US20060160158A1 - Target and method for inhibition of bacterial rna polymerase - Google Patents

Target and method for inhibition of bacterial rna polymerase Download PDF

Info

Publication number
US20060160158A1
US20060160158A1 US10/526,323 US52632305A US2006160158A1 US 20060160158 A1 US20060160158 A1 US 20060160158A1 US 52632305 A US52632305 A US 52632305A US 2006160158 A1 US2006160158 A1 US 2006160158A1
Authority
US
United States
Prior art keywords
rnap
entity
derivative
mccj25
bacterial
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/526,323
Inventor
Richard Ebright
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US10/526,323 priority Critical patent/US20060160158A1/en
Publication of US20060160158A1 publication Critical patent/US20060160158A1/en
Priority to US12/257,801 priority patent/US8198021B2/en
Priority to US13/482,149 priority patent/US8575306B2/en
Assigned to NATIONAL INSTITUTES OF HEALTH - DIRECTOR DEITR reassignment NATIONAL INSTITUTES OF HEALTH - DIRECTOR DEITR CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: RUTGERS, THE STATE UNIV OF NJ
Abandoned legal-status Critical Current

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G01N33/532—Production of labelled immunochemicals
    • G01N33/533—Production of labelled immunochemicals with fluorescent label
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • New approaches to drug development are necessary to combat the ever-increasing number of antibiotic-resistant pathogens.
  • RNA is synthesized in cellular organisms by a complex molecular machine, known as RNA polymerase (“RNAP”).
  • RNAP RNA polymerase
  • RNAP comprises at least 4 subunits with a total molecular mass of around 400 kDa.
  • RNAP mediates the transcription of DNA to produce RNA.
  • Bacterial RNAP is a multimeric protein consisting of subunits ⁇ 2 , ⁇ , ⁇ ′, and ⁇ . An ⁇ factor is required for initiation of transcription by forming a holoenzyme complex.
  • Rifampicin binds to a site adjacent to the active center of bacterial RNAP, the exit channel, and physically prevents synthesis of products longer than ⁇ 4 nucleotides.
  • tuberculosis strains resistant to rifampicin (and rifampicin analogs) are becoming widespread, effectively removing rifampicin from the therapeutic arsenal.
  • novel antibiotics that target the same bacterial enzyme as rifampicin, RNAP, (and thus that have the same biochemical and therapeutic effects as rifampicin).
  • the models propose that nucleic acids completely fill the active-center cleft of RNAP, such that the only route by which incoming nucleoside triphosphate substrates (NTPs) can access the active center is through an approximately 25 ⁇ long, 10 ⁇ wide tunnel known as the “secondary channel” or “pore,” that bores through the floor of the active-center cleft of RNAP opposite the active-center cleft.
  • NTPs nucleoside triphosphate substrates
  • RNAP ⁇ ′ subunit a region within the secondary channel comprising two adjacent short peptide segments of the RNAP ⁇ ′ subunit are conserved in amino-acid sequence in bacterial species, including both Gram-positive bacteria and Gram-negative bacteria. Throughout the following specification, this region is referred to as the “ ⁇ ′ pocket” or the “target,” and the two short peptide segments are referred to as “homologous secondary channel amino acids or amino acid sequences.” Applicant has also discovered that this same region is not conserved, and in fact is radically different, in amino-acid sequence in eukaryotic RNAP, such as human RNAP I, RNAP II, and RNAP III.
  • a first aspect of the present invention is directed to a method for identifying agents that bind to a homologous RNAP secondary channel amino acid sequence, comprising preparing a reaction solution comprising the agent to be tested and an entity containing a homologous secondary channel amino acid sequence; and detecting presence or amount of binding.
  • detection or quantitation of binding is conducted relative to binding of the agent to an entity containing an altered homologous amino acid sequence.
  • quantitation of binding is compared to binding of the 21-amino acid (GGAGHVPEYFVGOGTPISFYG) bacteriocidal peptide microcin J25 (“MccJ25”), or a derivative thereof, to the entity via the homologous secondary channel amino acid sequence.
  • GGAGHVPEYFVGOGTPISFYG 21-amino acid
  • MccJ25 bacteriocidal peptide microcin J25
  • Another aspect of the present invention is directed to a method for identifying agents that inhibit an activity of RNAP via binding to a homologous secondary channel amino acid sequence.
  • This aspect entails preparing a reaction solution comprising the agent to be tested, a catalytic entity containing a homologous secondary channel amino acid sequence, and a substrate for the entity; and determining extent of inhibition of RNAP activity via binding of the agent to the homologous secondary channel amino acid sequence.
  • MccJ25 is active against Gram-negative bacteria (Delgado et al., (2001) J. Bacteriol. 183:4543-4550). It was recently discovered that RNAP is a target of MccJ25. (Delgado et al., (2001) J. Bacteriol. 183:4543-4550; Yuzenkova et al., (2002) J. Biol. Chem. 277:50867-50875). The present invention provides that analogs of MccJ25 inhibit transcription by requiring determinants within the ⁇ ′ pocket.
  • the invention also provides probe-labeled derivatives of MccJ25, which can be used for detailed analysis of MccJ25 and other ⁇ ′-pocket-directed inhibitors of RNAP.
  • probe-labeled derivatives of MccJ25 can be used in high-throughput screening, by assessing ability of compounds or compound mixtures to compete with a probe-labeled derivative of MccJ25 for binding to RNAP or an RNAP fragment containing the target.
  • the invention has broad applications in analysis of RNAP structure and function, control of bacterial gene expression, control of bacterial growth, antibacterial chemistry, antibacterial therapy, and drug discovery.
  • a further aspect of Applicants' invention is directed to an analog of MccJ25 having an amino acid sequence that differs from MccJ25 in terms of at least one amino acid deletion, insertion, or substitution, and that binds bacterial RNAP or inhibits bacterial RNAP catalytic activity to a greater extent than MccJ25.
  • the present invention also provides for the identification of potential antibacterial agents or antibiotics that, because of their binding affinity to regions within RNAP that are conserved among bacteria, have broad-spectrum activity. It also provides for the identification of potential anti-bacterial agents or antibiotics that, because of their substantial lack of binding affinity for eukaryotic RNAPs, will be relatively non-disruptive to normal cellular functions of the host.
  • compounds identified according to the target and method of this invention would have applications not only in antibacterial therapy, but also in: (a) identification of bacterial RNAP (diagnostics, environmental-monitoring, and sensors applications), (b) labeling of bacterial RNAP (diagnostics, environmental-monitoring, imaging, and sensors applications), (c) immobilization of bacterial RNAP (diagnostics, environmental-monitoring, and sensors applications), (d) purification of bacterial RNA polymerase (biotechnology applications), (e) regulation of bacterial gene expression (biotechnology applications), and (f) antisepsis (antiseptics, disinfectants, and advanced-materials applications).
  • FIG. 1 illustrates a sequence alignment for the target amino acid residues 736-747 and 779-781 of the ⁇ ′ subunit of RNAP from Escherichia coli; and corresponding residues of the ⁇ ′ subunits of Haemophilus influenzae, Vibrio cholerae, Pseudomonas aeruginose, Treponema pallidum, Borrelia burgdorferi, Xyella fastidiosa, Camploacter jejuni, Neisseria meningitides, Rickettsia prowazekii, Thermotoga maritime, Chlamydia trachomatis, Mycoplasma pneumoniae, Bacillus subtilis, Staphylococcus aureus, Mycobacterium tuberculosis, Synechocystis sp., Aquifex aeolicus, Deinococcus radiodurans, Thermus thermophilus, and Thermus aquaticus (collectively, “the homologous
  • FIG. 2 illustrates a model showing the location of the target within the structure of RNAP.
  • FIG. 3 illustrates that MccJ25 does not inhibit open-complex formation.
  • RP o RNAP-promoter open complex;
  • P free promoter DNA.
  • FIG. 4 illustrates that MccJ25 inhibits abortive initiation and elongation.
  • A Results of transcription experiments assessing effects of MccJ25 on abortive initiation and elongation.
  • B As (A), but with RNAP derivative bearing Thr931 ⁇ Ile substitution in RNAP ⁇ ′ subunit (see Delgado et al., 2001).
  • FIG. 5 illustrates that MccJ25 inhibits at the level of NTP uptake.
  • A Results of transcription experiments assessing NTP-concentration-dependence of effects of MccJ25 on abortive initiation and elongation.
  • FIG. 6 illustrates that MccJ25 binds within the RNAP secondary channel.
  • Schematic map of RNAP ⁇ ′ subunit showing locations of conserved regions (conserved regions A-H lettered and shaded; additional conserved regions lightly shaded) and locations of substitutions that confer MccJ25-resistance (substitution of Delgado et al., 2001 in black; substitutions from random mutagenesis as red bars; and substitutions from saturation mutagenesis in pink).
  • RNAP Three-dimensional structure of RNAP showing locations of substitutions that confer MccJ25-resistance [substitution of Delgado et al., 2001 in red in (B); substitutions from random mutagenesis in red in (C); and substitutions from random and saturation mutagenesis in red in (D)].
  • Each panel presents a stereodiagram. In each panel, the view is directly into the RNAP secondary channel—toward the active-center Mg ++ (white sphere at center).
  • Atomic coordinates are based on the crystallographic structure of Thermus thermophilus RNAP at 2.6 ⁇ resolution (Vassylyev et al., (2002) Nature 417, 712-719) PDB accession 1IW7; ⁇ subunit omitted for clarity).
  • Correspondences between residues of E. coli RNAP ⁇ ′ and T. thermophilus RNAP ⁇ ′ are based on a comprehensive sequence alignment of bacterial RNAP ⁇ ′ subunits, archaeal RNAP A subunits, and eukaryotic RNAP largest subunits (unpublished).
  • the present invention provides methods of designing specific inhibitors of bacterial RNAP, the enzyme responsible for transcription.
  • the present invention also provides for the design of small-molecule inhibitors (i.e., diameter ⁇ 20 ⁇ , MW ⁇ 2.1 kDa) that bind, with a k d ⁇ 1 ⁇ M, to a target site that is highly conserved in bacterial RNAP, but distinctly different in eukaryotic RNAP.
  • the invention provides targets and methods for specific binding and inhibition of RNAP from bacterial species.
  • the invention has applications in control of bacterial gene expression, control of bacterial growth, antibacterial chemistry, and antibacterial therapy.
  • NTPs nucleoside-triphosphate substrates
  • RNAP secondary channel mediates multiple biochemical activities important for function of RNAP, including: uptake of NTPs, release of pyrophosphate product, release of abortive-RNA and edited-RNA products, interaction with RNA product during transcriptional pausing, interaction with RNA product during transcriptional arrest, interaction with RNA product during editing, and interaction with the elongation factors GreA and GreB.
  • RNAP secondary channel inhibits at least one of these activities. Specifically, it has now been found, and is disclosed herein, that physically blocking the RNAP secondary channel with a small molecule prevents uptake of NTPs by RNAP and thus inhibits transcription.
  • the present invention is based in part on Applicant's discovery that a region within the RNAP secondary channel comprising amino acids 736-747 and 779-781 of the RNAP ⁇ ′ subunit from Escherichia coli (the “ ⁇ ′ pocket” or “target”) is a useful target for compounds that block transcription. It was found that said pocket is lined with residues that are invariant or nearly invariant in RNAP from bacterial species, but that are radically different in RNAP from eukaryotic species ( FIG. 1 ). It further was found that this region forms a ⁇ 5 ⁇ shallow pocket within the wall of the RNAP secondary channel ( FIG. 2 ).
  • RNAP nucleic acids completely fill the active channel of RNAP; and thus that the only route by which incoming nucleoside-triphosphate (NTP) substrates can access this active center is through this secondary channel.
  • NTP nucleoside-triphosphate
  • the present invention relates to molecules that bind to RNAP in the secondary channel of RNAP from Escherichia coli, or in corresponding regions of RNAP from other bacterial species and prevent RNAP from carrying out at least one biochemical activity with which the secondary channel is associated (e.g., uptake of NTP substrates, release of pyrophosphate product, release of edited nucleotide and oligonucleotide products, interaction with RNA product during transcriptional pausing, interaction with RNA product during transcriptional arrest, interaction with RNA product during editing, and interaction with the elongation factors GreA and GreB).
  • methods and compositions are described involving compounds that specifically block the secondary channel of RNAP resulting in inhibition of transcription.
  • the target referred to above in Escherichia coli is similar in amino acid sequence to that of most or all other species of bacterial RNAP and is called herein the homologous bacterial RNAP secondary channel ( FIG. 1 ).
  • amino acid residues 736-747 and 779-781 of the ⁇ subunit of RNAP from Escherichia coli exhibit high similarity to amino acid residues 740-751 and 783-785 of the ⁇ ′ subunit of RNAP from Bacillus subtilis ( FIG.
  • the target differs radically in amino acid sequence between bacterial RNAP and eukaryotic RNAP, including human RNAP I, RNAP II, and RNAP III ( FIG. 1 ).
  • RNAP I RNAP I, RNAP II, and RNAP III
  • FIG. 1 This allows for the identification of molecules that bind, in a target-dependent fashion, to bacterial RNAP, but that do not bind, or that bind substantially less well, to eukaryotic RNAP.
  • This also allows for the identification of molecules that inhibit, in a target-dependent fashion, an activity of to bacterial RNAP, but that do not inhibit, or that inhibit substantially less well, an activity of eukaryotic RNAP.
  • This differentiation is important, because it permits the identification of bacterial-RNAP-selective binding molecules and bacteria-selective inhibitors.
  • the invention provides, by way of example only, a target region corresponding to, and alignable with residues 736-747 and 779-781 of the ⁇ ′ subunit of RNAP from Escherichia coli ; as well as corresponding residues of the ⁇ ′ subunit of Bacillus subtilis, Haemophilus influenzae, Vibrio cholerae, Pseudomonas aeruginosa, Treponema pallidum, Borrelia burgdorferi, Xyella fastidlosa, Campylobacter jejuni, Neisseria meningitidis, Rickettsia prowazekii, Thermotoga maritima, Chlamydia trachomatis, Mycoplasma pneumoniae, Staphylococcus aureus, Mycobacterium tuberculosis, Synechocystis sp., Aquifex aeolicus, Deinococcus radiodurans, Thermus thermophil
  • the present invention further relates to a method for identifying molecules that bind to the ⁇ ′ pocket through the use of an assay for molecules that bind to RNAP in a ⁇ ′-pocket-specific fashion.
  • Escherichia coli RNAP or a fragment thereof containing the ⁇ ′ pocket is used as the test protein for binding, and a derivative of said RNAP or RNAP fragment having at least one a substitution, an insertion, or a deletion within the ⁇ ′ pocket is used as the control protein for target-site specificity of binding.
  • “Hits” can be analyzed for binding and inhibition of Gram-negative-bacterial RNAP, Gram-positive-bacterial RNAP, and eukaryotic RNAP I, RNAP III and RNAP III, in vivo and in vitro. “Hits” also can be characterized structurally by x-ray diffraction analysis of co-crystals with RNAP or an RNAP fragment containing the ⁇ ′ pocket.
  • the invention also provides strategies to identify small-molecule inhibitors from compound libraries.
  • two strategies are described as follows: (a) selection of molecules that bind to RNAP, or a fragment thereof, in a ⁇ ′-pocket-dependent fashion (affinity selection of phage-displayed linear and cyclic decapeptide libraries), and (b) screening for molecules that inhibit transcription in a ⁇ ′-pocket-dependent fashion (iterative deconvolution of solution-phase linear and cyclic D-hexapeptide libraries).
  • the invention provides the use of a wild-type bacterial RNAP, or fragment thereof, as the test protein for binding/inhibition, and a derivative of bacterial RNAP, or a fragment thereof, having at least one substitution, insertion, or deletion within the ⁇ ′ pocket as the control protein for ⁇ ′-pocket dependence of binding/inhibition.
  • the invention also provides for a method of identifying a compound for use as an inhibitor of bacterial RNAP comprising: analyzing a compound or a compound library, that involves docking to, modeling of, geometric calculations with, and/or energetic calculations with, a portion of the structure of an RNAP from a bacterial species comprising at least one residue within the set of residues corresponding to, and alignable with, the target.
  • the invention provides for at least three drug-discovery assay methods: a) screening based on binding of a compound within the secondary channel of a bacterial RNAP or fragment thereof; b) screening based on inhibition of an activity associated with the secondary channel of a bacterial RNAP or fragment thereof; and c) screening based on displacement of a compound, containing a detectable group, from the secondary channel of a bacterial RNAP or a fragment thereof.
  • One of the embodiments of the present invention is an assay system designed to identify compounds that bind a bacterial RNAP, or a fragment thereof, in a manner that requires the ⁇ ′ pocket.
  • the assay is designed to measure the binding of a compound to a determinant that includes at least one amino acid residue contained within a set of amino acid residues identifiable by sequence alignment and/or structure alignment as corresponding to amino acid residues 736-747 and 779-781 of Escherichia coli RNAP ⁇ or to amino acid residues 740-751 and 783-785 of Bacillius subtilis RNAP ⁇ ′.
  • One of the embodiments of the present invention is an assay system designed to identify compounds that inhibit an activity of a bacterial RNAP, or a fragment thereof, in a manner that requires the ⁇ ′ pocket.
  • the assay is designed to measure the inhibition of an activity, said inhibition involving the binding of a compound to a determinant that includes at least one amino acid residue contained within a set of amino acid residues identifiable by sequence alignment and/or structure alignment as corresponding to amino acid residues 736-747 and 779-781 of Escherichia coli RNAP ⁇ ′ or to amino acid residues 740-751 and 783-785 of Bacillius subtilis RNAP ⁇ ′.
  • Another embodiment of the present invention is an assay designed to measure the binding of a compound to a bacterial RNAP derivative, or a fragment thereof, containing at least one amino acid substitution, insertion, or deletion within a set of amino acid residues identifiable by sequence alignment and/or structure alignment as corresponding to amino acid residues 736-747 and 779-781 of Escherichia coli RNAP ⁇ ′ or to amino acid residues 740-751 and 783-785 of Bacillius subtilis RNAP ⁇ ′.
  • Another embodiment of the present invention is an assay designed to measure the inhibition of an activity of a bacterial RNAP derivative, or a fragment thereof, containing at least one amino acid substitution, insertion, or deletion within a set of amino acid residues identifiable by sequence alignment and/or structure alignment as corresponding to amino acid residues 736-747 and 779-781 of Escherichia coli RNAP ⁇ ′ or to amino acid residues 740-751 and 783-785 of Bacillius subtilis RNAP ⁇ ′.
  • the bacterial RNAP, or RNAP derivative can be isolated from bacteria, produced by recombinant methods, or produced through in vitro protein synthesis.
  • Various compounds can be introduced to determine whether a tested compound binds to, inhibits an activity of, or displaces a detectable-group containing molecule from, the bacterial RNAP or RNAP derivative in a ⁇ ′-pocket-dependent manner.
  • Tested compounds can include antibodies, peptides, and various chemical compounds. Additionally, with the known amino acid sequence for a particular RNAP, one of skill in the art could design specific inhibitors. The tested compounds can be chosen from chemical libraries, or a computer model can be used to choose compounds that are likely to be effective based on the known structure of the secondary channel, the ⁇ ′ pocket, and the structure of the compound.
  • the assay system can be performed in vivo or in vitro and thus does not necessarily require isolation of the RNAP.
  • the compounds can also be tested for competitive inhibition.
  • Preferred strategies for identifying inhibitors include: 1) through affinity selection of phage-displayed linear and cyclic decapeptide libraries and 2) through iterative deconvolution of solution-phase linear and cyclic D-hexapeptide libraries.
  • Wild type E. coli RNAP is the preferred test protein for binding and inhibition and [Val744;Gln746] ⁇ ′-RNAP (a derivative of E. coli RNAP having substitutions at two positions in the ⁇ ′ (738-747) pocket) as the control protein.
  • Deconvolution essentially entails the resynthesis of that combinatorial pool or mixture that was found to be active in screening against a target of interest. Resynthesis may result in the generation of a set of smaller pools or mixtures, or a set of individual compounds. Rescreening and iterative deconvolution are performed until the individual compounds that are responsible for the activity observed in the screens of the parent mixtures are isolated.
  • the library is a vast mixture of filamentous phage clones, each displaying one peptide sequence on the virion surface.
  • the survey is accomplished by using the binding protein to affinity-purify phage that display tight-binding peptides and propagating the purified phage in Escherichia coli.
  • the amino acid sequences of the peptides displayed on the phage are then determined by sequencing the corresponding coding region in the viral DNA's. Potential applications of the epitope library include investigation of the specificity of antibodies and discovery of mimetic drug candidates.
  • Fusion phage are filamentous bacteriophage vectors in which foreign antigenic determinants are cloned into phage gene III and displayed as part of the gene III protein (pIII) at one tip of the virion. Fusion phage whose displayed determinant binds an antibody (Ab) can be selected from a vast background of nonbinding phage by affinity purification (AP) as follows: First, phage are reacted with biotinylated Ab (bio-Ab), then diluted and placed on a streptavidin-coated petri dish, thereby specifically attaching Ab-reactive phage to the plastic surface through the Ab-biotin-streptavidin bridge.
  • bio-Ab biotinylated Ab
  • Free phage are washed away, and bound phage eluted in acid and used to infect Escherichia coli cells.
  • a single round of AP can enrich Ab-binding phage by as much as a factor of 105 relative to unreactive phage; further enrichment is achieved by further rounds of AP after amplification on agar medium.
  • Ab serves as a powerful selective agent favoring the target clones, so that vast numbers of phage can be surveyed.
  • Fusion phage displaying short cloned peptides are infectious analogs of chemically synthesized mimotopes, with the key advantages of replicability and clonability.
  • a large library of such phage an “epitope library”—may display tens of millions of peptide epitopes.
  • the peptides can in effect be individually surveyed for binding to an Ab or other binding protein by affinity purifying reactive phage from the library, propagating individual phage clones, and sequencing the relevant part of their DNA's to determine the amino acid sequences of their displayed peptides.
  • Nonsupport-bound SCLs originally composed of millions of peptides, were shown to be usable in virtually any assay system (including those involving membrane-bound acceptors or whole cell organisms).
  • the original peptide SCLs have been transformed (i.e., peralkylated and/or exhaustively reduced) using a “libraries from libraries” approach (Ostresh et al., (1994) Proc. Nail. Acad. Sci. U.S.A. 91:11138; Dörner et al., in ”Peptides 1994: Proceedings of the 23rd European Peptide Symposium” (H. L. S. Maia, ed.), p. 463.
  • the first synthetic method known as the “divide, couple, and recombine” (DCR) (Id.) or “split resin” (Lam et al., (1991) Nature 354:82) method, has typically been used with the iterative deconvolution approach.
  • the second synthetic method which involves the use of a predefined chemical ratio of protected amino acids at each coupling step for incorporation of mixture positions, Ostresh et al., (1994) Biopolymers 34:1681) has been developed for use with the positional scanning deconvolution process (Pinilla et al., (1992) BioTechniques 13:901). This latter method offers the advantage that both defined and mixture positions are easily incorporated at any position in a sequence.
  • the iterative deconvolution approach will be illustrated here for the preparation of a dual-defined position hexapeptide SCL, designated OOXXXX-NH 2 (where O represents a defined amino acid, and X represents a mixture of amino acids) using the DCR method.
  • the mixtures making up this library have been assayed for antimicrobial and/or antifungal activity (Blondelle et al., (1995) Trends Anal. Chem. 14:83; Houghten et al., (1992) Bio Techniques 13:412; and Houghten et al., (1991) Nature 354:84) in order to identify the first two amino acid residues of active hexapeptide sequences.
  • the remaining four positions were then identified sequentially through an iterative process of synthesis and screening. This process can be completed in 6 to 10 weeks (four separate iterative synthesis steps are required).
  • the positional scanning approach involves the screening of separate single position SCLs to identify the most effective amino acids at each position of the sequence. When used in concert, this information can be used to identify individual active sequences. This process can be completed in approximately 2 weeks (only one synthesis step is required for confirmation of activity).
  • Fluorenylmethyloxycarbonyl (Fmoc)-based chemistry strategies can also be used.
  • a portion of each resin mixture i.e., X-resin, XX-resin, XXX-resin, etc
  • XXX-resin a portion of each resin mixture (i.e., X-resin, XX-resin, etc) is held back for synthesis of the subsequent peptide mixtures during the iterative process in which additional positions are sequentially defined. While up to 76 amino acids have been used in the mixture positions, cysteine is normally omitted from the mixture positions of an SCL to prevent polymerization side reactions.
  • the number of resin beads used should be 10 to 100 times higher than the final number of individual compounds in a resin mixture in order to ensure statistical representation of each peptide in the library (Gallop et al., (1994) I. Med. Chem. 37:1233).
  • the generation of a dual-defined position SCL made up of L-amino acid hexapeptides (designated OOXXXX-NH 2 ) is described here to illustrate the DCR methodology.
  • This library contains approximately 52 million (20 2 ⁇ 19 4 ) different peptides.
  • nonsupport-bound combinatorial libraries represents an important breakthrough in all areas of basic research and drug discovery.
  • the use of a wide variety of chemical transformations permits a range of peptidomimetic libraries to be generated, which greatly expands the chemical diversity available.
  • the results described in this chapter demonstrate that an existing peptide PS-SCL can be chemically transformed to generate a peptidomimetic SCL from which highly active individual compounds can be identified.
  • the synthesis and deconvolution methods developed for peptide libraries are easily applied to other types of chemical pharmacophores.
  • the soluble nature of the nonsupport-bound combinatorial libraries is a distinct advantage over other methods in that membrane-bound and whole cell assays can also be used.
  • the deconvolution methods used allow the chemical structure of peptidic, peptidomimetic, and organic compounds to be determined based solely on the structural similarities of compounds within each active pool or sublibrary.
  • One aspect of the invention provides high throughput screening of molecules specific to the bacterial RNAP target. This can be done in many different ways well known in the art. For example, this could be done by attaching bacterial RNAP to the bottom of the wells of a 96-well plate at an appropriate concentration by incubating the RNAP in the well overnight at 4° C. Alternatively, the wells are first coated with compositions of polylysine that facilitates the binding of the bacterial RNAP to the wells. Following attachment, samples from a library of test compounds (concentrations are determined by the compound being tested) are added (along with an appropriate binding buffer known in the art) to the wells and incubated for a sufficient time and temperature to facilitate binding.
  • the wells are washed with an appropriate washing solution at 4° C. Increasing or decreasing salt and/or detergent concentrations in the wash varies the stringency of the washing steps. Detection of binding is accomplished using antibodies (representative examples include RIA and ELISA), biotinylation, biotin-streptavidin binding, and radioisotopes. The concentration of the sample library compounds is also varied to calculate a binding affinity by Scatchard analysis. Binding to the bacterial RNAP target identifies a “lead compound”. Once a lead compound is identified, the screening process is repeated using compounds chemically related to the lead compound to identify compounds with the tightest binding affinities. Selected compounds having binding affinity are further tested in one of two assays. These assays use test compounds from 1) phage-displayed linear and cyclic decapeptide libraries and 2) iterative deconvolution of solution-phase linear and cyclic D-hexapeptide libraries.
  • a phage library can be used to test compounds that could bind to the ⁇ ′ pocket of bacterial RNAP.
  • the phage library is constructed in the N-terminal region of the major coat protein pVIII, as previously described (Felici et al., 1991).
  • two Cys are included as invariant residues flanking the random nonapeptide. Transformation yields approximately 1 ⁇ 10 8 independent clones, and the presence of a productive insert is indicated by the blue color of the colonies on Xgal/IPTG plates (Felici et al., 1991).
  • the construction of the library results in hybrid capsids, expressing the random peptides, dispersed along wt pVIII copies.
  • Single plagues (10 5 ) are transferred onto nitrocellulose and probed with RNAP. Positive plaques are eluted from nitrocellulose, the phage are amplified and sequenced, and their reactivity is further confirmed by dot-blot analysis. The amino acid sequences are then deduced.
  • Biologically active compounds are selected from large populations of randomly generated sequences.
  • Libraries are made up of six-residue peptide sequences with amidated carboxy-termini and either acetylated or non-acetylated amino-termini.
  • the first two amino acids in each peptide chain are individually and specifically defined, while the last four amino acids consist of equimolar, or close to equimolar, mixtures of 19 of the 20 naturally occurring L-amino acids, cysteine is omitted from the mixture positions of the two libraries but included in the defined positions.
  • the peptides in these libraries are generally represented as Ac—O 1 O 2 XXXX—NH 2 and O 1 O 2 XXX—NH 2 , where O 1 and O 2 are defined positions, which are represented by the single letters AA, AC, AD and so on up to and including YV, YW, YY, to reach a total of 400 (20 2 ) combinations, and each X position is represented by an equimolar mixture of the 19 natural amino acids (non-natural amino acids can be used as well). Four mixture positions (XXXX) result in a total of 130,321 (19 4 ) different combinations.
  • Each of the 400 different peptide mixtures that make up each of the libraries thus consists of 130,321 individual hexamers; in total, 52,321,400 peptides are represented.
  • the peptides are attached to a resin or alternatively cleaved from the resin, extracted and lyophilized before use.
  • Each nonsupport-bound peptide mixture is typically used at a concentration of 1 mg/ml.
  • each of the individual sub-libraries (one for each position along the peptide) that make up the positional scanning library is composed of 18 different peptide mixtures.
  • Each position is defined (represented as 0) and occupied by one of 18 of the 20 natural L-amino acids (cysteine and tryptophan are omitted); the remaining five positions of the six-residue sequence are composed of mixtures (represented as X) of the same 18 amino acids.
  • the six different sub-libraries vary only in the location of their defined amino acids, they can therefore be represented as: Ac—O 1 XXXXX—NH 2 , Ac—XO 2 XXXX—NH 2 , Ac—XXO 3 XXX—NH 2 , Ac—XXXO 4 XX—NH 2 , AC-XXXXO 5 X—NH 2 , and Ac—XXXXO 6 —NH 2 .
  • each peptide mixture represents 1,889,568 (18 5 ) individual sequences
  • each of the six positional sub-libraries contains in total 34,012,224 (18 ⁇ 1,889,568) different compounds.
  • each of the six individual sub-libraries (for example, Ac—XXXO 4 XX—NH 2 ) can be examined independently and moved forward in an interactive fashion. When used in concert, however, this set of 108 mixtures constitutes a positional scanning library.
  • binding partners The ⁇ pocket of bacterial RNAP—which contains the target—and compounds which interact and bind are sometimes referred to herein as “binding partners.” Any of a number of assay systems may be utilized to test compounds for their ability to interfere with the interaction of the binding partners. However, rapid, high-throughput assays for screening large numbers of compounds, including but not limited to ligands (natural or synthetic), peptides, or small organic molecules are preferred. Compounds that are so identified to interfere with the interaction of the binding partners should be further evaluated for binding or inhibitory activity in cell based assays, animal model systems and in patients as described herein.
  • the basic principle of the assay systems used to identify the compounds of the present invention is based on the identification of compounds that interfere with the interaction between the target and MccJ25, which involves preparing a reaction mixture containing a bacterial RNAP, or RNAP fragment or derivative containing the secondary channel, and MccJ25 under conditions and for a time sufficient to allow the two binding partners to interact and bind, thus forming a complex.
  • the reaction is conducted in the presence and absence of the test compound; i.e., the test compound may be initially included in the reaction mixture, or added at a time subsequent to the addition of the bacterial RNAP, or RNAP fragment or derivative containing the secondary channel, and MccJ25; controls are incubated without the test compound.
  • the formation of a complex between the bacterial RNAP secondary channel and MccJ25 then is detected.
  • the formation of a complex in the control reaction, but not, or to a lesser extent, in the reaction mixture containing the test compound indicates that the compound interferes with the interaction between the bacterial RNAP, or RNAP fragment or derivative containing the secondary channel, and MccJ25.
  • the bacterial RNAP, or RNAP fragment or derivative containing the secondary channel, and MccJ25 binding partners used as components in the assay may be derived from natural sources, e.g., purified from bacterial RNAP, respectively, using protein separation techniques well known in the art; produced by recombinant DNA technology using techniques known in the art (see e.g., Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories Press, Cold Spring Harbor, N.Y); and/or chemically synthesized in whole or in part using techniques known in the art; e.g., peptides can be synthesized by solid phase techniques, cleaved from the resin and purified by preparative high performance liquid chromatography (see, e.g., Creighton, 1983, Proteins: Structures and Molecular Principles, W.
  • composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing; e.g., using the Edman degradation procedure (see e.g., Creighton, 1983, supra at pp. 34-49).
  • One of the binding partners used in the assay system should be labeled, either directly or indirectly, to facilitate detection of a complex formed between the bacterial RNAP secondary channel and MccJ25.
  • Any of a variety of suitable labeling systems may be used including but not limited to radioisotopes such as 125 I and 32 P; enzyme labelling systems that generate a detectable calorimetric signal or light when exposed to substrate; and fluorescent labels.
  • Cyanine fluorescent labels are especially preferred. Cyanine labels incorporated at residue 13 or 15 of MccJ25 are especially preferred.
  • RNAP RNAP fragment or derivative containing the secondary channel
  • MccJ25 binding partners of the assay
  • fusion proteins that can facilitate labeling, immobilization and/or detection.
  • the coding sequence of the bacterial RNAP secondary channel can be fused to that of a heterologous protein that has enzyme activity or serves as an enzyme substrate in order to facilitate labeling and detection.
  • the fusion constructs should be designed so that the heterologous component of the fusion product does not interfere with binding of the bacterial RNAP secondary channel and MccJ25.
  • Indirect labeling involves the use of a third protein, such as a labeled antibody, which specifically binds to the bacterial RNAP secondary channel.
  • a third protein such as a labeled antibody, which specifically binds to the bacterial RNAP secondary channel.
  • a labeled antibody which specifically binds to the bacterial RNAP secondary channel.
  • Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by an Fab expression library.
  • various host animals may be immunized by injection with the bacterial RNAP secondary channel.
  • Such host animals may include but are not limited to rabbits, mice, and rats, to name but a few.
  • Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
  • BCG Bacille Calmette-Guerin
  • Corynebacterium parvum bacille Calmette-Guerin
  • Monoclonal antibodies may be prepared by using any technique, which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein, (Nature, 1975, 256:495-497), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today, 4:72, Cote et al., 1983, Proc. Natl. Acad. Sci., 80:2026-2030) and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
  • Antibody fragments that recognize specific epitopes may be generated by known techniques.
  • such fragments include but are not limited to: the F(ab′) 2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab′) 2 fragments.
  • Fab expression libraries may be constructed (Huse et al., 1989, Science, 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.
  • the assay can be conducted in a heterogeneous or homogeneous format.
  • a heterogeneous assay is an assay in which reaction results are monitored by separating and detecting at least one component during or following reaction.
  • a homogeneous reaction is an assay in which reaction results are monitored without separation of components.
  • the order of addition of reactants can be varied to obtain different information about the compounds being tested.
  • test compounds that interfere with the interaction between the binding partners e.g., by competition, can be identified by conducting the reaction in the presence of the test substance; i.e., by adding the test substance to the reaction mixture prior to or simultaneously with the bacterial RNAP secondary channel and MccJ25.
  • test compounds that disrupt preformed complexes e.g. compounds with higher binding constants that displace one of the binding partners from the complex, can be tested, by adding the test compound to the reaction mixture after complexes have been formed.
  • the various formats are described briefly below.
  • one binding partner e.g., either the bacterial RNAP secondary channel or MccJ25
  • MccJ25 the binding partner
  • the anchored species may be immobilized by non-covalent or covalent attachments.
  • an immobilized antibody specific for the bacterial RNAP secondary channel may be used to anchor the bacterial RNAP secondary channel to the solid surface.
  • the surfaces may be prepared in advance and stored.
