	26.021	1.00	9.87	C
ATOM	4261	SG	CYS	B	136	−0.426	47.442	27.058	1.00	9.28	S
ATOM	4262	C	CYS	B	136	−0.286	47.049	23.783	1.00	6.94	C
ATOM	4263	O	CYS	B	136	0.375	47.951	23.242	1.00	8.86	O
ATOM	4264	N	GLY	B	137	−1.528	46.918	23.504	1.00	6.75	N
ATOM	4266	CA	GLY	B	137	−2.147	47.852	22.595	1.00	9.92	C
ATOM	4269	C	GLY	B	137	−2.508	49.229	23.168	1.00	10.96	C
ATOM	4270	O	GLY	B	137	−2.470	49.438	24.371	1.00	9.72	O
ATOM	4271	N	PRO	B	138	−2.984	50.143	22.297	1.00	11.07	N
ATOM	4272	CA	PRO	B	138	−3.165	51.514	22.722	1.00	10.23	C
ATOM	4274	CB	PRO	B	138	−3.533	52.322	21.450	1.00	12.09	C
ATOM	4277	CG	PRO	B	138	−3.656	51.346	20.402	1.00	12.93	C
ATOM	4280	CD	PRO	B	138	−3.292	49.940	20.879	1.00	10.42	C
ATOM	4283	C	PRO	B	138	−4.269	51.565	23.733	1.00	10.00	C
ATOM	4284	O	PRO	B	138	−4.374	52.585	24.375	1.00	8.95	O
ATOM	4285	N	ASN	B	139	−5.100	50.528	23.821	1.00	11.01	N
ATOM	4287	CA	ASN	B	139	−6.229	50.453	24.757	1.00	11.73	C
ATOM	4289	CB	ASN	B	139	−7.398	49.648	24.143	1.00	12.66	C
ATOM	4292	CG	ASN	B	139	−7.043	48.164	23.935	1.00	15.97	C
ATOM	4293	OD1	ASN	B	139	−5.850	47.792	23.628	1.00	17.55	O
ATOM	4294	ND2	ASN	B	139	−8.102	47.349	23.816	1.00	16.59	N
ATOM	4297	C	ASN	B	139	−5.851	49.894	26.113	1.00	11.34	C
ATOM	4298	O	ASN	B	139	−6.692	49.722	26.961	1.00	11.56	O
ATOM	4299	N	GLY	B	140	−4.580	49.571	26.321	1.00	11.16	N
ATOM	4301	CA	GLY	B	140	−4.135	49.044	27.588	1.00	11.37	C
ATOM	4304	C	GLY	B	140	−4.515	47.571	27.751	1.00	13.70	C
ATOM	4305	O	GLY	B	140	−4.560	47.091	28.894	1.00	11.23	O
ATOM	4306	N	PHE	B	141	−4.740	46.853	26.652	1.00	10.89	N
ATOM	4308	CA	PHE	B	141	−4.891	45.423	26.705	1.00	12.78	C
ATOM	4310	CB	PHE	B	141	−6.306	44.957	26.389	1.00	10.06	C
ATOM	4313	CG	PHE	B	141	−7.336	45.362	27.436	1.00	11.78	C
ATOM	4314	CD1	PHE	B	141	−7.711	44.504	28.471	1.00	7.36	C
ATOM	4316	CE1	PHE	B	141	−8.597	44.947	29.489	1.00	9.72	C
ATOM	4318	CZ	PHE	B	141	−9.128	46.180	29.446	1.00	12.47	C
ATOM	4320	CE2	PHE	B	141	−8.703	47.083	28.426	1.00	12.66	C
ATOM	4322	CD2	PHE	B	141	−7.866	46.658	27.409	1.00	11.40	C
ATOM	4324	C	PHE	B	141	−3.889	44.781	25.793	1.00	9.78	C
ATOM	4325	O	PHE	B	141	−3.560	45.224	24.695	1.00	12.17	O
ATOM	4326	N	CYS	B	142	−3.707	43.526	26.091	1.00	7.08	N
ATOM	4328	CA	CYS	B	142	−2.768	42.694	25.376	1.00	9.17	C
ATOM	4330	CB	CYS	B	142	−2.189	41.557	26.226	1.00	9.73	C
ATOM	4333	SG	CYS	B	142	−1.323	42.018	27.751	1.00	10.02	S
ATOM	4334	C	CYS	B	142	−3.320	42.140	24.095	1.00	9.02	C
ATOM	4335	O	CYS	B	142	−4.431	41.691	24.074	1.00	11.66	O
ATOM	4336	N	GLY	B	143	−2.562	42.134	23.011	1.00	9.08	N
ATOM	4338	CA	GLY	B	143	−3.060	41.566	21.754	1.00	10.12	C
ATOM	4341	C	GLY	B	143	−2.022	41.372	20.679	1.00	10.66	C
ATOM	4342	O	GLY	B	143	−0.853	41.535	21.057	1.00	6.24	O
ATOM	4343	N	SER	B	144	−2.373	40.993	19.468	1.00	10.91	N
ATOM	4345	CA	SER	B	144	−1.348	40.819	18.471	1.00	12.34	C
ATOM	4347	CB	SER	B	144	−1.704	40.101	17.211	1.00	14.54	C
ATOM	4350	OG	SER	B	144	−2.592	39.027	17.539	1.00	17.92	O
ATOM	4352	C	SER	B	144	−0.582	42.056	18.066	1.00	14.23	C
ATOM	4353	O	SER	B	144	−1.210	43.081	18.067	1.00	14.50	O
ATOM	4354	OXT	SER	B	144	0.614	42.013	17.708	1.00	13.17	O
ATOM	4355	S	SO4	X		1	−8.456	59.328	25.375	1.00	62.73	S
ATOM	4356	O1	SO4	X		1	−7.367	58.486	24.804	1.00	61.80	O
ATOM	4357	O2	SO4	X		1	−8.232	60.230	26.492	1.00	59.94	O
ATOM	4358	O3	SO4	X	1	−8.605	60.235	24.188	1.00	60.50	O
ATOM	4359	O4	SO4	X		1	−9.327	58.362	26.132	1.00	58.47	O
ATOM	4360	S	SO4	X		2	21.150	27.268	10.030	1.00	44.73	S
ATOM	4361	O1	SO4	X		2	22.620	27.325	10.129	1.00	45.48	O
ATOM	4362	O2	SO4	X		2	20.443	28.463	10.581	1.00	44.20	O
ATOM	4363	O3	SO4	X		2	20.634	27.169	8.666	1.00	44.34	O
ATOM	4364	O4	SO4	X	2	20.873	25.984	10.659	1.00	44.14	O
ATOM	4365	S	SO4	X	3	11.477	23.840	10.225	1.00	54.03	S
ATOM	4366	O1	SO4	X	3	12.992	23.747	10.387	1.00	52.64	O
ATOM	4367	O2	SO4	X		3	10.500	24.718	10.950	1.00	52.07	O
ATOM	4368	O3	SO4	X	3	11.312	24.727	9.071	1.00	55.72	O
ATOM	4369	O4	SO4	X	3	11.011	22.642	9.534	1.00	52.59	O
ATOM	4370	S	SO4	X		4	15.596	8.604	28.993	1.00	75.74	S
ATOM	4371	O1	SO4	X	4	16.683	9.569	29.222	1.00	76.36	O
ATOM	4372	O2	SO4	X	4	14.997	8.662	30.328	1.00	75.37	O
ATOM	4373	O3	SO4	X		4	14.478	8.820	28.043	1.00	74.08	O
ATOM	4374	O4	SO4	X		4	16.378	7.433	28.550	1.00	75.08	O
ATOM	4375	O5	PG4	X	100	12.072	43.213	7.525	1.00	39.50	O
ATOM	4377	C8	PG4	X	100	12.548	43.607	8.885	1.00	37.25	C
ATOM	4380	C7	PG4	X	100	11.817	43.689	10.251	1.00	33.81	C
ATOM	4383	O4	PG4	X	100	11.369	44.773	11.185	1.00	34.32	O
ATOM	4384	C6	PG4	X	100	9.889	44.956	11.391	1.00	24.12	C
ATOM	4387	C5	PG4	X	100	8.581	45.829	11.434	1.00	26.64	C
ATOM	4390	O3	PG4	X	100	7.471	45.386	10.455	1.00	29.66	O
ATOM	4391	C4	PG4	X	100	6.503	46.017	9.644	1.00	28.44	C
ATOM	4394	C3	PG4	X	100	5.903	45.321	8.386	1.00	30.07	C
ATOM	4397	O2	PG4	X	100	6.866	44.799	7.455	1.00	30.65	O
ATOM	4398	C2	PG4	X	100	6.761	43.940	6.323	1.00	32.24	C
ATOM	4401	C1	PG4	X	100	8.049	43.362	5.699	1.00	35.20	C
ATOM	4404	O1	PG4	X	100	8.996	44.184	4.980	1.00	36.32	O
ATOM	4406	O5	PG4	X	101	−8.880	40.691	20.549	1.00	42.26	O
ATOM	4408	C8	PG4	X	101	−9.332	39.861	19.445	1.00	37.50	C
ATOM	4411	C7	PG4	X	101	−10.060	40.099	18.098	1.00	36.74	C
ATOM	4414	O4	PG4	X	101	−9.381	39.225	17.139	1.00	35.25	O
ATOM	4415	C6	PG4	X	101	−9.588	38.588	15.865	1.00	37.24	C
ATOM	4418	C5	PG4	X	101	−8.334	38.332	15.007	1.00	38.38	C
ATOM	4421	O3	PG4	X	101	−7.427	37.351	15.506	1.00	40.25	O
ATOM	4422	C4	PG4	X	101	−6.369	36.662	14.847	1.00	42.96	C
ATOM	4425	C3	PG4	X	101	−5.678	35.666	15.803	1.00	44.49	C
ATOM	4428	O2	PG4	X	101	−4.238	35.808	16.035	1.00	47.79	O
ATOM	4429	C2	PG4	X	101	−3.655	35.990	17.344	1.00	47.22	C
ATOM	4432	C1	PG4	X	101	−4.649	36.586	18.393	1.00	46.24	C
ATOM	4435	O1	PG4	X	101	−4.356	37.565	19.404	1.00	39.61	O
ATOM	4437	O	HOH	W	1	0.000	58.790	14.540	0.50	11.72	O
