US20070032639A1 - Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation - Google Patents

Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation Download PDF

Info

Publication number
US20070032639A1
US20070032639A1 US11543601 US54360106A US2007032639A1 US 20070032639 A1 US20070032639 A1 US 20070032639A1 US 11543601 US11543601 US 11543601 US 54360106 A US54360106 A US 54360106A US 2007032639 A1 US2007032639 A1 US 2007032639A1
Authority
US
Grant status
Application
Patent type
Prior art keywords
rna
lt
srnas
nt
ig
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11543601
Inventor
Susan Gottesman
Gisela Storz
Francis Repoila
Karen Wassarman
Carsten Rosenow
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services (HHS)
Affymetrix Inc
Original Assignee
US Department of Health and Human Services (HHS)
Affymetrix Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245Escherichia (G)

Abstract

The invention relates to new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation.

Description

    RELATED APPLICATIONS
  • [0001]
    This application is a divisional of U.S. application Ser. No. 10/627,007, filed Jul. 25, 2003, which is a continuation and claims the benefit of priority of International Application No. PCT/US02/03147 filed Jan. 31, 2002, designating the United States of America and published in English, which claims the benefit of priority of U.S. Provisional Application No. 60/266,402 filed Feb. 1, 2001, all of which are hereby expressly incorporated by reference in their entireties.
  • FIELD OF THE INVENTION
  • [0002]
    The invention relates to new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation.
  • BACKGROUND OF THE INVENTION
  • [0003]
    In the last few years, the importance of regulatory small RNAs (sRNAs) as mediators of a number of cellular processes in bacteria has begun to be recognized. Although instances of naturally occurring antisense RNAs have been known for many years, the participation of sRNAs in protein tagging for degradation, modulation of RNA polymerase activity, and stimulation of translation are relatively recent discoveries (see Wassarman, K. M. et al. 1999 Trends Microbiol 7:37-45 for review; Wassarman, K. M. and Storz, G. 2000 Cell 101:613-623). These findings have raised questions about how extensively sRNAs are used, what other cellular activities might be regulated by sRNAs, and what other mechanisms of action exist for sRNAs. In addition, prokaryotic sRNAs appear to target different cellular functions than their eukaryotic counterparts that primarily act during RNA biogenesis. It is unclear whether this difference between prokaryotic and eukaryotic sRNAs is accurate or stems from the incompleteness of current knowledge. Implicit in these questions is the question of how many sRNAs exist in a given organism and whether the current known sRNAs are truly representative of sRNA function in general.
  • [0004]
    To date, most known bacterial sRNAs have been identified fortuitously by the direct detection of highly abundant sRNAs (4.5S RNA, tmRNA, 6S RNA, RNase P RNA, and Spot42 RNA), by the observation of an sRNA during studies on proteins (OxyS RNA, Crp Tic RNA, CsrB RNA, and GcvB RNA) or by the discovery of activities associated with overexpression of genomic fragments (MicF RNA, DicF RNA, DsrA RNA, and RprA RNA) (Okamoto, K. and Freundlich, M. 1986 PNAS USA 83:5000-5004; Bhasin, R. S. 1989 Studies on the mechanism of the autoregulation of the crp operon of E. coli K12 In: Dept. of Biochemistry and Cell Biology, State University of New York at Stonybrook; Urbanowski, M. L. et al. 2000 Mol Microbiol 37:856-868; Wassarman, K. M. and Storz, G. 2000 Cell 101:613-623; Majdalani, N. et al. 2001 Mol Microbiol 39:1382-1394; for review see Wassarman, K. M. et al. 1999 Trends Microbiol 7:37-45). None of the E. coli sRNAs were found as a result of mutational screens. This observation may reflect the small target size of genes encoding sRNAs compared to protein genes, or may be a consequence of the regulatory rather than essential nature of many sRNA functions. The complete genome sequence of an organism provides a rapid inventory of most encoded proteins, tRNAs, and rRNAs, but it has not led to the immediate recognition of other genes that are not translated. In particular, new bacterial sRNA genes have been overlooked, as there are no identifiable classes of sRNAs that can be found based solely on sequence determinants.
  • SEGUE TO THE SUMMARY OF THE INVENTION
  • [0005]
    We and others have previously suggested several approaches to look for new sRNAs including computer searching of complete genomes based on parameters common to sRNAs, probing of genomic microarrays, and isolating sRNAs based on an association with general RNA binding proteins (Wassarman, K. M. et al. 1999 Trends Microbiol 7:37-45; Eddy, S. R. 1999 Curr Opin Genet Dev 9:695-699). Using a combination of these approaches, we have identified 17 novel sRNAs; in addition, we have found six small transcripts that contain short conserved open reading frames (ORFs).
  • SUMMARY OF THE INVENTION
  • [0006]
    A burgeoning list of small RNAs with a variety of regulatory functions has been identified in both prokaryotic and eukaryotic cells. However, it remains difficult to identify small RNAs by sequence inspection. We utilized the high conservation of small RNAs among closely related bacterial species, as well as analysis of transcripts detected by high-density oligonucleotide probe arrays, to predict the presence of novel small RNA genes in the intergenic regions of the Escherichia coli genome. The existence of 23 distinct new RNA species was confirmed by Northern analysis. Of these, six are predicted to encode short ORFs, whereas 17 are novel functional small RNAs. Based on the interaction of these small RNAs with the RNA binding protein Hfq, the modulation of rpoS expression, and other information, we contemplate these new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation. As such, we anticipate their use in the development of diagnostics and in the development of antibiotics.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • [0007]
    FIG. 1 shows BLAST alignments of representative Ig regions. The indicated Ig regions were used in a BLAST search of the NCBI Unfinished Microbial Genomes database. Each panel shows the summary figure provided by the BLAST program for matches to Salmonella enteritidis, Salmonella paratyphi A, Salmonella typhi, Salmonella typhimurium LT2 and Klebsiella pneumoniae, three contain known sRNA genes (rprA, csrB, and oxys), and four contain sRNA candidates (#14, #17, #52, and #36; see Table 1). For each panel, the center numbered line represents the length of the full Ig region; the orientation of flanking genes is given by >(clockwise) or <(counterclockwise). The top hatched line in each panel is the match to E. coli (full identity throughout the Ig). The other hatched or double-diagonal lines resulted from the closest matches, and the other lines indicate additional less homologous matches. Location of the conserved region with respect to the borders of the Ig region also was a criterion used for the selection of our candidates; conservation 3′ to an ORF or far from the 5′ start of an ORF was considered more likely to encode an sRNA. Note that the conservation within the Ig region encoding oxyS might be interpreted as a leader sequence based on location relative to the start of the flanking gene (oxyR). However, the conservation extends for 185 nt, and therefore candidate regions in our search in which the conservation was near the start of an ORF but was longer than 150 nt were considered further.
  • [0008]
    FIG. 2 is the expression profile across high-density oligonucleotide arrays for representative Ig regions. Probe intensities are shown for the indicated Ig regions (solid bars) and the flanking ORFs (hatched bars), calculated from the perfect match minus the mismatch intensities. All negative differences were set to zero. The data shown are for one experiment using cDNA probes, but similar results were seen in the duplicate experiment and with directly labeled RNA probes. The Ig regions and each flanking gene generally contain 15 interrogating probes. Upward bars correspond to genes transcribed on the Watson (W, clockwise) strand and downward bars correspond to genes transcribed on the Crick (C, counterclockwise) strand. The C strand signal for the CsrB Ig region corresponds well with the known location of the csrB gene. Similarly for the RprA Ig region, the W strand signal corresponds with the location of the rprA gene, but only one probe is positive. The W strand signal for #14 and the C strand signal for #17 overlap well with the conserved regions shown in the BLAST analysis in FIG. 1. #36 was chosen for further analysis because of the strong C strand signal; both flanking ORFs are on the W strand. For #52, low levels of expression were seen on both strands; the very low level for probes in the middle of the Ig on the C strand overlapped best with the conserved region found by the BLAST searches (FIG. 1).
  • [0009]
    FIG. 3 shows detection of novel sRNAs by Northern hybridization. Northern hybridization using strand specific probes for each candidate was done on RNA extracted from MG1655 cells grown under three different growth conditions: (E), exponential growth in LB medium; (M), exponential growth in M63-glucose medium, and (S) stationary phase in LB medium. Five μg of total RNA was loaded in each lane. Exposure times were optimized for each panel for visualization here, therefore the signal intensity shown does not indicate relative abundance between sRNAs. Oligonucleotide probes were used for #12, #22, #55-I, #55-I, and #61; RNA probes were used for all other panels. DNA molecular weight markers (5′-end-labeled MspI digested pBR322 DNA) were run with each set of samples for direct estimation of RNA transcript length. One lane of DNA molecular weight markers are shown for comparison, but these are approximate sizes as there was slight variation in running of gels.
  • [0010]
    FIG. 4 shows results of coimmunoprecipitation of sRNAs with the Hfq protein. (A) Immunoprecipitations using extract from MG1655 cells grown in LB medium in exponential growth (OD600=0.4) were done using no antibody (lane 1); 5 μl of preimmune serum (lane 2); or 0.5, 1, 5, or 10 μl of hfq antisera (lanes 3-6). Selected RNAs were fractionated on a 10% polyacrylamide urea gel after 3′-end labeling. Asterisks mark RNA bands present in the anti-hfq precipitated samples but not in the preimmune control samples and therefore represent Hfq-interfacing RNAs. (B) Immunoprecipitations were done using extract from MG1655 cells grown under three different growth conditions: (E) exponential growth in LB medium; (M) exponential growth in M63-glucose medium, and (S) stationary phase in LB medium. Immunoprecipitations were carried out with 5 μl of preimmune sera (lane 1) or 5 μl Hfq antisera (lane 2) and compared to total RNA from 1/10 extract equivalent used in the immunoprecipitations (lane 3). RNAs were fractionated on 10% polyacrylamide urea gels and analyzed by Northern hybridization using RNA probes to previously known sRNAs or our novel RNAs as indicated.
  • [0011]
    Brief Description of the Sequences
    Candidate
    Number SEQ ID NO
    12 1
    14 2
    22 3
    24 4
    25 5
    26 6
    27 7
    31 8
    38 9
    40 10
    41-I 11
    41-II 12
    52-I 13
    52-II 14
    55-I 15
    55-II 16
    61 17
     8 18
    43 19
     9 (nucleotide) 20
     9 (amino acid) 21
    17 (nucleotide) 22
    17 (amino acid) 23
    28 (nucleotide) 24
    28 (amino acid) 25
    36(nucleotide) 26
    36 (amino acid) 27
    49 (nucleotide) 28
    49 (amino acid) 29
    50 (nucleotide) 30
    50 (amino acid) 31
  • DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
  • [0012]
    By “RNA” or “gene product” or “transcription product” is meant the RNA encoded by the E. Coli gene or RNA substantially homologous or complementary thereto or a derivative or fragment thereof having RNA activity. Encompassed by the definition of “RNA” are variants of RNA in which there have been trivial mutations such as substitutions, deletions, insertions or other modifications of the native RNA. The term “substantial homology” or “substantial identity”, when referring to polypeptides or polynucleotides, indicates that the sequence of a polypeptide or polynucleotide in question, when properly aligned, exhibits at least about 30% identity with the sequence of an entire naturally occurring polypeptide or polynucleotide or a portion thereof. Polynucleotides of the present invention which are homologous or substantially homologous to, for example, the polynucleotides of the invention are usually at least about 70% identity to that shown in the Sequence Listing, preferably at least about 90% identity and most preferably at least about 95% identity, or a complement thereof. Any technique known in the art can be used to sequence polynucleotides, including, for example, dideoxynucleotide sequencing (Sanger et al. 1977 PNAS USA 74:5463-5467), or using the Sequenase™ kit (United States Biochemical Corp.). Homologs of polynucleotides and polypeptides, whether synthetically or recombinantly produced or found in nature, are also encompassed by the scope of the invention, and are herein defined as polynucleotides and polypeptides which are homologous to, respectively, polynucleotides and polypeptides of the invention, or fragments, variants, or complements thereof. Homologous polynucleotides and polypeptides are generally encoded by homologous genes as described above, and retain significant amino acid residue or nucleotide identity to the genes of the invention. Such polypeptides can be expressed by other organisms such as bacteria, yeast and higher order organisms such as mammals. Various methods of determining amino acid residue or nucleotide identity are known in the art. Homologous polynucleotides or polypeptides can be obtained by in vitro synthesis by expressing genes derived from other bacteria or by mutagenizing genes of the invention. Also included in the definition of “substantially homologous polynucleotides” would be those polynucleotides which, when annealed under conditions known in the art, would remain annealed under moderate wash conditions also known in the art (such as washing in 6×SSPE twice at room temperature and then twice at 37° C.) (Wahl et al. 1987 Methods in Enzymology 152 Academic Press Inc., San Diego).
  • [0013]
    Polynucleotide and polypeptide homology is typically measured using sequence analysis software. See, e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705.
  • [0014]
    By “polynucleotide” or “nucleic acid” is meant a single- or double-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases, or other natural, chemically or biochemically modified or containing non-natural or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups (as typically found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and is thus a oligodeoxynucleoside phosphoramidate (P—NH2) or a mixed phosphoramidate-phosphodiester oligomer (Peyrottes et al. 1996 Nucleic Acids Res 24:1841-8; Chaturvedi et al. 1996 Nucleic Acids Res 24:2318-23; and Schultz et al. 1996 Nucleic Acids Res 24:2966-73). In another embodiment, a phosphorothiate linkage can be used in place of a phosphodiester linkage (Braun et al. 1988 J Immunol 141:2084-9; and Latimer et al. 1995 Mol Immunol 32:1057-1064). In addition, a double-stranded polynucleotide can be obtained from the single-stranded polynucleotide product of chemical synthesis either by synthesizing the complementary strand and annealing the strands under appropriate conditions, or by synthesizing the complementary strand de novo using a DNA polymerase with an appropriate primer.
