US20060281133A1 - Targeted fusion proteins and methods for the characterization of cellular membrane domains - Google Patents

Targeted fusion proteins and methods for the characterization of cellular membrane domains Download PDF

Info

Publication number
US20060281133A1
US20060281133A1 US11/414,158 US41415806A US2006281133A1 US 20060281133 A1 US20060281133 A1 US 20060281133A1 US 41415806 A US41415806 A US 41415806A US 2006281133 A1 US2006281133 A1 US 2006281133A1
Authority
US
United States
Prior art keywords
gem
membrane
protein
fluorescent protein
domains
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/414,158
Inventor
William Rodgers
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US11/414,158 priority Critical patent/US20060281133A1/en
Publication of US20060281133A1 publication Critical patent/US20060281133A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5041Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving analysis of members of signalling pathways
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/92Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving lipids, e.g. cholesterol, lipoproteins, or their receptors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/033Fusion polypeptide containing a localisation/targetting motif containing a motif for targeting to the internal surface of the plasma membrane, e.g. containing a myristoylation motif
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/60Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]

Definitions

  • This invention relates to the fields of cellular biology and membrane and protein biochemistry.
  • the present invention provides fusion proteins encoding fluorescent proteins.
  • the fusion proteins target glycolipid-enriched membrane (GEM) and non-glycolipid-enriched membrane (non-GEM) domains of cell membranes by virtue of membrane-anchoring signal from p56 lck or pp60 c-scr , respectively.
  • the plasma membrane of mammalian cells contains domains representing distinct regions within the lipid bilayer with a composition that is different from the bulk composition of the plasma membrane.
  • An important example of such domains are glycolipid-enriched membrane (GEM) domains (Simons and Toomre, 2000), also referred to as lipid rafts.
  • GEM domains are enriched with cholesterol and specific proteins, many of which function in cell signaling.
  • the enrichment of signaling proteins in GEM domains has led to the notion that they represent a specialized signaling compartment within the plasma membrane.
  • T cells disruption of GEM domains also inhibits T cell activation (Xavier et al., 1998)
  • GEM and non-GEM domains can be studied in intact cells using fluorescence imaging techniques such as confocal microscopy.
  • fluorescence imaging techniques such as confocal microscopy.
  • the labeled targeting agents and methods described herein represent a advance in the characterization of GEM and non-GEM compartments of the plasma membrane in live cells.
  • the present invention provides a novel and useful method for studying the GEM and non-GEM domains of the plasma membrane of cells through the use of fusion proteins that are specifically targeted to these domains.
  • the invention provides for fusion proteins targeted to either GEM or non-GEM domains.
  • a fusion protein for targeting GEM domains is comprised of a peptide of 5 to about 15 consecutive amino acid residues comprising a membrane targeting sequence from p56 Lck , a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein.
  • the membrane targeting sequence from p56 Lck may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acid residues in length.
  • the targeting sequence of the fusion protein may include the first 10 amino acid residues of p56 Lck .
  • the fluorescent protein of the fusion protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • a fusion protein for targeting non-GEM domains is comprised of a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60 c-Src , a polypeptide encoding a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein.
  • the membrane targeting sequence from pp60 c-Src may comprise 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acid residues in length.
  • the targeting sequence of the fusion protein may include the first 15 amino acid residues of pp60 c-Src .
  • the fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • the linker can be either a peptide or a non-peptide.
  • the linker is a poly-glutamine peptide of about 4 amino acid residues in length.
  • a polynucleotide that encodes a fusion protein targeted to GEM domains is comprised of a peptide of 5 to about 15 consecutive amino acid residues comprising a membrane targeting sequence from p56 Lck , a polypeptide encoding a fluorescent protein, and a linker inserted between, and covalently bound to, said membrane targeting sequence and said fluorescent protein.
  • the targeting sequence and linker are encoded by the ATGGGCTGTGTCTGCAGCTCAAACCCTGAAAACAACAACAAC.
  • the linker can also be a poly-glutamine peptide of about 4 amino acid residues in length.
  • the fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • a polynucleotide that encodes a fusion protein targeted to non-GEM domains is comprised of a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60 c-Src , a polypeptide encoding a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein.
  • the targeting sequence and linker are encoded by ATGGGGAGCAGCAAGAGCAAGCCCAAGGACCCCAGCCAGCGCCGGAACAAC AACAA.
  • the linker may also be a poly-glutamine peptide of about 4 amino acid residues in length.
  • the fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • Expression vectors comprising polynucleotides that encode fusion proteins targeted to GEM and non-GEM domains are also included in the present invention.
  • the expression vector is pWay20.
  • the promoter is a cytomegalovirus (CMV) promoter.
  • the fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • the present invention also provides for methods of targeting a protein to a GEM or non-GEM domain of a cell membrane.
  • the method comprises providing a fusion protein and contacting the fusion protein with a cell.
  • fusion proteins targeted to GEM domains are comprised of a peptide of 5 to about 15 residues comprising a membrane targeting sequence from p56 Lck , a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein.
  • the fusion proteins are comprised of a peptide of 10 to about 20 residues comprising a membrane targeting sequence from pp60 c-Src , a fluorescent protein, and a linker inserted between, and covalently bound to the membrane targeting sequence and the fluorescent protein.
  • the fluorescent protein of the fusion protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein
  • the method of targeting a fusion protein to a GEM or non-GEM domain can further comprise an assessment of the location or localization of the fusion protein.
  • This assessment can involve techniques including, but not limited to, immunoblotting. Fluorescence-based imaging techniques may be used to assess location or localization of the fusion protein, including use of cell imaging, flow cytometry, and fluorometry. In a preferred embodiment, confocal microscopy is used to assess the location of the fusion proteins. In addition, membrane fractionation may be used to assess location of fusion proteins within cell membranes.
  • the method of targeting a fusion protein to a GEM or non-GEM domain can also comprise providing a second fusion protein.
  • the second fusion protein is comprised of a peptide of 5 to about 15 residues comprising a membrane targeting sequence from p56 Lck or a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60 c-Src , a fluorescent protein different from the fluorescent protein in the first fusion protein, and a linker inserted between, and covalently bound to, said membrane targeting sequence and said fluorescent protein; and the second fusion protein is contacted with a cell.
  • the method may also comprising assessing the location or localization of the second fusion protein.
  • the fluorescent protein of the second fusion protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • the present invention provides for a method of screening a compound for its effect on GEM and non-GEM domain targeting.
  • the method includes providing a cell labeled with a fusion protein targeted to either GEM or non-GEM domains, admixing a candidate substance with the cell, and determining the effect of the candidate substance on GEM or non-GEM targeting.
  • fusion proteins targeting to GEM domains are comprised of a peptide of 5 to about 15 residues comprising a membrane targeting sequence from p56 Lck , a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorscent protein.
  • the fusion proteins are comprised of a peptide of 10 to about 20 residues comprising a membrane targeting sequence from pp60 c-Src , a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein.
  • the method of screening the effects of compounds may further comprise assessing the location or localization of the fusion protein.
  • this assessment involves the use of confocal microscopy.
  • immunoblotting and membrane fractionation may be used to assess the location of fusion proteins.
  • Fluorescence-based techniques such as cell imaging, flow cytometry, and fluorometry may also be used to assess fusion protein localization.
  • the fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • FIGS. 1 A- 1 B Targeting of GFP to GEM and non-GEM fractions in Jurkat T cells.
  • FIG. 1A GFP was fused to the membrane-anchoring domain of either Lck (top) or c-Src (bottom). Each contains a poly-glutamine insert between the membrane-anchoring domain and GFP in order to add flexibility between the separate structural regions of the protein.
  • FIG. 1B Measurement of GEM-association of L 10 - and S 15 -GFP by equilibrium centrifugation.
  • Jurkat T cells expressing either protein were lysed with TX-100, and the GEM and TX-100 soluble (TXS) membrane fractions were separated by equilibrium centrifugation using a discontinuous sucrose gradient. Each protein was detected by immunoblotting using antibody that recognizes GFP. Fraction 1 represents the top of the gradient.
  • FIGS. 2 A- 2 B Measurement of targeting of GFP to membrane caps in stimulated T cells.
  • FIG. 2A Jurkat cells expressing L 10 -GFP (left) or S 15 -GFP (right) were stimulated using polystyrene beads coated with antibody specific to CD3. The asterisk indicates the position of the beads.
  • the plots in FIG. 2A represent quantitation of the fluorescence intensity of the plasma membrane of each image.
  • the y-axis of each plot represents the relative fluorescence intensity of the plasma membrane, and it has arbitrary units ranging in value between 0 and 255.
  • the x-axis represents the distance around the perimeter of the cell, and each pixel represents 0.25 ⁇ m.
  • the region of the graph corresponding to the bead-contact site in the plasma membrane is marked by the red lines.
  • the relative enrichment of each GFP molecule at the bead contact site was measured and plotted for populations of stimulated Jurkat cells. Protein enrichment was measured using the ratio of average fluorescence intensity of the plasma membrane at the bead contact site divided by the average fluorescence intensity of the plasma membrane outside of the bead contact site.
  • glycolipid-enriched membrane (GEM) domains are enriched with cholesterol and specific proteins, many of which function in cell signaling.
  • GEM domains many of their properties remain elusive, due in large in part to the fact that most studies rely on detergent lysis of cells in order to separate the detergent-resistant GEM fraction from the non-GEM fraction of the plasma membrane.
  • the present invention overcomes such deficiencies in the art by providing compositions and methods that permit the study of GEM and non-GEM targeting in plasma membranes.
  • the present invention involves the use of labeled fusion proteins that contain targeting signals for both GEM and non-GEM regions. These fusion proteins may be employed advantageously in gaining a better understanding of intracellular trafficking and in the screening of agents that alter the localization of peptides to either GEM or non-GEM regions of the membrane.
  • the measurements will assess such functions as cell surface targeting, intracellular localization, and protein repartitioning, for example, as part of cellular activation.
  • GEM domains The presence of signaling proteins in GEM domains has led to the notion that they represent a specialized signaling compartment within the plasma membrane.
  • One important signaling protein that associates with GEM domains is the Src protein tyrosine kinase p56 Lck (Rodgers et al., 1994; Shenoy-Scaria et al., 1993). Association of p56 Lck with GEM domains is noteworthy as it is essential for T cell development and stimulation (Karnitz et al., 1992); Straus et al., 1992). Furthermore, disruption of the GEM-targeting signal of p56 Lck also inhibits T cell activation (Kabouridis et al., 1997).
  • a fusion or chimeric protein is a specialized kind of protein variant that is an insertional variant.
  • This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus or in even at other parts of the protein, to all or a portion of a second polypeptide.
  • fusion proteins have been generated that comprise regions of the membrane-anchoring signal (p56 lck or pp60c-src).
  • the regions involved with GEM and non-GEM targeting in p56 lck or pp60 c-scr have been identified previously (Kwong and Lublin,1995; Shenoy-Scaria et al., 1994). However, it was unclear whether discrete portions of these molecules would be compatible in the context of a fluorescent protein fusion, and thus retain their targeting function.
  • regions as small as 10 residues of p56 Lck and 15 residues of pp60 Src retain their respective targeting functions when fused to fluorescent proteins.
  • the p56 Lck sequence of MGCVCSSNPE was used successfully to target GFP to GEM domains.
  • the sequence MGSSKSKPKDPSQRR of pp60 Src was used successfully to target GFP to non-GEM regions. It is believed that the carboxy-terminal five residues of each of these peptides may be removed while retaining their targeting function.
  • the present invention contemplates fusion proteins comprising regions of proteins linked to fluorescent proteins such as green fluorescent proteins (GFP), (Chalfie et al. 1994; Prasher, 1995; WO 95/07463), cyan fluorescent proteins (CFP) (Heim and Tsien 1996), Accession # AB041904, and yellow fluorescent proteins (YFP) (Miyawaki et al., 1997).