ATOM	4440	O	HOH	W		2	0.000	24.853	14.540	0.50	12.82	O
ATOM	4443	O	HOH	W	3	5.569	8.132	30.455	1.00	18.15	O
ATOM	4446	O	HOH	W	4	4.308	30.482	21.389	1.00	18.25	O
ATOM	4449	O	HOH	W	5	10.470	13.439	29.078	1.00	19.96	O
ATOM	4452	O	HOH	W	6	10.334	71.418	15.207	1.00	20.56	O
ATOM	4455	O	HOH	W	7	12.261	35.986	13.669	1.00	17.17	O
ATOM	4458	O	HOH	W	8	8.715	36.629	25.110	1.00	18.41	O
ATOM	4461	O	HOH	W	9	−2.731	12.411	24.763	1.00	16.82	O
ATOM	4464	O	HOH	W	10	9.048	44.966	26.900	1.00	27.01	O
ATOM	4467	O	HOH	W	11	6.415	10.293	33.357	1.00	20.43	O
ATOM	4470	O	HOH	W	12	3.956	33.537	27.379	1.00	19.80	O
ATOM	4473	O	HOH	W	13	1.940	39.628	17.828	1.00	22.19	O
ATOM	4476	O	HOH	W	14	−1.947	16.381	18.388	1.00	15.41	O
ATOM	4479	O	HOH	W	15	2.281	12.528	31.170	1.00	16.86	O
ATOM	4482	O	HOH	W	16	13.356	11.260	29.109	1.00	30.83	O
ATOM	4485	O	HOH	W	17	13.419	59.715	28.278	1.00	20.40	O
ATOM	4488	O	HOH	W	18	9.109	68.562	12.889	1.00	19.53	O
ATOM	4491	O	HOH	W	19	20.514	43.163	16.705	1.00	35.54	O
ATOM	4494	O	HOH	W	20	11.132	68.532	31.061	1.00	21.92	O
ATOM	4497	O	HOH	W	21	10.592	50.742	22.338	1.00	19.02	O
ATOM	4500	O	HOH	W	22	5.729	58.346	14.919	1.00	20.60	O
ATOM	4503	O	HOH	W	23	6.395	47.767	25.855	1.00	21.74	O
ATOM	4506	O	HOH	W	24	−5.301	15.063	18.514	1.00	19.43	O
ATOM	4509	O	HOH	W	25	8.102	51.134	19.350	1.00	19.33	O
ATOM	4512	O	HOH	W	26	5.711	21.642	8.152	1.00	20.85	O
ATOM	4515	O	HOH	W	27	14.942	71.340	21.781	1.00	18.33	O
ATOM	4518	O	HOH	W	28	−7.820	61.894	18.143	1.00	22.35	O
ATOM	4521	O	HOH	W	29	12.150	15.157	30.288	1.00	23.42	O
ATOM	4524	O	HOH	W	30	15.645	73.649	26.582	1.00	24.21	O
ATOM	4527	O	HOH	W	31	27.619	71.256	33.365	1.00	28.16	O
ATOM	4530	O	HOH	W	32	11.082	30.951	10.399	1.00	27.41	O
ATOM	4533	O	HOH	W	33	5.396	8.177	16.702	1.00	19.60	O
ATOM	4536	O	HOH	W	34	5.838	58.094	28.696	1.00	27.76	O
ATOM	4539	O	HOH	W	35	−4.247	15.097	22.657	1.00	19.58	O
ATOM	4542	O	HOH	W	36	4.961	50.326	20.161	1.00	15.13	O
ATOM	4545	O	HOH	W	37	2.553	43.907	16.824	1.00	19.84	O
ATOM	4548	O	HOH	W	38	3.560	44.117	10.280	1.00	26.18	O
ATOM	4551	O	HOH	W	39	10.369	70.392	29.020	1.00	23.61	O
ATOM	4554	O	HOH	W	40	−4.440	61.433	32.419	1.00	32.08	O
ATOM	4557	O	HOH	W	41	5.516	52.935	20.837	1.00	15.86	O
ATOM	4560	O	HOH	W	42	−5.375	40.911	18.995	1.00	24.57	O
ATOM	4563	O	HOH	W	43	5.490	39.538	12.342	1.00	31.58	O
ATOM	4566	O	HOH	W	44	7.558	35.834	20.807	1.00	19.05	O
ATOM	4569	O	HOH	W	45	4.729	60.236	29.586	1.00	15.57	O
ATOM	4572	O	HOH	W	46	2.279	32.794	23.898	1.00	18.78	O
ATOM	4575	O	HOH	W	47	7.077	42.538	11.012	1.00	18.63	O
ATOM	4578	O	HOH	W	48	−1.052	10.367	16.178	1.00	28.44	O
ATOM	4581	O	HOH	W	49	1.958	57.209	15.560	1.00	22.98	O
ATOM	4584	O	HOH	W	50	18.613	78.830	29.537	1.00	23.72	O
ATOM	4587	O	HOH	W	51	3.528	15.368	44.050	1.00	29.21	O
ATOM	4590	O	HOH	W	52	−6.051	41.809	33.733	1.00	28.67	O
ATOM	4593	O	HOH	W	53	1.499	14.231	35.574	1.00	21.04	O
ATOM	4596	O	HOH	W	54	−4.121	67.336	15.091	1.00	22.73	O
ATOM	4599	O	HOH	W	55	−0.324	37.396	17.017	1.00	24.78	O
ATOM	4602	O	HOH	W	56	9.434	33.285	26.515	1.00	29.61	O
ATOM	4605	O	HOH	W	57	18.143	33.757	12.186	1.00	29.20	O
ATOM	4608	O	HOH	W	58	13.968	43.052	13.635	1.00	19.33	O
ATOM	4611	O	HOH	W	59	12.408	28.178	11.443	1.00	26.19	O
ATOM	4614	O	HOH	W	60	18.506	19.558	21.258	1.00	24.26	O
ATOM	4617	O	HOH	W	61	18.217	58.246	23.895	1.00	26.84	O
ATOM	4620	O	HOH	W	62	−1.232	38.434	27.190	1.00	22.02	O
ATOM	4623	O	HOH	W	63	4.995	69.915	14.221	1.00	20.73	O
ATOM	4626	O	HOH	W	64	5.965	33.589	21.250	1.00	16.38	O
ATOM	4629	O	HOH	W	65	5.460	68.539	10.698	1.00	22.04	O
ATOM	4632	O	HOH	W	66	3.600	33.068	21.336	1.00	20.02	O
ATOM	4635	O	HOH	W	67	19.422	69.743	22.196	1.00	20.58	O
ATOM	4638	O	HOH	W	68	−1.767	73.135	14.951	1.00	36.16	O
ATOM	4641	O	HOH	W	69	1.423	10.955	37.687	1.00	24.08	O
ATOM	4644	O	HOH	W	70	14.952	66.300	14.549	1.00	25.64	O
ATOM	4647	O	HOH	W	71	8.446	76.529	30.667	1.00	28.89	O
ATOM	4650	O	HOH	W	72	11.897	46.124	15.353	1.00	19.96	O
ATOM	4653	O	HOH	W	73	13.452	67.576	36.982	1.00	24.13	O
ATOM	4656	O	HOH	W	74	6.475	25.912	11.779	1.00	23.93	O
ATOM	4659	O	HOH	W	75	0.016	23.977	35.410	1.00	34.89	O
ATOM	4662	O	HOH	W	76	8.360	44.168	23.192	1.00	21.03	O
ATOM	4665	O	HOH	W	77	6.253	52.072	17.601	1.00	18.19	O
ATOM	4668	O	HOH	W	78	10.791	23.588	29.362	1.00	29.93	O
ATOM	4671	O	HOH	W	79	−0.729	47.967	15.636	1.00	24.15	O
ATOM	4674	O	HOH	W	80	−5.946	41.064	26.119	1.00	25.29	O
ATOM	4677	O	HOH	W	81	12.859	22.724	30.930	1.00	26.81	O
ATOM	4680	O	HOH	W	82	12.877	23.410	23.827	1.00	21.68	O
ATOM	4683	O	HOH	W	83	−0.579	45.550	17.331	1.00	19.14	O
ATOM	4686	O	HOH	W	84	12.717	45.547	17.915	1.00	18.82	O
ATOM	4689	O	HOH	W	85	4.653	54.216	29.700	1.00	27.98	O
ATOM	4692	O	HOH	W	86	8.433	5.156	37.077	1.00	22.40	O
ATOM	4695	O	HOH	W	87	−6.017	69.464	20.826	1.00	39.33	O
ATOM	4698	O	HOH	W	88	2.994	48.232	22.818	1.00	15.43	O
ATOM	4701	O	HOH	W	89	9.112	75.208	34.001	1.00	37.26	O
ATOM	4704	O	HOH	W	90	−0.072	73.879	18.702	1.00	33.81	O
ATOM	4707	O	HOH	W	91	−3.833	23.229	27.552	1.00	26.34	O
ATOM	4710	O	HOH	W	92	8.797	34.594	22.914	1.00	19.91	O
ATOM	4713	O	HOH	W	93	−5.093	38.811	23.433	1.00	26.55	O
ATOM	4716	O	HOH	W	94	3.630	46.545	13.630	1.00	20.19	O
ATOM	4719	O	HOH	W	95	12.956	75.740	24.756	1.00	17.89	O
ATOM	4722	O	HOH	W	96	−2.191	46.712	19.298	1.00	19.11	O
ATOM	4725	O	HOH	W	97	0.254	26.340	16.863	1.00	28.81	O
ATOM	4728	O	HOH	W	98	18.526	19.241	16.363	1.00	26.18	O
ATOM	4731	O	HOH	W	99	−1.153	25.253	20.015	1.00	25.87	O
ATOM	4734	O	HOH	W	100	18.488	22.025	16.032	1.00	33.45	O
ATOM	4737	O	HOH	W	101	17.029	78.337	21.107	1.00	24.35	O
ATOM	4740	O	HOH	W	102	9.100	17.423	9.981	1.00	25.36	O
ATOM	4743	O	HOH	W	103	13.927	80.205	30.359	1.00	32.23	O
ATOM	4746	O	HOH	W	104	16.562	30.601	12.293	1.00	31.46	O
ATOM	4749	O	HOH	W	105	0.233	75.590	20.523	1.00	22.05	O
ATOM	4752	O	HOH	W	106	5.911	74.458	14.901	1.00	34.42	O