  • [0015]
    A nucleic acid is said to “encode” an RNA or a polypeptide if, in its native state or when manipulated by methods known to those skilled in the art, it can be transcribed and/or translated to produce the RNA, the polypeptide or a fragment thereof. The anti-sense strand of such a nucleic acid is also said to encode the sequence. The polynucleotides of the present invention comprise those which are naturally-occurring, synthetic or recombinant.
  • [0016]
    A “recombinant” nucleic acid is one which is chemically synthesized or the product of the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Isolated segments within a recombinant nucleic acid can be naturally occurring sequences.
  • [0017]
    By “polynucleotide” or “gene” or “RNA” and the like is meant a polynucleotide encoding or comprising the RNA of the invention, or a homolog, fragment, derivative or complement thereof and having RNA activity as described herein. As is known in the art, a DNA can be transcribed by an RNA polymerase to produce RNA, but an RNA can be reverse transcribed by reverse transcriptase to produce a DNA. Thus a DNA can encode an RNA and vice versa.
  • [0018]
    The invention also encompasses vectors such as single- and double-stranded plasmids or viral vectors comprising RNA, DNA or a mixture or variant thereof, further comprising a polynucleotide of the invention. A wide variety of suitable expression systems are known in the art and are selected based on the host cells used, inducibility of expression desired and ease of use. The non-transcribed portions of a gene and the non-coding portions of a gene can be modified as known in the art. For example, the native promoters can be deleted, substituted or supplemented with other promoters known in the art; transcriptional enhancers, inducible promoters or other transcriptional control elements can be added, as can be replication origins and replication initiator proteins, autonomously replicating sequence (ARS), marker genes (e.g. antibiotic resistance markers), sequences for chromosomal integration (e.g., viral integration sites or sequences homologous to chromosomal sequences), restriction sites, multiple cloning sites, ribosome-binding sites, RNA splice sites, polyadenylation sites, transcriptional terminator sequences, mRNA stabilizing sequences, 5′ stem-loop to protect against degradation, and other elements commonly found on plasmids and other vectors known in the art. Secretion signals from secreted polypeptides can also be included to allow the polypeptide to cross and/or lodge in cell membranes or be secreted from the cell. Such vectors can be prepared by means of standard recombinant techniques discussed, for example, in Sambrook et al. 1989 Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Press, Cold Spring Harbor Laboratory, N.Y.; and Ausubel et al. (eds.), 1987 Current Protocols in Molecular Biology, Greene Publishing Associates, Brooklyn, N.Y.). Many useful vectors are known in the art and can be obtained from vendors including, but not limited to, Stratagene, New England Biolabs, and Promega Biotech.
  • [0019]
    An appropriate promoter and other necessary vector sequences are selected so as to be functional in the chosen host. While prokaryotic host cells are preferred, mammalian or other eukaryotic host cells, including, but not limited to, yeast, filamentous fungi, plant, insect, amphibian or avian species, can also be useful for production of the polypeptides of the present invention. See, Kruse et al. (eds.) 1973 Tissue Culture Academic Press. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al. 1989 or Ausubel et al. 1987; see also, e.g., Metzger et al. 1988 Nature 334:31-36. Examples of commonly used mammalian host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cells, and W138, BHK, and COS cell lines, or others as appropriate, e.g., to provide higher expression, desirable glycosylation patterns, etc.
  • [0020]
    By “bacterial host cell” or “bacteria” or “bacterium” is meant various micro-organism(s) containing at least one chromosome but lacking a discrete nuclear membrane. Representatives include E. coli, Bacillus, Salmonella, Pseudomonas, Staphylococcus and other eubacteria, archaebacteria, chlamydia and rickettsia and related organisms, and the like, and may be spherical, rod-like, straight, curved, spiral, filamentous or other shapes.
  • [0021]
    Vectors suitable for use with various cells can comprise promoters which can, when appropriate, include those naturally associated with genes of the invention. Promoters can be operably linked to a polynucleotide of the invention.
  • [0022]
    A nucleic acid sequence is “operably linked” when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the gene. Generally, operably linked means that the DNA sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.
  • [0023]
    Promoters can be inducible or repressible by factors which respond biochemically to changes in temperature, osmolarity, carbon source, sugars, etc., as is known in the art. Promoters including, but not limited to, the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters can be used in prokaryotic hosts. Useful yeast promoters include, but are not limited to, the promoter regions for metallothionein, 3-phosphoglycerate kinase or other glycolytic enzymes such as enolase or glyceraldehyde-3-phosphate dehydrogenase, enzymes responsible for maltose and galactose utilization. Appropriate foreign mammalian promoters include, but are not limited to, the early and late promoters from SV40 (Fiers et al. 1978 Nature 273:113-120) and promoters derived from murine Moloney leukemia virus, mouse mammary tumor virus, avian sarcoma viruses, adenovirus II, bovine papilloma virus or polyoma. In addition, the construct can be joined to an amplifiable gene (e.g., DHFR) so that multiple copies of the construct can be made. For appropriate enhancer and other expression control sequences suitable for vectors, see also Enhancers and Eukaryotic Gene Expression, Cold Spring Harbor Press: N.Y. 1983.
  • [0024]
    While expression vectors are preferably autonomously replicating, they can also be inserted into the genome of the host cell by methods known in the art. Expression and cloning vectors preferably contain a selectable marker which is a gene encoding a protein necessary under at least one control for the survival or growth of a host cell transformed with the vector. The presence of this gene ensures the growth of only those host cells which express the inserts. Typical selection genes are known in the art and include, but are not limited to, those which encode proteins that (a) confer resistance to antibiotics or other toxic substances, e.g., ampicillin, neomycin, methotrexate, etc.; (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli. The choice of the proper selectable marker depends on the host cell, as appropriate markers for different hosts are well known.
  • [0025]
    As one of skill in the art will understand, the choice in construction and arrangement of markers, promoters, origins of replication, etc. in various vectors of the present invention will be dictated by the desired level and timing of expression of RNA of the invention, with the ultimate goal of regulating the production of metabolic compounds in the host cell.
  • [0026]
    By “protein” or “polypeptide” is meant a polypeptide encoded by the E. coli gene of the invention or a polypeptide substantially homologous thereto and having protein activity. Encompassed by the proteins of the invention are variants thereof in which there have been trivial substitutions, deletions, insertions or other modifications of the native polypeptide which substantially retain protein characteristics, particularly silent or conservative substitutions. Silent nucleotide substitutions are changes of one or more nucleotides which do not change any amino acid of protein. Conservative substitutions include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. Such conservative substitutions are not expected to interfere with biochemical activity, particularly when they occur in structural regions (e.g., alpha helices or beta pleated sheets) of the polypeptide, which can be predicted by standard computer analysis of the amino acid sequence of the protein. Also encompassed by the claimed polypeptides of the invention are polypeptides encoded by polynucleotides which are substantially homologous to a polynucleotide of the invention.
  • [0027]
    Nucleic acids encoding the polypeptides of the present invention include not only native or wild-type sequences but also any sequence capable of encoding the polypeptide, which can be synthesized by making use of the redundancy in the genetic code. Various codon substitutions can be introduced, e.g., silent or conservative changes as discussed above. Due to degeneracy in the genetic code there is some degree of flexibility in the third base of each codon and some amino acid residues are encoded by several different codons. Each possible codon could be used in the gene to encode the protein. While this may appear to present innumerable choices, in practice, each host has a particular preferred codon usage, so that genes can be tailored for optimal translation in the host in which they are expressed. Thus, synthetic genes that encode the proteins of the invention are included in this invention.
  • [0028]
    Techniques for nucleic acid manipulation are described generally, for example, in Sambrook et al. (1989) and Ausubel et al. (1987). Reagents useful in applying such techniques, such as restriction enzymes and the like, are widely known in the art and commercially available from vendors including, but not limited to, New England BioLabs, Boehringer Mannheim, Amersham, Promega Biotech, U.S. Biochemicals, New England Nuclear, and a number of other sources.
  • [0029]
    Nucleic acid probes and primers based on sequences of the invention can be prepared by standard techniques. Such a probe or primer comprises an isolated nucleic acid. In the case of probes, the nucleic acid further comprises a label (e.g., a radionuclide such as 32P ATP or 35S) or a reporter molecule (e.g., a ligand such as biotin or an enzyme such as horseradish peroxidase). The [32P]-ATP, [35S]-dATP and [35S]-methionine can be purchased, for example, from DuPont NEN (Wilmington, Del.). Probes can be used to identify the presence of a hybridizing nucleic acid sequence, e.g., an RNA in a sample or a cDNA or genomic clone in a library. Primers can be used, for example, for amplification of nucleic acid sequences, e.g., by the polymerase chain reaction (PCR). See, e.g., Innis et al. (eds.) 1990 PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego. The preparation and use of probes and primers is described, e.g., in Sambrook et al. (1989) or Ausubel et al. (1987). The genes of homologs of RNA of the invention in other species can be obtained by generating cDNA from RNA from such species using any technique known in the art, such as using Riboclone cDNA Synthesis Systems AMV RT (Promega, Madison, Wis.), then probing such cDNA with radiolabeled primers containing various portions (e.g. 30 or 40 bases long) of the sequences disclosed herein. To obtain homologs of the proteins of the invention, degenerate primers can encode the amino acid sequence of the disclosed E. coli protein but differ in codon usage from the sequences disclosed.
  • [0030]
    Antisense and ribozyme nucleic acids capable of specifically binding to sequences of the invention are also useful for interfering with gene expression.
  • [0031]
    The nucleic acids of the present invention (whether sense or anti-sense, and whether encoding the genes of the invention, or a homolog, variant, fragment or complement thereof) can be produced in large amounts by replication of a suitable recombinant vector comprising DNA sequences in a compatible host cell. Alternatively, these nucleic acids can be chemically synthesized, e.g., by any method known in the art, including, but not limited to, the phosphoramidite method described by Beaucage et al. 1981 Tetra Letts 22:1859-1862, and the triester method according to Matteucci et al. 1981 J Am Chem Soc 103:3191, preferably using commercial automated synthesizers. The purification of nucleic acids produced by the methods of the present invention can be achieved by any method known in the art including, but not limited to, those described, e.g., in Sambrook et al. (1989), or Ausubel et al. (1987). Numerous commercial kits are available for DNA purification including Qiagen plasmid mini DNA cartridges (Chatsworth, Calif.).
  • [0032]
    The nucleic acids of the present invention can be introduced into host cells by any method known in the art, which vary depending on the type of cellular host, including, but not limited to, electroporation; transfection employing calcium chloride, rubidium chloride calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment; P1 transduction; use of suicide vectors; lipofection; infection (where the vector is an infectious agent, such as a retroviral genome); and other methods. See generally, Sambrook et al. (1989), and Ausubel et al. (1987). The cells into which these nucleic acids have been introduced also include the progeny of such cells.
  • [0033]
    A polypeptide “fragment”, “portion”, or “segment” is a stretch of amino acid residues of at least about 7 to 19 amino acids (or the minimum size retaining an antigenic determinant). A fragment of the present invention can comprise a portion of at least 20 amino acids of the protein sequence, at least 30 amino acids of the protein sequence, at least 40 amino acids of the protein sequence, at least 50 amino acids of the protein sequence, or all or substantially all of the protein sequence. In addition, the invention encompasses polypeptides which comprise a portion of the sequence of the lengths described in this paragraph, which further comprise additional amino acid sequences on the ends or in the middle of sequences. The additional amino acid sequences can, for example, comprise another protein or a functional domain thereof, such as signal peptides, membrane-binding moieties, etc.
  • [0034]
    A polynucleotide fragment of the present invention can comprise a polymer of at least six bases or basepairs. A fragment of the present invention can comprise at least six bases or basepairs, at least 10 bases or basepairs, at least twenty bases or basepairs, at least forty bases or base pairs, at least fifty bases or basepairs, at least one hundred bases or basepairs, at least one hundred fifty bases or basepairs, at least two hundred bases or basepairs, at least two hundred fifty bases or basepairs, at least three hundred bases or basepairs of the gene sequence. In addition, the invention encompasses polynucleotides which comprise a portion of the sequence of the lengths described in this paragraph, which further comprise additional nucleic acid sequences on the 5′ or 3′ end or inserted into the sequence. These additional sequences can, for example, encode a coding region of a gene or a functional domain thereof or a promoter.