  • the binding partner of the immobilized species is added to the coated surface with or without the test compound. After the reaction is complete, unreacted components are removed (e.g., by washing) and any complexes formed will remain immobilized on the solid surface.
  • the detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the binding partner was pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed.
  • an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the binding partner (the antibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody).
  • the antibody in turn, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody.
  • test compounds which inhibit complex formation or which disrupt preformed complexes can be detected.
  • the reaction can be conducted in a liquid phase in the presence or absence of the test compound, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific for an epitope on the bacterial RNAP secondary channel to anchor any complexes formed in solution.
  • test compounds which inhibit complex or which disrupt preformed complexes can be identified.
  • a homogeneous assay can be used.
  • a preformed complex of the bacterial RNAP secondary channel and MccJ25 is prepared in which one of the binding partners is labeled, but the signal generated by the label is quenched due to complex formation (see, e.g., U.S. Pat. No. 4,109,496 by Rubenstein, which utilizes this approach for immunoassays).
  • the addition of a test substance that competes with and displaces one of the binding partners from the preformed complex will result in the generation of a signal above background. In this way, test substances, which disrupt the bacterial RNAP secondary channel and MccJ25 interaction can be identified.
  • FRET fluorescence resonance energy transfer
  • FRET permits accurate determination of distances in the range of ⁇ 20 to ⁇ 100 ⁇ .
  • FRET permits accurate determination of distances up to more than one-half the diameter of a transcription complex (diameter ⁇ 150 ⁇ ; Zhang et al. 1999; Cramer et al., 2001; Gnatt et al., 2001).
  • a preferred assay involves monitoring of FRET between a fluorescent-probe-labeled derivative of a bacterial RNAP and a fluorescent-probe-labeled derivative of MccJ25.
  • An especially preferred assay involves monitoring of FRET between a coumarin-dye-labeled derivative of a bacterial RNAP and a cyanine-dye-labeled derivative of MccJ25.
  • Especially preferred sites of labeling of RNAP for this purpose include residue 14, residue 59, or residue 517 of Escherichia coli RNAP ⁇ 70 subunit, or a corresponding residue, identifiable by sequence and/or structural alignment, of another bacterial RNAP ⁇ subunit.
  • Especially preferred sites of labeling of MccJ25 for this purpose include residue 13 and residue 15.
  • a given compound found to inhibit one bacterium may be tested for general antibacterial activity against a wide range of different bacterial species.
  • a compound that inhibits the interaction of Escherichi coli RNAP, or a RNAP fragment or derivative thereof containing the secondary channel, of with MccJ25 can be tested, according to the assays described infra, against Haemophilus influenzae.
  • inhibitory compounds which are identified in the foregoing assay systems, may be tested for antibacterial activity in any one of the various microbiological assays known to the skilled worker in the field of microbiology.
  • the most effective inhibitors of bacterial RNAP identified by the processes of the present invention can then be used for subsequent animal experiments.
  • the ability of an inhibitor to prevent bacterial infection can be assayed in animal models that are natural hosts for bacteria.
  • animal models may include mammals such as pigs, dogs, ferrets, mice, monkeys, horses, and primates.
  • animal models can be used to determine the LD 50 and the LD 50 in animal subjects, and such data can be used to derive the therapeutic index for the inhibitor of the bacterial RNAP secondary channel/MccJ25 interaction.
  • the identified compounds that inhibit bacterial replication can be administered to a patient at therapeutically effective doses to treat bacterial infection.
  • a therapeutically effective dose refers to that amount of the compound sufficient to result in amelioration of symptoms of bacterial infection.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED 50 .
  • Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of infection in order to minimize damage to uninfected cells and reduce side effects.
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC 50 (i.e., the concentration of the test compound which achieves a half-maximal infection, or a half-maximal inhibition) as determined in cell culture.
  • IC 50 i.e., the concentration of the test compound which achieves a half-maximal infection, or a half-maximal inhibition
  • levels in plasma may be measured, for example, by high performance liquid chromatography.
  • compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients.
  • the compounds and their physiologically acceptable salts and solvates may be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.
  • the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate).
  • binding agents e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose
  • fillers e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate
  • lubricants e.g., magnesium stearate, talc or silica
  • disintegrants e.g., potato star
  • Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid).
  • the preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
  • small molecule is a compound that has a molecular weight of less than 15 kDa.
  • small organic molecule is an organic compound [or organic compound complexed with an inorganic compound (e.g., metal)] that has a molecular weight of less than 3 kDa.
  • an amino acid sequence that contains about 60 amino acid residues can contain between 51 to 69 amino acid residues, more preferably 57 to 63 amino acid residues.
  • target minimally comprises amino acid residues of a target set of residues corresponding to, and alignable with, either residues 736-747 and 779-781 of the ⁇ ′ subunit of RNAP from Escherichia coli or a set of residues corresponding to, and alignable with residues 740-751 and 783-785 of the ⁇ ′ subunit of RNAP from Bacillus subtilis.
  • sequence homology in all its grammatical forms refers to the relationship between proteins that possess a “common evolutionary origin,” including proteins from superfamilies (e.g., the immunoglobulin superfamily) and homologous proteins from different species (e.g., myosin light chain, etc). [Reeck et al., Cell, 50:667 (1987)].
  • sequence similarity in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that do not share a common evolutionary origin [see Reeck et al., 1987, supral.
  • sequence similarity in common usage and in the instant application, may refer to sequence similarity and not a common evolutionary origin.
  • two amino acid sequences are “substantially homologous” or “substantially similar” when greater than 25% of the amino acids are identical, or greater than about 50% are similar (functionally identical).
  • the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wis.) pileup program with the default parameters.
  • corresponding to is used herein to refer similar or homologous sequences, whether the exact position is identical or different from the molecule to which the similarity or homology is measured.
  • corresponding to refers to the sequence similarity, and not the numbering of the amino acid residues or nucleotide bases.
  • the present invention contemplates isolation of nucleic acids encoding either targets I or I.
  • the present invention further provides for subsequent modification of the nucleic acid to generate a fragment or modification of the target, that will crystallize.
  • a potential modulator of the target can be examined through the use of computer modeling using a docking program such as GRAM, DOCK, or AUTODOCK [Dunbrack et al., Folding & Design, 2:27-42 (1997)], to identify potential modulators of the bacterial RNAP target .
  • This procedure can include computer fitting of potential modulators to the bacterial RNAP target to ascertain how well the shape and the chemical structure of the potential modulator will bind to either the individual bound subunits or to the bacterial RNAP target [Bugg et al., Scientific American, December:92-98 (1993); West et al., TIPS, 16:67-74 (1995)].
  • Computer programs can also be employed to estimate the attraction, repulsion, and steric hindrance of the subunits with a modulator/inhibitor (e.g., the bacterial RNAP target and a potential stabilizer).
  • a potential modulator could be obtained by initially screening a random peptide library produced by recombinant bacteriophage for example, [Scott and Smith, Science, 249:386-390 (1990); Cwirla et al., Proc. Natl. Acad. Sci., 87:6378-6382 (1990); Devlin et al., Science, 249:404-406 (1990)].
  • a peptide selected in this manner would then be systematically modified by computer modeling programs as described above, and then treated analogously to a structural analog as described below.
  • a potential modulator/inhibitor can be either selected from a library of chemicals as are commercially available from most large chemical companies including Merck, Glaxo Welcome, Bristol Meyers Squib, Monsanto/Searle, Eli Lilly, Novartis and Pharmacia UpJohn, or alternatively the potential modulator may be synthesized de novo. As mentioned above, the de novo synthesis of one, or even a group of, specific compounds is reasonable in the art of drug design.
  • the potential modulator can be placed into a standard binding assay with RNAP or an active fragment thereof such as the target, for example.
  • the subunit fragments can be synthesized by either standard peptide synthesis described above, or generated through recombinant DNA technology or classical proteolysis. Alternatively, the corresponding full-length proteins may be used in these assays.
  • the ⁇ ′ subunit can be attached to a solid support.
  • Methods for placing the ⁇ ′ subunit on the solid support are well known in the art and include such things as linking biotin to the ⁇ ′ subunit and linking avidin to the solid support.
  • the solid support can be washed to remove unreacted species.
  • a solution of a labeled potential modulator e.g., an inhibitor
  • the solid support is washed again to remove the potential modulator not bound to the support.
  • the amount of labeled potential modulator remaining with the solid support and thereby bound to the ⁇ ′ subunit can be determined.
  • the dissociation constant between the labeled potential modulator and the ⁇ ′ subunit for example can be determined.
  • Suitable labels for bacterial RNAP target or the potential modulator are exemplified herein.
  • isothermal calorimetry can be used to determine the stability of the bacterial RNAP target in the absence and presence of the potential modulator.
  • a compound is assayed for its ability to bind to the target.
  • a compound that binds to the target then can be selected.
  • the effect of a potential modulator on an activity of the bacterial RNAP target is determined.
  • the potential modulator then can be added to a bacterial culture to ascertain its effect on bacterial proliferation.
  • a potential modulator that inhibits bacterial proliferation then can be selected.
  • the effect of the potential modulator on an activity of a bacterial RNAP, or a fragment thereof is determined (either independently, or subsequent to a binding assay as exemplified above).
  • the extent or rate of the DNA-dependent RNA transcription is determined.
  • a labeled nucleotide could be used. This assay can be performed using a real-time assay—e.g., with a fluorescent analog of a nucleotide.
  • the determination can include the withdrawal of aliquots from the incubation mixture at defined intervals and subsequent placing of the aliquots on nitrocellulose paper or on gels.
  • the potential modulator is selected when it is an inhibitor of the bacterial RNAP.
  • RNAP activity is a modification of the method of Burgess et al. [J. Biol. Chem., 244:6160 (1969)] [See http://www.worthington-biochem.com/manual/R/RNAP.html].
  • One unit incorporates one nanomole of UMP into acid insoluble products in 10 minutes at 37° C. under the assay conditions such as those listed below.
  • the suggested recompounds are: (a) 0.04 M Tris-HCl, pH 7.9, containing 0.01 M MgCl.sub.2, 0.15 M KCl, and 0.5 mg/ml BSA; (b) Nucleoside triphosphates (NTP): 0.15 mM each of ATP, CTP, GTP, UTP; spiked with 3 H-UTP 75000-150000 cpms/0.1 ml; (c) 0.15 mg/ml calf thymus DNA; (d) 10% cold perchloric acid; and (e) 1% cold perchloric acid. 0.1-0.5 units of RNAP in 5 ⁇ l-10 ⁇ l is used as the starting enzyme concentration.
  • the procedure is to add 0.1 ml Tris-HCl, 0.1 ml NTP and 0.1 ml DNA to a test tube for each sample or blank. At zero time enzyme (or buffer for blank) is added to each test tube, and the contents are then mixed and incubated at 37° C. for 10 minutes. 1 ml of 10% perchloric acid is added to the tubes to stop the reaction. The acid insoluble products can be collected by vacuum filtration through MILLIPORE filter discs having a pore size of 0.45 u-10 u (or equivalent). The filters are then washed four times with 1% cold perchloric acid using 1 ml-3 ml for each wash. These filters are then placed in scintillation vials.
  • the present invention further provides for assays for analysis of antibacterial activity, such as for example include a Minimal Bacteriocidal Concentration (MBC) assay also described in detail below, concerning defining the target of MccJ25.
  • MBC Minimal Bacteriocidal Concentration
  • RNAP/mg of protein For calculation of units of RNAP/mg of protein the equation described in U.S. Pat. No. 6,225,076 can be used.
  • a crystal can be grown that comprises the bacterial RNAP, or a fragment thereof, and the potential modulator.
  • the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of better than 4.0 Angstroms.
  • the three-dimensional structure of the crystal is determined by molecular replacement. Molecular replacement involves using a known three-dimensional structure as a search model to determine the structure of a closely related molecule or protein-ligand complex in a new crystal form. The measured X-ray diffraction properties of the new crystal are compared with the search model structure to compute the position and orientation of the protein in the new crystal.
  • Computer programs that can be used include: X-PLOR (see above), CNS, (Crystallography and NMR System, a next level of XPLOR), and AMORE [J. Navaza, Acta Crystallographics ASO, 157-163 (1994)].
  • X-PLOR see above
  • CNS Crystallography and NMR System, a next level of XPLOR
  • AMORE J. Navaza, Acta Crystallographics ASO, 157-163 (1994)].
  • an electron density map can be calculated using the search model to provide X-ray phases. Thereafter, the electron density is inspected for structural differences and the search model is modified to conform to the new structure. Using this approach, it will be possible to solve the three-dimensional structure of different bacterial target having pre-ascertained amino acid sequences.
  • Other computer programs that can be used to solve the structures of the bacterial RNAP from other organisms include: QUANTA, CHARMM; INSIGHT; SYBYL; MACROMODE
  • a candidate drug can be selected by performing rational drug design with the three-dimensional structure determined for the crystal, preferably in conjunction with computer modeling discussed above.
  • the candidate drug e.g., a potential modulator of bacterial RNAP
  • a candidate drug can be identified as a drug, for example, if it inhibits bacterial proliferation.
  • a potential inhibitor e.g., a candidate antibacterial agent
  • an assay that can measure bacterial growth may be used to identify a candidate antibacterial agent.
  • Methods of testing a potential bacteriostatic or bacteriocidal compound in isolated cultures and in animal models are well known in the art, and can include standard minimum-inhibitory-concentration (MIC) and minimum-bacteriocidal-concentration (MBC) assays.
  • MIC minimum-inhibitory-concentration
  • MBC minimum-bacteriocidal-concentration
  • the potential modulators can be administered by a variety of ways including topically, orally, subcutaneously, or intraperitoneally depending on the proposed use. Generally, at least two groups of animals are used in the assay, with at least one group being a control group, which is administered the administration vehicle without the potential modulator.
  • compounds identified according to the target and method of this invention would have applications not only in antibacterial therapy, as described above, but also in: (i) identification of bacterial RNAP (diagnostics, environmental-monitoring, and sensors applications), (ii) labeling of bacterial RNAP (diagnostics, environmental-monitoring, imaging, and sensors applications), (iii) immobilization of bacterial RNAP (diagnostics, environmental-monitoring, and sensors applications), (iv) purification of bacterial RNA polymerase (biotechnology applications), (v) regulation of bacterial gene expression (biotechnology applications), and (vi) antisepsis (antiseptics, disinfectants, and advanced-materials applications).
  • Cyclic Peptide MCCJ25 (MCCJ25) Inhibits Transcription by Obstructing the RNAP Secondary Channel
  • MccJ25 The cyclic-peptide antibiotic MccJ25 (MccJ25) inhibits transcription by Escherichia coli RNA polymerase (RNAP) in a purified system.
  • Biochemical results indicate that MccJ25 inhibits the abortive-initiation and elongation phases of transcription.
  • Kinetic results indicate that MccJ25 inhibits transcription by interfering with NTP uptake.
  • Genetic results indicate that MccJ25 inhibits transcription through interactions with an extensive determinant, comprising nearly fifty amino acid residues, within the RNAP secondary channel (also known as the secondary channel or pore).
  • MccJ25 inhibits transcription by binding within, and obstructing, the RNAP secondary channel—acting essentially as a “cork in a bottle.” Obstruction of the RNAP secondary channel represents a novel mechanism of inhibition and an attractive target for drug discovery.
  • MccJ25 (MccJ25) is a 21 residue cyclic-peptide antibiotic (Salomon and Farias (1992) J. Bacteriol. 174, 7428-7435; Blond et al., (1999) Eur. J. Biochem. 259, 747-755).
  • MccJ25 is produced by Escherichia coli strains that harbor a plasmid-borne antibiotic-synthesis and antibiotic-export cassette, consisting of a gene for MccJ25 precursor (a 58 residue linear peptide), two genes for factors that process MccJ25 precursor into MccJ25, and one gene for export of MccJ25 (Solbiati et al., (1999) J. Bacteriol.
  • MccJ25 exhibits bacteriocidal activity against a range of Gram-negative bacterial species, including E. coli (Salomon and Farias (1992) J. Bacteriol. 174, 7428-7435).
  • RNAP RNAP
  • the present invention provides that MccJ25 inhibits transcription in a purified system, provides the steps in transcription at which inhibition occurs, provides the mechanism by which inhibition occurs, and provides define—through isolation of more than 120 independent single-substitution MccJ25-resistant mutants of xpoC following random and saturation mutagenesis—the determinant of RNAP for function of MccJ25.
  • the present invention also provides that MccJ25 inhibits transcription by binding within, and obstructing, the RNAP secondary channel. This represents a novel mechanism for inhibition of a nucleotide polymerase and an attractive target for antibacterial drug discovery.
  • RNAP binds to promoter DNA, to yield an RNAP-promoter closed complex;
  • RNAP melts approximately 14 bp of promoter DNA surrounding the transcription start site, to yield an RNAP-promoter open complex;
  • RNAP begins synthesis of RNA, typically carrying out multiple rounds of abortive initiation (synthesis and release of RNA products less than 9-11 nt in length), as an RNAP-promoter initial transcribing complex; and
  • RNAP upon synthesis of an RNA product of a critical threshold length of 9-11 nt, RNAP breaks its interactions with promoter DNA and begins to translocate along DNA, processively synthesizing RNA as an RNAP-DNA elongation complex.
  • RNAP holoenzyme was incubated with a fluorochrome-labelled DNA fragment containing the lacUV5 promoter—in parallel in the absence and presence of MccJ25—and we analyzed products by non-denaturing PAGE followed by x/y fluorescence scanning ( FIG. 3 ). The results indicate that MccJ25 at a concentration of 1, 10, or 100 ⁇ M has no effect on formation of open complex ( FIG. 3 ). MccJ25 does not inhibit steps in transcription up to and including formation of open complex.
  • RNAP holoenzyme was pre-incubated with a DNA fragment containing the lacUVS promoter to form the RNAP-promoter open complex; radiolabelled NTPs were added and RNA synthesis was allowed to proceed for 5 min at 37° C.—in parallel in the absence and presence of MccJ25—and products were analyzed by urea-PAGE followed by storage-phosphor imaging ( FIG. 4 ).
  • MccJ25 at a concentration of 1, 10, or 100 ⁇ M inhibits both formation of abortive products (7 nt and 8 nt RNA species produced in large stoichiometric excess over the DNA template (see Record et al. 1996; deHaseth et al. 1998)) and formation of the full-length product (26 nt RNA species; produced in stoichiometric equivalence with DNA template) ( FIG. 4A ).
  • the inhibition is specific; thus, inhibition is overcome completely upon substitution of residue 931 of the RNAP ⁇ ′ subunit—the substitution shown by Delgado et al., (2001) J. Bacteriol.
  • MccJ25 inhibits both abortive initiation and elongation. MccJ25 interferes with a process common to both abortive initiation and elongation—i.e., NTP uptake, phosphodiester-bond formation, or translocation.
  • MccJ25 Binds Within the RNAP Secondary Channel—Random Mutagenesis:
  • the RNAP secondary channel is a 25 ⁇ long ⁇ 10-15 ⁇ wide, tunnel through which NTPs must pass to access the RNAP active-center and NTP binding site (Zhang et al., (1999) Cell 98, 811-824; Cramer et al., (2001) Science 292, 1863-1 876; and Ebright (2000) J. Mol. Biol. 304, 687-689).
  • MccJ25 inhibits transcription by interfering with NTP uptake, immediately suggests a possible mechanism of inhibition: i.e., MccJ25 may inhibit transcription by binding within, and obstructing, the RNAP secondary channel.
  • RNAP ⁇ ′ subunit comprises nearly one-half of all residues of RNAP and comprises all residues of the RNAP secondary channel. Mutagenesis using error-prone PCR was performed (Zhou (1991) Nucl. Acids Res. 19, 6052; Zhou et al., (1993) Proc. Natl. Acad. Sci.
  • RNAP secondary channel contains a multi-residue determinant for function of MccJ25. Based on the fact that substitutions conferring MccJ25-resistance were obtained at none of the >1000 residues of ⁇ ′ outside the immediate vicinity of the secondary channel, it is concluded that no part of ⁇ ′ outside the immediate vicinity of the secondary channel contains a determinant for function of MccJ255.
  • MccJ25 Binds within the RNAP Secondary Channel—Saturation Mutagenesis:
  • the sites at which single substitutions were obtained define a nearly continuous surface, comprising most of the interior lining and part of the rim of the RNAP secondary channel ( FIG. 6D ).
  • the sites span nearly the full circumference of the RNAP secondary channel ( FIG. 6D ).
  • the side chains of the majority of implicated residues are solvent-accessible—directed into the lumen of the RNAP secondary channel or toward the exterior of RNAP—and make no obvious interactions important for RNAP structure or function.
  • the present invention also provides that the sites of substitutions that confer MccJ25-resistance map the binding site on RNAP for MccJ25 and, in essence, serve as a genetic footprint of the binding site.
  • MccJ25-resistance 733, 783, 931, 935, and 1138 (Yuzenkova et al., (2002) J. Biol. Chem. 277, 50867-50875).
  • the target for MccJ25 includes these sites within ⁇ ′ (four of which are reported herein; Tables 2 and 5).
  • MccJ25 inhibits the abortive-initiation and elongation phases of transcription, that inhibition involves interference with NTP uptake, that inhibition is partial-competitive with respect to NTPs (i.e., involves a site distinct from the RNAP NTP binding site), and that inhibition involves an extensive determinant within the RNAP secondary channel, comprising nearly the entire lining of the RNAP secondary channel (nearly fifty sites for substitutions conferring MccJ25-resistance).
  • RNAP secondary channel is a 25 A long, -10-15 A wide, fully enclosed tunnel through which NTPs must pass to access the RNAP active-center and NTP binding site (Zhang et al., (1999) Cell 98, 811-824; Cramer et al., (2001) Science 292, 1863-1 876; and Ebright (2000) J. Mol. Biol. 304, 687-689).
  • MccJ25 inhibits transcription by binding within, and obstructing, the RNAP secondary channel—acting essentially as a “cork in a bottle.”
  • RNAP secondary channel represents a novel mechanism of inhibition of RNAP.
  • Rifampicin an inhibitor of bacterial RNAP, functions by sterically preventing synthesis of an RNA product longer than -4 nt (Campbell et al., (2001) Cell 104, 901-9 12).
  • Streptolydigin and ⁇ -amanitin, inhibitors of bacterial RNAP and eukaryotic RNAP II, respectively, are proposed to interfere with active-center conformational changes associated with phosphodiester-bond formation and/or translocation (Epshtein et al., (2002) Mol. Cell 10, 623-634; Bushnell et al., (2002) Proc. Natl. Acad. Sci. USA 99, 12 18-1222).
  • the RNAP secondary channel is eminently “druggable,” presenting an extended, encircling surface complementary to a range of molecules—like MccJ25—that have molecular weights of 500-2,500 Da.
  • the RNAP secondary channel exhibits distinct patterns of sequence conservation in bacterial RNAP and eukaryotic RNAP, permitting identification of agents—like MccJ25—that inhibit bacterial RNAP but do not inhibit eukaryotic RNAP.
  • RNAP secondary channel is distinct from, and well-separated from, the binding site of the RNAP inhibitor in current use in antimicrobial therapy, rifampicin, permitting identification of agents—like MccJ25 (unpublished data)—that do not exhibit cross-resistance with rifampicin.
  • Plasmid pTUC202 carries genes for synthesis and export of MccJ25 (Solbiati et al., (1999) J. Bacteriol. 181, 2659-2662; gift of Dr. F. Moreno).
  • Plasmid pRL663 encodes C-terminally hexahistidine-tagged E. coli RNAP ⁇ ′ subunit under control of the tac promoter (Wang et al., (1995) Cell 81, 341-350; gift of Dr. R. Landick).
  • Plasmid pREII-NHx encodes N-terminally hexahistidine-tagged E. coli RNAP ⁇ subunit under control of tandem lpp and 'lacUV5 promoters (Niu et al., 1996).
  • MccJ25 was purified essentially as in Blond et al. 1999.
  • E. coli strain DH5 ⁇ (hsdR17 recA1 relA1 endA1 gyrA96 gal deoR phoA supE44 thi ⁇ (lacZYA-argF)U169 ⁇ 80dlacZ ⁇ M15; Invitrogen, Inc).
  • transformed with plasmid pTUC202 (Solbiati et al., 1996) was shaken in 1 L M9 medium (Sambrook and Russell (2001).
  • RNAP holoenzyme was prepared from strain XE54/pREII-NH ⁇ (thi pREII-NH ⁇ ; Niu et al., (1996) Cell 87, 1123-1134) using metal-ion affinity chromatography and ion-exchange chromatography (Id.).
  • Ile931] ⁇ ′-RNAP holoenzyme was prepared from strain 397c [rpoC ts 397 argG thi lac ⁇ I 857 h 80 S t68 dlac + ); Christie et al., (1996) J. Bacteriol.
  • Reaction mixtures contained (20 ⁇ l): 100 nM RNAP holoenzyme, 20 nM DNA fragment lacUV5-12(Cy5, +26) (Mukhopadhyay et al., (2001) Cell 106, 453-463), and 0-100 ⁇ M MccJ25 in TB [50 mM Tris-HCl (pH 8.0), 100 mM KCl, 10 mM MgCl 2 , 1 mM dithiothreitol, 10 ⁇ g/ml bovine serum albumin, and 5% glycerol].
  • reaction mixtures were applied to 5% polyacrylamide slab gels (30:1 acrylamide/bisacrylamide; 6 ⁇ 9 ⁇ 0.1 cm) and electrophoresed in 90 mM Tris-borate (pH 8.0) and 0.2 mM EDTA (20 V/cm; 30 min at 37° C.) and analyzed using an x/y fluorescence scanner (Storm 860; Molecular Dynamics, Inc.).
  • Reaction mixtures contained (18 ⁇ l): 100 nM RNAP holoenzyme, 20 nM DNA fragment lacUV5-12(Cy5, +26) (Mukhopadhyay et al., (2001) Cell 106, 453-463), and 0-100 ⁇ M MccJ25 in TB.
  • RNA synthesis was initiated by addition of 2 ⁇ l 5 mM ApA and 125 ⁇ M (or 250 jiM, 500 ⁇ M, and 1 mM) each of [ ⁇ - 32 P]UTP (0.6 Bq/fmol), ATP, CTP, GTP.
  • reactions were terminated by addition of 10 ⁇ l 80% formamide, 10 mM EDTA, 0.04% bromophenol blue, and 0.04% xylene cyanol.
  • Reaction mixtures contained (46.5 ⁇ l): 100 nM RNAP holoenzyme, 20 nM DNA fragment lacUV5-12 (Mukhopadhyay et al., (2001) Cell 106, 453-463), and 0-100 ⁇ M MccJ25 in TB. Following 15 min at 37° C., 0.5 ⁇ l mg/ml heparin was added, and, following a further 2 min at 37° C., 1 ⁇ l of 0.25-5 mM (y-AmNS)UTP (Molecular Probes, Inc.) was added, and reaction mixtures were transferred to sub-micro fluorometer cuvettes (Starna Cells, Inc.).
  • the quantity of UMP incorporated into RINA was determined from the quantity of ( ⁇ -AmNS)UTP consumed, which, in turn, was calculated as follows (Schlageck et al.
  • ( ⁇ - AmNS ) UTP consumed [( ⁇ - AmNS ) UTP 0 ]( F t ⁇ F 0 )/(12.4 ⁇ F 0 )
  • ( ⁇ -AmNS)UTP 0 is the quantity of ( ⁇ -AmNS)UTP at time 0
  • F 0 is the fluorescence emission intensity at time 0
  • F t is the fluorescence emission intensity at time t.
  • Data were fit to full-competitive, partial-competitive, full-noncompetitive, partial-noncompetitive, full-uncompetitive, partial-uncompetitive, full-mixed, and partial-mixed models of inhibition as in the preceding section.
  • Random mutagenesis was performed by error-prone PCR amplification of the XbaI-SnaBI (codons 1-292), SnaBI-SphI (codons 292-546), SphI -SalI (codons 546-876), SalI-BspEI (codons 876-1213), and BspEI-XhoI (codons 1213-1408) rpoC segments of plasmid pRL663 (procedure of Zhou (1991) Nucl. Acids Res. 19, 6052; Zhou et al., (1993) Proc. Natl. Acad. Sci. USA 90, 6081-6085).
  • mutagenesis procedure yields all possible transition and transversion substitutions (Id. at Table 2).
  • Mutagenized plasmid DNA was introduced by transformation into strain Stbl2 [mcrA ⁇ (mcrBC-hsdRMS-mrr) recA1 relA1 endA1 gyrA96 lon supE44 thi ⁇ (lac-proAB); Invitrogen, Inc.], transformants ( ⁇ 10 4 cells) were applied to LB-agar plates (Sambrook and Russell (2001).
  • plasmid DNA was prepared, plasmid DNA was introduced by transformation into strain DH5 ⁇ [hsdR17 recA1 relA1 endA1 gyrA96 gal deoR phoA supE44 thi ⁇ (lacZYA-argF)U169 ⁇ 80dlacZ ⁇ M15; Invitrogen, Inc.], transformants ( ⁇ 10 4 cells) were applied to LB-agar plates containing I ⁇ g/ml MccJ25 and 200 ⁇ g/ml ampicillin and, in parallel, to LB-agar plates containing 200 ⁇ g/ml ampicillin, and plates were incubated 16 h at 32° C.
  • the nucleotide sequence of the mutagenized rpoC segment was determined by dideoxy nucleotide sequencing.
  • Saturation mutagenesis A set of “doped” oligodeoxyribonucleotide primers corresponding to codons 425-437, 487-509, 592-608, 675-703, 723-743, 739-757, 772-793, 918-937, 1132-1141, and 1236-1251 of the xpoC gene of pRL663 was synthesized on an AB392 automated synthesizer (Applied Biosystems, Inc). using solid-phase ⁇ -cyanoethylphosphoramidite chemistry (sequences in Table 4).
  • the level of “doping” was selected to yield an average of 0.4-1 substitution per molecule of oligodeoxyribonucleotide primer (equations in Hermes et al., 1989, 1990).
  • nucleotides corresponding to codons 429-433, 597-603, and 1136-1137 were synthesized using phosphoramidite reservoirs containing 92% of the correct phosphoramidite and 8% of a 1:1:1:1 mix of dA, dC, dG, and dT phosphoramidites (i.e., 94% total correct phosphoramidite and 6% total incorrect phosphoramidite);
  • nucleotides corresponding to codons 492-504, 680-698, 726-740, 74 1-754, 775-790, 922-933, and 123 9-1248 were synthesized using phosphoramidite reservoirs containing 98% of the correct phosphoramidite and 2% of a 1:1:1:1 mix of dA, dC, dG, and dT phosphoramidites (i.e., 98.5% total correct phosphoramidite and 1.5% total incorrect phosphoramidite); and all other nucleotides were
  • Primer-extension mutagenesis reactions were performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, Inc)., with a “doped” oligodeoxyribonucleotide primer, a complementary wild-type oligodeoxyribonucleotide primer, and pRL663 as template (primers at 75 nM; all other components at concentrations as specified by the manufacturer).
  • Mutagenized plasmid DNA was introduced into cells, and plasmid-linked MccJ25 r clones were identified and characterized, as in the preceding section.
  • Strain 397c [rpoC ts 397 argG thi lac ( ⁇ cI 857 h 80 S t68 dlac+); Christie et al., 1996] was transformed with pRL663 or a pRL663 derivative, transformants ( ⁇ 10 4 cells) were applied to LB-agar plates (Sambrook and Russell (2001). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory)) containing 1 ⁇ g/ml MccJ25 and 200 ⁇ g/ml ampicillin, plates were incubated 16 h at 37° C., and bacterial growth was scored.
  • Strain DH5 ⁇ [hsdR17 recA1 relA1 endA1 gyrA96 gal deoR phoA supE44 thi ⁇ (lacZYA-argF)U169 ⁇ 80dlacZ ⁇ M15; Invitrogen,. Inc.] was transformed with pRL663 or a pRL663 derivative, transformants(10 6 cells) were incubated 2 h at 37° C. in 1 ml LB (Id.) containing 0.01, 0.05, 0.1, or 1 mg/ml MccJ25; aliquots (10 ⁇ l) were applied to LB-agar plates (Id). containing 200 ⁇ g/ml ampicillin; plates were incubated 16 h at 37° C.; and colonies were counted. The MBC was defined as the lowest concentration of MccJ25 that yielded a colony count of ⁇ 5.
  • One aspect of the invention provides probe-labelled derivatives of the peptide antibiotic MccJ25 (MccJ25).
  • MccJ25 peptide antibiotic MccJ25
  • the invention has broad applications in analysis of RNAP structure and function, control of bacterial gene expression, control of bacterial growth, antibacterial chemistry, antibacterial therapy, and drug discovery.
  • the present invention also provides a composition
  • a composition comprising a compound according to the general structural formula (I): J-Z-X, wherein J is MccJ25 or a substituted and/or truncated derivative thereof, Z is a covalent linker or is absent, and X is a detectable group.
  • compositions comprising a compound according to the general structural formula (I) wherein X is selected from the group consisting of a fluorescent moiety, a phosphorescent moiety, a luminescent moiety, an absorbent moiety, a photosensitizer, a spin label, a radioisotope, an isotope detectable by nuclear magnetic resonance, a paramagnetic atom, a heavy atom, a hapten, a crosslinking agent, a cleavage agent, and combinations thereof.
  • X is selected from the group consisting of a fluorescent moiety, a phosphorescent moiety, a luminescent moiety, an absorbent moiety, a photosensitizer, a spin label, a radioisotope, an isotope detectable by nuclear magnetic resonance, a paramagnetic atom, a heavy atom, a hapten, a crosslinking agent, a cleavage agent, and combinations thereof.
  • Another aspect of the present invention provides
  • composition comprising formula (I) wherein X is a cyanine dye.
  • composition comprising formula (I) wherein X is a Cy3.
  • composition comprising formula (I) wherein X is a Cy5.
  • the present invention also provides a composition comprising a derivative of MccJ25 having a detectable group incorporated at position 13, according to the general structural formula (II): [O 13 -Z-X]J, wherein O is an amino acid or amino acid derivative, Z is a covalent linker or is absent, and X is a detectable group.
  • One aspect of the present invention provides a composition according to formula) (II) wherein O is lysine; and wherein X is selected from the group consisting of a fluorescent moiety, a phosphorescent moiety, a luminescent moiety, an absorbent moiety, a photosensitizer; a spin label, a radioisotope, an isotope detectable by nuclear magnetic resonance, a paramagnetic atom, a heavy atom, a hapten, a crosslinking agent, a cleavage agent, and combinations thereof.
  • a preferred aspect of the present invention provides a composition according to formula (II) wherein X is a fluorescent moiety.
  • An especially preferred aspect of the present invention provides a composition according to formula (II) wherein X is a cyanine dye.
  • An especially preferred aspect of the present invention provides a composition according to said formula (II) wherein X is Cy3 or Cy5.
  • the present invention also provides a composition comprising a derivative of MccJ25 having a detectable group incorporated at position 15, according to the general structural formula (III): [O 15 -Z-X]J, wherein O is an amino acid or amino acid derivative, Z is a covalent linker or is absent, and X is a detectable group.
  • One aspect of the present invention provides a composition according to formula) (III) wherein O is lysine; and wherein X is selected from the group consisting of a fluorescent moiety, a phosphorescent moiety, a luminescent moiety, an absorbent moiety, a photosensitizer, a spin label, a radioisotope, an isotope detectable by nuclear magnetic resonance, a paramagnetic atom, a heavy atom, a hapten, a crosslinking agent, a cleavage agent, and combinations thereof.
  • a preferred aspect of the present invention provides a composition according to formula (III) wherein X is a fluorescent moiety.
  • An especially preferred aspect of the present invention provides a composition according to formula (III) wherein X is a cyanine dye.
  • An especially preferred aspect of the present invention provides a composition according to said formula (III) wherein X is Cy3 or Cy5.
  • the present invention also provides a composition comprising a derivative of MccJ25 having a detectable group incorporated at position 17, according to the general structural formula (IV): [O 17 -Z-X]J, wherein O is an amino acid or amino acid derivative, Z is a covalent linker or is absent, and X is a detectable group.
  • One aspect of the present invention provides a composition according to formula) (IV) wherein O is lysine; and wherein X is selected from the group consisting of a fluorescent moiety, a phosphorescent moiety, a luminescent moiety, an absorbent moiety, a photosensitizer, a spin label, a radioisotope, an isotope detectable by nuclear magnetic resonance, a paramagnetic atom, a heavy atom, a hapten, a crosslinking agent, a cleavage agent, and combinations thereof.
  • a preferred aspect of the present invention provides a composition according to formula (IV) wherein X is a fluorescent moiety.
  • An especially preferred aspect of the present invention provides a composition according to formula (IV) wherein X is a cyanine dye.
  • An especially preferred aspect of the present invention provides a composition according to said formula (IV) wherein X is Cy3 or Cy5.
  • the present invention also provides a composition
  • a composition comprising a compound according to any one of the general structural formulas (I), (II), (III), or (IV) for a) analysis, synthesis, screening, or design of ligands of RNAP; b) analysis, synthesis, screening, or design of modulators of RNAP activity; c) analysis, synthesis, screening, or design of modulators of bacterial gene expression; and d) analysis, synthesis, screening, or design of modulators of bacterial growth.
  • the invention provides for the use of a compound according to any one of the general structural formulas (I), (II), (III), or (IV) in an assay assessing the ability of a molecule, or set of molecules, to displace said compound from a bacterial RNAP, or a fragment thereof, or to compete with said compound for binding to a bacterial RNAP, or a fragment thereof.
  • the invention provides for the use of a compound according to any one of the general structural formulas (I), (II), (III), or (IV) in a homogeneous assay FRET assay measuring the ability of a molecule, or set of molecules, to displace said compound from a bacterial RNAP, or a fragment thereof, or to compete with said compound for binding to a bacterial RNAP, or a fragment thereof.
  • the present invention provides for the preparation of [Cy3-Lys13]MccJ25 (a compound according to structural formulas (I) and (II)) and demonstration that the compound binds to and inhibits RNAP with high potency.
  • the present invention also provides for the preparation of [Lys13]MccJ25, [Lys15]MccJ25, and [Lys17]MccJ25 (intermediates in synthesis of compounds according to structural formulas (I)-(IV) and demonstration that the compounds bind to and inhibit RNAP with high potency.
  • the present invention also provides for the use of Cy3-Lys13]MccJ25 (a compound according to structural formulas (I) and (II)) in a homogeneous FRET assay measuring the ability of a molecule, or set of molecules, to displace said compound from a bacterial RNAP, or a fragment thereof, or to compete with said compound for binding to a bacterial RNAP, or a fragment thereof.
  • the invention has applications in control of bacterial gene expression, control of bacterial growth, antibacterial chemistry, and antibacterial therapy.