ATOM	4755	O	HOH	W	107	−3.053	9.843	23.060	1.00	33.67	O
ATOM	4758	O	HOH	W	108	13.624	60.717	14.932	1.00	22.75	O
ATOM	4761	O	HOH	W	109	−11.385	35.553	17.771	1.00	25.06	O
ATOM	4764	O	HOH	W	110	9.197	52.364	11.557	1.00	33.98	O
ATOM	4767	O	HOH	W	111	15.172	64.468	37.267	1.00	34.40	O
ATOM	4770	O	HOH	W	112	3.808	9.889	15.981	1.00	32.38	O
ATOM	4773	O	HOH	W	113	3.113	38.346	15.162	1.00	28.61	O
ATOM	4776	O	HOH	W	114	10.293	33.312	10.568	1.00	36.43	O
ATOM	4779	O	HOH	W	115	17.095	48.164	10.932	1.00	31.46	O
ATOM	4782	O	HOH	W	116	0.976	52.541	28.901	1.00	28.51	O
ATOM	4785	O	HOH	W	117	−3.666	54.865	23.887	1.00	34.22	O
ATOM	4788	O	HOH	W	118	16.943	16.288	34.339	1.00	25.43	O
ATOM	4791	O	HOH	W	119	−10.149	64.450	29.311	1.00	32.72	O
ATOM	4794	O	HOH	W	120	19.689	59.775	21.082	1.00	26.63	O
ATOM	4797	O	HOH	W	121	−3.691	48.425	17.743	1.00	19.17	O
ATOM	4800	O	HOH	W	122	21.430	73.034	23.048	1.00	28.42	O
ATOM	4803	O	HOH	W	123	10.265	27.752	12.773	1.00	31.81	O
ATOM	4806	O	HOH	W	124	0.806	63.954	34.184	1.00	23.12	O
ATOM	4809	O	HOH	W	125	12.287	7.157	27.671	1.00	24.45	O
ATOM	4812	O	HOH	W	126	18.944	29.156	12.709	1.00	26.63	O
ATOM	4815	O	HOH	W	127	−7.243	66.210	21.853	1.00	29.41	O
ATOM	4818	O	HOH	W	128	−0.149	12.004	35.548	1.00	27.14	O
ATOM	4821	O	HOH	W	129	4.382	24.565	9.438	1.00	28.77	O
ATOM	4824	O	HOH	W	130	−3.342	25.747	27.914	1.00	29.86	O
ATOM	4827	O	HOH	W	131	−1.529	50.070	17.418	1.00	22.20	O
ATOM	4830	O	HOH	W	132	14.650	72.436	15.638	1.00	25.05	O
ATOM	4833	O	HOH	W	133	17.878	62.716	31.362	1.00	25.14	O
ATOM	4836	O	HOH	W	134	9.227	79.817	20.659	1.00	29.29	O
ATOM	4839	O	HOH	W	135	−3.314	37.852	25.395	1.00	23.68	O
ATOM	4842	O	HOH	W	136	0.000	73.500	14.540	0.50	41.45	O
ATOM	4845	O	HOH	W	137	4.068	51.191	26.923	1.00	23.45	O
ATOM	4848	O	HOH	W	138	20.008	71.988	20.726	1.00	27.68	O
ATOM	4851	O	HOH	W	139	13.234	5.847	32.263	1.00	26.27	O
ATOM	4854	O	HOH	W	140	21.749	63.563	28.203	1.00	39.60	O
ATOM	4857	O	HOH	W	141	−5.465	73.144	23.338	1.00	32.11	O
ATOM	4860	O	HOH	W	142	6.574	53.636	15.141	1.00	33.57	O
ATOM	4863	O	HOH	W	143	−4.638	57.202	19.896	1.00	36.81	O
ATOM	4866	O	HOH	W	144	23.482	65.349	22.878	1.00	40.79	O
ATOM	4869	O	HOH	W	145	0.000	36.784	14.540	0.50	36.06	O
ATOM	4872	O	HOH	W	146	11.619	25.587	27.445	1.00	38.30	O
ATOM	4875	O	HOH	W	147	3.678	0.181	34.918	1.00	35.60	O
ATOM	4878	O	HOH	W	148	−0.922	55.118	30.320	1.00	34.56	O
ATOM	4881	O	HOH	W	149	10.578	21.194	36.599	1.00	24.21	O
ATOM	4884	O	HOH	W	150	6.844	79.063	19.415	1.00	27.87	O
ATOM	4887	O	HOH	W	151	6.947	33.486	28.230	1.00	35.70	O
ATOM	4890	O	HOH	W	152	9.923	10.379	12.113	1.00	24.52	O
ATOM	4893	O	HOH	W	153	16.798	8.264	42.844	1.00	32.24	O
ATOM	4896	O	HOH	W	154	17.274	19.428	9.768	1.00	27.77	O
ATOM	4899	O	HOH	W	155	8.826	21.865	11.163	1.00	26.29	O
ATOM	4902	O	HOH	W	156	27.143	68.891	26.526	1.00	36.72	O
ATOM	4905	O	HOH	W	157	16.246	79.665	31.172	1.00	29.11	O
ATOM	4908	O	HOH	W	158	11.534	25.541	24.515	1.00	26.28	O
ATOM	4911	O	HOH	W	159	10.685	45.664	4.374	1.00	37.97	O
ATOM	4914	O	HOH	W	160	−5.673	61.783	21.945	1.00	24.53	O
ATOM	4917	O	HOH	W	161	22.240	79.362	26.912	1.00	29.20	O
ATOM	4920	O	HOH	W	162	0.803	5.435	33.148	1.00	26.13	O
ATOM	4923	O	HOH	W	163	2.950	3.896	25.431	1.00	32.10	O
ATOM	4926	O	HOH	W	164	8.803	73.744	14.259	1.00	34.41	O
ATOM	4929	O	HOH	W	165	18.289	18.636	29.961	1.00	28.63	O
ATOM	4932	O	HOH	W	166	−5.968	58.836	17.376	1.00	37.46	O
ATOM	4935	O	HOH	W	167	10.900	60.135	29.293	1.00	33.46	O
ATOM	4938	O	HOH	W	168	15.619	63.656	29.877	1.00	29.28	O
ATOM	4941	O	HOH	W	169	19.391	35.752	15.989	1.00	33.30	O
ATOM	4944	O	HOH	W	170	4.391	49.703	24.737	1.00	29.63	O
ATOM	4947	O	HOH	W	171	−3.594	71.525	30.335	1.00	41.73	O
ATOM	4950	O	HOH	W	172	9.494	60.912	37.398	1.00	38.36	O
ATOM	4953	O	HOH	W	173	−6.047	39.285	21.011	1.00	43.07	O
ATOM	4956	O	HOH	W	174	3.638	25.697	34.715	1.00	27.03	O
ATOM	4959	O	HOH	W	175	8.238	39.535	27.775	1.00	20.24	O
ATOM	4962	O	HOH	W	176	9.002	24.171	31.532	1.00	19.88	O
ATOM	4965	O	HOH	W	177	−1.497	9.498	20.373	1.00	28.11	O
ATOM	4968	O	HOH	W	178	6.540	52.061	12.149	1.00	28.41	O
ATOM	4971	O	HOH	W	179	17.795	51.254	16.536	1.00	28.05	O
ATOM	4974	O	HOH	W	180	23.668	63.439	29.730	1.00	34.47	O
ATOM	4977	O	HOH	W	181	13.724	58.071	15.406	1.00	28.65	O
ATOM	4980	O	HOH	W	182	1.468	63.179	36.696	1.00	37.17	O
ATOM	4983	O	HOH	W	183	−4.503	17.545	28.757	1.00	31.69	O
ATOM	4986	O	HOH	W	184	1.190	54.806	14.848	1.00	40.39	O
ATOM	4989	O	HOH	W	185	−5.451	48.707	30.980	1.00	47.15	O
ATOM	4992	O	HOH	W	186	26.237	64.077	25.969	1.00	34.48	O
ATOM	4995	O	HOH	W	187	4.495	59.364	32.171	1.00	47.06	O
ATOM	4998	O	HOH	W	188	18.371	17.436	12.446	1.00	31.73	O
ATOM	5001	O	HOH	W	189	−4.452	13.028	19.551	1.00	42.23	O
ATOM	5004	O	HOH	W	190	6.392	20.193	39.348	1.00	34.18	O
ATOM	5007	O	HOH	W	191	11.097	47.282	24.689	1.00	27.20	O
ATOM	5010	O	HOH	W	192	6.759	70.006	33.832	1.00	30.32	O
ATOM	5013	O	HOH	W	193	−5.313	55.974	21.971	1.00	37.30	O
ATOM	5016	O	HOH	W	194	11.186	33.502	23.735	1.00	31.59	O
ATOM	5019	O	HOH	W	195	5.132	39.962	25.444	1.00	26.14	O
ATOM	5022	O	HOH	W	196	15.843	61.406	28.650	1.00	37.75	O
ATOM	5025	O	HOH	W	197	6.121	49.560	11.474	1.00	19.12	O
ATOM	5028	O	HOH	W	198	−3.691	64.262	32.648	1.00	33.48	O
ATOM	5031	O	HOH	W	199	11.259	30.201	26.404	1.00	39.04	O
ATOM	5034	O	HOH	W	200	15.467	10.721	25.734	1.00	30.17	O
ATOM	5037	O	HOH	W	201	17.074	37.421	26.045	1.00	35.86	O
ATOM	5040	O	HOH	W	202	11.016	31.027	23.765	1.00	36.02	O
ATOM	5043	O	HOH	W	203	−7.480	39.258	24.530	1.00	29.90	O
ATOM	5046	O	HOH	W	204	20.829	20.177	22.398	1.00	31.08	O
ATOM	5049	O	HOH	W	205	12.637	77.832	32.808	1.00	35.88	O
ATOM	5052	O	HOH	W	206	0.194	9.694	40.528	1.00	37.33	O
ATOM	5055	O	HOH	W	207	−0.188	5.179	28.683	1.00	39.12	O
ATOM	5058	O	HOH	W	208	5.619	72.852	32.734	1.00	30.88	O
ATOM	5061	O	HOH	W	209	10.039	20.268	34.085	1.00	23.56	O