  • [0035]
    The terms “isolated”, “pure”, “substantially pure”, and “substantially homogenous” are used interchangeably to describe a polypeptide, or polynucleotide which has been separated from components which naturally accompany it. A monomeric protein or a polynucleotide is substantially pure when at least about 60 to 75% of a sample exhibits a single polypeptide or polynucleotide sequence. A substantially pure protein or polynucleotide typically comprises about 60 to 90% by weight of a protein or polynucleotide sample, more usually about 95%, and preferably will be over about 99% pure.
  • [0036]
    Protein or polynucleotide purity or homogeneity may be indicated by a number of means, such as polyacrylamide gel electrophoresis of a sample, followed by visualizing a single band upon staining the gel. For certain purposes higher resolution can be provided by using high performance liquid chromatography (HPLC) or other means well known in the art for purification.
  • [0037]
    An RNA or a protein is “isolated” when it is substantially separated from the contaminants which accompany it in its natural state. Thus, a polypeptide which is chemically synthesized or expressed as a recombinant protein, i.e., an expression product of an isolated and manipulated genetic sequence, is considered isolated. A recombinant polypeptide is considered “isolated” even if expressed in a homologous cell type.
  • [0038]
    A polypeptide can be purified from cells in which it is produced by any of the purification methods known in the art. For example, such polypeptides can be purified by immunoaffinity chromatography employing, e.g., the antibodies provided by the present invention. Various methods of protein purification include, but are not limited to, those described in Guide to Protein Purification, ed. Deutscher, vol. 182 of Methods in Enzymology Academic Press, Inc., San Diego, 1990 and Scopes, 1982 Protein Purification: Principles and Practice Springer-Verlag, New York.
  • [0039]
    Polypeptide fragments of the protein of the invention are first obtained by digestion with enzymes such as trypsin; clostripain, or Staphylococcus protease, or with chemical agents such as cyanogen bromide, O-iodosobenzoate, hydroxylamine or 2-nitro-5-thiocyanobenzoate. Peptide fragments can be separated by reversed-phase HPLC and analyzed by gas-phase sequencing. Peptide fragments are used in order to determine the partial amino acid sequence of a polypeptide by methods known in the art including but not limited to, Edman degradation.
  • [0040]
    The present invention also provides polyclonal and/or monoclonal antibodies capable of specifically binding to a polypeptide of the invention, or homolog, fragment, complement or derivative thereof. Antibodies can also be produced which bind specifically to a polynucleotide of the invention, such as an RNA of the invention or homolog, fragment, complement or derivative thereof, and may be produced as described in, for example, Thiry 1994 Chromosoma 103:268-76; Thiry 1993 Eur J Cell Biol 62:259-69; Reines 1991 J Biol Chem 266:10510-7; Putterman et al. 1996 J Clin Invest 97:2251-9; and Fournie 1996 Clin Exp Immunol 104:236-40. Antibodies capable of binding to polypeptides or polynucleotides of the invention can be useful in detecting protein, in titrating protein, for quantifying protein, for purifying protein or polynucleotide, or for other uses.
  • [0041]
    For production of polyclonal antibodies, an appropriate host animal is selected, typically a mouse or rabbit. The substantially purified antigen, whether the whole polypeptide, a fragment, derivative, or homolog thereof, or a polypeptide coupled or fused to another polypeptide, or polynucleotide or homolog, derivative, complement or fragment thereof, is presented to the immune system of the host by methods appropriate for the host, commonly by injection into the footpads, intramuscularly, intraperitoneally, or intradermally. Peptide fragments suitable for raising antibodies can be prepared by chemical synthesis, and are commonly coupled to a carrier molecule (e.g., keyhole limpet hemocyanin) and injected into a host over a period of time suitable for the production of antibodies. The sera are tested for immunoreactivity to the protein or fragment. Monoclonal antibodies can be made by injecting the host with the protein polypeptides, fusion proteins or fragments thereof and following methods known in the art for production of such antibodies (Harlow et al. 1988 Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratories).
  • [0042]
    An immunological response is usually assayed with an immunoassay, a variety of which are provided, e.g., in Harlow et al. 1988, or Goding 1986 Monoclonal Antibodies: Principles and Practice, 2d ed., Academic Press, New York), although any method known in the art can be used.
  • [0043]
    Monoclonal antibodies with affinities of 108 M−1, preferably 109 to 1010, or stronger are made by standard procedures as described, e.g., in Harlow et al. 1988, or Goding 1986. Briefly, appropriate animals are immunized with the antigen by a standard protocol. After the appropriate period of time, the spleens of such animals are excised and individual spleen cells fused to immortalized myeloma cells. Thereafter the cells are clonally separated and the supernatants of each clone are tested for their production of an appropriate antibody specific for the desired region of the antigen.
  • [0044]
    Other suitable techniques of antibody production include, but are not limited to, in vitro exposure of lymphocytes to the antigenic polypeptides or selection of libraries of antibodies in phage or similar vectors (Huse et al. 1989 Science 246:1275-1281).
  • [0045]
    Frequently, the polypeptides and antibodies are labeled, either covalently or noncovalently, with a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known. Suitable labels include, but are not limited to, radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles. Also, recombinant immunoglobulins can be produced by any method known in the art.
  • [0000]
    Identification of Novel Small RNAs Using Comparative Genomics and Microarrays
  • [0046]
    As a starting point for detecting novel sRNAs in E. coli, we considered a number of common properties of the previously identified sRNAs that might serve as a guide to identify genes encoding new sRNAs. We are defining sRNA as relatively short RNAs that do not function by encoding a complete ORF. Of the 13 small RNAs known when this work begun, we were struck by the high conservation of these genes between closely related organisms. In most cases, the conservation between E. coli and Salmonella was above 85%, whereas that of the typical gene encoding an ORF was frequently below 70%. Conservation tests on random noncoding regions of the genome suggested that extended conservation in intergenic regions was unusual enough to be used as an initial parameter to screen for new sRNA genes. We therefore tested this approach to look for novel sRNAs in the E. coli genome.
  • [0047]
    All known sRNAs are encoded within intergenic (Ig) regions (defined as regions between ORFs). A file containing all Ig sequences from the E. coli genome (Blattner, F. R. et al. 1997 Science 277:1453-1474) was used as a starting point for our homology search. We arbitrarily chose the 1.0- to 2.5-Mb region of the 4.6-Mb E. coli genome to test and refine our approach and developed the following steps for searching the full E. coli genome.
  • [0048]
    All Ig regions of 180 nucleotides (nt) or larger were compared to the NCBI Unfinished Microbial Genomes database using the BLAST program (Altschul, S. F. et al. 1990 J Mol Biol 215:403-410). These 1097 Ig regions were rated based on the degree of conservation and length of the conserved region when compared to the closely related Salmonella and Klebsiella pneumoniae species. The highest rating was given to Ig regions with a high degree of conservation (raw BLAST score of >80) over at least 80 nt (see below for explanation of ratings). Note that most promoters do not meet these length and conservation requirements. FIG. 1 shows a set of BLAST searches for three known sRNAs (RprA RNA, CsrB RNA, OxyS RNA), three Ig regions with high conservation (#14, #17, #52) and one Ig region with intermediate conservation (#36). Some Ig regions had a large number of matches, often to several chromosomal regions of the same organism. These Ig regions were noted and many were found to contain tRNAs, rRNAs, REP, or other repeated sequences. The 40 highly conserved Ig regions containing tRNAs and/or rRNAs were eliminated from our search, as these regions were complicated in their patterns of conservation.
  • [0049]
    Next the orientation and identity of the ORFs bordering the Ig regions were determined using the Colibri database, an annotated listing of all E. coli genes and their coordinates. Inconsistencies between the Colibri database and our original file led to the reclassification of some Ig regions as shorter than 180 nt, and these were not analyzed further. Of the remaining 1006 Ig regions, 13 contained known small RNAs, 295 were in the highest conservation group, 88 showed intermediate conservation, and 610 showed no conservation.
  • [0050]
    The location of the conservation relative to the orientation of the flanking ORFs was an important consideration in choosing candidates for further analysis. In many cases (132/295 Ig regions), the conserved region was just upstream of the start of an ORF, consistent with conservation of regulatory regions, including untranslated leaders. Cases where the conserved region was >50 nt from an ORF start or extended over more than 150 nt in length (RprA RNA, CsrB RNA, OxyS RNA, #17, and #52 in FIG. 1), or where the bordering ORFs ended rather than started at the Ig region (#14 in FIG. 1), were considered better candidates for novel sRNAs.
  • [0051]
    Published information on promoters and other known regulatory sites within conserved regions of promising candidates was tabulated and used to eliminate many candidates in which the conservation could be attributed to previously identified promoter or 5′ untranslated leaders. Finally, the remaining candidate regions were examined for sequence elements such as potential promoters, terminators, and inverted repeat regions. We considered evidence for possible stem-loops, in particular those with characteristics of rho-independent terminators, as especially indicative of possible sRNA genes (Table 1).
  • [0052]
    Using these criteria, together with microarray expression data (see below), a set of 59 candidates was selected (Table 1). Candidates 1-18 were chosen in the first round of screening of the 1.0- to 2.5-Mb region; some of these candidates would not have met the higher criteria applied to the rest of the genome.
    TABLE 1
    sRNA Candidates
    Ig Ig Flanking Selection Microarray Northern Interpretation of
    No.a Start Length Genes Strandb Criteriac Detectiond Detectione Conservationf
    1 1019277 359 ompA/sulA << C (4), S < large known ompA leader
    2 1102420 754 csgD/csgB <> C (4), L none faint large known csgD leader, promoter
    3 1150625 213 fabG/acpP >> C* (4), S > multiple, 300+ nt known acpP mRNA & operon
    4 1194145 201 ymfC/icd <> C* (0), S > large leader
    5 1297345 476 adhE/ychE <> C (4), L none large known adhE leader
    6 1298466 740 yhcE/oppA >> C (2), L, S > large + faint others leader, promoter?
    7 1328693 376 yciN/topA <> C (4) none large known leader, promoter
    8 1407055 480 ydaN/dbpA >> C (4), L none none predict sRNA
    9 1515024 314 ydcW/ydcX >> C (4), L, S <, > 180 nt (<) mRNA, 31 aa ORF
    10 1671526 411 ydgF/ydgG <> C (4), L, T none none promoter/leader?
    11 1755132 313 pykF/lpp >> C (4) > (rif) 300 nt known lpp mRNA
    12 1762411 550 ydiC/ydiH << C(4), T none 60 nt (<) sRNA
    13 1860454 341 yeaA/gapA <> C (4), S > (rif) large known gapA leader,
    promoter?
    14 2165049 278 yegQ/orgK >< C (4), L, S > 86 nt (>) sRNA
    15 2276258 335 yejG/bcr << C (4), L, S < large leader
    16 2403093 633 nuoA/lrhA << C (4), L, S < large + 300 nt known processed leader
    17 2588726 540 acrD/yffB >> C (4), S, I < 175, 266 nt (<) mRNA, 19 aa ORF
    18 1339749 196 yciM/pyrF >> C (3), S* none none promoter/leader?
    19 450835 462 cyoA/ampG << C (4), S* > faint large promoter/leader?
    20 753692 708 gltA/sdhC <> C* (4), S < (rif) faint large known gltA, sdhC leaders
    21 986206 605 ompF/asnS << (4), S*, I, P, T < (rif), > large known ompF leader, promoter
    22 2651357 823 sseA/sseB >< C (4), L, S, I, T > (rif) 320 nt (>) sRNA
    24 3348110 223 elbB/arcB << C* (4), S* <, > 45 nt (>) sRNA
    25 3578437 332 yhhX/yhhY <> C (4), L, P, T none 90 nt (<) sRNA
    26 3983621 681 aslA/hemY << C (4), T > 210 nt (>) sRNA
    27 4275510 548 soxR/yjcD >> C (4), L, S*, T < 140 nt (<) sRNA
    28 4609568 412 osmY/yjjU >> C (4), L, S* <, > (rif) 350 nt (>) mRNA, 53 aa ORF
    29 454011 346 bolA/tig >> C* (4), S, I > (rif). large leader or operon
    30 668152 370 ybeB/cobC << C (4), L, S*, I, P <, >(rif) large (>) leader/promoter?
    31 887180 180 ybjK/ybjL >< C (4), L none 80 nt (<) sRNA
    32 2590752 343 dapE/ypfH >< C (0), L, S <, > none 66 aa ORF
    33 2967000 684 ygdP/mutH <> C* (4) none none promoter/leader?
    34 3672003 413 yhjD/yhjE >> C* (4) none none promoter/leader?
    35 3719676 284 yiaZ/glyS << C (4), L, P none large leader/promoter?
    36 3773784 508 mtlR/yibL >> (2), S* < (rif) 500 nt (<) mRNA, 69 aa ORF
    37 4638109 402 yjjY/lasT >> C (4), L, P, F > none/faint known arcA leader
    38 4048313 614 yihA/yihI <> C* (4), S, T > (rif) 270 nt (>) sRNA
    39 279100 512 afaB/yagB << C (4), L, S* <, > faint large IS30, leader/promoter?
    40 852161 245 b0816/ybiQ <> C (4), L, P none 205 nt (<) sRNA
    41 2974037 584 aas/galR <> C (4), L, S, T <, > 89, 83 nt (<) sRNA
    42 2781229 432 pinH/ypjB << C(1), L, T none none not conserved
    43 3192539 424 yqiK/rfaE >< C*(4), L, S <, > none predicted sRNA
    44 3245066 347 exuR/yqjA >> C (4), L > none promoter/leader?
    45 3376287 221 rplM/yhcM << C* (4), (S), T < (rif) large leader
    46 2531398 386 cysK/ptsH >> C (4), S*, T <, > (rif) large known ptsH leader
    47 4403561 207 purA/yjeB >> C (4), S*, I > large leader/promoter?
    48 1239170 391 dadX/ycgO >< C (4), L none none IS end
    49 1306670 373 cls/kch << C* (4) none 250 nt (>) mRNA, 57 aa ORF
    50 1620541 446 ydeE/ydeH >< C (4), L, I > 185, 220 nt (>) mRNA, 31 aa ORF
    51 1903281 377 yobD/yebN >> C (4), L none none promoter/leader?
    52 1920997 395 pphA/yebY << C (4), L, S* <, > 275 nt (>), sRNA
    100 nt (<)
    53 1932629 237 edd/zwf << C (4) < none promoter/leader?
    54 2085091 263 yeeF/yeeY << C (4), T < large leader
    55 2151151 740 yegL/yegM <> C (4), L > 143 nt + others(>) sRNA
    56 2494583 497 ddg/yfdZ >< C (4), L < none known ORF
    57 3717395 283 yiaG/cspA >> C*(4), S* <, > large known cspA leader
    58 4177159 415 rplA/rplJ >> C (4), S* <, > large known operon
    59 1668974 396 ynfM/asr >> (2), S* < none promoter/leader?
    60 2033263 591 yedS/yedU >> (1), S* <, > none not conserved
    61 3054807 394 ygfA/serA >< (1), D <, > 139 nt (>) sRNA

