US20070006334A1

US20070006334A1 - Transgenic animals expressing salivary proteins

Info

Publication number: US20070006334A1
Application number: US11/488,795
Authority: US
Inventors: Cecil Forsberg; Serguei Golovan; John Phillips
Original assignee: Individual
Current assignee: Individual
Priority date: 1999-04-23
Filing date: 2006-07-19
Publication date: 2007-01-04
Also published as: US7115795B1

Abstract

The invention provides a transgenic animal having within its genome a transgene construct for gastrointestinal tract specific expression of a protein. In a preferred embodiment the protein is a phytase or a homologue thereof. Such proteins may be heterologous and may be specifically expressed in the salivary gland of the animal by operably linking the nucleic acid sequence encoding the protein with regulatory sequence including a salivary gland protein promoter/enhancer. Also provided are methods of expressing and producing proteins using such nucleic acid constructs. Further, antibodies specific to such proteins and immunological diagnostic kits are also provided.

Description

RELATED APPLICATIONS

This application is a continuation of U.S. application Ser. No. 09/926,375 filed Feb. 28, 2002 which is a national phase entry of PCT/CA00/00430 filed Apr. 20, 2000 (which designated the U.S.) which claims the benefit of U.S. Provisional application Ser. No. 60/130,508 filed Apr. 23, 1999 (now abandoned). All of the prior applications are incorporated herein in their entirety.

FIELD OF THE INVENTION

The present invention relates to transgenic animals and, more specifically, to animals genetically modified to express a desired protein.

BACKGROUND OF THE INVENTION

Phosphorus is an essential element for the growth of all organisms. In livestock production, phosphorus deficiency has been described as the most prevalent mineral deficiency throughout the world and feed must often be supplemented with inorganic phosphorus in order to obtain desired growth performance of monogastric animals (e.g. pigs, poultry etc.).
Phytic acid, or phytate, (myo- inositol 1,2,3,4,5,6-hexakis dihydrogen phosphate) is a major storage form of phosphorus in cereals and legumes, representing 18% to 88% of the total phosphorus content (Reddy et al. 1982). The enzyme phytase (myo-inositol hexakisphosphate phosphohydrolase) belongs to the group of phosphoric monoester hydrolases: it catalyzes the hydrolysis of phytate (myo-inositol hexakis phosphate) to inorganic monophosphate and lower phosphoric esters of myo-inositol or, in some cases, free myo-inositol. Phytases are classified either as 3-phytases or 6-phytases based on the first phosphate group attacked by the enzyme. 3-phytase is typical for microorganisms and 6-phytase for plants (Cosgrove, 1980).
Phytase is either absent or present at a very low levels in monogastric animals (Bitar and Reinhold 1972; Iqbal et aL. 1994). Consequently, dietary phytate is not digested or absorbed from the small intestine and instead is concentrated in fecal material, thereby contributing to phosphorus pollution in areas of intensive livestock production. Runoff from animal farms leads to contamination of rivers and streams. Such runoff has resulted in rapid drops in the oxygen concentration in rivers and streams due to excessive algal growth in water, which, in turn, has led to an increase in the mortality rate of fish and existing flora and fauna. This is becoming a global problem as pig and poultry production is increased (Miner 1999; Mallin 2000). Furthermore, phytic acid is viewed as an anti-nutritional factor because it interacts with essential dietary minerals and proteins limiting the nutritional values of cereals and legumes in man and animals (Harland and Morris 1995).
For the above reasons, various attempts have been made to enable animals to utilize available phytate in feed. Such attempts have included production of low phytate plants (Abelson 1999), addition of phytase to the animal feed (Simons et aL 1990 (Stahl et al. 1999) or transformation of the fodder plants to produce the required phytase (Pen et al. 1993, Verwoerd et al. 1995). A combination of these options, the feeding of phytase to poultry receiving low phytate corn has also been tested (Huff et al. 1998). However, these solutions increase the cost of animal production. Also because phytase is an enzyme, it is susceptible to inactivation by heat and moisture and is generally unstable at the high temperatures used for feed pelleting.
The primary phytase used for supplementing animal feeds is from Asperigillus sp.; however, phytases are produced by a large number of plants and microorganisms (Wodzinski and Ullah 1996) (Dvorakova 1998). A phytase produced by Escherichia coli has been reported to exhibit the highest activity of those reported (Wodzinski and Ullah 1996). This phytase from E. coli was initially cloned as an acid phosphatase gene that was designated APPA (Dassa et al. 1990). Greiner et al. (1991; 1993) purified phytase from E. coli and reported that some of the kinetic properties of the acid phosphatase activity of the native phytase of E. coli were similar to those of the APPA-encoded acid phosphatase. However, the authors did not clone the phytase gene to prove that it was identical to APPA gene. We have subsequently cloned, overexpressed and characterized APPA gene, and shown that the E. coli gene APPA codes for a bifunctional enzyme exhibiting both phytase and acid phosphatase activities (Golovan et al. 2000). Phytases exhibit phosphatase activity, however the relative activities differ widely among enzymes (Wodzinski and Ullah 1996).
Therefore, there is a need for an improved method of allowing access by animals to phytase so as to enable efficient phytate metabolism and, thereby reducing phosphate pollution.
In the field of protein production using recombinant methods, one of the associated problems relates to the lack of required glycosylation. Therefore, a method of producing such glycoproteins is also needed.

SUMMARY OF THE INVENTION

In one embodiment, the invention provides a transgenic non-human animal that carries in the genome of its somatic and/or germ cells a nucleic acid sequence including a heterologous transgene construct, the construct including a trangene encoding a protein, the transgene being operably linked to a first regulatory sequence for salivary gland specific expression of the protein.
In another embodiment, the invention provides a transgenic non-human animal that carries in the genome of its somatic and/or germ cells a nucleic acid sequence including a heterologous transgene construct, the construct including a trangene encoding phytase or a homologue thereof.
In yet another embodiment, the invention provides a method of expressing a protein, the method comprising the steps of:
a) introducing a transgene construct into a non-human animal embryo such that a non-human transgenic animal that develops from the embryo has a genome that comprises the transgene construct, wherein the transgene construct comprises:

- i) a transgene encoding the protein, and
- ii) at least one regulatory sequence for gastrointestinal tract specific expression of the protein,

b) transferring the embryo to a foster female; and,
c) developing the embryo into the transgenic animal
wherein the transgene is produced in the gastrointestinal tract of the animal.
In a further embodiment, the invention provides a transgenic animal adapted for expressing a protein according to the above method. The invention also provides for the progeny of such animal.
In another embodiment, the invention provides a process for producing a protein comprising the steps of:
a) obtaining saliva containing the protein from a non-human transgenic animal, the animal containing within its genome a transgene construct, wherein the transgene construct comprises:

- i) a transgene encoding the protein, and
- ii) at least one regulatory sequence for salivary gland specific expression of the protein, and
- extracting the protein from the saliva.

In a further embodiment, the invention provides a method for expressing a phytase or a homologue thereof in a non-human animal, the method comprising:
a) constructing a nucleic acid sequence including a transgene construct comprising:

- i) a transgene encoding the phytase or a homologue thereof, and
- ii) at least one regulatory sequence for gastrointestinal tract specific expression of the protein, and

b) transfecting the animal with the nucleic acid sequence;
whereby the animal carries within the genome of its somatic and/or germ cells the transgene construct and wherein the animal expresses the phytase or a homologue thereof in its gastrointestinal tract.
In another embodiment the invention provides a nucleic acid molecule comprising a nucleic acid sequence including a gene encoding a protein, the gene being operably linked to at least one regulatory sequence for gastrointestinal tract specific expression of the protein.
In another embodiment the invention provides an antibody specific to the protein expressed by the above nucleic acid sequence and a test kit for immunologically detecting such protein. The invention also provides for hybridomas secreting such antibodies.
In another embodiment the invention provides cells that are transfected with the above nucleic acid sequence.
In another embodiment, the invention provides a method for producing a protein molecule comprising a glycosylated protein secreted in the saliva that exhibits a novel physiological activity. One example of such an activity is phytase.

BRIEF DESCRIPTION OF THE DRAWINGS

These and other features of the preferred embodiments of the invention will become more apparent in the following detailed description in which reference is made to the appended drawings wherein:
FIG. 1 is a schematic diagram representing a method for producing the gene construct of the present invention containing the inducible proline-rich protein (PRP) promoter/enhancer. More specifically, FIG. 1 is a schematic diagram illustrating the steps in the construction of the transgenes R15/APPA+intron and R15/APPA used for the generation of transgenic mice. (SEQ ID NO: 36)
FIG. 2 is a schematic diagram representing a method for producing the gene construct of the present invention containing the SV40 promoter. More specifically, FIG. 2 is a schematic diagram illustrating the steps in construction of the plasmid containing the transgene SV40/APPA+intron that was introduced by transfection into mammalian cell lines.
FIG. 3 is a schematic diagram representing a method for producing the gene construct of the present invention containing the constitutive parotid secretory protein (PSP) promoter/enhancer. More specifically, FIG. 3 is a schematic diagram illustrating the steps in construction of the transgenes Lama2/APPA that codes for the native AppA phytase and the Lama2/PSP/APPA that codes for the AppA phytase with the PSP signal peptide sequence. (SEQ ID NOS: 37 & 38)
FIG. 4 is a schematic diagram of the Lama2-APPA plasmid containing the APPA transgene.
FIG. 5 illustrates the nucleic acid sequence of the Lama2/APPA plasmid containing the E. coli APPA gene (SEQ ID NO: 1).
FIG. 6 illustrates the PCR results for transformed mice. More specifically, FIG. 6 is a picture of an agarose gel illustrating APPA PCR products from genomic tail DNA of third generation offspring from the transgenic female founder mouse 3-1 generated using the Xho1 and Not1 fragment of the Lama2/APPA construct. A second generation phytase gene positive male was crossed with each of two phytase positive transgenic females 9f and 11f (Table 3). From litter 18m× 11f offspring 3, 4, 5 & 6 are PCR positive and from litter 18m× 11f offspring 2 and 3 are PCR positive. Std is the oligonucleotide standard and the numbers on the left are the bp sizes of the standard. Lane C is a negative control reaction mixture that lacks a DNA template and appA is a positive control containing an amplified segment of the phytase gene. The primers used were APPA-UP2 and APPA-KPN.
FIG. 7 illustrates the PCR results for transformed founder pigs. More specifically, FIG. 7 is a picture of an agarose gel illustrating phytase gene PCR products and β-globin PCR products from genomic tail DNA of five founder piglets from litter 167. Std is a 1 kb ladder. Lane 2 using the phytase primer set is positive for the phytase gene, and all of the samples were positive for the β-globin gene. Lane C is a negative control not containing template DNA. The phytase transgene primer set included APPA-UP2 and APPA-KPN gave an expected fragment size of 750 bp. The primer set for the β-globin gene included PIG-BGF and PIG-BRG gives an expected fragment size of 207 bp.
FIG. 8 illustrates the PCR results for transgene rearrangement tests. More specifically, FIG. 8 is a picture of an agarose gel showing the PCR products of four separate primer sets used to amplify different segments of the transgene introduced into pig 167-02. The Std contained a kilobase DNA ladder. The primers used included lane 1, APPA-UP2 and APPA-KPN (750 bp); lane 2, APPA -MATURE and APPA-KPN (1235 bp); lane 3 APPA MATURE and APPA-DOWN2 (608 bp); lane 4, PIG-BGF and PIG-BGR (207 bp). lane 5, a negative control without DNA template added; lane 6, the appA gene & primers APPA-UP2 and APPA-KPN. The numbers on the left indicate the sizes of the bands in the standard. No PCR products were detected in the absence of either DNA template or primers.
FIG. 9 illustrates weight and salivary phytase activity of the transgenic boar 167-02 and average weight of the pen-mates at intervals during growth. Symbols: Weight of 167-02, ●; Average weight ±SD of four penmates, ▴; phytase activity of 167-02, ▪; Phytase specific activity, □. Arrows indicate sampling for fecal phosphorus concentration.
FIG. 10 illustrates weight and salivary phytase activity of the transgenic boar 282-02 and average weight of the pen-mates at intervals during growth. Symbols: Weight of 282-02, ●; Average weight ±SD of five penmates, ▴; phytase activity of 282-02, ▪; Phytase specific activity, □. Arrows indicate sampling for fecal phosphorus concentration.
FIG. 11 illustrates weight and salivary phytase activity of the transgenic boar 282-04 and average weight of the pen-mates at intervals during growth. Symbols: Weight of 282-04, ●; Average weight ±SD of five penmates, ▴; phytase activity of 282-04, ▪; Phytase specific activity, □. Arrows indicate sampling for fecal phosphorus concentration.
FIG. 12 illustrates weight and salivary phytase activity of the transgenic boar 405-02 and average weight of the pen-mates at intervals during growth. Symbols: Weight of 405-02, ●; Average weight ±SD of four penmates, ▴; phytase activity of 405-02, ▪; Phytase specific activity, □. Arrows indicate sampling for fecal phosphorus concentration.
FIG. 13 illustrates weight and salivary phytase activity of the transgenic boar 421-06 and average weight of the pen-mates at intervals during growth. Symbols: Weight of 421-06, ●; Average weight ±SD of four penmates, ▴; phytase activity of 421-06, ▪; Phytase specific activity, □. Arrows indicate sampling for fecal phosphorus concentration.
FIG. 14 illustrates the PCR results of first generation pigs. More specifically, FIG. 14 is a picture of an agarose gel showing the PCR analysis of eight liter 154 piglets. The phytase transgenic boar 167-02 was used to breed a non-transgenic female. Std, 100 bp ladder, numbers on left are the sizes of the fragments in each band in bp; lane 167-02, DNA from boar 167-02 1, DNA from 167-02; lane C, is a lane without added DNA; lanes 1-8, are amplified DNA inserts from each of the offspring piglets of the litter. Phytase primers were Lama-UP and APPA-DOWN4. β-globin primers were PIG-BGF and PIG-BGR.
FIG. 15 illustrates a sodium dodecylsulfate gel stained with silver demonstrating the sizes of the E. coli produced APPA phytase and the APPA phytase produced by the pig and a demonstration that the pig phytase is glycosylated. More specifically, FIG. 15 is a picture of a sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) profile of the purified AppA phytase produced in E. coli and the purified pig salivary phytase stained directly with silver (A) and a transfer from a similar SDS-PAGE gel transferred to nitrocellulose and stained for glyoproteins (B). Creatinase is not glycosylated while transferring is glycosylated. The numbers on the left are the masses in of the molecular mass standards (Std) expressed in kDa.
FIG. 15B is a picture of Western blot of the untreated pig AppA phytase and the same phytase after treatment with a combination of three deglycosylating enzymes. Lane 1, Purified AppA phytase produced in E. coli (untreated); lane 2, purified pig phytase (untreated); lane 3, purified pig phytase treated with the combination of deglycosylating enzymes including N-glycosidase F, O-glycosidase and neuraminidase.
FIG. 16 illustrates a Western blot of the pig phytase and the E. coli produced APPA phytase using monoclonal antibodies directed to the APPA phytase documenting that they have homologous epitopes. More specifically, FIG. 6 is a Western blot of the AppA phytase from pig saliva after various purification steps and of purified phytase produced in E. coli. A monoclonal antibody prepared against the E. coli phytase was used as the primary antibody for detection. Lane 1, saliva from non-transgenic pig 164-04; lane 2, saliva from transgenic pig 167-02; Lane 3, saliva fraction not bound to DEAE-Sepharose; lane 4, salivary phytase bound to DEAE-Sepharose and released with an NaCl gradient; lane 5, salivary phytase further purified by Chromatofocusing with a pH gradient of 4 to 7; lane 6, phytase purified from E. coli. The numbers on the left are the masses of molecular mass standards (not shown) expressed in kDa.
FIG. 17 illustrates an SDS-Page of the E. coli APPA phytase, saliva samples from phytase negative and positive pigs and mice and a corresponding Western blot documenting that phytases from all three sources have homologous antigenic epitopes, but the animal phytases are larger than that produced in E. coli. More specifically, FIG. 6 is a SDS-PAGE profile of the purified E. coli produced AppA phytase and the AppA phytases produced by pigs and mice stained with silver (A) and a Western blot of an identical set of protein samples (B). A polyclonal antibody prepared against the E. coli phytase was used as the primary antibody for detection. Lane 1, Purified AppA phytase produced in E. coli ; lane 2, Saliva from a non-transgenic pig 164-01; lane 3, Saliva from a AppA producing transgenic pig 167-02; lane 4, Purified phytase from pig 167-02; lane 5, Saliva from a non-transgenic mouse; lane 6, Saliva from a transgenic mouse containing R15/APPA transgene induced with isoproterenol; lane 7, Saliva from a transgenic mouse containing the Lama/APPA transgene; Std, Molecular mass markers. The numbers on the left are the masses of molecular mass standards (not shown) expressed in kDa.
FIG. 18 illustrates the nucleic acid sequence of the known segment of the R15/APPA+intron plasmid including the vector sequences of pBLCAT3 (SEQ ID NO:2).
FIG. 19 illustrates the nucleic acid sequence of the known segment of the R15/APPA+intron transgene construct used for the generation of transgenic mice (SEQ ID NO:3).
FIG. 20 illustrates the nucleic acid sequence of the known segment of the R15/APPA plasmid including the vector sequences of pBLCAT3 (SEQ ID NO:4).
FIG. 21 illustrates the nucleic acid sequence of the known segment of the R15/APPA transgene construct used for the generation of transgenic mice (SEQ ID NO:5).
FIG. 22 illustrates the nucleic acid sequence of the SV40/APPA+intron plasmid (SEQ ID NO:6).
FIG. 23 illustrates the nucleic acid sequence of the Lama2/APPA transgene construct used for the generation of transgenic mice and transgenic pigs (SEQ ID NO: 7).