Abstract

Target and method for inhibition of bacterial RNA polymerase disclosed are targets and methods for specific binding and inhibition of RNAP from bacterial species. Bacterial RNA polymerase RPOC_ECOLI (736) QIRQLAGMRGLM  (779) ARK RPOC_HAEIN (737) QIRQLAGMRGLM  (780) ARK RPOC_VIBCH (736) QIRQLAGMRGLM  (779) ARK RPOC_PSEAE (736) QIRQLAGMRGLM  (779) ARK RPOC_TREPA (703) QIRQLAGMRGLM  (746) ARK RPOC_BORBU (699) QIRQLAGMRGLM  (742) ARK RPOC_XYLFA (759) QIRQLAAMRGLM  (802) ARK RPOC_CAMJE (734) QISQLAAMRGLM  (777) ARK RPOC_NEIMA (738) QIKQLSGMRGLM  (781) ARK RPOC_RICPR (730) QIKQLGGMRGLM  (773) MRK RPOC_THEMA(1010) QVKQLAGIRGLM (1072) ARK RPOC_CHLTR (736) QLKQLGALRGLM  (779) ARK RPOC_MYCPN (820) NFTQLFGMRGLM  (874) ARK RPOC_BACSU (740) NFTQLAGMRGLM  (783) ARK RPOC_STAAU (744) NFTQLAGMRGLM  (787) ARK RPOC_MYCTU (813) QTRTLAGMKGLV  (856) ARK RPOC_SYNY3 (763) QVRQLVGMRGLM  (806) ARK RPOC_AQUAE (850) QIRQLAGMRGLM  (893) ARK RPOC_DEIRA(1052) QIRQLAGMRGLM (1095) ARK RPOC_TTHER(1034) QIRQLCGLRGLM (1077) ARK RPOC_THEAQ(1034) QIRQLCGMRGLM (1077) ARK Human RNA polymerases I, II, and III RPA1_HUMAN (908) NTMQISCLLGQI  (971) GRE RPB1_HUMAN (780) NISQVIAVVGQQ  (843) GRE RPC1_HUMAN (791) NISQMIACVGQQ  (854) GRE