  • GFP green fluorescent proteins
  • CFP cyan fluorescent proteins
  • YFP yellow fluorescent proteins
  • These fluorescent proteins may be used in combination to perform double-labeling studies by co-expressing the two colors together, as well as energy transfer measurements. Energy transfer is particularly useful for measuring distance between molecules in the 50-75 Angstrom range.
  • GFP proteins have since been isolated, for example, the naturally-occurring blue fluorescent variant of GFP (Heim et al. 1994) and several other mutational variants, described in U.S. Pat. No. 6,172,188, incorporated herein by reference which allows the use of fluorescent probes having different excitation and emission spectra permits simultaneous monitoring of more than one process.
  • GFP proteins provide non-invasive assays which allow detection of cellular events in intact, living cells. Other fluorescent or luminescent (e.g., proteins also could be employed).
  • the fusion proteins of the present invention are comprised of a membrane-targeting signal (a region of p56 Lck or pp60 cSrc ) and a fluorescent protein joined via a linker, such as an amino acid sequence.
  • a linker such as an amino acid sequence.
  • An exemplary form of a peptide linker is a four-residue poly-glutamine insert.
  • U.S. Pat. No. 5,856,456 provides peptide linkers for use in connecting polypeptide constituents to make fusion proteins.
  • the linker is up to about 50 amino acids in length, contains at least one occurrence of a charged amino acid (preferably arginine or lysine) followed by a proline, and is characterized by greater stability and reduced aggregation.
  • U.S. Pat. No. 5,880,270 discloses aminooxy-containing linkers useful in a variety of immunodiagnostic and separative techniques.
  • any other linking/coupling agents known to those of skill in the art can be used according to the present invention, such as, for example, avidin-biotin linkages, amide linkages, ester linkages, thioester linkages, ether linkages, thioether linkages, phosphoester linkages, phosphoramide linkages, anhydride linkages, disulfide linkages, ionic and hydrophobic interactions, bispecific antibodies and antibody fragments, or combinations thereof.
  • Cross-linking reagents are used to form molecular bridges that tie together functional groups of two different molecules.
  • hetero-bifunctional cross-linkers can be used that eliminate unwanted homopolymer formation. Table 1 lists such agents.
  • An exemplary hetero-bifunctional cross-linker contains two reactive groups: one reacting with primary amine group (e.g., N-hydroxy succinimide) and the other reacting with a thiol group (e.g., pyridyl disulfide, maleimides, halogens, etc.).
  • primary amine group e.g., N-hydroxy succinimide
  • a thiol group e.g., pyridyl disulfide, maleimides, halogens, etc.
  • the cross-linker may react with the lysine residue(s) of one protein (e.g., the selected antibody or fragment) and through the thiol reactive group, the cross-linker, already tied up to the first protein, reacts with the cysteine residue (free sulfhydryl group) of the other protein (e.g., the selective agent).
  • SMPT cross-linking reagent
  • Another cross-linking reagent is SMPT, which is a bifunctional cross-linker containing a disulfide bond that is “sterically hindered” by an adjacent benzene ring and methyl groups. It is believed that steric hindrance of the disulfide bond serves a function of protecting the bond from attack by thiolate anions such as glutathione which can be present in tissues and blood, and thereby help in preventing decoupling of the conjugate prior to the delivery of the attached agent to the target site.
  • thiolate anions such as glutathione which can be present in tissues and blood
  • the SMPT cross-linking reagent lends the ability to cross-link functional groups such as the SH of cysteine or primary amines (e.g., the epsilon amino group of lysine).
  • Another possible type of cross-linker includes the hetero-bifunctional photoreactive phenylazides containing a cleavable disulfide bond such as sulfosuccinimidyl-2-(p-azido salicylamido) ethyl-1,3′-dithiopropionate.
  • the N-hydroxy-succinimidyl group reacts with primary amino groups and the phenylazide (upon photolysis) reacts non-selectively with any amino acid residue.
  • non-hindered linkers also can be employed in accordance herewith.
  • Other useful cross-linkers include SATA, SPDP and 2-iminothiolane (Wawrzynczak & Thorpe, 1987). The use of such cross-linkers is well understood in the art.
  • U.S. Pat. No. 4,680,3308 describes bifunctional linkers useful for producing conjugates of ligands with amine-containing polymers and/or proteins, especially for forming antibody conjugates with chelators, drugs, enzymes, detectable labels and the like.
  • U.S. Pat. Nos. 5,141,648 and 5,563,250 disclose cleavable conjugates containing a labile bond that is cleavable under a variety of mild conditions. This linker is particularly useful in that the agent of interest may be bonded directly to the linker, with cleavage resulting in release of the active agent.
  • nucleic acid is well known in the art.
  • a “nucleic acid” as used herein will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase.
  • a nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine “A,” a guanine “G,” a thymine “T” or a cytosine “C”) or RNA (e.g., an A, a G, an uracil “U” or a C).
  • nucleic acid encompass the terms “oligonucleotide” and “polynucleotide,” each as a subgenus of the term “nucleic acid.”
  • oligonucleotide refers to a molecule of between about 3 and about 100 nucleobases in length.
  • polynucleotide refers to at least one molecule of greater than about 100 nucleobases in length.
  • a nucleic acid may encompass a double-stranded molecule or a triple-stranded molecule that comprises one or more complementary strand(s) or “complement(s)” of a particular sequence comprising a molecule.
  • a single stranded nucleic acid may be denoted by the prefix “ss,” a double stranded nucleic acid by the prefix “ds,” and a triple stranded nucleic acid by the prefix “ts.”
  • a nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production or biological production.
  • a synthetic nucleic acid e.g., a synthetic oligonucleotide
  • Non-limiting examples of a synthetic nucleic acid include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266 032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986, incorporated herein by reference.
  • one or more oligonucleotide may be used.
  • a non-limiting example of an enzymatically produced nucleic acid includes one produced by enzymes in amplification reactions such as PCRTM (see for example, U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Pat. No. 5,645,897, incorporated herein by reference.
  • a non-limiting example of a biologically produced nucleic acid includes a recombinant nucleic acid produced (i.e., replicated) in a living cell, such as a recombinant DNA vector replicated in bacteria (see for example, Sambrook et al. 1989, incorporated herein by reference).
  • a nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al., 1989, incorporated herein by reference).
  • the present invention concerns a nucleic acid that is an isolated nucleic acid.
  • isolated nucleic acid refers to a nucleic acid molecule (e.g., an RNA or DNA molecule) that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells.
  • isolated nucleic acid refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components or in vitro reaction components such as for example, macromolecules such as lipids or proteins, small biological molecules, and the like.
  • nucleic acid(s) of the present invention may be combined with other nucleic acid sequences, including but not limited to, promoters, enhancers, polyadenylation signals, restriction enzyme sites, multiple cloning sites, coding segments, and the like, to create one or more nucleic acid construct(s).
  • a “nucleic acid construct” is a nucleic acid engineered or altered by the hand of man, and generally comprises one or more nucleic acid sequences organized by the hand of man.
  • the invention concerns one or more recombinant vector(s) comprising nucleic acid sequences that encodes a fusion protein comprised of a membrane targeting sequence of p56 Lck or pp60 cSrc , a polypeptide encoding fluorescent proteins, and a linker inserted between, and covalently bound to, the membrane targeting sequence of fluorescent proteins.
  • the recombinant vectors are DNA vectors.
  • codons that encode the same amino acid, such as the six codons for arginine and serine, and also refers to codons that encode biologically equivalent amino acids. Codons are shown in Table 2 in preference of human use from left to right. Thus, the most preferred codon for alanine is thus “GCC”, and the least is “GCG” (see Table 2, below).
  • amino acid sequences or nucleic acid sequences may include additional residues, such as additional N— or C-terminal amino acids or 5′ or 3′ sequences, or various combinations thereof, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein, polypeptide or peptide activity where expression of a proteinaceous composition is concerned.
  • the addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5′ and/or 3′ portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.
  • this invention is not limited to the particular nucleic acid or amino acid sequences of the fusion proteins.
  • Recombinant vectors and isolated nucleic acid segments may therefore variously include these coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, and they may encode larger polypeptides or peptides that nevertheless include such coding regions or may encode biologically functional equivalent proteins, polypeptide or peptides that have variant amino acids sequences.
  • nucleic acids of the present invention encompass biologically functional equivalent fusion proteins or polypeptides. Such sequences may arise as a consequence of codon redundancy or functional equivalency that are known to occur naturally within nucleic acid sequences or the proteins, polypeptides or peptides thus encoded.
  • functionally equivalent proteins, polypeptides or peptides may be created via the application of recombinant DNA technology, in which changes in the protein, polypeptide or peptide structure may be engineered, based on considerations of the properties of the amino acids being exchanged.
  • Changes designed by man may be introduced, for example, through the application of site-directed mutagenesis techniques as discussed herein below, e.g., to introduce improvements or alterations to the antigenicity of the protein, polypeptide or peptide, or to test mutants in order to examine the activity of the fusion protein at the molecular level.
  • vector is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated.
  • a nucleic acid sequence can be “exogenous,” which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found.
  • Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs).
  • a preferred expression vector is pWay20 (Lo and Hughes, 1998).
  • expression vector refers to any type of genetic construct comprising a nucleic acid coding for a RNA capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes.
  • Expression vectors can contain a variety of “control sequences,” which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.
  • a “promoter” is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors, to initiate the specific transcription a nucleic acid sequence.
  • the phrases “operatively positioned,” “operatively linked,” “under control,” and “under transcriptional control” mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence.
  • a promoter generally comprises a sequence that functions to position the start site for RNA synthesis.
  • the best known example of this is the TATA box, but in some promoters lacking a TATA box, such as, for example, the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation. Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well.
  • a coding sequence “under the control of” a promoter one positions the 5 end of the transcription initiation site of the transcriptional reading frame “downstream” of (i.e., 3 of) the chosen promoter.
  • the “upstream” promoter stimulates transcription of the DNA and promotes expression of the encoded RNA.
  • promoter elements frequently are flexible, so that promoter function is preserved when elements are inverted or moved relative to one another.
  • the spacing between promoter elements can be increased to 50bp apart before activity begins to decline.
  • individual elements can function either cooperatively or independently to activate transcription.
  • a promoter may or may not be used in conjunction with an “enhancer,” which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.
  • a promoter may be one naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5 non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as “endogenous.”
  • an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.
  • certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment.
  • a recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment.
  • promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus, or prokaryotic or eukaryotic cell, and promoters or enhancers not “naturally occurring,” i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression.
  • the promoter is a cytomegalovirus (CMV) promoter. Promoters that are most commonly used in recombinant DNA construction include the -lactamase (penicillinase), lactose and tryptophan (trp) promoter systems.
  • sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCRTM, in connection with the compositions disclosed herein (see U.S. Pat. Nos. 4,683,202 and 5,928,906, each incorporated herein by reference).
  • control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
  • promoter and/or enhancer that effectively directs the expression of the DNA segment in the organelle, cell type, tissue, organ, or organism chosen for expression.
  • Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, (see, for example Sambrook et al. 1989, incorporated herein by reference).
  • the promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides.
  • the promoter may be heterologous or endogenous.
  • a specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be “in-frame” with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements.
  • Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector (see, for example, Carbonelli et al., 1999, Levenson et al., 1998, and Cocea, 1997, incorporated herein by reference.)
  • MCS multiple cloning site
  • “Restriction enzyme digestion” refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art.
  • a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector.
  • “Ligation” refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology.
  • RNA molecules will undergo RNA splicing to remove introns from the primary transcripts.
  • Vectors containing genomic eukaryotic sequences may require donor and/or acceptor splicing sites to ensure proper processing of the transcript for protein expression (see, for example, Chandler et al., 1997, herein incorporated by reference.)
  • the vectors or constructs of the present invention will generally comprise at least one termination signal.
  • a “termination signal” or “terminator” is comprised of the DNA sequences involved in specific termination of an RNA transcript by an RNA polymerase. Thus, in certain embodiments a termination signal that ends the production of an RNA transcript is contemplated. A terminator may be necessary in vivo to achieve desirable message levels.
  • the terminator region may also comprise specific DNA sequences that permit site-specific cleavage of the new transcript so as to expose a polyadenylation site.
  • RNA molecules modified with this polyA tail appear to more stable and are translated more efficiently.
  • terminator comprises a signal for the cleavage of the RNA, and it is more preferred that the terminator signal promotes polyadenylation of the message;
  • the terminator and/or polyadenylation site elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
  • Terminators contemplated for use in the invention include any known terminator of transcription described herein or known to one of ordinary skill in the art, including but not limited to, for example, the termination sequences of genes, such as for example the bovine growth hormone terminator or viral termination sequences, such as for example the SV40 terminator.
  • the termination signal may be a lack of transcribable or translatable sequence, such as due to a sequence truncation.
  • polyadenylation signal In expression, particularly eukaryotic expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript.
  • the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed.
  • Preferred embodiments include the SV40 polyadenylation signal or the bovine growth hormone polyadenylation signal, convenient and known to function well in various target cells. Polyadenylation may increase the stability of the transcript or may facilitate cytoplasmic transport.
  • a vector in a host cell may contain one or more origins of replication sites (often termed “ori”), which is a specific nucleic acid sequence at which replication is initiated.
  • ori origins of replication sites
  • ARS autonomously replicating sequence
  • cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the expression vector.
  • markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector.
  • a selectable marker is one that confers a property that allows for selection.
  • a positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection.
  • An example of a positive selectable marker is a drug resistance marker.
  • a drug selection marker aids in the cloning and identification of transformants
  • genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers.
  • markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions other types of markers including screenable markers such as fluorescent proteins, whose basis is colorimetric analysis, are also contemplated.
  • screenable enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized.
  • Suitable methods for nucleic acid delivery for use with the current invention are believed to include virtually any method by which a nucleic acid (e.g., DNA) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art.
  • a nucleic acid e.g., DNA
  • Such methods include, but are not limited to, direct delivery of DNA such as by ex vivo transfection (Wilson et al., 1989), by injection (U.S. Pat. Nos.
  • WO 94/09699 and 95/06128 U.S. Pat. Nos. 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (U.S. Pat. Nos. 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium -mediated transformation (U.S. Pat. Nos. 5,591,616 and 5,563,055, each incorporated herein by reference); by PEG-mediated transformation of protoplasts (U.S. Pat. Nos.
  • organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
  • Fluorescence imaging techniques will be used in the present invention to study the location and localization of fusion proteins targeted to GEM and non-GEM regions of cell plasma membranes.
  • confocal microscopy will be used to study the distribution of these fusion proteins on the plasma membrane surface of intact cells.
  • confocal microscopy will be used to study the distribution of fusion proteins on plamsa membranes to study the effect of a candidate substance that has been previously admixed with the cell.
  • fluorescence imaging techniques are available.
  • fluorescent activated cell sorting, flow cytometry, or flow microfluorometry provides the means of scanning individual cells for the presence of labeled fusion proteins.
  • the method employs instrumentation that is capable of activating, and detecting the excitation emissions of labeled cells in a liquid medium.
  • FACS Fluorescence Activated Cell Sorting
  • Flow cytometry involves the separation of cells or other particles in a liquid sample.
  • the purpose of flow cytometry is to analyze the separated particles for one or more characteristics thereof.
  • the basis steps of flow cytometry involve the direction of a fluid sample through an apparatus such that a liquid stream passes through a sensing region.
  • the particles should pass one at a time by the sensor and are categorized base on size, refraction, light scattering, opacity, roughness, shape, fluorescence, etc.
  • Apparati permit quantitative multiparameter analysis of cellular properties at rates of several thousand cells per second. These instruments provide the ability to differentiate among cell types. Data are often displayed in one-dimensional (histogram) or two-dimensional (contour plot, scatter plot) frequency distributions of measured variables.
  • the partitioning of multiparameter data files involves consecutive use of the interactive one- or two-dimensional graphics programs.
  • Quantitative analysis of multiparameter flow cytometric data for rapid cell detection consists of two stages: cell class characterization and sample processing.
  • cell class characterization partitions the cell feature into cells of interest and not of interest.
  • sample processing each cell is classified in one of the two categories according to the region in which it falls.
  • Analysis of the class of cells is very important, as high detection performance may be expected only if an appropriate characteristic of the cells is obtained.
  • a particular form of this phenomenon is known as fluorescence energy transfer, or FET.
  • FET occurs between a donor fluorophore and an acceptor dye (which may or may not be a fluorophore) when the absorption spectrum of one (the acceptor) overlaps the emission spectrum of the other (the donor) and the two dyes are in close proximity. Dyes with these properties are referred to as donor/acceptor dye pairs or energy transfer dye pairs.
  • the excited-state energy of the donor fluorophore is transferred by a resonance dipole-induced dipole interaction to the neighboring acceptor. This results in quenching of donor fluorescence.
  • the acceptor is also a fluorophore
  • the intensity of its fluorescence may be enhanced.
  • the efficiency of energy transfer is highly dependent on the distance between the donor and acceptor, and equations predicting these relationships have been developed by Forster (1948).
  • the distance between donor and acceptor dyes at which energy transfer efficiency is 50% is referred to as the Forster distance (R O ).
  • Other mechanisms of fluorescence quenching are also known including, for example, charge transfer and collisional quenching.
  • the present invention also provides for isolatoing and identification of proteins and polypeptides from cellular membranes.
  • purified proteins, polypeptides, or peptides as used herein, is intended to refer to an proteinaceous composition, isolatable from mammalian cells or recombinant host cells, wherein the at least one protein, polypeptide, or peptide is purified to any degree relative to its naturally-obtainable state, i.e., relative to its purity within a cellular extract.
  • a purified protein, polypeptide, or peptide therefore also refers to a wild-type or mutant protein, polypeptide, or peptide free from the environment in which it naturally occurs.
  • purified will refer to a specific protein, polypeptide, or peptide composition that has been subjected to fractionation to remove various other proteins, polypeptides, or peptides, and which composition substantially retains its activity, as may be assessed, for example, by the protein assays, as described herein below, or as would be known to one of ordinary skill in the art for the desired protein, polypeptide or peptide.
  • a natural or recombinant composition comprising at least some specific proteins, polypeptides, or peptides will be subjected to fractionation to remove various other components from the composition.
  • various other techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite, lectin affinity and other affinity chromatography steps; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques.
  • any fusion protein purification method can now be practiced. This is exemplified by the generation of an specific protein-glutathione S-transferase fusion protein, expression in E. coli, and isolation to homogeneity using affinity chromatography on glutathione-agarose or the generation of a polyhistidine tag on the N— or C-terminus of the protein, and subsequent purification using Ni-affinity chromatography.
  • any purification method can now be employed.
  • protein, polypeptide, or peptide Although preferred for use in certain embodiments, there is no general requirement that the protein, polypeptide, or peptide always be provided in their most purified state. Indeed, it is contemplated that less substantially purified protein, polypeptide or peptide, which are nonetheless enriched in the desired protein compositions, relative to the natural state, will have utility in certain embodiments.
  • Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein.
  • Inactive products also have utility in certain embodiments, such as, e.g., in determining antigenicity via antibody generation.
  • FIG. 1A The separate GFP fusion proteins are outlined in FIG. 1A . Each was constructed using the GFP cloning and expression vector pWay20 (Lo et al., 1998). This vector contains a Sma1 site immediately upstream of and in-frame with enhanced GFP (eGFP, Clontech, Carlsbad, Calif.) and a stop codon at the 3′ end of eGFP. A CMV promoter drives gene transcription.
  • eGFP enhanced GFP
  • Clontech Clontech, Carlsbad, Calif.
  • the GEM-targeted GFP molecule was constructed using the first 10 amino acids of p56 Lck followed by an intermediate four-residue poly-glutamine insert, and finally eGFP itself(L 10 -GFP) ( FIG. 1A ).
  • the polyglutamine insert was added to provide flexibility between the adjacent protein domains (Minor and Kim, 1994).
  • the oligonucleotides used for encoding the N-terminal region of p56 Lck and the poly-glutamine spacer were: ATGGGCTGTGTCTGCAGCTCAAACCCTGAAAACAAC-AACAAC (coding; SEQ ID NO:1) and GTTGTTGTTGTTTTCAGGGTTTGAGC-TGCAGACACAGCCCAT (noncoding SEQ ID NO:2).
  • the oligonucleotides were annealed and subcloned into Sma1-cut pWay20.
  • the GFP-labeled marker for the non-GEM compartment consists of the first 15 amino acids of pp60 c-Scr followed by a poly-glutamine spacer and eGFP (S 15 -GFP) ( FIG. 1A ).
  • the oligonucleotides encoding the membrane-anchoring domain and poly-glutamine insert were: ATGGGGAGCAGCAAGAGCAAGCCCAAGGACCCCAGCCAGCGCCGGAACAACAACAA (coding; SEQ ID NO:3) and GTTGTTGTTGTTCCGGCGCTGGCTGGGGTCCTTGGGCTTGCTCTCTTGCTGCTCCC CAT (noncoding; SEQ ID NO:4).
  • TX-100 Triton X-100
  • TXS Triton X-100-soluble membrane fractions
  • the gradient consisted of 1.75 ml of a 30% sucrose solution overlaid with 0.75 ml of a 5% sucrose solution.
  • Centrifugation was performed using a SW rotor. All sucrose solutions were in 10 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 5 mM EDTA (TNE).
  • the samples were centrifuged for 16-18 hr at 200000 ⁇ g. Following centrifugation, the gradients were harvested by fractionating from the top. Each gradient fraction was separated by SDS-PAGE, and L 10 - and S 15 -GFP were detected by immunoblotting using monoclonal antibody specific to GFP (Covance Research Products, Inc., Richmond, Calif.).
  • FIG. 1B shows that L 10 -GFP is present in the GEM fraction represented by gradient fractions 1 through 4.
  • S 15 -GFP occurs only in the TX-100-soluble fraction of the membrane represented by gradient fractions 6 through 10. Quantitation showed that approximately 55% of the total L 10 -GFP is present in the GEM fraction, and this is similar to that of wild-type p56 Lck in Jurkat cells (Rodgers and Rose, 1996). Altogether, FIG. 1B shows that the GEM- and non-GEM targeting signals efficiently target GFP to the respective membrane compartments as measured by sucrose gradient equilibrium centrifugation of TX-100 lysates.
  • FIG. 2A Jurkat cells expressing either L 10 - or S 15 -GFP are shown in FIG. 2A . Importantly, the images show that L 10 - and S 15 -GFP are membrane associated, with the majority of the signal occurring in the plasma membrane. In many cells, L 10 -GFP and S 15 -GFP were also enriched in intracellular structures that probably represent early endosomes (Ley et al., 1994). An example of this is indicated by the arrow in the image of the cell expressing S 15 -GFP.
  • FIGS. 2 A-B shows L 10 -GFP is selectively enriched in membrane caps that form as a result of crosslinking of the TcR by OKT3-coated bead.
  • each cell shown in FIG. 2A has bound an OKT3-coated bead, and the asterisk indicates this.
  • the fluorescence is enriched in the region of the plasma membrane contacting the bead.
  • S 15 -GFP is not enriched in a membrane cap.