DESCRIPTION OF THE PREFERRED EMBODIMENTS

In the following description, a number of recombinant DNA technology terms are used. The following definitions have been provided in order to enable a clearer understanding of the specification and appended claims:
“Promoter”—a DNA sequence generally described as the 5′ region of a gene and located proximal to the start codon. The transcription of an adjacent gene is initiated at the promoter region. If a promoter is an inducible promoter then the rate of transcription increases in response to an inducing agent. A constitutive promoter is one that initiates transcription of an adjacent gene without additional regulation.
“Operably Linked”—a nucleic acid sequence is “operably linked” when placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is “operably linked” to a coding sequence if the promoter causes the transcription of the sequence. Generally, operably linked means that the linked nucleic acid sequences are contiguous and, where it is necessary to join two protein coding regions, contiguous and in one reading frame.
“Phytase”—any protein that liberates phosphate from myo-inositolhexakis-phosphate or other inositol phosphates. Its catalytic capability may be limited to phytic acid or one of its salts, or it may show less specificity and hydrolyze a variety of phosphorylated compounds.
“Gene”—a DNA sequence that contains a template for an RNA polymerase and contains information needed for expressing a polypeptide or protein.
“Polynucleotide Molecule”—a polydeoxyribonucleic (DNA) acid molecule or a polyribonucleic acid (RNA) molecule.
“Expression”—the process by which a polypeptide is produced from a structural gene.
“Cloning vehicle”—is a plasmid or phage DNA or other DNA sequence which is capable of carrying genetic information into a host cell. A cloning vehicle is often characterized by one or more endonuclease recognition sites at which such DNA sequences may be cut in a determinable fashion without loss of an essential biological function of the vehicle. A cloning vehicle is a DNA sequence into which a desired DNA may be spliced in order to bring about its cloning into the host cell.
“Vector”—is a term also used to refer to a cloning vehicle.
“Plasmid”—is a cloning vehicle generally comprising a circular DNA molecule that is maintained and replicates autonomously in at least one host cell.
“Expression vehicle”—a vehicle or vector similar to a cloning vehicle but which supports expression of a gene that has been cloned into it, after transformation of a host. The cloned gene is usually placed under the control of (i.e. is operably linked to) certain control sequences such as promoter sequences.
“Host”—a cell that is utilized as the recipient and carrier of recombinant material.
“Homologous”—refers to a nucleic acid molecule that originates from the same genus or species as the host.
“Heterologous”—refers to a nucleic acid molecule that originates from a different genus or species than that of the host.
“Glycoprotein”—refers to a peptide molecule that has undergone glycosylation.
“Glycosylation”—refers to the addition of carbohydrate groups to a amino acid residues of a peptide molecule.
In recent years, transgenic animals have been developed for many purposes (Pinkert et al. 1990) (Wall et al. 1997). One premise, therefore, for the present invention is that by providing a transgenic animal capable of expressing phytase, the problems discussed above would be obviated. The options for heterologous phytase expression in animals include (i) salivary gland secretion of a phytase, (ii) pancreatic secretion of the enzyme into the small intestine along with the digestive enzymes, or (iii) secretion from the intestinal epithelial cells much like that of indigenous alkaline phosphatase and glycosidases (Low, 1989). The E. coli phytase would appear to be best suited for hydrolytic activity in the monogastric stomach because the enzyme has a pH optimum in the range of 2.5 to 4.5 and it is resistant to pepsin, the predominant protease active in the stomach. The phytase has a periplasmic location in E. coli and has an N-terminal signal peptide sequence (Golovan et al., 1999) that seemed optimally adapted for secretion from the parotid gland. Phytase could be expressed in either the pancreas for secretion into the small intestine or it could be expressed in the intestinal epithelial tissue and secreted into the intestinal milieu. However, if these choices of expression locations were chosen, it would be necessary to select an enzyme active at the more neutral pH of the small intestine and one which was more resistant to pancreatic enzymes including trypsin, chymotrypsin and elastase.
Factors of importance in terms of the expressed enzyme when selecting a phytase for expression in the gastrointestinal tract include a pH that is optimum for activity, high catalytic activity, broad substrate specificity, and protease resistance. If any of these properties, or indeed others, is not acceptable, there are now sophisticated molecular methods for modifying the properties of an enzyme. These include site directed mutagenesis, random mutagenesis and various modifications of DNA shuffling (Harayama, 1998; Crameri et al., 1998).
Synthesis of phytase in the salivary gland and secretion in the saliva would, therefore, provide for early contact of the enzyme with phytic acid present in the feed and provide sufficient time for hydrolysis.
The salivary gland system of the pig consists of three pairs of glands, the parotid gland, which secretes through a duct on each cheek, and mandibular and submaxillary glands that have joint ducts that secrete beneath the front on the tongue. Saliva secreted in the pig via these ducts is discontinuous and is produced during consumption of solid foods, and can equal the weight of food consumed when water is limited during feed consumption (Corring, 1980; Arkhipovets, 1956). For example, the quantity of saliva produced by a 45 kg pig can vary from near zero when the pig receives a mainly liquid diet to 500 g when a dry diet is consumed without access to water. The salivary glands of the pig secrete amylase (Rozhkov and Galimov, 1990) and a variety of other salivary proteins and mucopolysaccharides.
To our knowledge no porcine genes coding for salivary proteins have been cloned. However, genes coding for major proteins secreted by the rat and mouse have been cloned and characterized. A multigene family encoding a group of unique proteins high in proline, the so-called proline-rich proteins (PRPs) are produced when either mice or rats consume tannins or are injected with isoproterenol.
It would be advantageous to develop an animal that is transformed to express phytase, preferably in the salivary gland. In such case, the phytate naturally occurring in the animal feed can be utilized by the animal without any additives being used. This will decrease the cost of animal production, and furthermore, will avoid polluting the environment with phosphorus. Therefore, the present invention aims to overcome the deficiencies of the prior art relating to increasing phytate utilization and, particularly, to provide transgenic animals which express phytase.
In the production of heterologous proteins by means of recombinant methods, several hurdles have been faced. One such hurdle that is often faced is the lack of required post-translational modification of the expressed protein thereby resulting in a protein that is structurally and/or functionally, different from the desired molecule. Glycosylation is one such post-translational modification that is desired. However, such modification is generally found to occur in more complex mammalian systems. Therefore in one embodiment of the present invention there is provided a method of producing recombinant glycoproteins.
In one embodiment, the present invention provides an animal capable of inducible or constitutive salivary expression of a heterologous protein. To illustrate this, the mouse was chosen as the animal model and the gene constructs used for transformation were created using the rat proline-rich protein (PRP) promoter/enhancer (inducible promoter) and the mouse parotid secretory protein (PSP) promoter/enhancer (constitutive promoter). In this illustration, phytase was used for expression in saliva.
After finding that an inducible phytase could be expressed in the parotid gland of mice the expression of the phytase transgene under the control of the constitutive PSP promoter was then tested. Two mice transgenic for the PSP construct were produced under contract at the University of Alabama.
Following the testing of the mice described above, transgenic pigs were developed by introduction into the genome a phytase transgene consisting of a constitutive promoter driving the synthesis of a highly active phytase. The pigs so generated were found to excrete less phosphorus in their feces than non-transgenic pigs.
Expression in the Salivary Glands
Saliva is a clear colorless fluid secreted by major salivary glands (parotid, submandibular, sublingual and minor salivary) that lubricates and cleans the oral structure, as well as initiates the process of digestion. The parotid glands are two of six major glands associated with the production of saliva. The parotid gland is composed mainly of two cell types: acinar and interglobular duct cells. The acinar cells, which represent 75 to 85% of the tissue, are the sites of secretory protein synthesis (Frandson and Spurgeon 1992). Two very abundant proteins are produced by these cells: a-amylase (AMY-1) (2% of polyA RNA) (Madsen and Hjorth 1985), and parotid secretory protein (PSP) (10% of polyA RNA) (Shaw and Schibler 1986). Several constructs are now available which allow tissue-specific expression of a transgene in the salivary glands of mice.
The salivary secretion in pigs has not received the attention given to that of mice and humans. It was suggested that salivary secretion is discontinuous (less secreted between periods of meal consumption). Up to 500 g of saliva may be secreted by a 45 kg pig upon consumption of 500 g of dry feed (Corring 1980). Wide variations were detected in both the flow rate and electrolytes in saliva between animals and even between samples taken from the same animal on separate days (Tryon and Bibby 1966). Very little is known about the composition of pig's saliva or salivary enzymes. Salivary amylase was detected, although the quantity was 250 000 times less than that of pancreatic amylase, and 100 times less than in human saliva (Low 1989). There are no constructs known which would allow salivary gland-specific expression of transgene in pigs.
I) APPA Gene Under Control Of An Inducible Promoter
1) Construction of R15/APPA constructs (Inducible Promoter)
In this process, a plasmid is constructed by linking a promoter/enhancer for a saliva protein with the APPA gene, which codes for the bifunctional phytase, acid phosphatase. The APPA gene used in this construction was cloned from E. coli ATCC 33965 into pBR322. This is described above (Golovan et al., 2000).
Proteins, unusually high in proline, the so-called proline-rich proteins (PRPs), comprise about 70% of the total proteins in human saliva (Bennick 1982). Unlike the constitutive expression of the PRPs in humans, the salivary glands of mice, rats and hamster normally either do not express PRPs or express them in low levels. In the rat and mouse, PRP gene expression can be dramatically induced by diets high in tannins or by injection with the β-agonist isoproterenol (Carlson 1993). After 6 to 10 days of daily isoproterenol injection the PRPs comprised about 70% of the total soluble protein in parotid gland extracts. PRP cDNA and PRP genes have been cloned and characterized from rats (Clements et al. 1985), mice (Ann and Carlson 1985), hamsters (Mehansho et al. 1987), and humans (Kim and Maeda 1986).
Transgenic mice were used to locate the cis-acting DNA elements that are essential for salivary-specific and inducible expression of the rat proline-rich protein gene, R15. It was found that a parotid control region (−6 to −1.7 kb) upstream of the R15 promoter is capable of directing parotid-specific and isoproterenol-inducible expression of a heterologous promoter construct (Tu et al. 1993). The distal −10 to −6 kb region was shown to function as an enhancer, which can increase levels of expression more than 30-fold. The −6 to −1.7 kb region also seems to function as a locus control region (LCR), because it conferred copy number-dependent and chromosomal position-independent expression of a reporter gene in 15 out of 15 independent transgenic mice (Tu, Lazowski, Ehlenfeldt, Wu, Lin, Kousvelari, and Ann 1993).
We obtained the R15-PRP promoter from Dr. D. K. Ann as a plasmid −10R15/CAT, which placed the chloramphenicol acetyltransferase gene (CAT) under control of the inducible R15-PRP promoter. We decided to use the plasmid as a basis for transgene construction (FIG. 1). Due to the absence of complete sequence information about the R15-PRP promoter (only 2 kbp out of 10 kbp was sequenced) we removed the R15-PRP promoter by Xho I digestion (FIG. 1, step 1). Re-ligated plasmid was used as a template for PCR with CAT-ATG and CAT-TAA synthetic primers. The 4.3 kbp CAT_PCRfragment had the initiation site of the CAT gene substituted with the optimal eukaryotic initiation sequence (Kozak 1987). The fragment was purified by agarose gel electrophoresis, re-ligated to itself and used to transform E. coli (FIG. 1, step 2). The CAT_PCRplasmid was digested with Nco I and filled-in using T4 DNA polymerase to generate a blunt end. After that, the CAT_PCRfragment was digested with Eco47III and purified by agarose gel electrophoresis (FIG. 1, step 3). Three rare codons in the APPA gene were modified during the sub-cloning steps leading to the construction of the transgene. Specifically, the A1a₃coding sequence was changed from GCG to GCC, the Pro₄₂₈sequence was changed from CCG to CCC, and the A1a₄₂₉sequence was changed from GCG to GCT. This modification was made in order to increase the possibility of transcription of the gene in eukaryotic cells. The APPA gene was amplified by PCR using the previously cloned APPA gene from the pBR322/APPA plasmid with the synthetic primers APPA-DRA and APPA-SMA. The 1.3 kbp APPA_PCRfragment generated by PCR was digested with Dra I and Sma I and gel-purified (FIG. 1, step 4). APPA_PCRand CAT_PCRfragments were blunt end ligated to produce CAT/APPA+intron vector (FIG. 1, step 5), which was introduced into a DH5α strain of E. coli. The insert orientation was checked by restriction digest with Sal I and EcoR I. The transgene in CAT/APPA+intron was checked by sequencing both strands. To remove the SV40 small t intron the 2.3 kbp APPA/intron/polyA fragment was excised from a plasmid by Xho I and EcoR I digestion (FIG. 1, step 6a), gel purified and digested by Dra I (FIG. 1, step 6b). The 1.5 kbp (APPA) and 0.2 kbp (polyA) fragments were gel-purified and linked together in three way ligation with CAT_PCRdigested with Xho I and EcoR I (FIG. 1, step 6c). The resulting plasmids CAT/APPA and CAT/APPA+intron were digested with Xho I, gel-purified and re-ligated with R15-PRP promoter digested with Xho I (FIG. 1, step 7). Because of the low efficiency of ligation the whole ligation mixture was used to transform E. coli , total plasmid DNA was prepared and run on the agarose gel. Plasmids which were larger than the original CAT/APPA (5.6 kbp) were eluted and re-transformed in E. coli. Plasmids with the R15-PRP insert (15 kbp) were identified by electrophoresing DNA from a single colony on an agarose gel. The correct orientation was identified by PCR with R15-UP1 and APPA-DOWN2 synthetic primers. The plasmids R15/APPA and R15/APPA+intron were both digested with Hind III and Kpn I; transgenes were gel-purified and further purified using a Qiagen column (FIG. 1, step 8).