ATOM	5064	O	HOH	W	210	4.491	1.662	26.042	1.00	36.43	O
ATOM	5067	O	HOH	W	211	9.543	34.268	32.189	1.00	44.91	O
ATOM	5070	O	HOH	W	212	18.162	14.065	30.634	1.00	40.62	O
ATOM	5073	O	HOH	W	213	19.262	76.397	39.166	1.00	33.47	O
ATOM	5076	O	HOH	W	214	6.323	57.214	33.232	1.00	31.54	O
ATOM	5079	O	HOH	W	215	21.017	16.074	15.221	1.00	46.56	O
ATOM	5082	O	HOH	W	216	11.669	67.591	11.375	1.00	42.53	O
ATOM	5085	O	HOH	W	217	11.940	61.510	12.504	1.00	33.55	O
ATOM	5088	O	HOH	W	218	9.102	63.809	9.568	1.00	39.79	O
ATOM	5091	O	HOH	W	219	18.537	12.895	24.532	1.00	33.67	O
ATOM	5094	O	HOH	W	220	−3.399	32.781	31.853	1.00	42.62	O
ATOM	5097	O	HOH	W	221	19.656	30.684	9.101	1.00	30.56	O
ATOM	5100	O	HOH	W	222	−7.746	31.604	23.654	1.00	51.51	O
ATOM	5103	O	HOH	W	223	6.410	70.578	12.271	1.00	43.62	O
ATOM	5106	O	HOH	W	224	18.414	26.816	21.935	1.00	33.30	O
ATOM	5109	O	HOH	W	225	−4.562	73.658	18.557	1.00	40.27	O
ATOM	5112	O	HOH	W	226	1.834	45.214	14.792	1.00	33.35	O
ATOM	5115	O	HOH	W	227	−6.456	16.978	25.284	1.00	42.58	O
ATOM	5118	O	HOH	W	228	1.485	47.197	34.415	1.00	43.14	O
ATOM	5121	O	HOH	W	229	8.518	58.008	29.660	1.00	46.30	O
ATOM	5124	O	HOH	W	230	13.320	17.345	43.256	1.00	36.98	O
ATOM	5127	O	HOH	W	231	−2.219	27.551	21.949	1.00	36.33	O
ATOM	5130	O	HOH	W	232	20.763	34.788	14.546	1.00	43.67	O
ATOM	5133	O	HOH	W	233	25.392	78.634	37.424	1.00	50.95	O
ATOM	5136	O	HOH	W	234	29.860	76.534	27.279	1.00	28.22	O
ATOM	5139	O	HOH	W	235	8.669	29.399	11.804	1.00	41.52	O
ATOM	5142	O	HOH	W	236	18.163	30.488	20.723	1.00	54.55	O
ATOM	5145	O	HOH	W	237	26.581	79.924	33.310	1.00	41.69	O
ATOM	5148	O	HOH	W	238	−7.320	17.258	21.238	1.00	34.51	O
ATOM	5151	O	HOH	W	239	15.141	41.048	27.454	1.00	28.78	O
ATOM	5154	O	HOH	W	240	15.351	24.118	24.643	1.00	36.57	O
ATOM	5157	O	HOH	W	241	10.464	50.247	25.346	1.00	40.45	O
ATOM	5160	O	HOH	W	242	−7.555	20.139	21.792	1.00	33.87	O
ATOM	5163	O	HOH	W	243	−3.365	10.200	32.114	1.00	37.80	O
ATOM	5166	O	HOH	W	244	7.111	14.218	46.259	1.00	37.31	O
ATOM	5169	O	HOH	W	245	−0.497	7.203	22.295	1.00	35.75	O
ATOM	5172	O	HOH	W	246	5.000	4.810	39.815	1.00	26.98	O
ATOM	5175	O	HOH	W	247	7.136	49.342	8.646	1.00	26.65	O
ATOM	5178	O	HOH	W	248	−5.792	22.456	25.116	1.00	32.36	O
ATOM	5181	O	HOH	W	249	16.203	12.016	16.320	1.00	31.39	O
ATOM	5184	O	HOH	W	250	−4.880	16.340	30.695	1.00	42.96	O
ATOM	5187	O	HOH	W	251	5.949	42.046	22.980	1.00	36.30	O
ATOM	5190	O	HOH	W	252	0.573	29.971	34.228	1.00	47.16	O
ATOM	5193	O	HOH	W	253	−0.987	29.373	20.834	1.00	36.44	O
ATOM	5196	O	HOH	W	254	19.444	19.199	18.718	1.00	37.77	O
ATOM	5199	O	HOH	W	255	24.736	80.148	25.329	1.00	39.85	O
ATOM	5202	O	HOH	W	256	11.691	61.111	31.739	1.00	32.31	O
ATOM	5205	O	HOH	W	257	2.864	3.875	17.924	1.00	38.15	O
ATOM	5208	O	HOH	W	258	14.511	16.067	9.859	1.00	49.07	O
ATOM	5211	O	HOH	W	259	6.041	15.719	44.019	1.00	38.12	O
ATOM	5214	O	HOH	W	260	−3.500	11.317	28.973	1.00	31.78	O
ATOM	5217	O	HOH	W	261	20.113	18.209	14.238	1.00	39.21	O
ATOM	5220	O	HOH	W	262	12.901	53.061	26.970	1.00	43.64	O
ATOM	5223	O	HOH	W	263	13.748	78.590	19.665	1.00	45.08	O
ATOM	5226	O	HOH	W	264	−5.789	32.286	21.059	1.00	36.44	O
ATOM	5229	O	HOH	W	265	−2.186	52.836	16.940	1.00	30.43	O
ATOM	5232	O	HOH	W	266	7.623	9.946	10.664	1.00	39.43	O
ATOM	5235	O	HOH	W	267	12.879	65.624	39.396	1.00	46.93	O
ATOM	5238	O	HOH	W	268	3.762	3.939	41.903	1.00	46.14	O
ATOM	5241	O	HOH	W	269	17.828	31.637	16.048	1.00	47.28	O
ATOM	5244	O	HOH	W	270	3.542	70.692	35.072	1.00	36.22	O
ATOM	5247	O	HOH	W	271	9.189	65.423	36.649	1.00	36.55	O
ATOM	5250	O	HOH	W	272	18.089	19.294	34.947	1.00	32.14	O
ATOM	5253	O	HOH	W	273	12.998	3.363	21.479	1.00	27.18	O
ATOM	5256	O	HOH	W	274	0.719	28.723	15.348	1.00	38.43	O
ATOM	5259	O	HOH	W	275	15.569	18.739	42.772	1.00	42.03	O
ATOM	5262	O	HOH	W	276	−3.457	55.073	30.607	1.00	45.58	O
ATOM	5265	O	HOH	W	277	5.522	31.715	14.294	1.00	32.09	O
ATOM	5268	O	HOH	W	278	−2.657	35.531	31.044	1.00	34.38	O
ATOM	5271	O	HOH	W	279	12.105	63.958	11.282	1.00	37.18	O
ATOM	5274	O	HOH	W	280	18.747	47.105	16.449	1.00	34.97	O
ATOM	5277	O	HOH	W	281	5.977	55.901	30.172	1.00	38.23	O
ATOM	5280	O	HOH	W	282	25.844	78.740	23.059	1.00	40.40	O
ATOM	5283	O	HOH	W	283	15.278	9.678	17.509	1.00	38.76	O
ATOM	5286	O	HOH	W	284	21.498	72.061	18.923	1.00	37.11	O
ATOM	5289	O	HOH	W	285	18.724	50.881	14.447	1.00	44.73	O
ATOM	5292	O	HOH	W	286	−11.218	48.480	24.128	1.00	42.03	O
ATOM	5295	O	HOH	W	287	−1.136	28.910	34.251	1.00	38.99	O
ATOM	5298	O	HOH	W	288	11.120	58.787	33.554	1.00	34.94	O
ATOM	5301	O	HOH	W	289	−10.583	56.470	31.910	1.00	43.90	O
ATOM	5304	O	HOH	W	290	2.255	4.906	22.735	1.00	33.76	O
ATOM	5307	O	HOH	W	291	−4.463	53.493	27.131	1.00	37.65	O
ATOM	5310	O	HOH	W	292	26.026	81.949	31.499	1.00	45.48	O
ATOM	5313	O	HOH	W	293	7.442	76.447	16.369	1.00	41.23	O
ATOM	5316	O	HOH	W	294	−3.686	27.401	26.198	1.00	35.10	O
ATOM	5319	O	HOH	W	295	21.577	22.219	15.316	1.00	41.70	O
ATOM	5322	O	HOH	W	296	−2.025	13.772	19.436	1.00	19.84	O
ATOM	5325	O	HOH	W	297	4.552	56.197	33.298	1.00	45.25	O
ATOM	5328	O	HOH	W	298	14.647	47.199	23.522	1.00	48.24	O
ATOM	5331	O	HOH	W	299	15.390	62.007	13.636	1.00	42.37	O
ATOM	5334	O	HOH	W	300	10.428	26.350	31.879	1.00	42.60	O
ATOM	5337	O	HOH	W	301	14.718	5.189	45.549	1.00	45.54	O
ATOM	5340	O	HOH	W	302	8.946	22.508	33.873	1.00	40.76	O
ATOM	5343	O	HOH	W	303	16.384	27.295	24.851	1.00	41.97	O
ATOM	5346	O	HOH	W	304	3.772	7.760	47.728	1.00	41.52	O
ATOM	5349	O	HOH	W	305	10.504	78.455	18.240	1.00	40.71	O
ATOM	5352	O	HOH	W	306	1.711	18.621	39.993	1.00	46.98	O
ATOM	5355	O	HOH	W	307	−2.232	37.318	29.555	1.00	52.79	O
ATOM	5358	O	HOH	W	308	17.695	84.082	24.846	1.00	35.15	O
ATOM	5361	O	HOH	W	309	9.444	81.936	21.257	1.00	43.21	O
ATOM	5364	O	HOH	W	310	18.962	14.586	41.000	1.00	33.95	O
ATOM	5367	O	HOH	W	311	17.224	59.864	27.056	1.00	44.86	O