Abstract

Cell membranes containing glycolipid-enriched membrane (GEM) and non-glycolipid-enriched membrane (non-GEM) domains are targeted using fusion proteins that are anchored in the cell membrane. Fusion proteins to target GEM (or non-GEM) domains are comprised of a selected fluorescent polypeptide, a membrane-targeting sequence of p56Lck (or pp60c-Src for non-GEM domains) and a linker inserted between the polypeptide and the membrane targeting sequence. Localization of fusion proteins in GEM and non-GEM domains is assessed using techniques including confocal microscopy, fluorescence-based techniques, and membrane fractionation. Using these techniques, compounds are screened for their effect on GEM and non-GEM domains of live cells. These fusion proteins therefore represent useful tools for studying subcellular trafficking and the function of discrete compartments in the plasma membrane.

Description

  • This application is related to, and claims a benefit of priority from, copending provisional U.S. Provisional Ser. No. 60/304,030, filed Jul. 9, 2001, the entire contents of which are hereby expressly incorporated by reference for all purposes.
  • BACKGROUND OF THE INVENTION
  • I. Field of the Invention
  • This invention relates to the fields of cellular biology and membrane and protein biochemistry. In particular, the present invention provides fusion proteins encoding fluorescent proteins. The fusion proteins target glycolipid-enriched membrane (GEM) and non-glycolipid-enriched membrane (non-GEM) domains of cell membranes by virtue of membrane-anchoring signal from p56lck or pp60c-scr, respectively.
  • II. Background
  • The plasma membrane of mammalian cells contains domains representing distinct regions within the lipid bilayer with a composition that is different from the bulk composition of the plasma membrane. An important example of such domains are glycolipid-enriched membrane (GEM) domains (Simons and Toomre, 2000), also referred to as lipid rafts. Besides glycolipids, GEM domains are enriched with cholesterol and specific proteins, many of which function in cell signaling. The enrichment of signaling proteins in GEM domains has led to the notion that they represent a specialized signaling compartment within the plasma membrane. Importantly, recent studies corroborate this hypothesis. For example, in T cells, disruption of GEM domains also inhibits T cell activation (Xavier et al., 1998)
  • Despite the current interest in GEM domains, many of their properties remain elusive. This is due in part to the fact that many studies of GEM domains include detergent lysis of cells in order to separate the detergent-resistant GEM fraction from the non-GEM fraction of the plasma membrane. Obviously, such procedures are highly disruptive and, in addition to potentially altering the natural structure of such domains, the permit no follow-up experiments to explore further functional aspects. Thus, there remains a need to develop new and improved methods for examining GEM and non-GEM targeting in situ.
  • SUMMARY OF THE INVENTION
  • To avoid disruption of GEM domains, the inventors have developed methods for studying their properties in situ. Using these methods, GEM and non-GEM domains can be studied in intact cells using fluorescence imaging techniques such as confocal microscopy. The labeled targeting agents and methods described herein represent a advance in the characterization of GEM and non-GEM compartments of the plasma membrane in live cells.
  • Thus, in one aspect, the present invention provides a novel and useful method for studying the GEM and non-GEM domains of the plasma membrane of cells through the use of fusion proteins that are specifically targeted to these domains. In one embodiment, the invention provides for fusion proteins targeted to either GEM or non-GEM domains. In one embodiment, a fusion protein for targeting GEM domains is comprised of a peptide of 5 to about 15 consecutive amino acid residues comprising a membrane targeting sequence from p56Lck, a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein. The membrane targeting sequence from p56Lck may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acid residues in length. Alternatively, the targeting sequence of the fusion protein may include the first 10 amino acid residues of p56Lck. The fluorescent protein of the fusion protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • In another embodiment, a fusion protein for targeting non-GEM domains is comprised of a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60c-Src, a polypeptide encoding a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein. The membrane targeting sequence from pp60c-Src may comprise 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acid residues in length. The targeting sequence of the fusion protein may include the first 15 amino acid residues of pp60c-Src. The fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • For fusion proteins targeting to either GEM or non-GEM domains, the linker can be either a peptide or a non-peptide. In a preferred embodiment, the linker is a poly-glutamine peptide of about 4 amino acid residues in length.
  • Another embodiment of the current invention provides for polynucleotides that encode fusion proteins targeted to either the GEM or non-GEM domains of plasma membranes. A polynucleotide that encodes a fusion protein targeted to GEM domains is comprised of a peptide of 5 to about 15 consecutive amino acid residues comprising a membrane targeting sequence from p56Lck, a polypeptide encoding a fluorescent protein, and a linker inserted between, and covalently bound to, said membrane targeting sequence and said fluorescent protein. In a particular embodiment, the targeting sequence and linker are encoded by the ATGGGCTGTGTCTGCAGCTCAAACCCTGAAAACAACAACAAC. The linker can also be a poly-glutamine peptide of about 4 amino acid residues in length. The fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • A polynucleotide that encodes a fusion protein targeted to non-GEM domains is comprised of a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60c-Src, a polypeptide encoding a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein. In a particular embodiment, the targeting sequence and linker are encoded by ATGGGGAGCAGCAAGAGCAAGCCCAAGGACCCCAGCCAGCGCCGGAACAAC AACAA. The linker may also be a poly-glutamine peptide of about 4 amino acid residues in length. The fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • Expression vectors comprising polynucleotides that encode fusion proteins targeted to GEM and non-GEM domains are also included in the present invention. In one embodiment, the expression vector is pWay20. In another embodiment, the promoter is a cytomegalovirus (CMV) promoter. The fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • The present invention also provides for methods of targeting a protein to a GEM or non-GEM domain of a cell membrane. The method comprises providing a fusion protein and contacting the fusion protein with a cell. In this method, fusion proteins targeted to GEM domains are comprised of a peptide of 5 to about 15 residues comprising a membrane targeting sequence from p56Lck, a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein. Alternatively, the fusion proteins are comprised of a peptide of 10 to about 20 residues comprising a membrane targeting sequence from pp60c-Src, a fluorescent protein, and a linker inserted between, and covalently bound to the membrane targeting sequence and the fluorescent protein. The fluorescent protein of the fusion protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein
  • The method of targeting a fusion protein to a GEM or non-GEM domain can further comprise an assessment of the location or localization of the fusion protein. This assessment can involve techniques including, but not limited to, immunoblotting. Fluorescence-based imaging techniques may be used to assess location or localization of the fusion protein, including use of cell imaging, flow cytometry, and fluorometry. In a preferred embodiment, confocal microscopy is used to assess the location of the fusion proteins. In addition, membrane fractionation may be used to assess location of fusion proteins within cell membranes.
  • The method of targeting a fusion protein to a GEM or non-GEM domain can also comprise providing a second fusion protein. In this method, the second fusion protein is comprised of a peptide of 5 to about 15 residues comprising a membrane targeting sequence from p56Lck or a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60c-Src, a fluorescent protein different from the fluorescent protein in the first fusion protein, and a linker inserted between, and covalently bound to, said membrane targeting sequence and said fluorescent protein; and the second fusion protein is contacted with a cell. The method may also comprising assessing the location or localization of the second fusion protein. The fluorescent protein of the second fusion protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • Finally, the present invention provides for a method of screening a compound for its effect on GEM and non-GEM domain targeting. The method includes providing a cell labeled with a fusion protein targeted to either GEM or non-GEM domains, admixing a candidate substance with the cell, and determining the effect of the candidate substance on GEM or non-GEM targeting. In this method, fusion proteins targeting to GEM domains are comprised of a peptide of 5 to about 15 residues comprising a membrane targeting sequence from p56Lck, a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorscent protein. Alternatively, the fusion proteins are comprised of a peptide of 10 to about 20 residues comprising a membrane targeting sequence from pp60c-Src, a fluorescent protein, and a linker inserted between, and covalently bound to, the membrane targeting sequence and the fluorescent protein.
  • The method of screening the effects of compounds may further comprise assessing the location or localization of the fusion protein. In a preferred embodiment, this assessment involves the use of confocal microscopy. Alternatively, immunoblotting and membrane fractionation may be used to assess the location of fusion proteins. Fluorescence-based techniques such as cell imaging, flow cytometry, and fluorometry may also be used to assess fusion protein localization. The fluorescent protein may be green fluorescent protein, yellow fluorescent protein, or cyan fluorescent protein.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
  • FIGS. 1A-1B: Targeting of GFP to GEM and non-GEM fractions in Jurkat T cells. (FIG. 1A) GFP was fused to the membrane-anchoring domain of either Lck (top) or c-Src (bottom). Each contains a poly-glutamine insert between the membrane-anchoring domain and GFP in order to add flexibility between the separate structural regions of the protein. (FIG. 1B) Measurement of GEM-association of L10- and S15-GFP by equilibrium centrifugation. Jurkat T cells expressing either protein were lysed with TX-100, and the GEM and TX-100 soluble (TXS) membrane fractions were separated by equilibrium centrifugation using a discontinuous sucrose gradient. Each protein was detected by immunoblotting using antibody that recognizes GFP. Fraction 1 represents the top of the gradient.
  • FIGS. 2A-2B: Measurement of targeting of GFP to membrane caps in stimulated T cells. (FIG. 2A) Jurkat cells expressing L10-GFP (left) or S15-GFP (right) were stimulated using polystyrene beads coated with antibody specific to CD3. The asterisk indicates the position of the beads. The plots in FIG. 2A represent quantitation of the fluorescence intensity of the plasma membrane of each image. The y-axis of each plot represents the relative fluorescence intensity of the plasma membrane, and it has arbitrary units ranging in value between 0 and 255. The x-axis represents the distance around the perimeter of the cell, and each pixel represents 0.25 μm. The region of the graph corresponding to the bead-contact site in the plasma membrane is marked by the red lines. In FIG. 2B, the relative enrichment of each GFP molecule at the bead contact site was measured and plotted for populations of stimulated Jurkat cells. Protein enrichment was measured using the ratio of average fluorescence intensity of the plasma membrane at the bead contact site divided by the average fluorescence intensity of the plasma membrane outside of the bead contact site.
  • DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS I. THE PRESENT INVENTION
  • As discussed above, glycolipid-enriched membrane (GEM) domains are enriched with cholesterol and specific proteins, many of which function in cell signaling. Despite the current interest in GEM domains, many of their properties remain elusive, due in large in part to the fact that most studies rely on detergent lysis of cells in order to separate the detergent-resistant GEM fraction from the non-GEM fraction of the plasma membrane.
  • The present invention overcomes such deficiencies in the art by providing compositions and methods that permit the study of GEM and non-GEM targeting in plasma membranes. In particular, the present invention involves the use of labeled fusion proteins that contain targeting signals for both GEM and non-GEM regions. These fusion proteins may be employed advantageously in gaining a better understanding of intracellular trafficking and in the screening of agents that alter the localization of peptides to either GEM or non-GEM regions of the membrane. In particular, the measurements will assess such functions as cell surface targeting, intracellular localization, and protein repartitioning, for example, as part of cellular activation.
  • II. MEMBRANE-TARGETED FUSION PROTEINS
  • A. p56Lck and pp60cSrc
  • The presence of signaling proteins in GEM domains has led to the notion that they represent a specialized signaling compartment within the plasma membrane. One important signaling protein that associates with GEM domains is the Src protein tyrosine kinase p56Lck (Rodgers et al., 1994; Shenoy-Scaria et al., 1993). Association of p56Lck with GEM domains is noteworthy as it is essential for T cell development and stimulation (Karnitz et al., 1992); Straus et al., 1992). Furthermore, disruption of the GEM-targeting signal of p56Lck also inhibits T cell activation (Kabouridis et al., 1997).
  • Earlier studies have identified the GEM-targeting signal of many proteins that reside within GEM domains. In the case of p56Lck, this consists of Gly2, Cys3, and Cys5 (Rodgers et al., 1994; Shenoy-Scaria et al., 1994). Each of these residues is lipid-modified: Gly2 is myristoylated and the cysteine residues are palmitoylated (Rodgers et al., 1994; Shenoy-Scaria et al., 1994; Yurchak et al., 1995). Replacement of either Gly2 with alanine or Cys3 and Cys5 with serine disrupts both membrane and GEM association of p56Lck (Rodgers et al., 1994). Similarly, pp60cSrc, whose membrane anchoring signal consists of myristoylation of Gly2 followed by a string of basic amino acids but no palmitoylation (Resh, 1994) associates only with the non-GEM compartment of the plasma membrane (Kwong and Lublin, 1995).