    aCandidate numbers. #23 was not analyzed; the region of conservation corresponds to a published leader sequence. Candidate #61 was added because it is homologous to candidate #43 and the duplicated regions within #55 (see Text and Table 2).

    bOrientation of flanking genes. > and < denote genes present on the clockwise (Watson) or counterclockwise (Crick) strand of the E. coli chromosome, respectively.

    cCriteria used for selection of candidates: C, conservation; C*, long conservation; (#), conservation score. Ig regions were assigned scores on the basis of BLAST searches (see text below). #4 and #32 were rerated from 4 (conserved) to 0 on reanalysis of the endpoints of the flanking ORF (#4) and information on an ORF within the Ig region (#32). L, location of
    # conservation either far from 5′ end of flanking gene or near 3′ end of gene; S, signal detected in microarray experiments; S*, microarray signal on opposite strand to flanking genes; I, inverted repeat; P, predicted promoter; T, predicted terminator; D, duplicated gene.

    dDetection on high-density oligonucleotide probe arrays. ><, orientation of signal as in b. Rif, signals present after 20 min treatment with rifampicin.

    eNorthern analysis of RNA extracted from MG1655 cells grown in three conditions (LB medium, exponential phase; minimal medium, exponential phase; LB medium, stationary phase). Strand specific probes were used for sRNA and mRNAs encoding novel ORFs (orientation noted < or > as in b); double stranded DNA probes were used for the rest. For #43, bands were originally detected with a double stranded probe, but appear to be from homologs (see text). Large, >400 nt.

    finterpretation of high conservation was based on microarray and Northern analyses as well as literature. mRNAs, small RNA transcripts predicted to encode new polypeptides (see text). “known leaders”, literature references supported the existence of leaders corresponding to conservation. For # 37, conservation is consistent with the leader of the arcA gene (Compan, I. and Touati, D.
    # 1994 Mol Microbiol 11: 955-964). The ORF noted for #56 is described in Seoane, A. S. and Levy, S. B. 1995 J Bacteriol 177: 530-535; and Bouvier, J. et al. 1992 J Bacteriol 174: 5265-5271; see GenBank entry BAA16347.1. The IS sequence fragment in the conserved region of #48 is homologous to that described by McVeigh, A. et al. 2000 Infect Immun 68: 5710-5715. “leaders”, a large band on Northern analysis, coupled with conservation near the
    # 5′ end of an ORF. “promoter/leade coupled with conservation near the 5′ end of a gene. “leader/promoter?”, RNA signal from microarray or Northern analyses suggested a leader, while the conservation is far from the expected position of a leader. “leader or operon”, (for #29) microarray analysis suggested a continuous transcript throughout Ig. “predicted sRNAs”, (for #8 and #43) Igs contain the hallmarks expected for an
    # sRNA, but RNA transcripts were not detected. Igs encoding sRNAs also may include leaders; this is not included in the conclusion column.

    Selecting Candidate Genes by Whole Genome Expression Analysis
  • [0053]
    In an independent series of experiments, high-density oligonucleotide probe arrays were used to detect transcripts that might correspond to sRNAs from Ig regions. Total RNA isolated from MG1655 cells grown to late exponential phase in LB medium was labeled for probes or used to generate cDNA probes (see text below). From a single RNA isolation each labeling approach was carried out in duplicate and individually hybridized to high-density oligonucleotide microarrays. The high-density oligonucleotide probe arrays used are appropriate for this analysis as they have probes specific for both the clockwise (Watson) and counterclockwise (Crick) strands of each Ig region as well as for the sense strand of each ORF. The resulting data from the four experiments were analyzed to examine global expression within Ig regions, as well as neighboring ORFs.
  • [0054]
    Our criteria for analyzing the microarray data evolved during the course of this analysis. Stringent criteria (longer transcripts in the Ig region, higher expression levels) identified many of the previously known sRNAs but did not uncover many strong candidates for new small RNAs. More relaxed criteria (shorter transcripts, lower expression levels) gave a very large number of candidates and therefore were not by themselves useful as the initial basis for identifying candidates. However, this data was very useful as an additional criterion for selection of candidate regions based on the conservation approach. Detection of a transcript by microarray on the strand opposite to that of surrounding ORFs was considered a strong indicator of an sRNA (S* in Table 1). Microarray data contributed to the selection of 34 of 59 candidates (Table 1). Examples of the different types of expression observed in microarray experiments are shown in FIG. 2. Signal corresponding to CsrB RNA clearly is detected on the Crick (C) strand. #17 and #36 have a transcript in the Ig region on the opposing strand (C) to that for the flanking genes (Watson; W). However, the expression patterns were not as obvious in many cases, either because expression levels were low or because the pattern of expression could be interpreted in a number of ways. For instance, very little expression was detected for RprA RNA encoded on the W strand, and there is unexplained signal detected from the opposite strand of the rprA and csrB Ig regions. #14 and #52 also had some expression on each strand (FIG. 2). #14 proved to express a small RNA from the Watson strand, while #52 expresses sRNAs from each strand (see below and Table 2).
  • [0055]
    Given that a number of the known sRNAs are relatively stable, we tested whether selection for stable RNAs might allow the microarray data to be more useful for de novo identification of sRNA candidates. The transcription inhibitor rifampicin was added to cells for 20 min prior to harvesting the RNA with the intention of enriching for stable RNAs. Many of the known sRNAs can be detected after the rifampicin treatment. Of the 59 candidates in Table 1 twelve retained a hybridization signal (marked rif in Table 1), and four of these proved to correspond to small transcripts (see below). Other rif resistant transcripts detected in Ig regions appeared to be due to highly expressed leaders.
    TABLE 2
    Novel sRNAs and Predicted Small ORFsa
    Effect on
    RNA Hfq rpoS-lacZh
    No. Gene Minute Sizeb,c,d Strande Expressionf Bindingg S M Other Informationj
    12 rydB 38  60b <<< M >> S > E NT 0.4 1.0
    14 ryeE 47  86b >>< E, S > M + (E) 0.25 1.2 bordered by cryptic prophage
    22 ryfA 57 320c >>< E, M NT NT NT PAIR3 (Rudd, K. E. 1999 Res Microbiol
    150: 653-664)
    24 ryhA 72  45b <>< S >> M > E + (S) 1.0 1.9 105, 120 nt, present S >> M > E
    105 nt binds Hfq (+, S)
    25 ryhB 77  90b <<> M >> S + (M) 1.2 0.4 multicopy plasmid restricts growth on
    succinate
    26 ryiA 86 210b <>< E > M, S + (E) 0.9 1.5 155 nt, present M > E, S
    27 ryjA 92 140b ><> S >> M − (S) NT NT
    31 rybB 19  80b ><< S >> M + (S) 1.0 2.3
    38 ryiB 87 270b <>> M > S >> E − (M) 1.0 1.6 CsrC (Romeo, pers. commun.)
    40 rybA 18 205b ><> S > M > E − (S) 1.2 1.5 ladder up from 255, 300 nt, present S > M > E
    41-I rygA 64  89b <<> S >> M, E + (S) 1.3i 1.7i PAIR2 (Rudd, K. E. 1999 Res Microbiol
    150: 653-664)
    41-II rygB 64  83b <<> S, E > M + (S) 1.3i 1.7i PAIR2 (Rudd, K. E. 1999 Res Microbiol
    150: 653-664)
    52-I ryeA 41 275b <>< M > E > S −/+ (M) 1.1i 1.0i 148, 152, 180 nt (+ others),
    present M, S
    52-II ryeB 41 100b <<< S >> M + (S) 1.1i 1.0i 70 nt, present S >> M
    55-I ryeC 46 143c <>> S > M > E NT 1.2 1.6 QUAD1a (Rudd, K. E. 1999 Res
    107c M > E, S Microbiol 150: 653-664)
    55-II ryeD 46 137c <>> M > E > S NT NT NT QUAD1b (Rudd, K. E. 1999 Res
    102c M > E Microbiol 150: 653-664)
    61 rygC 65 139c >>< S >> M > E NT NT NT QUAD1c (Rudd, K. E. 1999 Res
    107c S, M > E Microbiol 150: 653-664)
     8 rydA 30 139d >(>)> none NT NT NT Expression not detected;
    predicted sRNA
    43 rygD 69 143d >(<)< none NT NT NT QUAD1d (Rudd, K. E. 1999 Res
    Microbiol 150: 653-664)
    Expression not detected
     9 yncL 32 180b ><> S > M > E +/− (S) NT NT 31 aa ORF
    17 ypfM 55 266b ><> E >> M −/+ (E) 2.0 1.5 19 aa ORF
    175 nt, present E, M
    28 ytjA 99 305b >>> S > M NT NT NT 53 aa ORF
    36 yibT 81 500b ><> S >> E, M NT 1.3 1.0 69 aa ORF
    49 yciY 28 250b <>< E, M NT NT NT 57 aa ORF
    50 yneM 35 185b >>< S NT NT NT 31 aa ORF
    220b M > E

    aTable is divided into three sections: detected sRNAs, predicted sRNAs and detected RNAs predicted to encode small ORFs.

    b,c,dRNA sizes estimated from Northern analyses using b single stranded RNA probes or c oligonucleotide probes, or dfrom predictions resulting from sequence analysis (see text).

    e>< denotes orientation of sRNA and flanking genes as in Table 1.

    fRelative expression in three growth conditions: E, LB medium, exponential phase; M, minimal medium, exponential phase; and S, LB medium, stationary phase.

    gRNA coimmunoprecipitation with Hfq as detected by Northern analysis: +, strong binding (>30% of RNA bound); +/−, weak binding (5-10%); −/+, minimal binding (<5%), and −, no detectable binding. E, M, S refer to cell growth conditions as in f.

    NT, not tested.

    hExpression of rpoS-lacZ fusion in the presence of multicopy plasmids carrying intergenic regions. Activity was measured in stationary phase in LB medium (S) or minimal medium (M) and normalized to the activity of the vector control in the same experiment. In parallel experiments, cells carrying the vector alone gave 1.3-2 (S) and 0.7-2.6 (M) units, cells carrying pRS-
    # DsrA plasmid gave a 4.9 fold increase (S) and 12 fold increase (M); cells carrying pRS-RprA plasmid gave 3.1 fold (S) and 3.3 fold (M) increase. Results in table are average of at least three independent assays. Values in bold were considered significantly different from the control. NT, not tested.

    i#41 and #52 each express two sRNAs so it is not possible to assign a phenotype to a given small RNA. Thus far there is no evidence for a strong phenotype for either candidate.

    jIncluded is information about additional RNA bands detected in Northern analysis.