ATOM	5370	O	HOH	W	312	8.196	32.729	30.403	1.00	46.43	O
ATOM	5373	O	HOH	W	313	6.716	21.920	35.622	1.00	40.07	O
ATOM	5376	O	HOH	W	314	−8.178	51.601	21.128	1.00	26.96	O
ATOM	5379	O	HOH	W	315	21.626	23.241	10.371	1.00	46.41	O
ATOM	5382	O	HOH	W	316	1.992	8.600	16.619	1.00	47.59	O
ATOM	5385	O	HOH	W	317	−9.110	62.976	22.532	1.00	41.04	O
ATOM	5388	O	HOH	W	318	10.186	78.289	31.815	1.00	35.64	O
ATOM	5391	O	HOH	W	319	7.452	56.107	15.200	1.00	47.41	O
ATOM	5394	O	HOH	W	320	16.416	21.307	39.421	1.00	47.41	O
ATOM	5397	O	HOH	W	321	−0.758	31.033	19.795	1.00	50.41	O
ATOM	5400	O	HOH	W	322	−0.518	16.247	39.461	1.00	34.97	O
ATOM	5403	O	HOH	W	323	−1.833	51.374	29.019	1.00	40.40	O
ATOM	5406	O	HOH	W	324	15.835	54.684	14.540	1.00	41.84	O
ATOM	5409	O	HOH	W	325	2.870	15.482	46.756	1.00	35.83	O
ATOM	5412	O	HOH	W	326	−4.606	53.769	17.686	1.00	34.90	O
ATOM	5415	O	HOH	W	327	16.007	35.046	26.985	1.00	43.92	O
ATOM	5418	O	HOH	W	328	16.481	19.803	36.607	1.00	33.16	O
ATOM	5421	O	HOH	W	329	−3.099	12.154	36.959	1.00	43.78	O
ATOM	5424	O	HOH	W	330	8.836	66.515	9.394	1.00	38.90	O
ATOM	5427	O	HOH	W	331	−5.196	55.555	14.903	1.00	41.11	O
ATOM	5430	O	HOH	W	332	3.673	20.670	43.076	1.00	49.53	O
ATOM	5433	O	HOH	W	333	14.210	57.558	29.654	1.00	38.52	O
ATOM	5436	O	HOH	W	334	−4.440	26.268	30.382	1.00	41.01	O
ATOM	5439	O	HOH	W	335	0.303	5.327	26.203	1.00	40.13	O
ATOM	5442	O	HOH	W	336	23.927	25.223	17.079	1.00	49.07	O
ATOM	5445	O	HOH	W	337	18.154	2.532	36.875	1.00	48.40	O
ATOM	5448	O	HOH	W	338	−1.578	9.589	38.800	1.00	45.45	O
ATOM	5451	O	HOH	W	339	10.755	44.148	30.134	1.00	44.26	O
ATOM	5454	O	HOH	W	340	−5.779	19.722	29.027	1.00	44.44	O
ATOM	5457	O	HOH	W	341	2.605	2.158	29.438	1.00	45.14	O
ATOM	5460	O	HOH	W	342	13.174	27.958	25.103	1.00	47.67	O
ATOM	5463	O	HOH	W	343	2.644	4.022	32.067	1.00	44.27	O
ATOM	5466	O	HOH	W	344	−6.107	51.428	30.348	1.00	37.84	O
ATOM	5469	O	HOH	W	345	8.444	46.539	25.407	1.00	27.68	O
ATOM	5472	O	HOH	W	346	0.216	9.594	15.345	0.50	19.30	O
ATOM	5475	O	HOH	W	347	7.419	52.115	28.750	1.00	43.60	O
ATOM	5478	O	HOH	W	348	1.084	74.672	17.236	1.00	43.61	O
ATOM	5481	O	HOH	W	349	9.086	56.763	13.070	1.00	32.67	O
ATOM	5484	O	HOH	W	350	10.168	36.128	33.057	1.00	46.83	O
ATOM	5487	O	HOH	W	351	6.222	30.908	12.092	1.00	40.82	O
ATOM	5490	O	HOH	W	352	18.711	54.082	21.232	1.00	40.98	O
ATOM	5493	O	HOH	W	353	7.045	24.081	34.543	1.00	40.00	O
ATOM	5496	O	HOH	W	354	19.551	36.122	18.141	1.00	39.80	O
ATOM	5499	O	HOH	W	355	8.323	35.863	26.985	1.00	42.79	O
ATOM	5502	O	HOH	W	356	15.768	76.605	17.198	1.00	41.62	O
ATOM	5505	O	HOH	W	357	7.713	14.211	11.015	1.00	38.48	O
ATOM	5508	O	HOH	W	358	−0.007	19.970	39.379	1.00	40.86	O
ATOM	5511	O	HOH	W	359	4.894	10.472	11.299	1.00	43.58	O
ATOM	5514	O	HOH	W	360	−7.013	19.983	24.789	1.00	41.53	O
ATOM	5517	O	HOH	W	361	11.882	69.046	38.268	1.00	37.09	O
ATOM	5520	O	HOH	W	362	0.847	38.127	31.394	1.00	44.71	O
ATOM	5523	O	HOH	W	363	12.543	77.215	35.944	1.00	46.47	O
ATOM	5526	O	HOH	W	364	−0.275	5.281	20.527	1.00	49.03	O
ATOM	5529	O	HOH	W	365	3.852	47.193	33.824	1.00	45.52	O
ATOM	5532	O	HOH	W	366	5.374	28.678	10.725	1.00	55.58	O
ATOM	5535	O	HOH	W	367	7.148	2.729	15.160	1.00	47.51	O
ATOM	5538	O	HOH	W	368	5.850	−0.340	39.838	1.00	45.55	O
ATOM	5541	O	HOH	W	369	20.182	18.359	34.879	1.00	43.84	O
ATOM	5544	O	HOH	W	370	9.912	3.925	45.795	1.00	45.61	O
ATOM	5547	O	HOH	W	371	−8.844	50.990	27.544	1.00	43.80	O
ATOM	5550	O	HOH	W	372	−8.869	42.344	32.264	1.00	36.72	O
ATOM	5553	O	HOH	W	373	15.800	13.628	27.582	1.00	41.13	O
ATOM	5556	O	HOH	W	374	18.901	14.505	33.218	1.00	41.62	O
ATOM	5559	O	HOH	W	375	1.853	79.517	18.137	1.00	46.62	O
ATOM	5562	O	HOH	W	376	16.236	86.830	33.769	1.00	41.68	O
ATOM	5565	O	HOH	W	377	4.608	27.482	37.133	1.00	45.58	O
ATOM	5568	O	HOH	W	378	−3.757	32.642	19.402	1.00	46.75	O
ATOM	5571	O	HOH	W	379	14.471	32.910	26.576	1.00	53.42	O
ATOM	5574	O	HOH	W	380	−1.037	46.322	34.315	1.00	47.01	O
ATOM	5577	O	HOH	W	381	1.793	32.853	32.560	1.00	42.76	O
ATOM	5580	O	HOH	W	382	−2.051	73.756	29.908	1.00	44.88	O
ATOM	5583	O	HOH	W	383	14.083	81.363	21.948	1.00	41.19	O
ATOM	5586	O	HOH	W	384	17.211	49.125	17.870	1.00	49.94	O
ATOM	5589	O	HOH	W	385	6.061	38.796	30.019	1.00	37.05	O
ATOM	5592	O	HOH	W	386	3.701	38.468	32.113	1.00	49.50	O
ATOM	5595	O	HOH	W	387	11.997	45.720	26.358	1.00	43.58	O
ATOM	5598	O	HOH	W	388	3.891	33.001	30.507	1.00	47.99	O
ATOM	5601	O	HOH	W	389	14.616	70.545	40.365	1.00	45.64	O
ATOM	5604	O	HOH	W	390	14.574	22.055	41.425	1.00	52.12	O
ATOM	5607	O	HOH	W	391	4.346	13.355	48.148	1.00	52.19	O
ATOM	5610	O	HOH	W	392	27.169	76.192	24.082	1.00	39.17	O
ATOM	5613	O	HOH	W	393	9.571	38.797	27.006	1.00	32.47	O
ATOM	5616	O	HOH	W	394	8.508	43.203	25.738	1.00	39.98	O
ATOM	5619	O	HOH	W	395	19.082	54.659	19.221	1.00	40.35	O
ATOM	5622	O	HOH	W	396	20.830	42.893	13.607	1.00	39.95	O
ATOM	5625	O	HOH	W	397	5.319	20.544	43.801	1.00	49.19	O
ATOM	5628	O	HOH	W	398	−0.686	77.185	18.682	1.00	48.70	O
ATOM	5631	O	HOH	W	399	13.037	80.375	31.401	1.00	34.60	O
ATOM	5634	O	HOH	W	400	9.194	62.157	37.713	1.00	52.16	O
ATOM	5637	O	HOH	W	401	−7.980	17.818	43.735	1.00	46.19	O
ATOM	5640	O	HOH	W	402	23.280	74.562	20.442	1.00	52.69	O
ATOM	5643	O	HOH	W	403	14.240	61.150	32.356	1.00	47.70	O
ATOM	5646	O	HOH	W	404	−0.769	78.275	30.180	1.00	50.98	O
ATOM	5649	O	HOH	W	405	−5.626	22.219	29.113	1.00	46.52	O
ATOM	5652	O	HOH	W	406	15.541	64.739	13.428	1.00	46.05	O
ATOM	5655	O	HOH	W	407	7.527	37.758	26.580	1.00	25.51	O
ATOM	5658	O	HOH	W	408	24.624	74.521	22.385	1.00	38.85	O
ATOM	5661	O	HOH	W	409	7.728	50.654	28.168	1.00	47.15	O
ATOM	5664	O	HOH	W	410	15.960	6.626	32.420	1.00	43.54	O
ATOM	5667	O	HOH	W	411	−7.813	53.566	25.122	1.00	52.09	O
ATOM	5670	O	HOH	W	412	7.890	45.778	27.572	1.00	30.54	O
ATOM	5673	O	HOH	W	413	21.095	43.371	18.127	1.00	38.67	O
ATOM	5676	O	HOH	W	414	12.440	22.432	33.478	1.00	44.89	O