FIG. 18 illustrates the nucleic acid sequence for the plasmid containing the known segment of the R15/APPA+intron sequence including the vector sequences of pBLCAT3. The sequence of this plasmid is designated as SEQ ID NO:2.
FIG. 19 illustrates the nucleic acid sequence for the transgene construct containing the known segment of the R15/APPA+intron sequence used for the generation of transgenic mice. The sequence of this transgene is designated as SEQ ID NO:3.
FIG. 20 illustrates the nucleic acid sequence for the plasmid containing the known segment of the R15/APPA sequence including the vector sequences of pBLCAT3. The sequence for this plasmid is designated as SEQ ID NO:4.
The pBLCAT3 sequence indicated above is present in the CAT/APPA of FIG. 1 and in the CAT/APPA+intron of FIG. 2. This sequence was part of the original −10R15/CAT and a portion of it was carried through in the construction process.
FIG. 21 illustrates the nucleic acid sequence for the transgene construct containing the known segment of the R15/APPA sequence used for the generation of transgenic mice. The sequence of this transgene is designated as SEQ ID NO:5.
2) Expression of SV40/APPA+intron in Cell Culture
To produce an SV40/APPA plasmid for expression of APPA in cell culture, the SV40 promoter/enhancer was amplified by PCR from the pSV-β-galactosidase plasmid (Promega) using the synthetic primers SV-HIND and SV-XHO. The SV40 promoter/enhancer fragment was digested with Xho I and Hind III, gel purified, and ligated into CAT/APPA digested with Xho I and Hind III (FIG. 2).
FIG. 22 illustrates nucleic acid sequence for the SV40/APPA+intron. The sequence for this plasmid is designated as SEQ ID NO:6.
We obtained a rat parotid acinar cell line PARC 5.8 (Quissell et al. 1998) that we intended to use for transient expression of the phytase transgene. The purpose was to test the efficiency of different constructs for transgene expression and also to detect any deleterious effects of phytase expression before introduction into the animals. We tried transient expression of the APPA gene using R15/APPA and R15/APPA+intron constructs but because of low transfection efficiency and/or low expression levels, we were unable to detect either phytase or β-galactosidase that we used as a control for transfection.
We exchanged the R15-PRP inducible promoter from the R15/APPA construct with the SV40 constitutive promoter-enhancer, which enables high level transient expression in different cell cultures. CHO, COS7 and HELA cell lines were screened for transient expression of the APPA phytase using the SV40 promoter/enhancer. All cell lines were maintained on DMEM/F12 (Sigma) cell medium with 10% (wt/vol) heat-inactivated fetal bovine serum at 37° C. in 5% CO₂and 95% air. Cells were grown to 70 % confluence before transfection. Two hours before transfection the medium was exchanged with fresh medium. Cells were transformed with 5 μg of DNA per 60 mm culture plate (1:1 SV40/APPA and SV40/β-galactosidase) using the DNA-Calcium-Phosphate method of transfection (Gorman et al. 1983). After 6 hours of incubation the medium was removed and cells were subjected to glycerol shock for 3 min (Ausbel et al. 1992). Cells were washed with phosphate-buffered saline (PBS) and incubated in fresh medium under standard growth conditions. After 48 hours of incubation cell-free culture fluid was collected, the cells washed two times with PBS and lysed with 1 ml of 1% (vol/vol) NP-40, 1 mM disodium EDTA in Hanks balanced salts (HBSS) for 1 hour at 4° C. The phytase assay was performed in a final volume of 100 μl of 0.1 M sodium acetate/acetic acid buffer (pH 4.5) using sodium phytate (4 mM) as a substrate at 37° C. After 6 hours of incubation the reaction was stopped with 67 μl ammonium molybdate/ammonium vanadate/nitric acid mixture and the concentration of liberated inorganic phosphate determined at 405 nm (Engelen et al. 1994). One unit (U) of enzyme activity was the amount of the enzyme releasing 1 μmol inorganic phosphate per minute. The assay was performed in triplicate. As a control for endogenous phytase activity, non-transfected cell lines were used.
We did not detect endogenous phytase activity in non-transfected cell lines. Phytase activity was detected in all transfected cell lines, with COS7 cells expressing a total of 0.35 U of phytase in cell-free culture fluid (4 ml) and 0.0034 U in the cell fraction (1.1 ml) obtained from the same plate. The phytase activity produced by COS7 cells was 7 times higher than that of CHO and 35 times more than the HELA cell line. More than 99% of activity was located in cell-free culture fluid, which suggests that the expressed enzyme was exported out of the cell using the bacterial signal sequence. We were unable to detect expression of cytoplasmic β-galactosidase, which we wanted to use as a control for transfection efficiency.
3) Expression of R15-PRP/APPA in Transgenic Mice
Transgenic mice were generated using the constructs R15/APPA and R15/APPA+intron by Dr. C. A. Pinkert at the NICHD Transgenic Mouse Development Facility (NTMDF), University of Alabama at Birmingham, Ala. The procedures followed in generating the mice have been standardized by the NTMDF and further information concerning this can be obtained at: transgenics.bhs.uab.edu/page1.htm, the content of which is incorporated herein by reference. This procedure involved the microinjection technique for transfecting mice with the desired nucleic acid sequence. To summarize, the sequences are microinjected into mouse zygotes and the surviving eggs are implanted into pseudopregnant recipient mice. The recipient mice then give birth to the resulting founder transgenic mice. It will be appreciated that various other methods of generating transgenic mice may be used in the present invention.
The R15/APPA transgene in mice was detected by PCR using the primers CAT-UP1 and APPA-DOWN2 that gives rise to a 700 bp fragment using the standard PCR conditions, except that the hybridization step was set at 51° C. for 40 seconds and the polymerization step was at 72° C. for one minute.
For the R15/APPA construct 8 PCR positive founder mice were obtained of which 4 were males and 4 were females. Three of the founders did not pass the transgene to progeny and were probably mosaics. For R15/APPA+intron 5 PCR positive founder mice were obtained, 3 were males and 2 were females, and one of them was found to be mosaic. At 10 to 12 weeks of age PRP production in the PCR positive progeny from different lines was induced for 10 days by daily intraperitoneal (ip) injection of 1 mg isoproterenol dissolved in 100 μl sterile saline. To serve as a control several PCR negative progeny were also induced. No significant differences in weight were noticed between PCR positive and PCR negative progeny at either the beginning or end of the induction period. Saliva was collected before induction and at the end of the 10 day induction period.
To collect saliva, mice were lightly anesthetized with a ketamine/xylazine mixture (ip injection of 50 mg ketamine and 5 mg xylazine per kg body weight diluted in water) and saliva flow was induced by injection with pilocarpine/isoproterenol (ip injection of 0.5 mg pilocarpine and 2 mg isoproterenol per kg body weight dissolved in saline (Hu et al. 1992). Between 100-250 μl saliva was collected from each mouse over a 30 min period beginning 5 min after the pilocarpine/isoproterenol injection.
The saliva was collected from each mouse by holding it in one hand and withdrawing saliva from the corner of the mouth with a 20 μl pipetter. Collected saliva was transferred to a cold Eppendorf microcentrifuge tube containing 2 μl of 0.5 M EDTA (pH 8.0) and 4 μl of 10 mg/ml protease inhibitor Pefabloc (Boehringer Mannheim) dissolved in water. The tubes with saliva were kept on ice until assays were conducted. Phytase activity in the saliva was assayed as described for the SV40/APPA expressed in cell culture.
Phytase expression was not detected in either un-induced or in induced PCR negative mice. For PCR positive mice, phytase expression was not detected in those that were un-induced. However, phytase expression was observed for PCR positive mice that were induced. The results of this study are summarized in Table 1.
Even though it was possible to distinguish saliva from induced PCR positive from that of PCR negative mice in a phytase assay by a characteristic yellow color, saliva from some of the negative mice, when assayed, produced cloudiness that was impossible to remove by centrifugation and that affected spectrophotometer readings. We did not notice any gender differences in expression, both males and females were found to produce phytase in saliva. In three lines (all R15/APPA+intron) no phytase expression or very low level of expression (0.03-0.95 U/ml) was detected, in 4 lines the level of expression ranged from 7 to 87 U/ml, and two lines (both R15/APPA) produced very high levels of phytase in saliva, 252 and 547 U/ml.
These experiments demonstrated that phytase can be expressed at a very high level in the salivary glands of mice, without detrimental effects on the animals. We also were able to produce progeny with an inducible salivary phytase from animals expressing the inducible phytase thereby documenting inheritance of the trait, and showing that the reproductive capability of animals was not affected. When the F2 generation of mice were tested for salivary phytase the level of phytase production was preserved.
Founders containing the transgene without the intron gave offspring that produced significantly higher levels of phytase. The SV40 intron in the R15/APPA+intron construct seems to cause a lower level of expression, and in three lines (A1f, A20f and B0m) the level of phytase was barely detectable. The level of phytase expression in A2m line (R15/APPA+intron) was 6.2 times lower than that of the B0m-intron line (R15/APPA).
Preliminary experiments showed that when the enzyme was analyzed by PAGE its size was increased from 42 kDa to 60 kDa. It is likely modified by glycosylation, but stable and active.
II) APPA Gene Under Control Of A Constitutive Promoter
1) Construction of the Lama2/APPA Transgene (Constitutive Promoter)
The murine parotid secretory protein (PSP) is the most abundantly expressed protein in the parotid gland of mice (Madsen and Hjorth 1985). After an hour of pulse labeling, the mouse parotid gland incorporates 65 to 85% of ¹⁴C-leucine into this single protein (Owerbach and Hjorth 1980). It was estimated that PSP mRNA accumulates up to 50,000 molecules per cell and that from 3 to 5 molecules of PSP are produced for every molecule of amylase (Madsen and Hjorth 1985). Despite the predominance of the PSP in saliva its function is not well characterized.
The single-copy gene coding for PSP has been cloned and characterized. It has two alleles PSP^a(Shaw and Schibler 1986) and PSP^b(Owerbach and Hjorth 1980). The PSP^ballele is also expressed in the sublingual gland, but at 1/10 of the level found in the parotid gland. It was shown that 4.6 kbp of 5′ flanking sequence of PSP^bis sufficient for salivary gland specific expression. The level of sublingual expression approached 100% of the PSP mRNA level, whereas the parotid expression did not exceed 1% (Mikkelsen et al. 1992), which demonstrates that regulatory sequences for sublingual and parotid expression are not identical. The level of expression was also dependent on the site of integration. The same construct was used for expression of the C-terminal chain of the human blood coagulation factor VIII, FVIII. A high level of FVIII mRNA was detected in the sublingual gland and a low level in the parotid gland. The transgenic lines also secreted the FVIII light chain into saliva at the level of about 10 units per salivation (about 0.05 ml of saliva) (Mikkelsen et al., 1992). Later the same group achieved a high level of parotid-specific expression that was similar or even exceeded that of the endogenous gene by using 11.4 kbp of 5′ flanking sequences and 2.5 kbp of 3′ flanking sequences (Larsen et al. 1994). The expression also seems to be position-independent and copy-number-dependent that could indicate the presence of a LCR in these sequences.
Lama 2 is a portion of the PSP gene and comprises an 18 kbp construct that is expressed in transgenic mice at up to 56% of the endogenous PSP gene.
Because a large part of Lama 2 had not been sequenced, the construct was first disassembled and subcloned into pBluescript KS(+) and after incorporation of the APPA gene, the Lama 2 was reassembled back (FIG. 3). We used unique enzymes RsrII and Sma1 to remove a 3.4 kbp fragment from Lama2, which was subcloned into the multiple cloning site (MCS) of pBluescript II KS(+) that was previously digested with Kpn1 and Sma1, using a Kpn1-RsrII adapter (FIG. 3, step 1).

KpnI* RsrII

TGGGAGGTCG (SEQ ID NO: 8)

CATGACCCTCCAGCCAG (SEQ ID NO: 9)
That allowed us to preserve the RsrII (CG/GWCCG) (SEQ ID NO: 10) site and destroy the Kpn1 site (GGTAC/C> (SEQ ID NO: 11) GGTAC/T) (SEQ ID NO: 12), which would otherwise interfere with future cloning. The pKS/Lama construct was digested with Apa1 and Kpn1 and used in a three-way ligation with the modified APPA (FIG. 3, step 2). We designed two PSP/APPA constructs. One construct APPA-signal/APPA (FIG. 3, steps 3a-7a) had the original bacterial signal sequence from the APPA protein having the following amino acid sequence:

(SEQ ID NO: 13)

Met-Lys-Ala-Ile-Leu-Ile-Pro-Phe-Leu-Ser-Leu-Leu-

Ile-Pro-Leu-Thr-Pro-Gln-Ser-Ala-Phe-Ala
We also modified a sequence near the ATG codon to resemble the optimal mammalian Kozak sequence (GCC GCC A/GCC ATG G) (SEQ ID NO: 14) (Kozak 1987), but we did not mutagenize the +4 position because it would change Lys to Glu in the signal sequence with possible deleterious consequences for protein export. This optimized sequence was used in our previous construct R15/APPA and led to high levels of phytase production. We checked the APPA bacterial signal sequence using the PSORT computer neural network trained on eukaryotic signal sequences and further described at /http://psort.nibb.acjp:8800/ (Nakai and Kanehisa 1992). The APPA bacterial signal sequence was recognized as an efficient leader peptide and the cleavage site was correctly predicted. PSORT also predicted that there is a high probability that phytase would be exported correctly outside of the cell. There were also publications showing that some bacterial signal sequences might function efficiently in mammalian cells (Williamson et al. 1994) (Hall et al. 1990). Our experiments using cell culture demonstrated that the APPA signal was correctly processed with export of phytase outside of the cell.
Experiments using cell culture cannot predict the direction of export and if phytase were exported into blood vessels instead of salivary ducts that could lead to deleterious effects. That is why we also designed a second construct PSP-signal/APPA (FIG. 3, steps 3b-7b) that would preserve the original PSP signal amino acid sequence:

(SEQ ID NO: 15)