Description

    CROSS-REFERENCE TO RELATED APPLICATIONS
  • This application claims priority to provisional applications: 60/407,684 filed Sep. 4, 2002; 60/474,607 filed on Jun. 2, 2003; and 60/474,608 filed on Jun. 2, 2003, the contents of which are incorporated herein by reference.
    • GOVERNMENT SUPPORT
  • This invention was supported with U.S. Government funds (NIH RO1-GM41376). Therefore, the Government may have rights in the invention.
    • BACKGROUND ART
  • Bacterial infections remain among the most common and deadly causes of human disease. Infectious diseases are the third leading cause of death in the United States and the leading cause of death worldwide (Binder et al., Science 284:1311-1313 (1999)). Multi-drug-resistant bacteria now cause infection that poses a grave and growing threat to public health. It has been shown that bacterial pathogens can acquire resistance to first-line and even second-line antibiotics. (See, Stuart B. Levy, The Challenge of Antibiotic Resistance, in Scientific American, 46-53 (March, 1998); Walsh, C. (2000) Nature 406, 775-781; Schluger, N. (2000) Int. J. Tuberculosis Lung Disease 4, S71-S75; Raviglione et al., (2001) Ann NY Acad Sci 953, 88-97). New approaches to drug development are necessary to combat the ever-increasing number of antibiotic-resistant pathogens.
  • RNA is synthesized in cellular organisms by a complex molecular machine, known as RNA polymerase (“RNAP”). In its simplest bacterial form, RNAP comprises at least 4 subunits with a total molecular mass of around 400 kDa. RNAP mediates the transcription of DNA to produce RNA. Bacterial RNAP is a multimeric protein consisting of subunits α2, β, β′, and ω. An σ factor is required for initiation of transcription by forming a holoenzyme complex.
  • Currently, there are a few known antibiotics that target RNAP—notably, rifampicin and rifampicin analogs (See Mitchison, D. (2000) Int. J. Tuberculosis Lung Disease 4, 796-806). Rifampicin is the only anti-tuberculosis compound able to rapidly clear infection and prevent relapse. Without rifampicin, treatment lengths must increase from 6 months to at least 18 months to ensure prevention of relapse. Rifampicin acts by specifically inhibiting RNAP (Campbell et al., (2001) Cell 104, 901-912). Rifampicin binds to a site adjacent to the active center of bacterial RNAP, the exit channel, and physically prevents synthesis of products longer than ˜4 nucleotides. Unfortunately, tuberculosis strains resistant to rifampicin (and rifampicin analogs) are becoming widespread, effectively removing rifampicin from the therapeutic arsenal. Thus, there is a need for novel antibiotics that target the same bacterial enzyme as rifampicin, RNAP, (and thus that have the same biochemical and therapeutic effects as rifampicin). There is also a need to develop methods for identifying antibiotics that interfere with bacterial RNAP.
  • Recently crystallographic structures have been determined for bacterial RNAP and eukaryotic RNAP II, and, based on the crystallographic structures, biophysical results, and biochemical results, models have been proposed for the structures of transcription initiation and elongation complexes (Gnatt et al., (2001) Science 292, 1876-1882; Ebright, R. (2000) J. Mol. Biol. 304, 687-689; Naryshkin et al., (2000 Cell 101, 601-611; Kim et al., (2000) Science 288, 1418-1421; Korzheva et al., (2000) Science 289, 619-625; and Mekler et al., (2002) Cell 108:599-614). The models propose that nucleic acids completely fill the active-center cleft of RNAP, such that the only route by which incoming nucleoside triphosphate substrates (NTPs) can access the active center is through an approximately 25 Å long, 10 Å wide tunnel known as the “secondary channel” or “pore,” that bores through the floor of the active-center cleft of RNAP opposite the active-center cleft. (Gnatt et al.,(2001 Science 292, 1876-1882; Ebright, R. (2000) J. Mol. Biol. 304, 687-689).
    • SUMMARY OF THE INVENTION
  • Applicant has discovered that a region within the secondary channel comprising two adjacent short peptide segments of the RNAP β′ subunit are conserved in amino-acid sequence in bacterial species, including both Gram-positive bacteria and Gram-negative bacteria. Throughout the following specification, this region is referred to as the “β′ pocket” or the “target,” and the two short peptide segments are referred to as “homologous secondary channel amino acids or amino acid sequences.” Applicant has also discovered that this same region is not conserved, and in fact is radically different, in amino-acid sequence in eukaryotic RNAP, such as human RNAP I, RNAP II, and RNAP III.
  • Accordingly, a first aspect of the present invention is directed to a method for identifying agents that bind to a homologous RNAP secondary channel amino acid sequence, comprising preparing a reaction solution comprising the agent to be tested and an entity containing a homologous secondary channel amino acid sequence; and detecting presence or amount of binding. In a preferred embodiment, detection or quantitation of binding is conducted relative to binding of the agent to an entity containing an altered homologous amino acid sequence. In other preferred embodiments, quantitation of binding is compared to binding of the 21-amino acid (GGAGHVPEYFVGOGTPISFYG) bacteriocidal peptide microcin J25 (“MccJ25”), or a derivative thereof, to the entity via the homologous secondary channel amino acid sequence.
  • Another aspect of the present invention is directed to a method for identifying agents that inhibit an activity of RNAP via binding to a homologous secondary channel amino acid sequence. This aspect entails preparing a reaction solution comprising the agent to be tested, a catalytic entity containing a homologous secondary channel amino acid sequence, and a substrate for the entity; and determining extent of inhibition of RNAP activity via binding of the agent to the homologous secondary channel amino acid sequence.
  • In some preferred embodiments, quantitation of inhibition is compared to binding of MccJ25 to the catalytic entity via the homologous secondary channel amino acid sequence. MccJ25 is active against Gram-negative bacteria (Delgado et al., (2001) J. Bacteriol. 183:4543-4550). It was recently discovered that RNAP is a target of MccJ25. (Delgado et al., (2001) J. Bacteriol. 183:4543-4550; Yuzenkova et al., (2002) J. Biol. Chem. 277:50867-50875). The present invention provides that analogs of MccJ25 inhibit transcription by requiring determinants within the β′ pocket. The invention also provides probe-labeled derivatives of MccJ25, which can be used for detailed analysis of MccJ25 and other β′-pocket-directed inhibitors of RNAP. In one aspect of the invention, probe-labeled derivatives of MccJ25 can be used in high-throughput screening, by assessing ability of compounds or compound mixtures to compete with a probe-labeled derivative of MccJ25 for binding to RNAP or an RNAP fragment containing the target. Thus, the invention has broad applications in analysis of RNAP structure and function, control of bacterial gene expression, control of bacterial growth, antibacterial chemistry, antibacterial therapy, and drug discovery.
  • A further aspect of Applicants' invention is directed to an analog of MccJ25 having an amino acid sequence that differs from MccJ25 in terms of at least one amino acid deletion, insertion, or substitution, and that binds bacterial RNAP or inhibits bacterial RNAP catalytic activity to a greater extent than MccJ25.
  • The present invention also provides for the identification of potential antibacterial agents or antibiotics that, because of their binding affinity to regions within RNAP that are conserved among bacteria, have broad-spectrum activity. It also provides for the identification of potential anti-bacterial agents or antibiotics that, because of their substantial lack of binding affinity for eukaryotic RNAPs, will be relatively non-disruptive to normal cellular functions of the host.
  • It is anticipated that compounds identified according to the target and method of this invention would have applications not only in antibacterial therapy, but also in: (a) identification of bacterial RNAP (diagnostics, environmental-monitoring, and sensors applications), (b) labeling of bacterial RNAP (diagnostics, environmental-monitoring, imaging, and sensors applications), (c) immobilization of bacterial RNAP (diagnostics, environmental-monitoring, and sensors applications), (d) purification of bacterial RNA polymerase (biotechnology applications), (e) regulation of bacterial gene expression (biotechnology applications), and (f) antisepsis (antiseptics, disinfectants, and advanced-materials applications).
  • These and other aspects of the present invention will be better appreciated by reference to the following drawings and Detailed Description.
  • The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
    • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 illustrates a sequence alignment for the target amino acid residues 736-747 and 779-781 of the β′ subunit of RNAP from Escherichia coli; and corresponding residues of the β′ subunits of Haemophilus influenzae, Vibrio cholerae, Pseudomonas aeruginose, Treponema pallidum, Borrelia burgdorferi, Xyella fastidiosa, Camploacter jejuni, Neisseria meningitides, Rickettsia prowazekii, Thermotoga maritime, Chlamydia trachomatis, Mycoplasma pneumoniae, Bacillus subtilis, Staphylococcus aureus, Mycobacterium tuberculosis, Synechocystis sp., Aquifex aeolicus, Deinococcus radiodurans, Thermus thermophilus, and Thermus aquaticus (collectively, “the homologous bacterial RNAP secondary channel amino acids”); and corresponding residues of the largest subunits of human RNAP I, RNAP II and RNAP III).
  • FIG. 2 illustrates a model showing the location of the target within the structure of RNAP.
  • FIG. 3 illustrates that MccJ25 does not inhibit open-complex formation. Results of electrophoretic mobility shift experiments assessing effects of MccJ25 on open-complex formation. RPo, RNAP-promoter open complex; P, free promoter DNA.
  • FIG. 4 illustrates that MccJ25 inhibits abortive initiation and elongation. (A) Results of transcription experiments assessing effects of MccJ25 on abortive initiation and elongation. (B) As (A), but with RNAP derivative bearing Thr931→Ile substitution in RNAP β′ subunit (see Delgado et al., 2001).
  • FIG. 5 illustrates that MccJ25 inhibits at the level of NTP uptake. (A) Results of transcription experiments assessing NTP-concentration-dependence of effects of MccJ25 on abortive initiation and elongation. (B) Double-reciprocal (Lineweaver-Burk) plot for inhibition of synthesis of 7-mer and 8-mer abortive products. Filled circles, no MccJ25; open circles, 1 μM MccJ25; filled triangles, 10 μM MccJ25; open triangles, 100 μM MccJ25. Data are from (A). Lines are fits to a partial-competitive model of inhibition (Ki=1.4±0.2 μM; α=15±3; r2=0.99). (C) Double-reciprocal (Lineweaver-Burk) plot for inhibition of synthesis of 3-mer and 4-mer abortive products. Filled circles, no MccJ25; open circles, 1 μM MccJ25; filled triangles, 10 μM MccJ25; open triangles, 100 μM MccJ25. Data are from fluorescence-detected abortive initiation assays (see Experimental Procedures). Lines are fits to a partial-competitive model of inhibition (Ki=1.2±0.3 μM; α=8 7±2; r2=0.97).
  • FIG. 6 illustrates that MccJ25 binds within the RNAP secondary channel. Schematic map of RNAP β′ subunit showing locations of conserved regions (conserved regions A-H lettered and shaded; additional conserved regions lightly shaded) and locations of substitutions that confer MccJ25-resistance (substitution of Delgado et al., 2001 in black; substitutions from random mutagenesis as red bars; and substitutions from saturation mutagenesis in pink). (B)-(D) Three-dimensional structure of RNAP showing locations of substitutions that confer MccJ25-resistance [substitution of Delgado et al., 2001 in red in (B); substitutions from random mutagenesis in red in (C); and substitutions from random and saturation mutagenesis in red in (D)]. Each panel presents a stereodiagram. In each panel, the view is directly into the RNAP secondary channel—toward the active-center Mg++ (white sphere at center). Atomic coordinates are based on the crystallographic structure of Thermus thermophilus RNAP at 2.6 Å resolution (Vassylyev et al., (2002) Nature 417, 712-719) PDB accession 1IW7; σ subunit omitted for clarity). Correspondences between residues of E. coli RNAP β′ and T. thermophilus RNAP β′ are based on a comprehensive sequence alignment of bacterial RNAP β′ subunits, archaeal RNAP A subunits, and eukaryotic RNAP largest subunits (unpublished).
    • BEST MODE OF CARRYING OUT THE INVENTION
  • The present invention provides methods of designing specific inhibitors of bacterial RNAP, the enzyme responsible for transcription. The present invention also provides for the design of small-molecule inhibitors (i.e., diameter <20 Å, MW≦2.1 kDa) that bind, with a kd<1 μM, to a target site that is highly conserved in bacterial RNAP, but distinctly different in eukaryotic RNAP. The invention provides targets and methods for specific binding and inhibition of RNAP from bacterial species. The invention has applications in control of bacterial gene expression, control of bacterial growth, antibacterial chemistry, and antibacterial therapy.
  • Recently, crystallographic structures have been determined for bacterial RNAP and eukaryotic RNAP II (Zhang et al., (1999) Cell 98, 811-824; Cramer et al., (2000) Science 288, 640-649; Cramer et al., (2001) Science 292, 1863-1876; Gnatt et al., (2001 Science 292, 1876-1882; and Ebright, R. (2000) J. Mol. Biol. 304, 687-689), and, based on the crystallographic structures, biophysical results, and biochemical results, models have been proposed for the structures of transcription initiation and elongation complexes (Gnatt et al., (2001) Science 292, 1876-1882; Ebright, R. (2000) J. Mol. Biol. 304, 687-689; Naryshkin et al., (2000 Cell 101, 601-611; Kim et al., (2000) Science 288, 1418-1421; Korzheva et al., (2000) Science 289, 619-625; and Mekler et al., (2002) Cell 108:599-614).
  • The models for the transcription elongation complex imply that nucleic acids completely fill the active-center cleft of RNAP, and thus the only route by which incoming nucleoside-triphosphate substrates (“NTPs”) can access the active center is through a ˜25 Å long, ˜10 Å wide tunnel—the “secondary channel” or “pore”—that bores through the floor of the active-center cleft of RNAP and extends to the exterior surface of RNAP opposite the active-center cleft (Gnatt et al., (2001) Science 292, 1876-1882; Ebright, R. (2000) J. Mol. Biol. 304, 687-689; and Korzheva et al., (2000) Science 289, 619-625).
  • The models for the transcription elongation complex imply that the RNAP secondary channel mediates multiple biochemical activities important for function of RNAP, including: uptake of NTPs, release of pyrophosphate product, release of abortive-RNA and edited-RNA products, interaction with RNA product during transcriptional pausing, interaction with RNA product during transcriptional arrest, interaction with RNA product during editing, and interaction with the elongation factors GreA and GreB.
  • It has now been found, and is disclosed herein, that physically blocking the RNAP secondary channel with a small molecule inhibits at least one of these activities. Specifically, it has now been found, and is disclosed herein, that physically blocking the RNAP secondary channel with a small molecule prevents uptake of NTPs by RNAP and thus inhibits transcription.
  • The present invention is based in part on Applicant's discovery that a region within the RNAP secondary channel comprising amino acids 736-747 and 779-781 of the RNAP β′ subunit from Escherichia coli (the “β′ pocket” or “target”) is a useful target for compounds that block transcription. It was found that said pocket is lined with residues that are invariant or nearly invariant in RNAP from bacterial species, but that are radically different in RNAP from eukaryotic species (FIG. 1). It further was found that this region forms a ˜5 Å shallow pocket within the wall of the RNAP secondary channel (FIG. 2).
  • Models for the transcription elongation complex suggest that nucleic acids completely fill the active channel of RNAP; and thus that the only route by which incoming nucleoside-triphosphate (NTP) substrates can access this active center is through this secondary channel. The present invention therefore relates to molecules that bind to the secondary channel of RNAP from Escherichia coli, or in corresponding regions of RNAP from other bacterial species. In a preferred embodiment, the present invention relates to molecules that bind to RNAP in the secondary channel of RNAP from Escherichia coli, or in corresponding regions of RNAP from other bacterial species and prevent RNAP from carrying out at least one biochemical activity with which the secondary channel is associated (e.g., uptake of NTP substrates, release of pyrophosphate product, release of edited nucleotide and oligonucleotide products, interaction with RNA product during transcriptional pausing, interaction with RNA product during transcriptional arrest, interaction with RNA product during editing, and interaction with the elongation factors GreA and GreB). In one aspect of the present invention, methods and compositions are described involving compounds that specifically block the secondary channel of RNAP resulting in inhibition of transcription.
  • The target referred to above in Escherichia coli is similar in amino acid sequence to that of most or all other species of bacterial RNAP and is called herein the homologous bacterial RNAP secondary channel (FIG. 1). (For example, amino acid residues 736-747 and 779-781 of the β subunit of RNAP from Escherichia coli exhibit high similarity to amino acid residues 740-751 and 783-785 of the β′ subunit of RNAP from Bacillus subtilis (FIG. 1).) Thus, the discovery of a molecule that binds to the target and inhibits an activity associated with the secondary channel in Escherichia coli RNAP also is likely to bind to the target an inhibit an activity associated with the secondary channel in other species of bacterial RNAP. Therefore, molecules found to be have antibiotic activity (through binding to the target and inhibiting an activity associated with the secondary channel) against Escherichia coli are likely to be found to have antibiotic activity against other bacterial species.
  • In contrast, the target differs radically in amino acid sequence between bacterial RNAP and eukaryotic RNAP, including human RNAP I, RNAP II, and RNAP III (FIG. 1). This allows for the identification of molecules that bind, in a target-dependent fashion, to bacterial RNAP, but that do not bind, or that bind substantially less well, to eukaryotic RNAP. This also allows for the identification of molecules that inhibit, in a target-dependent fashion, an activity of to bacterial RNAP, but that do not inhibit, or that inhibit substantially less well, an activity of eukaryotic RNAP. This differentiation is important, because it permits the identification of bacterial-RNAP-selective binding molecules and bacteria-selective inhibitors.
  • The invention provides, by way of example only, a target region corresponding to, and alignable with residues 736-747 and 779-781 of the β′ subunit of RNAP from Escherichia coli; as well as corresponding residues of the β′ subunit of Bacillus subtilis, Haemophilus influenzae, Vibrio cholerae, Pseudomonas aeruginosa, Treponema pallidum, Borrelia burgdorferi, Xyella fastidlosa, Campylobacter jejuni, Neisseria meningitidis, Rickettsia prowazekii, Thermotoga maritima, Chlamydia trachomatis, Mycoplasma pneumoniae, Staphylococcus aureus, Mycobacterium tuberculosis, Synechocystis sp., Aquifex aeolicus, Deinococcus radiodurans, Thermus thermophilus, and Thermus aquaticus.
  • The present invention further relates to a method for identifying molecules that bind to the β′ pocket through the use of an assay for molecules that bind to RNAP in a β′-pocket-specific fashion. In one embodiment, Escherichia coli RNAP or a fragment thereof containing the β′ pocket, is used as the test protein for binding, and a derivative of said RNAP or RNAP fragment having at least one a substitution, an insertion, or a deletion within the β′ pocket is used as the control protein for target-site specificity of binding. “Hits” can be analyzed for binding and inhibition of Gram-negative-bacterial RNAP, Gram-positive-bacterial RNAP, and eukaryotic RNAP I, RNAP III and RNAP III, in vivo and in vitro. “Hits” also can be characterized structurally by x-ray diffraction analysis of co-crystals with RNAP or an RNAP fragment containing the β′ pocket.
  • The invention also provides strategies to identify small-molecule inhibitors from compound libraries. By way of example, two strategies are described as follows: (a) selection of molecules that bind to RNAP, or a fragment thereof, in a β′-pocket-dependent fashion (affinity selection of phage-displayed linear and cyclic decapeptide libraries), and (b) screening for molecules that inhibit transcription in a β′-pocket-dependent fashion (iterative deconvolution of solution-phase linear and cyclic D-hexapeptide libraries). In each case, the invention provides the use of a wild-type bacterial RNAP, or fragment thereof, as the test protein for binding/inhibition, and a derivative of bacterial RNAP, or a fragment thereof, having at least one substitution, insertion, or deletion within the β′ pocket as the control protein for β′-pocket dependence of binding/inhibition.
  • The invention also provides for a method of identifying a compound for use as an inhibitor of bacterial RNAP comprising: analyzing a compound or a compound library, that involves docking to, modeling of, geometric calculations with, and/or energetic calculations with, a portion of the structure of an RNAP from a bacterial species comprising at least one residue within the set of residues corresponding to, and alignable with, the target.
  • The invention provides for at least three drug-discovery assay methods: a) screening based on binding of a compound within the secondary channel of a bacterial RNAP or fragment thereof; b) screening based on inhibition of an activity associated with the secondary channel of a bacterial RNAP or fragment thereof; and c) screening based on displacement of a compound, containing a detectable group, from the secondary channel of a bacterial RNAP or a fragment thereof.
  • One of the embodiments of the present invention is an assay system designed to identify compounds that bind a bacterial RNAP, or a fragment thereof, in a manner that requires the β′ pocket. The assay is designed to measure the binding of a compound to a determinant that includes at least one amino acid residue contained within a set of amino acid residues identifiable by sequence alignment and/or structure alignment as corresponding to amino acid residues 736-747 and 779-781 of Escherichia coli RNAP β or to amino acid residues 740-751 and 783-785 of Bacillius subtilis RNAP β′.
  • One of the embodiments of the present invention is an assay system designed to identify compounds that inhibit an activity of a bacterial RNAP, or a fragment thereof, in a manner that requires the β′ pocket. The assay is designed to measure the inhibition of an activity, said inhibition involving the binding of a compound to a determinant that includes at least one amino acid residue contained within a set of amino acid residues identifiable by sequence alignment and/or structure alignment as corresponding to amino acid residues 736-747 and 779-781 of Escherichia coli RNAP β′ or to amino acid residues 740-751 and 783-785 of Bacillius subtilis RNAP β′.
  • Another embodiment of the present invention is an assay designed to measure the binding of a compound to a bacterial RNAP derivative, or a fragment thereof, containing at least one amino acid substitution, insertion, or deletion within a set of amino acid residues identifiable by sequence alignment and/or structure alignment as corresponding to amino acid residues 736-747 and 779-781 of Escherichia coli RNAP β′ or to amino acid residues 740-751 and 783-785 of Bacillius subtilis RNAP β′.
  • Another embodiment of the present invention is an assay designed to measure the inhibition of an activity of a bacterial RNAP derivative, or a fragment thereof, containing at least one amino acid substitution, insertion, or deletion within a set of amino acid residues identifiable by sequence alignment and/or structure alignment as corresponding to amino acid residues 736-747 and 779-781 of Escherichia coli RNAP β′ or to amino acid residues 740-751 and 783-785 of Bacillius subtilis RNAP β′.
  • Isolation of RNAP:
  • The bacterial RNAP, or RNAP derivative, can be isolated from bacteria, produced by recombinant methods, or produced through in vitro protein synthesis. Various compounds can be introduced to determine whether a tested compound binds to, inhibits an activity of, or displaces a detectable-group containing molecule from, the bacterial RNAP or RNAP derivative in a β′-pocket-dependent manner.
  • Tested compounds can include antibodies, peptides, and various chemical compounds. Additionally, with the known amino acid sequence for a particular RNAP, one of skill in the art could design specific inhibitors. The tested compounds can be chosen from chemical libraries, or a computer model can be used to choose compounds that are likely to be effective based on the known structure of the secondary channel, the β′ pocket, and the structure of the compound.
  • The assay system can be performed in vivo or in vitro and thus does not necessarily require isolation of the RNAP.
  • The compounds can also be tested for competitive inhibition. Preferred strategies for identifying inhibitors include: 1) through affinity selection of phage-displayed linear and cyclic decapeptide libraries and 2) through iterative deconvolution of solution-phase linear and cyclic D-hexapeptide libraries. Wild type E. coli RNAP is the preferred test protein for binding and inhibition and [Val744;Gln746]β′-RNAP (a derivative of E. coli RNAP having substitutions at two positions in the β′ (738-747) pocket) as the control protein. Deconvolution essentially entails the resynthesis of that combinatorial pool or mixture that was found to be active in screening against a target of interest. Resynthesis may result in the generation of a set of smaller pools or mixtures, or a set of individual compounds. Rescreening and iterative deconvolution are performed until the individual compounds that are responsible for the activity observed in the screens of the parent mixtures are isolated.
  • Phage Display-General Method: Searching for Peptide Ligands With an Epitope Library:
  • Tens of millions of short peptides can be easily surveyed for tight binding to an antibody, receptor or other binding protein using an “epitope library.” (See (1990) Science 249:386; (1990) Science 249:404; and (1990) Proc. Natl. Acad. Sci. 87:6378). The library is a vast mixture of filamentous phage clones, each displaying one peptide sequence on the virion surface. The survey is accomplished by using the binding protein to affinity-purify phage that display tight-binding peptides and propagating the purified phage in Escherichia coli. The amino acid sequences of the peptides displayed on the phage are then determined by sequencing the corresponding coding region in the viral DNA's. Potential applications of the epitope library include investigation of the specificity of antibodies and discovery of mimetic drug candidates.
  • “Fusion phage” are filamentous bacteriophage vectors in which foreign antigenic determinants are cloned into phage gene III and displayed as part of the gene III protein (pIII) at one tip of the virion. Fusion phage whose displayed determinant binds an antibody (Ab) can be selected from a vast background of nonbinding phage by affinity purification (AP) as follows: First, phage are reacted with biotinylated Ab (bio-Ab), then diluted and placed on a streptavidin-coated petri dish, thereby specifically attaching Ab-reactive phage to the plastic surface through the Ab-biotin-streptavidin bridge. Free phage are washed away, and bound phage eluted in acid and used to infect Escherichia coli cells. A single round of AP can enrich Ab-binding phage by as much as a factor of 105 relative to unreactive phage; further enrichment is achieved by further rounds of AP after amplification on agar medium. Thus, Ab serves as a powerful selective agent favoring the target clones, so that vast numbers of phage can be surveyed.
  • The idea of using fusion phage to develop an “epitope library” (Parmley and G. P. Smith, (1988) Gene 73:305) was inspired by the synthetic “mimotope” strategy of Geysen et al. (See Synthetic Peptides as Antigens; Ciba Foundation Symposium 119, R. Porter and J. Wheelan, Eds. (Wiley, New York. 1986), pp. 131-149). By synthesizing peptide mixtures on plastic pins and assessing their ability to bind an Ab against a protein antigen, these workers delineated a peptide that mimics a discontinuous epitope—an Ab-binding determinant composed of residues distant in the primary sequence but adjacent in the folded structure. They called these peptide mimics mimotopes. In this way ligands can be discovered for an Ab whose specificity is not known in advance.
  • Fusion phage displaying short cloned peptides are infectious analogs of chemically synthesized mimotopes, with the key advantages of replicability and clonability. A large library of such phage—an “epitope library”—may display tens of millions of peptide epitopes. The peptides can in effect be individually surveyed for binding to an Ab or other binding protein by affinity purifying reactive phage from the library, propagating individual phage clones, and sequencing the relevant part of their DNA's to determine the amino acid sequences of their displayed peptides. A survey based on the epitope library undoubtedly would be imperfect because of bias introduced by the biology of the phage and other factors; still, it would represent a powerful new approach to the study of the specificity of Ab's and other binding proteins. (See Scott and Smith (1990) Science 249:386; Devlin et al., (1990) Science 249:404; Ciwirla et al., (1990) Proc. Natl Acad. Sci. 87:6378; McLafferty et al., (1993) Gene 128:29; Alessandra et al., (1993) Gene 128:51; McConnell et al., (1994) Gene 151:115, which are incorporated herein by reference).
  • Iterative Deconvolution Approach:
  • See the following reference for a general discussion of iterative deconvolution: (Ostresh et al., (1996) Meths. Enzym. 267:220, which is incorporated herein by reference). The practical development of synthetic combinatorial libraries (SCLs) made up of tens of millions of compounds has proven to be a powerful source for the identification of novel biologically active compounds such as analgesics, antibacterials, antifungals, and enzyme inhibitors. (See Pinilla et al., (1994) Drug Dev. Res. 33:133; Pinilla et al., (1995) Pept. Sci. 37:221; Gallop et al., (1994) J. Med. Chem. 37:1233). In particular, a range of new compounds having potent antimicrobial and/or antifungal activities have been rapidly identified from pools of millions of compounds. (See Blondelle et al., (1995) J. Appl. Bacteriol. 78:39; Blondelle et al., (1994) Antimicrob. Agent Chemother. 38:2280; Ostresh et al., (1994) Proc. Nail. Acad. Sci. U.S.A. 91:11138; Houghten et al., (1992) Bio Techniques 13:412; Houghten et al., (1991) Nature 354: 84).
  • Nonsupport-bound SCLs, originally composed of millions of peptides, were shown to be usable in virtually any assay system (including those involving membrane-bound acceptors or whole cell organisms). In an expansion of SCL concepts and diversities, the original peptide SCLs have been transformed (i.e., peralkylated and/or exhaustively reduced) using a “libraries from libraries” approach (Ostresh et al., (1994) Proc. Nail. Acad. Sci. U.S.A. 91:11138; Dörner et al., in ”Peptides 1994: Proceedings of the 23rd European Peptide Symposium” (H. L. S. Maia, ed.), p. 463. Escom, Leiden, 1995; and Cuervo et al., Id. at page 465) to yield peptidomimetic and organic libraries having entirely different physical, chemical, and biological properties relative to the peptide SCLs used as starting materials. The screening of such libraries has yielded active compounds derived from entirely different sequences than the active peptides previously identified from the starting SCLs using the same assay.
  • Two approaches can be employed for the structural deconvolution of active compounds from assay data using nonsupport-bound SCLs: the “iterative” approach and the “positional scanning” approach. In addition, two synthetic methods were developed for the incorporation of multiple functionalities at diverse positions within an SCL. As first illustrated for peptides, (See Houghten et al., (1992) Bio Techniques 13:412; and Houghten et al., (1991) Nature 354: 84, which are incorporated herein by reference). The first synthetic method, known as the “divide, couple, and recombine” (DCR) (Id.) or “split resin” (Lam et al., (1991) Nature 354:82) method, has typically been used with the iterative deconvolution approach. The second synthetic method, which involves the use of a predefined chemical ratio of protected amino acids at each coupling step for incorporation of mixture positions, Ostresh et al., (1994) Biopolymers 34:1681) has been developed for use with the positional scanning deconvolution process (Pinilla et al., (1992) BioTechniques 13:901). This latter method offers the advantage that both defined and mixture positions are easily incorporated at any position in a sequence.
  • These synthesis and deconvolution methods have been used to identify individual active compounds in a wide variety of SCLs and assays. (Pinilla et al., (1994) Drug Dev. Res. 33:133; Pinilla et al., (1995) Pept. Sci. 37:221). More specifically, individual compounds from nonsupport-bound SCLs have been identified which have potent antimicrobial activity against gram-positive bacteria (Staphylococcus aureus, Streptococcus sanguis), gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa), and fungi (Candida albicans). The iterative deconvolution approach will be illustrated here for the preparation of a dual-defined position hexapeptide SCL, designated OOXXXX-NH2 (where O represents a defined amino acid, and X represents a mixture of amino acids) using the DCR method. The mixtures making up this library have been assayed for antimicrobial and/or antifungal activity (Blondelle et al., (1995) Trends Anal. Chem. 14:83; Houghten et al., (1992) Bio Techniques 13:412; and Houghten et al., (1991) Nature 354:84) in order to identify the first two amino acid residues of active hexapeptide sequences. The remaining four positions were then identified sequentially through an iterative process of synthesis and screening. This process can be completed in 6 to 10 weeks (four separate iterative synthesis steps are required). The positional scanning approach, involves the screening of separate single position SCLs to identify the most effective amino acids at each position of the sequence. When used in concert, this information can be used to identify individual active sequences. This process can be completed in approximately 2 weeks (only one synthesis step is required for confirmation of activity).
  • Both iterative and positional scanning peptide SCLs have been used as starting materials for the generation of peptidomimetic SCLs using the “libraries from libraries” approach.
  • Synthesis:
  • Iterative Peptide Libraries: As mentioned earlier, these libraries are prepared using the DCR process (Houghten et al., (1991) Nature 354:84) (in conjunction with simultaneous multiple peptide synthesis (SMPS), (Houghten, (1985) Proc. Natl. Acad. Sci. U.S.A. 82:5131) also known as the “tea bag” approach. Standard t-butyloxycarbonyl (Boc)-based peptide synthesis protocols are typically used to couple protected amino acids (Bachem, Torrance, Calif.) to methylbenzhydrylamine (MBHA)-derivatized polystyrene resin (Peninsula, Belmont, Calif.). Fluorenylmethyloxycarbonyl (Fmoc)-based chemistry strategies can also be used. During preparation of the initial library, a portion of each resin mixture (i.e., X-resin, XX-resin, XXX-resin, etc) is held back for synthesis of the subsequent peptide mixtures during the iterative process in which additional positions are sequentially defined. While up to 76 amino acids have been used in the mixture positions, cysteine is normally omitted from the mixture positions of an SCL to prevent polymerization side reactions. It should be noted that for libraries synthesized by the DCR method, the number of resin beads used should be 10 to 100 times higher than the final number of individual compounds in a resin mixture in order to ensure statistical representation of each peptide in the library (Gallop et al., (1994) I. Med. Chem. 37:1233). The generation of a dual-defined position SCL made up of L-amino acid hexapeptides (designated OOXXXX-NH2) is described here to illustrate the DCR methodology. This library contains approximately 52 million (202×19 4) different peptides.
  • The practical use of nonsupport-bound combinatorial libraries represents an important breakthrough in all areas of basic research and drug discovery. The use of a wide variety of chemical transformations permits a range of peptidomimetic libraries to be generated, which greatly expands the chemical diversity available. The results described in this chapter demonstrate that an existing peptide PS-SCL can be chemically transformed to generate a peptidomimetic SCL from which highly active individual compounds can be identified. The synthesis and deconvolution methods developed for peptide libraries are easily applied to other types of chemical pharmacophores. The soluble nature of the nonsupport-bound combinatorial libraries is a distinct advantage over other methods in that membrane-bound and whole cell assays can also be used. In addition, the deconvolution methods used allow the chemical structure of peptidic, peptidomimetic, and organic compounds to be determined based solely on the structural similarities of compounds within each active pool or sublibrary.
  • Screening for an Inhibitor of Bacterial RNAP:
  • One aspect of the invention provides high throughput screening of molecules specific to the bacterial RNAP target. This can be done in many different ways well known in the art. For example, this could be done by attaching bacterial RNAP to the bottom of the wells of a 96-well plate at an appropriate concentration by incubating the RNAP in the well overnight at 4° C. Alternatively, the wells are first coated with compositions of polylysine that facilitates the binding of the bacterial RNAP to the wells. Following attachment, samples from a library of test compounds (concentrations are determined by the compound being tested) are added (along with an appropriate binding buffer known in the art) to the wells and incubated for a sufficient time and temperature to facilitate binding. Following the incubation, the wells are washed with an appropriate washing solution at 4° C. Increasing or decreasing salt and/or detergent concentrations in the wash varies the stringency of the washing steps. Detection of binding is accomplished using antibodies (representative examples include RIA and ELISA), biotinylation, biotin-streptavidin binding, and radioisotopes. The concentration of the sample library compounds is also varied to calculate a binding affinity by Scatchard analysis. Binding to the bacterial RNAP target identifies a “lead compound”. Once a lead compound is identified, the screening process is repeated using compounds chemically related to the lead compound to identify compounds with the tightest binding affinities. Selected compounds having binding affinity are further tested in one of two assays. These assays use test compounds from 1) phage-displayed linear and cyclic decapeptide libraries and 2) iterative deconvolution of solution-phase linear and cyclic D-hexapeptide libraries.
  • A phage library can be used to test compounds that could bind to the β′ pocket of bacterial RNAP. The phage library is constructed in the N-terminal region of the major coat protein pVIII, as previously described (Felici et al., 1991). In addition, in an attempt to define a more constrained context, two Cys are included as invariant residues flanking the random nonapeptide. Transformation yields approximately 1×108 independent clones, and the presence of a productive insert is indicated by the blue color of the colonies on Xgal/IPTG plates (Felici et al., 1991). The construction of the library results in hybrid capsids, expressing the random peptides, dispersed along wt pVIII copies. The absence of the Cys in wt pVIII allows one to detect the presence of free thiol groups in the hybrid capsids. Clones are analyzed with a Cys-specific recompound (DIG protein detection kit, Boehringer Mannheim, Germany) in order to show some of the peptides are in cyclized form. This indicates that in many cases the insert is displayed as a loop structure, which limits its mobility. Phage affinity purification is performed utilizing the biopanning technique, as previously described by Parmley and Smith (1988). After the round of biopanning, 104 phage out of the initial 1010 are eluted from a streptavidin-coated plate. The phage are screened directly with a plaque assay. Single plagues (105) are transferred onto nitrocellulose and probed with RNAP. Positive plaques are eluted from nitrocellulose, the phage are amplified and sequenced, and their reactivity is further confirmed by dot-blot analysis. The amino acid sequences are then deduced.