REFERENCES

Albericio, F., Annis, I., Royo, M., Barany, G. 2000. In Chan, W. C., White, P. D. (Eds), Fmoc solid phase synthesis. A practical approach, Oxford University Press, NY, pp. 81-91.
Alter, S. C., Kramps, J. A., Janoff, A. & Schwartz, L. B. (1990) Interactions of human mast cell tryptase with biological protease inhibitors. Arch. Biochem. Biophys. 276, 26-31.
Atkins, P. C., Schwartz, L. B., Adkinson, N. F., von-Allmen, C., Valenzano, M. & Zweiman, B. (1990) In vivo antigen-induced cutaneous mediator release: simultaneous comparisons of histamine, tryptase, and prostaglandin D2 release and the effect of oral corticosteroid administration. J. Allergy Clin. Immunol. 86, 360-70.
Auerswald, E. A., Morenweiser, R., Sommerhoff, C. P. et al. (1994) Recombinant leech derived tryptase inhibitor: construction, production, protein chemical characterization and inhibition of HIV-1 replication. Biological Chemistn Hoppe-Seyler 375, 695-703.
R. Baggio, P. Burgstaller, S. P. Hale, A. R. Putney, M. Lane, D. Lipovsek, M. C. Wright, R. W. Roberts, R. Liu, J. W. Szostak, R. W. Wagner, Identification of epitope-like consensus motifs using mRNA display, J. Mol. Recognit. 15 (2002) 126-134.
Brockow K, Akin C, Huber M, Scott L M, Schwartz L B, Metcalfe D D. (2002) Levels of mast-cell growth factors in plasma and in suction skin blister fluid in adults with mastocytosis: correlation with dermal mast-cell numbers and mast-cell tryptase. J Allergy Clin Immunol. January; 109(1):82-8.
Broide, D. H., Gleich, G. J., Cuomo, A. J., Cobum, D. A., Federman, E. C., Schwartz, L. B. & Wasserman, S. I. (1991) Evidence of ongoing mast cell and eosinophil degranulation in symptomatic asthma airway. J. Allergy Clin. Immunol. 88, 637-48.
Castells, M. & Schwartz, L. B. (1988) Tryptase levels in nasal-lavage fluid as an indicator of the immediate allergic response. J. Allergy Clin. Immunol. 82, 348-55.
Caughey, G. H., Leidig, F., Viro, N. F, Nadel, J. A (1989) Substance P and vasoactive intestinal peptide degradation by mast cell tryptase and chymase. J Pharmacol Exp Ther. 1988 January; 244(1):133-7.
S. Chakraborty, U. Haldar, A. K. Bera, A. K. Pal, S. Bhattacharya, S. Ghosh, B. P. Mukhopadhyay, A. Banerjee, Recognition and stabilization of a unique CPRI-structural motif in cucurbitaceae family trypsin inhibitor peptides: molecular dynamics based homology modeling using the X-ray structure of MCTI-II, J. Biomol. Struct. Dyn. 18 (2001) 569-577.
Chan, W. C., White, P. D. In Chan, W. C., White, P. D. (Eds), Fmoc solid phase synthesis. A practical approach, Oxford University Press, NY, 2000, p. 63.
Chase, T. & Shaw, E. (1970) in Meth. Enzymol. Vol. XIX (Perlman et al., eds), pp. 20-27.
X. M. Chen, Y. W. Qian, C. W. Chi, K. D. Gan, M. F. Zhang, C. Q. Chen, Chemical synthesis, molecular cloning, and expression of the gene coding for the Trichosanthes trypsin inhibitor—a squash family inhibitor, J. Biochem. (Tokyo) 112 (1992) 45-51.
L. Chiche, C. Gaboriaud, A. Heitz, J. P. Momon, B. Castro, P. A. Kollman, Use of restrained molecular dynamics in water to determine three-dimensional protein structure: prediction of the three-dimensional structure of Ecballium elaterium trypsin inhibitor II, Proteins 6 (1989) 405-417.
Christmann, A., Walter, K., Wentzel, A., Kratzner, R., Kolmar H. (1999) The cystine knot of a squash-type protease inhibitor as a structural scaffold for Escherichia coli cell surface display of conformationally constrained peptides. Protein Eng 12(9):797-806.
D. J. Craik, N. L. Daly, C. Waine, The cystine knot motif in toxins and implications for drug design, Toxicon 39 (2001) 43-60.
Craik, D. J., Simonsen, S., Daly, N. L. (2002) The cyclotides: novel macrocyclic peptides as scaffolds in drug design. Curr Opin Drug Discov Devel. March; 5(2):251-60.
Cregar L., Elrod K. C., Putnam D. et al. (1999) Neutrophil myeloperoxidase is a potent and selective inhibitor of mast cell tryptase. Archives of Biochemistry and Biophysics 366, 125-130.
Cox, S. W. & Eley, B. M. (1989) Tryptase-like activity in crevicular fluid from gingivitis and periodontitis patients. J. Period. Res. 24, 41-4.
Daly, N. L., Love, S., Alewood, P. F., and Craik, D. J. (1999) Chemical synthesis and folding pathways of large cyclic polypeptides: studies of the cystine knot polypeptide kalata B1. Biochemistry 38, 10606-10614
N. L. Daly, D. J. Craik, Acyclic permutants of naturally occurring cyclic proteins characterization of cystine knot and beta-sheet formation in the macrocyclic polypeptide kalata B1, J. Biol. Chem. 275 (2000) 19068-19075.
DeLano, W. L. (2002). “The PyMOL Molecular Graphics System.” on World Wide Web http://www.pymol.org. DeLano Scientific, San Carlos, Calif., USA.
S. M. Deyev, R. Waibel, E. N. Lebedenko, A. P. Schubiger, A. Plückthun, Design of multivalent complexes using the barnase barstar module, Nat. Biotechnol. 21 (2003) 1486-1492.
Di Marco, S., Priestle, J. P. (1997) Structure of the complex of leech-derived tryptase inhibitor (LDTI) with trypsin and modeling of the LDTI-tryptase system. Structure. 1 November 15; 5(11):1465-74.
H. Döbeli, H. Andres, N. Breyer, N. Draeger, D. Sizmann, M. T. Zuber, B. Weinert, B. Wipf, Recombinant fusion proteins for the industrial production of disulfide bridge containing peptides: purification, oxidation without concatamer formation, and selective cleavage, Protein Expr. Purif. 12 (1998) 404-414.
Elrod, K. C., Moore, W. R., Abraham, W. M. et al. (1997) Lactoferrin, a potent tryptase inhibitor, abolishes late-phase airway responses in allergic sheep. American Journal of and Critical Care Medicine 156, 375-381.
W. D. Fairlie, A. D. Uboldi, D. P. De Souza, G. J. Hemmings, N. A. Nicola, M. Baca, A fusion protein system for the recombinant production of short disulfide-containing peptides, Protein Expr. Purif. 26 (2002) 171-178.
A. R. Fersht, The sixth Datta Lecture. Protein folding and stability: the pathway of folding of barnase, FEBS Lett. 325 (1993) 5-16.
Franconi, G. M., Graf, P. D., Lazarus, S. C., Nadel, J. A. & Caughey, G. H. (1989) Mast cell tryptase and chymase reverse airway smooth muscle relaxation induced by vasoactive intestinal peptide in the ferret. J. Pharmacol. Exp. Ther. 248, 947-51.
Gelly, J. C., Gracy, J., Kaas, Q., Le-Nguyen, D., Heitz, A., Chiche, L. (2004) The KNOTTIN website and database: a new information system dedicated to the knottin scaffold. Nucleic Acids Res. January 1; 32 Database issue:D156-9.
Guex, N. and M. C. Peitsch (1997). “SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling.” Electrophoresis 18(15): 2714-23.
Gustafson, K. R., Sowder, R. C., I I, Henderson, L. E., Parsons, I. C., Kashman, Y., Cardellina I I, J. H., McMahon, J. B., Buckheit, R. W., Jr., Pannell, L. K., and Boyd, M. R. (1994) J. Am. Chem. Soc. 116, 9337-9338
Gustafson, K. R., Walton, L. K., Sowder, R. C. I., Johnson, D. G., Pannell, L. K., Cardellina, J. H. I., and Boyd, M. R. (2000) New circulin macrocyclic polypeptides from Chassalia parvifolia J. Nat. Prod. 63, 176-178
N. Hamato, T. Koshiba, T. N. Pham, Y. Tatsumi, D. Nakamura, R. Takano, K. Hayashi, Y. M. Hong, S. Hara, Trypsin and elastase inhibitors from bitter gourd (Momordica charantia LINN.) seeds: purification, amino acid sequences, and inhibitory activities of four new inhibitors, J. Biochem. (Tokyo) 117 (1995) 432-437.
R. W. Hartley, D. L. Rogerson, Jr., Production and purification of the extracellular ribonuclease of Bacillus amyloliquefaciens (barnase) and its intracellular inhibitor (barstar). I. Barnase, Prep. Biochem. 2 (1972) 229-242.
Hartley, R. W. (1988) Barnase and barstar. Expression of its cloned inhibitor permits expression of a cloned ribonuclease. J Mol. Biol. August 20; 202(4):913-5.
He, S H (2004) Key role of mast cells and their major secretory products in inflammatory bowel disease. World J. Gastroenterol. 2004 Feb. 1; 10(3):309-18.
Hernandez, J. F., Gagnon, J., Chiche, L., Nguyen, T. M., Andrieu, J. P., Heitz, A., Trinh Hong, T., Pham, T. T., and Le Nguyen, D. (2000) Squash trypsin inhibitors from Momordica cochinchinensis exhibit an atypical macrocyclic structure. Biochemistry 39, 5722-30
Hood, L. IMMUNOLOGY 2nd ed., Benjamin-Cummings 1984.
Howarth, P H (1995) The cellular basis for allergic rhinitis. Allergy. 1995; 50(23 Suppl):6-10.
Isaacs, N. W. (1995) Cystine knots. Curr. Biol. 5, 391-395
Jones, T. A., J. Y. Zou, et al. (1991). “Improved methods for building protein models in electron density maps and the location of errors in these models.” Acta Crystallographica Section a Foundations of Crystallography 2(1): 110-19.
M. Jucovic, R. W. Hartley, In vivo system for the detection of low level activity barnase mutants, Protein Eng. 8 (1995) 497-499.
Juliusson, S., Holmberg, K., Baumgarten, C. R., Olsson, M., Enander, I. & Pipkorn, U. (1991) Tryptase in nasal lavage fluid after local allergen challenge. Relationship to histamine levels and TAME-esterase activity. Allergy 46, 459-65.