Met-Phe-Gln-Leu-Gly-Ser-Leu-Val-Val-Leu-Cys-Gly-

Leu-Leu-Ile-Gly-Asn-Ser-Glu-Ser.
This leader peptide was also efficiently recognized by PSORT with the correct cleavage site (Nakai and Kanehisa 1992). In this construct we also preserved the original PSP sequences near the ATG start codons, which may not be optimal, but could be important in regulation of gene expression. The APPA gene for both constructs was amplified by PCR using as the template our previous transgenic construct R15/APPA that possessed the optimal Kozak sequence and the modified codons for residues A1a3, Pro428 and A1a429 as described earlier. For the APPA signal/APPA construct two synthetic primers were used which introduced a Cla1 site near the ATG codon (APPA-CLA) and a Kpn1 site near the TAA stop codon (APPA-KPN). The APPA _PCR1 product was digested with Cla1 and Kpn1. The Cla1 site was also introduced into Lama 2 using pKS/Lama 2 as template for PCR. LAMA-UP primer was located upstream of Apa1 site and the LAMA-CLA primer introduced the Cla1 site near ATG codon (FIG. 3, step 3a). Lama _PCR1 product was digested with Cla1 and Apa1 (FIG. 3, step 4a). pKS/Lama (Apa1-Kpn1), Lama_PCR1 (Apa1-Cla1) and APPA_PCR1 (Cla1-Kpn1) were combined together in a three-way ligation reaction (FIG. 3, step 5a). The recovered pKS/Lama/APPA plasmid was digested with RsrII, Sma1 and inserted back into Lama2 (FIG. 3, step 6a).
For the PSPsignal/APPA construct, the synthetic APP-KPN primer was used with the synthetic APPA-MATURE primer, which produced phytase without a signal sequence. The APPA _PCR2 product was blunt-ended using T4 DNA polymerase and digested with Kpn1. The PSP signal sequence was produced using the LAMA-UP and LAMA-SIGNAL primer (FIG. 3, step 3b). The Lama _PCR2 was blunt-ended using T4 DNA polymerase and digested with Apa1 (FIG. 3, step 4b). pKS/Lama (Apa1-Kpn1), Lama_PCR2 (Apa1-blunt) and APPA_PCR2 (blunt-Kpn1) were combined together in a three-way ligation reaction (FIG. 3, step 5b). The recovered pKS/Lama/APPA plasmid was digested with RsrII, Sma1 and inserted back into Lama2 (FIG. 3, step 6b).
Even though both constructs were successfully produced we decided to use Lama2/APPAsignal/APPA for the generation of transgenic mice, because we have results from our previous transgenic constructs R15/APPA and R15/APPA+intron which demonstrated that phytase with optimized Kozak sequence and the APPA signal peptide was synthesized at a high level in salivary glands after induction and was efficiently exported into the salivary duct. The Lama2/APPA vector was digested with XhoI and NotI, and the transgene was gel-purified and further purified using a Qiagen column (FIG. 3, step 7a).
2) Sequence of the Lama2/APPA Construct
A large segment of the Lama2 construct (Laursen and Hjorth 1997) used for construction of the Lama2-APPA transgene had not been reported in GenBank prior to our research. To ensure that we could more clearly describe the transgene construct, and furthermore to avoid the introduction of deleterious DNA sequences from the mouse into the pig in the process of generating transgenic pigs, we sequenced the Lama2-APPA plasmid on both strands. FIG. 4 illustrates schematically the structure of the Lama2-APPA plasmid. FIG. 5 illustrates the nucleic acid sequence (SEQ ID NO: 1) of such plasmid. The full transgene sequence was reconstructed from overlapping DNA sequences using the Contig Assembly Program (CAP) developed by Huang (1996; 1999) and then inspected manually for sequencing errors. The transgene sequence was checked for the presence of interspersed repetitive elements using the computer program RepeatMasker (Smith and Green, RepeatMasker. It was found that 26% of the transgene sequence was composed of repetitive elements (Table 2). However, such repetitive elements are widely present in all mammalian genomes. For example, up to 50% of the human genome is derived from repetitive elements (Smit 1996; Kazazian 1998).
FIG. 23 illustrates the nucleic acid sequence (SEQ ID NO:7) of the Lama2/APPA transgene construct.
The Lama2 high level expression cassette (Laursen and Hjorth 1997) contains the enhancer region and the promoter of the Psp gene in the parotid gland. High expression was shown to be dependent on regulatory elements between −11.5 kb and −6.5 kb and/or between +8.3 kb and +10.9 kb. Svendsen et al. ( 1998a) showed that a 1.5 kb sequence between −3.1 kb and −4.6 kb had properties of a parotid and sublingual specific enhancer and was designated as the PSP proximal enhancer. Furthermore, they showed that transgenes containing the PSP promoter and 5′ flanking region located between −3.6 kb and −4.3 kb contained sequence information necessary to direct salivary gland specific expression.
Screening the transgene with RepeatMasker did not reveal the presence of any full-length active autonomous elements. The repeats present were extensively modified by insertions and deletions. The blasix program was also used to compare the transgene sequence translated in all reading frames against the National Center for Biotechnology Information (NCBI) protein sequence database (ncbi.nlm.nih.gov/BLAST/) (Altschul et al. 1990; Gish and States 1993; Terada and Nakanuma 1993). A region of DNA from 861 to 2180 was found that might code for parts of a protein with limited homology (38-58% identities) to the C-terminus of several human and mouse reverse transcriptases. However, the region was extensively modified by mutations with multiple frame shifts and inversions, and probably represented remnants left from the reverse transcriptase gene of a LINE element. It is unlikely that it would be active, due to extensive modifications in the amino acid sequence such that only 18% of the full reverse transcriptase sequence was present and the highly conserved amino acid motif (Y/FXDD) was absent from the sequence (Xiong and Eickbush 1990). The complete sequence was also scanned for the presence of open reading frames (ORFs) that code for proteins using the program GENSCAN (CCR-081.mit.edu/GENSCAN.html) (Burge and Karlin 1997). Only one gene was found and it corresponded to the APPA phytase gene. GENSCAN unexpectedly predicted a different N-terminus for the phytase than would have been expected from the sequence. However, that could have resulted from the lower accuracy of GENSCAN for detecting initiation sites (Burge and Karlin 1998).
3) Generation of Transgenic Mice Expressing a Constitutive Salivary Phytase
In the following description, a pair of founder mice, incorporating the phytase gene and a constitutive promoter, were prepared under contract by the University of Alabama. As will be discussed, these founders were used to produce offspring, which were then analyzed for the presence of the phytase gene by PCR and animals containing the gene were then tested constitutive salivary phytase production.
Two transgenic founder mice (a black male and a white female, 3-1) containing the phytase transgene were received from the NICHD Transgenic Mouse Development Facility at the University of Alabama. The black male was negative for salivary phytase, but the female, 3-1, exhibited a salivary phytase activity of 30 U/ml. Progeny produced by crossing the black male with 4 CD-1 females produced 9 out of 25 females and 13 out of 26 males that were PCR positive. All progeny were negative for salivary phytase. The female founder, 3-1, was out-crossed with a CD-1 male to produce 3 litters for a total of 35 offspring. Of the progeny from these matings one phytase positive GI male was obtained. When the GI male was outcrossed with 6 CD-1 females, of the 6 litters 20/34 males were PCR positive and salivary phytase positive and 21/28 females were PCR positive and salivary phytase positive (Table 3). The salivary phytase activity of different offspring from the same first generation (GI) male ranged from 1.3 to 71.2 U/ml. There was no significant difference in the phytase activities between male or female mice.
PCR assays for identification of the transgenic mice were carried out with an initial heating step at 95° C. for 3 min, 40 cycles using 95° C. for 30 sec, 54° C. for 30 sec and 72° C. for 1 min) using the following primers: APPA-UP2 and APPA-KPN (FIG. 6).
The phytase assays were conducted as described above for the R15-PRP/APPA phytase expressed in cell culture.
4) Production of Transgenic Pigs Containing the Phytase Transgene Lama 2/APPA
Transgenic pigs were produced using Yorkshire and Yorkshire/Landrace cross gilts as the embryo donors and Yorkshire sows as the recipients. The experimental procedure used was similar to that described by Wall et al. ( 1985). The detailed procedure is described below. The Lama2/APPA construct with the APPA signal peptide was used as the transgene for microinjection.
Methodology for the generation of transgenic pigs
The following is a description of the preferred method of generating transgenic pigs according to the invention. However, it will be apparent to those skilled in the art that various other methods are also applicable.
a) Superovulation of prepuberal gilts and sows.
Selected Yorkshire or Yorkshire/Landrace cross gilts between 70 to 80 kg were superovulated by intramuscular injection of 2000 IU of pregnant mare's serum gonadotropin (PMSG, Ayerst Veterinary Laboratories), followed by 700 IU human chorionic gonadotropin (HCG, Ayerst Veterinary Laboratories) 60 to 72 hours later, administered in the same manner. The gilts were artificially inseminated three times with a 16 hour interval between inseminations using semen from a high breeding index Yorkshire boar. Twenty-four hours after the last insemination, the gilts were slaughtered and the reproductive tract recovered.
b) Synchronization of estrus in recipients
Estrus was synchronized in experienced recipient sows as described for donor sows. Since synchronization and not superovulation was the goal, hormone levels were reduced to 500 IU for PSMG and 500 IU for HCG. PMSG was given the day the sow's litter was weaned, followed in 72 hours by HCG and surgery for embryo transfer was performed 54 hours thereafter.
c) Embryo collection
Reproductive tracts were collected at the abattoir, inserted into bags, sealed and the bags immersed in water at 39° C. for transport to the laboratory. Recovery of the embryos and microinjection with the transgene was conducted in a laboratory maintained at 32 to 33° C. The oviducts were dissected from the tracts and flushed, using a syringe and a feeding tube, with 15 ml of pre-warmed HBECM-3 medium (Dobrinsky et al. 1996). The media was collected in a 100 mm Petri dish and placed in an incubator at 38.5° C. with an atmosphere of 5% (vol/vol) of CO₂, 5% (vol/vol) O₂and the balance N₂. After all tracts were flushed, embryos were individually collected from the flushed media using a polished transfer pipette. Embryos were rinsed twice in 3 ml volumes of pre-incubated BECM-3 and placed in 100 μl of pre-incubated BECM-3 under 3 ml of filter sterilized mineral oil until injected.
d) Pronuclear injection
Embryos from one gilt were collected and placed in one ml of pre-warmed HBECM-3 in a 1.5 ml centrifuge tube and centrifuged for 6 min at 14,000×g (Wall et al. 1985). The embryos were then collected and placed in an injection dish with 40 μl of pre-warmed HBECM-3 covered with 2.5 ml of filter sterilized mineral oil. The pronucleus in each embryo was injected (Gordon et al. 1980) with three picolitres of Lama2/APPA DNA in solution at a concentration of 5 ng of DNA per μl in 10 mM Tris, pH 7.5, 0.1 mM EDTA. After injection, the embryos were placed in dishes containing 100 μl of pre-incubated BECM-3 under 3 ml of filter sterilized mineral oil. After all embryos were injected, which took no more than 4 hours since collection of reproductive tracts, the embryos were transferred to 1.8 ml cryotube (Nunc) containing 1 ml of pre-warmed HBECM-3 and transported in an incubator at 38.5° C. to the swine surgery.
e) Embryo transfer
Recipient sows were anesthetized by intravenous injection of 500 mg Brietol and anesthesia maintained by inhalation of 3% halothane with 4 litres per min of nitrous oxide and 4 litres per min oxygen. The oviducts were exposed through a laparotomy, just off the dorsal midline, and a catheter, containing 20 to 35 injected embryos and 3 to 6 untreated embryos, was passed into the infundibulum and down the oviduct to the isthmus and emptied. The oviduct was returned to the abdominal cavity and the incision closed.
f) Growth of pigs
New-born piglets were kept together until weaning. At that time males and females were separated and penned with non-transgenic same sex pigs of a similar age from other litters. The pigs are fed ad libitum starter rations until 25 kg wt, grower diet from 25 to 60 kg wt and finisher diet from 60 kg to market weight. Water is available ad libitum. Transgenic pigs 167-02, 282-02 and 282-04 were maintained on a low phytate ration until 85, 50, and 50 days of age, respectively, and then switched to the grower ration. All other transgenic pigs were given the standard high phosphorus diets.
The diets were provided as pelleted formulations during the weanling, grower and finishing phases are shown in Tables 4 and 5. The vitamin and mineral mixes included in the diets are shown in Tables 6 and 7.
PCR analysis
Tail segments from newborn piglets were collected and slices of each placed in 600 μl of 50 mM NaOH and heating at for 95° C. for 15 minutes. The suspension was neutralized with 50 μl of 1 M Tris (pH 8.0) and insoluble materials removed by centrifugation for 5 min in a microcentrifuge. A 2 μl sample of each was used for PCR with primers APPA-UP2 and APPA-KPN.
The primers produce a 750 bp fragment if the transgene is present. As a positive control PIG-BGF and PIG-BGR primers were used to detect the porcine β-globin gene from the same DNA preparation (Heneine and Switzer 1996). The PCR reaction was performed using the same conditions as described for detection of the phytase transgene. As a negative control genomic DNA from a non-transgenic pig was used in the PCR reaction, for a positive control this DNA was spiked with a known amount of transgene (1 gene copy/per genome).
When a positive signal was identified by PCR for pig 167-02 (FIG. 3) another DNA preparation was made and two more pairs of PCR primers were used to test for gene integrity (FIG. 4) APPA-MATURE with APPA-KPN, and APPA-MATURE with APPA-DOWN2.
PCR conditions were similar to those described previously.
Extraction of DNA from blood for PCR analysis
The method for extraction of DNA from blood was based on a method described by Higuchi (1989) with some modifications. A 100 μl volume of whole blood was mixed with 200 μl of lysis buffer (10 mM Tris-HCl, 0.32 M sucrose, 5 mM MgCl₂, 1% (vol/vol) Triton X-100, pH 7.5.), mixed briefly and incubated on ice for 5 min. The sample was then centrifuged at 14,000×G for 3 min, and the supemate discarded. The sediment was suspended in lysis buffer, mixed, incubated and centrifuged. This procedure was repeated 2 more times, or until no hemoglobin remained. The sediment was dissociated in 100 μl of 50 mM NaOH, mixed and heated at 100C for 10 min. The contents were cooled, 10 μl of 1 M Tris-HCl (pH 8.5) added and mixed briefly. The sample was then centrifuged at 14,000×g for 2 min and 2 μl of the supernate used for analysis by PCR.
The PCR reaction mixture with a total volume of 40 μl consisted of, 23.8 μl of distilled water, 4 μl of 10 X Gibco BRL PCR buffer, 1.2 μl of 50 mM MgCl₂, 0.8 μl of 10 mM dNTPs, 40 pmol of each of the forward and reverse primers in 8 μl, 2 μl of template DNA and 0.2 μl of Taq DNA polymerase (Gibco BRL, 5 U/μl). The amplification procedure was performed with an initial heating step at 95° C. for 3 min followed by 40 cycles of 95° C. for 30 sec, 54° C. for 30 sec and 72° C. for 60 sec.
The transgenic pigs were detected with primers for the APPA gene (APPA-KPN with APPA-UP2), and as a control PIG-BGF with PIG-BGR primers were used for detection of the porcine β-globin gene.
Saliva collection from pigs for phytase assays and weighing of pigs
Weanling pigs were sampled for salivary phytase by wiping under the tongue with a cotton tipped applicator, breaking the stick off and centrifuging the applicator tip in a 0.4 ml microcentrifuge tube, with a hole in the bottom, contained within a 1.5 ml microcentrifuge tube. Grower and finishing pigs were sampled using 1.5 inch long #2 dental cotton absorbent rolls (Ash Temple Sundries Ltd, Don Mills, ON) attached to dental floss. These were centrifuged in 1.5 ml microcentrifuge tubes with holes in the bottom while contained in larger tubes. The saliva was collected from the larger tube and stored at −20° C. until analyzed.
Saliva was collected and pigs were weighed at weekly intervals.
Analysis for phytase activity.
Saliva samples were either assayed directly or after dilution in 0.1 M acetate buffer pH 4.5. Phytase was assayed in 200 μl of 0.1 M sodium acetate buffer (pH 4.5) using sodium phytate (4 mM) as a substrate at 37° C. After 10 min of incubation the reaction was stopped by addition of 133 μl ammonium molybdate/ammonium vanadate/nitric acid mixture and the concentration of liberated inorganic phosphate determined at 405 nm QUOTE “(Engelen, van der Heeft, Randsdorp, and Smit 1994)” (Engelen, van der Heeft, Randsdorp, and Smit 1994). This and all other assays were performed in triplicate. One unit (U) of enzyme activity was the amount of the enzyme releasing 1 μmol of inorganic phosphate per minute.
Assays for salivary phytase and for phytase in blood samples were conducted as previously described for saliva samples. A reagent blank with blood added at the same concentration as the samples assayed was subtracted from the sample readings.
Collection of fecal materials and analysis for total phosphorus
Fresh feces were collected from each pig during the grower and finisher phases. Samples were placed in aluminum trays closed with a wax paper top and immediately frozen, and kept frozen until they were lyophilized for analysis. After lyophilization the samples were transferred to room conditions overnight to reach equilibrium in moisture content. The samples were separately ground with a mortar and pestle until homogenous and sealed in plastic containers until analyzed further. Dry matter content of samples was analyzed according to AOAC (Association of Official Analytical Chemists (AOAC) 1984) by heating 1 gram samples at 110° C. for 4 hours and cooling in a desiccator prior to weighing. To analyze total phosphorus content, samples were heated at 550° C. in a muffle furnace and 10 ml of 10 M HCl added and heated to boiling. The contents from each sample was quantitatively diluted to 250 ml with water and inorganic phosphorus content was measured by the method of Heinoen and Lahti ( 1981).
Purification of the E. coli produced phytase and pig salivary phytase
The APPA phytase was over expressed in E. coli strain BL21(DE3) and the EDTA lysozyme extract fraction purified on DEAE-Sepharose and Sephadex-G75 as described by Jia et al. ( 1998). The pig phytase was purified by chromatography on DEAE-Sepharose and the band of enzyme eluted with a sodium chloride gradient was further purified by Chromatofocusing using a pH gradient from pH 4.0 to 7.0.
SDS-PAGE analysis and Silver Staining
Sodium dodecylsulfate polyacrylamide gel electrophoresis was performed using a 10% gel as described by Laemmli (1970), except that protein in the sample buffer was heated at 70° C. for 10 minutes. Samples were stained with silver as described by Nesterenko et al. (1994).
Preparation of a monoclonal antibody specific for the APPA encoded E. coli phytase
Monoclonal antibodies specific to the E. coli APPA encoded phytase were prepared according to the procedures of Galfre and Milstein (198 1). Briefly, two female Balb/c mice were immunized 7 times over a period of 59 days with a purified APPA enzyme preparation. Mouse spleens were harvested, and the cells therein fused with an NS-1 myeloma cell line (Kohler and Milstein, 1976). Fused cells were selected for their ability to grow in media containing hypoxanthine, aminopterin, and thymidine (HAT). Western blotting and Enzyme-Linked Immunosorbent Assays (ELISA) were used identify those clones capable of secreting an antibody into the culture medium that recognized epitopes on both the E. coli and pig derived APPA enzyme. Clones secreting a desirable antibody were subcloned twice to ensure a pure culture of antibody secreting hybridomas.
Production of Polyclonal Antibodies Against the Purified E. coli derived APPA Phytase