  • A fusion or chimeric protein is a specialized kind of protein variant that is an insertional variant. This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus or in even at other parts of the protein, to all or a portion of a second polypeptide. In the present invention, fusion proteins have been generated that comprise regions of the membrane-anchoring signal (p56lck or pp60c-src). The regions involved with GEM and non-GEM targeting in p56lck or pp60c-scr have been identified previously (Kwong and Lublin,1995; Shenoy-Scaria et al., 1994). However, it was unclear whether discrete portions of these molecules would be compatible in the context of a fluorescent protein fusion, and thus retain their targeting function.
  • Thus, in accordance with the present invention, it has been demonstrated that regions as small as 10 residues of p56Lck and 15 residues of pp60Src retain their respective targeting functions when fused to fluorescent proteins. As shown in FIG. 1A, the p56Lck sequence of MGCVCSSNPE was used successfully to target GFP to GEM domains. The sequence MGSSKSKPKDPSQRR of pp60Src was used successfully to target GFP to non-GEM regions. It is believed that the carboxy-terminal five residues of each of these peptides may be removed while retaining their targeting function.
  • B. Fluorescent Proteins
  • The present invention contemplates fusion proteins comprising regions of proteins linked to fluorescent proteins such as green fluorescent proteins (GFP), (Chalfie et al. 1994; Prasher, 1995; WO 95/07463), cyan fluorescent proteins (CFP) (Heim and Tsien 1996), Accession # AB041904, and yellow fluorescent proteins (YFP) (Miyawaki et al., 1997). These fluorescent proteins may be used in combination to perform double-labeling studies by co-expressing the two colors together, as well as energy transfer measurements. Energy transfer is particularly useful for measuring distance between molecules in the 50-75 Angstrom range.
  • Several variants of GFP proteins have since been isolated, for example, the naturally-occurring blue fluorescent variant of GFP (Heim et al. 1994) and several other mutational variants, described in U.S. Pat. No. 6,172,188, incorporated herein by reference which allows the use of fluorescent probes having different excitation and emission spectra permits simultaneous monitoring of more than one process. GFP proteins provide non-invasive assays which allow detection of cellular events in intact, living cells. Other fluorescent or luminescent (e.g., proteins also could be employed).
  • C. Linkers/Coupling Agents
  • The fusion proteins of the present invention are comprised of a membrane-targeting signal (a region of p56Lck or pp60cSrc) and a fluorescent protein joined via a linker, such as an amino acid sequence. An exemplary form of a peptide linker is a four-residue poly-glutamine insert. U.S. Pat. No. 5,856,456 provides peptide linkers for use in connecting polypeptide constituents to make fusion proteins. The linker is up to about 50 amino acids in length, contains at least one occurrence of a charged amino acid (preferably arginine or lysine) followed by a proline, and is characterized by greater stability and reduced aggregation. U.S. Pat. No. 5,880,270 discloses aminooxy-containing linkers useful in a variety of immunodiagnostic and separative techniques.
  • Additionally, any other linking/coupling agents known to those of skill in the art can be used according to the present invention, such as, for example, avidin-biotin linkages, amide linkages, ester linkages, thioester linkages, ether linkages, thioether linkages, phosphoester linkages, phosphoramide linkages, anhydride linkages, disulfide linkages, ionic and hydrophobic interactions, bispecific antibodies and antibody fragments, or combinations thereof.
  • Cross-linking reagents are used to form molecular bridges that tie together functional groups of two different molecules. To link two different compounds in a step-wise manner, hetero-bifunctional cross-linkers can be used that eliminate unwanted homopolymer formation. Table 1 lists such agents.
    TABLE 1
    HETERO-BIFUNCTIONAL CROSS-LINKERS
    Spacer Arm
    Length\after cross-
    linker Reactive Toward Advantages and Applications linking
    SMPT Primary amines Greater stability 11.2 A
    Sulfhydryls
    SPDP Primary amines Thiolation  6.8 A
    Sulfhydryls Cleavable cross-linking
    LC-SPDP Primary amines Extended spacer arm 15.6 A
    Sulfhydryls
    Sulfo-LC-SPDP Primary amines Extended spacer arm 15.6 A
    Sulfhydryls Water-soluble
    SMCC Primary amines Stable maleimide reactive group 11.6 A
    Sulfhydryls Enzyme-antibody conjugation
    Hapten-carrier protein conjugation
    Sulfo-SMCC Primary amines Stable maleimide reactive group 11.6 A
    Sulfhydryls Water-soluble
    Enzyme-antibody conjugation
    MBS Primary amines Enzyme-antibody conjugation  9.9 A
    Sulfhydryls Hapten-carrier protein conjugation
    Sulfo-MBS Primary amines Water-soluble  9.9 A
    Sulfhydryls
    SIAB Primary amines Enzyme-antibody conjugation 10.6 A
    Sulfhydryls
    Sulfo-SIAB Primary amines Water-soluble 10.6 A
    Sulfhydryls
    SMPB Primary amines Extended spacer arm 14.5 A
    Sulfhydryls Enzyme-antibody conjugation
    Sulfo-SMPB Primary amines Extended spacer arm 14.5 A
    Sulfhydryls Water-soluble
    EDC/Sulfo-NHS Primary amines Hapten-Carrier conjugation 0
    Carboxyl groups
    ABH Carbohydrates Reacts with sugar groups 11.9 A
    Nonselective
  • An exemplary hetero-bifunctional cross-linker contains two reactive groups: one reacting with primary amine group (e.g., N-hydroxy succinimide) and the other reacting with a thiol group (e.g., pyridyl disulfide, maleimides, halogens, etc.). Through the primary amine reactive group, the cross-linker may react with the lysine residue(s) of one protein (e.g., the selected antibody or fragment) and through the thiol reactive group, the cross-linker, already tied up to the first protein, reacts with the cysteine residue (free sulfhydryl group) of the other protein (e.g., the selective agent).
  • Another cross-linking reagent is SMPT, which is a bifunctional cross-linker containing a disulfide bond that is “sterically hindered” by an adjacent benzene ring and methyl groups. It is believed that steric hindrance of the disulfide bond serves a function of protecting the bond from attack by thiolate anions such as glutathione which can be present in tissues and blood, and thereby help in preventing decoupling of the conjugate prior to the delivery of the attached agent to the target site.
  • The SMPT cross-linking reagent, as with many other known cross-linking reagents, lends the ability to cross-link functional groups such as the SH of cysteine or primary amines (e.g., the epsilon amino group of lysine). Another possible type of cross-linker includes the hetero-bifunctional photoreactive phenylazides containing a cleavable disulfide bond such as sulfosuccinimidyl-2-(p-azido salicylamido) ethyl-1,3′-dithiopropionate. The N-hydroxy-succinimidyl group reacts with primary amino groups and the phenylazide (upon photolysis) reacts non-selectively with any amino acid residue.
  • In addition to hindered cross-linkers, non-hindered linkers also can be employed in accordance herewith. Other useful cross-linkers, not considered to contain or generate a protected disulfide, include SATA, SPDP and 2-iminothiolane (Wawrzynczak & Thorpe, 1987). The use of such cross-linkers is well understood in the art.
  • U.S. Pat. No. 4,680,338, describes bifunctional linkers useful for producing conjugates of ligands with amine-containing polymers and/or proteins, especially for forming antibody conjugates with chelators, drugs, enzymes, detectable labels and the like. U.S. Pat. Nos. 5,141,648 and 5,563,250 disclose cleavable conjugates containing a labile bond that is cleavable under a variety of mild conditions. This linker is particularly useful in that the agent of interest may be bonded directly to the linker, with cleavage resulting in release of the active agent.
  • III. NUCLEIC ACID COMPOSITIONS
  • A. General
  • Certain embodiments of the present invention concern polynucleotides that encode fusion proteins. The term “nucleic acid” is well known in the art. A “nucleic acid” as used herein will generally refer to a molecule (i.e., a strand) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine “A,” a guanine “G,” a thymine “T” or a cytosine “C”) or RNA (e.g., an A, a G, an uracil “U” or a C). The term “nucleic acid” encompass the terms “oligonucleotide” and “polynucleotide,” each as a subgenus of the term “nucleic acid.” The term “oligonucleotide” refers to a molecule of between about 3 and about 100 nucleobases in length. The term “polynucleotide” refers to at least one molecule of greater than about 100 nucleobases in length.
  • These definitions generally refer to a single-stranded molecule, but in specific embodiments will also encompass an additional strand that is partially, substantially or fully complementary to the single-stranded molecule. Thus, a nucleic acid may encompass a double-stranded molecule or a triple-stranded molecule that comprises one or more complementary strand(s) or “complement(s)” of a particular sequence comprising a molecule. As used herein, a single stranded nucleic acid may be denoted by the prefix “ss,” a double stranded nucleic acid by the prefix “ds,” and a triple stranded nucleic acid by the prefix “ts.”
  • B. Preparation of Nucleic Acids
  • A nucleic acid may be made by any technique known to one of ordinary skill in the art, such as for example, chemical synthesis, enzymatic production or biological production. Non-limiting examples of a synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266 032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986, incorporated herein by reference. In the methods of the present invention, one or more oligonucleotide may be used. Various different mechanisms of oligonucleotide synthesis have been disclosed in for example, U.S. Pat. Nos. 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244, each of which is incorporated herein by reference.
  • A non-limiting example of an enzymatically produced nucleic acid includes one produced by enzymes in amplification reactions such as PCR™ (see for example, U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195, each incorporated herein by reference), or the synthesis of an oligonucleotide described in U.S. Pat. No. 5,645,897, incorporated herein by reference. A non-limiting example of a biologically produced nucleic acid includes a recombinant nucleic acid produced (i.e., replicated) in a living cell, such as a recombinant DNA vector replicated in bacteria (see for example, Sambrook et al. 1989, incorporated herein by reference).
  • C. Purification of Nucleic Acids
  • A nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al., 1989, incorporated herein by reference).
  • In certain aspect, the present invention concerns a nucleic acid that is an isolated nucleic acid. As used herein, the term “isolated nucleic acid” refers to a nucleic acid molecule (e.g., an RNA or DNA molecule) that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells. In certain embodiments, “isolated nucleic acid” refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components or in vitro reaction components such as for example, macromolecules such as lipids or proteins, small biological molecules, and the like.
  • D. Regulatory Components and Expression Constructs
  • The nucleic acid(s) of the present invention, regardless of the length of the sequence itself, may be combined with other nucleic acid sequences, including but not limited to, promoters, enhancers, polyadenylation signals, restriction enzyme sites, multiple cloning sites, coding segments, and the like, to create one or more nucleic acid construct(s). As used herein, a “nucleic acid construct” is a nucleic acid engineered or altered by the hand of man, and generally comprises one or more nucleic acid sequences organized by the hand of man.
  • In particular embodiments, the invention concerns one or more recombinant vector(s) comprising nucleic acid sequences that encodes a fusion protein comprised of a membrane targeting sequence of p56Lckor pp60cSrc, a polypeptide encoding fluorescent proteins, and a linker inserted between, and covalently bound to, the membrane targeting sequence of fluorescent proteins. In particular aspects, the recombinant vectors are DNA vectors.
  • The term “functionally equivalent codon” is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine and serine, and also refers to codons that encode biologically equivalent amino acids. Codons are shown in Table 2 in preference of human use from left to right. Thus, the most preferred codon for alanine is thus “GCC”, and the least is “GCG” (see Table 2, below).
    TABLE 2
    Preferred Human DNA Codons
    Amino Acids Codons
    Alanine Ala A GCC GCT GCA GCG
    Cysteine Cys C TGC TGT
    Aspartic acid Asp D GAC GAT
    Glutamic acid Glu E GAG GAA
    Phenylalanine Phe F TTC TTT
    Glycine Gly G GGC GGG GGA GGT
    Histidine His H CAC CAT
    Isoleucine Ile I ATC ATT ATA
    Lysine Lys K AAG AAA
    Leucine Leu L CTG CTC TTG CTT CTA TTA
    Methionine Met M ATG
    Asparagine Asn N AAC AAT
    Proline Pro P CCC CCT CCA CCG
    Glutamine Gln Q CAG CAA
    Arginine Arg R CGC AGG CGG AGA CGA CGT
    Serine Ser S AGC TCC TCT AGT TCA TCG
    Threonine Thr T ACC ACA ACT ACG
    Valine Val V GTG GTC GTT GTA
    Tryptophan Trp W TGG
    Tyrosine Tyr Y TAC TAT
  • It will also be understood that amino acid sequences or nucleic acid sequences may include additional residues, such as additional N— or C-terminal amino acids or 5′ or 3′ sequences, or various combinations thereof, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein, polypeptide or peptide activity where expression of a proteinaceous composition is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5′ and/or 3′ portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.
  • It will also be understood that this invention is not limited to the particular nucleic acid or amino acid sequences of the fusion proteins. Recombinant vectors and isolated nucleic acid segments may therefore variously include these coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, and they may encode larger polypeptides or peptides that nevertheless include such coding regions or may encode biologically functional equivalent proteins, polypeptide or peptides that have variant amino acids sequences.
  • The nucleic acids of the present invention encompass biologically functional equivalent fusion proteins or polypeptides. Such sequences may arise as a consequence of codon redundancy or functional equivalency that are known to occur naturally within nucleic acid sequences or the proteins, polypeptides or peptides thus encoded. Alternatively, functionally equivalent proteins, polypeptides or peptides may be created via the application of recombinant DNA technology, in which changes in the protein, polypeptide or peptide structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced, for example, through the application of site-directed mutagenesis techniques as discussed herein below, e.g., to introduce improvements or alterations to the antigenicity of the protein, polypeptide or peptide, or to test mutants in order to examine the activity of the fusion protein at the molecular level.