Kabsch, W. (1993). “Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants.” Journal of Applied Crystallography 26(6): 795-800.
Kantardjieff, K. A. and B. Rupp (2003). “Matthews coefficient probabilities: Improved estimates for unit cell contents of proteins, DNA, and protein-nucleic acid complex crystals.” Protein Sci 12(9): 1865-71.
Kissinger, C. R., D. K. Gehlhaar, et al. (1999). “Rapid automated molecular replacement by evolutionary search.” Acta Crystallogr D Biol Crystallogr 55 (Pt 2): 484-91.
Kohno, T., Kim, J. I., Kobayashi, K., Kodera, Y., Maeda, T., and Sato, K. (1995) Three-dimensional structure in solution of the calcium channel blocker omega-conotoxin MVIIA. Biochemistry. August 15; 34(32):10256-65.
S. Kojima, K. Miyoshi, K. Miura, Synthesis of a squash-type protease inhibitor by gene engineering and effects of replacements of conserved hydrophobic amino acid residues on its inhibitory activity, Protein Eng. 9 (1996) 1241-1246.
Le-Nguyen, D., Heitz, A., Chiche, L., Castro, B., Boigegrain, R. A., Favel, A., and Coletti-Previero, M. A. (1990) Molecular recognition between serine proteases and new bioactive microproteins with a knotted structure Biochimie, 72 431-435
S. P. Martsev, Y. I. Tsybovsky, O. A. Stremovskiy, S. G. Odintsov, T. G. Balandin, P. Arosio, Z. I. Kravchuk, S. M. Deyev, Fusion of the antiferritin antibody VL domain to barnase results in enhanced solubility and altered pH stability, Protein Eng. Des. Sel. 17 (2004) 85-93.
Michaelsson G, Kraaz W, Hagforsen E, Pihi-Lundin I, Loof L. (1997) Psoriasis patients have highly increased numbers of tryptase-positive mast cells in the duodenal stroma. Br J. Dermatol. 1997 June; 136(6):866-70.
Miller, J. S., Westin, E. H., Schwartz, L. B. (1989) Cloning and characterization of complementary DNA for human tryptase J Clin Invest. October; 84(4):1188-95.
Miller, J. S., Moxley, G., Schwartz, L. B. (1990) Cloning and characterization of a second complementary DNA for human tryptase: J Clin Invest. 1990 September; 86(3):864-70.
J. F. Morrison, Kinetics of the reversible inhibition of enzyme-catalysed reactions by tight-binding inhibitors, Biochim. Biophys. Acta 185 (1969) 269-286.
L. Narasimhan, J. Singh, C. Humblet, K. Guruprasad, T. Blundell, Snail and spider toxins share a similar tertiary structure and ‘cystine motif’, Nat. Struct. Biol. 1 (1994) 850-852.
Newhouse, B. J. (2002) Tryptase inhibitors—review of the recent patent literature. IDrugs. 2002 July; 5(7):682-8.
R. S. Norton, P. K. Pallaghy, The cystine knot structure of ion channel toxins and related polypeptides, Toxicon 36 (1998) 1573-1583.
C. J. Paddon, R. W. Hartley, Expression of Bacillus amyloliquefaciens extracellular ribonuclease (barnase) in Escherichia coli following an inactivating mutation, Gene 53 (1987) 11-19.
Pallaghy, P. K., Nielsen, K. J., Craik, D. J., and Norton, R. (1994) A common structural motif incorporating a cystine knot and a triple-stranded beta-sheet in toxic and inhibitory polypeptides. Protein Sci. 3, 1833-1839.
A. Polanowski, T. Wilusz, B. Nienartowicz, E. Cieslar, A. Slominska, K. Nowak, Isolation and partial amino acid sequence of the trypsin inhibitor from the seeds of Cucurbita maxima, Acta Biochim. Pol. 27 (1980) 371-382.
Rees, D. C., Lipscomb, W. N. (1982) Refined crystal structure of the potato inhibitor complex of carboxypeptidase A at 2.5 A resolution. Proc. Natl. Acad. Sci. USA 77, 4633-4637.
Ruoss, S. J., Hartmann, T., Caughey, G. H (1991) Mast cell tryptase is a mitogen for cultured fibroblasts. J Clin Invest. 1991 August; 88(2):493-9.
Saether, O., Craik, D. J., Campbell, I. D., Sletten, K., Juul, J., and Norman, D. G. (1995) Elucidation of the primary and three-dimensional structure of the uterotonic polypeptide kalata B1 Biochemistry 34, 4147-4158
Sambrook J., Fritsch E. F. & Maniatis T. (1989) Molecular cloning: a laboratory manual. pp. Pages. New York: Cold Spring Harbor Laboratory Press.
Schwartz, L. B., Metcalfe, D. D., Miller, J. S., Earl, H. & Sullivan, T. (1987) Tryptase levels as an indicator of mast-cell activation in systemic anaphylaxis and mastocytosis. N. Engl. J. Med. 316, 1622-6.
Schwartz, L. B., Yunginger, J. W., Miller, J., Bokhari, R. & Dull, D. (1989) Time course of appearance and disappearance of human mast cell tryptase in the circulation after anaphylaxis. J. Clin. Invest. 83, 1551-5.
Schwartz L. B. (1994) Tryptase: a mast cell serine protease. Methods in Enzymology 244, 88-100.
Sekizawa, K., Caughey, G. H., Lazarus, S. C., Gold, W. M. & Nadel, J. A. (1989) Mast cell tryptase causes airway smooth muscle hyperresponsiveness in dogs. J. Clin. Invest. 83, 175-9.
Shalit, M., Schwartz, L. B., von-Allmen, C., Atkins, P. C., Lavker, R. M. & Zweiman, B. (1990) Release of histamine and tryptase in vivo after prolonged cutaneous challenge with allergen in humans. J. Immunol. 1988 Aug. 1; 141(3):821-6. J. Allergy Clin. Immunol. 86, 117-25.
U. Sinha, S. A. Wolz, P. J. Lad, Two new extracellular serine proteases from Streptomyces fradiae, Int. J. Biochem. 23 (1991) 979-984.
Sommerhoff, C. P., Sollner, C., Mentele, R. et al. (1994) A Kazal-type inhibitor of human mast cell tryptase: isolation from the medical leech Hirudo medicinalis, characterization, and sequence analysis. Biological Chemistry Hoppe-Seyler 375, 685-694.
Sommerhoff, C. P., Bode, W., Pereira, P. J, Stubbs, M. T, Sturzebecher, J., Piechottka, G. P., Matschiner, G., Bergner, A. (1999) The structure of the human betall-tryptase tetramer: fo(u)r better or worse. Proc Natl Acad Sci USA. September 28; 96(20):1098-491.
Sperr W. R., Jordan, J. H., Baghestanian, M, Kiener, H. P., Samorapoompichit, P., Semper, H., Hauswirth, A., Schernthaner, G. H., Chott, A., Natter, S., Kraft, D., Valenta, R., Schwartz, L. B., Geissler, K., Lechner, K., Valent, P. (2001) Expression of mast cell tryptase by myeloblasts in a group of patients with acute myeloid leukemia. Blood. October 1; 98(7):2200-9.
Sperr, W. R., Hauswirth, A. W., Valent, P. (2002) Tryptase a novel biochemical marker of acute myeloid leukemia. Leuk Lymphoma. 2002 December; 43(12):2257-61.
Stubbs, M. T., Morenweiser, R., Sturzebecher, J. et al. (1997) The three-dimensional structure of recombinant leech-derived tryptase inhibitor in complex with trypsin. Implications for the structure of human mast cell tryptase and its inhibition. Journal of Biological Chemistry 272, 19931-19937.
Tam, E. K., Franconi, G. M., Nadel, J. A. & Caughey, G. H. (1990) Protease inhibitors potentiate smooth muscle relaxation induced by vasoactive intestinal peptide in isolated human bronchi. Amer. J. Respir. Cell. Molec. Biol. 2, 449-52.
Tam, J. P., Lu, Y. A., Yang, J. L., and Chiu, K. W. (1999) An unusual structural motif of antimicrobial peptides containing end-to-end macrocycle and cystine-knot disulfides Proc. Natl. Acad. Sci. U.S.A. 96, 8913-8918
Towbin, H., Staehelin, T., Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA. September; 76(9):4350-4.
Vanderslice, P., Ballinger, S. M., Tam, E. K., Goldstein, S. M., Craik, C. S., Caughey, G. H. (1990) Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family. Proc Natl Acad Sci USA. 1990 May; 87(10):3811-5.
W. E. Van Nostrand, S. L. Wagner, J. S. Farrow, D. D. Cunningham, Immunopurification and protease inhibitory properties of protease nexin-2/amyloid beta-protein precursor, J. Biol. Chem. 265 (1990) 9591-9594.
Walls, A. F., Bennett, A. R., Godfrey, R. C., Holgate, S. T. & Church, M. K. (1991) Mast cell tryptase and histamine concentrations in bronchoalveolar lavage fluid from patients with interstitial lung disease. Clin. Sci. 81, 183-8.
Wentzel, A., Christmann, A., Kratzner, R., Kolmar, H. (1999) Sequence requirements of the GPNG beta-turn of the Ecballium elaterium trypsin inhibitor II explored by combinatorial library screening., J. Biol. Chem., 274, 21037-21043.
Wentzel, A., Christmann, A., Adams, T., Kolmar, H. (2001) Display of passenger proteins on the surface of Escherichia coli K-12 by the enterohemorrhagic E. coli intimin EaeA. J. Bacteriol. December; 183(24):7273-84.
Wenzel, S. E., Fowler, A. A. 3d. & Schwartz, L. B. (1988) Activation of pulmonary mast cells by bronchoalveolar allergen challenge. In vivo release of histamine and tryptase in atopic subjects with and without asthma. Am. Rev. Respir. Dis. 137, 1002-8.
Winn, M. D., G. N. Murshudov, et al. (2003). “Macromolecular TLS refinement in REFMAC at moderate resolutions.” Methods Enzymol 374: 300-21.
Witherup, K. M., Bogusky, M. J., Anderson, P. S., Ramjit, H., Ransom, R. W., Wood, T., and Sardana, M. (1994) Cyclopsychotride A, a biologically active, 31-residue cyclic peptide isolated from Psychotria longipes. J. Nat. Prod. 57, 1619-1625

Claims

1. Use of a microprotein or a polynucleotide encoding said microprotein for the preparation of a pharmaceutical composition for treating or preventing a disease that can be treated or prevented by inhibiting the activity of tryptase.