Antibodies were prepared in two New Zealand White Rabbits by two intramuscular injections at different sites in the thigh of 50 μg of purified Escherichia coli derived APPA phytase in 0.5 ml of a 1:1 mixture of phosphate-buffered saline (PBS) and Freund's Complete Adjuvant. This was followed by repeat injections of 20 μg each of phytase in a 1:1 mixture of PBS and Freund's Incomplete Adjuvant on days 4, 19, 25, and 39. Blood was collected via heart puncture on day 42. The serum was separated from the cell fraction and used as the source of antibodies. The basic procedures for antibody production are described in Harlow and Lane (1988).
Western blotting
Western blotting was performed as described by Towbin et al. (Towbin et al. 1979).
Deglycosylation of pig phytase was done according to protocols, Roche Molecular Biochemicals, with following modifications. Protein in 50 mM Tris (pH 8.0), 1 mM EDTA, 1% SDS, 1% 2-mercaptoethanol was denaturated by heating at 95° C. for 3 min. Than protein was precipitated with chloroform-methanol method (Wessel and Flugge 1984) and resuspended at 100 μg/mL in 20 mM Sodium Phosphate (pH 7.2) with 1% Triton X-100. Complete deglycosylation of 5 μg in 50 μL phytase was carried out overnight at 37° C. using 1 unit (U) N-glycosidase F, 1.2 mU O-glycosidase and 1 mU neuraminidase (Boehringer Mannheim GmbH). After incubation 0.5 μg of protein was run on the SDS gel.
Staining of glycoproteins
This staining was done using DIG Glycan Detection Kit (Boehringer Mannheim) according to manufacture instructions (O'Shannessy et al. 1987).
Statistics on the generation of transgenic pigs
The statistics on embryos recovered, microinjected and transferred into donor sows is shown in Table 8. A total of 4147 embryos injected with the transgene and 675 untreated embryos were introduced into 140 recipient sows with an average of 30 injected embryos and 5 uninjected embryos. All offspring were tested for the presence of the transgene in tissue biopsy, in blood by PCR analysis, and by an assay for phytase activity in the saliva.
Table 9 lists the transgenic pigs that were produced, their birth dates, sex and salivary phytase levels. There were 31 pigs transgenic for the phytase gene out of 203 live piglets born from embryos microinjected. These were detected by the presence of the gene in blood samples using the standard primer set, APPA-UP2 and APPA -KPN, but only 14 were detected by analysis of tail DNA preparations using the standard primer set. When the negative samples were reanalyzed using the primer set LAMA-UP 1 and APPA-down4 (FIG. 8) a further 8 tail DNA samples were found to be positive. Purification of the tail biopsy DNA probably would have led to all being PCR positive for the phytase transgene.
Characteristics of the phytase transgene in transgenic pig 167-02
The application of PCR to detection of transgenic pigs is exemplified by analysis of litter 167 in which one of 7 piglets tested, including one that was stillborn and one that was crushed by the sow after birth, one live piglet designated 167-02 was identified as positive for the APPA gene by generation of a PCR product (Lane 2) of approximately 750 bps from the tail chromosomal DNA (FIG. 7). No rearrangements of the APPA gene were detected as documented by the positive PCR results using primers directed to the 3′ region (lane 2) the whole gene (lane 3) and the 5′ region (lane 4) of the APPA gene (FIG. 8).
Salivary phytase and weight gain during growth of transgenic and non-transgenic penmates.
Data on salivary phytase activity and weight gain are shown for five transgenic pigs and for weight gains of their non-transgenic penmates in FIGS. 9, 10, 11, 12 and 13. The phytase activity in the saliva varied substantially from one sampling time to the next. This variability was attributed to a combination of environmental factors including whether the animal had just consumed food or water, and regulation of parotid and saliva secretion in relation to food and water consumption. The weight gains during growth of the five transgenic pigs was within the range of the weight gains of the normal non-transgenic pigs.
With the exception of 167-02 the growth rate of the transgenic pigs was similar to that of the non-transgenic litter mates.
Phosphorus content in the fecal materials from transgenic and non-transgenic pigs.
The phosphorus content of fresh fecal samples from three of the transgenic founder pigs, 167-02, 282-02, 282-04, 405-02 and 421-06 receiving weaning, grower or finisher ration is shown in Table 9. The phosphorus content of the feces of the transgenic pigs ranged from 1.59 to 2.26% while that of the non-transgenic penmates ranged from 1.61 to 2.76%. The reduction in fecal phosphorus ranged from a maximum of 26% to a minimum of 8%. In most cases the differences were at the 99% level of significance. The ages of the pigs at the time of fecal sampling and the corresponding phytase activities are shown in FIGS. 9, 10, 11, 12 & 13. The rations fed contained a supplement of readily available phosphorus suitable for maximizing growth of non-transgenic pigs. Since the reduction in fecal phosphorus is measured in transgenic pigs receiving a diet high in mineral phosphorus it is very likely that the fecal phosphorus would be substantially lower if the diet lacked mineral phosphorus. Under these conditions the phosphorus released from phytate would provide a substantial proportion of the dietary phosphorus and little would reach the large intestine and be excreted in the feces.
Transmission of the phytase transgene (to be completed)
When semen from the transgenic boar 167-02 was used to inseminate four Yorkshire gilts all four sows had litters in which 4 out of 8, 2 out of 9, 7 out of 8 and 2 out of 5 of the piglets were transgenic for the phytase gene (Table 11). The PCR data for litter 154 that documents the presence of the transgene is shown in FIG. 14. All pigs containing the gene exhibited phytase activity in the saliva, and it ranged from 341 to 10,077 units per ml. Half of the transgenic piglets had salivary phytase activities of greater than 2000 units per ml. The specific activity of the phytase in the saliva ranged from 39 U/mg protein to a high of 706 units/mg protein.
This data documents that the gene was transferred and that the level of phytase expression observed in the founder was preserved in the first generation of pigs. Both male and female pigs at 11 days of age exhibited high phytase activity.
Characteristics of the phytase enzyme synthesized in the salivary glands of the pig
The phytase enzyme was purified to homogeneity from E. coli and from saliva collected from transgenic pig 167-02. Silver stains of the purified enzymes after SDS-PAGE are shown in FIG. 15. The E. coli derived enzyme has a molecular mass of approximately 45 kDa while that produced by the pig was about 55 kDa. The enzymes were also electrophoresed as before, transferred to nitrocellulose and stained for glycoproteins. The second part of FIG. 15 shows that the pig APPA protein is glycosylated. FIG. 15B shows that treatment of the pig phytase with deglycosylation enzymes changes the size of the phytase from 60 kDa to 45 kDa, an observation that confirms the glycosylated nature of the recombinant phytase produced in the saliva of the pig.
The data in FIG. 16 shows that the pig phytase is homologous with the E. Coli enzyme despite their difference in size.
The purified pig phytase had K_mand V_maxvalues of 0.33 mM and 624 units per mg of protein, respectively. Golovan et al. (2000) previously reported the K_mand V_maxfor the E. coli enzyme to be 0.63 mM and 2325 units per mg of protein. Thus the salivary phytase exhibits approximately 25% of the activity of the E. coli enzyme. This reduction in activity may be due to glycosylation that either modifies the catalytic site of the enzyme or otherwise leads to the formation of an enzyme with lower catalytic activity.
The latter finding of the production of a glycosylated protein suggests a method of producing such proteins using transgenic animals. Currently, although recombinant methods are available for producing proteins in host cells, it is often found that the mature peptide lacks the glycosylation normally associated with proteins produced by higher life forms. Insulin is an example of such protein. The findings of this study suggest that one means of producing the desired glycoproteins would be to generate transgenic animals such as the pig, that have been transformed, by known methods or the method described above, with a gene encoding the desired protein. When expressed by such animal, the subject protein would be produced and would undergo post-translational processing in the cell including the step of glycosylation. Thus, the invention contemplates a general method of producing such glycosylated proteins. Further, the invention contemplates a method of producing glycosylated proteins through the expression in and isolation from the saliva of an animal that has been transformed with a gene encoding such protein, and wherein such gene is operably linked to a saliva protein promoter or enhancer.
Various methods are known in the art for the collection of glycoproteins from the parotid gland of the pig for various applications. For example, surgical techniques have been published by Denny et al. (1972) for the collection of secretions from the parotid gland and submandibular salivary ducts.
Test kit for detection of the APPA phytase protein in pigs
The monoclonal antibodies produced against the APPA phytase expressed in E. coli reacted with the APPA phytases produced in the saliva of transgenic mice and pigs (FIG. 17). Immunological detection of phytase in saliva provides definitive proof that the phytase secreted in transgenic pig saliva is a product of the APPA gene expressed in the pig salivary gland. This serves as a reliable method to document phytase production in transgenic pigs.
A further test would also be obtainable using the polyclonal antibodies discussed above.
The DNA sequence encoding phytase may be obtained from a variety of sources such as microbial, plant or animal sources. Preferably, the DNA sequence is obtained from a microbial source such as bacteria. Most preferred DNA sequences are obtained from Escherichia coli.
The cloning of a gene or a cDNA encoding a phytase protein may be achieved using various methods. One method is by purification of the phytase protein, subsequent determination of the N-terminal and several internal amino acid sequences and screening of a genomic or cDNA library of the organism producing the phytase using oligonucleotide probes based on the amino acid sequences. If at least a partial sequence of the gene is known, this information may be used to clone the corresponding cDNA using, for instance, the polymerase chain reaction (PCR) (PCR Technology: Principles and Applications for DNA Amplification, (1989) H. A. Ehrlich, ed., Stockton Press, New York; the contents of which are incorporated herein by reference). It will be evident to those skilled in the art that the cloned phytase gene described above may be used in heterologous hybridization experiments, directed to the isolation of phytase encoding genes from other microorganisms.
The DNAs encoding phytase or individual fragments or modified proteins thereof can be fused, in proper reading frame, with appropriate regulatory signals as described in detail below, to produce a genetic construct that is then amplified, for example, by preparation in a bacterial (e.g., E. coli) plasmid vector according to conventional methods. Such methods are described in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press 1989), the contents of which are incorporated herein by reference. The amplified construct is thereafter excised from the vector and purified for use in producing transgenic animals.
The desired protein may also be produced as a fusion protein containing another protein. For example, the desired recombinant protein of this invention may be produced as part of a larger recombinant protein in order to stabilize the desired protein. Useful modifications within this context include, but are not limited to, those that alter post-translational modifications, size or active site, or that fuse the protein or portions thereof to another protein. Such modifications can be introduced into the protein by techniques well known in this art, such as by synthesizing modified genes by ligation of overlapping oligonucleotides or introducing mutations into the cloned genes by, for example, oligonucleotide-mediated mutagenesis.
The cloned phytase gene may be used as starting materials for the construction of improved phytases. Improved phytases are phytases, altered by mutagenesis techniques (e.g. site-directed mutagenesis, or directed evolution), which have properties that differ from those of wild-type phytases (Kuchner and Arnold 1997). For example, the temperature or pH optimum, specific activity, temperature or protease resistance may be altered so as to be better suited for a particular application.
A choice of expression in cellular compartments (such as cytosol, endoplasmic reticulum) or extracellular expression can be used in the present invention, depending on the biophysical and biochemical properties of the phytase. Such properties include, but are not limited to pH sensitivity, sensitivity to proteases, and sensitivity to the ionic strength of the preferred compartment. The DNA sequence encoding the enzyme of interest should be modified in such a way that the enzyme can exert its action at the desired location in the cell. To achieve extracellular expression of the phytase, the expression construct of the present invention utilizes a bacterial signal sequence. Although signal sequences that are homologous (native) to the animal host species are preferred, heterologous signal sequences, i.e. those originating from other animal species or of microbial origin, may be used as well. Such signal sequences are known to those skilled in the art.
All parts of the relevant DNA constructs (promoters, regulatory, secretory, stabilizing, targeting, or termination sequences) of the present invention may be modified, if desired, to affect their control characteristics using methods known to those skilled in the art. The cis-acting regulatory regions useful in the invention include the promoter that drives expression of the phytase gene. Highly preferred are promoters that are specifically active in salivary gland cells. Among such promoters, highly preferred are mouse parotid secretory protein (PSP) promoter, rat proline-rich protein (PRP) promoter, human salivary amylase promoter, mouse mammary tumor virus promoter (Samuelson 1996). Among the useful sequences that regulate transcription, in addition to the promoters discussed above, are enhancers, splice signals, transcription termination signals, and polyadenylation sites. Particularly useful in this regard are those that increase the efficiency of the transcription of the genes for phytase in the salivary gland or other cells of the transgenic animals listed above. Preferred are transcription regulatory sequences for proteins highly expressed in the salivary gland cells. Introns could be introduced to increase levels of expression. Such introns include the synthetic intron SIS, SV40 small t antigen intron and others (Whitelaw et al. 1991; Petitclerc et al. 1995).
Preferably, the expression system or construct of this invention also includes a 3′ untranslated region downstream of the DNA sequence encoding the desired recombinant protein, or the salivary protein gene used for regulation. This region apparently stabilizes the RNA transcript of the expression system and thus increases the yield of the desired protein. Among the 3′ untranslated regions useful in this regard are sequences that provide a polyA signal. Such sequences may be derived, e.g., from the SV 40 small t antigen late polyadenylation signal, synthetic polyadenylation signal or other 3′ untranslated sequences well known in this art (Carswell and Alwine 1989; Levitt et al. 1989).
Preferably, the 3′ untranslated region is derived from a salivary-specific protein. The stabilizing effect of this region's polyA transcript is important in stabilizing the mRNA of the expression sequence. Further, the addition of locus control regions (LCRs), matrix attachment regions (MAR) and scaffold attachment regions (SARs) would allow position-independent, copy number dependent expression of the transgene with either homologous or heterologous promoters (Taboit-Dameron et al. 1999; Geyer 1997). Co-integration of an actively expressed gene with the transgene was also shown to increase expression levels of a poorly expressed transgene (Clark et al. 1993). Also important in increasing the efficiency of expression of phytase is a strong translation initiation site (Kozak 1987). Likewise, sequences that regulate the post-translational modification of phytase may be useful in the invention.
The term “animal” as used herein denotes all animals except humans. It also includes an individual animal in all stages of development, including embryonic and fetal stages.
A “transgenic” animal is any animal containing cells that bear genetic information received, directly or indirectly, by deliberate genetic manipulation at the subcellular level, such as by microinjection or infection with a recombinant virus. “Transgenic” in the present context does not encompass classical crossbreeding or in vitro fertilization, but rather denotes animals in which one or more cells receive a recombinant DNA molecule. Although it is highly preferred that this molecule be integrated within the animal's chromosomes, the invention also encompasses the use of extrachromosomally replicating DNA sequences, such as might be engineered into yeast artificial chromosomes. The information to be introduced into the animal may be foreign to the species of the animal to which the recipient belongs (i.e., “heterologous”), or the information may be foreign only to the particular individual recipient, or genetic information already possessed by the recipient. In the last case, the introduced gene may be expressed in a manner different than the native gene.
As indicated above, the transgenic animals of this invention are other than human. Farm animals (pigs, goats, sheep, cows, horses, rabbits and the like), rodents (such as mice and rats), domestic pets (eg. cats and dogs), fish and poultry (eg. chickens) are included in the scope of this invention. It is highly preferred that a transgenic animal of the present invention be produced by introducing into single cell embryos appropriate polynucleotides that encode phytase, or fragments or modified products thereof, in a manner such that these polynucleotides are stably integrated into the DNA of germ line cells of the mature animal, and are inherited in normal mendelian fashion. Advances in technologies for embryo micromanipulation now permit introduction of heterologous DNA into fertilized mammalian ova. For instance, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal. In one preferred method, developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo. In a most preferred method, however, the appropriate DNAs are co-injected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals. Such techniques are well known (see reviews of standard laboratory procedures for microinjection of heterologous DNAs into mammalian fertilized ova, including Hogan et al., Manipulating The Mouse Embryo, (Cold Spring Harbor Press 1986); Krimpenfort et al., Bio/Technology 9:844 (1991); Palmiter et al., Cell, 41: 343 (1985); Kraemer et al., Genetic Manipulation Of The Early Mammalian Embryo, (Cold Spring Harbor Laboratory Press 1985); Hammer et al., Nature, 315: 680 (1985); Wagner et al., U.S. Pat. No. 5,175,385; Krimpenfort et al., U.S. Pat. No. 5,175,384, the respective contents of which are incorporated herein by reference).
For a person skilled in art, it will also be clear that the present invention provides for other proteins to be expressed in the salivary gland of the pig. Such proteins may be secreted into saliva to improve digestion and decrease pollution potential (for example, endoglucanases), or specifically targeted for secretion into blood and have effects on the growth and health of the animal (such as growth hormone).
Phytase activity may be measured via a number of assays, the choice of which is not critical to the present invention. For example, the phytase enzyme activity of the transgenic animal tissue may be tested with an ELISA-assay, Western blotting or direct enzyme assays using calorimetric techniques or gel assay system.
The examples included herein are provided so as to give those of ordinary skill in the art a complete disclosure and description of how to make and use the invention and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, pH, etc.) but some experimental errors and deviation should be accounted for. Unless indicated otherwise, temperature is in degrees Centigrade and pressure is at or near atmospheric.