    Small RNA Transcripts Detected by Northern Hybridization
  • [0056]
    The final test for the presence of an sRNA gene was the direct detection of a small RNA transcript. The candidates in Table 1 were analyzed by Northern hybridization using RNA extracted from MG1655 cells harvested from three growth conditions (exponential phase in LB medium, exponential phase in M63-glucose medium, or stationary phase in LB medium). The microarray analysis discussed above used RNA isolated from cells grown to late exponential phase in LB medium, which is intermediate between the two LB growth conditions used for the Northern analysis. Initially, Northern analysis was carried out using double-stranded DNA probes containing the full Ig region for most candidates. In three cases (#8, #22, and #55) PCR amplification of the Ig region to generate a probe was not successful and therefore oligonucleotide probes were used for Northern analysis. Seventeen candidates gave distinct bands consistent with small RNAs, and one additional candidate gave a somewhat larger RNA, but the location of conservation was not consistent with a leader sequence for a flanking ORF (#36). In some of these cases, two or more RNA species were detected with a single Ig probe (Table 2, see also FIG. 3). One candidate (#43) gave a signal with the double stranded DNA probe, but contains regions duplicated elsewhere in E. coli that probably account for this signal (see below). Of the remaining 41 candidates, 17 gave no detectable transcript. These Ig regions could encode sRNAs expressed only under very specific growth conditions. For instance, #8 has all the sequence hallmarks of an sRNA gene (a well-conserved region preceded by a possible promoter and ending with a terminator), but has not been detected. Alternatively, the observed conservation could be due to nontranscribed regulatory regions. Fairly large RNAs were detected for another 24 candidates. Given the size of these transcripts together with data on the orientation of flanking genes and the location of conserved regions, it is likely these are leader sequences within mRNAs (Table 1).
  • [0057]
    For candidates expressing RNAs not expected to be 5′ untranslated leaders, Northern analysis was carried out with strand-specific probes to determine gene orientation (FIG. 3). For many of the candidates, we used sequence elements (see below) as well as expression information from the microarray experiments to predict which strand was most likely expressed; both strands were tested when predictions were unclear. The results from the strand-specific probes generally agreed with predictions and were used to estimate the RNA size (Table 2). Interestingly, in one case there is an sRNA expressed from both the W and C strand within the Ig (#52; FIG. 3). For #12, although no sRNA had been detected using a double stranded DNA probe, the presence of a potential terminator and promoter remained suggestive of the presence of an sRNA gene. Therefore, oligonucleotide probes also were used in Northern analysis of this candidate, and a small RNA transcript was detected (FIG. 3; Table 1).
  • [0058]
    Examination of expression profiles of the RNAs under different growth conditions gave an indication of specificity of expression. Some candidates were detected under all three growth conditions; others were preferentially expressed under one growth condition (FIG. 3; Table 2). For instance, #25 was present primarily during growth in minimal medium, consistent with the absence of detection in the whole genome expression experiment, which analyzed RNA isolated from cells grown in rich medium.
  • [0000]
    Sequence Predictions of sRNA Genes and ORFs
  • [0059]
    For the candidates expressing small RNA transcripts, the conserved sequence blocks (contigs) from K. pneumoniae, the highest conserved Salmonella species, and in a few cases Yersinia pestis, were selected from the NCBI Unfinished Microbial Genome database and aligned with the E. coli Ig region using GCG Gap (Devereux, J. et al. 1984 Nucleic Acids Res 12:387-395). Multiple alignments were assembled by hand, and the conserved regions were examined for likely promoters and terminators and other conserved structures. Information from the alignments, together with results from strand-specific Northern and microarray expression analyses, allowed assignments of gene orientation, putative regulatory regions, and RNA length from the predicted starting and ending positions. Where a terminator sequence was very apparent (13 of 19 candidates), transcription was assumed to end at the terminator, and the observed size of the transcript was used to help identify possible promoters. The identification of promoters and terminators was less definite when there was only one species with conservation to E. coli.
  • [0060]
    As the alignments were assembled, the pattern of conservation in some cases was reminiscent of patterns expected from ORFs, with higher sequence variation in positions consistent with the third nucleotide of codons. GCG Map (Devereux, J. et al. 1984 Nucleic Acids Res 12:387-395) was used to predict translation in all frames for all of the candidate small RNAs. In six cases, the conservation and translation potential suggested the presence of a short ORF. In these cases, a ribosome-binding site and the potential ORF were well conserved, with the most variation in the third position of codons, but other elements of the predicted RNA were less well conserved. For example, #17 expresses an RNA of about 266 nt, containing a predicted ORF of only 19 amino acids. Within the predicted Shine-Delgarno sequence and ORF, only 9/80 positions showed variation for either Klebsiella or Salmonella, while the overall RNA is less than 60% conserved. We predict that for #17, as well as five others (Table 2), the detected RNA transcript is functioning as an mRNA, encoding a short, conserved ORF. An evaluation of both the new predicted ORFs and the untranslated sRNAs with GLIMMER, a program designed to predict ORFs within genomes, gave complete agreement with our designations (Delcher, A. L. et al. 1999 Nucleic Acids Res 27:4636-4641).
  • [0061]
    We have assigned gene names to all candidates that we have confirmed are expressed as RNAs (see Table 2). The genes we predict to encode ORFs were given names according to accepted practice for ORFs (Rudd, K. E. 1998 Microbiol Mol Biol Rev 62:985-1019). The genes that express sRNAs without evidence of conserved ORFs were named with a similar nomenclature: ryx, with ry denoting RNA and x indicating the 10 min interval on the E. coli genetic map.
  • [0062]
    We noted one instance of overlap in sequence between our new sRNAs. The conserved region within #43 is highly homologous to a duplicated region within #55, as well as to a fourth region of the chromosome within a more poorly conserved Ig (#61 in Table 1). This repeated region was previously denoted the QUAD repeat and suggested to encode sRNAs (Rudd, K. E. 1999 Res Microbiol 150:653-664). Each of the QUAD repeats contains a short stretch homologous to boxC, a repeat element of unknown function present in 50 copies or more within the genome of E. coli (Bachellier, S. et al. 1996 Repeated Sequences In: Escherichia coli and Salmonella: Cellular and Molecular Biology eds. F. C. Neidhardt, et al. pp. 2012-2040 American Society for Microbiology, Washington, D.C.). Rudd also has detected transcripts from the QUAD regions. To determine which of the four QUAD genes was being expressed, we designed oligonucleotide probes unique for each of the four repeats. These oligonucleotide probes demonstrated expression for three of the four QUAD genes (#55-I, #55-II, and #61); furthermore, each gave two RNA bands (FIG. 3; Table 2). No signal was detected for the fourth repeat (#43). The #41 Ig region encodes another pair of repeats, PAIR2 (Rudd, K. E. 1999 Res Microbiol 150:653-664), and we observed two RNA species, suggesting that each of the repeats may be transcriptionally active. Finally, another repeat region noted by Rudd, PAIR3, is encoded by the #22 Ig region.
  • [0000]
    Many sRNAs Bind Hfq and Modulate rpoS Expression
  • [0063]
    Hfq is a small, highly abundant RNA-binding protein first identified for its role in replication of the RNA phage Qβ (Franze de Fernandez, M. et al. 1968 Nature 219:588-590; reviewed in Blumenthal, T. and Carmichael, G. G. 1979 Annu Rev Biochem 48:525-548). Recently, Hfq has been shown to be involved in a number of RNA transactions in the cell, including translational regulation (rpoS), mRNA polyadenylation, and mRNA stability (ompA, mutS, and miaA) (Muffler, A. et al. 1996 Genes & Dev 10:1143-1151; Tsui, H.-C. T. et al. 1997 J Bacteriol 179:7476-7487; Vytvytska, O. et al. 1998 PNAS USA 95:14118-14123; Hajndsorf, E. and Regnier, P. 2000 PNAS USA 97:1501-1505; Vytvytska, O. et al. 2000 Genes & Dev 14:1109-1118). Three of the known E. coli sRNAs regulate rpoS expression: DsrA RNA and RprA RNA positively regulate rpoS translation, whereas OxyS RNA represses its translation. In all three cases the Hfq protein is required for regulation (Zhang, A. et al. 1998 EMBO J. 17:6061-6068; Majdalani, N. et al. 2001 Mol Microbiol 39:1382-1394; Sledjeski, D. D. et al. 2001 J Bacteriol 183:1997-2005), and binding studies have revealed a direct interaction between Hfq and the OxyS and DsrA RNAs (Zhang, A. et al. 1998 EMBO J17:6061-6068; Sledjeski, D. D. et al. 2001 J Bacteriol 183:1997-2005).
  • [0064]
    Given the interaction of the Hfq protein with at least three of the known sRNAs, we asked how many of the newly discovered sRNAs are bound by this protein. Hfq-specific antisera was used to immunoprecipitate Hfq-associated RNAs from extracts of cells grown under the conditions used for the Northern analysis. Total immunoprecipitated RNA was examined using two methods. First, RNA was 3′-end labeled and selected RNAs were visualized directly on polyacrylamide gels. Under each growth condition, several RNA species co-immunoprecipitated with Hfq-specific sera but not with preimmune sera, which indicates that many sRNAs interact with Hfq (FIG. 4A). Second, selected RNAs were examined using Northern hybridization to determine whether other known sRNAs and any of our newly discovered sRNAs interact with Hfq. For each sRNA, Hfq binding was examined under growth conditions where the sRNA was most abundant (FIG. 4B; Table 2). sRNAs present in samples using the Hfq antisera but not preimmune sera were concluded to interact with Hfq. Comparison of levels of a selected sRNA relative to the total amount of that sRNA in the extract revealed that many of the sRNAs bound Hfq quite efficiently (>30% bound) (#14, #24, #25, #26, #31, #41, #52-II, Spot42 RNA, and RprA RNA), but other sRNAs bound Hfq less efficiently (<10% bound) (#9, #17, and #52-I), or not at all (#27, #38, #40, 6S RNA, 5S RNA, and tmRNA) (FIG. 4; Table 2).
  • [0065]
    As mentioned above, at least three of the known sRNAs that interact with Hfq also regulate translation of rpoS, the stationary phase sigma factor. In light of the fact that many of the new sRNAs also interact with Hfq, we examined whether these new sRNAs affect rpoS expression. Plasmids carrying the Ig regions encoding either control sRNAs (pRS-DsrA and pRS-RprA) or many of our novel sRNAs were introduced into an MG1655 Alac derivative carrying a rpoS-lacZ translational fusion. We then compared expression of the rpoS-lacZ fusion in these cells to cells carrying the control vector by measuring β-galactosidase activity at stationary phase in LB or M63-glucose medium (Table 2). As expected, overproduction of either DsrA RNA or RprA RNA increased rpoS-lacZ expression significantly (Table 2 legend). A number of plasmids (pRS-#24, pRS-#31) led to increased rpoS-lacZ expression, whereas others (pRS-#12, pRS-#14, and pRS-#25) led to decreased expression. These results indicate that the corresponding sRNAs may directly regulate rpoS expression or indirectly affect rpoS expression by altering Hfq activity, possibly by competition. Intriguingly, there is not a complete correlation between Hfq binding and altered rpoS-lacZ expression in these studies.
  • [0066]
    As another strategy in defining possible functions for the sRNAs, we screened strains carrying the multicopy plasmids for effects on growth in LB medium at various temperatures as well as growth in minimal medium containing a number of different carbon sources. pRS-#25 renders cells unable to grow on succinate in agreement with predictions for #25 RNA interaction with sdh mRNA (discussed below). We were unable to isolate plasmids carrying the #27 Ig region without mutations, indicating that overproduction of this small RNA may interfere with growth. No other growth phenotypes were observed. A caveat for the interpretation of results with the multicopy plasmids is that they contain the full intergenic region, therefore we cannot rule out effects of sequences outside the sRNA genes but within the intergenic regions.
  • [0067]
    In summary, a multifaceted search strategy to predict sRNA genes was validated by our discovery of 17 novel sRNAs. Northern analysis determined that 44 of 60 candidate regions express RNA transcripts, some of them expressing more than one RNA species. Of these transcripts, 24 were concluded to be 5′ untranslated leaders for mRNAs of flanking genes, and another six are predicted to encode new, short ORFs (Tables 1 and 2). The 17 transcripts believed to be novel, functional sRNAs range from 45 nt to 320 nt in length and vary significantly in expression levels and expression profiles under different growth conditions. More than half of the new sRNAs were found to interact with the RNA-binding protein Hfq, indicating that Hfq binding may be a defining characteristic of a family of prokaryotic sRNAs.
  • [0000]
    Evaluation of Selection Criteria
  • [0068]
    Three general approaches for predicting sRNA genes were evaluated in this work. In the primary approach, Ig regions were scored for degree and length of conservation between closely related bacterial species followed by examination of sequence features. This approach proved to be very productive in identifying Ig regions encoding novel sRNAs in E. coli; more than 30% of the candidates selected primarily on the basis of their conservation proved to encode novel small transcripts. The availability of nearly completed genome sequences for Salmonella and Klebsiella made this approach possible. Any organism for which the genome sequences of closely related species are known can be analyzed in this way. Comparative genomics of this sort have been used before to search for regulatory sites (for review, see Gelfand, M. S. 1999 Res Microbiol 150:755-771), but have not been employed previously to find sRNAs.
  • [0069]
    Although we found the conservation-based approach to be the most productive in identifying sRNA genes, we note a number of limitations to its use. A high level of conservation is not sufficient to indicate the presence of an sRNA gene. Many of the most highly conserved regions, not unexpectedly, were consistent with regulatory and leader sequences for flanking genes. We also did not analyze any Ig regions where conservation was attributable to sources other than an sRNA. For example, potential sRNAs processed from mRNAs, or any sRNAs encoded by the antisense strand of ORFs or leaders, may have been missed in our approach. We made the assumption that Ig regions must be >180 nt to encode an sRNA of >60 nt, a 50-60-nt promoter and regulatory region to control expression of the sRNA, as well as regulatory regions for flanking genes. Any sRNA genes in smaller Ig regions would have been overlooked. We also excluded the highly conserved tRNA and rRNA operons from our consideration because of their complexity. It is certainly possible that sRNA genes may be associated with these other RNA genes. In fact, sRNA genes have been predicted to be encoded in at least one tRNA operon. In addition, conservation need not be a property of all sRNAs. We expect sRNAs that play a role in modulating cellular metabolism to be well conserved, as is the case for the previously identified sRNAs. Nevertheless, sRNAs may be encoded within or act upon regions for which there is no homology between E. coli, Klebsiella, and Salmonella (e.g., in cryptic prophages and pathogenicity islands), and they would be missed by this approach. Only one of 24 Ig regions within the e14, CP4-54, or CP4-6 prophages showed conservation. A few of these Ig regions showed evidence of transcription by microarray analysis, and RNAs have been implicated in immunity regulation in phage P4 (Ghisotti, D. et al. 1992 Mol Microbiol 6:3405-3413), which is related to the prophages CP4-54 and CP4-6. Despite the limitations listed above, however, we believe the use of conservation provides a relatively quick identification of the majority of sRNAs.
  • [0070]