2. The use of claim 1, wherein the microprotein comprises at least six cysteine residues, of which six cysteine residues are connected via disulphide bonds so as to form a cystine knot.

3. The use of claim 1, wherein the microprotein has a peptide backbone with an open or a circular conformation.

4. The use of claim 1, wherein the microprotein comprises the amino acid motif CX₃-CX₄-CX_4-7-CX₁-CX_4-5-CX_5-7(SEQ ID NO: 18), with X meaning independently from each other any amino acid residue.

5. The use of claim 1, wherein the microprotein has a length of between 28 and 40 amino acids.

6. The use of claim 1, wherein the microprotein comprises an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence depicted in any one of SEQ ID NOs: 1 to 15;

(b) the amino acid sequence depicted in SEQ ID NO: 16 or 17;

(c) a fragment of the amino acid sequence of (a) or (b), said fragment being capable of inhibiting tryptase activity; and

(d) a functional equivalent in which at least one residue of the amino acid sequence or of the fragment of any one of (a) to (c) is substituted, added and/or deleted, said functional equivalent being capable of inhibiting tryptase activity.

7. The use of claim 1, wherein the microprotein is fused to barnase.

8. The use of claim 7, wherein the barnase is inactive.

9. The use of claim 1, wherein the microprotein is administered to the patient in the form of a gene delivery vector which expresses the microprotein.

10. The use of claim 9, wherein the cells are transformed with the vector ex vivo and the transformed cells are administered to the patient.

11. The use of claim 1, wherein the disease is selected from the group consisting of asthma, inflammation, psoriasis, pulmonary fibrosis, an interstitial lung disease, rheumatoid arthritis, gingivitis, peridontitis, an allergic reaction, allergic rhinitis, osteoarthritis, atherosclerosis, angiogenesis, multiple sclerosis and cancer.

12. A method for the treatment of an individual in need of inhibiting the activity of tryptase comprising administering to said individual an effective amount of a pharmaceutical composition comprising the microprotein as defined in claim 1 or a polynucleotide encoding said microprotein and, optionally, a pharmaceutically acceptable carrier.

13. Use of the microprotein as defined in claim 1 or a polynucleotide encoding said microprotein for inhibiting tryptase activity.

14. The use of claim 13, which is in vitro.

15. Use of the microprotein as defined in claim 1 for purifying tryptase.

16. Use of the microprotein as defined in claim 1 as a carrier molecule for tryptase or a derivative thereof.

17. Use of the microprotein as defined in claim 1 for detecting and/or quantifying tryptase in a sample.

18. A method for diagnosing a disorder associated with an aberrant abundance of tryptase in a given cell, tissue, organ or organism, comprising

(a) contacting a sample from said cell, tissue, organ or organism with a microprotein as defined in claim 1 under conditions allowing binding between tryptase and the microprotein;

(b) determining the amount of the microprotein bound to tryptase; and

(c) diagnosing a disorder when the determined amount is above or below a standard amount.

19. Use of the microprotein as defined in claim 1 or a polynucleotide for diagnosing a disease related to an aberrant expression of tryptase.

20. A kit comprising a microprotein as defined in claim 1 and a manual for carrying out a method of diagnosing a disease related to an aberrant expression of tryptase and, optionally, means of detection or a standard tryptase sample.

21. (canceled)

22. A fusion protein comprising barnase and a microprotein.

23. The fusion protein of claim 22, wherein said barnase is inactive.

24. A fusion protein comprising barnase and a microprotein, wherein the microprotein is a microprotein as defined in claim 1.

25. A nucleic acid molecule comprising a nucleotide sequence encoding the fusion protein of claim 1.

26. The nucleic acid molecule of claim 25, which is DNA, cDNA, or RNA.

27. A vector comprising the nucleic acid molecule of claim 25.

28. The vector of claim 27, wherein the nucleotide sequence encoding the fusion protein is operably linked to one or more expression control sequences allowing the expression of the fusion protein in a host cell.

29. A host cell genetically engineered with the nucleic acid molecule of claim 25 or a vector comprising said nucleic acid molecule.

30. A method for preparing a fusion protein comprising cultivating the host cell of claim 29 under conditions that the fusion protein encoded by said nucleic acid molecule or vector is expressed; and recovering the fusion protein from the culture.

31. The method of claim 30, wherein said recovering comprises a step in which the fusion protein is purified by way of binding the barnase moiety of the fusion protein to barstar.

32. A fusion protein obtainable by the method of claim 30.

33. A method of detecting or purifying the fusion protein of claim 21 comprising the step of contacting the fusion protein with barstar.

34. The method of claim 33, wherein barstar is immobilized.

35. Use of the fusion protein of claim 21 for producing a crystal of said fusion protein.

36. A crystal of a microprotein fused with barnase.

37. The crystal of claim 36, wherein the microprotein is a microprotein.

38. The crystal of claim 36, wherein the barnase is inactive.

39. The crystal of claim 36, wherein the microprotein fused with barnase comprises the amino acid sequence set forth in SEQ ID NO: 19.

40. The crystal of claim 36, which belongs to space group C222₁.

41. The crystal of claim 36, having the unit cell dimensions of a=73.981 Å, b=217.820 Å and c=58.322 Å, α=β=γ=90°.

42. The crystal of claim 36 which has the crystal coordinates as depicted in Table 6.

43. A method of preparing the crystal of claim 36 comprising the steps of:

(a) providing an aqueous solution comprising a microprotein fused with barnase;

(b) providing a reservoir solution comprising a precipitating agent;

(c) mixing a volume of said aqueous solution with a volume of said reservoir solution thereby forming a mixed volume; and

(d) crystallizing at least a portion of said mixed volume.

44. The method of claim 43, wherein the reservoir solution comprises at least one compound selected from the group consisting of HEPES, NaCl, PEG 100, PEG 200, PEG 400, PEG 500, PEG 600, PEG 800, PEG 1000, PEG 2000, PEG 3000, PEG 4000, PEG 5000, PEG 6000, PEG 7000, PEG 8000, ammonium sulphate, ammonium acetate, sodium sulphate, organic solvents, isopropanol, citrate buffer, Tris buffer, cacodylate buffer, MES-buffer, dithiothreitol, octylglycopyranoside and uranylacetate.

45. The method of claim 43, wherein the reservoir solution comprises PEG 400.

46. The method of claim 43, wherein the reservoir solution comprises PEG at a concentration between 5 and 10%.

47. The method of claim 43, wherein the reservoir solution has pH 6.5.

48. The method of claim 43, wherein said crystallizing is carried out according to the sitting drop method.

49. A crystal of a microprotein obtainable by the method of claim 43.

50. A method for determining the three-dimensional structure of a microprotein, comprising the steps of:

(a) performing an X-ray diffraction analysis of a crystal of a microprotein fused with barnase;

(b) computationally processing the diffraction data obtained in step (a) in order to determine the three-dimensional structure of the crystal components and thereby to obtain crystal coordinates; and

(c) storing the obtained crystal coordinates on a data storage medium.

51. The method of claim 50, wherein step (b) further comprises to use data on the three-dimensional structure of barnase not being fused to the microprotein for modelling the structure of the barnase moiety within the fusion protein.

52. The method of claim 50, wherein the crystal is a crystal of a microprotein fused with a barnase.

53. Use of the crystal of claim 36 or structure data obtainable therefrom for designing or identifying a compound as a drug.

54. The use of claim 53, wherein the drug is capable of inhibiting a serine protease.

55. The use of claim 54, wherein the serine protease is tryptase.

56. A machine-readable data storage medium comprising the structure data of the crystal of claim 36 and which, when read by an appropriate machine, can be used to display a three-dimensional representation of the microprotein contained in the crystal or a portion thereof.

57. The data storage medium of claim 56 obtainable by the method comprising the steps of:

(c) storing the obtained crystal coordinates on a data storage medium.

58. A method of identifying a compound capable of binding to a microprotein comprising the steps of:

(a) performing a fitting reaction by computational means between a microprotein and a candidate compound using the structure data of the microprotein obtainable from the crystal of claim 36 and structure data of said compound; and

(b) determining whether the candidate compound is capable of binding the microprotein based on the data obtained in the fitting reaction.

59. Use of a crystal of a microprotein fused with a barnase or structure data obtainable therefrom or the data storage medium of claim 56 for identifying a compound capable of binding to a microprotein.

60. A method for optimizing the binding activity of a microprotein to a target molecule comprising the steps of:

(a) determining by computational means one or more residues of the microprotein which participate in the binding interaction with the target molecule using structure data of the microprotein obtainable from a crystal of claim 36 and structure data of the target molecule; and

(b) modifying in the microprotein one or more of said determined residues so as to optimize the binding activity of the microprotein to the target molecule.

61. The method of claim 60, wherein the structure data of the microprotein and the target molecule are obtained from a crystallized co-complex of said microprotein and target molecule.

62. The method of claim 60, wherein the structure data of the microprotein the binding activity of which is to be optimized is obtained by computationally superimposing its structure on the structure data of another microprotein's crystal.

63. Use of the crystal of claim 35 for optimizing the three-dimensional structure of said microprotein with respect to its binding and/or inhibiting activity to a target molecule.

64. The method of claim 60, wherein the target molecule is a tryptase.

65. A pharmaceutical composition comprising the crystal of claim 36 and, optionally, a pharmaceutically acceptable carrier.

66. Use of a crystal of claim 36 for the preparation of a pharmaceutical composition for treating or preventing a disease that can be treated or prevented by inhibiting the activity of tryptase.

67. The use of claim 66, wherein the disease is selected from the group consisting of asthma, inflammation, psoriasis, pulmonary fibrosis, an interstitial lung disease, rheumatoid arthritis, gingivitis, peridontitis, an allergic reaction, allergic rhinitis, osteoarthritis, atherosclerosis, angiogenesis, multiple sclerosis or cancer.