Although the invention has been described with reference to certain specific embodiments, various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the invention as outlined in the claims appended hereto.

TABLE 1


Secretion of phytase in the saliva of transgenic mice containing the R15-
PRP/APPA transgene and non-transgenic mice induced with isoproterenol and pilocarpine.

						Phytase activity
Founder	Mice	PCR	Gender	Generation	Transgene	micromoles/min/ml

A0m	4bfr(+)	positive	F	1	APPA + intron	39.73
A0m	2brm(+)	positive	M	1	APPA + intron	24.29
A0m	2brm(+)	positive	M	2	APPA + intron	14.42
A0m	5brf(+)	positive	F	2	APPA + intron	7.36
A0m	1brm(−)	negative	M	1	APPA + intron	0.00
A1f	9brf(+)	positive	F	1	APPA + intron	0.08
A1f	11w f(+)	positive	F	1	APPA + intron	0.07
A1f	5brm(+)	positive	M	1	APPA + intron	0.03
A1f	10wf(−)	negative	F	1	APPA + intron	0.02
A20f	1brm(+)	positive	M	1	APPA + intron	0.53
A20f	5brf(+)	positive	F	1	APPA + intron	0.12
A20f	4brf(−)	negative	F	1	APPA + intron	0.03
A2m	13wf(+)	positive	F	1	APPA + intron	87.70
B0m	5brf(+)	positive	F	1	APPA + intron	0.95
B0m	3brm(+)	positive	M	1	APPA + intron	0.73
B0m	6wf(−)	negative	F	1	APPA + intron	0.00
B0f	3wf(+)	positive	F	2	APPA	252.43
B0m-intr	9wf(+)	positive	F	1	APPA	546.74
W0m	8wf(+)	positive	F	1	APPA	60.42
W30m	1wm(+)	positive	M	2	APPA	41.91
W30m	11w f(+)	positive	F	1	APPA	43.44
W30m	4wm(−)	negative	M	1	APPA	0.02
W30m	10wf(−)	negative	F	1	APPA	0.02

TABLE 2


Repeat sequences found in the Lama2-APPA construct.

					Substitu-
					tions %	Deletions	Insertions
		DNA			of	% of	% of
Start	End	strand	Repeat	Class/family	consensus	consensus	consensus

765	927	+	L1M1	LINE/L1	25	4.2	6.7
928	965	+	(CA)n	Simple repeat	0	0	0
966	1020	+	L1M1	LINE/L1	25	4.2	6.7
1021	1156	+	B1_MM	SINE/Alu	15.4	0	0
1159	1231	+	CAAAC)n	Simple repeat	1.4	0	0
1232	1385	+	L1M1	LINE/L1	25	4.2	6.7
1652	2308	C	L1	LINE/L1	28.5	11.9	1.7
2334	2406	C	MIR	SINE/MIR	27.4	4.1	0
2415	3266	+	RMER13A	LTR	17.7	4	6.1
6016	6127	C	L1MA9	LINE/L1	25.5	2	1
6831	7007	+	CT-rich	Low	30.5	1.7	3.4
				complexity
7299	7510	C	B3	SINE/B2	27.8	7.5	1.4
7718	7746	+	(TCTCTG)n	Simple repeat	6.9	0	0
8499	8581	C	MIR	SINE/MIR	24.1	12.1	3.6
9010	9603	+	Lx4	LINE/L1	21.7	6.4	0.2
10465	10519	+	(TG)n	Simple repeat	5.5	1.8	0
11235	11287	C	MER5A	DNA/MERI	28.3	0	1.9
				type
12372	12537	C	L1MA4A	LINE/L1	28.3	5.4	0
14240	14388	+	B1_MM	SINE/Alu	4	0	1.3
14869	14945	C	MIR	SINE/MIR	36.4	1.3	0
16391	16540	C	ORR1D	LTR/MaLR	29.3	0	6
16774	17214	+	RMER4	LTR	21.3	10	11.8
17229	17718	C	L1_MM	LINE/L1	15.3	0	0.8

TABLE 3


Salivary phytase activities of G2 mice from the founder female 3-1
generated using the construct Lama2-APPA. The mice were between 21
and 30 days of age.

male mouse #	Phytase (U/ml)	female mouse #	Phytase (U/ml)

5	28.3	1	9.0
6	2.5	2	29.9
8	6.6	4	8.0
9	44.7	5	43.0
10	12.7	6	26.9
12	28.3	8	1.9
15	28.1	9	66.3
18	71.2	10	19.9
19	19.5	11	61.3
20	15.7	12	36.4
21	20.9	13	18.0
22	4.1	17	38.9
24	13.0	18	18.5
26	53.4	19	27.0
28	20.4	23	6.5
29	34.1	24	16.1
30	11.1	25	9.4
32	3.1	26	14.8
33	51.7	27	1.3
34	19.0	28	8.2

TABLE 4


Composition and nutrient levels of Phase II starter diet and low phytate
starter diets fed to weanling pigs 5-10 kg.

Diet/Nutrient Levels¹

Ingredients	Phase II Starter Diet	Low Phytate Starter Diet

Corn	33.15	25.44
Barley	8.00	8.00
Wheat	20.00	40.00
Soybean meal	21.00	8.00
Fish meal	5.00	5.00
Meat and bone meal	—	1.00
Whey	8.00	8.00
Fat	2.00	2.00
Lysine-HCl	0.10	0.28
Dicalcium phosphate	1.10	—
CaCO₃	0.90	1.10
Iodized salt	0.30	0.30
Vitamin premix¹	0.250	0.55
Mineral premix¹	0.10	0.10
Lincommix 44	0.10	0.10
Total (kg)	100.00	100.00
Calculated nutritive
values
DE (kcal/g)	3.44	3.36
CP (%)	19.46	18.62
Ca (%)	1.00	0.94
Total P (%)	0.74	0.66
Ca/p	1.35:1	1.42:1
Total AA contents (%)
Arginine	1.16	1.17
Histidine	0.50	0.48
Isoleucine	0.81	0.77
Leucine	1.58	1.54
Lysine	1.17	1.06
Methionine	0.34	0.29
Cysteine	0.34	0.34
Methionine + Cysteine	0.68	0.63
Phenylalanine	0.90	0.90
Tyrosine	0.65	0.65
Threonine	0.75	0.68
Tryptophan	0.23	0.23
Valine	0.91	0.86

¹Minerals and vitamins meet or exceed levels recommended by NRC (1998).

TABLE 5


Composition and nutrient levels of grower and finisher diets.

Diet/Nutrient Levels

	Grower Diet For	Finishing Diet For pigs
Ingredients	pigs
20 to 50 kg	50 to 120 kg

Corn	51.78	40.00
Barley	8.10	23.03
Wheat	20.00	23.00
Soybean meal	16.00	13.00
Fat	1.00	1.00
Lysine-HCl	0.12	0.12
Dicalcium phosphate	1.20	1.00
CaCO₃	1.15	1.15
Iodized salt	0.50	0.50
Vitamin premix¹	0.15	0.15
Mineral premix¹	0.10	0.10
Total (kg)	100.00	100.05
Calculated nutritive values
DE (kcal/g)	3.39	3.33
CP (%)	14.76	14.17
Ca (%)	0.79	0.74
Total P (%)	0.57	0.53
Ca/P	1.39:1	1.39:1
Total AA contents (%)
Arginine	0.86	0.80
Histidine	0.38	0.36
Isoleucine	0.58	0.55
Leucine	1.28	1.18
Lysine	0.78	0.73
Methionine	0.24	0.23
Cysteine	0.29	0.29
Methionine + Cysteine	0.53	0.52
Phenylalanine	0.70	0.68
Tyrosine	0.50	0.46
Threonine	0.52	0.49
Tryptophan	0.17	0.16
Valine	0.68	0.65

¹Minerals and vitamins meet or exceed levels recommended by NRC (1998).

TABLE 6


Vitamin premix composition¹

	Nutrient	Amount per 5 kg of premix

	Wheat midds	3.867	kg
	Vitamin A	10 million	IU
	Vitamin D
	1 million	IU
	Vitamin E
	40 thousand	IU
	Menadione	2.5	g
	Pantothenic acid	15	g
	Riboflavin	5	g
	Folic acid	2	g
	Niacin	25	g
	Thiamin	1.5	g
	Pyridoxine	1.5	g
	Vitamin B
₁₂	25	mg
	Biotin	200	mg
	Choline	500	g

	¹From Hoffman-LaRoche Limited, P.O. Box 877, Cambridge, ON. N1R5X9

TABLE 7


Composition of the mineral premix^1,2

	Mineral component	Amount (%)

	Limestone	43.3
	Copper sulfate (25%)	6.0
	Ferrous sulfate (30%)	33.4
	Zinc oxide (72%)	13.9
	Manganous oxide (56%)	3.4

	¹Mineral premix prepared at Arkell
	²Dicalcium phosphate contained 18.5% calcium and 20.5% of phosphate and normally is added at a level of 1.2% to the pig grower diet, 1.0% to the finisher diet and 1.5% to the nursing sow diet.

TABLE 8


Statistics on embryo recovery and the introduction of embryos
containing the transgene into recipient sows.

	Treatment	Number

	Guts used for embryo recovery:
	Yorkshire	279
	Yorkshire x Landrace cross	168
	Duroc	12
	Total	459
	Recipient sows¹	74
	Embryos transferred to recipients:
	Embryos microinjected with the transgene	4147
	Uninjected carrier embryos	675
	Total	4543
	Total number of embryo transfers	140

	¹Sows were used for up to three farrowings of potentially transgenic pigs. Sows were inseminated with Yorkshire semen from a high breeding value boars.