    An alternative genomic sequence-based strategy for identifying sRNAs would be to search for orphan promoter and terminator elements as well as other potential RNA structural elements. Potential promoter elements were generally too abundant to be useful predictors without other information on their expected location and orientation. We found sequences predicted to be rho-independent terminators a more useful indicator of sRNAs; such sequences were clearly present for 13/17 of the sRNAs and 3/6 of the new mRNAs. In a number of cases, it appears that the sRNAs share a terminator with a convergent gene for an ORF. In other cases, either no terminator was detected or it appeared to be in a neighboring ORF. A search using promoter and terminator sequences as the requirements for identifying sRNAs might therefore have found two-thirds of the sRNAs described here. Phage integration target sequences also could be scanned for nearby sRNA genes. Many phage att sites overlap tRNAs (reviewed in Campbell, A. M. 1992 J Bacteriol 174: 7495-7499), and ssrA, encoding the tmRNA, has a 3′ structure like a tRNA and overlaps the att site of a cryptic prophage (Kirby, J. E. et al. 1994 J Bacteriol 176:2068-2081). In this work, we found that the 3′ end and terminator of #14 overlaps the previously mapped phage P2 att site (Barreiro, V. and Haggard-Ljungquist, E. 1992 J Bacteriol 174:4086-4093). # 14 sRNA does not obviously resemble a tRNA, suggesting that the overlap between phage att sites and RNA genes extends beyond tRNAs and related molecules and may be common to additional sRNAs.
  • [0071]
    Our second approach, high-density oligonucleotide probe array expression analysis, proved to be more useful in confirming the presence of sRNA genes first found by the conservation approach than in identifying new sRNA genes de novo. Further consideration of the location of microarray signal compared to flanking genes as well as analysis of microarray signals after a variety of growth conditions should expand the ability to detect sRNAs in this manner. Under a single growth condition, signal consistent with the RNA identified by Northern analysis was detected for 5/15 of the Ig regions proven to encode new sRNAs and for 4/6 of the new mRNAs. Thus, a similar analysis of microarray data in nonconserved genomic regions might help in the identification of sRNAs missed by the conservation-based approaches. We predict that sRNAs from any organism expressed at reasonably high levels under normal growth conditions will be detected by microarrays that interrogate the entire genome, inclusive of noncoding regions.
  • [0072]
    One clear limitation in detecting sRNAs with microarray or Northern analyses is the fact that some sRNAs may be expressed only under limited growth conditions or at extremely low levels. We chose three growth conditions to scan our samples. While most of the previously known sRNAs were seen under these conditions, OxyS RNA, which is induced by oxidative stress, was not detectable. For a few of our candidates in which no RNA was detected, it is possible that an sRNA is encoded but is not expressed sufficiently to be detected under any of our growth conditions. Another possible limitation of hybridization-based approaches is that highly structured sRNAs may be refractory to probe generation. sRNA transcripts may not remain quantitatively represented after the fragmentation used in the direct labeling approach here. cDNA labeling also may underrepresent sRNAs because they are a small target for the oligonucleotide primers, and secondary structure can interfere with efficiency of extension.
  • [0073]
    As our third approach, sRNAs were selected on the basis of their ability to bind to the general RNA binding protein, Hfq. Northern analysis revealed that many of our novel sRNAs interact with Hfq. In preliminary microarray analysis of Hfq-selected RNAs to look for additional unknown sRNAs, DsrA RNA, DicF RNA, Spot42 RNA, #14, #24, #25, #31, #41, and #52-II were detected among those RNAs with the largest difference in levels between Hfq-specific sera and pre-immune sera. This preliminary experiment suggests that microarray analysis of selected RNAs will be very valuable on a genome-wide basis. Interestingly, a large number of genes with leaders and a number of RNAs for operons were found to co-immunoprecipitate with Hfq (including the known Hfq target nlpD-rpoS mRNA (Brown, L. and Elliott, T. 1996 J Bacteriol 178:3763-3770). It seems likely that the subset of sRNAs binding a common protein will represent a subset in terms of function; the sRNAs of known function associated with Hfq in our experiments appear to be those involved in regulating mRNA translation and stability. Other sRNAs have been shown to interact with specific prokaryotic RNA-binding proteins, for example, tmRNA with SmpB (Karzai, A. W. et al. 1999 EMBO J. 18:3793-3799), and the possibility of other sRNAs interacting with these proteins or other general sRNA-binding proteins should be tested. This approach is adaptable to all organisms, and, in fact, binding to Sm and Fibrillarin proteins has been the basis for identification of several sRNAs in eukaryotic cells (Montzka, K. A. and Steitz, J. A. 1988 PNAS USA 85:8885-8889; Tyc, K. and Steitz, J. A. 1989 EMBO J8:3113-3119).
  • [0074]
    All the criteria we used to identify sRNAs also will detect short genes encoding new small peptides, and we have found six conserved short ORFs. Although our approach was intended to develop methods to identify non-translated genes within the genome, short ORFs also are missing from annotated genome sequences. The combination of a requirement for conservation and/or transcription with sequence predictions for ORFs should add significantly to our ability to recognize short ORFs. Small polypeptides have been shown to have a variety of interesting cellular roles. We expect that the short ORFs we have found are involved in signaling pathways, akin to those of B. subtilis peptides that enter the medium and carry out cell-cell signaling (reviewed in Lazazzera, B. A. 2000 Curr Opin Microbiol 3:177-182).
  • [0000]
    Characteristics and Functions of New sRNAs
  • [0075]
    The current work serves as a blueprint for the prediction, detection, and characterization of a large group of novel sRNAs. We have definitive information on characteristics that provide information regarding the cellular roles of these new sRNAs. Several known sRNAs that bind the Hfq protein act via base pairing to target mRNAs. The finding that a number of our new sRNAs bind Hfq indicates a similar mechanism of action for this subset of sRNAs. We searched the E. coli genome for possible complementary target sequences and examined phenotypes associated with multicopy plasmids containing new sRNA genes. Intriguingly, #25, an sRNA preferentially expressed in minimal medium, has extended complementarity to a sequence near the start of sdhD, the second gene of the succinate dehydrogenase operon. When the #25 Ig region is present on a multicopy plasmid, it interferes with growth on succinate minimal medium (Table 2), consistent with #25 sRNA acting as an antisense RNA for sdhD. Complementarity to many target mRNAs was found for a number of other novel sRNAs, confirming the validity of this analysis.
  • [0076]
    As outlined in the evaluation of each of our approaches, we do not expect our searches have been exhaustive. sRNAs also have been detected by others using a variety of approaches. The sRNA encoded by #38 was independently identified as a regulatory RNA (CsrC RNA; T. Romeo, pers. comm.), and others have found additional sRNAs using variations of the approaches used here (Argaman, L. et al. 2001. Curr. Biol. in press). Nevertheless, we think it unlikely that there are many more than 50 sRNAs encoded by the E. coli chromosome and by closely related bacteria. We expect such sRNAs to be present and playing important regulatory roles in all organisms. Using the approaches described here, it is feasible to search all sequenced organisms for these important regulatory molecules. We anticipate that study of the expanded list of sRNAs in E. coli will allow a more complete understanding of the range of roles played by regulatory sRNAs.
  • EXAMPLE 1
  • [0000]
    Computer Searches
  • [0077]
    Ig regions are defined here as sequences between two neighboring ORFs. We compared Ig regions of >180 nt against the NCBI Unfinished Microbial Genomes database (Worldwide web at ncbi.nlm.nih.gov/Microb_blast/unfinishedgenome.html) using the BLAST program (Altschul, S. F. et al. 1990 J Mol Biol 215:403-410). Salmonella enteritidis sequence data were from the University of Illinois, Department of Microbiology (Worldwide web at salmonella.org). Salmonella typhi and Yersinia pestis sequence data were from the Sanger Centre (Worldwide web at sanger.ac.uk/Projects/S_typhi/ and sanger.ac.uk/Projects/Y_pestis/). Salmonella typhimurium, Salmonella paratyphi, and Klebsiella pneumoniae sequences were from the Washington University Genome Sequencing Center.
  • [0078]
    Each Ig region was rated based on the best match to Salmonella or K. pneumoniae species. Ig regions containing previously identified sRNAs were rated 5 (each of them met the criteria to be rated 4). Ig regions were rated 4 if the raw BLAST score was >200 (hatched bars in FIG. 1) or 80-200 (double-diagonal bars in FIG. 1) extending for >80 nt; 3 if the raw BLAST score was 80-200 (double-diagonal bar) extending for 60-80 nt; 2 if the raw BLAST score was 50-80 (diagonal bar) extending for >65 nt; and 1 if the raw BLAST score was <50 (diagonal-dash, solid or none) or <65 nt. The location of the longest conserved section(s) within each Ig and the number of matches to the NCBI Unfinished Microbial database were recorded. Note that the computer searches were done from May 2000 to December 2000; more sequences are expected to match as the database continues to expand. The identity and orientation of genes flanking each Ig region were determined from the Colibri database (using http://for genolist.pasteur.fr/Colibri). Ig regions that the Colibri database predicted to be <180 nt in length and Ig regions containing tRNA and/or rRNAs were rated 0 and removed from further consideration.
  • [0000]
    Strains and Plasmids
  • [0079]
    Strains were grown at 37° C. in Luria-Bertani (LB) medium or M63 minimal medium supplemented with 0.2% glucose and 0.002% vitamin Bi (Silhavy, T. J. et al. 1984 Experiments with gene fusions Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.) except for phenotype testing of strains carrying multicopy plasmids as described below. Ampicillin (50 μg/ml) was added where appropriate. E. coli MG1655 was the parent for all strains used in this study. MG1655 Δlac (DJ480, obtained from D. Jin, NCI), was lysogenized with a λ phage carrying an rpoS-lacZ translational fusion (Sledjeski, D. D. et al. 1996 EMBO J15:3993-4000) to create strain SG30013.
  • [0080]
    To generate clones containing the Ig region of each candidate (pCR-#N where N refers to candidate number; see Table 1), Ig regions were amplified by PCR from a MG1655 colony and cloned into the pCRII vector using the TOPO TA cloning kit (Invitrogen). Oligonucleotides were designed so the entire conserved region and in most cases the full Ig region was included. In a few cases, repeated sequences or other irregularities required a reduction in the Ig regions cloned. See Table 3 for a list of all oligonucleotides used in this paper. Ig regions encoding sRNAs also were cloned into multicopy expression vectors (pRS-#N) in which each Ig region is flanked by several vector-encoded transcription terminators. To generate pRS-#N plasmids, pCR-#N plasmids were digested with BamHI and XhoI and the Ig-containing fragments were cloned into the BamHI and SalI sites of pRS1553 (Pepe, C. M. et al. 1997 J Mol Biol 270:14-25), replacing the lacZ-αpeptide. To construct pBS-spot42, the Spot42-containing fragment was amplified by PCR from K12 genomic DNA, digested with EcoRI and BamHI and cloned into corresponding sites in pBluescript II SK+ (Stratagene). All DNA manipulations were carried out using standard procedures. All clones were confirmed by sequencing.
    TABLE 3
    Oligonucleotides
    Oligo SEQ ID Candidate
    Name Sequence NO Number
    KW-39 GCGCCTCGTTATCATCCAAAATACG 32  #1
    KW-40 GTCGCCCAGCCAATGCTTTCAGTCG 33
    KW-41 ATTGATCGCACACCTGACAGCTGCC 34  #2
    KW-42 GTTGTCACCCTGGACCTGGTCGTAC 35
    KW-43 TGACCGCGATTTGCACAAAATGC 36  #3
    KW-44 ACTCTTAAATTTCCTATCAAAACTCGC 37
    KW-45 GGTATTTTCAGAGATTATGAATTGCCG 38  #4
    KW-46 TCACCTCTCCTTCGAGCGCTACTGG 39
    KW-47 AATGCTCTCCTGATAATGTTAAACTT 40  #5
    KW-48 GGTTAGCTCCGAAGCAAAAGCCGGAT 41
    KW-49 TAATTCCTTTCAAATGAAACGGAGC 42  #6
    KW-50 GGACTCCCTCATTATAATTACTGG 43
    KW-51 CTCCTTAAACAAGGACATTAGTCTACG 44  #7
    KW-52 ATTCACCTTACCTAATTTGATTCTTCC 45
    KW-123 CCATCGCTTGACGTTGCATTCACCTGC 46 #8(probes)
    KW-124 GTCGGCGTCGTACGAATCAATTGTGC 47
    KW-125 GCACAATTGATTCGTACGACGCCGAC 48
    KW-55 TAAGGATAATATTGCAGATCGTAAG 49  #9
    KW-56 ATCATCAAACAGCAACTTGCCC 50
    KW-57 TGTCCTTCTCCTGCAAGAGAATTATT 51 #10
    KW-58 GCTAATAATAATGTCTTTTTCGCTCC 52
    FR-100 GCTTTTGTGAATTAATTTGTATATCGAAGCG 53 #11
    FR-101 TATTAATACCCTCTAGATTGAGTTAATC 54
    FR-102 CGATTTACCTCACTTCATCGCTTTCAG 55 #12
    FR-103 TGATCCTGACTTAATGCCGCAAGTTC 56
    FR-104 GCTTATCTCCGGCACTCTCAGTGGCTTAGCTCT 57 (probe)
    TGAAGG
    FR-105 TTGCTCACATCTCACTTTAATCGTGCTC 58 #13
    FR-106 ATATTCCACCAGCTATTTGTTAGTGAATAAAAG 59
    G
    FR-107 TGATTAATTTCGATTATTTTTCCCGGATGG 60 #14
    FR-108 ATTAGAAACAGGAAGCCCCTCAGTCGAG 61
    FR-109 TTATTTTCCCCGGAAGCACATTCACTTCAC 62 #15
    FR-110 TGATCTATTGCACAACGAGGAAGC 63
    FR-111 TGCTTACTCATCAAAAGTAGCGCCAGATTC 64 #16
    FR-112 TAATCGACGGACGATAGATAATTCCTG 65
    FR-113 CCAATGTGTCGCCTTTTTCAACTTTCCG 66 #17
    FR-114 CGATTTATGAGAATAAATACTCATTTAAGGGTG 67
    FR-115 AAATCCGACTTTAGTTACAACATAC 68 #18
    FR-116 GACCAGACCTTCTTGATGATGGGCAC 69
    KW-69 CGACCTCAATTCCACGGGATCTGG 70 #19
    KW-70 ATTTAGCTGTAGTAATCACTCGCCG 71
    KW-71 GGTCTCCTTAGCGCCTTATTGCG 72 #20
    KW-72 CGCCCACATGCTGTTCTTATTATTCCC 73
    KW-73 TTTATGACACCTGCCACTGCCGTC 74 #21
    KW-74 CTGTCAAGTTATCTGTTTGTTAAGTCAAGC 75
    KW-126 GCTGTGAAGCACCTGCGTTGCTCATG 76 #22
    KW-127 GCTGTGAAACACCTGCATTTACGGCCACGG 77 (probes)
    KW-128 CCGTGGCCGTAAATGCAGGTGTTTCACAGC 78
    KW-77 CCTTTCGCAATTGACTGAAACAC 79 #24
    KW-78 GGCTAGACCGGGGTGCGCG 80
    KW-79 AAGGTGGTTATTTACACCTTAGCG 81 #25
    KW-80 GTCCTCTTTGGGGTAAATGTC 82
    KW-81 AATGCTCCGGTTTCATGTCATC 83 #26
    KW-82 TAGTTCCTTCTCACCCGGAG 84
    FR-117 CACAAGGGCGCTTTAGTTTGTTTTCCG 85 #27
    FR-118 ATCCCCTGAGAGTTTAATTTTCGTCAAG 86
    KW-85 TAATTCGTCGTAATTCGTCCTCC 87 #28
    KW-86 CTCTGCCTTCCTGTTTTTGTTGTG 88
    FR-119 AAACGCATTTGCAACTGTCGGCGCTTTTCC 89 #29
    FR-120 CTTGTTACCTCAAAAAATCACAGTGCTCG 90
    FR-121 GCAGTCGGTGATGCTGGATTTGCCCTG 91 #30
    FR-122 GTTTTTTTACGGGTAAGCCGCAACGACCATTG 92
    FR-123 TAGTAGATAAGTTTTAGATAAC 93 #31
    FR-124 TAAAACTGAAGTTGCCCTGAAAATG 94
    FR-125 TGATGAGTGGTTCTGCAAGAGG 95 #32
    FR-126 TAAAAGACAGATTACCTGGCCTG 96
    FR-127 CGGACTACCTCAAAATAAAGCTTTATATACG 97 #33
    FR-128 GTCATGATACCTTGATTAAAAAACAAACAGC 98
    FR-129 GGCTATAATGCGCACATAACCTCTTG 99 #34
    FR-130 AATCTTTTCTTATTTTTTGGCTAACGAATAGCC 100
    FR-131 GTCCAACTTTTTGGGGTCAGTACAAACTTTG 101 #35
    FR-132 TAATAACGCCGTTATTAAATAGCCTGCC 102
    FR-133 TAAGCAACGTCTGCTTACTGCCCCTC 103 #36
    FR-134 GTGATGGCTTCTGATAAAGATAAATTTATAGCC 104
    FR-135 TAACAGGCTAAGAGGGGC 105 #37
    FR-136 ATTGCCACTCTTCTTGATCAAATAACCG 106
    FR-137 AATGCGTCTGTTGATAATTCAAATTAGTC 107 #38
    FR-138 TAGCCGTTTTATTCAGTATAGATTTGCG 108
    KW-89 GTTCGTCGGTAACCCGTTTCAGC 109 #39
    KW-90 ATGGCTTAAAGAGAGGTGCC 110
    KW-91 CGTACTTTAAAGGGAGAATGAC 111 #40
    KW-92 GTGCTTCCTCATTATGGTGACG 112
    KW-93 GAATGGAGGGAGATTACACG 113 #41
    KW-94 CCTTAGTGGGTAAACGCTTAC 114
    KW-95 CTTTCAGGCAGCTAAGGAAAG 115 #42
    KW-96 CAATATGTATTATTGATTGAGTAAACGGG 116
    KW-97 CCTCTTCCAGGAATAATCCC 117 #43
    KW-98 CGGAAAGCGGTTCACAGATC 118
    KW-132 CTCGTAAGTTTCGCAGCTTATTA 119 #43 (probe)
    KW-99 TGAAATTCCTGTCCGACAGG 120 #44
    KW-100 GCACTACCGCAATGTTATTGC 121
    KW-101 GCTTAGCCAATAAATAGTTACACG 122 #45
    KW-102 TAAAACCTGTCACAAATCACAAA 123
    KW-103 GTGGCCTGCTTCAAACTTTCG 124 #46
    KW-104 GTAAAGTCTAGCCTGGCGGTTCG 125
    FR-139 TAATTCTGGTACGCCTGGCAGATATTTTGCC 126 #47
    FR-140 ATCAACCTCAAAAGGGAAATCGGG 127
    KW-105 TAACTTGTTGTAAGCCGGATCGG 128 #48
    KW-106 TGAAGCATCTATCGCCGGTTGCG 129
    KW-107 GATTAGAAATCCTTTTGAAAGCGCATTG 130 #49
    KW-108 CTTATTGGGCACCGCAATGG 131
    KW-109 CGAACACAATAAAGATTTAATTCAGCC 132 #50
    KW-110 CTGATGCTACTGTGTCAACG 133
    KW-111 AATAATCAGACATAGCTTAGGC 134 #51
    KW-112 GCCGTGATGGTTTTCGCGTTC 135
    KW-113 TATTTTCCTCCCGCGCTAAAG 136 #52
    KW-114 TTCAGCTGATGACCACCACGCTT 137
    KW-115 GAGTTGTCAGAGCAGGATGATTC 138 #53
    KW-116 TATCTGCGCTTATCCTTTATGG 139
    KW-117 CCTTTACGGTGATAACCGTCGCG 140 #54
    KW-118 CTGACAAGCCTCTCATTCTCTTGTC 141
    KW-119 GAGAATTATCGAGGTCCGGTATC 142 #55
    KW-120 CTACGCGTTAGCGATAGACTGC 143
    FR-141 AGGCTTACTAAGAACACCAGGGGGAGGGGAA 144 probe for 55-I
    FR-142 AGTCATAAGCTTCCCCGCTTACTAAGACTA 145 probe for 55-II
    KW-121 CCTCAAATCGGCCATAATAACC 146 56
    KW-122 TAAACACCGTCGTCAGAAATGC 147
    FR-143 TAGACTTTTATCCACTTTATTGCTG 148 #57
    FR-144 GTGTGCCTTTCGGCGATATGGCGTG 149
    FR-145 CCTTTACGTGGGCGGTGATTTTGTC 150 #58
    FR-146 TAGCTTTGCTCCTGGATGTTTGCC 151
    FR-147 GCTGTAATTTATTCAGCGTTTGTACATACG 152 #59 (probe)
    FR-148 TCAGTCAACTCGCTGCGGCGTGTTAC 153 #60
    FR-149 CTTATTGTTGCTTAGTTAGGGTAGTCAC 154
    KW-131 CAGTCAGTCTCAGGGGAGGAGCAATC 155 #61 (probe)
    KW-59 TGAATGCACAATAAAAAAATCCCGACCCTG 156 For DsrA
    KW-60 AGTCGCGCAGTACTCCTCTTACCAG 157 Ig region
    KW-63 TAATTTCTCATCAGGCGGCTCTGC 158 for RprA Ig
    KW-64 TAACATTATCAGCCTGCTGACGGC 159 region
    sp42-5′-1 GGCCGAATTCGTAGGGTACAGAGGTAAG 160 for cloning
    sp42-3′-1 GGCCGGATCCGTCATTACTGACTGGGGCGG 161 pBSspot42