  • Biologically active compounds are selected from large populations of randomly generated sequences. Libraries are made up of six-residue peptide sequences with amidated carboxy-termini and either acetylated or non-acetylated amino-termini. The first two amino acids in each peptide chain are individually and specifically defined, while the last four amino acids consist of equimolar, or close to equimolar, mixtures of 19 of the 20 naturally occurring L-amino acids, cysteine is omitted from the mixture positions of the two libraries but included in the defined positions. The peptides in these libraries are generally represented as Ac—O1O2XXXX—NH2 and O1O2XXXX—NH2, where O1 and O2 are defined positions, which are represented by the single letters AA, AC, AD and so on up to and including YV, YW, YY, to reach a total of 400 (202) combinations, and each X position is represented by an equimolar mixture of the 19 natural amino acids (non-natural amino acids can be used as well). Four mixture positions (XXXX) result in a total of 130,321 (194) different combinations. Each of the 400 different peptide mixtures that make up each of the libraries thus consists of 130,321 individual hexamers; in total, 52,321,400 peptides are represented. The peptides are attached to a resin or alternatively cleaved from the resin, extracted and lyophilized before use. Each nonsupport-bound peptide mixture is typically used at a concentration of 1 mg/ml. Therefore, if one assumes that the average molecular weight of Ac—O1O2XXXX—NH2 is 785, then a mixture of 130,321 peptides at a total final concentration of 1 mg/ml yields a concentration of every peptide within each mixture of 7.67 ng/ml (9.8 nM), sufficiently high for most biologically significant interactions if even a single peptide sequence is active. After the mixture of libraries is screened for binding to bacterial RNAP, the remaining mixture positions are defined through an iterative enhancement and selection process in order to identify the most active sequence. An extremely rapid alternative method for identifying active compounds is the positional scanning approach. In this approach, if one uses a library made up of peptides, for example, each of the individual sub-libraries (one for each position along the peptide) that make up the positional scanning library is composed of 18 different peptide mixtures. Each position is defined (represented as 0) and occupied by one of 18 of the 20 natural L-amino acids (cysteine and tryptophan are omitted); the remaining five positions of the six-residue sequence are composed of mixtures (represented as X) of the same 18 amino acids. The six different sub-libraries vary only in the location of their defined amino acids, they can therefore be represented as: Ac—O1XXXXX—NH2, Ac—XO2XXXX—NH2, Ac—XXO3XXX—NH2, Ac—XXXO4XX—NH2, AC-XXXXO5X—NH2, and Ac—XXXXXO6—NH2. As each peptide mixture represents 1,889,568 (185) individual sequences, each of the six positional sub-libraries contains in total 34,012,224 (18×1,889,568) different compounds. Alternatively, each of the six individual sub-libraries (for example, Ac—XXXO4XX—NH2) can be examined independently and moved forward in an interactive fashion. When used in concert, however, this set of 108 mixtures constitutes a positional scanning library.
  • Screening Assays for Compounds that Interfere with the Interaction of RNAP Target and MCCJ25:
  • The β pocket of bacterial RNAP—which contains the target—and compounds which interact and bind are sometimes referred to herein as “binding partners.” Any of a number of assay systems may be utilized to test compounds for their ability to interfere with the interaction of the binding partners. However, rapid, high-throughput assays for screening large numbers of compounds, including but not limited to ligands (natural or synthetic), peptides, or small organic molecules are preferred. Compounds that are so identified to interfere with the interaction of the binding partners should be further evaluated for binding or inhibitory activity in cell based assays, animal model systems and in patients as described herein. The basic principle of the assay systems used to identify the compounds of the present invention is based on the identification of compounds that interfere with the interaction between the target and MccJ25, which involves preparing a reaction mixture containing a bacterial RNAP, or RNAP fragment or derivative containing the secondary channel, and MccJ25 under conditions and for a time sufficient to allow the two binding partners to interact and bind, thus forming a complex. In order to test a compound for inhibitory activity, the reaction is conducted in the presence and absence of the test compound; i.e., the test compound may be initially included in the reaction mixture, or added at a time subsequent to the addition of the bacterial RNAP, or RNAP fragment or derivative containing the secondary channel, and MccJ25; controls are incubated without the test compound. The formation of a complex between the bacterial RNAP secondary channel and MccJ25 then is detected. The formation of a complex in the control reaction, but not, or to a lesser extent, in the reaction mixture containing the test compound indicates that the compound interferes with the interaction between the bacterial RNAP, or RNAP fragment or derivative containing the secondary channel, and MccJ25.
  • The assay components and various formats that may be utilized are described in the subsections below.
  • Assay Components:
  • The bacterial RNAP, or RNAP fragment or derivative containing the secondary channel, and MccJ25 binding partners used as components in the assay may be derived from natural sources, e.g., purified from bacterial RNAP, respectively, using protein separation techniques well known in the art; produced by recombinant DNA technology using techniques known in the art (see e.g., Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories Press, Cold Spring Harbor, N.Y); and/or chemically synthesized in whole or in part using techniques known in the art; e.g., peptides can be synthesized by solid phase techniques, cleaved from the resin and purified by preparative high performance liquid chromatography (see, e.g., Creighton, 1983, Proteins: Structures and Molecular Principles, W. H. Freeman & Co., N.Y., pp. 50-60). The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing; e.g., using the Edman degradation procedure (see e.g., Creighton, 1983, supra at pp. 34-49).
  • One of the binding partners used in the assay system should be labeled, either directly or indirectly, to facilitate detection of a complex formed between the bacterial RNAP secondary channel and MccJ25. Any of a variety of suitable labeling systems may be used including but not limited to radioisotopes such as 125I and 32P; enzyme labelling systems that generate a detectable calorimetric signal or light when exposed to substrate; and fluorescent labels.
  • Fluorescent labels are preferred. Cyanine fluorescent labels are especially preferred. Cyanine labels incorporated at residue 13 or 15 of MccJ25 are especially preferred.
  • Where recombinant DNA technology is used to produce the bacterial RNAP, or RNAP fragment or derivative containing the secondary channel, and MccJ25 binding partners of the assay it may be advantageous to engineer fusion proteins that can facilitate labeling, immobilization and/or detection. For example, the coding sequence of the bacterial RNAP secondary channel can be fused to that of a heterologous protein that has enzyme activity or serves as an enzyme substrate in order to facilitate labeling and detection. The fusion constructs should be designed so that the heterologous component of the fusion product does not interfere with binding of the bacterial RNAP secondary channel and MccJ25.
  • Indirect labeling involves the use of a third protein, such as a labeled antibody, which specifically binds to the bacterial RNAP secondary channel. Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by an Fab expression library.
  • For the production of antibodies, various host animals may be immunized by injection with the bacterial RNAP secondary channel. Such host animals may include but are not limited to rabbits, mice, and rats, to name but a few. Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
  • Monoclonal antibodies may be prepared by using any technique, which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein, (Nature, 1975, 256:495-497), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today, 4:72, Cote et al., 1983, Proc. Natl. Acad. Sci., 80:2026-2030) and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In addition, techniques developed for the production of “chimeric antibodies” (Morrison et al., 1984, Proc. Natl. Acad. Sci., 81:6851-6855; Neuberger et al., 1984, Nature, 312:604-608; Takeda et al., 1985, Nature, 314:452-454) by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. Alternatively, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce single chain antibodies specific to the bacterial RNAP secondary channel.
  • Antibody fragments, that recognize specific epitopes may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab′)2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab′)2 fragments. Alternatively, Fab expression libraries may be constructed (Huse et al., 1989, Science, 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.
  • Assay Formats:
  • The assay can be conducted in a heterogeneous or homogeneous format. A heterogeneous assay is an assay in which reaction results are monitored by separating and detecting at least one component during or following reaction. A homogeneous reaction is an assay in which reaction results are monitored without separation of components. In either approach, the order of addition of reactants can be varied to obtain different information about the compounds being tested. For example, test compounds that interfere with the interaction between the binding partners, e.g., by competition, can be identified by conducting the reaction in the presence of the test substance; i.e., by adding the test substance to the reaction mixture prior to or simultaneously with the bacterial RNAP secondary channel and MccJ25. On the other hand, test compounds that disrupt preformed complexes, e.g. compounds with higher binding constants that displace one of the binding partners from the complex, can be tested, by adding the test compound to the reaction mixture after complexes have been formed. The various formats are described briefly below.
  • In one example of a heterogeneous assay system, one binding partner, e.g., either the bacterial RNAP secondary channel or MccJ25, is anchored onto a solid surface, and its binding partner, which is not anchored, is labeled, either directly or indirectly. In practice, microtiter plates are conveniently utilized. The anchored species may be immobilized by non-covalent or covalent attachments. Alternatively, an immobilized antibody specific for the bacterial RNAP secondary channel may be used to anchor the bacterial RNAP secondary channel to the solid surface. The surfaces may be prepared in advance and stored.
  • In order to conduct the assay, the binding partner of the immobilized species is added to the coated surface with or without the test compound. After the reaction is complete, unreacted components are removed (e.g., by washing) and any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the binding partner was pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the binding partner is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the binding partner (the antibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody). Depending upon the order of addition of reaction components, test compounds which inhibit complex formation or which disrupt preformed complexes can be detected.
  • Alternatively, the reaction can be conducted in a liquid phase in the presence or absence of the test compound, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific for an epitope on the bacterial RNAP secondary channel to anchor any complexes formed in solution. Again, depending upon the order of addition of reactants to the liquid phase, test compounds which inhibit complex or which disrupt preformed complexes can be identified.
  • In a preferred embodiment of the invention, a homogeneous assay can be used. In this approach, a preformed complex of the bacterial RNAP secondary channel and MccJ25 is prepared in which one of the binding partners is labeled, but the signal generated by the label is quenched due to complex formation (see, e.g., U.S. Pat. No. 4,109,496 by Rubenstein, which utilizes this approach for immunoassays). The addition of a test substance that competes with and displaces one of the binding partners from the preformed complex will result in the generation of a signal above background. In this way, test substances, which disrupt the bacterial RNAP secondary channel and MccJ25 interaction can be identified.
  • One aspect of the invention provides for developing methods to use fluorescence resonance energy transfer (FRET)-based homogeneous assays to provide probe-labelled derivatives of the MccJ25. (Förster, 1948; reviewed in Lilley and Wilson. 2000; Selvin, 2000; Mukhopadhyay et al., 2001; Mekler et al., 2002). FRET occurs in a system having a fluorescent probe serving as a donor and a second fluorescent probe serving as an acceptor, where the emission wavelength of the donor overlaps the excitation wavelength of the acceptor. In such a system, upon excitation of the donor with light of its excitation wavelength, energy can be transferred from the donor to the acceptor, resulting in excitation of the acceptor and omission at the acceptor's emission wavelength.
  • With commonly used fluorescent probes, FRET permits accurate determination of distances in the range of ˜20 to ˜100 Å. FRET permits accurate determination of distances up to more than one-half the diameter of a transcription complex (diameter ˜150 Å; Zhang et al. 1999; Cramer et al., 2001; Gnatt et al., 2001).
  • A preferred assay involves monitoring of FRET between a fluorescent-probe-labeled derivative of a bacterial RNAP and a fluorescent-probe-labeled derivative of MccJ25.
  • An especially preferred assay involves monitoring of FRET between a coumarin-dye-labeled derivative of a bacterial RNAP and a cyanine-dye-labeled derivative of MccJ25. Especially preferred sites of labeling of RNAP for this purpose include residue 14, residue 59, or residue 517 of Escherichia coli RNAP σ70 subunit, or a corresponding residue, identifiable by sequence and/or structural alignment, of another bacterial RNAP σ subunit. Especially preferred sites of labeling of MccJ25 for this purpose include residue 13 and residue 15.
  • In accordance with the invention, a given compound found to inhibit one bacterium may be tested for general antibacterial activity against a wide range of different bacterial species. For example, and not by way of limitation, a compound that inhibits the interaction of Escherichi coli RNAP, or a RNAP fragment or derivative thereof containing the secondary channel, of with MccJ25 can be tested, according to the assays described infra, against Haemophilus influenzae.
  • Assays for Antibacterial Activity:
  • Any of the inhibitory compounds, which are identified in the foregoing assay systems, may be tested for antibacterial activity in any one of the various microbiological assays known to the skilled worker in the field of microbiology.
  • Animal Model Assays:
  • The most effective inhibitors of bacterial RNAP identified by the processes of the present invention can then be used for subsequent animal experiments. The ability of an inhibitor to prevent bacterial infection can be assayed in animal models that are natural hosts for bacteria. Such animals may include mammals such as pigs, dogs, ferrets, mice, monkeys, horses, and primates. As described in detail herein, such animal models can be used to determine the LD50 and the LD50 in animal subjects, and such data can be used to derive the therapeutic index for the inhibitor of the bacterial RNAP secondary channel/MccJ25 interaction.
  • Pharmaceutical Preparations and Methods of Administration:
  • The identified compounds that inhibit bacterial replication can be administered to a patient at therapeutically effective doses to treat bacterial infection. A therapeutically effective dose refers to that amount of the compound sufficient to result in amelioration of symptoms of bacterial infection.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of infection in order to minimize damage to uninfected cells and reduce side effects.
  • The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal infection, or a half-maximal inhibition) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
  • Pharmaceutical compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients.
  • Thus, the compounds and their physiologically acceptable salts and solvates may be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.
  • For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • For oral administration, the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
  • As used herein a “small molecule” is a compound that has a molecular weight of less than 15 kDa.
  • As used herein a “small organic molecule” is an organic compound [or organic compound complexed with an inorganic compound (e.g., metal)] that has a molecular weight of less than 3 kDa.
  • As used herein the term “about” means within 10 to 15%, preferably within 5 to 10%. For example an amino acid sequence that contains about 60 amino acid residues can contain between 51 to 69 amino acid residues, more preferably 57 to 63 amino acid residues.
  • As used herein the term “target” minimally comprises amino acid residues of a target set of residues corresponding to, and alignable with, either residues 736-747 and 779-781 of the β′ subunit of RNAP from Escherichia coli or a set of residues corresponding to, and alignable with residues 740-751 and 783-785 of the β′ subunit of RNAP from Bacillus subtilis.
  • As used herein, the term “sequence homology” in all its grammatical forms refers to the relationship between proteins that possess a “common evolutionary origin,” including proteins from superfamilies (e.g., the immunoglobulin superfamily) and homologous proteins from different species (e.g., myosin light chain, etc). [Reeck et al., Cell, 50:667 (1987)].
  • Accordingly, the term “sequence similarity” in all its grammatical forms refers to the degree of identity or correspondence between nucleic acid or amino acid sequences of proteins that do not share a common evolutionary origin [see Reeck et al., 1987, supral. However, in common usage and in the instant application, the term “homologous,” when modified with an adverb such as “highly,” may refer to sequence similarity and not a common evolutionary origin.
  • Similarly, in a particular embodiment, two amino acid sequences are “substantially homologous” or “substantially similar” when greater than 25% of the amino acids are identical, or greater than about 50% are similar (functionally identical). Preferably, the similar or homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wis.) pileup program with the default parameters.
  • The term “corresponding to” is used herein to refer similar or homologous sequences, whether the exact position is identical or different from the molecule to which the similarity or homology is measured. Thus, the term “corresponding to” refers to the sequence similarity, and not the numbering of the amino acid residues or nucleotide bases.
  • The present invention contemplates isolation of nucleic acids encoding either targets I or I. The present invention further provides for subsequent modification of the nucleic acid to generate a fragment or modification of the target, that will crystallize.
  • Protein-Structure Based Design of Inhibitors of Bacterial RNAP:
  • Once the three-dimensional structure of a crystal comprising a bacterial RNAP target is determined, a potential modulator of the target, can be examined through the use of computer modeling using a docking program such as GRAM, DOCK, or AUTODOCK [Dunbrack et al., Folding & Design, 2:27-42 (1997)], to identify potential modulators of the bacterial RNAP target . This procedure can include computer fitting of potential modulators to the bacterial RNAP target to ascertain how well the shape and the chemical structure of the potential modulator will bind to either the individual bound subunits or to the bacterial RNAP target [Bugg et al., Scientific American, December:92-98 (1993); West et al., TIPS, 16:67-74 (1995)]. Computer programs can also be employed to estimate the attraction, repulsion, and steric hindrance of the subunits with a modulator/inhibitor (e.g., the bacterial RNAP target and a potential stabilizer).
  • Initially, compounds known to bind to the target—for example, MccJ25—can be systematically modified by computer modeling programs until one or more promising potential analogs are identified. In addition, systematic modification of selected analogs can then be systematically modified by computer modeling programs until one or more potential analogs are identified. Such analysis has been shown to be effective in the development of HIV protease inhibitors [Lam et al., Science 263:380-384 (1994); Wlodawer et al., Ann. Rev. Biochem. 62:543-585 (1993); Appelt, Perspectives in Drug Discovery and Design 1:23-48 (1993); Erickson, Perspectives in Drug Discovery and Design 1:109-128 (1993)]. Alternatively, a potential modulator could be obtained by initially screening a random peptide library produced by recombinant bacteriophage for example, [Scott and Smith, Science, 249:386-390 (1990); Cwirla et al., Proc. Natl. Acad. Sci., 87:6378-6382 (1990); Devlin et al., Science, 249:404-406 (1990)]. A peptide selected in this manner would then be systematically modified by computer modeling programs as described above, and then treated analogously to a structural analog as described below.
  • Once a potential modulator/inhibitor is identified, it can be either selected from a library of chemicals as are commercially available from most large chemical companies including Merck, Glaxo Welcome, Bristol Meyers Squib, Monsanto/Searle, Eli Lilly, Novartis and Pharmacia UpJohn, or alternatively the potential modulator may be synthesized de novo. As mentioned above, the de novo synthesis of one, or even a group of, specific compounds is reasonable in the art of drug design. The potential modulator can be placed into a standard binding assay with RNAP or an active fragment thereof such as the target, for example. The subunit fragments can be synthesized by either standard peptide synthesis described above, or generated through recombinant DNA technology or classical proteolysis. Alternatively, the corresponding full-length proteins may be used in these assays.
  • For example, the β′ subunit can be attached to a solid support. Methods for placing the β′ subunit on the solid support are well known in the art and include such things as linking biotin to the β′ subunit and linking avidin to the solid support. The solid support can be washed to remove unreacted species. A solution of a labeled potential modulator (e.g., an inhibitor) can be contacted with the solid support. The solid support is washed again to remove the potential modulator not bound to the support. The amount of labeled potential modulator remaining with the solid support and thereby bound to the β′ subunit can be determined. Alternatively, or in addition, the dissociation constant between the labeled potential modulator and the β′ subunit, for example can be determined. Suitable labels for bacterial RNAP target or the potential modulator are exemplified herein. In a particular embodiment, isothermal calorimetry can be used to determine the stability of the bacterial RNAP target in the absence and presence of the potential modulator.
  • In another aspect of the present invention, a compound is assayed for its ability to bind to the target. A compound that binds to the target then can be selected. In a particular embodiment, the effect of a potential modulator on an activity of the bacterial RNAP target is determined. The potential modulator then can be added to a bacterial culture to ascertain its effect on bacterial proliferation. A potential modulator that inhibits bacterial proliferation then can be selected.
  • In a particular embodiment, the effect of the potential modulator on an activity of a bacterial RNAP, or a fragment thereof, is determined (either independently, or subsequent to a binding assay as exemplified above). In one such embodiment, the extent or rate of the DNA-dependent RNA transcription is determined. For such assays, a labeled nucleotide could be used. This assay can be performed using a real-time assay—e.g., with a fluorescent analog of a nucleotide. Alternatively, the determination can include the withdrawal of aliquots from the incubation mixture at defined intervals and subsequent placing of the aliquots on nitrocellulose paper or on gels. In a particular embodiment the potential modulator is selected when it is an inhibitor of the bacterial RNAP.
  • One assay for RNAP activity is a modification of the method of Burgess et al. [J. Biol. Chem., 244:6160 (1969)] [See http://www.worthington-biochem.com/manual/R/RNAP.html]. One unit incorporates one nanomole of UMP into acid insoluble products in 10 minutes at 37° C. under the assay conditions such as those listed below. The suggested recompounds are: (a) 0.04 M Tris-HCl, pH 7.9, containing 0.01 M MgCl.sub.2, 0.15 M KCl, and 0.5 mg/ml BSA; (b) Nucleoside triphosphates (NTP): 0.15 mM each of ATP, CTP, GTP, UTP; spiked with 3H-UTP 75000-150000 cpms/0.1 ml; (c) 0.15 mg/ml calf thymus DNA; (d) 10% cold perchloric acid; and (e) 1% cold perchloric acid. 0.1-0.5 units of RNAP in 5 μl-10 μl is used as the starting enzyme concentration.
  • The procedure is to add 0.1 ml Tris-HCl, 0.1 ml NTP and 0.1 ml DNA to a test tube for each sample or blank. At zero time enzyme (or buffer for blank) is added to each test tube, and the contents are then mixed and incubated at 37° C. for 10 minutes. 1 ml of 10% perchloric acid is added to the tubes to stop the reaction. The acid insoluble products can be collected by vacuum filtration through MILLIPORE filter discs having a pore size of 0.45 u-10 u (or equivalent). The filters are then washed four times with 1% cold perchloric acid using 1 ml-3 ml for each wash. These filters are then placed in scintillation vials. 2 mls of methyl cellosolve are added to the scintillation vials to dissolve the filters. When the filters are completely dissolved (after about five minutes) 10 mls of scintillation fluid are added and the vials are counted in a scintillation counter.
  • Additional assays for analysis of RNAP activity contemplated by the present invention include RNA transcription assays and fluorescence-detected abortive initiation assays described in detail below, concerning defining the target of MccJ25. The present invention further provides for assays for analysis of antibacterial activity, such as for example include a Minimal Bacteriocidal Concentration (MBC) assay also described in detail below, concerning defining the target of MccJ25.
  • For calculation of units of RNAP/mg of protein the equation described in U.S. Pat. No. 6,225,076 can be used.
  • When suitable potential modulators are identified, a crystal can be grown that comprises the bacterial RNAP, or a fragment thereof, and the potential modulator. Preferably, the crystal effectively diffracts X-rays for the determination of the atomic coordinates of the protein-ligand complex to a resolution of better than 4.0 Angstroms. The three-dimensional structure of the crystal is determined by molecular replacement. Molecular replacement involves using a known three-dimensional structure as a search model to determine the structure of a closely related molecule or protein-ligand complex in a new crystal form. The measured X-ray diffraction properties of the new crystal are compared with the search model structure to compute the position and orientation of the protein in the new crystal. Computer programs that can be used include: X-PLOR (see above), CNS, (Crystallography and NMR System, a next level of XPLOR), and AMORE [J. Navaza, Acta Crystallographics ASO, 157-163 (1994)]. Once the position and orientation are known an electron density map can be calculated using the search model to provide X-ray phases. Thereafter, the electron density is inspected for structural differences and the search model is modified to conform to the new structure. Using this approach, it will be possible to solve the three-dimensional structure of different bacterial target having pre-ascertained amino acid sequences. Other computer programs that can be used to solve the structures of the bacterial RNAP from other organisms include: QUANTA, CHARMM; INSIGHT; SYBYL; MACROMODE; and ICM.
  • A candidate drug can be selected by performing rational drug design with the three-dimensional structure determined for the crystal, preferably in conjunction with computer modeling discussed above. The candidate drug (e.g., a potential modulator of bacterial RNAP) can then be assayed as exemplified above, or in situ. A candidate drug can be identified as a drug, for example, if it inhibits bacterial proliferation.
  • A potential inhibitor (e.g., a candidate antibacterial agent) would be expected to interfere with bacterial growth. Therefore, an assay that can measure bacterial growth may be used to identify a candidate antibacterial agent.
  • Methods of testing a potential bacteriostatic or bacteriocidal compound (e.g., the candidate antibacterial agent) in isolated cultures and in animal models are well known in the art, and can include standard minimum-inhibitory-concentration (MIC) and minimum-bacteriocidal-concentration (MBC) assays. In animal models, the potential modulators can be administered by a variety of ways including topically, orally, subcutaneously, or intraperitoneally depending on the proposed use. Generally, at least two groups of animals are used in the assay, with at least one group being a control group, which is administered the administration vehicle without the potential modulator.
  • For all of the assays described herein further refinements to the structure of the compound generally will be necessary and can be made by the successive iterations of any and/or all of the steps provided by the particular screening assay.
  • It is anticipated that compounds identified according to the target and method of this invention would have applications not only in antibacterial therapy, as described above, but also in: (i) identification of bacterial RNAP (diagnostics, environmental-monitoring, and sensors applications), (ii) labeling of bacterial RNAP (diagnostics, environmental-monitoring, imaging, and sensors applications), (iii) immobilization of bacterial RNAP (diagnostics, environmental-monitoring, and sensors applications), (iv) purification of bacterial RNA polymerase (biotechnology applications), (v) regulation of bacterial gene expression (biotechnology applications), and (vi) antisepsis (antiseptics, disinfectants, and advanced-materials applications).
  • The present invention is not to be limited in scope by the specific embodiments describe herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
    • EXAMPLES Example 1 Cyclic Peptide MCCJ25 (MCCJ25) Inhibits Transcription by Obstructing the RNAP Secondary Channel
  • Introduction:
  • The cyclic-peptide antibiotic MccJ25 (MccJ25) inhibits transcription by Escherichia coli RNA polymerase (RNAP) in a purified system. Biochemical results indicate that MccJ25 inhibits the abortive-initiation and elongation phases of transcription. Kinetic results indicate that MccJ25 inhibits transcription by interfering with NTP uptake. Genetic results indicate that MccJ25 inhibits transcription through interactions with an extensive determinant, comprising nearly fifty amino acid residues, within the RNAP secondary channel (also known as the secondary channel or pore). MccJ25 inhibits transcription by binding within, and obstructing, the RNAP secondary channel—acting essentially as a “cork in a bottle.” Obstruction of the RNAP secondary channel represents a novel mechanism of inhibition and an attractive target for drug discovery.
  • MccJ25 (MccJ25) is a 21 residue cyclic-peptide antibiotic (Salomon and Farias (1992) J. Bacteriol. 174, 7428-7435; Blond et al., (1999) Eur. J. Biochem. 259, 747-755). MccJ25 is produced by Escherichia coli strains that harbor a plasmid-borne antibiotic-synthesis and antibiotic-export cassette, consisting of a gene for MccJ25 precursor (a 58 residue linear peptide), two genes for factors that process MccJ25 precursor into MccJ25, and one gene for export of MccJ25 (Solbiati et al., (1999) J. Bacteriol. 181, 2659-2662; Duarte et al., (2001) Can. J. Microbiol. 47, 877-882). MccJ25 exhibits bacteriocidal activity against a range of Gram-negative bacterial species, including E. coli (Salomon and Farias (1992) J. Bacteriol. 174, 7428-7435).
  • Recently, it was proposed that the functional target of MccJ25 is RNAP (RNAP). Thus, it reported that it is possible to isolate a mutant resistant to MccJ25 in rpoC—the gene for the RNAP β′ subunit—and that MccJ25 inhibits RNAP-dependent transcription in crude cell extracts (Delgado et al., (2001) J. Bacteriol. 183, 4543-4550).
  • The present invention provides that MccJ25 inhibits transcription in a purified system, provides the steps in transcription at which inhibition occurs, provides the mechanism by which inhibition occurs, and provides define—through isolation of more than 120 independent single-substitution MccJ25-resistant mutants of xpoC following random and saturation mutagenesis—the determinant of RNAP for function of MccJ25. The present invention also provides that MccJ25 inhibits transcription by binding within, and obstructing, the RNAP secondary channel. This represents a novel mechanism for inhibition of a nucleotide polymerase and an attractive target for antibacterial drug discovery.
  • MCCJ25 Does Not Inhibit Open-Complex Formation:
  • Transcription involves the following steps (Record et al., (1996) In Escherichia coli and Salmonella, F. C. Neidhart, ed. (Washington, D.C., ASM Press), pp. 792-820; DeHaseth et al., (1998) J. Bacteriol. 180, 3019-3025): (i) RNAP binds to promoter DNA, to yield an RNAP-promoter closed complex; (ii) RNAP melts approximately 14 bp of promoter DNA surrounding the transcription start site, to yield an RNAP-promoter open complex; (iii) RNAP begins synthesis of RNA, typically carrying out multiple rounds of abortive initiation (synthesis and release of RNA products less than 9-11 nt in length), as an RNAP-promoter initial transcribing complex; and (iv), upon synthesis of an RNA product of a critical threshold length of 9-11 nt, RNAP breaks its interactions with promoter DNA and begins to translocate along DNA, processively synthesizing RNA as an RNAP-DNA elongation complex.
  • To determine whether MccJ25 inhibits steps in transcription up to and including formation of the RNAP-promoter open complex, electrophoretic mobility-shift experiments were performed. RNAP holoenzyme was incubated with a fluorochrome-labelled DNA fragment containing the lacUV5 promoter—in parallel in the absence and presence of MccJ25—and we analyzed products by non-denaturing PAGE followed by x/y fluorescence scanning (FIG. 3). The results indicate that MccJ25 at a concentration of 1, 10, or 100 μM has no effect on formation of open complex (FIG. 3). MccJ25 does not inhibit steps in transcription up to and including formation of open complex.
  • MccJ25 Inhibits Abortive Initiation and Elongation:
  • To determine whether MccJ25 inhibits steps in transcription subsequent to formation of the RNAP-promoter open complex, standard transcription experiments were performed. RNAP holoenzyme was pre-incubated with a DNA fragment containing the lacUVS promoter to form the RNAP-promoter open complex; radiolabelled NTPs were added and RNA synthesis was allowed to proceed for 5 min at 37° C.—in parallel in the absence and presence of MccJ25—and products were analyzed by urea-PAGE followed by storage-phosphor imaging (FIG. 4). The results indicate that MccJ25 at a concentration of 1, 10, or 100 μM inhibits both formation of abortive products (7 nt and 8 nt RNA species produced in large stoichiometric excess over the DNA template (see Record et al. 1996; deHaseth et al. 1998)) and formation of the full-length product (26 nt RNA species; produced in stoichiometric equivalence with DNA template) (FIG. 4A). The inhibition is specific; thus, inhibition is overcome completely upon substitution of residue 931 of the RNAP β′ subunit—the substitution shown by Delgado et al., (2001) J. Bacteriol. 183, 4543-4550, to confer resistance to MccJ25 in viva (FIG. 4B). Parallel experiments starting with a stalled elongation complex, rather than with open complex, yield equivalent results with respect to inhibition of formation of full-length (unpublished results). MccJ25 inhibits both abortive initiation and elongation. MccJ25 interferes with a process common to both abortive initiation and elongation—i.e., NTP uptake, phosphodiester-bond formation, or translocation.
  • MccJ25 Inhibits by Interfering with NTP Uptake:
  • To assess whether inhibition by MccJ25 is NTP-concentration-dependent, transcription experiments were performed at each of four NTP concentrations (12.5 μM, 25 μM, 50 μM, and 100 μM). The results indicate that high NTP concentrations can overcome inhibition by MccJ25 (FIG. 5A). As the NTP concentration increases, the extent of inhibition by MccJ25 decreases—both at the level of abortive products and at the level of the full-length product (FIG. 5A). Thus, inhibition by MccJ25 is NTP-concentration-dependent.
  • Quantitative analysis of the NTP-concentration-dependence data indicates that mode of inhibition by MccJ25 is partial competitive—i.e., that MccJ25 binds to a site on RNAP distinct from the NTP binding site and increases KM for NTPs (FIG. 5B). Ki, the reciprocal of the equilibrium binding constant for MccJ25-RNAP interaction, is estimated to be 1.4±0.2 μM; α, the factor by which MccJ25 increases KM for NTPS, is estimated to be 15±3 (FIG. 5B). Fluorescence-detected abortive initiation assays assessing iterative tri- and tetranucleotide synthesis—assays for which the initial-velocity assumption is rigorously valid—yield equivalent results: i.e., partial-competitive inhibition, with Ki=1.2±0.3 μM, and α 8.7±2 (FIG. 5C). MccJ25 inhibits transcription by binding to a site on RNAP distinct from the NTP binding site and interfering with NTP uptake.
  • MccJ25 Binds Within the RNAP Secondary Channel—Random Mutagenesis:
  • The MccJ25-resistant zpoC mutant of Delgado et al. 2001 results in substitution of residue 931 of RNAP β′ subunit (Thr931→Ile). In the primary structure of β′, residue 931 maps to conserved region G (FIG. 6A). In the three-dimensional structure of bacterial RNAP, residue 931 of β′ maps to the RNAP NTP-uptake channel (also referred to as the secondary channel or pore; FIG. 6B). The RNAP secondary channel is a 25 Å long ˜10-15 Å wide, tunnel through which NTPs must pass to access the RNAP active-center and NTP binding site (Zhang et al., (1999) Cell 98, 811-824; Cramer et al., (2001) Science 292, 1863-1 876; and Ebright (2000) J. Mol. Biol. 304, 687-689). The location of the substitution, in conjunction with our finding that MccJ25 inhibits transcription by interfering with NTP uptake, immediately suggests a possible mechanism of inhibition: i.e., MccJ25 may inhibit transcription by binding within, and obstructing, the RNAP secondary channel.
  • To define determinants of β′ specifically required for transcription inhibition by MccJ25—and thereby to test the hypothesis that determinants for binding of MccJ25 are located within the RNAP secondary channel—random mutagenesis of the entire gene encoding β′ were performed and isolated and characterized MccJ25-resistant mutants. (RNAP β′ subunit comprises nearly one-half of all residues of RNAP and comprises all residues of the RNAP secondary channel). Mutagenesis using error-prone PCR was performed (Zhou (1991) Nucl. Acids Res. 19, 6052; Zhou et al., (1993) Proc. Natl. Acad. Sci. USA 90, 6081-6085) of five DNA segments spanning the length of a plasmid-borne rpoC gene (Table 1). Overall, 20 mutagenesis reactions were performed, ˜100,000 candidates were analyzed, and 22 independent plasmid-linked MccJ25-resistant mutants were isolated (Table 1). Minimum-bacteriocidal-concentration (MBC) assays indicate that all 22 MccJ25-resistant mutants exhibit ≧50-fold increases in MBC, and 18 of 22 MccJ25-resistant mutants exhibit ≧50-fold increases in MBC (Table 2, column 5). Complementation assays indicate that all 22 MccJ25-resistant mutants can complement an rpocts mutant for growth at the non-permissive temperature, confirming that each encodes a β′ derivative functional in transcription—indeed sufficiently functional in transcription to support viability (Table 2, column 4).
    TABLE 1
    Summary of random mutagenesis and selection
    codons 1-292
    mutagenesis reactions 4
    total candidates 11,000
    independent plasmid-linked MccJ25r candidates 0
    codons 292-546
    mutagenesis reactions 3
    total candidates 13,000
    independent plasmid-linked MccJ25r candidates 9
    codons 546-876
    mutagenesis reactions 4
    total candidates 11,000
    independent plasmid-linked MccJ25r candidates 11
    codons 876-1213
    mutagenesis reactions 5
    total candidates 36,000
    independent plasmid-linked MccJ25r candidates 1
    codons 1213-1408
    mutagenesis reactions 4
    total candidates 25,000
    independent plasmid-linked MccJ25r candidates 1
    overall
    mutagenesis reactions 20
    total candidates 96,000
    independent plasmid-linked MccJ25r candidates 22
  • For each of the 22 MccJ25-resistant mutants, the DNA-nucleotide sequence of the relevant segment of the zpoC gene was determined, and the amino acid sequence of the substituted β′ derivative was inferred (Table 2). Nineteen different substitutions, involving eighteen different sites within β′, were obtained (Table 2).
    TABLE 2
    MccJ25r isolates from random mutagenesis and
    selection
    Amino Number
    acid Codon of Complement-
    substi- substi- independent ation of MBC*
    tution tution isolates rpoCts (mg/ml)
    none none − ++ 0.01
     424 Asn→Ser AAC→AGC  1** + 0.1
     428 Thr→lle ACT→ATT 2 ++ 0.5
     430 His→Leu CAC→CTC 3 + 0.5
     464 Asp→Gly GAC→GCC 1 ++ 0.05
     469 His→Arg CAC→CGC 1 ++ 0.05
     504 Gln→Arg CAG→CGG 1 ++ 0.5
     733 Ser→Phe TCT→TTC 1 + 0.5
     738 Arg→Leu CGT→CTT 1 ++ 0.05
     776 Thr→lle ACC→ATC 1 ++ 0.5
     779 Ala→Thr GCT→ACT 1 ++ 1
     780 Arg→Cys CGT→TGT 1 ++ 1
     782 Gly→Ala GGT→GCT 1 ++ 1
     785 Asp→Gly GAT→GGT 1 ++ 0.5
     786 Thr→lle ACC→ATC 1 ++ 0.5
     789 Lys→Arg AAA→AGA 1 ++ 0.5
     789 Lys→Gln AAA→CAA 1 ++ 1
     869 Cys→Arg TGT→CGT 1 + 1
     933 Arg→Cys CGT→TGT 1 ++ 1
    1244 Gln→Leu CAG→CTG 1 ++ 0.5