TABLE 9


Transgenic pigs containing a salivary phytase gene generated by microinjectons of
single cell zygotes using the Lama2-APPA transgene

		Presence of
		Transgene²Tail/		Salivary
ID # of pig¹	Birth Date	Blood	Sex	phytase (U/ml)³	Zygote source⁴

167-02	Apr. 14, 1999	+/+	Boar	6,000	Yorkshire
282-02	Jun. 14, 1999	+/+	Boar	618	Yorkshire
282-04	Jun. 14, 1999	+/+	Boar	1,349	Yorkshire
405-02	Aug. 14, 1999	+/+	Gilt	339	York/Landrace
421-02	Aug. 24, 1999	−/+	Gilt	0.8	York/Landrace
421-04	Aug. 24, 1999	−/+	Gilt	2.2	York/Landrace
421-06	Aug. 24, 1999	+/+	Boar	97	York/Landrace
448-01	Sep. 03, 1999	+/+	Gilt	0	York/Landrace
491-01	Sep. 25, 1999	+/+	Gilt	2.3	York/Landrace
491-02	Sep. 25, 1999	+/+	Gilt	0	York/Landrace
491-03	Sep. 25, 1999	+/+	Gilt	0.3	York/Landrace
491-05	Sep. 25, 1999	+/+	Boar	0	York/Landrace
496-05	Sep. 26, 1999	+/+	Boar	0	York/Landrace
500-03	Sep. 28, 1999	+/+	Boar	136	York/Landrace
510-01	Sep. 28, 1999	+/+	Boar	0.2	York/
559-05	Nov. 01, 1999	+*/+	Boar	>418	York/Landrace
560-04	Nov. 02, 1999	+*/+	Boar	5	Yorkshire
594-03	Nov. 18, 1999	+/+	Gilt	2.3	Yorkshire
613-02	Nov. 27, 1999	−/+	Gilt	0.5	York/Landrace
613-03	Nov. 27, 1999	−/+	Gilt	0.3	York/Landrace
647-01	Dec. 13, 1999	−/+	Gilt	0.5	York/Landrace
647-03	Dec. 13, 1999	+*/+	Gilt	16.3	York/Landrace
647-04	Dec. 13, 1999	−*/+	Gilt	0.5	York/Landrace
647-08	Dec. 13, 1999	−*/+	Boar	0.4	York/Landrace
647-09	Dec. 13, 1999	+*/+	Boar	1.92	York/Landrace
668-01	Dec. 17, 1999	+*/+	Gilt	489	Yorkshire
671-02	Dec. 19, 1999	+*/+	Boar	6.9	York/Landrace
671-04	Dec. 19, 1999	+*/+	Boar	325	York/Landrace
675-03	Dec. 21, 1999	−*/+	Gilt	2.1	York/Landrace
675-04	Dec. 21, 1999	+*/+	Boar	42.6	York/Landrace
675-06	Dec. 21, 1999	−*/+	Boar	5.0	York/Landrace

¹The number preceeding the dash represents the litter number and the number following the dash is the pig number within the litter.
²All PCR assays were conducted with the primer APPA-up2-APPA-Kpn. Assays indicated with a star gave a negative result with the primer pair. However these samples gave a positive result for the primer set APPA-d4-Lama-up1. Samples 613-02 and 613-03 were negative with the latter primer set.
³Saliva was sampled and assayed for phytase 2 to 4 days after birth of the piglets.
⁴Zygotes used for microinjection were collected from superovulated Yorkshire or Yorkshire-Landrace cross gilts.

TABLE 10


Phosphorus content of feces collected from pigs producing a salivary phytase and
non-transgenic pen-mates¹. The data was subjected to a T-test analysis and the data
recorded below.

Mean Fecal		Relative reduction
Phosphorus		in fecal
(%)	SE	phosphorus (%)	t	t (1%)

1. 167-02 Grower Diet (122 days):	1.59		24.47
Non-transgenic (n = 4)	2.11	0.0604669		8.517	4.6
2. 167-02 Finisher Diet (154 days):	1.97		16.97
Non-transgenic (n = 4)	2.37	0.0240767		16.717	4.6
3. 282-02 Grower Diet (93 days):	1.85		12.90
Non-transgenic (n = 5)	2.124	0.022231964		12.324	4.03
4. 282-02 Finisher Diet (145 days):	1.76		16.03
Non-transgenic (n = 5)	2.096	0.099153384		3.389	4.03²
5. 282-04 Grower Diet (93 days):	1.95		8.19
Non-transgenic (n = 5)	2.124	0.022231964		7.827	4.03
6. 282-04 Finisher Diet (145 days):	1.56		25.57
Non-transgenlc (n = 5)	2.096	0.099153384		5.406	4.03
7. 421-06 Starter II Diet (40 days):	1.17		27.47
Non-transgenic (n = 5)	1.612	0.086155741		5.140	4.03
8. 421-06 Start III Diet (48 days):	1.57		18.01
Non-transgenic (n = 5)	1.915	0.102884789		3.351	4.03
9. 421-06 Grower Diet (81 days):	2.00		13.28
Non-transgenic (n = 5)	2.310	0.151658823		2.022	4.03
10. 421-06 Finisher Diet (136	1.71		21.20
days):
Non-transgenic (n = 5)	2.173	0.053023237		8.687	4.03
11. 405-02 Starter II Diet (40	1.81		26.97
days):
Non-transgenic (n = 5)	2.482	0.173625623		3.856	4.03
12. 405-02 Starter III Diet (48	1.54		36.58
days):
Non transgenic (n = 4)	2.430	0.104642248		8.496	4.6
13. 405-02 Grower Diet (80 days):	2.26		18.19
Non-transgenic (n = 4)	2.763	0.124724697		4.029	4.6
14. 405-02 Finisher Diet (136	2.26		13.24
days):
Non-transgenic (n = 4)	2.605	0.217198066		1.588	4.6

¹Fresh fecal samples were collected on 3 different days was freeze-dried and then dried to constant weight at 110° C. for 24 h, and analyzed for total phosphorus.
²At the 5% level of confidence t = 2.57.

TABLE 11


Phytase activities of the first generation (G1) transgenic
offspring obtained by the crossing the phytase positive boar
167-02 with non-transgenic Yorkshire gilts¹

ID			Salivary phytase	Specific Activity
# of pig	Birth Date	Sex	(U/ml)	U/mg protein

151-01	Mar. 16, 2000	F	1193	126
151-02	″	F	736	63.3
151-05	″	M	710	109
151-07	″	M	8019	315
152-04	″	M	10077	364
152-09	″	M	3054	200
154-01	Mar. 19, 2000	F	2472	256
154-03	″	F	6425	706
154-04	″	F	n.d.	n.d.
154-05	″	M	2767	213
154-06	″	M	341	39
154-07	″	M	4029	142
154-08	″	M	1184	47.4
159-03	Mar. 20, 2000	F	1563	116
159-04	″	M	2285	201

¹The number of males and females (M/F) in each litter were 5/3, 7/2, 5/4, and 2/3 for litter numbers 151, 152, 154 and 159, respectively. Saliva was collected from the piglets on day 11.

TABLE 12


Primers used for construction and
detection of transgenic constructs.

		Forward/
Name	Start-End¹	Reverse	Sequence²

Primers used in R15/APPA +intron and R15/APPA
construction

APPA-	R	TCGGCGCTCACCTTGAGTTC
DOWN2		(SEQ ID NO: 16)

APPA-	F	CCGTTTAAAGCCATCTTAATCCCA
DRA		T
		(SEQ ID NO: 17)

APPA-	R	GTCCCGGGTATGCGTGCTTCATTC
SMA		(SEQ ID NO: 18)

CAT-	R	CCATGGTGGCGGCTTTTAGCTTCC
ATG		TTAGCTCCTGA
		(SEQ ID NO: 19)

CAT-	F	AGCGCTTGCAGTTTGTAAGGCAGT
TAA		TATTGGTGCCC
		(SEQ ID NO: 20)

CAT-	F	TCG AGG AGC TTG GCG AGA
UP1		TT
		(SEQ ID NO: 21)

R15-	F	TTTCGGGCCAATGTTGCTGT
UP1		(SEQ ID NO: 22)

Primers used in SV40/APPA +intron construction

SV-	F	CCCAAGCTTTACACTTTATGC
HIND		(SEQ ID NO: 23)

SV-	R	GCCCTCGAGCCTCCTCACTACTTC
XHO		T
		(SEQ ID NO: 24)

Primers used in Lama2/APPA and Lama2/PSP/APPA
construction

APPA-	12635-12657	F	GGATCGATAAAAGCCGCCACCATG
CLA			AA
			(SEQ ID NO: 25)

APPA-	13307-13326	R	TCGGCGCTCACCTTGAGTTC
DOWN2			(SEQ ID NO: 26)

APPA-	12751-12780	R	GCACGCACACCATGACGACTGACA
DOWN4			ATCACC
			(SEQ ID NO: 27)

APPA-	13935-13959	R	CGGGTACCTTACAAACTGCAAGCG
KPN			G
			(SEQ ID NO: 28)

APPA-	12719-12738	F	CAGAGTGAGCCGGAGCTGAA
MATURE			(SEQ ID NO: 29)

APPA-	13210-13229	F	CGAACTGGAACGGGTGCTTA
UP2			(SEQ ID NO: 30)

LAMA-	12615-12639	R	GCATCGATCTTTGGTTCTGACAAA
CLA			TGG
			(SEQ ID NO: 31)

LAMA-		R	TGACTCTGAGTTCCCAATGA
SIGNAL			(SEQ ID NO: 32)

LAMA-	12111-12130	F	GTGCTGCTCCAAGTTTGGTG
UP			(SEQ ID NO: 33)

Primers for detection of the porcine β-globin gene

PIG-	F	GCAGATTCCCAAACCTTCGCAGAG
BGF		(SEQ ID NO: 34)

PIG-	R	TCTGCCCAAGTCCTAAATGTGCGT
BGR		(SEQ ID NO: 35)

¹The location of the primers shown for Lama2/APPA sequence.
The start and stop codons of APPA are indicated in bold letters, the optimal initiation sequence for translation is italicized, and the restriction sites for restriction enzymes are underlined.

REFERENCE LIST

The following references have been referred to in the present application. The content of these references are incorporated herein by reference.