    RNA Analysis
  • [0081]
    RNA for Northern analysis was isolated directly from ˜3×109 cells in exponential growth (OD600=0.2-0.4) or stationary phase (overnight growth) as described previously (Wassarman, K. M. and Storz, G. 2000 Cell 101:613-623). Five-μg RNA samples were fractionated on 10% polyacrylamide urea gels and transferred to Hybond N membrane as described previously (Wassarman, K. M. and Storz, G. 2000 Cell 101:613-623). For Northern analysis of candidate regions, double-stranded DNA probes were generated by PCR from a colony of MG1655 cells or from the pCR-#N plasmids with oligonucleotides used for cloning the pCR-#N plasmids. PCR amplification was done with 52° C. annealing for 30 cycles in 1×PCR buffer (1 mM each dATP, dGTP, and dTTP; 2.5 μM dCTP; 100 μCi [α32P] dCTP; 10 ng plasmid; 1 unit taq polymerase) (Perkin Elmer). Probes were purified over G-50 microspin columns (Amersham Pharmacia Biotech) prior to use. Northern membranes were prehybridized in a 1:1 mixture of Hybrisol I and Hybrisol II (Intergen) at 40° C. DNA probes with 500 μg sonicated salmon sperm DNA were heated for 5 min to 95° C., added to prehybridization solution, and membranes were hybridized overnight at 40° C. Membranes were washed by rinsing twice with 4×SSC/0.1% SDS at room temperature followed by three washes with 2×SSC/0.1% SDS at 40° C. Northern blot analysis using RNA probes was done as described previously (Wassarman, K. M. and Steitz, J. A. 1992 Mol Cell Biol 12:1276-1285). RNA probes were generated by in vitro transcription according to manufacturer protocols (Roche Molecular Biochemicals) from pCR-#N plasmids linearized with EcoRV or HinDIII using SP6 RNA polymerase or T7 RNA polymerase, respectively; pBS-6S (pGS0112; Wassarman, K. M. and Storz, G. 2000 Cell 101:613-623) or pBS-spot42 were linearized with EcoRI using T3 RNA polymerase; pGEM-5S (pG5019; Altuvia, S. et al. 1997 Cell 90:43-53) or pGEM-10Sa (Altuvia, S. et al. 1997 Cell 90:43-53) were linearized with EcoRI using SP6 RNA polymerase. Oligonucleotide probes were labeled by polynucleotide kinase according to manufacturer protocols (New England Biolabs) using [γ32P]ATP (>5000 Ci/mmole; Amersham Pharmacia Biotech). For oligonucleotide probes, Northern membranes were prehybridized in
  • [0082]
    Ultrahyb (Ambion) at 40° C. followed by addition of labeled oligonucleotide probe and hybridization overnight at 40° C. Membranes were washed twice with 2×SSC/0.1% SDS at room temperature followed by two washes with 0.1×SSC/0.1% SDS at 40° C. for 15 minutes each.
  • [0000]
    Immunoprecipitation
  • [0083]
    Immunoprecipitations were carried out using extracts from cells in exponential growth (OD600=0.2-0.4) or stationary phase (overnight growth) as described previously (Wassarman, K. M. and Storz, G. 2000 Cell 101:613-623), using rabbit antisera against the Hfq protein or preimmune serum. After immunoprecipitation, RNA was isolated from Protein A Sepharose-antibody pellets by extraction with phenol:chloroform:isoamyl alcohol (50:50:1) followed by ethanol precipitation. RNA was examined on gels directly after 3′ end labeling or analyzed by Northern hybridization after fractionation on 10% polyacrylamide urea gels as described previously (Wassarman, K. M. and Storz, G. 2000 Cell 101:613-623).
  • [0000]
    rpoS-lacZ Expression
  • [0084]
    Effects on rpoS-lacZ expression by multicopy plasmids containing the novel sRNAs were determined from a single colony of SG30013 transformed with pRS-#N, grown for 18 h in 5 ml of LB-ampicillin medium or M63-ampicillin medium supplemented with 0.2% glucose at 37° C. β-galactosidase activity in the culture was assayed as described previously (Zhou, Y.-N. and Gottesman, S. 1998 J Bacteriol 180:1154-1158). The numbers provided in Table 2 were calculated as the ratio between pRS-#N and the pRS1553 vector control.
  • [0000]
    Phenotype Testing
  • [0085]
    To test carbon source utilization or temperature sensitivity associated with the multicopy plasmids containing the novel sRNAs, a single colony of MG1655 transformed with a given pRS-#N was grown for 6 hours in 5 ml LB-ampicillin medium at 37° C. Then 10 μl of serial dilutions (10−2, 10−4, and 10−6) were spotted on M63-ampicillin plates containing 0.2% of the carbon source being tested (glucose, arabinose, lactose, glycerol, ribose, or succinate) and grown at 37° C.; or on LB plates incubated at room temperature or 42° C. Plates were analyzed after both 1 and 2 days. Failure to grow in Table 2 indicates an efficiency of plating of <10−3.
  • [0000]
    Microarray Analysis
  • [0086]
    RNA for microarray analysis was isolated using the MasterPure RNA purification kit according to the manufacturer protocols (Epicentre) from MG1655 cells grown to OD600=0.8 in LB medium at 37° C. DNA was removed from RNA samples by digestion with DNase I for 30 min at 37° C. Probes for microarray analysis were generated by one of two methods: direct labeling of enriched mRNA or generation of labeled cDNA.
  • [0087]
    To generate direct labeled RNA probes, mRNA enrichment and labeling was done as described in the Affymetrix expression handbook (Affymetrix). Oligonucleotide primers complementary to 16S and 23S rRNA were annealed to total RNA followed by reverse transcription to synthesize cDNA strands complementary to 16S and 23S rRNA species. 16S and 23S were degraded with RNase H followed by DNase I treatment to remove cDNA and oligonucleotides. Enriched RNA was fragmented for 30 min at 95° C. in 1×T4 polynucleotide kinase buffer (New England Biolabs), followed by labeling with γ-S-ATP and T4 polynucleotide kinase and ethanol precipitation. The biotin label was introduced by resuspending RNA in 96 μl of 30 mM MOPS (pH 7.5), 4 μl of a 50 mM Iodoacetylbiotin solution, and incubating at 37° C. for 1 hr. RNA was purified using the RNA/DNA Mini Kit according to manufacturer protocols (QIAGEN).
  • [0088]
    To generate cDNA probes, 5 μg of total RNA was reverse transcribed using the Superscript II system for first strand cDNA synthesis (Life Technologies) and 500-ng random hexamers. RNA and primers were heated to 70° C. and cooled to 25° C.; reaction buffer was then added, followed by addition of Superscript II and incubation at 42° C. RNA was removed by RNase H and RNase A. The cDNA was purified using the Qiaquick cDNA purification kit (QIAGEN) and fragmented by incubation of up to 5 μg cDNA and 0.2 U DNase I for 10 min at 37° C. in 1× one-phor-all buffer (Amersham-Pharmacia Biotech). The reaction was stopped by incubation for 10 min at 99° C., and fragmentation was confirmed on a 0.7% agarose gel to verify that average length fragments were 50-100 nt. Fragmented cDNA was 3′-end-labeled with terminal transferase (Roche Molecular Biochemicals) and biotin-N-6-ddATP (DuPont/NEN) in 1×TdT buffer (Roche Molecular Biochemicals) containing 2.5 mM cobalt chloride for 2 hours at 37° C.
  • [0089]
    Hybridization to microarrays and staining procedures were done according to the Affymetrix expression manual (Affymetrix). The arrays were read at 570 nm with a resolution of 3 μm using a laser scanner.
  • [0090]
    The expression of genes was analyzed using the Affymetrix Microarray Suite 4.01 software program. Detection of transcripts in intergenic regions was done using the intensities of each probe designed to be a perfect match and the corresponding probe designed to be the mismatch. If the perfect match probe showed an intensity that was 200 units higher than the mismatch probe, the probe pair was called positive. Two neighboring positive probe pairs were considered evidence of a transcript. The location and length of the transcripts were estimated based on the first and last identified positive probe pair within an Ig region.
  • [0091]
    While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of the invention. All patents, patent applications and publications referred to above are hereby incorporated by reference.