    *Minimum bacteriocidal concentration; defined as the lowest concentration of MccJ25 that yields a viable cell count of −0 after incubation 2 h at 37° C. (see Exeperimental Procedures).

    **Isolated as double mutant 354 Val→lle; 424 Asn→Ser; complementation and MBC data are for a single mutant constructed using site-directed mutagenesis.
  • In the primary structure of β′, the sites at which substitutions were obtained map to conserved region D, conserved region E, conserved region F, the segment between conserved regions F and G, conserved region G, and the segment between conserved regions G and H (referred to as conserved region G′ by Zakharova et Al., (1998) J. Biol. Chem. 273, 24912-24920) (FIG. 6A). In the three-dimensional structure of RNAP, the locations of the substitutions are tightly clustered—and are centered on the RNAP secondary channel (FIG. 6C). The substitutions, without exception, map to residues that line the RNAP secondary channel, or to residues that make direct contact with residues that line the RNAP Secondary channel (FIG. 6C). The substitutions map to the floor, the roof, and the walls of RNAP secondary channel (FIG. 6C). The RNAP secondary channel contains a multi-residue determinant for function of MccJ25. Based on the fact that substitutions conferring MccJ25-resistance were obtained at none of the >1000 residues of β′ outside the immediate vicinity of the secondary channel, it is concluded that no part of β′ outside the immediate vicinity of the secondary channel contains a determinant for function of MccJ255.
  • MccJ25 Binds Within the RNAP Secondary Channel—Saturation Mutagenesis:
  • To define systematically the MccJ25 determinant within the RNAP secondary channel, saturation mutagenesis of the rpoc gene, was performed, targeting all codons for residues that line the RNAP secondary channel. A saturation mutagenesis using a set often ”doped” oligodeoxyribonucleotide primers, designed to introduce all possible nucleotide substitutions at all positions of all codons for residues that line the RNAP secondary channel was performed (sequences in Table 3; methods essentially as in the following references (Ner et al., (1988) DNA 7, 127-134; Hermes et al., (1989) Gene 84, 143-151; and Niu et al., (1994) J. Mol. Biol. 243, 595-602). In total, 23 mutagenesis reactions were performed, ˜40,000 candidates were analyzed, and 105 independent plasmid-linked MccJ25-resistant mutants were isolated and characterized (Table 4).
    TABLE 3
    Sequences of “doped” oligonucleotide primers used
    in saturation mutagenesis
    Codon Sequence
     429-433* CCGTGCACCGACTCTGCACCGTCTGGGTATCCAGGCAT
    TTG
     492-504** GCAACAACATCCTGTCCCCGGCGAACGGCGAACCAATC
    ATCGTTCCGTCTCAGGACGTTGTACTGGGTC
     597-603* GTCAACCAGGCGCTGGGTAAAAAAGCAATCTCCAAAAT
    GCTGAACACCTGC
     680-698** CGGGCGAACGCTACAACAAAGTTATCGATATCTGGGCT
    GCGGCGAACGATCGTGTATCCAAAGCGATGATGGATAAC
    CTGCAAAC
     726-740** CTACATGATGGCCGACTCCGGTGCGCGTGGTTCTGCGGC
    ACAGATTCGTCAGCTTGCTGGTATG
     741-754** CGTCAGCTTGCTGGTATGCGTGGTCTGATGGCGAAGCCG
    GATGGCTCCATCATCGAAACG
     775-790** GTACTTCATCTCCACCCACGGTGCTCGTAAAGGTCTGGC
    GGATACCGCACTGAAAACTGCGAACTCCG
     922-933** GTGTTATCGCGGGACAGTCCATCGGTGAACCGGGTACAC
    AGCTGACCATGCGTACGTTCCACATCGGTGG
    1136-1137* CCAAGGACATCACCGGTGGTCTGCCGCGCGTTGC
    1239-1248** CGAAGTACAGGACGTATACCGTGTGCAGGGCGTTAAGAT
    TAACGATAAAC

    *Underlined nucleotides were synthesized using phosphoramidite reservoirs having 92% correct phosphoramidite and 8% of a 1:1:1:1 mix of dA, dC, dG, and dT phosphoramidites (i.e., 94% of total correct phosphoramidites and 6% of total incorrect phosphoramidites).