  • IV. NUCLEIC ACID-BASED EXPRESSION SYSTEMS
  • A. Vectors
  • The term “vector” is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be “exogenous,” which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques (see, for example, Maniatis et al., 1988 and Ausubel et al., 1994, both incorporated herein by reference). In the present invention, a preferred expression vector is pWay20 (Lo and Hughes, 1998).
  • The term “expression vector” refers to any type of genetic construct comprising a nucleic acid coding for a RNA capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of “control sequences,” which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.
  • 1. Promoters and Enhancers
  • A “promoter” is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors, to initiate the specific transcription a nucleic acid sequence. The phrases “operatively positioned,” “operatively linked,” “under control,” and “under transcriptional control” mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence.
  • A promoter generally comprises a sequence that functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters lacking a TATA box, such as, for example, the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation. Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well. To bring a coding sequence “under the control of” a promoter, one positions the 5 end of the transcription initiation site of the transcriptional reading frame “downstream” of (i.e., 3 of) the chosen promoter. The “upstream” promoter stimulates transcription of the DNA and promotes expression of the encoded RNA.
  • The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription. A promoter may or may not be used in conjunction with an “enhancer,” which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.
  • A promoter may be one naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5 non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as “endogenous.” Similarly, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus, or prokaryotic or eukaryotic cell, and promoters or enhancers not “naturally occurring,” i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression. For example, in a preferred embodiment of the present invention, the promoter is a cytomegalovirus (CMV) promoter. Promoters that are most commonly used in recombinant DNA construction include the -lactamase (penicillinase), lactose and tryptophan (trp) promoter systems. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (see U.S. Pat. Nos. 4,683,202 and 5,928,906, each incorporated herein by reference). Furthermore, it is contemplated the control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
  • Naturally, it will be important to employ a promoter and/or enhancer that effectively directs the expression of the DNA segment in the organelle, cell type, tissue, organ, or organism chosen for expression. Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, (see, for example Sambrook et al. 1989, incorporated herein by reference). The promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides. The promoter may be heterologous or endogenous.
  • 2. Initiation Signals and Internal Ribosome Binding Sites
  • A specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be “in-frame” with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements.
  • 3. Multiple Cloning Sites
  • Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector (see, for example, Carbonelli et al., 1999, Levenson et al., 1998, and Cocea, 1997, incorporated herein by reference.) “Restriction enzyme digestion” refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art. Frequently, a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector. “Ligation” refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology.
  • 4. Splice Sites
  • Most transcribed eukaryotic RNA molecules will undergo RNA splicing to remove introns from the primary transcripts. Vectors containing genomic eukaryotic sequences may require donor and/or acceptor splicing sites to ensure proper processing of the transcript for protein expression (see, for example, Chandler et al., 1997, herein incorporated by reference.)
  • 5. Termination Signals
  • The vectors or constructs of the present invention will generally comprise at least one termination signal. A “termination signal” or “terminator” is comprised of the DNA sequences involved in specific termination of an RNA transcript by an RNA polymerase. Thus, in certain embodiments a termination signal that ends the production of an RNA transcript is contemplated. A terminator may be necessary in vivo to achieve desirable message levels.
  • In eukaryotic systems, the terminator region may also comprise specific DNA sequences that permit site-specific cleavage of the new transcript so as to expose a polyadenylation site. This signals a specialized endogenous polymerase to add a stretch of about 200 A residues (polyA) to the 3′ end of the transcript. RNA molecules modified with this polyA tail appear to more stable and are translated more efficiently. Thus, in other embodiments involving eukaryotes, it is preferred that that terminator comprises a signal for the cleavage of the RNA, and it is more preferred that the terminator signal promotes polyadenylation of the message; The terminator and/or polyadenylation site elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
  • Terminators contemplated for use in the invention include any known terminator of transcription described herein or known to one of ordinary skill in the art, including but not limited to, for example, the termination sequences of genes, such as for example the bovine growth hormone terminator or viral termination sequences, such as for example the SV40 terminator. In certain embodiments, the termination signal may be a lack of transcribable or translatable sequence, such as due to a sequence truncation.
  • 6. Polyadenylation Signals
  • In expression, particularly eukaryotic expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed. Preferred embodiments include the SV40 polyadenylation signal or the bovine growth hormone polyadenylation signal, convenient and known to function well in various target cells. Polyadenylation may increase the stability of the transcript or may facilitate cytoplasmic transport.
  • 7. Origins of Replication
  • In order to propagate a vector in a host cell, it may contain one or more origins of replication sites (often termed “ori”), which is a specific nucleic acid sequence at which replication is initiated. Alternatively an autonomously replicating sequence (ARS) can be employed if the host cell is yeast.
  • 8. Selectable and Screenable Markers
  • In certain embodiments of the invention, cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the expression vector. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector. Generally, a selectable marker is one that confers a property that allows for selection. A positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection. An example of a positive selectable marker is a drug resistance marker.
  • Usually the inclusion of a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. In addition to markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions, other types of markers including screenable markers such as fluorescent proteins, whose basis is colorimetric analysis, are also contemplated. Alternatively, screenable enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized. One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable and screenable markers are well known to one of skill in the art.
  • Vector Delivery and Cell Transformation
  • Suitable methods for nucleic acid delivery for use with the current invention are believed to include virtually any method by which a nucleic acid (e.g., DNA) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by ex vivo transfection (Wilson et al., 1989), by injection (U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harlan and Weintraub, 1985; U.S. Pat. No. 5,789,215, incorporated herein by reference); by electroporation (U.S. Pat. No. 5,384,253, incorporated herein by reference; Tur-Kaspa et al, 1986; Potter et al., 1984); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE-dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al., 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991) and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Pat. Nos. 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (U.S. Pat. Nos. 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616 and 5,563,055, each incorporated herein by reference); by PEG-mediated transformation of protoplasts (U.S. Pat. Nos. 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition-mediated DNA uptake (Potrykus et al., 1985), and any combination of such methods. Through the application of techniques such as these, organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
  • V. LOCALIZATION OF FUSION PROTEINS: FLUORESENCE IMAGING TECHNIQUES
  • Fluorescence imaging techniques will be used in the present invention to study the location and localization of fusion proteins targeted to GEM and non-GEM regions of cell plasma membranes. In one embodiment, confocal microscopy will be used to study the distribution of these fusion proteins on the plasma membrane surface of intact cells. In another embodiment, confocal microscopy will be used to study the distribution of fusion proteins on plamsa membranes to study the effect of a candidate substance that has been previously admixed with the cell.
  • Other fluorescence imaging techniques are available. By way of example, fluorescent activated cell sorting, flow cytometry, or flow microfluorometry provides the means of scanning individual cells for the presence of labeled fusion proteins. The method employs instrumentation that is capable of activating, and detecting the excitation emissions of labeled cells in a liquid medium.
  • FACS is unique in its ability to provide a rapid, reliable, quantitative, and multiparameter analysis on either living or fixed cells. The fusion proteins of the present invention provide a useful tool for the analysis and quantitation of GEM and non-GEM domains of individual cells. Cells would generally be obtained by biopsy, single cell suspension in blood or culture.
  • Flow cytometry involves the separation of cells or other particles in a liquid sample. Generally, the purpose of flow cytometry is to analyze the separated particles for one or more characteristics thereof. The basis steps of flow cytometry involve the direction of a fluid sample through an apparatus such that a liquid stream passes through a sensing region. The particles should pass one at a time by the sensor and are categorized base on size, refraction, light scattering, opacity, roughness, shape, fluorescence, etc.
  • Rapid quantitative analysis of cells proves useful in biomedical research and medicine. Apparati permit quantitative multiparameter analysis of cellular properties at rates of several thousand cells per second. These instruments provide the ability to differentiate among cell types. Data are often displayed in one-dimensional (histogram) or two-dimensional (contour plot, scatter plot) frequency distributions of measured variables. The partitioning of multiparameter data files involves consecutive use of the interactive one- or two-dimensional graphics programs.
  • Quantitative analysis of multiparameter flow cytometric data for rapid cell detection consists of two stages: cell class characterization and sample processing. In general, the process of cell class characterization partitions the cell feature into cells of interest and not of interest. Then, in sample processing, each cell is classified in one of the two categories according to the region in which it falls. Analysis of the class of cells is very important, as high detection performance may be expected only if an appropriate characteristic of the cells is obtained.
  • Not only is cell analysis performed by flow cytometry, but so too is sorting of cells. In U.S. Pat. No. 3,826,364, an apparatus is disclosed which physically separates particles, such as functionally different cell types. In this machine, a laser provides illumination which is focused on the stream of particles by a suitable lens or lens system so that there is highly localized scatter from the particles therein. In addition, high intensity source illumination is directed onto the stream of particles for the excitation of fluorescent particles in the stream. Certain particles in the stream may be selectively charged and then separated by deflecting them into designated receptacles. A classic form of this separation is via fluorescent tagged antibodies, which are used to mark one or more cell types for separation.
  • Other methods for flow cytometry can be found in U.S. Pat. Nos. 4,284,412; 4,989,977; 4,498,766; 5,478,722; 4,857,451; 4,774,189; 4,767,206; 4,714,682; 5,160,974; and 4,661,913.
  • In an advantageous embodiment, one may employ a second fluorescent agent that either quenches or is activated or quenched by the emission of the fluorescent fusion protein of the present invention. A particular form of this phenomenon is known as fluorescence energy transfer, or FET. FET occurs between a donor fluorophore and an acceptor dye (which may or may not be a fluorophore) when the absorption spectrum of one (the acceptor) overlaps the emission spectrum of the other (the donor) and the two dyes are in close proximity. Dyes with these properties are referred to as donor/acceptor dye pairs or energy transfer dye pairs. The excited-state energy of the donor fluorophore is transferred by a resonance dipole-induced dipole interaction to the neighboring acceptor. This results in quenching of donor fluorescence. In some cases, if the acceptor is also a fluorophore, the intensity of its fluorescence may be enhanced. The efficiency of energy transfer is highly dependent on the distance between the donor and acceptor, and equations predicting these relationships have been developed by Forster (1948). The distance between donor and acceptor dyes at which energy transfer efficiency is 50% is referred to as the Forster distance (RO). Other mechanisms of fluorescence quenching are also known including, for example, charge transfer and collisional quenching.
  • VI. ISOLATION OF PROTEINS
  • The present invention also provides for isolatoing and identification of proteins and polypeptides from cellular membranes. The term “purified proteins, polypeptides, or peptides” as used herein, is intended to refer to an proteinaceous composition, isolatable from mammalian cells or recombinant host cells, wherein the at least one protein, polypeptide, or peptide is purified to any degree relative to its naturally-obtainable state, i.e., relative to its purity within a cellular extract. A purified protein, polypeptide, or peptide therefore also refers to a wild-type or mutant protein, polypeptide, or peptide free from the environment in which it naturally occurs.