Claims (26)

  1. 1. An isolated polynucleotide comprising Candidate #8, or its complement, or its homolog having at least about 95% identity thereto.
  2. 2. An isolated polynucleotide comprising Candidate #12, or its complement, or its homolog having at least about 95% identity thereto.
  3. 3. An isolated polynucleotide comprising Candidate #14, or its complement, or its homolog having at least about 95% identity thereto.
  4. 4. An isolated polynucleotide comprising Candidate #22, or its complement, or its homolog having at least about 95% identity thereto.
  5. 5. An isolated polynucleotide comprising Candidate #24, or its complement, or its homolog having at least about 95% identity thereto.
  6. 6. An isolated polynucleotide comprising Candidate #25, or its complement, or its homolog having at least about 95% identity thereto.
  7. 7. An isolated polynucleotide comprising Candidate #26, or its complement, or its homolog having at least about 95% identity thereto.
  8. 8. An isolated polynucleotide comprising Candidate #27, or its complement, or its homolog having at least about 95% identity thereto.
  9. 9. An isolated polynucleotide comprising Candidate #31, or its complement, or its homolog having at least about 95% identity thereto.
  10. 10. An isolated polynucleotide comprising Candidate #38, or its complement, or its homolog having at least about 95% identity thereto.
  11. 11. An isolated polynucleotide comprising Candidate #40, or its complement, or its homolog having at least about 95% identity thereto.
  12. 12. An isolated polynucleotide comprising Candidate #41-I, or its complement, or its homolog having at least about 95% identity thereto.
  13. 13. An isolated polynucleotide comprising Candidate #41-II, or its complement, or its homolog having at least about 95% identity thereto.
  14. 14. An isolated polynucleotide comprising Candidate #43, or its complement, or its homolog having at least about 95% identity thereto.
  15. 15. An isolated polynucleotide comprising Candidate #52-I, or its complement, or its homolog having at least about 95% identity thereto.
  16. 16. An isolated polynucleotide comprising Candidate #52-II, or its complement, or its homolog having at least about 95% identity thereto.
  17. 17. An isolated polynucleotide comprising Candidate #55-I, or its complement, or its homolog having at least about 95% identity thereto.
  18. 18. An isolated polynucleotide comprising Candidate #55-II, or its complement, or its homolog having at least about 95% identity thereto.
  19. 19. An isolated polynucleotide comprising Candidate #61, or its complement, or its homolog having at least about 95% identity thereto.
  20. 20. An isolated polynucleotide comprising Candidate #9, or its complement, or its homolog having at least about 95% identity thereto.
  21. 21. An isolated polynucleotide comprising Candidate #17, or its complement, or its homolog having at least about 95% identity thereto.
  22. 22. An isolated polynucleotide comprising Candidate #28, or its complement, or its homolog having at least about 95% identity thereto.
  23. 23. An isolated polynucleotide comprising Candidate #36, or its complement, or its homolog having at least about 95% identity thereto.
  24. 24. An isolated polynucleotide comprising Candidate #49, or its complement, or its homolog having at least about 95% identity thereto.
  25. 25. An isolated polynucleotide comprising Candidate #50, or its complement, or its homolog having at least about 95% identity thereto.
  26. 26.-56. (canceled)
US11543601 2001-02-01 2006-10-05 Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation Abandoned US20070032639A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US26640201 true 2001-02-01 2001-02-01
PCT/US2002/003147 WO2002060914A8 (en) 2001-02-01 2002-01-31 Identification of small rnas and orfs form e. coli as mediators of cell and intercell regulation
US10627007 US7119193B2 (en) 2001-02-01 2003-07-25 Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation
US11543601 US20070032639A1 (en) 2001-02-01 2006-10-05 Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US11543601 US20070032639A1 (en) 2001-02-01 2006-10-05 Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation
US12905288 US20110166336A1 (en) 2001-02-01 2010-10-15 Identification of New Small RNAs and ORFs of E. Coli as Mediators of Cell and Intercell Regulation

Publications (1)

Publication Number Publication Date
US20070032639A1 true true US20070032639A1 (en) 2007-02-08

Family

ID=23014422

Family Applications (3)

Application Number Title Priority Date Filing Date
US10627007 Active 2023-01-08 US7119193B2 (en) 2001-02-01 2003-07-25 Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation
US11543601 Abandoned US20070032639A1 (en) 2001-02-01 2006-10-05 Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation
US12905288 Abandoned US20110166336A1 (en) 2001-02-01 2010-10-15 Identification of New Small RNAs and ORFs of E. Coli as Mediators of Cell and Intercell Regulation

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10627007 Active 2023-01-08 US7119193B2 (en) 2001-02-01 2003-07-25 Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation

Family Applications After (1)

Application Number Title Priority Date Filing Date
US12905288 Abandoned US20110166336A1 (en) 2001-02-01 2010-10-15 Identification of New Small RNAs and ORFs of E. Coli as Mediators of Cell and Intercell Regulation

Country Status (2)

Country Link
US (3) US7119193B2 (en)
WO (1) WO2002060914A8 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009036036A1 (en) * 2007-09-10 2009-03-19 Nickerson Cheryl A Methods and compositions based on culturing microorganisms in low sedimental fluid shear conditions
US20100113904A1 (en) * 2008-11-05 2010-05-06 Nellcor Puritan Bennett Llc System And Method For Facilitating Observation Of Monitored Physiologic Data
US9179876B2 (en) 2012-04-30 2015-11-10 Nellcor Puritan Bennett Ireland Systems and methods for identifying portions of a physiological signal usable for determining physiological information
US9247896B2 (en) 2012-01-04 2016-02-02 Nellcor Puritan Bennett Ireland Systems and methods for determining respiration information using phase locked loop
US9554712B2 (en) 2013-02-27 2017-01-31 Covidien Lp Systems and methods for generating an artificial photoplethysmograph signal
US9560978B2 (en) 2013-02-05 2017-02-07 Covidien Lp Systems and methods for determining respiration information from a physiological signal using amplitude demodulation
US9848820B2 (en) 2014-01-07 2017-12-26 Covidien Lp Apnea analysis system and method

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002060914A8 (en) * 2001-02-01 2004-07-08 Susan Gottesman Identification of small rnas and orfs form e. coli as mediators of cell and intercell regulation
CA2450504A1 (en) * 2002-12-20 2004-05-26 Kane Biotech Inc. Csrc polynucleotides and uses thereof for biofilm modulation
US20040180364A1 (en) * 2003-01-08 2004-09-16 Affymetrix, Inc. Methods for analyzing global regulation of coding and non-coding RNA transcripts involving low molecular weight RNAs
CA2531123A1 (en) * 2003-07-02 2005-01-13 Perkinelmer Las, Inc. Assay and process for labeling and detection of micro rna and small interfering rna sequences
WO2008014236A1 (en) * 2006-07-24 2008-01-31 Tetralogic Pharmaceuticals Corporation Dimeric iap inhibitors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050069894A1 (en) * 2001-02-01 2005-03-31 Susan Gottesman Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050069894A1 (en) * 2001-02-01 2005-03-31 Susan Gottesman Identification of new small RNAs and ORFs of E. coli as mediators of cell and intercell regulation

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009036036A1 (en) * 2007-09-10 2009-03-19 Nickerson Cheryl A Methods and compositions based on culturing microorganisms in low sedimental fluid shear conditions
US20100290996A1 (en) * 2007-09-10 2010-11-18 Arizona Board Of Regents, For And On Behalf Of Arizona State University Methods and compositions based on culturing microorganisms in low sedimental fluid shear conditions
US20100113904A1 (en) * 2008-11-05 2010-05-06 Nellcor Puritan Bennett Llc System And Method For Facilitating Observation Of Monitored Physiologic Data
US9247896B2 (en) 2012-01-04 2016-02-02 Nellcor Puritan Bennett Ireland Systems and methods for determining respiration information using phase locked loop
US9179876B2 (en) 2012-04-30 2015-11-10 Nellcor Puritan Bennett Ireland Systems and methods for identifying portions of a physiological signal usable for determining physiological information
US9560978B2 (en) 2013-02-05 2017-02-07 Covidien Lp Systems and methods for determining respiration information from a physiological signal using amplitude demodulation
US9554712B2 (en) 2013-02-27 2017-01-31 Covidien Lp Systems and methods for generating an artificial photoplethysmograph signal
US9848820B2 (en) 2014-01-07 2017-12-26 Covidien Lp Apnea analysis system and method

Also Published As

Publication number Publication date Type
US20110166336A1 (en) 2011-07-07 application
WO2002060914A2 (en) 2002-08-08 application
US7119193B2 (en) 2006-10-10 grant
WO2002060914A3 (en) 2003-09-18 application
WO2002060914A8 (en) 2004-07-08 application
US20050069894A1 (en) 2005-03-31 application

Similar Documents

Publication Publication Date Title
Kawamoto et al. Base‐pairing requirement for RNA silencing by a bacterial small RNA and acceleration of duplex formation by Hfq
Jacob‐Dubuisson et al. Initiation of assembly and association of the structural elements of a bacterial pilus depend on two specialized tip proteins.
Lloyd et al. Yersinia YopE is targeted for type III secretion by N‐terminal, not mRNA, signals
Abo et al. SsrA‐mediated tagging and proteolysis of LacI and its role in the regulation of lac operon
Jensen et al. The Caulobacter crescentus smc gene is required for cell cycle progression and chromosome segregation
Baker et al. CsrA regulates glycogen biosynthesis by preventing translation of glgC in Escherichia coli
Muffler et al. The RNA-binding protein HF-I, known as a host factor for phage Qbeta RNA replication, is essential for rpoS translation in Escherichia coli.
Wassarman et al. Small RNAs in escherichia coli
Mangan et al. The integration host factor (IHF) integrates stationary‐phase and virulence gene expression in Salmonella enterica serovar Typhimurium
Pioletti et al. Crystal structures of complexes of the small ribosomal subunit with tetracycline, edeine and IF3
US5817483A (en) Process for the production of stochastically-generated peptides,polypeptides or proteins having a predetermined property
Williams et al. Probing the structure, function, and interactions of the Escherichia coli H-NS and StpA proteins by using dominant negative derivatives.
Kato et al. Hda, a novel DnaA‐related protein, regulates the replication cycle in Escherichia coli
Urwyler et al. Proteome analysis of Legionella vacuoles purified by magnetic immunoseparation reveals secretory and endosomal GTPases
Thanassi et al. Identification of 113 conserved essential genes using a high‐throughput gene disruption system in Streptococcus pneumoniae
Moir et al. Genomics and antimicrobial drug discovery
Sulavik et al. The MarR repressor of the multiple antibiotic resistance (mar) operon in Escherichia coli: prototypic member of a family of bacterial regulatory proteins involved in sensing phenolic compounds.
US5763192A (en) Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique
US5817793A (en) Multiple antibiotic resistance operon assays
Viprey et al. Symbiotic implications of type III protein secretion machinery in Rhizobium
Ahmer et al. Salmonella typhimurium encodes an SdiA homolog, a putative quorum sensor of the LuxR family, that regulates genes on the virulence plasmid
Moon et al. A PhoQ/P‐regulated small RNA regulates sensitivity of Escherichia coli to antimicrobial peptides
Méndez-Ortiz et al. Genome-wide transcriptional profile of Escherichia coli in response to high levels of the second messenger 3′, 5′-cyclic diguanylic acid
Paschal et al. Homology of the 74-kD cytoplasmic dynein subunit with a flagellar dynein polypeptide suggests an intracellular targeting function.
Hommais et al. Large‐scale monitoring of pleiotropic regulation of gene expression by the prokaryotic nucleoid‐associated protein, H‐NS

Legal Events

Date Code Title Description
AS Assignment

Owner name: AFFYMETRIX, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ROSENOW, CARSTEN;REEL/FRAME:025145/0313

Effective date: 20041122

Owner name: THE UNITED STATES OF AMERICA, AS REPRESENTED BY TH

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:GOTTESMAN, SUSAN;STORZ, GISELA;REPOILA, FRANCIS;AND OTHERS;SIGNING DATES FROM 20040810 TO 20100818;REEL/FRAME:025145/0289