    **Underlined nucleotides were synthesized using phosphoramidite reservoirs having 98% correct phosphoramidite and 2% of a 1:1:1:1 mix of dA, dC, dG, and dT phosphoramidites (i.e., 98.5% of total correct phosphoramidites and 1.5% of total incorrect phosphoramidites).
  • Sequencing indicates that 100 of the 105 MccJ25-resistant mutants are single-substitution mutants (Table 4). The single-substitution mutants comprise 71 different substitutions, involving 43 different sites within β′ (Table 4).
    TABLE 4
    Summary of saturation mutagenesis and selection
    codons 429-433
    mutagenesis reactions 4
    total candidates 6,000
    independent plasmid-linked MccJ25r candidates 8
    codons 492-504
    mutagenesis reactions 2
    total candidates 2,000
    independent plasmid-linked MccJ25r candidates 9
    codons 597-603
    mutagenesis reactions 3
    total candidates 5,000
    independent plasmid-linked MccJ25r candidates 0
    codons 680-698
    mutagenesis reactions 2
    total candidates 8,000
    independent plasmid-linked MccJ25r candidates 6
    codons 726-740
    mutagenesis reactions 2
    total candidates 3,000
    independent plasmid-linked MccJ25r candidates 12
    codons 741-754
    mutagenesis reactions 2
    total candidates 4,000
    independent plasmid-linked MccJ25r candidates 5
    codons 775-790
    mutagenesis reactions 3
    total candidates 3,000
    independent plasmid-linked MccJ25r candidates 33
    codons 922-933
    mutagenesis reactions 2
    total candidates 1,000
    independent plasmid-linked MccJ25r candidates 13
    codons 1136-1137
    mutagenesis reactions 1
    total candidates 2,000
    independent plasmid-linked MccJ25r candidates 4
    codons 1239-1248
    mutagenesis reactions 2
    total candidates 3,000
    independent plasmid-linked MccJ25r candidates 15
    overall
    mutagenesis reactions 23
    total candidates 37,000
    independent plasmid-linked MccJ25r candidates 105
  • In the three-dimensional structure of RNAP, the sites at which single substitutions were obtained define a nearly continuous surface, comprising most of the interior lining and part of the rim of the RNAP secondary channel (FIG. 6D). The sites span nearly the full circumference of the RNAP secondary channel (FIG. 6D). The side chains of the majority of implicated residues are solvent-accessible—directed into the lumen of the RNAP secondary channel or toward the exterior of RNAP—and make no obvious interactions important for RNAP structure or function.
  • The present invention provides that the RNAP secondary channel contains an extensive determinant for function of MccJ25. Based on the size of the determinant (nearly 50 residues; Tables 3 and 6), the architecture of the determinant (interior of hollow cylinder), and the solvent-accessibility of the determinant, The present invention provides that the determinant corresponds to the binding site on RNAP for MccJ25. For reference, the size and molecular mass of MccJ25 (2,107 Da; diameter=19 Å, modeled as a sphere) would allow MccJ25 to make direct contact with all, or nearly all, residues of the determinant. The present invention also provides that the sites of substitutions that confer MccJ25-resistance map the binding site on RNAP for MccJ25 and, in essence, serve as a genetic footprint of the binding site.
    TABLE 5
    MccJ25r isolates from saturation mutagenesis and selection
    Number of
    Amino acid independent MBC*
    substitution isolates (mg/mi)
    Single-substitution mutants
    428 Thr−>Ile 3 0.5
    428 Thr−>Asn 2 0.5
    429 Leu−>Gln 2 0.5
    430 His−>Tyr 1 0.5
    498 Pro−>Leu 1 1
    498 Pro−>Gln 1 1
    503 Ser−>Pro 1 0.5
    503 Ser−>Tyr 1 0.5
    504 Gln−>Arg 1 0.5
    504 Gln−>Glu 2 0.5
    508 Leu−>Val 1 0.05
    680 Asn−>Lys 2 0.5
    684 Asp−>Ala 1 1
    684 Asp−>Tyr 1 0.5
    684 Asp−>Glu 1 0.5
    684 Asp−>Vai 1 0.5
    732 Gly−>Asp 2 0.1
    733 Ser−>Phe 1 0.1
    733 Ser−>Val 1 0.5
    733 Ser−>Tyr 1 0.1
    735 Ala−>Δ 2 1
    736 Gln−>Pro 1 0.5
    738 Arg−>Leu 1 0.05
    744 Arg−>Pro 1 0.05
    744 Arg−>His 1 0.05
    748 Ala−>Pro 3 0.1
    775 Ser−>Cys 1 0.5
    776 Thr−>Ile 3 0.5
    777 His−>Tyr 1 1
    777 His−>Pro 2 0.5
    779 Ala−>Gly 1 0.5
    779 Ala−>Thr 1 1
    779 Ala−>Pro 2 0.5
    780 Arg−>Cys 1 1
    782 Gly−>Ala 1 1
    783 Leu−>Pro 1 0.1
    784 Ala−>Glu 1 0.5
    785 Asp−>Gly 2 0.5
    786 Thr−>Ile 1 0.5
    786 Thr−>Ala 2 0.5
    788 Leu−>Met 1 1
    789 Lys−>Asn 2 1
    789 Lys−>Gln 1 1
    789 Lys−>Arg 1 0.5
    790 Thr−>Ala 2 1
    790 Thr−>Ile 2 1
    790 Thr−>Ser 2 0.5
    790 Thr−>Asn 1 0.5
    922 Cys−>Tyr 1 0.5
    926 Pro−>Ser 1 0.5
    927 Gly−>Ser 2 1
    927 Gly−>Cys 1 1
    930 Leu−>Met 1 1
    931 Thr−>Ile 2 1
    931 Thr−>Ala 2 1
    932 Met−>Ile 2 1
    933 Arg−>Cys 1 1
    1136 Gly−>Cys 1 1
    1136 Gly−>Ala 1 0.5
    1137 Gly−>Aia 1 0.5
    1137 Gly−>Arg 1 1
    1240 Val−>Glu 1 0.5
    1241 Tyr−>Ser 2 0.1
    1241 Tyr−>His 2 0.1
    1241 Tyr−>Cys 1 0.1
    1244 Gln−>Pro 2 0.1
    1244 Gln−>Leu 1 0.5
    1244 Gln−>Glu 2 0.1
    1247 Lys−>Glu 2 0.1
    1247 Lys−>Gln 1 0.1
    1248 lle−>Ser 1 0.1
    multiple-substitution mutants
    493 Pro−>Thr 1 0.1
    498 Pro−>Thr
    732 Gly−>Asp 1 0.1
    733 Ser−>Ala
    732 Gly−>Asp 1 0.5
    735 Gly−>Thr
    733 Ser−>Val 1 0.1
    734 Ala−>Gly
    777 His−>Ser 1 0.5
    778 Gly−>Ala

    Minimum bacteriocidal concentration; defined as the lowest concentration of MccJ25 that yields a viable cell count of ˜0 after incubation 2 hr at 37° C. (see Experimental Procedures).
  • Thirteen of fifteen sites associated with the highest level of MccJ25-resistance (MBC=1 mg/ml; Tables 2 and 5) cluster in an ˜20 Åט20 Åט20 Å sub-region of the RNAP secondary channel, bounded by the a-helix containing residue 684 (D/E helix), the α-helix containing residue 735 (E helix), the a-helix containing residues 777-790 (F helix), the α-helix and loop containing residues 927-933 (G helix and loop), and loop containing residues 1136-1137 (G′ loop) (sub-region above and to left of the active-center Mg++ in view in FIG. 6D). The present invention provides that this sub-region is the most important part of the determinant.
  • Single substitutions at five sites within β′ confer MccJ25-resistance: 733, 783, 931, 935, and 1138 (Yuzenkova et al., (2002) J. Biol. Chem. 277, 50867-50875). The target for MccJ25 includes these sites within β′ (four of which are reported herein; Tables 2 and 5).
  • The present invention provides that MccJ25 inhibits the abortive-initiation and elongation phases of transcription, that inhibition involves interference with NTP uptake, that inhibition is partial-competitive with respect to NTPs (i.e., involves a site distinct from the RNAP NTP binding site), and that inhibition involves an extensive determinant within the RNAP secondary channel, comprising nearly the entire lining of the RNAP secondary channel (nearly fifty sites for substitutions conferring MccJ25-resistance). The results of Yuzenkova et al., (2002) J. Biol. Chem. 277, 50867-50875, although limited, also indicate that inhibition involves a multi-residue determinant within the RNAP secondary channel (five sites for substitutions conferring MccJ25-resistance) Preliminary results of fluorescence-resonance-energy-transfer experiments with a fluorochrome-labelled MccJ25 derivative provide direct evidence that MccJ25 binds within the RNAP secondary channel (methods as in Mekler et al., (2002) Cell 108, 599-6 14). The RNAP secondary channel is a 25 A long, -10-15 A wide, fully enclosed tunnel through which NTPs must pass to access the RNAP active-center and NTP binding site (Zhang et al., (1999) Cell 98, 811-824; Cramer et al., (2001) Science 292, 1863-1 876; and Ebright (2000) J. Mol. Biol. 304, 687-689). MccJ25 inhibits transcription by binding within, and obstructing, the RNAP secondary channel—acting essentially as a “cork in a bottle.”
  • The present invention also provides that a molecule the size of MccJ25 (2.1 kDa; diameter=19 Å, modeled as a sphere) readily could bind within, and obstruct, the RNAP secondary channel (dimensions=25 Å by 10-15 Å).
  • Obstruction of the RNAP secondary channel represents a novel mechanism of inhibition of RNAP. Rifampicin, an inhibitor of bacterial RNAP, functions by sterically preventing synthesis of an RNA product longer than -4 nt (Campbell et al., (2001) Cell 104, 901-9 12). Streptolydigin and α-amanitin, inhibitors of bacterial RNAP and eukaryotic RNAP II, respectively, are proposed to interfere with active-center conformational changes associated with phosphodiester-bond formation and/or translocation (Epshtein et al., (2002) Mol. Cell 10, 623-634; Bushnell et al., (2002) Proc. Natl. Acad. Sci. USA 99, 12 18-1222).
  • Several arguments suggest that obstruction of the RNAP secondary channel represents an exceptionally attractive target for development of novel antimicrobial agents. First, the RNAP secondary channel is eminently “druggable,” presenting an extended, encircling surface complementary to a range of molecules—like MccJ25—that have molecular weights of 500-2,500 Da. Second, the RNAP secondary channel exhibits distinct patterns of sequence conservation in bacterial RNAP and eukaryotic RNAP, permitting identification of agents—like MccJ25—that inhibit bacterial RNAP but do not inhibit eukaryotic RNAP. Third, the RNAP secondary channel is distinct from, and well-separated from, the binding site of the RNAP inhibitor in current use in antimicrobial therapy, rifampicin, permitting identification of agents—like MccJ25 (unpublished data)—that do not exhibit cross-resistance with rifampicin.
  • Experimental Procedures:
  • Plasmids:
  • Plasmid pTUC202 carries genes for synthesis and export of MccJ25 (Solbiati et al., (1999) J. Bacteriol. 181, 2659-2662; gift of Dr. F. Moreno). Plasmid pRL663 encodes C-terminally hexahistidine-tagged E. coli RNAP β′ subunit under control of the tac promoter (Wang et al., (1995) Cell 81, 341-350; gift of Dr. R. Landick). Plasmid pREII-NHx encodes N-terminally hexahistidine-tagged E. coli RNAP α subunit under control of tandem lpp and 'lacUV5 promoters (Niu et al., 1996).
  • MccJ25:
  • MccJ25 was purified essentially as in Blond et al. 1999. E. coli strain DH5α (hsdR17 recA1 relA1 endA1 gyrA96 gal deoR phoA supE44 thi Δ(lacZYA-argF)U169ø80dlacZΔM15; Invitrogen, Inc). transformed with plasmid pTUC202 (Solbiati et al., 1996) was shaken in 1 L M9 medium (Sambrook and Russell (2001). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, NY, Cold Spring Harbor Laboratory)), for 24 h at 37° C., and the culture medium was harvested by centrifugation (5000× g; 15 mm at 22° C.). The culture medium was applied to a preparative C8 cartridge (10 g Mega-BE C8; Varian, Inc); the cartridge was washed successively with 50 ml water, 50 ml 20% methanol, and 50 ml 50% methanol; the cartridge was eluted with 4×5 ml fractions of 80% methanol; and fractions containing MccJ25 (detected by UV absorbance at 276 nm) were pooled, lyophilized, re-dissolved in 10 ml 20% methanol, and stored in aliquots at −20° C. Yields typically were 100 mg (determined by UV-absorbance at 276 nm using ε276=2,900 M−1 cm−1 (calculated as in Gill and von Hippel, 1989 (1991) J. Mol. Biol. 220, 307-324)). Purities typically were 50% (determined by analytical reversed-phase HPLC). Samples for electrophoretic mobility shift assays, transcription assays, and fluorescence-detected abortive initiation assays were further purified by reversed-phase HPLC on a C18, 5 μM, 300 Å column (Rainin, Inc)., with solvent A=20% methanol and 0.1% trifluoroacetic acid, solvent B=methanol and 0.1% trifluoroacetic acid, and gradient=0-90% solvent B in solvent A in 50 mm, flow rate=1 ml/min. Fractions containing MccJ25 (retention time ˜30 mm; detected by UV absorbance at 276 nm) were pooled, lyophilized,. re-dissolved in 500 μl 10% methanol, and stored in aliquots at −20° C. Yields typically were 50 mg per 1 L culture. Purities typically were >95%.
  • RNAP:
  • RNAP holoenzyme was prepared from strain XE54/pREII-NHα(thi pREII-NHα; Niu et al., (1996) Cell 87, 1123-1134) using metal-ion affinity chromatography and ion-exchange chromatography (Id.). (Ile931]β′-RNAP holoenzyme was prepared from strain 397c [rpoCts397 argG thi lac λI857h80St68dlac+); Christie et al., (1996) J. Bacteriol. 178, 699 1-6993) transformed with a pRL663 derivative encoding [Ile931]β′-RNAP (constructed using site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit; Stratagene, Inc).) using identical procedures. Yields typically were 6 mg. Purities typically were >95%.
  • Electrophoretic Mobility Shift Assays:
  • Reaction mixtures contained (20 μl): 100 nM RNAP holoenzyme, 20 nM DNA fragment lacUV5-12(Cy5, +26) (Mukhopadhyay et al., (2001) Cell 106, 453-463), and 0-100 μM MccJ25 in TB [50 mM Tris-HCl (pH 8.0), 100 mM KCl, 10 mM MgCl2, 1 mM dithiothreitol, 10 μg/ml bovine serum albumin, and 5% glycerol]. Following 15 min at 37° C., 0.5 μl 1 mg/ml heparin was added (to disrupt non-specific complexes (Cech and McClure (1980) Biochem. 19, 2440-2447)), and, following a further 2 min at 37° C., reaction mixtures were applied to 5% polyacrylamide slab gels (30:1 acrylamide/bisacrylamide; 6×9×0.1 cm) and electrophoresed in 90 mM Tris-borate (pH 8.0) and 0.2 mM EDTA (20 V/cm; 30 min at 37° C.) and analyzed using an x/y fluorescence scanner (Storm 860; Molecular Dynamics, Inc.).
  • Transcription Assays:
  • Reaction mixtures contained (18 μl): 100 nM RNAP holoenzyme, 20 nM DNA fragment lacUV5-12(Cy5, +26) (Mukhopadhyay et al., (2001) Cell 106, 453-463), and 0-100 μM MccJ25 in TB. Following 15 min at 37° C., 0.5 μl 1 mg/ml heparin was added, and, following a further 2 min at 37° C., RNA synthesis was initiated by addition of 2 μl 5 mM ApA and 125 μM (or 250 jiM, 500 μM, and 1 mM) each of [α-32P]UTP (0.6 Bq/fmol), ATP, CTP, GTP. Following 5 min at 37° C., reactions were terminated by addition of 10 μl 80% formamide, 10 mM EDTA, 0.04% bromophenol blue, and 0.04% xylene cyanol. Products were heated 10 min at 90° C., resolved by urea-PAGE (Sambrook and Russell (2001). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory)), and quantified using an x/y storage-phosphor scanner (Storm 860; Molecular Dynamics, Inc.). Data were fit to full-competitive, partial-competitive, full-noncompetitive, partial-noncompetitive, full-uncompetitive, partial-uncompetitive, full-mixed, and partial-mixed models of inhibition using the Fit-To-Model feature of the SigmaPlot Enzyme Kinetics Module (SPSS, Inc.).
  • Fluorescence-Detected Abortive Initiation Assays:
  • Reaction mixtures contained (46.5 μl): 100 nM RNAP holoenzyme, 20 nM DNA fragment lacUV5-12 (Mukhopadhyay et al., (2001) Cell 106, 453-463), and 0-100 μM MccJ25 in TB. Following 15 min at 37° C., 0.5 μl mg/ml heparin was added, and, following a further 2 min at 37° C., 1 μl of 0.25-5 mM (y-AmNS)UTP (Molecular Probes, Inc.) was added, and reaction mixtures were transferred to sub-micro fluorometer cuvettes (Starna Cells, Inc.). Following 2 min at 37° C., RNA synthesis was initiated by addition of 2.5 μl 10 mM ApA, and fluorescence emission intensity was monitored 5 min at 37° C. [excitation wavelength=360 nm and emission wavelength=500 nm; excitation and emission slit widths=4 nm; QuantaMaster QM1 spectrofluorometer (PTI, Inc).]. The quantity of UMP incorporated into RINA was determined from the quantity of (γ-AmNS)UTP consumed, which, in turn, was calculated as follows (Schlageck et al. 1979):
    (γ-AmNS)UTP consumed=[(γ-AmNS)UTP 0](F t −F 0)/(12.4×F 0)
    where (γ-AmNS)UTP0 is the quantity of (γ-AmNS)UTP at time 0, F0 is the fluorescence emission intensity at time 0, and Ft is the fluorescence emission intensity at time t. Data were fit to full-competitive, partial-competitive, full-noncompetitive, partial-noncompetitive, full-uncompetitive, partial-uncompetitive, full-mixed, and partial-mixed models of inhibition as in the preceding section.
    Random Mutagenesis:
  • Random mutagenesis was performed by error-prone PCR amplification of the XbaI-SnaBI (codons 1-292), SnaBI-SphI (codons 292-546), SphI -SalI (codons 546-876), SalI-BspEI (codons 876-1213), and BspEI-XhoI (codons 1213-1408) rpoC segments of plasmid pRL663 (procedure of Zhou (1991) Nucl. Acids Res. 19, 6052; Zhou et al., (1993) Proc. Natl. Acad. Sci. USA 90, 6081-6085). The mutagenesis procedure yields all possible transition and transversion substitutions (Id. at Table 2). Mutagenized plasmid DNA was introduced by transformation into strain Stbl2 [mcrA Δ(mcrBC-hsdRMS-mrr) recA1 relA1 endA1 gyrA96 lon supE44 thi Δ(lac-proAB); Invitrogen, Inc.], transformants (−104 cells) were applied to LB-agar plates (Sambrook and Russell (2001). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory)) containing 1 μg/ml MccJ25 and 200 μg/ml ampicillin, and plates were incubated 24 h at 37° C. followed by 0-48 h at 25° C. For each MccJ25r clone (identified as a clone yielding a colony on the original selective plate and also yielding colonies when re-streaked to the same medium and incubated 16 h at 37° C.), plasmid DNA was prepared, plasmid DNA was introduced by transformation into strain DH5α [hsdR17 recA1 relA1 endA1 gyrA96 gal deoR phoA supE44 thi Δ(lacZYA-argF)U169ø80dlacZΔM15; Invitrogen, Inc.], transformants (˜104 cells) were applied to LB-agar plates containing I μg/ml MccJ25 and 200 μg/ml ampicillin and, in parallel, to LB-agar plates containing 200 μg/ml ampicillin, and plates were incubated 16 h at 32° C. For each plasmid-linked MccJ25r clone (identified as a clone yielding comparable numbers of colonies on the plates with and without MccJ25), the nucleotide sequence of the mutagenized rpoC segment was determined by dideoxy nucleotide sequencing.
  • Saturation mutagenesis: A set of “doped” oligodeoxyribonucleotide primers corresponding to codons 425-437, 487-509, 592-608, 675-703, 723-743, 739-757, 772-793, 918-937, 1132-1141, and 1236-1251 of the xpoC gene of pRL663 was synthesized on an AB392 automated synthesizer (Applied Biosystems, Inc). using solid-phase β-cyanoethylphosphoramidite chemistry (sequences in Table 4). The level of “doping” (nucleotide misincorporation) was selected to yield an average of 0.4-1 substitution per molecule of oligodeoxyribonucleotide primer (equations in Hermes et al., 1989, 1990). Thus, the nucleotides corresponding to codons 429-433, 597-603, and 1136-1137 were synthesized using phosphoramidite reservoirs containing 92% of the correct phosphoramidite and 8% of a 1:1:1:1 mix of dA, dC, dG, and dT phosphoramidites (i.e., 94% total correct phosphoramidite and 6% total incorrect phosphoramidite); the nucleotides corresponding to codons 492-504, 680-698, 726-740, 74 1-754, 775-790, 922-933, and 123 9-1248 were synthesized using phosphoramidite reservoirs containing 98% of the correct phosphoramidite and 2% of a 1:1:1:1 mix of dA, dC, dG, and dT phosphoramidites (i.e., 98.5% total correct phosphoramidite and 1.5% total incorrect phosphoramidite); and all other nucleotides were synthesized using phosphoramidite reservoirs containing 100% of the correct phosphoramidite. Primer-extension mutagenesis reactions were performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, Inc)., with a “doped” oligodeoxyribonucleotide primer, a complementary wild-type oligodeoxyribonucleotide primer, and pRL663 as template (primers at 75 nM; all other components at concentrations as specified by the manufacturer). Mutagenized plasmid DNA was introduced into cells, and plasmid-linked MccJ25r clones were identified and characterized, as in the preceding section.
  • Complementation Assays:
  • Strain 397c [rpoCts397 argG thi lac (λcI857h80St68dlac+); Christie et al., 1996] was transformed with pRL663 or a pRL663 derivative, transformants (˜104 cells) were applied to LB-agar plates (Sambrook and Russell (2001). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory)) containing 1 μg/ml MccJ25 and 200 μg/ml ampicillin, plates were incubated 16 h at 37° C., and bacterial growth was scored.
  • Minimum Bacteriocidal Concentration (Mbc) Assays:
  • Strain DH5α [hsdR17 recA1 relA1 endA1 gyrA96 gal deoR phoA supE44 thi Δ(lacZYA-argF)U169 ø80dlacZΔM15; Invitrogen,. Inc.] was transformed with pRL663 or a pRL663 derivative, transformants(106 cells) were incubated 2 h at 37° C. in 1 ml LB (Id.) containing 0.01, 0.05, 0.1, or 1 mg/ml MccJ25; aliquots (10 μl) were applied to LB-agar plates (Id). containing 200 μg/ml ampicillin; plates were incubated 16 h at 37° C.; and colonies were counted. The MBC was defined as the lowest concentration of MccJ25 that yielded a colony count of <5.
    • Example 2 Probe-Labelled Derivatives of Peptide Antibiotic MccJ25
  • One aspect of the invention provides probe-labelled derivatives of the peptide antibiotic MccJ25 (MccJ25). The invention has broad applications in analysis of RNAP structure and function, control of bacterial gene expression, control of bacterial growth, antibacterial chemistry, antibacterial therapy, and drug discovery.
  • The present invention also provides a composition comprising a compound according to the general structural formula (I): J-Z-X, wherein J is MccJ25 or a substituted and/or truncated derivative thereof, Z is a covalent linker or is absent, and X is a detectable group. One aspect of the present invention, provides a composition comprising a compound according to the general structural formula (I) wherein X is selected from the group consisting of a fluorescent moiety, a phosphorescent moiety, a luminescent moiety, an absorbent moiety, a photosensitizer, a spin label, a radioisotope, an isotope detectable by nuclear magnetic resonance, a paramagnetic atom, a heavy atom, a hapten, a crosslinking agent, a cleavage agent, and combinations thereof. Another aspect of the present invention, provides a composition comprising formula (I) wherein X is a fluorescent moiety. Another aspect of the present invention, provides a composition comprising formula (I) wherein X is a cyanine dye. Another aspect of the present invention, provides a composition comprising formula (I) wherein X is a Cy3. Another aspect of the present invention, provides a composition comprising formula (I) wherein X is a Cy5.
  • The present invention also provides a composition comprising a derivative of MccJ25 having a detectable group incorporated at position 13, according to the general structural formula (II): [O13-Z-X]J, wherein O is an amino acid or amino acid derivative, Z is a covalent linker or is absent, and X is a detectable group. One aspect of the present invention, provides a composition according to formula) (II) wherein O is lysine; and wherein X is selected from the group consisting of a fluorescent moiety, a phosphorescent moiety, a luminescent moiety, an absorbent moiety, a photosensitizer; a spin label, a radioisotope, an isotope detectable by nuclear magnetic resonance, a paramagnetic atom, a heavy atom, a hapten, a crosslinking agent, a cleavage agent, and combinations thereof. A preferred aspect of the present invention, provides a composition according to formula (II) wherein X is a fluorescent moiety. An especially preferred aspect of the present invention, provides a composition according to formula (II) wherein X is a cyanine dye. An especially preferred aspect of the present invention provides a composition according to said formula (II) wherein X is Cy3 or Cy5.
  • The present invention also provides a composition comprising a derivative of MccJ25 having a detectable group incorporated at position 15, according to the general structural formula (III): [O15-Z-X]J, wherein O is an amino acid or amino acid derivative, Z is a covalent linker or is absent, and X is a detectable group. One aspect of the present invention, provides a composition according to formula) (III) wherein O is lysine; and wherein X is selected from the group consisting of a fluorescent moiety, a phosphorescent moiety, a luminescent moiety, an absorbent moiety, a photosensitizer, a spin label, a radioisotope, an isotope detectable by nuclear magnetic resonance, a paramagnetic atom, a heavy atom, a hapten, a crosslinking agent, a cleavage agent, and combinations thereof. A preferred aspect of the present invention provides a composition according to formula (III) wherein X is a fluorescent moiety. An especially preferred aspect of the present invention provides a composition according to formula (III) wherein X is a cyanine dye. An especially preferred aspect of the present invention provides a composition according to said formula (III) wherein X is Cy3 or Cy5.
  • The present invention also provides a composition comprising a derivative of MccJ25 having a detectable group incorporated at position 17, according to the general structural formula (IV): [O17-Z-X]J, wherein O is an amino acid or amino acid derivative, Z is a covalent linker or is absent, and X is a detectable group. One aspect of the present invention, provides a composition according to formula) (IV) wherein O is lysine; and wherein X is selected from the group consisting of a fluorescent moiety, a phosphorescent moiety, a luminescent moiety, an absorbent moiety, a photosensitizer, a spin label, a radioisotope, an isotope detectable by nuclear magnetic resonance, a paramagnetic atom, a heavy atom, a hapten, a crosslinking agent, a cleavage agent, and combinations thereof. A preferred aspect of the present invention, provides a composition according to formula (IV) wherein X is a fluorescent moiety. An especially preferred aspect of the present invention provides a composition according to formula (IV) wherein X is a cyanine dye. An especially preferred aspect of the present invention provides a composition according to said formula (IV) wherein X is Cy3 or Cy5.
  • The present invention also provides a composition comprising a compound according to any one of the general structural formulas (I), (II), (III), or (IV) for a) analysis, synthesis, screening, or design of ligands of RNAP; b) analysis, synthesis, screening, or design of modulators of RNAP activity; c) analysis, synthesis, screening, or design of modulators of bacterial gene expression; and d) analysis, synthesis, screening, or design of modulators of bacterial growth.
  • In a preferred embodiment, the invention provides for the use of a compound according to any one of the general structural formulas (I), (II), (III), or (IV) in an assay assessing the ability of a molecule, or set of molecules, to displace said compound from a bacterial RNAP, or a fragment thereof, or to compete with said compound for binding to a bacterial RNAP, or a fragment thereof.
  • In an especially preferred embodiment, the invention provides for the use of a compound according to any one of the general structural formulas (I), (II), (III), or (IV) in a homogeneous assay FRET assay measuring the ability of a molecule, or set of molecules, to displace said compound from a bacterial RNAP, or a fragment thereof, or to compete with said compound for binding to a bacterial RNAP, or a fragment thereof.
  • The present invention provides for the preparation of [Cy3-Lys13]MccJ25 (a compound according to structural formulas (I) and (II)) and demonstration that the compound binds to and inhibits RNAP with high potency. The present invention also provides for the preparation of [Lys13]MccJ25, [Lys15]MccJ25, and [Lys17]MccJ25 (intermediates in synthesis of compounds according to structural formulas (I)-(IV) and demonstration that the compounds bind to and inhibit RNAP with high potency.
  • The present invention also provides for the use of Cy3-Lys13]MccJ25 (a compound according to structural formulas (I) and (II)) in a homogeneous FRET assay measuring the ability of a molecule, or set of molecules, to displace said compound from a bacterial RNAP, or a fragment thereof, or to compete with said compound for binding to a bacterial RNAP, or a fragment thereof.
    • INDUSTRIAL APPLICABILITY
  • The invention has applications in control of bacterial gene expression, control of bacterial growth, antibacterial chemistry, and antibacterial therapy.
  • Although the invention herein has been described with reference to particular embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention. It is therefore to be understood that numerous modifications may be made to the illustrative embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the appended claims.
  • All patent and non-patent publications cited in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All these publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated herein by reference.