  • Generally, “purified” will refer to a specific protein, polypeptide, or peptide composition that has been subjected to fractionation to remove various other proteins, polypeptides, or peptides, and which composition substantially retains its activity, as may be assessed, for example, by the protein assays, as described herein below, or as would be known to one of ordinary skill in the art for the desired protein, polypeptide or peptide.
  • Various methods for quantifying the degree of purification of proteins, polypeptides, or peptides will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific protein activity of a fraction, or assessing the number of polypeptides within a fraction by gel electrophoresis.
  • To purify a desired protein, polypeptide; or peptide a natural or recombinant composition comprising at least some specific proteins, polypeptides, or peptides will be subjected to fractionation to remove various other components from the composition. In addition to those techniques described in detail herein below, various other techniques suitable for use in protein purification will be well known to those of skill in the art. These include, for example, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite, lectin affinity and other affinity chromatography steps; isoelectric focusing; gel electrophoresis; and combinations of such and other techniques.
  • Another example is the purification of a specific fusion protein using a specific binding partner. Such purification methods are routine in the art. As the present invention provides DNA sequences for the specific proteins, any fusion protein purification method can now be practiced. This is exemplified by the generation of an specific protein-glutathione S-transferase fusion protein, expression in E. coli, and isolation to homogeneity using affinity chromatography on glutathione-agarose or the generation of a polyhistidine tag on the N— or C-terminus of the protein, and subsequent purification using Ni-affinity chromatography. However, given many DNA and proteins are known, or may be identified and amplified using the methods described herein, any purification method can now be employed.
  • Although preferred for use in certain embodiments, there is no general requirement that the protein, polypeptide, or peptide always be provided in their most purified state. Indeed, it is contemplated that less substantially purified protein, polypeptide or peptide, which are nonetheless enriched in the desired protein compositions, relative to the natural state, will have utility in certain embodiments.
  • Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein. Inactive products also have utility in certain embodiments, such as, e.g., in determining antigenicity via antibody generation.
  • VII. EXAMPLES
  • The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
  • Example 1 Fusion Proteins Construction and Plasma Membrane Localization
  • Gene Construction. The separate GFP fusion proteins are outlined in FIG. 1A. Each was constructed using the GFP cloning and expression vector pWay20 (Lo et al., 1998). This vector contains a Sma1 site immediately upstream of and in-frame with enhanced GFP (eGFP, Clontech, Carlsbad, Calif.) and a stop codon at the 3′ end of eGFP. A CMV promoter drives gene transcription.
  • The GEM-targeted GFP molecule was constructed using the first 10 amino acids of p56Lck followed by an intermediate four-residue poly-glutamine insert, and finally eGFP itself(L10-GFP) (FIG. 1A). The polyglutamine insert was added to provide flexibility between the adjacent protein domains (Minor and Kim, 1994). The oligonucleotides used for encoding the N-terminal region of p56Lck and the poly-glutamine spacer were: ATGGGCTGTGTCTGCAGCTCAAACCCTGAAAACAAC-AACAAC (coding; SEQ ID NO:1) and GTTGTTGTTGTTTTCAGGGTTTGAGC-TGCAGACACAGCCCAT (noncoding SEQ ID NO:2). For construction of the gene, the oligonucleotides were annealed and subcloned into Sma1-cut pWay20.
  • The GFP-labeled marker for the non-GEM compartment consists of the first 15 amino acids of pp60c-Scr followed by a poly-glutamine spacer and eGFP (S15-GFP) (FIG. 1A). The oligonucleotides encoding the membrane-anchoring domain and poly-glutamine insert were: ATGGGGAGCAGCAAGAGCAAGCCCAAGGACCCCAGCCAGCGCCGGAACAACAACAA (coding; SEQ ID NO:3) and GTTGTTGTTGTTCCGGCGCTGGCTGGGGTCCTTGGGCTTGCTCTTGCTGCTCCC CAT (noncoding; SEQ ID NO:4).
  • Cell Lysis and Equilibrium Centrifugation. Cells were lysed with 1% Triton X-100 (TX-100) and the samples prepared as described previously (Rodgers and Rose, 1996). The GEM and TX-100-soluble (TXS) membrane fractions were separated by equilibrium centrifugation using a discontinuous sucrose gradient. The gradient consisted of 1.75 ml of a 30% sucrose solution overlaid with 0.75 ml of a 5% sucrose solution. Centrifugation was performed using a SW rotor. All sucrose solutions were in 10 mM Tris-HCl (pH 7.5), 150 mM NaCl, and 5 mM EDTA (TNE). The samples were centrifuged for 16-18 hr at 200000×g. Following centrifugation, the gradients were harvested by fractionating from the top. Each gradient fraction was separated by SDS-PAGE, and L10- and S15-GFP were detected by immunoblotting using monoclonal antibody specific to GFP (Covance Research Products, Inc., Richmond, Calif.).
  • Cell Stimulation. Polystyrene beads coated with OKT3 monoclonal antibody specific to CD3 were prepared as described (Lowin-Kropf et al., 1998) Cells were stimulated by incubating 106 cells with 5×105 beads for 15 min at 30° C. Following incubation, the cell-bead mixture was seeded onto poly-L-lysine coated coverslips by incubating at room temperature for 5 min. The cells were fixed using 2% paraformaldehyde for 30 min at room temperature. To measure capping of F-actin, the cells were labeled with Texas Red-conjugated phalloidin as described (Rodgers and Zavzavadjian, 2001).
  • Measurement of Association with GEM Domains. To measure association of either L10, or S15-GFP with GEM domains, membrane fractionation experiments were performed using Jurkat cells expressing either construct. In this experiment, the GEM and non-GEM compartments were separated by sucrose gradient equilibrium centrifugation. For this, the cells are first lysed with TX-100, during which the GEM domains form membrane sheets and vesicles. The GEM fraction in the cell lysate is then separated from the detergent-soluble non-GEM fraction by equilibrium centrifugation (Brown and Rose, 1992). FIG. 1B shows that L10-GFP is present in the GEM fraction represented by gradient fractions 1 through 4. Conversely, S15-GFP occurs only in the TX-100-soluble fraction of the membrane represented by gradient fractions 6 through 10. Quantitation showed that approximately 55% of the total L10-GFP is present in the GEM fraction, and this is similar to that of wild-type p56Lck in Jurkat cells (Rodgers and Rose, 1996). Altogether, FIG. 1B shows that the GEM- and non-GEM targeting signals efficiently target GFP to the respective membrane compartments as measured by sucrose gradient equilibrium centrifugation of TX-100 lysates.
  • Jurkat cells expressing either L10- or S15-GFP are shown in FIG. 2A. Importantly, the images show that L10- and S15-GFP are membrane associated, with the majority of the signal occurring in the plasma membrane. In many cells, L10-GFP and S15-GFP were also enriched in intracellular structures that probably represent early endosomes (Ley et al., 1994). An example of this is indicated by the arrow in the image of the cell expressing S15-GFP.
  • Example 2 T Cell Stimulation and Targeting of GEM Domains by Fusion Proteins
  • Stimulation of T cells by antibody-mediated crosslinking of the T cell receptor (TcR) results in patching of GEM domains at the site of TcR crosslinking (Janes et al., 1999). Importantly, FIGS. 2A-B shows L10-GFP is selectively enriched in membrane caps that form as a result of crosslinking of the TcR by OKT3-coated bead. For example, each cell shown in FIG. 2A has bound an OKT3-coated bead, and the asterisk indicates this. In the cell expressing L10-GFP, the fluorescence is enriched in the region of the plasma membrane contacting the bead. Conversely, S15-GFP is not enriched in a membrane cap. Actin staining using phalloidin confirmed that a membrane cap was present at the bead contact site in the S15-GFP sample (data not shown). Furthermore, the amount of enrichment of the respective GFP constructs at the bead contact site was quantitated by measuring the fluorescence intensity of the plasma membrane around the perimeter of the cell. The fluorescence intensity profile for each experiment is shown in the bottom panels in FIG. 2A. The red lines indicate the region of the plasma membrane that contacts the antibody-coated bead. These results show there is approximately a 5-fold enrichment of L10-GFP at the bead contact site, but no significant enrichment of S15-GFP. Thus, L10-GFP is selectively targeted to GEM domains that occur in TcR caps in stimulated T cells.
  • Targeting of either L10-GFP or S15-GFP to membrane caps was measured in populations of cells stimulated with OKT3-coated beads. Histograms showing the distribution of protein enrichment values in membrane caps are shown in FIG. 2B. In the L10-GFP sample, approximately one-third of the cells exhibited a 2.0-fold or greater enrichment of the GFP in the membrane caps. Conversely, essentially none of the cells expressing S15-GFP exhibited significant enrichment of fluorescence in membrane caps. Thus, the histograms in FIG. 2B correlated with FIG. 2A showing selective targeting of GFP to membrane caps by the L10 sequence. Based on the data in FIGS. 1A-B and FIGS. 2A-B, it is concluded that L10-GFP is efficiently targeted to GEM domains, and that S15-GFP is excluded from this membrane compartment.
  • All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
  • REFERENCES
  • The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
    • U.S. Pat. No. 3,826,364
    • U.S. Pat. No. 4,284,412
    • U.S. Pat. No. 4,498,766
    • U.S. Pat. No. 4,659,774
    • U.S. Pat. No. 4,661,913
    • U.S. Pat. No. 4,680,338
    • U.S. Pat. No. 4,682,195
    • U.S. Pat. No. 4,683,202
    • U.S. Pat. No. 4,684,611
    • U.S. Pat. No. 4,714,682
    • U.S. Pat. No. 4,767,206
    • U.S. Pat. No. 4,774,189
    • U.S. Pat. No. 4,816,571
    • U.S. Pat. No. 4,857,451
    • U.S. Pat. No. 4,952,500
    • U.S. Pat. No. 4,959,463
    • U.S. Pat. No. 4,989,977
    • U.S. Pat. No. 5,141,648
    • U.S. Pat. No. 5,141,813
    • U.S. Pat. No. 5,160,974
    • U.S. Pat. No. 5,264,566
    • U.S. Pat. No. 5,302,523
    • U.S. Pat. No. 5,322,783
    • U.S. Pat. No. 5,384,253
    • U.S. Pat. No. 5,428,148
    • U.S. Pat. No. 5,464,765
    • U.S. Pat. No. 5,478,722
    • U.S. Pat. No. 5,538,877
    • U.S. Pat. No. 5,538,880
    • U.S. Pat. No. 5,550,318
    • U.S. Pat. No. 5,554,744
    • U.S. Pat. No. 5,563,055
    • U.S. Pat. No. 5,563,250
    • U.S. Pat. No. 5,574,146
    • U.S. Pat. No. 5,580,859
    • U.S. Pat. No. 5,589,466
    • U.S. Pat. No. 5,591,616
    • U.S. Pat. No. 5,602,244
    • U.S. Pat. No. 5,610,042
    • U.S. Pat. No. 5,645,897
    • U.S. Pat. No. 5,656,610
    • U.S. Pat. No. 5,702,932
    • U.S. Pat. No. 5,736,524
    • U.S. Pat. No. 5,780,448
    • U.S. Pat. No. 5,789,215
    • U.S. Pat. No. 5,856,456
    • U.S. Pat. No. 5,880,270
    • U.S. Pat. No. 5,928,906
    • U.S. Pat. No. 5,945,100
    • U.S. Pat. No. 5,981,274
    • U.S. Pat. No. 5,994,624
    • U.S. Pat. No. 6,172,188
    • Ausubel, Brent, Kingston, Moore, Seidman, Smith, Struhl, In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, New York, 1994.
    • Brown and Rose, Cell, 68:533-544, 1992.
    • Carbonelli, Corley, Seigelchifer, Zorzopulos, FEMS Microbiol Lett, 177(1):75-82, 1999.
    • Chandler, Mayeda, Yeakley, Krainer, Fu, Proc Natl Acad Sci USA, 94(8):3596-601, 1997.
    • Chen and Okayama, Mol. Cell Biol., 7(8):2745-2752, 1987.
    • Cocea, Biotechniques, 23(5):814-816, 1997.
    • EP 266 032
    • Fechheimer, Boylan, Parker, Sisken, Patel, Zimmer, Proc. Nat'l Acad. Sci. USA, 84:8463-8467, 1987.
    • Forster, 1948. Ann. Phys. 2, 55-75, 1948.
    • Fraley et al., Proc. Nat'l Acad. Sci. USA, 76:3348-3352, 1979.
    • Gopal, Mol. Cell Biol., 5:1188-1190, 1985.
    • Graham and van der Eb, Virology, 52:456-467, 1973.
    • Harland and Weintraub, J. Cell Biol., 101:1094-1099, 1985.
    • Heim and Tsien, “Engineering green fluorescent protein for improved brightness, longer wavelengths and fluorescence resonance energy transfer” Current Biology 1996, 6:178-182.
    • Janes, Ley, Magee, J. Cell Biol., 147:447-61, 1999.
    • Kabouridis, Magee, Ley, Embo. J., 16:4983-98, 1997.
    • Kaneda et al., Science, 243:375-378, 1989.
    • Karnitz, Sutor, Torigoe, Reed, Bell, McKean, Leibson, Abraham, Mol. Cell Biol., 12:4521-30, 1992.
    • Kato et al., J. Biol. Chem., 266:3361-3364, 1991.
    • Kwong and Lublin, Biochem. Biophys. Res. Commun., 207:868-76, 1995.
    • Levenson, Transue, Roninson, Hum Gene Ther, 9(8):1233-6, 1998.
    • Ley, Marsh, Bebbington, Proudfoot, Jordan, J. Cell Biol., 125:639-49, 1994.
    • Lo, Rodgers, Hughes, Biotechniques, 25:94-96, 1998.
    • Lowin-Kropf, Shapiro, Weiss, J. Cell Biol., 140:861-71, 1998.
    • Minor and Kim, Nature, 367:660-3, 1994.
    • Miyawaki, Llopis, Heim, McCaffery, Adams, Ikura, and Tsien, “Fluorescent indicators for Ca2+based on green fluorescent proteins and calmodulin” Nature vol. 388, pp. 882-887, 1997
    • Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982.
    • Nicolau et al., Methods Enzymol., 149:157-176, 1987.
    • Potrykus, Paszkowski, Saul, Petruska, Shillito, Mol Gen Gene.t, 199(2):169-77, 1985.
    • Potter et. al., Proc. Nat'l Acad. Sci. USA, 81:7161-7165, 1984.
    • Resh, Cell 76:411-3, 1994.
    • Rippe, Brenner and Leffert, Mol. Cell Biol., 10:689-695, 1990.
    • Rodgers and Rose, J. Cell Biol., 135:1515-23, 1996.
    • Rodgers, Crise, Rosek, Mol. Cell Biol., 14:5384-91, 1994.
    • Sambrook et al., “Molecular Cloning,” A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, New York, 13.7-13.9:1989.
    • Shenoy-Scaria, Dietzen, Kwong, Link, Lublin, J. Cell Biol., 126:353-63, 1994.
    • Shenoy-Scaria, Gauen, Kwong, Shaw, Lublin, Mol. Cell Biol., 13:6385-92, 1993.
    • Simons and Toomre, Nature Mol. Cell Biol. Rev. 1:31-39, 2000.
    • Straus and Weiss, Cell, 70:585-93, 1992.
    • Tur-Kaspa, Teicher, Levine, Skoultchi and Shafritz, Mol. Cell Biol., 6:716-718, 1986.
    • Wawrzynczak & Thorpe, 1987
    • Wilson et al., Science, 244:1344-1346, 1989.
    • WO 94/09699
    • WO 95/06128
    • WO 95/07463
    • Wong et al., Gene, 10:87-94, 1980.
    • Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987.
    • Wu and Wu, Biochemistry, 27:887-892, 1988.
    • Xavier, Brennan, Li, McCormack, Seed, Immunity, 8:723-32, 1998.
    • Yurchak and Sefton, Mol. Cell Biol., 15:6914-22, 1995.