Abelson, P. H. 1999. A potential phosphate crisis [editorial]. Science 283: 2015.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403-410.
Ann, D. K. and Carlson, D. M. 1985. The structure and organization of a proline-rich protein gene of a mouse multigene family. J. Biol. Chem. 260: 15863-15872.
Arkhipovets, A. I. 1956. Age characteristics of salivary secretion in young pigs. Journal of Physiology of USSR 42: 882-886.
Association of Official Analytical Chemists (AOAC) 1984. Official methods of analysis of the Association of Official Analytical Chemists. Association of Official Analytical Chemists, Washington.
Ausbel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. 1992. Short protocols in molecular biology. John Wiley & Sons, New York.
Barsh, G. S. and Epstein, C. J. 1989. Physical and genetic characterization of a 75-kilobase deletion associated with al, a recessive lethal allele at the mouse agouti locus. Genetics 121: 811-818.
Bennick, A. 1982. Salivary proline-rich proteins. Mol. Cell Biochem. 45: 83-99.
Bitar, K. and Reinhold, J. G. 1972. Phytase and alkaline phosphatase activities in intestinal mucosae of rat, chicken, calf, and man. Biochim. Biophys. Acta 268: 442-452.
Burge, C. and Karlin, S. 1997. Prediction of complete gene structures in human genomic DNA. J. Mol. Biol 268: 78-94.
Burge, C. B. and Karlin, S. 1998. Finding the genes in genomic DNA. Curr. Opin. Struct. Biol. 8: 346-354.
Carlson, D. M. 1993. Salivary proline-rich proteins: biochemistry, molecular biology, and regulation of expression. Crit Rev. Oral Biol. Med. 4: 495-502.
Carswell, S. and Alwine, J. C. 1989. Efficiency of utilization of the simian virus 40 late polyadenylation site: effects of upstream sequences. Mol. Cell Biol. 9: 4248-4258.
Chi, T. H. and Crabtree, G. R. 2000. Perspectives: signal transduction. Inositol phosphates in the nucleus [comment]. Science 287: 1937-1939.
Clark, A. J., Archibald, A. L., McClenaghan, M., Simons, J. P., Wallace, R., and Whitelaw, C. B. 1993. Enhancing the efficiency of transgene expression. Philos. Trans. R. Soc. Lond B Biol. Sci. 339: 225-232.
Clements, S., Mehansho, H., and Carlson, D. M. 1985. Novel multigene families encoding highly repetitive peptide sequences. Sequence analyses of rat and mouse proline-rich protein cDNAs. J Biol. Chem. 260: 13471-13477.
Corring, T. 1980. Endogenous secretions in the pig. In Current concepts of digestion and absorption in pigs. Edited by A. G. Low and I. G. Partridge. National Institute for Research in Dairying, Reading pp. 136-150.
Cosgrove, D. J. 1980. Inositol phosphates. Their chemistry, biochemistry and physiology. Elsevier, Amsterdam.
Crameri, A., Dawes, G., Rodriguez, E. Jr., Silver, S. and Stemmer, W. P. C. 1997. Molecular evolution of an arsenate detoxification pathway by DNA shuffling. Nature Biotechnol. 15: 436-438.
Dassa, J., Marck, C., and Boquet, P. L. 1990. The complete nucleotide sequence of the Escherichia coli gene APPA reveals significant homology between pH 2. 5 acid phosphatase and glucose-1-phosphatase. J. Bacteriol. 172: 5497-5500.
Denny, H. R. and Messervy, A. 1972. Surgical techniques for the extirpation of the submandibular salivary glands and the collection of salivary secretions in the pig. Vet. Rec. 90: 650-654.
Dobrinsky, J. R., Johnson, L. A., and Rath, D. 1996. Development of a culture medium (BECM-3) for porcine embryos: Effect of bovine serum albumin and fetal bovine serum on embryo development. Biol. Reprod. 55: 1069-1074.
Dvorakova, J. 1998. Phytase: sources, preparation and exploitation. Folia Microbiol. (Praha) 43: 323-338.
Engelen, A. J., van der Heeft, F. C., Randsdorp, P. H., and Smit, E. L. 1994. Simple and rapid determination of phytase activity. J AOAC Int. 77: 760-764.
Frandson, R. D. and Spurgeon, T. L. 1992. Anatomy and physiology of farm animals. Lea & Febiger, Philadelphia.
Galfre, G. and Milstein, C. 1981. Preparation of monoclonal antibodies: strategies and procedures. Methods Enzymol. 73: 3-46.
Geyer, P. K. 1997. The role of insulator elements in defining domains of gene expression. Curr. Opin. Genet. Dev. 7: 242-248.
Gish, W. and States, D. J. 1993. Identification of protein coding regions by database similarity search. Nature Genetics 3: 266-272.
Golovan, S., Wang, G., Zhang, J., and Forsberg, C. W. 2000. Characterization and overproduction of the Escherichia coli APPA encoded bifunctional enzyme that exhibits both phytase and acid phosphatase activities [In Process Citation]. Can. J. Microbiol. 46: 59-71.
Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., and Ruddle, F. H. 1980. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc. Natl. Acad. Sci. USA 77: 7380-7384.
Gorman, C., Padmanabhan, R., and Howard, B. H. 1983. High efficiency DNA-mediated transformation of primate cells. Science 221: 551-553.
Greiner, R. and Jany, K.-D. Characterization of a phytase from Escherichia coli. Herbsttagung der Gesellschaft fur Biologische Chemie 372. 1991. Ref Type: Abstract
Greiner, R., Konietzny, U., and Jany, K.-D. 1993. Purification and characterization of two phytases from Escherichia coli. Arch Biochem. Biophys. 303: 107-113.
Hall, J., Hazlewood, G. P., Surani, M. A., Hirst, B. H., and Gilbert, H. J. 1990. Eukaryotic and prokaryotic signal peptides direct secretion of a bacterial endoglucanase by mamalian cells. J. Biol. Chem. 275: 19996-19999.
Harland, B. F. and Morris, E. R. 1995. Phytate: A good or a bad food component? Nutr. Res. 15: 733-754.
Harlow, E., and Lane, D. 1988. Antibodies: a laboratory manual. Cold Spring Harbor Laboratory, New York.
Harayama, S. 1998. Artificial evolution by DNA shuffling. Trends Biotechnol. 16: 76-81.
Heinoen, J. K. and Lahti, R. J. 1981. A new and convenient colorimetric determination of inorganic orthophosphate and its application to the assay of inorganic pyrophosphate. Anal. Biochem. 133: 313-317.
Heneine, W. and Switzer, W. M. 1996. Highly sensitive and specific polymerase chain reaction assays for detection of baboon and pig cells following xenotransplantation in humans. Transplantation 62: 1360-1362.
Higuchi, R. 1989. Simple and rapid preparation of samples for PCR. In PCR technology: principles and applications for DNA amplification. Edited by H. A. Erlich. Macmillan Publishers; Stockton Press, New York, N.Y. pp. 31-38.
Hu, Y., Nakagawa, Y., Purushotham, K. R., and Humphreys-Beher, M. G. 1992. Functional changes in salivary glands of autoimmune disease-prone NOD mice. Am. J. Physiol. 263: E607-E614.
Huang, X. 1996. An improved sequence assembly program. Genomics 33: 21-31.
Huang, X. 1999. A contig assembly program based on sensitive detection of fragment overlaps. Genomics 14: 18-25.
Huff, W. E., Moore, P. A., Jr., Waldroup, P. W., Waldroup, A. L., Balog, J. M., Huff, G. R., Rath, N. C., Daniel, T. C., and Raboy, V. 1998. Effect of dietary phytase and high available phosphorus corn on broiler chicken performance. Poult Sci 77: 1899-1904.
Iqbal, T. H., Lewis, K. O., and Cooper, B. T. 1994. Phytase activity in the human and rat small intestine. Gut 35: 1233-1236.
Jia, Z., Golovan, S., Ye, Q., and Forsberg, C. W. 1998. Purification, crystallization and preliminary X-ray analysis of the Escherichia coli phytase. Acta Crystallogr. D. Biol. Crystallogr. 54 (Pt 4): 647-649.
Kazazian, H. H. J. 1998. Mobile elemants and disease. Curr. Opin. Genet. Dev. 8: 343-350.
Kim, H. S. and Maeda, N. 1986. Structures of two HaeIII-type genes in the human salivary proline-rich protein multigene family. J Biol. Chem. 261: 6712-6718.
Kohler, G. and Milstein, C. 1976. Derivation of specific antibody-producing tissue culture and tumor lines by cell fusion. Eur. J. Immunol. 7: 511-519.
Kozak, M. 1987. At least six nucleotides preceding the AUG initiator codon enhance traslation in mammalian cells. Proc. Natl. Acad. Sci. USA 196: 947-950.
Kuchner, O. and Arnold, F. H. 1997. Directed evolution of enzyme catalysts. Trends Biotechnol. 15: 523-530.
Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-785.
Larsen, H. J., Brodersen, C. H., and Hjorth, J. P. 1994. High-level salivary gland expression in transgenic mice. Transgenic Res. 3: 311-316.
Laursen, J. and Hjorth, J. P. 1997. A cassette for high-level expression in the mouse salivary glands. Gene 198: 367-372.
Levitt, N., Briggs, D., Gil, A., and Proudfoot, N. J. 1989. Definition of an efficient synthetic poly(A) site. Genes Dev. 3: 1019-1025.
Low, A. G. 1989. Research into the digestive physiology of pigs. In Nutrition and digestive physiology in monogastric farm animals. Edited by E. J. van Weerden and J. Huisman. Pudoc, Wageningen pp. 1-15.
Madsen, H. O. and Hjorth, J. P. 1985. Molecular cloning of mouse PSP mRNA. Nucleic Acids Res. 13: 1-13.
Mallin, M. A. 2000. Impacts of industrial animal production on rivers and estuaries. American Scientist 88: 26-37.
Mehansho, H., Ann, D. K., Butler, L. G., Rogler, J., and Carlson, D. M. 1987. Induction of proline-rich proteins in hamster salivary glands by isoproterenol treatment and an unusual growth inhibition by tannins. J. Biol. Chem. 262: 12344-12350.
Menniti, F. S., Oliver, K. G., Putney, J. W., Jr., and Shears, S. B. 1993. Inositol phosphates and cell signaling: new views of InsP5 and InsP6. Trends Biochem. Sci 18: 53-56.
Mikkelsen, T. R., Brandt, J., Larsen, H. J., Larsen, B. B., Poulsen, K., Ingerslev, J., Din, N., and Hjorth, J. P. 1992. Tissue-specific expression in the salivary glands of transgenic mice. Nucleic Acids Res. 20: 2249-2255.
Miner, J. R. 1999. Alternatives to minimize the environmental impact of large swine production units. J. Anim Sci. 77: 440-444.
Nakai, K. and Kanehisa, M. 1992. A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics 14: 897-911.
Nesterenko, M. V., Tilley, M., and Upton, S. J. 1994. A simple modification of Blum's silver stain method allows for 30 minute detection of proteins in polyacrylamide gels. J Biochem. Biophys. Methods 28: 239-242.
O'Shannessy, D. J., Voorstad, P. J., and Quarles, R. H. 1987. Quantitation of glycoproteins on electroblots using the biotin-streptavidin complex. Anal. Biochem. 163: 204-209.
Owerbach, D. and Hjorth, J. P. 1980. Inheritance of a parotid secretory protein in mice and its use in determining salivary amylase quantitative variants. Genetics 95: 129-141.
Pen, J., Verwoerd, T. C., Vanparidon, P. A., Beudeker, R. F., Vandenelzen, P. J. M., Geerse, K., Vanderklis, J. D., Versteegh, H. A. J., Vanooyen, A. J. J., and Hoekema, A. 1993. Phytase-containing transgenic seeds as a novel feed additive for improved phosphorus utilization. Biotechnology 11: 811-814.
Petitclerc, D., Attal, J., Theron, M. C., Bearzotti, M., Bolifraud, P., Kann, G., Stinnakre, M. G., Pointu, H., Puissant, C., and Houdebine, L. M. 1995. The effect of various introns and transcription terminators on the efficiency of expression vectors in various cultured cell lines and in the mammary gland of transgenic mice. J Biotechnol. 40: 169-178.
Pinkert, C. A., Dyer, T. J., Kooyman, D. L., and Kiehm, D. J. 1990. Characterization of transgenic livestock production. Domest. Anim Endocrinol. 7: 1-18.
Quissell, D. O., Barzen, K. A., Redman, R. S., Camden, J. M., and Turner, J. T. 1998. Development and characterization of SV40 immortalized rat parotid acinar cell lines. In Vitro Cell Dev. Biol.—Animal. 34: 58-67.
Reddy, N. R., Sathe, S. K., and Salunkhe, D. K. 1982. Phytates in legumes and cereals. Adv. Food Res. 28: 1-92.
Rozhkov, Y. I. and Galimov, I. R. 1990. Salivary gland polymorphism in pigs and cattle detected by affinity electrophoresis. Anim. Genet 21: 277-283.
Samuelson, L. C. 1996. Transgenic approaches to salivary gland research. Annu. Rev. Physiol. 58: 209-229.
Shaw, P. and Schibler, U. 1986. Structure and expression of the parotid secretory protein gene of mouse. J Mol. Biol. 192: 567-576.
Simons, P. C., Versteegh, H. A., Jongbloed, A. W., Kemme, P. A., Slump, P., Bos, K. D., Wolters, M. G., Beudeker, R. F., and Verschoor, G. J. 1990. Improvement of phosphorus availability by microbial phytase in broilers and pigs. Br J Nutr. 64: 525-540.
Smit, A. F. A. 1996. The origin of interspersed repeats in the human genome. Curr. Opin. Genet. Dev. 6: 743-748.
Stahl, C. H., Han, Y. M., Roneker, K. R., House, W. A., and Lei, X. G. 1999. Phytase improves iron bioavailability for hemoglobin synthesis in young pigs. J Anim Sci 77: 2135-2142.
Svendsen, P., Laursen, J., Krogh-Pedersen, H., and Hjorth, J. P. 1998a. Novel salivary gland specific binding elements located in the PSP proximal enhancer core. Nucleic Acids Res. 26: 2761-2770.
Taboit-Dameron, F., Malassagne, B., Viglietta, C., Puissant, C., Leroux-Coyau, M., Chereau, C., Attal, J., Weill, B., and Houdebine, L. M. 1999. Association of the 5′HS4 sequence of the chicken beta-globin locus control region with human EF1 alpha gene promoter induces ubiquitous and high expression of human CD55 and CD59 cDNAs in transgenic rabbits. Transgenic Res. 8: 223-235.
Terada, T. and Nakanuma, Y. 1993. An immunohistochemical survey of amylase isoenzymes in cholangiocarcinoma and hepatocellular carcinoma. Arch Pathol. Lab Med. 117: 160-162.
Towbin, H., Staehelin, T., and Gordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76(9), 4350-4354. 1979. Ref Type: Generic
Tryon, A. F. and Bibby, B. G. 1966. Preliminary studies on pig saliva. Arch. Oral Biol. 11: 527-531.
Tu, Z. J., Lazowski, K. W., Ehlenfeldt, R. G., Wu, G., Lin, H. H., Kousvelari, E., and Ann, D. K. 1993. Isoproterenol/tannin-dependent R15 expression in transgenic mice is mediated by an upstream parotid control region. Gene Expr. 3: 289-305.
Verwoerd, T. C., van Paridon, P. A., van Ooyen, A. J., van Lent, J. W., Hoekema, A., and Pen, J. 1995. Stable accumulation of Aspergillus niger phytase in transgenic tobacco leaves. Plant Physiol 109: 1199-1205.
Wall, R. J., Hyman, P., Kerr, D., Pintado, B., and Wells, K. 1997. Transgenic animal technology. J. Androl 18: 236-239.
Wall, R. J., Pursel, V. G., Hammer, R. E., and Prinster, R. L. (Editors). 1985. Development of porcine ova that were centrifuged to permit visualization of pronuclei and nuclei. Biol. Reprod. 32.
Wessel, D. and Flugge, U. I. 1984. A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal. Biochem. 138: 141-143.
Whitelaw, C. B., Archibald, A. L., Harris, S., McClenaghan, M., Simons, J. P., and Clark, A. J. 1991. Targeting expression to the mammary gland: intronic sequences can enhance the efficiency of gene expression in transgenic mice. Transgenic Res. 1: 3-13.
Williamson, C. M., A. J. Bramley, and A. J. Lax 1994. Expression of the lysostaphin gene of Staphylococcus simulans in a eukaryotic system. Appl. Environ. Microbiol. 60: 771-776.
Wodzinski, R. J. and Ullah, A. H. 1996. Phytase. Adv. Appl. Microbiol. 42: 263-302.
Xiong, Y. and Eickbush, T. H. 1990. Origin and evolution of retroelements based upon their reverse transcriptase sequences. EMBO J. 9: 3353-3362.

Claims

1-35. (canceled)

36. A method for expressing a phytase in a non-human animal, said method comprising:

a) constructing a nucleic acid sequence including a transgene construct comprising:

i) a transgene encoding said phytase, and

ii) at least one regulatory sequence for gastrointestinal tract specific expression of said protein, and

b) transfecting the animal with said nucleic acid sequence;

whereby said animal carries within the genome of its somatic and germ cells said transgene construct and wherein said animal expresses said phytase in its gastrointestinal tract and wherein the animal is selected from the group consisting of pigs, goats, sheep, cows, horses, fish and poultry.

37. The method of claim 36 wherein said transgene construct results in salivary gland or pancreatic gland specific expression of said phytase.

38. The method of claim 37 wherein said regulatory sequence provides for salivary gland specific expression of said phytase.

39. The method of claim 38 wherein said salivary gland is a parotid gland, submaxillary, or a submandibular gland.

40. The method of claim 38 wherein said phytase is expressed in the saliva of said mammal.

41. The method of claim 38 wherein said transgene construct comprises a nucleic acid sequence according to SEQ ID NO:3, SEQ ID NO:5; or SEQ ID NO:7.

42. The method of claim 38 wherein said transgene construct comprises a nucleic acid sequence according to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6.

43. The method of claim 38 wherein said animal is a pig.

44. A nucleic acid molecule comprising (a) a nucleic acid sequence encoding a phytase operably linked to (b) at least one regulatory sequence for gastrointestinal tract specific expression of said phytase.

45. The molecule of claim 44 wherein said at least one regulatory sequence comprises a salivary protein promoter/enhancer sequence, whereby expression of said protein is salivary gland specific.

46. The molecule of claim 45 wherein said salivary protein promoter/enhancer sequence comprises a parotid secretory protein (PSP) promoter/enhancer, a proline-rich protein (PRP) promoter/enhancer, a salivary amylase promoter/enhancer, or a SV40 promoter/enhancer.

47. The molecule of claim 44 wherein said molecule comprises a nucleic acid sequence according to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6.

48. The molecule of claim 44 wherein said molecule includes a nucleic acid sequence according to SEQ ID NO:3, SEQ ID NO:5; or SEQ ID NO:7.

49. An antibody specific to a protein expressed by a nucleic acid sequence according to SEQ ID NO:3, SEQ ID NO:5; or SEQ ID NO:7.

50. The antibody of claim 49 wherein said antibody is monoclonal.

51. The antibody of claim 49 wherein said antibody is polyclonal.

52. A hybridoma secreting the antibody of claim 50.

53. A host cell transfected with molecule according to any one of claim 44.

54. The host cell of claim 53 wherein said cell is an animal cell.

55. A diagnostic kit for immunologically detecting a protein expressed by a nucleic acid sequence according to SEQ ID NO:3, SEQ ID NO:5; or SEQ ID NO:7, the kit including an antibody specific to said protein.

56. The kit of claim 55 wherein said antibody is monoclonal.

57. The kit of claim 56 wherein said antibody is polyclonal.

58. A kit for detecting phytase in a sample from a non-human animal prepared according to claim 36, said kit comprising an antibody that binds to phytase.

59. The kit according to claim 58 wherein the antibody binds to a protein expressed by a nucleic acid sequence according to SEQ ID NO: 3, SEQ ID NO: 5; or SEQ ID NO: 7.