Claims (77)

1. An analog of bacteriocidal -peptide microcin J25 (MccJ25) that (1) has an amino acid sequence that differs from that of MccJ25 in terms of at least one amino acid substitution, insertion, or deletion; and (2) that binds a bacterial RNAP and inhibits an activity of bacterial RNAP with a potency at least equal to that of MccJ25.
2. An analog according to claim 1 selected from the group consisting of [Lys5]MccJ25, [Lys13]MccJ25, [Lys15]MccJ25, and [Lys17]MccJ25.
3. An analog according to claim 1 selected from the group consisting of [X-Lys5]MccJ25, [X-Lys133MccJ25, [X-Lys15]MccJ25, and [X-Lys17]MccJ25, where X contains a detectable group.
4. An analog according to claim 3 where the detectable group contains a chromophore.
5. An analog according to claim 3 where the detectable group contains a fluorophore.
6. An analog according to claim 3 where the detectable group is Cy3.
7. An analog according to claim 1 that also contains a detectable group.
8. An analog according to claim 7 where the detectable group contains a chromophore.
9. An analog according to claim 7 where the detectable group contains a fluorophore.
10. An analog according to claim 7 where the detectable group is Cy3.
11. A method for identifying an agent that binds to a bacterial RNAP homologous secondary channel amino acid sequence in a first entity, comprising the steps of: (a) preparing a reaction solution including the agent to be tested and a first entity including a bacterial RNAP homologous secondary channel amino acid sequence; and (b) detecting at least one of the presence, extent, concentration-dependence, or kinetics of binding of the agent to the bacterial RNAP homologous secondary channel amino acid sequence.
12. The method of claim 11 wherein the first entity is an intact bacterial RNAP.
13. The method of claim 11 wherein the first entity is a fragment of a bacterial RNAP.
14. The method of claim 11 wherein the first entity is a derivative of Escherichia coli RNAP.
15. The method of claim 11 wherein the first entity is a derivative of Bacillus subtilis RNAP.
16. The method of claim 11 further comprising comparison of: (a) the binding of the agent to the first entity; and (b) the binding of the agent to a second entity that contains a derivative of a bacterial RNAP homologous secondary channel amino acid having at least one substitution, insertion, or deletion.
17. The method of claim 16 wherein the second entity is a derivative of an intact bacterial RNAP.
18. The method of claim 16 wherein the second entity is a derivative of a fragment of a bacterial RNAP.
19. The method of claim 16 wherein the second entity is a derivative of Escherichia coli RNAP.
20. The method of claim 16 wherein the second entity is a derivative of Bacillus subtilis RNAP.
21. The method of claim 11 further comprising comparison of: (a) at least one of the presence, extent, concentration-dependence, or kinetics of binding of the agent to the first entity; and (b) at least one of the presence, extent, concentration-dependence, or kinetics of binding of the agent to a eukaryotic RNAP derivative.
22. The method of claim 21 wherein the eukaryotic RNAP derivative is a human RNAP derivative.
23. The method of claim 21 wherein the eukaryotic RNAP derivative is a human RNAP II derivative.
24. The method of claim 11 further comprising comparison of: (a) at least one of the presence, extent, concentration-dependence, or kinetics of binding of the agent to the first entity; and (b) at least one of the presence, extent, concentration-dependence, or kinetics of binding of MccJ25 to the first entity.
25. A method for identifying an agent that inhibits an activity of a bacterial RNAP by binding to a bacterial RNAP homologous secondary channel amino acid sequence, comprising: (a) preparing a reaction solution comprising the agent to be tested and a first entity containing a bacterial RNAP homologous secondary channel amino acid sequence; and (b) detecting the at least one of the presence, extent, concentration-dependence, or kinetics of inhibition of an activity of said first entity, wherein inhibition involves binding of the agent to the homologous bacterial RNAP secondary channel amino acid sequence.
26. The method of claim 25 wherein the first entity is an intact bacterial RNAP.
27. The method of claim 25 wherein the first entity is a fragment of a bacterial RNAP.
28. The method of claim 25 wherein the first entity is a derivative of Escherichia coli RNAP.
29. The method of claim 25 wherein first entity is a derivative of Bacillus subtilis RNAP.
30. The method of claim 25 wherein the activity is RNA synthesis.
31. The method of claim 25 wherein the activity is NTP uptake.
32. The method of claim 25 wherein the activity is pyrophosphate release.
33. The method of claim 25 wherein the activity is abortive-RNA release.
34. The method of claim 25 wherein the activity is edited-RNA release.
35. The method of claim 25 wherein the activity is transcriptional pausing.
36. The method of claim 25 wherein the activity is transcriptional arrest.
37. The method of claim 25 wherein the activity is Gre-factor binding.
38. The method of claim 25 further comprising comparison of: (a) at least one of the presence, extent, concentration-dependence, or kinetics of the inhibition by the agent of an activity of the first entity; and (b) at least one of the presence, extent, concentration-dependence, or kinetics of the inhibition by the agent of an activity of a second entity that contains a derivative of a bacterial RNAP homologous secondary channel amino acid having at least one substitution, insertion, or deletion.
39. The method of claim 38 wherein the second entity is a derivative of an intact bacterial RNAP.
40. The method of claim 38 wherein the second entity is a derivative of a fragment of a bacterial RNAP.
41. The method of claim 38 wherein the second entity is a derivative of Escherichia coli RNAP.
42. The method of claim 38 wherein the second entity is a derivative of Bacillus subtilis RNAP.
43. The method of claim 38 wherein the activity is RNA synthesis.
44. The method of claim 38 wherein the activity is NTP uptake.
45. The method of claim 38 wherein the activity is pyrophosphate release.
46. The method of claim 38 wherein the activity is abortive-RNA release.
47. The method of claim 38 wherein the activity is edited-RNA release.
48. The method of claim 38 wherein the activity is transcriptional pausing.
49. The method of claim 38 wherein the activity is transcriptional arrest.
50. The method of claim 38 wherein the activity is Gre-factor binding.
51. The method of claim 38 further comprising comparison of: (a) at least one of the presence, extent, concentration-dependence, or kinetics of inhibition by the agent of an activity of the first entity; and (b) at least one of the presence, extent, concentration-dependence, or kinetics of inhibition by the agent of an activity of a eukaryotic RNAP derivative.
52. The method of claim 51 wherein the eukaryotic RNAP derivative is a human RNAP derivative.
53. The method of claim 51 wherein the eukaryotic RNAP derivative is a human RNAP II derivative.
54. The method of claim 25 further comprising comparison of: (a) at least one of the presence, extent, concentration-dependence, or kinetics of inhibition by the agent of an activity of the first entity; and (b) at least one of the presence, extent, concentration-dependence, or kinetics of inhibition by MccJ25 of an activity of the first entity.
55. A method for identifying an agent that binds to a bacterial RNAP homologous secondary channel amino acid sequence, comprising (a) preparing a reaction solution comprising the agent to be tested, a reference compound that binds to a homologous bacterial RNAP secondary channel amino acid sequence, and a first entity containing a bacterial RNAP homologous secondary channel amino acid sequence, and (b) detecting at least one of the presence, extent, concentration-dependence, or kinetics of competition by the agent for binding of the reference compound to the homologous secondary channel amino acid sequence.
56. The method of claim 55 wherein the first entity is an intact bacterial RNAP.
57. The method of claim 55 wherein the first entity is a fragment of a bacterial RNAP.
58. The method of claim 55 wherein the first entity is a derivative of Escherichia coli RNAP.
59. The method of claim 55 the first entity is a derivative of Bacillus subtilis RNAP.
60. The method of claim 55 wherein the reference compound contains a detectable group.
61. The method of claim 60 wherein the detectable group contains a chromophore.
62. The method of claim 60 wherein the detectable group contains a fluorophore.
63. The method of claim 55 wherein the reference compound is MccJ25.
64. The method of claim 55 wherein the reference compound is a MccJ25 derivative.
65. The method of claim 55 wherein the reference compound is a chromophore-labelled MccJ25 derivative.
66. The method of claim 55 wherein the reference compound is a fluorophore-labelled MccJ25 derivative.
67. The method of claim 55 wherein the reference compound is selected from the group consisting of [Cy3-Lys5]-MccJ25 and (Cy3-Lys13]-MccJ25.
68. The method of claim 55 further comprising measurement of FRET.
69. The method of claim 55 further comprising comparison of: (a) at least one of the presence, extent, concentration-dependence, or kinetics of the binding of the agent to the first entity; and (b) at least one of the presence, extent, concentration-dependence, or kinetics of the binding of the agent to a second entity that contains a derivative of a bacterial RNAP homologous secondary channel amino acid having at least one substitution, insertion, or deletion.
70. The method of claim 69 wherein the second entity is a derivative of an intact bacterial RNAP.
71. The method of claim 69 wherein the second entity is a derivative of a fragment of a bacterial RNAP.
72. The method of claim 69 wherein the second entity is a derivative of Escherichia coli RNAP.
73. The method of claim 69 wherein the second entity is a derivative of Bacillus subtilis RNAP.
74. The method of claim 69 further comprising comparison of: (a) at least one of the presence, extent, concentration-dependence, or kinetics of binding of the agent to the first entity, and (b) at least one of the presence, extent, concentration-dependence, or kinetics of binding of the agent to a eukaryotic RNAP derivative.
75. The method of claim 74 wherein the eukaryotic RNAP derivative is a human RNAP derivative.
76. The method of claim 74 wherein the eukaryotic RNAP derivative is a human RNAP II derivative.
77. The method of claim 55 further comprising comparison of: (a) at least one of the presence, extent, concentration-dependence, or kinetics of binding of the agent to the first entity; and (b) at least one of the presence, extent, concentration-dependence, or kinetics of binding of MccJ25 to the first entity.
US10/526,323 2002-09-04 2003-09-04 Target and method for inhibition of bacterial rna polymerase Abandoned US20060160158A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US10/526,323 US20060160158A1 (en) 2002-09-04 2003-09-04 Target and method for inhibition of bacterial rna polymerase
US12/257,801 US8198021B2 (en) 2002-09-04 2008-10-24 Target and method for inhibition of bacterial RNA polymerase
US13/482,149 US8575306B2 (en) 2002-09-04 2012-05-29 Target and method for inhibition of bacterial RNA polymerase

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US40768402P 2002-09-04 2002-09-04
US47460703P 2003-06-02 2003-06-02
US47460803P 2003-06-02 2003-06-02
US10/526,323 US20060160158A1 (en) 2002-09-04 2003-09-04 Target and method for inhibition of bacterial rna polymerase
PCT/US2003/027457 WO2004023093A2 (en) 2002-09-04 2003-09-04 Target and method for inhibition of bacterial rna polymerase

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/257,801 Continuation US8198021B2 (en) 2002-09-04 2008-10-24 Target and method for inhibition of bacterial RNA polymerase

Publications (1)

Publication Number Publication Date
US20060160158A1 true US20060160158A1 (en) 2006-07-20

Family

ID=31982349

Family Applications (3)

Application Number Title Priority Date Filing Date
US10/526,323 Abandoned US20060160158A1 (en) 2002-09-04 2003-09-04 Target and method for inhibition of bacterial rna polymerase
US12/257,801 Expired - Fee Related US8198021B2 (en) 2002-09-04 2008-10-24 Target and method for inhibition of bacterial RNA polymerase
US13/482,149 Expired - Fee Related US8575306B2 (en) 2002-09-04 2012-05-29 Target and method for inhibition of bacterial RNA polymerase

Family Applications After (2)

Application Number Title Priority Date Filing Date
US12/257,801 Expired - Fee Related US8198021B2 (en) 2002-09-04 2008-10-24 Target and method for inhibition of bacterial RNA polymerase
US13/482,149 Expired - Fee Related US8575306B2 (en) 2002-09-04 2012-05-29 Target and method for inhibition of bacterial RNA polymerase

Country Status (3)

Country Link
US (3) US20060160158A1 (en)
AU (1) AU2003265884A1 (en)
WO (1) WO2004023093A2 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008121154A2 (en) * 2007-03-31 2008-10-09 Rutgers, The State University Of New Jersey Nucleic acid sequences for biosynthesis of non -mccj25-related lariat peptides
US20090137467A1 (en) * 2005-11-04 2009-05-28 Ebright Richard H Bipartite Inhibitors of Bacterial RNA Polymerase
US8575306B2 (en) 2002-09-04 2013-11-05 Rutgers, The State University Of New Jersey Target and method for inhibition of bacterial RNA polymerase
CN105407855A (en) * 2013-06-04 2016-03-16 西格玛仪器控股有限责任公司 Diagnostic and therapeutic treatment device, and related systems and methods of utilizing such a device
US9782324B2 (en) 2011-09-15 2017-10-10 Sigma Instruments Holdings, Llc System and method for treating skin and underlying tissues for improved health, function and/or appearance
US9861547B2 (en) 2011-09-15 2018-01-09 Sigma Instruments Holdings, Llc Systems and methods for preventing, managing and/or treating peripheral neuropathy, peripheral vascular disease, erectile dysfunction, urinary incontinence, cellulite and other conditions
US10226397B2 (en) 2011-09-15 2019-03-12 Sigma Instruments Holdings, Llc System and method for treating soft tissue with force impulse and electrical stimulation
US10342649B2 (en) 2011-09-15 2019-07-09 Sigma Instruments Holdings, Llc System and method for treating animals
US11020188B2 (en) 2017-11-10 2021-06-01 Sigma Instruments Holdings, Llc System, method, and GUI for treating skin and underlying tissues for improved health, function and/or appearance

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060246479A1 (en) * 2005-02-10 2006-11-02 Rutgers, The State University Of New Jersey Switch-region: target and method for inhibition of bacterial RNA polymerase
US7442762B2 (en) * 2005-03-09 2008-10-28 Rutgers, The State University Of New Jersey Mutational derivatives of microcin J25
WO2007106472A2 (en) * 2006-03-13 2007-09-20 Rutgers, The State University Of New Jersey Non-mccj25-related lariat-peptide inhibitors of bacterial rna polymerase
WO2012129173A1 (en) * 2011-03-18 2012-09-27 Rutgers, The State University Of New Jersey Bridge-helix cap: target and method for inhibition of bacterial rna polymerase
WO2015062887A2 (en) * 2013-10-31 2015-05-07 Sony Corporation Telecommunications apparatus and methods

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020034808A1 (en) * 1999-09-15 2002-03-21 Darst Seth A. Crystal of bacterial core RNA polymerase

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6162613A (en) 1998-02-18 2000-12-19 Vertex Pharmaceuticals, Inc. Methods for designing inhibitors of serine/threonine-kinases and tyrosine kinases
AU2795799A (en) 1998-02-26 1999-09-15 Guennadi V. Glinskii Antibacterial drugs, methods for their design and methods for their use
US20060160158A1 (en) 2002-09-04 2006-07-20 Ebright Richard H Target and method for inhibition of bacterial rna polymerase

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020034808A1 (en) * 1999-09-15 2002-03-21 Darst Seth A. Crystal of bacterial core RNA polymerase

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8575306B2 (en) 2002-09-04 2013-11-05 Rutgers, The State University Of New Jersey Target and method for inhibition of bacterial RNA polymerase
US20090137467A1 (en) * 2005-11-04 2009-05-28 Ebright Richard H Bipartite Inhibitors of Bacterial RNA Polymerase
US8372839B2 (en) 2005-11-04 2013-02-12 Rutgers, The State University Of New Jersey Bipartite inhibitors of bacterial RNA polymerase
WO2008121154A2 (en) * 2007-03-31 2008-10-09 Rutgers, The State University Of New Jersey Nucleic acid sequences for biosynthesis of non -mccj25-related lariat peptides
WO2008121154A3 (en) * 2007-03-31 2009-01-15 Univ Rutgers Nucleic acid sequences for biosynthesis of non -mccj25-related lariat peptides
US9782324B2 (en) 2011-09-15 2017-10-10 Sigma Instruments Holdings, Llc System and method for treating skin and underlying tissues for improved health, function and/or appearance
US9861547B2 (en) 2011-09-15 2018-01-09 Sigma Instruments Holdings, Llc Systems and methods for preventing, managing and/or treating peripheral neuropathy, peripheral vascular disease, erectile dysfunction, urinary incontinence, cellulite and other conditions
US10226397B2 (en) 2011-09-15 2019-03-12 Sigma Instruments Holdings, Llc System and method for treating soft tissue with force impulse and electrical stimulation
US10342649B2 (en) 2011-09-15 2019-07-09 Sigma Instruments Holdings, Llc System and method for treating animals
CN105407855A (en) * 2013-06-04 2016-03-16 西格玛仪器控股有限责任公司 Diagnostic and therapeutic treatment device, and related systems and methods of utilizing such a device
US11020188B2 (en) 2017-11-10 2021-06-01 Sigma Instruments Holdings, Llc System, method, and GUI for treating skin and underlying tissues for improved health, function and/or appearance

Also Published As

Publication number Publication date
US20100047780A1 (en) 2010-02-25
US20130030152A1 (en) 2013-01-31
AU2003265884A8 (en) 2004-03-29
AU2003265884A1 (en) 2004-03-29
US8198021B2 (en) 2012-06-12
WO2004023093A2 (en) 2004-03-18
WO2004023093A3 (en) 2004-09-10
US8575306B2 (en) 2013-11-05

Similar Documents

Publication Publication Date Title
US8575306B2 (en) Target and method for inhibition of bacterial RNA polymerase
US8114583B2 (en) Switch-region: target and method for inhibition of bacterial RNA polymerase
US6077682A (en) Methods of identifying inhibitors of sensor histidine kinases through rational drug design
US8697354B2 (en) RNA-exit-channel: target and method for inhibition of bacterial RNA polymerase
US7442762B2 (en) Mutational derivatives of microcin J25
US20070196886A1 (en) Target And Method For Inhibition Of Bacterial Rna Polymerase Minimized Derivatives Of Peptide Antibiotic Mccj25
WO2005024040A2 (en) TARGET AND METHOD FOR INHIBITION OF BACTERIAL RNA POLYMERASE: MINIMIZED DERIVATIVES OF PEPTIDE ANTIBIOTIC MccJ25
Lazzarin et al. Noncanonical sortase‐mediated assembly of pilus type 2b in Group B Streptococcus
US20150094229A1 (en) Methods for the screening of antibacterial substances
US20040157314A1 (en) Inhibitors of Staphylococcus aureus primary sigma factor and uses thereof
Groth et al. Molecular architecture of the c-subunit oligomer in the membrane domain of F-ATPases probed by tryptophan substitution mutagenesis
US7326541B2 (en) Fragments and variants of Staphylococcus aureus DNAG primase, and uses thereof
US20080057494A1 (en) Ribosomal Rna Methyltransferases Rima:Target Validation and Processes for Deleloping an Inhibitor Assay and Identification of Candidate Inhibitors
WO2006113841A2 (en) Nucleic acid-like proteins
AU2002220422B2 (en) S.aureus protein STAAU R2, gene encoding it and uses thereof
JP2004530411A (en) Methods for identifying antimicrobial compounds
김정목 Functional and structural analyses of the carboxy-terminal domain of the transcription factor BldD in Streptomyces coelicolor A3 (2)
Goss Threonine Phosphorylation Regulates Two-Component Systems Involved in Cell Wall Metabolism
CA2433308A1 (en) Compositions and methods involving an essential staphylococcus aureus gene and its encoded protein staau_r4
Mayans et al. Structural basis for activation of the titin kinase domain during myofibrillogenesis
BajpaiPrachi et al. Polymorphic Variation of CYP2D6 and GSTT1 Genes and its Association with Susceptibility to Chronic Myeloid Leukemia (CML)
Schuster1& et al. The second messenger c-di-AMP inhibits the osmolyte uptake system OpuC in Staphylococcus aureus
AU2002220422A1 (en) S.aureus protein STAAU R2, gene encoding it and uses thereof
WO2000011141A2 (en) tRNA BINDING DOMAIN

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH - DIRECTOR DEITR, MARYLAND

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:RUTGERS, THE STATE UNIV OF NJ;REEL/FRAME:055157/0150

Effective date: 20210203