Claims (13)

1-20. (canceled)
21. A polynucleotide that encodes a fusion protein comprising:
(a) a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60c-Src;
(b) a fluorescent protein; and
(c) a linker inserted between, and covalently bound to, said membrane targeting sequence and said fluorescent protein.
22. The polynucleotide of claim 21, wherein said targeting sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or20 amino acid residues in length.
23. The polynucleotide of claim 21, wherein said targeting sequence is the first 15 amino acid residues of pp60c-Scr.
24. The polynucleotide of claim 21, wherein said targeting sequence and said linker are encoded by the oligonucleotide
ATGGGGAGCAGCAAGAGCAAGCCCAAGGACCCCAGCCAGCGCCGGAACAA CAACAA.
25. The polynucleotide of claim 21, wherein said linker is a poly-glutamine peptide of about 4 amino acid residues in length.
26. The polynucleotide of claim 21, wherein the fluorescent protein is green fluorescent protein, yellow fluorescent protein or cyan fluorescent protein.
27-30. (canceled)
31. An expression vector comprising a polynucleotide comprising:
(a) a fusion protein coding region comprising:
(i) a peptide of 10 to about 20 consecutive amino acid residues comprising a membrane targeting sequence from pp60c-Src;
(ii) a fluorescent protein;
(iii) a linker inserted between, and covalently bound to, said membrane targeting sequence of said fluorescent protein; and
(b) a promoter operatively linked to said fusion protein coding region.
32. The expression vector of claim 31, wherein said expression vector is pWay20.
33. The expression vector of claim 31, wherein said promoter is a cytomegalovirus (CMV) promoter.
34. The expression vector of claim 31, wherein the fluorescent protein is green fluorescent protein, yellow fluorescent protein or cyan fluorescent protein.
35-70. (canceled)
US11/414,158 2001-07-09 2006-04-27 Targeted fusion proteins and methods for the characterization of cellular membrane domains Abandoned US20060281133A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/414,158 US20060281133A1 (en) 2001-07-09 2006-04-27 Targeted fusion proteins and methods for the characterization of cellular membrane domains

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US30403001P 2001-07-09 2001-07-09
US10/191,767 US6838263B2 (en) 2001-07-09 2002-07-09 Targeted fusion proteins and methods for the characterization of cellular membrane domains
US10/992,609 US20050255449A1 (en) 2001-07-09 2004-11-17 Targeted fusion proteins and methods for the characterization of cellular membrane domains
US11/414,158 US20060281133A1 (en) 2001-07-09 2006-04-27 Targeted fusion proteins and methods for the characterization of cellular membrane domains

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/992,609 Division US20050255449A1 (en) 2001-07-09 2004-11-17 Targeted fusion proteins and methods for the characterization of cellular membrane domains

Publications (1)

Publication Number Publication Date
US20060281133A1 true US20060281133A1 (en) 2006-12-14

Family

ID=23174730

Family Applications (3)

Application Number Title Priority Date Filing Date
US10/191,767 Expired - Fee Related US6838263B2 (en) 2001-07-09 2002-07-09 Targeted fusion proteins and methods for the characterization of cellular membrane domains
US10/992,609 Abandoned US20050255449A1 (en) 2001-07-09 2004-11-17 Targeted fusion proteins and methods for the characterization of cellular membrane domains
US11/414,158 Abandoned US20060281133A1 (en) 2001-07-09 2006-04-27 Targeted fusion proteins and methods for the characterization of cellular membrane domains

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US10/191,767 Expired - Fee Related US6838263B2 (en) 2001-07-09 2002-07-09 Targeted fusion proteins and methods for the characterization of cellular membrane domains
US10/992,609 Abandoned US20050255449A1 (en) 2001-07-09 2004-11-17 Targeted fusion proteins and methods for the characterization of cellular membrane domains

Country Status (3)

Country Link
US (3) US6838263B2 (en)
AU (1) AU2002354560A1 (en)
WO (1) WO2003006606A2 (en)

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6838263B2 (en) * 2001-07-09 2005-01-04 Oklahoma Medical Research Foundation Targeted fusion proteins and methods for the characterization of cellular membrane domains
US7404950B2 (en) * 2003-02-18 2008-07-29 Baylor College Of Medicine Induced activation in dendritic cell
EP2076272B1 (en) * 2006-10-19 2015-07-29 Baylor College Of Medicine Generating an immune response by inducing cd40 and pattern recognition receptors
CN101659705A (en) * 2008-08-27 2010-03-03 北京微生物流行病研究所 Fusion protein for imaging nucleus and chromosomes in living cell
DK2331680T3 (en) * 2008-09-22 2017-08-21 Baylor College Medicine Methods and Compositions for Generating an Immune Response by Induction of CD-40 as well as Pattern Recognition Receptor Adapters
WO2011146862A1 (en) 2010-05-21 2011-11-24 Bellicum Pharmaceuticals, Inc. Methods for inducing selective apoptosis
US9434935B2 (en) 2013-03-10 2016-09-06 Bellicum Pharmaceuticals, Inc. Modified caspase polypeptides and uses thereof
SG11201506974XA (en) 2013-03-14 2015-10-29 Bellicum Pharmaceuticals Inc Methods for controlling t cell proliferation
EP3569253A1 (en) 2013-06-05 2019-11-20 Bellicum Pharmaceuticals, Inc. Methods for inducing partial apoptosis using caspase polypeptides
CN111849912B (en) 2014-02-14 2024-03-15 贝里坤制药股份有限公司 Method for activating T cells using inducible chimeric polypeptides
AU2015312117A1 (en) 2014-09-02 2017-03-02 Bellicum Pharmaceuticals, Inc. Costimulation of chimeric antigen receptors by Myd88 and CD40 polypeptides
AU2015341481C1 (en) 2014-11-03 2021-09-16 ACADEMISCH ZIEKENHUIS LEIDEN (h.o.d.n. LUMC) T cell receptors directed against Bob1 and uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6342379B1 (en) * 1995-06-07 2002-01-29 The Regents Of The University Of California Detection of transmembrane potentials by optical methods
US20020076729A1 (en) * 1998-10-05 2002-06-20 Tobias Meyer Methods and apparatus for the high through-put detection of binding interactions in VIVO
US20030066095A1 (en) * 2000-06-01 2003-04-03 Valerie Baubet Chimeric GFP-aequorin as bioluminescent Ca++ reporters at the single cell level
US6838263B2 (en) * 2001-07-09 2005-01-04 Oklahoma Medical Research Foundation Targeted fusion proteins and methods for the characterization of cellular membrane domains

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6342379B1 (en) * 1995-06-07 2002-01-29 The Regents Of The University Of California Detection of transmembrane potentials by optical methods
US20020076729A1 (en) * 1998-10-05 2002-06-20 Tobias Meyer Methods and apparatus for the high through-put detection of binding interactions in VIVO
US20030066095A1 (en) * 2000-06-01 2003-04-03 Valerie Baubet Chimeric GFP-aequorin as bioluminescent Ca++ reporters at the single cell level
US6838263B2 (en) * 2001-07-09 2005-01-04 Oklahoma Medical Research Foundation Targeted fusion proteins and methods for the characterization of cellular membrane domains

Also Published As

Publication number Publication date
US20050255449A1 (en) 2005-11-17
WO2003006606A3 (en) 2003-11-13
US6838263B2 (en) 2005-01-04
US20030092132A1 (en) 2003-05-15
AU2002354560A1 (en) 2003-01-29
WO2003006606A2 (en) 2003-01-23

Similar Documents

Publication Publication Date Title
US20060281133A1 (en) Targeted fusion proteins and methods for the characterization of cellular membrane domains
Pan et al. CDK-regulated dimerization of M18BP1 on a Mis18 hexamer is necessary for CENP-A loading
Mahajan et al. Molecular characterization of the SUMO-1 modification of RanGAP1 and its role in nuclear envelope association
EP0711303B2 (en) Biotinylation of proteins
Rodgers Making membranes green: construction and characterization of GFP-fusion proteins targeted to discrete plasma membrane domains
ÜHLEIN et al. Functional implications of ribosomal protein L2 in protein biosynthesis as shown by in vivo replacement studies
US20070212707A1 (en) Cell cycle markers
JP4417549B2 (en) Positive-negative selection in homologous recombination
Blum et al. The luminal domain of p23 (Tmp21) plays a critical role in p23 cell surface trafficking
US20120142015A1 (en) Gfp fusion proteins and their use
CN109748970B (en) Alpha-ketoglutaric acid optical probe and preparation method and application thereof
US20060088901A1 (en) Methods and kits for determining ubiquitin protein ligase (E3) activity
US20210163899A1 (en) Fusion proteins for the detection of apoptosis
Moor et al. Cloning and expression of human phenylalanyl-tRNA synthetase in Escherichia coli: comparative study of purified recombinant enzymes
EP1541679B1 (en) Method of analyzing organelle-localized protein and materials for analysis
EP2154533A1 (en) Method for determining SUMOylation
US20220169682A1 (en) Split photoactive yellow protein complementation system and uses thereof
EP1171601B1 (en) Nucleic acids encoding a mutt domain-containing polypeptide
Hah et al. DNA-dependent protein kinase mediates V (D) J recombination via RAG2 phosphorylation
Elliott et al. Regulation of cytoskeletal association by a basic amino acid motif in polyoma virus middle T antigen
US20030039990A1 (en) Non-destructive cell-based assay
EP1637540A1 (en) Hyperactive Stat molecules and their use in assays employing gene activation
Kim et al. New fast BiFC plasmid assay system for in vivo protein-protein interactions
Glatzová The role of structural motifs in the localisation of T-cell plasma membrane proteins
US7258981B2 (en) Sensitive proteasome sensor constructs and methods for their design and use

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION