US20060063184A1

US20060063184A1 - Compositions and methods for the detection of DNA topoisomerase II complexes with DNA

Info

Publication number: US20060063184A1
Application number: US11/222,626
Authority: US
Inventors: Carolyn Felix; Donald Baldwin
Original assignee: Childrens Hospital of Philadelphia CHOP
Current assignee: Childrens Hospital of Philadelphia CHOP
Priority date: 2004-09-09
Filing date: 2005-09-09
Publication date: 2006-03-23
Also published as: US8642265B2; US20100167944A1

Abstract

Compositions, methods, and kits for detecting DNA topoisomerase II-DNA complexes are disclosed.

Description

This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 60/608,331, filed on Sep. 9, 2004. The foregoing application is incorporated by reference herein.
Pursuant to 35 U.S.C. §202(c) it is acknowledged that the U.S. Government has certain rights in the invention described herein, which was made in part with funds from the National Institutes of Health, Grant Numbers RO1 CA77683, CA85469, and CA80175.

FIELD OF THE INVENTION

The present invention relates to the fields of molecular biology and oncology. More specifically, the invention provides compositions and methods for detection of DNA topoisomerase II complexes with genomic DNA.

BACKGROUND OF THE INVENTION

Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full.
Epipodophyllotoxins and anthracyclines, which are commonly used chemotherapeutic DNA topoisomerase II inhibitors, more accurately are called DNA topoisomerase II poisons because they increase the concentration of DNA topoisomerase II cleavage complexes and have the overall effect of enhancing cleavage, which is cytotoxic (1). These agents are associated with leukemia as a treatment complication (2). Most DNA topoisomerase II inhibitor-related leukemias have MLL (myeloid lymphoid leukemia) translocations (3). The translocations disrupt an 8.3 kb bcr between exons 5-11 of the ˜100 kb MLL gene at chromosome band 11q23. The association of DNA topoisomerase II inhibitors with leukemia has suggested a translocation mechanism that involves chromosomal breakage from drug-stabilized DNA topoisomerase II cleavage and formation of the breakpoint junctions when the breakage is repaired (2). The drug stabilized complexes have been called ternary (drug-DNA-topoisomerase II) complexes in the literature. In previous reports, MLL translocations have been characterized and tracked in leukemias in two patients receiving chemotherapy (Megonigal 2000; Blanco 2001), and the role of chemotherapy-stabilized DNA topoisomerase II cleavage in the translocation process has been investigated in in vitro assays of DNA substrates outside of the cellular context (Lovett, 2001; Lovett 2001; Whitmarsh 2003). However, cell death from chemotherapy also forces bone marrow progenitor cell proliferation (4) and native DNA topoisomerase IIα expression is highest in proliferating cells (5, 6).
Genomic breakpoint junctions on derivative chromosomes arising from MLL translocations were cloned in two cases of leukemia following intensive neuroblastoma regimens (7, 8). Such chemotherapy regimens have been associated with a high incidence of leukemia as a treatment complication (9).

SUMMARY OF THE INVENTION

It is an objective of the present invention to provide compositions and methods for detecting ternary topoisomerase II/DNA complexes with cytotoxic chemotherapy drugs (e.g., DNA topoisomerase II poisons) or with natural compounds that have similar activity, as well as topoisomerase II complexes with DNA formed by the native enzyme as a means to assess strategies to prevent the oncogenic events associated with chemotherapy and exposure to natural topoisomerase II inhibitors.
In addition, it is known that cytotoxic chemotherapy may cause cell death that is followed by bone marrow progenitor cell proliferation with accompanying increased native DNA topoisomerase II expression. A patient has recently bee identified with leukemia with an MLL translocation which emerged after chemotherapy that did not include a DNA topoisomerase II poison (Langer, 2003). Accordingly, it is another objective of the present invention to provide compositions and methods for detecting topoisomerase II/DNA complexes that are formed by the native enzyme at elevated levels, and as a means to prevent leukemogenic events associated with chemotherapy.
Thus, in accordance with the present invention, compositions, methods, and kits are provided for the detection of topoisomerase II-genomic DNA complexes. The detection of such complexes can be indicative of DNA damage, particularly in relation to treatment-related leukemia. An exemplary method entails providing cells which express topoisomerase II and exposing the cells to an agent suspected of inducing formation of agent-topoisomerase-DNA cleavage complexes for a time period sufficient for such complexes to form. The cells are then lysed and DNA-topoisomerase cleavage complexes are isolated. Alternatively, the cells can be exposed to agents that result in increased expression of topoisomerase II without formation of agent-topoisomerase-DNA cleavage complexes, in which topoisomerase II-DNA cleavage complexes can be measured. Following isolation, the DNA present in the isolated complexes can be amplified by degenerative oligonucleotide PCR and then assayed by real-time PCR with primers specific for the region of interest, such as, for example, the MLL breakpoint cluster region (bcr). Alternatively or additionally, the DNA present in the isolated complexes that has been amplified by degenerative oligonucleotide PCR can be labeled with a detectable label. The optionally labeled DNA is then characterized via hybridization to predetermined sequences present in the region of genomic DNA where the complexes form in order to characterize the sites of complex formation with DNA at the sequence level. In one aspect of the invention, the predetermined sequences are present on a microarray. According to another aspect, the genomic DNA sequences are from the MLL bcr. According to another aspect, the genomic DNA sequences, with or without DNA sequences from the MLL bcr, comprise partner genes which are fused with MLL in certain leukemias. In accordance with another aspect of the invention, the genomic DNA sequences are sequences associated with leukemia. In accordance with yet another aspect of the invention, the genomic DNA sequences comprise the entire human genome.
In accordance with another aspect of the instant invention, a method for identifying sequences present in DNA topoisomerase II-DNA complexes in cells is provided. The method comprises: a) providing cells suspected of containing DNA topoisomerase II-DNA complexes; b) isolating DNA topoisomerase II-DNA complexes from the cell; c) amplifying the DNA present in isolated DNA topoisomerase II-DNA complexes via polymerase chain reaction; and d) identifying the sequences present in said amplified DNA, thereby identifying the sequences present in said DNA topoisomerase II-DNA complexes. In a preferred embodiment, the DNA in the DNA topoisomerase II-DNA complexes is genomic DNA. In a particular embodiment, the identification of the sequences in step d) comprises 1) further amplifying the amplified DNA from step c) with gene specific primers; 2) further amplifying the amplified DNA from step c) by real-time PCR; and/or 3) hybridizing the amplified DNA from step c) with a microarray, such as those described hereinbelow. In another embodiment, the cells are CD34+ cells. Additionally, the amplified DNA of step c) may comprise sequences from the MLL gene. According to another aspect of the invention, the cells are exposed to an agent suspected of modulating formation of topoisomerase cleavage complexes.
In yet another aspect of the invention, microarrays are provided. In a particular embodiment, the microarray comprises at least one of the group consisting of MLL bcr oligonucleotide sequences and oligonucleotide sequences of MLL partner genes. In another embodiment, the MLL bcr oligonucleotide sequences hybridize to non-repetitive MLL bcr sequences. The microarrays may also further comprise oligonucleotide sequences from the Alu region between nucleotide positions 663-1779 in the MLL bcr and/or control sequences which are not involved in MLL translocations. Examples of control sequences include, without limitation, MLL exon 25, MLL exon 3, GAPDH, c-myc, and bacterial gene sequences. MLL partner genes include, without limitation, LAF-4, AF4 (MLLT2, FEL), AF5α, AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17, ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1), AF15q14, AF1p (eps15), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17, ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM, LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL. In a particular embodiment of the invention, the microarray comprises oligonucleotide sequences of at least one of SEQ ID NOs 1-162. In another particular embodiment of the invention, the microarray comprises oligonucleotide sequences of at least one of SEQ ID NOs 163-246.
In accordance with yet another aspect of the instant invention, kits are provided for performing the methods of the instant invention, such as for the detection of DNA-DNA topoisomerase II complexes and the sequences of the DNA of these complexes. The kits may comprise any or all of the following: an agent and a buffer for lysing cells; a solid support; a buffer for isolating DNA-DNA topoisomerase II complexes; at least one primer for use in whole genome amplification method; a buffer for PCR amplification of isolated topoisomerase II bound DNA; primers and buffer for real-time PCR analysis of specific genes in the isolated, topoisomerase II-bound DNA that has been amplified by a whole genome amplification method; at least one detectable label for comparative labeling of topoisomerase II bound DNA from two cell populations that has been amplified by a whole genome amplification method or comparative labeling of topoisomerase II bound DNA from one cell population that has been amplified by a whole genome amplification method and a calibrated control DNA; calibrated control DNA for labeling and hybridization to the microarray at the same time as the test sample labeled with another detectable label; a microarray comprising sequences from at least one of the group consisting of the MLL bcr and MLL partner genes and, optionally, control sequences; and instruction material. In a particular aspect of the invention, the kit comprises: a) an agent and a buffer for lysing cells; b) a solid support and a buffer for isolating DNA-DNA topoisomerase II complexes; c) at least one primer and a buffer for PCR amplification of isolated DNA by whole genome amplification; d) at least one first detectable label for incorporation into products of whole genome amplification; e) calibrated reference standard DNA comprising a second detectable label; f) a microarray comprising oligonucleotide sequences from the MLL bcr; and g) instruction material.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A is a summary of the clinical course and treatment of patient t-120 and the Southern blot and PCR analysis of sequential bone marrow specimens. The chemotherapy cycles administered according to the Memorial Sloan-Kettering N7 regimen were CAV (cyclophosphamide 4200 mg/m², doxorubicin 75 mg/M², vincristine 1.5 mg/m²) or PVP (cisplatin 200 mg/m², etoposide 600 mg/m²). 3F8* indicates radiolabeled anti-GD2 monoclonal antibody treatment. (+) or (−) indicates detection of MLL translocation by Southern blot analysis or by nested PCR with gene-specific primers. FIG. 1B is a gel of a Southern blot analysis of MLL breakpoint cluster region (bcr) rearrangements in sequential marrow specimens. FIG. 1C is a gel of Clonotypic PCR analysis (Round 1) and nested clonotypic PCR analysis of the der(4) genomic breakpoint junction in sequential marrow specimens.
FIGS. 2A and 2B are images of autoradiographs showing the cleavage products after 10 min incubation at 37° C. of 25 ng (30,000 cpm) singly 5′ end-labeled DNA with 147 nM human DNA topoisomerase IIα, 1 mM ATP and, where indicated, 20 μM etoposide (VP16), etoposide catechol (VP16-OH), etoposide quinone (VP16-Q), or doxorubicin (ADR). FIG. 2A is an analysis of normal homologues of MLL genomic breakpoint sequences in ALL (acute lymphoblastic leukemia) of patient t-120. DNA topoisomerase II cleavage of MLL intron 8 coordinates 6513 to 6778. FIG. 2B is an analysis of normal homologues of AF-4 genomic breakpoint sequences in ALL of patient t-120 in DNA topoisomerase II in vitro cleavage assays. DNA topoisomerase II cleavage of AF-4 intron 3 coordinates 6956 to 7239. The indicated reactions were incubated for an additional 10 min at 75° C. before trapping of covalent complexes. The 5′ side (−1 position) of the cleavage sites are shown. Corkscrew arrows at far right indicate translocation breakpoints. FIGS. 2C and 2D demonstrate the effects of doxorubicin over a range of concentrations on the cleavage of the MLL (FIG. 2C) and AF-4 (FIG. 2D) substrates.
FIGS. 3A and 3B are schematic drawings of models for processing of cleavage sites to form der(11) and der(4) genomic breakpoint junctions in ALL of patient t-120. In FIG. 3A, DNA topoisomerase II cleavage sites at MLL intron 8 position 6588 and AF-4 intron 3 position 7126 with 4-base 5′ overhangs are shown at the top. The cleavage at MLL (fragment shown is SEQ ID NO: 258) intron 8 position 6588 was detected in the presence of etoposide, etoposide metabolites and doxorubicin. The cleavage at AF-4 (fragment shown is SEQ ID NO: 259) intron 3 position 7126 was detected in the presence of etoposide and etoposide metabolites. The processing includes exonucleolytic nibbling (italic) to form single-base homologies and create both breakpoint junctions of the t(4; 11) by error-prone non-homologous end joining (NHEJ) (boxes). In formation of the der(11) (SEQ ID NO: 260 shown) positions 6590 to 6592 on the antisense strand of MLL and positions 7127 to 7129 on the sense strand of AF-4 are lost by exonucleolytic nibbling (italic, middle) before NHEJ (box, middle) joins the indicated bases. Positions 7110 to 7126 on the sense strand of AF-4, positions 7111 to 7130 on the antisense strand of AF-4, positions 6589 to 6594 on the sense strand of MLL and positions 6593 to 6595 on the antisense strand of MLL are lost by exonucleolytic nibbling (italic, bottom) and the der(4) (SEQ ID NO: 261 shown) also forms by NHEJ (box, bottom). Similarly, FIG. 3B demonstrates the formation of der(11) (SEQ ID NO: 260 shown) and der(4) (SEQ ID NO: 261 shown) genomic breakpoint junctions wherein the DNA topoisomerase II cleavage sites at MLL (fragment shown is SEQ ID NO: 258) intron 8 position 6588 and AF-4 (fragment shown is SEQ ID NO: 259) intron 3 position 7114 are employed, the latter of which was detected in the presence of doxorubicin.
FIGS. 4A and 4B are images of autoradiographs of normal homologues of MLL (FIG. 4A) and GAS7 (FIG. 4B) genomic breakpoint sequences in acute myeloid leukemia (AML) of patient t-39 in DNA topoisomerase II in vitro cleavage assays. DNA topoisomerase II cleavage of MLL intron 8 coordinates 4589 to 4768 and GAS7 coordinates 1129 to 1440 upstream of exon 1. FIGS. 4C and 4D demonstrate the effects of doxorubicin over a range of concentrations on the cleavage of the MLL at position 4673 and 4675 (FIG. 4C) and GAS7 at position 1238 (FIG. 4D).
FIG. 5 is a schematic drawing of a model for processing of DNA topoisomerase II cleavage sites that were detected without drug and enhanced greatly with low concentration doxorubicin, (the only DNA topoiosomerase II targeted drug to which the patient was exposed before molecular detection of the translocation) to form der(11) (SEQ ID NO: 264 shown) and der(17) (SEQ ID NO: 265 shown) genomic breakpoint junctions in AML of patient t-39. Both genomic breakpoint junctions are formed by resolution of doxorubicin-stimulated DNA topoisomerase II cleavage sites via error-prone nonhomologous end-joining (NHEJ). DNA topoisomerase II cleavage sites at MLL (fragment shown is SEQ ID NO: 262) intron 8 position 4675 and GAS7 (fragment shown is SEQ ID NO: 263) position 1238 with 4-base 5′ overhangs are shown at the top. In formation of the der(11) positions 4664 to 4675 on the sense strand of MLL, positions 4665 to 4679 on the antisense strand of MLL and positions 1239 to 1240 on the sense strand of GAS7 are lost by exonucleolytic nibbling (italic, middle) before NHEJ (box, middle) and gap fill-in (black, middle) ensue. Positions 1204 to 1238 on the sense strand of GAS7, positions 1207 to 1242 on the antisense strand of GAS7, positions 4676 to 4679 on the sense strand of MLL and positions 4680 to 4682 on the antisense strand of MLL are lost by exonucleolytic nibbling (italic, bottom) and the der(17) forms by NHEJ (box, bottom) and mismatch repair (asterisks, bottom).
FIG. 6 is an image of a Western blot analysis of DNA topoisomerase IIα protein expression in ex vivo-expanded CD34+ cells and cultured hematopoietic cell lines. 3 μg of protein per lane were loaded on the gel. The filter was simultaneously hybridized to mouse anti-human DNA topoisomerase IIα (DAKO, Glostrup, Denmark) and mouse anti-human β-actin (Abcam, Cambridge, Mass.) antibodies.
FIGS. 7A through 7D are images of Western blots demonstrating DNA topoisomerase II-DNA complex formations in the presence of various drugs at various concentrations in a modified ICE bioassay. The assays were performed on CEM cells (FIG. 7A), K562 cells (FIGS. 7B and 7C), and KG-1 cells (FIG. 7D). Etoposide (VP16), etoposide catechol (VP16-OH), etoposide quinone (VP16-Q), and doxorubicin were tested.
FIG. 8 is an image of a gel showing a modified in vivo complex of enzyme (ICE) assay of DNA topoisomerase II covalent complexes in ex-vivo expanded CD34⁺ cells. The cells were untreated or treated for 2 hours with etoposide at 100 μM final concentration. Total genomic DNA containing protein-bound DNA was isolated on a CsCl cushion and 5.6 μg per well was loaded on a 4-12% Bis-Tris gradient gel. An anti-human DNA topoisomerase IIα antibody (DAKO, Glostrup, Denmark) was used to detect DNA topoisomerase II covalent complexes. Recombinant human DNA topoisomerase IIα is in lane at the far left. The molecular weight of the topoisomerase II band is >170 kD, which is the molecular weight of topoisomerase II. This is consistent with DNA bound to the enzyme.
FIGS. 9A, 9B, 9C, and 9D are plots from the real-time PCR analysis of DNA topoisomerase II covalent complexes with MLL and other sequences. CD34⁺ cells were untreated or treated for 2 hours with etoposide at a 100 μM final concentration. Total genomic DNA containing protein-bound DNA was isolated on a CsCl cushion, and DNA topoisomerase IIα-bound DNA was purified on an immunoaffinity column and then amplified by degenerative oligonucleotide PCR (DOP). 50 ng of DOP products ranging from 500 bp to 1 kb in size served as a template for amplification in real-time PCR with primers specific for MLL intron 8-exon 9 (FIG. 9A), GAPDH (FIG. 9B), MLL exon 25 (FIG. 9C), or MLL intron7-exon 8 (FIG. 9D). Products were not detectable in duplicate reagent-control reactions for these amplicons. ΔRn (measure of reporter signal) v. cycles are shown in the plots.
FIG. 10 is a schematic drawing of the methods of an in vivo complex of enzyme bioassay allowing for the detection of DNA-DNA topoisomerase II complexes.
FIG. 11 is a schematic drawing of the methods for the isolation of DNA-DNA topoisomerase II complexes.
FIG. 12A is an image of XeoChips™ containing different amounts of products from DOP amplification of MLL bcr plasmid that were labeled with AlexaFluor 546 or AlexaFluor 647 in order to establish conditions for calibrated standard. FIGS. 12B and 12C are Quantile-Quantile plots standardized by intensity comparing etoposide-treated and untreated cells and genistein-treated and untreated cells, respectively, when the test sample (treated or untreated) was labeled with AlexaFluor 546 and the MLL bcr calibrated reference sample was labeled with AlexaFluor 647. The points that deviate from the linear relationship suggests coldspots or hotspots for formation DNA topoisomerase II cleavage complexes in the treated compared to untreated cells.

DETAILED DESCRIPTION OF THE INVENTION

The emergence of the MLL translocation relative to intensive multimodality neuroblastoma therapy administered to two patients with secondary acute leukemia was traced to assess the role of specific agents in the genesis of the translocations. An in vitro assay was employed and a CD34+ cell model developed in order to pinpoint whether the translocations arose from drug stimulated DNA topoisomerase IIα cleavage and formation of drug-DNA-topoisomerase II complexes at or in close proximity to the translocation breakpoints. Variability in the molecular emergence of traceable translocations was found. In one case, the t(4; 11) was first detectable 6 months after neuroblastoma diagnosis, following completion of all chemotherapy and exposure to etoposide and doxorubicin. Processing of functional DNA topoisomerase II cleavage sites enhanced by etoposide or its metabolites or doxorubicin resulted in both breakpoint junctions. In another case, doxorubicin was the only DNA topoisomerase II inhibitor exposure before detection of the MLL-GAS7 translocation at six weeks after starting treatment (7). There were strong DNA topoisomerase II cleavage sites detected without drug and further enhanced by doxorubicin in MLL and GAS7 that resulted in both breakpoint junctions. This is the first functional demonstration of relevance of doxorubicin-DNA-topoisomerase II covalent complexes with MLL and with its partner gene in the genesis of MLL translocations in treatment-related AML.
In the ALL of patient t-120 described above, the translocation breakpoint in the leukemia and the site of in vitro drug-DNA-topoisomerase II complex formation both were at the translocation breakpoint hotspot region 3′ in intron 8 in the MLL bcr (reviewed in Whitmarsh 2003). In the recent treatment-related AML described by Langer (2003) where the leukemia occurred after cytotoxic chemotherapy without DNA topoisomerase II poisons, the translocation breakpoint also was at the same translocation breakpoint hotspot region. The in vitro assays described above as well as in Whitmarsh (2003) showed that not only drug-DNA-topoisomerase II complexes but also DNA-native topoisomerase II complexes were formed in this translocation breakpoint hotspot region.
It was important to devise a cellular model to further study the role of DNA topoisomerase II cleavage in the genesis of MLL translocations because cleavage sites in the cellular context should be more restricted than in vitro (Capranico et al., 1990). In the development of this cellular model it was important to focus on the breakpoint hotspot region 3′ in intron 8 of the MLL bcr. DNA topoisomerase II was highly expressed in CD34+ cells and formed cleavage complexes with the MLL bcr at the 3′ breakpoint hotspot region in untreated CD34+ cells and CD34+ cells treated with etoposide. These findings establish that DNA topoisomerase II forms cleavage complexes with the MLL bcr in bone marrow stem cells, and implicate not only drug-stabilized DNA topoisomerase II cleavage but also native DNA topoisomerase II cleavage as mechanisms to damage MLL.
A modified in vivo complex of enzyme (ICE) bioassay, which entails trapping and immunodetection of DNA covalently bound to DNA topoisomerase II, has been developed to examine native and chemotherapy-stabilized DNA topoisomerase II cleavage complexes in ex vivo stimulated CD34+ progenitor cells from normal human marrow. The details of the ICE assay as applied to cell lines were described in (Whitmarsh 2003). However, the ICE bioassay detects overall formation of DNA topoisomerase II covalent complexes genome-wide but does not address the enzyme-DNA interaction at the sequence level.
In accordance with the present invention, a new approach was created to detect DNA topoisomerase II covalent complexes with MLL bcr in CD34+ cells at the sequence level. Total genomic DNA samples including protein-bound DNA from untreated or etoposide-treated ex vivo-expanded human CD34+ cells were prepared on a CsCl cushions according to the ICE assay protocol. However, the ICE assay then utilizes immunoblotting to detect all DNA in total genomic DNA bound to DNA topoisomerase IIα by the covalent phosphotyrosine linkage formed between this enzyme and DNA (Whitmarsh et al., 2003) without attention to any specific sequences. The instant assay diverges, for example, from the ICE assay in the following manner: DNA topoisomerase IIα covalent complexes in the total genomic DNA isolated using the CsCl cushion are purified on an immuno-affinity column consisting of Protein A-Sepharose beads covalently coupled to a mouse anti-human DNA topoisomerase IIα antibody. Eluted material from the column is then subjected to degenerative oligonucleotide PCR (DOP) in order to generate template DNAs in sufficient quantity for real-time PCR. MLL bcr primers for real-time PCR were designed to amplify positions 6784 to 6851 at the junction of intron 8-exon 9 near the previously described translocation breakpoint hotspot (Whitmarsh et al., 2003). Other primer pairs would amplify a genomic region of GAPDH and a genomic region of MLL exon 25, which are not involved in MLL translocations (Langer et al., 2003). Yet other primers would amplify a region of the MLL bcr at the junction of intron 7-exon 8 near a region where other MLL translocation breakpoints have been identified in cases of leukemia in infants.
The finding of native DNA topoisomerase II complexes and etoposide-DNA-topoisomerase II complexes in total genomic DNA (without regard to any specific sequences in the genome) of CD34+ cells by ICE had never been described. Moreover, the assay disclosed herein that incorporates immuno affinity purification, whole genome amplification and real-time PCR after isolation of total cellular DNA including protein bound DNA, to rapidly detect DNA topoisomerase II covalently bound specifically to the MLL bcr in human CD34+ cells. Using this new assay, native as well as etoposide-stabilized DNA topoisomerase II covalent complexes with the MLL bcr were detectable in the immuno-affinity purified DNA topoisomerase II covalent complexes, demonstrating for the first time that DNA topoisomerase II forms covalent complexes with MLL at sites of translocation breakpoints in human CD34+ cells. Since DNA templates containing double-strand breaks from DNA topoisomerase II cleavage would not be amplified by PCR, these data indicate the presence of DNA-DNA topoisomerase II covalent complexes proximal to the amplicon (MLL bcr positions 6784 to 6851) where products were detected with resolution at the size of the DOP template. The use of chemotherapy creates a risk for leukemia as a treatment complication. Tracing of the temporal molecular emergence of the leukemia-associated MLL translocations relative to chemotherapy administration and analysis of the genomic breakpoint junction sequences in the leukemias and functional DNA topoisomerase II cleavage assays suggest that not only drug-stabilized but also native DNA topoisomerase II cleavage can result in translocations. In particular, a rare case of treatment-related leukemia recently was described where the prior chemotherapy exposure did not include a DNA topoisomerase II poison (Langer 2003) Native DNA topoisomerase II cleavage can be the cause of the DNA damage in such cases because cytotoxic chemotherapy in general typically is followed by bone marrow progenitor cell proliferation (Knudson, 1992), which would be associated with high DNA topoisomerase IIα expression (Isaacs et al., 1998; Woessner et al., 1991).
In accordance with the present invention, a custom oligonucleotide array comprising sequences that span the breakpoint cluster region of the MLL gene that is disrupted in infant leukemias and treatment-related leukemias is provided. This custom oligonucleotide array can be used as an alternative to the real time PCR approach to detect the specific sequences that are involved in the formation of DNA-topoisomerase complexes or drug-DNA-topoisomerase complexes. This microarray facilitates analysis of the formation of DNA topoisomerase II complexes with MLL upon various different treatments of primary human hematopoietic cells and hematopoietic cell lines or non-hematopoietic cells. Briefly, such complexes can be detected by 1) treating the cells (in vitro, ex vivo, or in vivo), 2) isolating total genomic DNA including protein bound DNA, 3) isolating DNA topoisomerase II-bound DNA (e.g., on an immunoaffinity column), 4) amplifying the DNA by degenerative oligonucleotide PCR or by alternative whole-genome amplification methods, 5) labeling the test sample and a calibrated reference sample with different detectable labels (e.g., two different fluorescent dyes), and 6) hybridizing the labeled test sample and the calibrated standard or, alternatively, two different test samples labeled with different dyes with an MLL bcr microarray with two different channels, one channel for each one of the two dyes. The Examples describe experiments utilizing real-time PCR and microarrays to further characterize topoisomerase II-genomic DNA complexes and the sequences bound by topoisomerase II. Partner genes identified by various panhandle PCR techniques (see, e.g., U.S. Pat. No. 6,368,791; U.S. patent application Ser. No. 10/118,783; and U.S. Provisional Application 60/599,385), or by other techniques that lead to the identification of the sequences of translocation breakpoints may also be used with the real-time PCR and microarrays (see Table 6 for list of exemplary partner genes). The partner genes can be employed, alone or in combination with the MLL bcr in order to determine the relationship of translocation breakpoints to sites of DNA topoisomerase complex formation in different types of cells.
Notably, DNA damage mediated by aberrant topoisomerase activity can occur following exposure to naturally occurring topoisomerase poisons/inhibitors rather than chemotherapeutic agents, and exposure of pregnant women to such agents has been linked to infant leukemias. The methods and compositions of the invention can be utilized to characterize this DNA damage and provide the means to develop strategies to prevent topoisomerase II mediated alteration of the fetal chromosomal DNA during pregnancy.
Definitions
As used herein, the term “microarray” refers to an ordered arrangement of hybridizable array elements. The array elements are arranged so that there are preferably at least one or more different array elements, more preferably at least 100 array elements, and most preferably at least 1,000 array elements on a solid support. Preferably, the hybridization signal from each of the array elements is individually distinguishable, the solid support is a chip, and the array elements comprise oligonucleotide probes.
The term “MLL partner gene” refers to the gene or genomic DNA sequence fused with MLL after a translocation, such as those fusions present in certain leukemias.
“Nucleic acid” or a “nucleic acid molecule” as used herein refers to any DNA or RNA molecule, either single or double stranded and, if single stranded, the molecule of its complementary sequence in either linear or circular form. In discussing nucleic acid molecules, a sequence or structure of a particular nucleic acid molecule may be described herein according to the normal convention of providing the sequence in the 5′ to 3′ direction. With reference to nucleic acids of the invention, the term “isolated nucleic acid” is sometimes used. This term, when applied to DNA, refers to a DNA molecule that is separated from sequences with which it is immediately contiguous in the naturally occurring genome of the organism in which it originated. For example, an “isolated nucleic acid” may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism.
The term “oligonucleotide” as used herein refers to sequences, primers and probes of the present invention, and is defined as a nucleic acid molecule comprised of two or more ribo- or deoxyribonucleotides, preferably more than three. The exact size of the oligonucleotide will depend on various factors and on the particular application and use of the oligonucleotide.
The phrase “specifically hybridize” refers to the association between two single-stranded nucleic acid molecules of sufficiently complementary sequence to permit such hybridization under pre-determined conditions generally used in the art (sometimes termed “substantially complementary”). In particular, the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the invention, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence.
For instance, one common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is set forth below (Sambrook et al., 1989):
T_m=81.5° C.+16.6 Log [Na+]+0.41(%G+C)−0.63(%formamide)−600/#bp in duplex
As an illustration of the above formula, using [Na+]=[0.368] and 50% formamide, with GC content of 42% and an average probe size of 200 bases, the T_mis 57° C. The T_mof a DNA duplex decreases by 1-1.5° C. with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42° C.
The stringency of the hybridization and wash depend primarily on the salt concentration and temperature of the solutions. In general, to maximize the rate of annealing of the probe with its target, the hybridization is usually carried out at salt and temperature conditions that are 20-25° C. below the calculated T_mof the hybrid. Wash conditions should be as stringent as possible for the degree of identity of the probe for the target. In general, wash conditions are selected to be approximately 12-20° C. below the T_mof the hybrid. In regards to the nucleic acids of the current invention, a moderate stringency hybridization is defined as hybridization in 6×SSC, 5× Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42° C., and washed in 2×SSC and 0.5% SDS at 55° C. for 15 minutes. A high stringency hybridization is defined as hybridization in 6×SSC, 5× Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42° C., and washed in 1×SSC and 0.5% SDS at 65° C. for 15 minutes. A very high stringency hybridization is defined as hybridization in 6×SSC, 5× Denhardt's solution, 0.5% SDS and 100 μg/ml denatured salmon sperm DNA at 42° C., and washed in 0.1×SSC and 0.5% SDS at 65° C. for 15 minutes.
The term “primer” as used herein refers to a DNA oligonucleotide, either single-stranded or double-stranded, either derived from a biological system, generated by restriction enzyme digestion, or produced synthetically which, when placed in the proper environment, is able to functionally act as an initiator of template-dependent nucleic acid synthesis. When presented with an appropriate nucleic acid template, suitable nucleoside triphosphate precursors of nucleic acids, a polymerase enzyme, suitable cofactors and conditions such as a suitable temperature and pH, the primer may be extended at its 3′ terminus by the addition of nucleotides by the action of a polymerase or similar activity to yield a primer extension product. The primer may vary in length depending on the particular conditions and requirement of the application. For example, in diagnostic applications, the oligonucleotide primer is typically 15-25 or more nucleotides in length. The primer must be of sufficient complementarity to the desired template to prime the synthesis of the desired extension product, that is, to be able anneal with the desired template strand in a manner sufficient to provide the 3′ hydroxyl moiety of the primer in appropriate juxtaposition for use in the initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represent an exact complement of the desired template. For example, a non-complementary nucleotide sequence may be attached to the 5′ end of an otherwise complementary primer. Alternatively, non-complementary bases may be interspersed within the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity with the sequence of the desired template strand to functionally provide a template-primer complex for the synthesis of the extension product.
Polymerase chain reaction (PCR) has been described in U.S. Pat. Nos. 4,683,195, 4,800,195, and 4,965,188, the entire disclosures of which are incorporated by reference herein.
The term “isolated” may refer to a compound or complex that has been sufficiently separated from other compounds with which it would naturally be associated. “Isolated” is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with fundamental activity or ensuing assays, and that may be present, for example, due to incomplete purification, or the addition of stabilizers.
As used herein, an “instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition of the invention for performing a method of the invention.
The phrase “solid support” refers to any solid surface including, without limitation, any chip (for example, silica-based, glass, or gold chip), glass slide, membrane, bead, solid particle (for example, agarose, sepharose, polystyrene or magnetic bead), column (or column material), test tube, or microtiter dish.
The following materials and methods are provided to facilitate the practice of the present invention.
Cloning and Detection of MLL Genomic Breakpoint Junction Sequences in Sequential Bone Marrows
Characterization of genomic breakpoint junction sequences of the der(11) and other derivative chromosomes in the leukemias of the patients designated patients t-120 and t-39 by panhandle PCR approaches and PCR with gene-specific primers was previously described (7, 8). Backtracking to examine molecular emergence of the translocation in sequential bone marrow specimens from patient t-39 and to date the translocation in relation to chemotherapy administration has been reported (7). For patient t-120 diagnosed with treatment-related ALL harboring t(4; 11), BamHI-digested DNAs from sequential marrow samples were analyzed with the B859 fragment of ALL-1 cDNA corresponding to the MLL bcr. The der(4) genomic breakpoint junction sequence obtained by reverse panhandle PCR (8) provided sequences for forward AF-4 primer 5′-ATTGTTCTGCCCCCAACATA-3′ (SEQ ID NO: 247) and reverse MLL primer 5′-AGAGGCCCAGCTGTAGTTCT-3′ (SEQ ID NO: 248), and nested forward AF-4 primer 5′-TCCGTAAGCTCGACCCTAGT-3′ (SEQ ID NO: 249) and nested reverse MLL primer 5′-GCGCTCGTTCTCCTCTAAAC-3′ (SEQ ID NO: 250), which were used for clonotypic PCR to examine sequential bone marrow samples for molecular emergence of the t(4;11) translocation in relation to chemotherapy administered.
DNA Topoisomerase II In Vitro Cleavage Assays
DNA topoisomerase II in vitro cleavage assays were performed using previously described methods (10, 11). DNA fragments containing the normal homologues of each genomic breakpoint in MLL or GAS7 were subcloned into the EcoRI and BamHI sites, and the DNA fragment containing the normal homologue of the AF-4 genomic breakpoint into the BamHI and NotI sites of pBluescript II SK (Stratagene; La Jolla, Calif.). Twenty-five ng of singly 5′ end-labeled DNA substrates from these plasmids were incubated with human DNA topoisomerase IIα, ATP and MgCl₂in absence of drug or in the presence of etoposide, etoposide catechol, etoposide quinone or doxorubicin at 20 μM final concentration for 10 min at 37° C. DNA topoisomerase II cleavage complexes were irreversibly trapped by adding SDS, without heating or after subsequent incubation for 10 min at 75° C. to evaluate heat stability (12). Cleavage complexes were deproteinized and electrophoresed in a DNA sequencing gel alongside a dideoxy sequencing ladder to locate the cleavage sites (10, 11). In addition, doxorubicin was studied over a range of lower concentrations because of its known mixed effects of DNA topoisomerase II cleavage enhancement at low concentrations and DNA topoisomerase II catalytic inhibition due to intercalation at high concentrations (Capranico, 1998).
Ex Vivo Expansion of CD34+ Cells
Ten×10⁶primary human cadaveric bone marrow CD34+ cells obtained through NHLBI were established in culture at a density of 2×10⁴to 2×10⁵cells per ml and expanded in two T-75 flasks for 8 days in HPGM serum-free medium (Cambrex, Walkersville, Md.) supplemented with 100 ng/ml each of stem cell factor, Flk2/Flt3 ligand (FL) and IL-6, 10 ng/ml thrombopoietin and 1 μg/ml soluble IL-6 receptor (R&D Systems, Minneapolis, Minn.), conditions that promote minimal differentiation (13).
Western Blot Analysis
DNA topoisomerase II protein expression was examined with a mouse anti-human DNA topoisomerase IIα antibody (DAKO, Glostrup, Denmark) in 3 μg of total cellular protein from untreated ex vivo-expanded CD34+ cells and compared to that in the hematopoietic cell lines RS4:11, SEM-K2 and K562 (14-16). Protein concentrations were measured using the RCDC protein assay kit (Biorad, Hercules, Calif.) and Western blot analysis was performed with the Western Breeze kit (Invitrogen, Carlsbad, Calif.). The filter was simultaneously hybridized to a mouse anti-human β-actin antibody (Abcam, Cambridge, Mass.).
Real-Time PCR Analysis of DNA Topoisomerase IIα mRNA Expression
Quantitative real-time PCR analysis was performed on 10 ng of cDNA prepared from total RNA from untreated ex vivo-expanded CD34+ cells by ‘Assays on Demand’ for DNA topoisomerase IIα and GAPDH (Applied Biosystems, Foster City, Calif.) and compared to that in cultured hematopoietic cell lines using 2^−ΔΔCtanalysis of relative gene expression data (17).
ICE (In Vivo Complex of Enzyme) Bioassay
Modified ICE assays were performed exactly as described (11). Five×10⁶ex vivo expanded CD34+ cells were incubated without drug or with 100 μM final concentration of etoposide at 37° C. in 2 ml of HPGM medium for 2 hours. Percentages of viable cells were assessed by Trypan Blue exclusion. Treated and untreated cells were pelleted and lysed as described (11). After flash-freezing and thawing at 37° C., the DNA was sheared by passage through a 25_1/2G needle. Supernatants were collected and layered onto a CsCl cushion, and total genomic DNA including protein-bound DNA was isolated by ultracentrifugation at 80,000×g in an NVT90 rotor (Beckman; Palo Alto, Calif.) (11). The pellet was dissolved in 200 μl of 10 mM Tris-HCl (pH 8.0) 1 mM EDTA buffer, the DNA was quantified and 5.6 μg of DNA was analyzed on a Western blot with a mouse anti-human DNA topoisomerase IIα antibody (DAKO, Glostrup, Denmark) to detect DNA topoisomerase IIα-bound DNA (11).
Affinity Column Purification of DNA-DNA Topoisomerase IIα Covalent Complexes and Detection of MLL-Bound DNA Topoisomerase Ia
Each 1 ml affinity column consisted of Protein A-Sepharose Beads (Pharmacia Biotech, Upsala, Sweden) covalently coupled to mouse anti-human DNA topoisomerase IIα antibody (DAKO, Glostrup, Denmark) in PBS/0.02% sodium azide (18). The column was pre-washed with 10 volumes of 1×PBS. Total genomic DNA samples including protein-bound DNA from 32.5×10⁶untreated or etoposide-treated ex vivo-expanded human CD34+ cells was prepared according to the ICE assay protocol and diluted to a volume of 10 ml with cold 1×PBS. Samples were pre-cleared by incubation with Protein A Sepharose for 30 min while rotating at 4° C. in a 15 ml conical tube (18) and then centrifuged at 1200 rpm for 5 min in a Beckman G6 low-speed centrifuge. Supernatants were transferred to clean 15 ml conical tubes and incubated with the 1 ml of anti-human DNA topoisomerase IIα antibody-conjugated beads for 2 hrs while rotating at 4° C. and then run by gravity flow over affinity columns, followed by washing of the columns with 10 volumes of cold 1×PBS. Antibody-bound DNA topoisomerase IIα-DNA complexes from the untreated and etoposide-treated CD34+ cells were eluted with 1 ml of 100 mM glycine pH 2.7 and collected in 1.5 ml Eppendorf tubes containing a few drops of 1×PBS pH 11 for neutralization (18). The eluted material was PCI-extracted, ethanol-precipitated with NaOAc, washed with 70% EtOH and resuspended in 25 μl of dH₂O and 1 μl was subjected to degenerative oligonucleotide PCR (DOP) using the primer 5′-CCGACTCGAGNNNNNNATGTGG-3′ (SEQ ID NO: 251) (19) to generate template DNAs in sufficient quantity for real-time PCR. The products were quantified by OD₂₆₀measurements and their sizes determined on an agarose gel.
MLL bcr primers for real-time PCR were selected using Primer Express v. 2.0 software, and their specificity confirmed using the BLAST algorithm. Forward and reverse primers 5′-ATAGTTTGTGTATTGCCAAGTCTGTTG-3′ (SEQ ID NO: 252) and 5′-GGCGCTCGTTCTCCTCTAAA-3′ (SEQ ID NO: 253), respectively, spanned MLL bcr positions 6784 to 6851 at the junction of intron 8-exon 9. The primer pair 5′-ACCACCGGGACCGCTACT-3′ (SEQ ID NO: 254) and 5′-GTGGCCCTAAGACATGATCAACT-3′ (SEQ ID NO: 255), was designed to amplify a genomic region of MLL exon 25, and a genomic region of GAPDH was examined by an intra-exon ‘Assay on Demand’ (Applied Biosystems); these genomic regions are not involved in MLL translocations. MGB oligonucleotide fluorogenic probes, which were synthesized by Applied Biosystems, were non-overlapping with the respective primer pairs and were designed according to Applied Biosystems guidelines using Primer Express v. 2.0 (20-23). Fluorogenic probe sequences for the amplicons at the MLL intron 8-exon 9 junction and MLL exon 25, respectively, were 5′-CCCTTCCACAAGTTTT-3′ (SEQ ID NO: 256) and 5′-ATCTTGAATCAAGTGCCAAA-3′ (SEQ ID NO: 257). Real-time PCR reactions were performed in duplicate in a MicroAmp 96-well plate using 50 ng of DOP-generated template, and the ABI Prism 7700 Sequence Detection System was used to examine product accumulation.
The following examples are provided to illustrate various embodiments of the present invention. They are not intended to limit the invention in any way.

EXAMPLE I

Identification and Tracing of Translocation Breakpoint Sequences in Leukemias in Patients, and Evidence from In Vitro Assays to Suggest that Translocation Breakpoints are Topoisomerase II Cleavage Sites

Therapy, Clinical Course and Detection of MLL-AF-4 Translocation in Sequential Bone Marrow Specimens of Patient t-120
In patient t-120, rearrangements consistent with both derivative chromosomes from the t(4;11) translocation were detected by Southern blot analysis in the bone marrow from ALL diagnosis, and both breakpoint junctions were characterized by panhandle PCR approaches (Raffini et al., 2002). The clinical course, primary neuroblastoma therapy and molecular analyses are summarized in FIG. 1A. All available sequential bone marrows were examined for the presence of the translocation. The translocation also was detectable by Southern blot at 9 months from the start of treatment. The translocation was not detectable by Southern blot analysis in the cells used for autologous marrow rescue or in any other marrow samples (FIG. 1B, 1C). By first-round PCR analysis of the der(4) breakpoint junction in 200 ng genomic DNA prepared from cryopreserved sequential bone marrow samples (˜20,000 cell equivalent), only the marrows at 9 months after neuroblastoma diagnosis and at ALL diagnosis contained the translocation. By nested PCR (FIG. 1B, 1C) the translocation also was detectable in the marrow from 6 months after neuroblastoma diagnosis, after all 7 chemotherapy cycles and bone marrow harvest. This was before local radiation therapy, radiolabeled 3F8 monoclonal antibody and autologous marrow rescue, 5 months before leukemia was diagnosed. Spiking DNA from the ALL sample into peripheral blood lymphocyte DNA from a normal subject and serial dilutions indicated that the sensitivity of the nested PCR for detection of the translocation was between 1 cell in 10⁵and 1 cell in 10⁶cells.
Chemotherapy Enhances DNA Topoisomerase II Cleavage at MLL and AF-4 Genomic Translocation Breakpoints in all of Patient t-120
From prior sequencing the der(11) MLL breakpoint was position 6588 or 6589 in intron 8 and the der(11) AF-4 breakpoint was position 7130 or 7131 in intron 3. The der(4) AF-4 breakpoint was position 7108, 7109 or 7110 in intron 3 and the der(4) MLL breakpoint was position 6594, 6595 or 6596 in intron 8 (Raffini et al., 2002). Although ‘A’ nucleotides at the breakpoints in both genes at the der(11) breakpoint junction and 5′-CA-3′ sequences at the breakpoints in both genes at the der(4) breakpoint junction precluded more precise breakpoint assignments, 4-7 bases and 19-22 bases, respectively, were deleted from MLL and AF-4 (Raffini et al., 2002).
These near-precise recombinations with few bases lost relative to the normal sequences indicated that the translocation breakpoints were in close proximity to the sites of damage. The first molecular detection of the translocation was after all 7 chemotherapy cycles, which included etoposide and doxorubicin as DNA topoisomerase II poisons. Therefore, DNA topoisomerase II in vitro cleavage assays were performed without drug or with etoposide, its catechol or quinone metabolites or doxorubicin on double stranded DNA substrates containing the normal homologues of the respective MLL (FIG. 2A, 2C) and AF-4 (FIG. 2B, 2D) translocation breakpoints to locate where the drugs to which the patient was exposed stimulated cleavage complexes. DNA topoisomerase II creates staggered nicks in duplex DNA with 4-base 5′ overhangs (Fortune and Osheroff, 2000); cleavage site locations were defined by the base at the 5′ side of cleavage (−1 position) on the sense strand of DNA. DNA topoisomerase II cleavage sites in MLL (FIG. 2A, 2C) and AF-4 (FIG. 2B, 2D) were identified at or proximal to the translocation breakpoints.
Because the der(11) and der(4) MLL breakpoints were at a hotspot for translocation breakpoints in treatment-related leukemia, cleavage assays of the relevant MLL substrate with all drugs at 20 μM final concentration had already been performed (Whitmarsh et al., 2003). In the present study, however, doxorubicin was studied over a range of concentrations (FIG. 2C) because of its dual effects of cleavage stimulation at low concentrations and DNA topoisomerase II catalytic inhibition due to intercalation at high concentrations (Capranico and Binaschi, 1998). MLL bcr position 6588 ranked 5^thof 8 cleavage sites detected without drug in the MLL substrate (Whitmarsh et al., 2003). Etoposide, etoposide catechol and etoposide quinone each at 20 μM, enhanced cleavage at this site 7.9-, 4.4- and 9.8-fold, respectively, over cleavage without drug (FIG. 2A). The especially strong cleavage detected at this position ranked 3^rdof cleavage sites in the substrate in the presence of etoposide quinone (FIG. 2A) (Whitmarsh et al., 2003). The enzyme-only cleavage and cleavage with etoposide or its metabolites at position 6588 remained detectable after heating, indicating resistance to religation and stability of the cleavage complexes. Although position 6588 was one of only two cleavage sites detected with doxorubicin at 20 μM, the cleavage was weak compared to enzyme-only cleavage (0.4-fold), indicating catalytic inhibition at high concentration (FIG. 2A). At concentrations from 0.01 μM to 0.5 μM doxorubicin resulted in dose-dependent increases over enzyme-only cleavage at MLL bcr position 6588 consistent with poisoning effects, whereas the cleavage enhancement at this site began to decrease at 2.5 μM (FIG. 2C). Thus the intercalating agent doxorubicin has site-specific, concentration-dependent, mixed effects of a poison and a catalytic inhibitor of DNA topoisomerase II at this position in the MLL translocation breakpoint hotspot region. In contrast, at positions 6587 and 6589, only catalytic inhibition was observed at all concentrations tested (FIG. 2C).
In the AF-4 intron 3 substrate spanning positions 6956 to 7239, there was no detectable cleavage at position 7126 without drug or with doxorubicin at 20 μM (FIG. 2B) or lower concentrations (FIG. 2D), but cleavage at this position ranked first in relative intensity among all cleavage sites with etoposide and etoposide catechol and 5^thamong all cleavage sites with etoposide quinone (FIG. 2B). There was 3.2-, 5.9- and 3.4-fold cleavage at position 7126 in the presence of etoposide, etoposide catechol and etoposide quinone, respectively, relative to the strongest enzyme-only cleavage in the substrate, which occurred at position 7114. Cleavage at position 7126 in the presence of etoposide and both etoposide metabolites were not only especially strong, but also especially heat-stable. Examination of doxorubicin-associated cleavage over a range of concentrations with particular attention to the region of the breakpoints showed dose-dependent increases in cleavage stimulation over enzyme-only cleavage at AF-4 intron 3 positions 7111, 7114 and 7119, consistent with poisoning effects, while cleavage at these sites began to decrease at 0.5 μM, consistent with the mixed effect of catalytic inhibition (FIG. 2D).
Processing of DNA Topoisomerase II Cleavage Sites Enhanced by Etoposide or its Metabolites or Doxorubicin Forms Both Genomic Breakpoint Junctions in all of Patient t-120
The model shown in FIG. 3A for formation of the observed der(11) and der(4) genomic breakpoint junctions was derived from the cleavage sites at MLL bcr position 6588, which was enhanced by etoposide, both etoposide metabolites and doxorubicin, and AF-4 intron 3 position 7126, which was enhanced by etoposide and both etoposide metabolites but not doxorubicin. Processing of the 4-base 5′ overhangs from DNA topoisomerase II cleavage at these sites would generate the der(11) and der(4) sequences observed in the leukemia. In the model shown, exonucleolytic nibbling creates single-base homologies and base-pairing promotes the formation of both breakpoint junctions by error-prone nonhomologous end-joining (NHEJ). Consistent with the genomic sequencing and relative to the sense strands, 6 bases from MLL and 20 bases from AF-4 are lost during the processing, MLL bcr position 6588 and AF-4 intron 3 position 7130 are joined to form the der(11), and AF-4 intron 3 position 7109 and MLL bcr position 6595 are joined to form the der(4) (FIG. 3A).
The especially strong doxorubicin-stabilized cleavage sites at MLL bcr position 6588 and AF-4 intron 3 position 7114 were used to develop the alternative model in FIG. 3B for formation of the observed der(11) and der(4) genomic breakpoint junctions by error-prone NHEJ. In this model, 6 bases from MLL and 20 bases from AF-4 relative to the sense strands again are lost during the processing (FIG. 3B), and the same bases in MLL bcr and AF-4 intron 3 as described above are joined to form both breakpoint junctions. These models demonstrate that interchromosomal recombination by repair of chemotherapy-stabilized DNA topoisomerase II cleavage could be the translocation mechanism in this ALL, although models using other DNA topoisomerase II cleavage sites proximal to the translocation breakpoints are possible as well (not shown). However, it cannot be determined in this case whether etoposide or its metabolites or doxorubicin led to the relevant damage resulting in the translocation in the leukemia in this patient since each compound stimulated strong DNA topoisomerase II cleavage complexes proximal to the breakpoints.
Therapy, Clinical Course and Molecular Detection of MLL-GAS7 Translocation in Sequential Bone Marrow Specimens of Patient t-39
Patient t-39 was a 13-year old boy with stage 4 neuroblastoma treated with 4 cycles of cyclophosphamide, doxorubicin and vincristine (CAV), 1 cycle of cyclophosphamide and doxorubicin in which vincristine was omitted for toxicity, 3 cycles of cisplatin and etoposide (PVP), surgical resection, local radiation, and 3F8 monoclonal antibody with GM-CSF (Megonigal et al., 2000). The clinical diagnosis of secondary AML and molecular analyses of sequential bone marrow samples relative to the neuroblastoma treatment have been described (Megonigal et al., 2000). The MLL translocation was not PCR-detectable at neuroblastoma diagnosis, but was detectable by clonotypic PCR analysis of the der(11) genomic breakpoint junction in all marrow specimens obtained at and after 6 weeks from the start of treatment, which was after two cycles of CAV (Megonigal et al., 2000). AML was diagnosed 15.5 months after the translocation was PCR-detectable (Megonigal et al., 2000).
MLL and GAS7 Genomic Translocation Breakpoints in AML of Patient t-39 are Proximal to Doxorubicin-Stabilized DNA Topoisomerase II Cleavage Sites
From previously described genomic sequencing, the der(11) MLL breakpoint in the treatment-related AML was position 4662, 4663, or 4664 in intron 8 and the der(11) GAS7 breakpoint was position 1240, 1241 or 1242 upstream of exon 1 (Megonigal et al., 2000). MLL positions 4663-4664 and GAS7 positions 1240-1241 were 5′-AT-3′, precluding more precise breakpoint assignments (Megonigal et al., 2000). The der(17) GAS7 breakpoint was position 1203 and the der(17) MLL breakpoint was position 4680 (Megonigal et al., 2000). 15-17 bp from MLL and 36-38 bp from GAS7 were deleted during this translocation (Megonigal et al., 2000). The involved region of MLL was more 5′ in the bcr and was not the translocation breakpoint hotspot.
Although doxorubicin was the only DNA topoisomerase II poison to which the patient was exposed before molecular emergence of the translocation (Megonigal et al., 2000), DNA topoisomerase II in vitro cleavage assays were performed without drug, with doxorubicin or, as references for cleavage site intensities, with etoposide or its metabolites. The translocation breakpoints were near strong, enzyme-only cleavage sites at MLL bcr position 4675 (FIG. 4A) and GAS7 position 1238 (FIG. 4B) that were enhanced substantially by doxorubicin at low concentrations (FIG. 4C, 4D). In the MLL bcr substrate, the enzyme-only cleavage at position 4675 was 0.27-fold relative to cleavage with etoposide, and this position ranked 3^rdamong all enzyme-only cleavage sites (FIG. 4A). GAS7 position 1238, where the enzyme-only cleavage was 0.44-fold relative to cleavage with etoposide, was the strongest enzyme-only cleavage site in the GAS7 substrate (FIG. 4B). The enzyme-only cleavage complexes at MLL bcr position 4675 and GAS7 position 1238 were highly heat-resistant (FIG. 4A, 4B), indicating these cleavage complexes were particularly stable. Consistent with behavior as a poison, doxorubicin at 0.01 μM was associated with quantifiably enhanced cleavage over the already very strong enzyme-only cleavage, not only at MLL bcr position 4675, but also at MLL bcr position 4673 (FIG. 4C) and GAS7 position 1238 (FIG. 4D). The site-specific enhancement of cleavage over enzyme-only cleavage at these sites in the presence of doxorubicin began to decrease at 0.1 μM (FIG. 4C, D) and there was complete diminution at 20 μM (FIG. 4A, 4B), indicating mixed effects of a poison and catalytic inhibitor of DNA topoisomerase II.
Processing of Doxorubicin-Stabilized DNA Topoisomerase II Cleavage Sites in MLL and GAS7 Generates Genomic Breakpoint Junctions in AML of Patient t-39
A model for processing of the doxorubicin-stimulated cleavage sites at MLL intron 8 position 4675 and GAS7 position 1238 to form both genomic breakpoint junctions in the AML of patient t-39 is shown in FIG. 5. Exonucleolytic nibbling of the indicated bases (italic, middle) creates a single-base homology (box, middle), and NHEJ and gap fill-in ensue, resulting in the der(11) breakpoint junction. The processing to create the observed der(17) genomic breakpoint junction also includes exonucleolytic nibbling (italic, bottom) to form a single-base homology (box), followed by NHEJ and mismatch repair (bottom). Relative to the sense sequences, the exonucleolytic nibbling in the model results in loss of 16 bases from MLL and 37 bases from GAS7 during processing of the overhangs from the cleavage (FIG. 5). MLL bcr position 4663 and GAS7 position 1241 are joined to form the der(11), and GAS7 position 1203 and MLL bcr position 4680 are joined to form the der(17), which is consistent with prior genomic sequencing of the breakpoint junctions in the AML (Megonigal et al., 2000).

EXAMPLE II

Hematopoietic Progenitor Cells—a Model Cellular System for Analysis of Chromosomal Translocations Mediated by Elevated Expression of Topoisomerase II

Characterization of Native DNA Topoisomerase IIα mRNA and Protein Expression in Human CD34+ Cells

By quantitative real-time PCR analysis, DNA topoisomerase IIα mRNA expression in the cell lines RS4:11, SEM-K2 and K562 cells was 1.54(1.16+2.03)-fold, 1.55(1.14-2.10)-fold and 2.75(2.53-2.99)-fold relative to ex vivo-expanded human CD34+ cells (Table 1), indicating that DNA topoisomerase IIα mRNA in proliferating bone marrow stem cells is in the range of that in hematopoietic cell lines. Western blot analysis suggested that DNA topoisomerase IIα protein expression in the ex vivo-expanded human CD34+ cells was also high and comparable to that in hematopoietic cell lines (FIG. 6).

TABLE 1


Relative DNA topoisomerase IIα mRNA expression in leukemia cell
lines compared to CD34+ cells

			ΔC_T		Normalized DNA
	DNA		(Avg. DNA		topoisomerase IIα
	topoisomerase		topoisomerase	ΔΔC_T	amount relative to
	IIα C_T	GAPDH C_T	IIα C_T− Avg.	(Avg. ΔC_T− Avg.	CD34+ cells
Cells	(Avg. ± S.D.)	(Avg. ± S.D.)	GAPDH C_T)	ΔC_T _{CD34+ cells})	2^−ΔΔCT

CD34+	25.69 ± 0.26	20.58 ± 0.06	5.11 ± 0.23	0	1
cells
RS4: 11	25.28 ± 0.38	20.79 ± 0.15	4.49 ± 0.40	−0.62 ± 0.40	1.54(1.16-2.03)
SEM-	24.50 ± 0.28	20.02 ± 0.18	4.48 ± 0.44	−0.63 ± 0.44	1.55(1.14-2.10)
K2
K562	25.61 ± 0.23	21.96 ± 0.12	3.65 ± 0.12	−1.46 ± 0.12	2.75(2.53-2.99)

EXAMPLE III

Ice Bioassay Detects Topoisomerase—DNA and Topoisomerase-DNA-Drug Covalent Complexes in Total Genomic DNA of Hematopoietic Cell Lines and CD34 Cells

DNA Topoisomerase II Covalent Complexes are Detected in Hematopoietic Cell Lines Treated with Chemotherapy
Although etoposide has been previously studied in ICE assays of, eg., the hematopoietic cell line CEM, induction of DNA topoisomerase II cleavage complexes by etoposide metabolites had not been previously studied in a cellular context. A modified in vivo complex of enzyme (ICE) bioassy was employed to determine whether etoposide metabolites induce DNA topoisomerase II covalent complexes in the chromatin context of hematopoietic cell lines (11). The assay entails trapping the DNA covalently bound to DNA topoisomerase II by phosphotyrosine linkage using protein denaturants and detection on a Western blot. Isolation of the protein-bound DNA using a CsCl cushion, as elaborated by Topogene, streamlines the methodology compared to previous methods. In addition, the approach was changed further from use of the slot blot analysis to detect the cleavage complexes to detection of the complexes by Western blot analysis, which enables size separation of the DNA-protein complexes. ICE bioassys demonstrated significant induction of DNA topoisomerase II cleavage complexes in CEM cells after treatment for 2 hours with etoposide or its catechol or quinone metabolites at 20 μM (FIG. 7A). The cleavage complexes induced by etoposide catechol were comparable in amount to the parent drug. Induction of DNA cleavage complexes was also observed in K562 cells treated with 20 μM etoposide or etoposide quinone (FIG. 7B). Consistent with the presence of DNA bound to the enzyme, the DNA topoisomerase IIα protein ran higher than its known molecular weight of 170 kDa. Notably, no induction of DNA topoisomerase II cleavage complexes was detected in either CEM or K562 cells after treatment with doxorubicin at the same concentration within the sensitivity of the assay. However, doxorubicin is an intercalative DNA topoisomerase II poison that induces DNA topoisomerase II cleavage with different sequence site-selectivity (Capranico et al., 1990) and that also is associated with leukemia as a treatment complication, albeit less often (Sandoval et al., 1993). Its behavior as a site-specific poison of DNA topoisomerase II in in vitro assays of translocation breakpoints was established herein. Additional ICE assays in K562 cells showed a concentration dependent increase in the induction of DNA topoisomerase II cleavage complexes treated with etoposide quinone for 2 hours, consistent with its behavior as a DNA topoisomerase II poison (FIG. 7C). Unlike in CEM cells and K562 cells, in KG1 cells not only etoposide and its metabolites, but also doxorubicin at 100 μM induced DNA II covalent complexes (FIG. 7D).
Native and Etoposide-Stabilized DNA Topoisomerase II Covalent Complexes are Detected In Ex Vivo Expanded Human CD34+ Cells
ICE assays were performed on ex vivo expanded CD34+ cells from cadaveric human bone marrow that were either treated for 2 hours with etoposide or untreated. Cell viability assessed by Trypan blue exclusion was ˜70% for both conditions. Results for the untreated cells and cells treated with etoposide at 100 μM final concentration are shown in FIG. 8. As predicted in proliferating cells (6), native DNA topoisomerase II covalent complexes were detected in the untreated cells. Etoposide treatment resulted in increased formation of DNA topoisomerase II covalent complexes. The DNA topoisomerase IIα protein ran higher than its known molecular weight of 170 kDa, which is consistent with the presence of DNA bound to the enzyme. Etoposide catechol treatment also showed increased formation of topoisomerase-DNA cleavage complexes in CD34+ cells.

EXAMPLE IV

Real-Time PCR with MLL Specific Primers Detects Topoisomerase-DNA and Topoisomerase-DNA-Drug Covalent Complexes with Specific Sequences in MLL Gene in Total Genomic DNA of Hematopoietic Cell Lines and CD34 Cells After Immunoaffinity Purification and DOP Amplification

DNA Topoisomerase II Covalent Complexes with MLL bcr are Detected in Untreated and Etoposide-Treated Ex Vivo-Expanded CD34+ Cells
A real-time PCR approach was developed to detect DNA topoisomerase II covalent complexes at the sequence level with the MLL breakpoint cluster region (bcr) in CD34+ cells. Total genomic DNA samples, including protein bound DNA from untreated or etoposide-treated, ex-vivo expanded human CD34+ cells, were prepared on CsCl cushions according to the ICE assay protocol. DNA-DNA topoisomerase IIα covalent complexes in the total genomic DNA were purified on an immuno-affinity column consisting of Protein A-Sepharose beads covalently coupled to a mouse anti-human DNA topoisomerase IIα antibody. The eluted material from the column was subjected to degenerative oligonucleotide PCR in order to generate template DNAs in sufficient quantity for real-time PCR. MLL bcr primers for real-time PCR were designed to amplify MLL bcr positions 6784 to 6851 at the junction of intron 8-exon 9 near the translocation breakpoint, which is in proximity to the hotspot region for translocation breakpoints occurring in cases of leukemia in patients exposed to DNA topoisomerase II poisons (Whitmarsh 2003) and, in at least one patient after chemotherapy without such agents (Langer 2003).
Real-time PCR products were detected with the primer pair for the junction of MLL intron 8-exon 9 in the DOP-amplified immunoaffinity-purified DNA topoisomerase IIα-bound DNA from untreated and etoposide-treated CD34+ cells (FIG. 9A). The DOP template DNA used for real-time PCR was 500 bp to 1 kb. Since DNA templates containing double-strand breaks from DNA topoisomerase II cleavage would not be amplified by PCR, these data indicate the presence of DNA-DNA topoisomerase II covalent complexes proximal to the amplicon (MLL bcr positions 6784 to 6851) where products were detected with resolution at the size of the DOP template. No products were detected in reactions assaying the GAPDH gene (FIG. 9B), which is not involved in MLL translocations. Although no product was detected in untreated CD34+ cells, etoposide induced DNA-DNA topoisomerase II covalent complexes proximal to the MLL exon 25 amplicon (FIG. 9C), indicating that the formation of DNA topoisomerase II cleavage complexes in MLL is not limited to the bcr.
DNA Topoisomerase II Covalent Complexes with MLL bcr are Detected in Etoposide-Treated and Genistein-Treated Ex Vivo-Expanded CD34+ Cells
In cases of leukemia in infants, the MLL translocation breakpoints are distributed heterogeneously in the bcr (Felix, 1998.) Genistein is one example of a naturally-occurring DNA topoisomerase II poison that can stimulate formation of cleavage complexes with DNA and to which the fetus can be exposed in utero via the maternal diet. FIG. 9D shows real-time PCR products that were detected with primers at the junction of MLL intron 7-exon 8 in the DOP-amplified immunoaffinity-purified DNA topoisomerase IIα-bound DNA after treatment of CD34+ cells with either etoposide or genistein.
2. Discussion
The temporal emergence of MLL translocations has been characterized herein with respect to the timing of administration of specific anti-cancer drugs and mechanistic studies of DNA topoisomerase II cleavage were performed in order to link specific DNA damage to the genesis of MLL translocations in two cases of treatment-related leukemia. There was variability in molecular emergence of the translocations; after all 4 cycles of CAV and 3 cycles of PVP in one case, but after only 2 cycles of CAV in the other (Megonigal et al., 2000). In both cases the translocation was absent at neuroblastoma diagnosis, suggesting that the treatment caused and did not select for a pre-existing translocation. These results are consistent with other observations on a patient diagnosed with primary ALL and MLL-rearranged treatment-related AML where the MLL translocation was found to emerge during the course of treatment (Blanco et al., 2001). Absence of the MLL translocation at neuroblastoma diagnosis and the short latency in the secondary cases under study here also relate to the time of acquisition of the translocation in MLL-rearranged de novo cases. In MLL-rearranged infant leukemias the translocation is a somatic, in utero event and the latency is short: specifically from some time in pregnancy to the time of leukemia diagnosis in the infant host (Ford et al., 1993; Gale et al., 1997; Megonigal et al., 1998). However, MLL-rearranged leukemias in older children generally are not traceable to birth (Maia et al., 2004). Factors that determine latency from acquisition of the translocation to emergence of leukemia are unknown but the variable latencies in the present study, 5 months and 15.5 months in the respective cases where the partner genes were AF-4 and GAS7, may indicate differences in sufficiency of the varied MLL gene fusions. Latency also may be a function of the subsequent primary cancer treatment, which would not only contribute to secondary alterations but also affect selection and survival of the preleukemia clone.
Patient t-120 was managed with autologous marrow rescue after monoclonal antibody 3F8-targeted ¹³¹I-radioimmunotherapy. The ALL was diagnosed 11 months after neuroblastoma diagnosis, only 2 weeks after transplant. It has been suggested that autologous stem-cell collection following etoposide is associated with an increased risk of leukemia with characteristic balanced translocations (Krishnan et al., 2000). However, by a sensitive PCR-based assay the t(4;11) was not detectable in the unpurged or the purged marrow autograft harvested after the second cycle of etoposide-containing PVP, and did not emerge until after all chemotherapy cycles were complete. The t(4;11) occurred before the local radiation and radioimmunotherapy during the intensive N7 neuroblastoma regimen. The MLL-GAS7 translocation also was present before any radiation (Megonigal et al., 2000), indicating that the chemotherapy but not radiation contributed to the damage that caused these translocations.
The DNA topoisomerase II inhibitor exposures before molecular emergence of the t(4;11) in the case of patient t-120 were doxorubicin and etoposide, and there were etoposide-, etoposide metabolite- and doxorubicin-stimulated DNA topoisomerase II in vitro cleavage sites proximal to the translocation breakpoints that could be repaired to form both breakpoint junctions. The alternative models for formation of the der(11) and der(4) genomic breakpoint junctions were based on cleavage sites at MLL bcr position 6588, which was enhanced by all of the drug exposures, and either the cleavage site at AF-4 intron 3 position 7126 enhanced only by etoposide and its metabolites (FIG. 3A) or AF-4 intron 3 position 7114 enhanced only by doxorubicin (FIG. 3B). Since this was a later-occurring translocation during the treatment and emerged only after exposure to both DNA topoisomerase II poisons in the regimen, it is possible that etoposide or its metabolites or doxorubicin caused the relevant damage. Nonetheless, in the ALL of patient t-120, the processing of functional drug-stabilized DNA topoisomerase II cleavage sites in MLL and AF-4 generated the observed genomic breakpoint junctions.
These results differ from the findings in the second case where the translocation first became detectable when doxorubicin was the only DNA topoisomerase II poison to which the patient was exposed. The translocation breakpoints in MLL and GAS7 were proximal to strong doxorubicin-stimulated DNA topoisomerase II in vitro cleavage sites at MLL bcr position 4675 and GAS7 position 1238 that could be resolved to form both breakpoint junctions. This is the first functional demonstration of relevance of doxorubicin-stimulated DNA topoisomerase II covalent complexes with MLL and with its partner gene in the genesis of MLL translocations in treatment-related AML.
Another consideration was that anthracyclines are known to exhibit both cleavage stimulation characteristic of DNA topoisomerase II poisons at low concentrations but, at high concentrations, catalytic inhibition of DNA topoisomerase II function due to intercalation (Capranico and Binaschi, 1998). Analysis of DNA topoisomerase II cleavage with doxorubicin over a range of concentrations unmasked doxorubicin-stimulated cleavage sites proximal to the translocation breakpoints in MLL, AF-4 and GAS7 that were not detected at higher concentrations. The balance of dose-dependent dual effects of doxorubicin as a poison and a catalytic inhibitor of DNA topoisomerase II function has substantial implications for its role in the genesis of translocations in a cellular context because the model for formation of the translocations is based on poisoning effects. The site selectivity of the doxorubicin-stimulated in vitro cleavage sites proximal to the breakpoints also is of interest. Different patterns of cleavage stimulation by various DNA topoisomerase II poisons at preferred sites in any given substrate has suggested that local base sequences enable formation of ternary drug-DNA-enzyme complexes (Capranico and Binaschi, 1998). The previously reported site selectivity of doxorubicin was A at position −1 and T at position −2 relative to the cleavage (Capranico and Binaschi, 1998). Here, however, only 2 of the 7 cleavage sites in MLL, AF-4 and GAS7 (shown in FIGS. 2C, 2D, 4C, and 4D) where doxorubicin behaved as a poison (specifically, MLL bcr position 4673 and AF-4 intron 3 position 7119), fulfilled these sequence preferences on either the sense strand or the antisense strand of the DNA. Thus the sequence preferences for poisoning effects of doxorubicin may be less stringent than previously thought.
Non-homologous end joining (NEJ) repair events, which have been implicated in the resolution of DNA damage in the MLL translocation process (Lovett et al., 2001), are often imprecise and ensue after small deletions or insertions at the site of damage (Liang et al., 1998). The models in FIGS. 3A, 3B, and 5 invoked small deletions at the DNA topoisomerase II cleavage sites in MLL and its partner genes to create homologous overhangs that formed characteristic breakpoint junctions. Single-base homologies, as would be present after exonucleolytic nibbling at these staggered nicks, are sufficient for error-prone NHEJ (Liang et al., 1998).
The formation of drug-stabilized and native DNA topoisomerase II cleavage complexes in ex vivo-expanded human CD34+ cells was also investigated as a cellular model for analysis of MLL translocations. It was important to devise a cellular model to further study the role of DNA topoisomerase II cleavage in the genesis of MLL translocations because cleavage sites in the cellular context should be more restricted than in vitro (Capranico et al., 1990). In a murine retroviral transplant model it recently was shown that leukemias with MLL translocations can arise either in self-renewing stem cells or in committed myeloid progenitor cell populations (Cozzio et al., 2003), corroborating relevance of the human CD34+cell model system. The analyses of DNA topoisomerase IIα mRNA (Table 1) and protein (FIG. 6) expression indicate that in human CD34+ cells grown in short-term culture DNA topoisomerase IIα is highly expressed at levels comparable to human hematopoietic cell lines. Human CD34+ cells had not been previously studied in the ICE bioassay, which detects any DNA in total genomic DNA bound to DNA topoisomerase IIα by the covalent phosphotyrosine linkage formed between this enzyme and DNA (Whitmarsh et al., 2003). Both native and etoposide-stabilized DNA topoisomerase IIα cleavage complexes were demonstrable in the CD34+ cells.
In addition, a new approach was devised for detecting DNA topoisomerase IIα covalently bound specifically to the MLL bcr in untreated or etoposide-treated CD34+ cells. This assay, which is similar to a ChIP assay (Boyd et al., 1998) without cross-linking, was accomplished by immuno-affinity purification of DNA topoisomerase II covalent complexes from the total genomic DNA of the CD34+ cells followed by DOP and then real-time PCR using primers proximal to the hotspot for MLL translocation breakpoints (Whitmarsh et al., 2003) in intron 8 3′ in the bcr. Native as well as etoposide-stabilized DNA topoisomerase II covalent complexes with the MLL bcr were detectable in the immuno-affinity purified DNA topoisomerase II covalent complexes, demonstrating that DNA topoisomerase II forms covalent complexes with MLL at sites of translocation breakpoints in human CD34+ cells. That MLL exon 25 is distal to the bcr and not involved in leukemia-associated translocations, yet etoposide induced DNA topoisomerase II cleavage complexes proximal to the MLL exon 25 amplicon, may suggest that translocations resulting from repair of DNA topoisomerase II-mediated damage in MLL exon 25 would not provide a selective or proliferative advantage for leukemogenesis. Detection of DNA topoisomerase II covalent complexes at the hotspot for MLL translocation breakpoints in intron 8 3′ in the bcr in the presence of etoposide establishes that drug-stabilized DNA topoisomerase II cleavage is a mechanism to damage MLL at a relevant site and in a relevant cellular model system.
In addition, formation of DNA topoisomerase IIα covalent complexes at the hotspot for MLL translocation breakpoints by the native enzyme is especially important. Translocations of the MLL gene are the hallmark aberrations in leukemias that follow chemotherapy with DNA topoisomerase II poisons (Rowley and Olney, 2002) and several treatment-related leukemias occurring after DNA topoisomerase II poisons have translocation breakpoints at this hotspot region (reviewed in (Whitmarsh et al., 2003)). However, not all MLL-rearranged treatment-related leukemias occur after exposure to these agents. For example, a case of secondary AML with t(9;11) and der(11) and der(9) MLL breakpoints in this hotspot region has been reported after chemotherapy for primary Hodgkin's disease without DNA topoisomerase II poisons (Langer et al., 2003). Formation of DNA topoisomerase IIα covalent complexes in this genomic region by the native enzyme may be the cause of the breakage in such cases. Furthermore, native DNA topoisomerase II cleavage also should be active during the bone marrow repopulation and recovery after cytotoxic chemotherapy in general because DNA topoisomerase IIα expression is cell cycle-dependent and highest in proliferating cells (Isaacs et al., 1998).
The results of the present study imply two mechanisms for DNA topoisomerase II involvement in the DNA damage that results in MLL translocations. The first mechanism implicates direct poisoning effects of drug-stabilized DNA topoisomerase II cleavage complexes at the translocation breakpoint sites as the damage mechanism. In the second mechanism, native DNA topoisomerase II mediates cleavage at the translocation breakpoints. This second mechanism is relevant to the cases where prior cytotoxic chemotherapy without DNA topoisomerase II poisons was administered. Ternary DNA topoisomerase II cleavage complexes with MLL sequences involved in translocations can be stimulated by poisons of the enzyme, but the native enzyme alone forms cleavage complexes with the MLL translocation breakpoint hotspot; either can be important in the DNA damage that leads to translocations.
Another example was shown of real-time PCR detection of DNA topoisomerase II complexes in proximity to the MLL intron 7-exon 8 junction in CD34+ cells that were treated either with etoposide or genistein, indicating that the naturally-occurring compound that is found in diet also is associated with formation of functional DNA topoisomerase cleavage complexes proximal to this amplicon in the MLL bcr.

EXAMPLE V

Microarrays

One goal of these assays is the global identification of DNA topoisomerase II mediated damage from etoposide and its metabolites in the MLL bcr and in the genome in general. Such damage can be studied in ex vivo-expanded human bone marrow progenitor cells as representative targets for translocations. A direct interaction of DNA topoisomerase II with specific MLL bcr sequences has not been investigated in a cellular context except in the real-time PCR assays described herein. The generation of a custom MLL bcr-specific oligonucleotide array would further streamline and improve upon the present detection method.
Employing XeoChip™ technology (Xeotron, Houston, Tex.), a first generation MLL bcr oligonucleotide array containing replicate slots of each of 162 probes was created. The 162 probes included 73 probes for the non-repetitive MLL bcr sequences, 8 probes for the Alu region between nucleotide positions 663-1779 in the MLL bcr, 57 probes for MLL exon 25 which is unaffected by the translocations, and 24 probes for 9 bacterial control genes (see Tables 2 and 3; Tables 4 and 5 provide another example of a series of oligonucleotides that can be employed in a microarray). The 8.3 kb MLL bcr is represented by replicates of each of the 73 50mers at average intervals of 115 bases to span the bcr. Because it has been well documented in the literature that the printing, general hybridization conditions, and scanning of microarrays introduce systemic effects that are related to the position on the chip, replicates of each of the probes in the array have been spaced throughout the chip.
MLL-specific probes without homology to each other or to Alu sequences were designed to be 50mer sense-strand sequences in accordance with Xeotron parameters. A BLAST search of the probes against the human genome sequence confirmed that the probes were MLL-specific. Special probe design was utilized for the Alu-rich region from MLL bcr positions 663-1779 where no consideration for cross-homology was possible. Bacterial control gene sequences were BLAST searched against the human genome sequence database. Probes were not designed to regions where BLAST hits were found and then designed to be sense-strand 50mer sequences using the Xeotron parameters. Except in the instance of the Alu-rich region probes, this probe design, under stringent hybridization and washing conditions, should enable distinguishing between distinct sequences where the overall homology is <80% (i.e. 10 mismatches out of 50 bases) and where there are no stretches of >25 bases of homology.
Primary CD34+ selected human bone marrow cells were obtained through the NHLBI or purchased commercially. The cells were expanded ex vivo using conditions optimized to promote minimal differentiation in order to increase cell numbers as required to generate a useful model system. Briefly, the general strategy is: 1) ex vivo-expand CD34+ cells or other relevant cells to be treated with etoposide or different test compound, 2) treat the cells with etoposide or reserve as untreated, 3) lyse the cells, 4) shear the DNA, 5) isolate total genomic DNA including any protein-bound DNA as for ICE bioassays (see FIG. 10), 6) isolate DNA-DNA topoisomerase II covalent complexes with an immunoaffinity column according to the scheme summarized in FIG. 11 and elute DNA-DNA topoisomerase II covalent complexes from the column, 7) perform whole genome amplification by degenerative oligonucleotide PCR or another suitable technique, 8) quantify DOP products by measuring the OD260, 9) measure fragment sizes of DOP products in an agarose gel, and 10) analyze the DOP products from the experimental sample (which can either be untreated cells or cells treated with specific agent) and the calibrated standard sample (i.e. plasmid containing genomic sequence of the MLL bcr) labeled with a detectable label such as Alexa Fluor dyes (Molecular Probes, Eugene, Oreg.), heat-denatured, and hybridized in different channels to a pre-hybridized MLL bcr XeoChip™.
Components of the experimental design, including statistical and computational tools to use MLL bcr DNA oligonucleotide arrays to study human CD34+ cells treated with etoposide and compare treated with untreated cells, also were developed. A degenerative oligonucleotide PCR-(DOP-) amplified plasmid DNA template containing an 8.3 kb genomic DNA insert of the entire MLL bcr in PBSK II+ is employed for use as a labeled reference sample calibrated against every probe in the array in order to enable better accuracy in spot intensity information and control for any unequal labeling of specific regions in the bcr in the DOP-amplified experimental samples. By 1) serial dilutions of AlexaFluor dye-labeled DOP products of the reference sample, 2) acquisition of MLL bcr XeoChip™ images with the Cy-3 and Cy-5 channels of a GenePix® (Axon Instruments, Foster City, Calif.) laser scanner, and 3) analysis using the GenePix® program, it has been established that hybridization of 0.02 μg of the reference sample gives a non-saturating hybridization signal (FIG. 12).
In additional experiments, CD34+ cells were expanded in culture, treated or untreated for 2 hours with etoposide at 100 μM final concentration. The total cellular DNA was harvested including any protein-bound DNA on CsCl cushions, and then immunoaffinity column purification of DNA covalently bound to DNA topoisomerase IIα was performed in etoposide-treated or untreated samples according to the schematics summarized in FIG. 10 and FIG. 11. DOP of the immunoaffinity-purified DNA topoisomerase II cleavage complexes from the treated and untreated cells was performed exactly as was done with the reference sample. In one such experiment the samples from untreated cells or cells treated with 100 μM etoposide were labeled with AlexaFluor 546 (equivalent of Cy-3; green) and the MLL bcr reference sample was labeled with AlexaFluor 647 (equivalent of Cy-5; red). Dye-swap experiments were also performed. MLL bcr XeoChip™ hybridizations were then performed with 0.02 μg of AlexaFluor dye-labeled DOP products of etoposide-treated or untreated samples in one channel of the chip and the reference sample labeled with the reverse AlexaFluor dye in the other channel.
GeneSpring (Silicon Genetics, Redwood City, Calif.) was employed as a computational tool to visualize and analyze the data from MLL bcr XeoChips™ with either treated or untreated samples in one channel and the reference sample in the other. Non-parametric statistical regression tools can also be applied in order to identify hybridization hotspots that suggest effects of treatment. The preliminary data analysis suggests that the MLL Xeochips™ microarray is useful for detecting hotspots and coldspots for DNA topoisomerase II complex formation with the MLL bcr.
A Quantile-Quantile (Q-Q) plot (44, 45) standardized by intensity was employed to compare etoposide-treated and untreated cells (FIG. 12B). DOP-amplified DNA from the DNA topoisomerase II cleavage complexes in treated or untreated cells on separate chips was labeled with AlexaFluor 546. The MLL bcr reference sample was labeled with AlexaFluor 647. The null hypothesis represented by the straight line is that there is no effect at any probe, whereas upward departure points are potential hotspots and downward departure points are potential coldspots. As seen in FIG. 12B, probes 1-41 and 1-51, for example, appear as hotspots and probes 2-28, 1-30, 1-18, and 1-15, for example, appears as a cold spot.

A similar Q-Q plot was performed on untreated cells and cells treated with 100 μM genistein (FIG. 12C). Probes 1-68 (SEQ ID NO: 157), 1-41 (SEQ ID NO: 49), 1-51 (SEQ ID NO: 141), and 1-33 (SEQ ID NO: 132) were identified as potential hotspots and probes 1-31 (SEQ ID NO: 27), 2-50 (SEQ ID NO: 162), 1-74 (SEQ ID NO: 62), 2-28 (SEQ ID NO: 34), 1-10 (SEQ ID NO: 83), and 1-22 (SEQ ID NO: 71) were identified as potential coldspots. Notably, probes 1-41 (SEQ ID NO: 49) and 1-51 (SEQ ID NO: 141) were identified as hotspots in both etopside and genistein treated cells while probe 2-28 (SEQ ID NO: 34) was identified as a coldspot. It is also noteworthy that probes 1-68 (SEQ ID NO: 157) and 1-33 (SEQ ID NO: 132) correspond to nearby oligonucleotides. Additionally, these results mirror in vitro cleavage studies with etoposide and genistein as there is some overlap in cleavage sites induced by the different agents as well as differences in site selectivity.

TABLE 2


						Probe
			Ranked			Position
Random	Original		order of		Sequence	within
Sorter	Sorter	Probe ID	preference	Sequence Description	Length	sequence

1	93	0002-12	12	MLL Exon 25	4249	2662
2	66	0001-66	24	MLL Exon-intron 5 to 11	8342	3682
3	113	0002-32	32	MLL Exon 25	4249	2450
4	24	0001-24	24	MLL Exon-intron 5 to 11	8342	5309
5	32	0001-32	32	MLL Exon-intron 5 to 11	8342	5938
6	106	0002-25	25	MLL Exon 25	4249	436
7	54	0001-54	12	MLL Exon-intron 5 to 11	8342	4395
8	161	LysX-M	1	LysX-M	270	132
9	118	0002-37	37	MLL Exon 25	4249	2748
10	112	0002-31	31	MLL Exon 25	4249	334
11	110	0002-29	29	MLL Exon 25	4249	2829
12	157	TrpnX-3	1	TrpnX-3	579	128
13	86	0002-5	5	MLL Exon 25	4249	3476
14	160	BioB-3	1	BioB-3	298	61
15	30	0001-30	30	MLL Exon-intron 5 to 11	8342	2460
16	61	0001-61	19	MLL Exon-intron 5 to 11	8342	3149
17	39	0001-39	39	MLL Exon-intron 5 to 11	8342	3214
18	81	0001-81	8	>MLL Exon-intron 5 to 11	8342	1578
19	12	0001-12	12	MLL Exon-intron 5 to 11	8342	4666
20	2	0001-2	2	MLL Exon-intron 5 to 11	8342	7974
21	73	0001-73	31	MLL Exon-intron 5 to 11	8342	1875
22	130	0002-49	12	MLL Exon 25	4249	160
23	85	0002-4	4	MLL Exon 25	4249	4048
24	103	0002-22	22	MLL Exon 25	4249	1285
25	46	0001-46	4	MLL Exon-intron 5 to 11	8342	314
26	57	0001-57	15	MLL Exon-intron 5 to 11	8342	3349
27	31	0001-31	31	MLL Exon-intron 5 to 11	8342	88
28	139	BioB-5	1	BioB-5	274	83
29	52	0001-52	10	MLL Exon-intron 5 to 11	8342	5089
30	72	0001-72	30	MLL Exon-intron 5 to 11	8342	4585
31	20	0001-20	20	MLL Exon-intron 5 to 11	8342	7877
32	13	0001-13	13	MLL Exon-intron 5 to 11	8342	5549
33	155	ThrX-5	1	ThrX-5	645	391
34	109	0002-28	28	MLL Exon 25	4249	2314
35	21	0001-21	21	MLL Exon-intron 5 to 11	8342	7776
36	45	0001-45	3	MLL Exon-intron 5 to 11	8342	4501
37	65	0001-65	23	MLL Exon-intron 5 to 11	8342	5347
38	34	0001-34	34	MLL Exon-intron 5 to 11	8342	4361
39	15	0001-15	15	MLL Exon-intron 5 to 11	8342	1779
40	119	0002-38	1	MLL Exon 25	4249	3435
41	35	0001-35	35	MLL Exon-intron 5 to 11	8342	6403
42	18	0001-18	18	MLL Exon-intron 5 to 11	8342	6578
43	99	0002-18	18	MLL Exon 25	4249	3937
44	126	0002-45	8	MLL Exon 25	4249	857
45	94	0002-13	13	MLL Exon 25	4249	181
46	7	0001-7	7	MLL Exon-intron 5 to 11	8342	7
47	105	0002-24	24	MLL Exon 25	4249	3395
48	100	0002-19	19	MLL Exon 25	4249	1182
49	41	0001-41	41	MLL Exon-intron 5 to 11	8342	343
50	116	0002-35	35	MLL Exon 25	4249	1984
51	117	0002-36	36	MLL Exon 25	4249	523
52	149	DapX-M	1	DapX-M	561	367
53	150	LysX-3	1	LysX-3	283	171
54	5	0001-5	5	MLL Exon-intron 5 to 11	8342	2361
55	162	LysX-5	1	LysX-5	273	12
56	67	0001-67	25	MLL Exon-intron 5 to 11	8342	3471
57	53	0001-53	11	MLL Exon-intron 5 to 11	8342	7636
58	88	0002-7	7	MLL Exon 25	4249	3557
59	27	0001-27	27	MLL Exon-intron 5 to 11	8342	3584
60	153	PheX-M	1	PheX-M	392	238
61	152	PheX-5	1	PheX-5	348	86
62	74	0001-74	1	>MLL Exon-intron 5 to 11	8342	779
63	83	0002-2	2	MLL Exon 25	4249	3839
64	75	0001-75	2	>MLL Exon-intron 5 to 11	8342	870
65	158	TrpnX-5	1	TrpnX-5	531	218
66	101	0002-20	20	MLL Exon 25	4249	2956
67	44	0001-44	2	MLL Exon-intron 5 to 11	8342	516
68	76	0001-76	3	>MLL Exon-intron 5 to 11	8342	991
69	114	0002-33	33	MLL Exon 25	4249	3303
70	19	0001-19	19	MLL Exon-intron 5 to 11	8342	7541
71	22	0001-22	22	MLL Exon-intron 5 to 11	8342	3022
72	135	0002-54	17	MLL Exon 25	4249	2457
73	90	0002-9	9	MLL Exon 25	4249	70
74	47	0001-47	5	MLL Exon-intron 5 to 11	8342	6398
75	144	BioDn-5	1	BioDn-5	277	221
76	123	0002-42	5	MLL Exon 25	4249	1264
77	79	0001-79	6	>MLL Exon-intron 5 to 11	8342	1343
78	122	0002-41	4	MLL Exon 25	4249	1556
79	111	0002-30	30	MLL Exon 25	4249	909
80	120	0002-39	2	MLL Exon 25	4249	2280
81	50	0001-50	8	MLL Exon-intron 5 to 11	8342	680
82	56	0001-56	14	MLL Exon-intron 5 to 11	8342	5466
83	10	0001-10	10	MLL Exon-intron 5 to 11	8342	2611
84	91	0002-10	10	MLL Exon 25	4249	604
85	124	0002-43	6	MLL Exon 25	4249	2016
86	37	0001-37	37	MLL Exon-intron 5 to 11	8342	6683
87	8	0001-8	8	MLL Exon-intron 5 to 11	8342	169
88	107	0002-26	26	MLL Exon 25	4249	1656
89	25	0001-25	25	MLL Exon-intron 5 to 11	8342	663
90	140	BioB-M	1	BioB-M	258	80
91	38	0001-38	38	MLL Exon-intron 5 to 11	8342	4480
92	26	0001-26	26	MLL Exon-intron 5 to 11	8342	3921
93	98	0002-17	17	MLL Exon 25	4249	2540
94	142	BioC-5	1	BioC-5	349	193
95	97	0002-16	16	MLL Exon 25	4249	1575
96	102	0002-21	21	MLL Exon 25	4249	3753
97	14	0001-14	14	MLL Exon-intron 5 to 11	8342	2699
98	16	0001-16	16	MLL Exon-intron 5 to 11	8342	6769
99	151	PheX-3	1	PheX-3	442	353
100	42	0001-42	42	MLL Exon-intron 5 to 11	8342	4574
101	55	0001-55	13	MLL Exon-intron 5 to 11	8342	2829
102	64	0001-64	22	MLL Exon-intron 5 to 11	8342	2515
103	127	0002-46	9	MLL Exon 25	4249	2636
104	134	0002-53	16	MLL Exon 25	4249	1392
105	84	0002-3	3	MLL Exon 25	4249	3101
106	108	0002-27	27	MLL Exon 25	4249	705
107	78	0001-78	5	>MLL Exon-intron 5 to 11	8342	1256
108	63	0001-63	21	MLL Exon-intron 5 to 11	8342	2940
109	138	0002-57	20	MLL Exon 25	4249	3351
110	141	BioC-3	1	BioC-3	253	5
111	4	0001-4	4	MLL Exon-intron 5 to 11	8342	6963
112	49	0001-49	7	MLL Exon-intron 5 to 11	8342	5675
113	77	0001-77	4	>MLL Exon-intron 5 to 11	8342	1153
114	28	0001-28	28	MLL Exon-intron 5 to 11	8342	5669
115	136	0002-55	18	MLL Exon 25	4249	278
116	92	0002-11	11	MLL Exon 25	4249	1437
117	89	0002-8	8	MLL Exon 25	4249	4165
118	128	0002-47	10	MLL Exon 25	4249	3269
119	3	0001-3	3	MLL Exon-intron 5 to 11	8342	250
120	11	0001-11	11	MLL Exon-intron 5 to 11	8342	517
121	62	0001-62	20	MLL Exon-intron 5 to 11	8342	3913
122	58	0001-58	16	MLL Exon-intron 5 to 11	8342	2299
123	125	0002-44	7	MLL Exon 25	4249	2118
124	148	DapX-5	1	DapX-5	499	2
125	146	CreX-5	1	CreX-5	535	229
126	95	0002-14	14	MLL Exon 25	4249	2206
127	147	DapX-3	1	DapX-3	447	85
128	132	0002-51	14	MLL Exon 25	4249	3757
129	137	0002-56	19	MLL Exon 25	4249	3037
130	71	0001-71	29	MLL Exon-intron 5 to 11	8342	5171
131	48	0001-48	6	MLL Exon-intron 5 to 11	8342	5258
132	33	0001-33	33	MLL Exon-intron 5 to 11	8342	2827
133	145	CreX-3	1	CreX-3	407	220
134	82	0002-1	1	MLL Exon 25	4249	1890
135	43	0001-43	1	MLL Exon-intron 5 to 11	8342	6966
136	23	0001-23	23	MLL Exon-intron 5 to 11	8342	7450
137	17	0001-17	17	MLL Exon-intron 5 to 11	8342	6493
138	115	0002-34	34	MLL Exon 25	4249	1775
139	129	0002-48	11	MLL Exon 25	4249	3568
140	6	0001-6	6	MLL Exon-intron 5 to 11	8342	3104
141	51	0001-51	9	MLL Exon-intron 5 to 11	8342	8087
142	121	0002-40	3	MLL Exon 25	4249	641
143	159	TrpnX-M	1	TrpnX-M	489	165
144	143	BioDn-3	1	BioDn-3	286	73
145	60	0001-60	18	MLL Exon-intron 5 to 11	8342	8175
146	133	0002-52	15	MLL Exon 25	4249	1748
147	80	0001-80	7	>MLL Exon-intron 5 to 11	8342	1493
148	70	0001-70	28	MLL Exon-intron 5 to 11	8342	5791
149	1	0001-1	1	MLL Exon-intron 5 to 11	8342	6881
150	87	0002-6	6	MLL Exon 25	4249	1033
151	9	0001-9	9	MLL Exon-intron 5 to 11	8342	5126
152	40	0001-40	40	MLL Exon-intron 5 to 11	8342	2278
153	156	ThrX-M	1	ThrX-M	571	485
154	104	0002-23	23	MLL Exon 25	4249	3201
155	96	0002-15	15	MLL Exon 25	4249	2073
156	154	ThrX-3	1	ThrX-3	463	135
157	68	0001-68	26	MLL Exon-intron 5 to 11	8342	3257
158	69	0001-69	27	MLL Exon-intron 5 to 11	8342	435
159	59	0001-59	17	MLL Exon-intron 5 to 11	8342	3818
160	36	0001-36	36	MLL Exon-intron 5 to 11	8342	8055
161	29	0001-29	29	MLL Exon-intron 5 to 11	8342	8293
162	131	0002-50	13	MLL Exon 25	4249	3121

TABLE 3


	SEQ ID
Probe ID	NO	Probe Sequence

0002-12	1	GTCCTGGCCCGTCTCAGATTTCCAATGCAGCTGTCCAGACCACTCCACCC

0001-66	2	AAAGAATCCTGAATAAATGGGGACTTTCTGTTGGTGGAAAGAAATATAGA

0002-32	3	TCCAACTCCTGAAGGCCACATGACTCCTGATCATTTTATCCAAGGACACA

0001-24	4	ATTCAGTCTACAAGTGCCAGGGGTCTACTGTATCCTCTTTTCCGTCTTAA

0001-32	5	AGGCCTTATTTAGGTTTGACCAATTGTCCCAATAATTCCTTTATGGCAAA

0002-25	6	TGAGTTCCAAGAGCTCAGAGGGATCTGCACATAATGTGCCTTACCCTGGA

0001-54	7	AGAGCAGGTTACAAGATAATATATAAAGCACAATCCCATCTTAGTTTGCA

LysX-M	8	CGCATACGCATGACTACATTACAACGGGCCAGGAAGATTCAAAGTTTGGT

0002-37	9	AACCAGAACATGCAGCCACTTTATGTTCTCCAAACTCTTCCAAATGGAGT

0002-31	10	ACAGTCACTTGGATGGATCTTCATCTTCAGAAATGAAGCAGTCCAGTCCT

0002-29	11	AGTTCTACACCCAGTGTGATGGAGACAAATACTTCAGTATTGGGACCCAT

TrpnX-3	12	AAATATTGCGGTATTCGGTCACTAAAGGATTTGCAGCTTGCGGCGGAATC

0002-5	13	CCACCTCACATCAGGGTCTGTGTCTGGCTTGGCATCCAGTTCCTCTGTCT

BioB-3	14	GAACGAACAGACTCAGGCGATGTGCTTTATGGCAGGCGCAAACTCGATTT

0001-30	15	CCACAGGATCAGAGTGGACTTTAAGGTAAAGGTGTTCAGTGATCATAAAG

0001-61	16	AGGCATCCTGCTTCTTTGTACCCCAGGAAGTACATAAATGATTGATCTGG

0001-39	17	AGTCTGTTTTGTTGGTATTTAGCAGGTACTATTCCCTGTTTAAACCAGCT

0001-81	18	CCTGTACTCCCAGCTACTCAGGAGAGTGAGCCAGGAGAATCGCGTGAACC

0001-12	19	TCCTACATCCTTTACAGTTCTTAAATTCCTGGCAGATACCTCTTTGCCTT

0001-2	20	TGGAGTGTAATAAGTGCCGAAACAGCTATCACCCTGAGTGCCTGGGACCA

0001-73	21	AAATCACCCTTCCCTGTATTCACTATTTTTATTTATTATGGATAAAGAGA

0002-49	22	ACTCTAGGAATAATGTTTCCTCAGTCTCCACCACCGGGACCGCTACTGAT

0002-4	23	CTCCATCCTCTCCATCTTCTGGACAGCGGTCAGCAAGCCCTTCAGTGCCG

0002-22	24	AGGACAGAAACCTAATGCTTCCAGATGGCCCCAAACCTCAGGAGCATGGC

0001-46	25	AAGCACTGATGTCTCAAACAGCATTTGAAAGCAGGAAATGTATGATTTGA

0001-57	26	AATCCCATCTCTCTTAAATTCAGTCTTTATTAGAGTTCTGATCTTTCTGT

0001-31	27	TCGGCCTGAATCCAAACAGGCCACCACTCCAGCTTCCAGGAAGTCAAGCA

BioB-5	28	TTCGATCCTCGTCAGGTGCAGGTCAGCACGTTGCTGTCGATTAAGACCGG

0001-52	29	AGAAAATCCAAGCTAGGTTGAAATCTGAATGTTGAGCAGTCAGTGAGACA

0001-72	30	TGTACCACCTTTACAATGAGGAAGGAAAAAGTAGCACAATTTTAAATAGG

0001-20	31	TGCCAGTAAATGTGAAATGGGGTACTAAGTAATAGGTGTTGGCTGAAGGT

0001-13	32	ACTGCACTCCTAAAGCATGACCAGTGCTTGATAAACTCTCCTCCATGCGA

ThrX-5	33	AGAAATCACCGATTGCCCTTGTCAACTCAGTCAACCCTTACCGCATTGAA

0002-28	34	GGAGTCCCACTGTCCCCAGCCAGAATCCCAGTAGACTAGCTGTTATCTCA

0001-21	35	ACTGAGTGCCTTTGGCAGGAAATAAATCTATCTCAATGCGTTAATTGGGA

0001-45	36	ATTAAGAGTGTGGTTGGATTATGGGTGACCTTTATTTGTTTCTCTGGTTT

0001-65	37	TTTCCGTCTTAATACAGTGCTTTGCACCCATATATATGCCACCCACAGGA

0001-34	38	TGGAAAGATGTCCATGACATATCACTGAGTGAAAAGAGCAGGTTACAAGA

0001-15	39	CCCACATGTTCTAGCCTAGGAATCTGCTTATTCTAAAGGCCATTTGGCGT

0002-38	40	GCCACAGCGGCAGGCACATCAACAATAAGCCAGGATACTAGCCACCTCAC

0001-35	41	TGGAAAGGACAAACCAGACCTTACAACTGTTTCGTATATTACAGAAAACG

0001-18	42	TTTCCACTGGTATTACCACTTTAGTACTCTGAATCTCCCGCAATGTCCAA

0002-18	43	CCCAGGTATCCAACTTTACCCAGACCGTAGACGCTCCTAATAGCATGGGA

0002-45	44	CGTGACAACTGGTGAGGAAGGAAACTTCAAGCCAGAGTTTATGGATGAGG

0002-13	45	CAGTCTCCACCACCGCGACCGCTACTGATCTTGAATCAAGTGCCAAAGTA

0001-7	46	TGCCCCAAAGAAAAGCAGTAGTGAGCCTCCTCCACGAAAGCCCGTCGAGG

0002-24	47	ACCGGCACCCCTGTTACCACAGAGTGTGGGAGGAACTGCTGCCACAGCGG

0002-19	48	TCAGCCTCTGAAAATCCAGGAGATGGTCCAGTGGCCCAACCAAGCCCCAA

0001-41	49	AGCAGGAAATGTATGATTTGAAGTCTTCAGTTCAAGAAAATCAGCTCTCT

0002-35	50	AGCTCCTGAAATCAGATTCAGACAATAACAACAGTGATCACTGTGGGAAT

0002-36	51	CTAGAGAACTGAATGTTAGTAAAATCGGCTCCTTTGCTGAACCCTCTTCA

DapX-M	52	TGTCTCGGCATTAATCCGTTTATGTGATCTGTATTCCATTCCGCTCGCCA

LysX-3	53	GATCGAACCGGGCCGTTCTCTCGTGGGAGACGCAGGCACAACTCTTTATA

0001-5	54	ACCTCCGGTCAATAAGCAGGAGAATGCAGGCACTTTCAACATCCTCAGCA

LysX-5	55	CAACATGGTCATTTAGAAATCGGAGGTGTGGATGCTCTCTATTTAGCGGA

0001-67	56	TGTATATCAAAGCCTCTTCATCTATAAGGAGCTCTTACCAATTAATAAGA

0001-53	57	TTTACTTAGTCTGTCTTTAGCATTTAATTGGGTGTAATCAGTTGCCTATT

0002-7	58	CCCTACAAGTAGTGCGTCAGTTCCAGGACACGTCACCTTAACCAACCCAA

0001-27	59	GAAATAAATACATGTTGGGTGGCAGGGGGAGGTGAAGGGAGGGTGTCTGT

PheX-M	60	TTTAATACATGAACAGCCTTTCCCAATCGTCGGTGAAATGACGTTGCCGA

PheX-5	61	GCAGATTCAGTAGCAGATGCCGTTCAAAAGGTCGATTTAAGTAGAAGTGC

0001-74	62	AACTTCAAGTTTAGGCTTTTAGCTGGGCACGGTCGCTCACGCTGGTAATC

0002-2	63	AGCAGACGAACACTATCAGCTTCAGCATGTGAACCAGCTCCTTGCCAGCA

0001-75	64	CAGCAGTTCAAGACCAGCCTGGGCAACATAGCAAGACCCTGTCTTTATTT

TrpnX-5	65	AAACCCTTACTGCCGGTGAGGCTGAAACGCTGATGAATATGATGATGGCA

0002-20	66	AAGGATTGCTACCCATGTCTCATCACCAGCACTTACATTCCTTCCCTGCA

0001-44	67	GCCCTTTCTTCACAGGTCAGTCAGTACTAAAGTAGTCGTTGCCAGCATCT

0001-76	68	TCAGGAGGCTGAGATAGAAGGATTGTCTTGAGCCCACGAATTCAAGGCTG

0002-33	69	AGTCTGTTAGATTTGGGGTCACTTAATACTTCATCTCACCGAACTGTCCC

0001-19	70	GGAAACCAAGGATGACTGTGCTTAGAGTATTGCTTTCTTTCTTGATTTGT

0001-22	71	CTCTCCACAGGAGGATTGTGAAGCACAAAATGTGTGGGAGATGGGAGGCT

0002-54	72	CCTGAAGGCCACATGACTCCTGATCATTTTATCCAAGGACACATGGATGC

0002-9	73	GCATTGGCTCCAGGCGTCACAGTACCTCTTCCTTATCACCCCACCGCTCC

0001-47	74	ACAAATGGAAAGGACAAACCAGACCTTACAACTGTTTCGTATATTACAGA

BioDn-5	75	CGCAAGAGGGCAGACCGATAGAATCATTGGTAATGAGCGCCGGATTACGC

0002-42	76	ACTATCAGAATCTTCCAGTACAGGACAGAAACCTAATGCTTCCAGATGGC

0001-79	77	GCAGTGAGCCGAGATTGCATCATTGCACTCTAGCCTGGACAACAGAGCTA

0002-41	78	CACTAGAACAGTGATTTCTTCAGGTGGAGAGCAACGACTGGCATCCCATA

0002-30	79	TTGACTCCTGAGTATATGGGCCAACGACCATGTAACAATGTTTCTTCTGA

0002-39	80	GAGCTACCATCTGATCTGTCTGTCTTGACCACCCGCAGTCCCACTGTCCC

0001-50	81	TGTTTCTCTGCCATTTCTCAGGGATGTATTCTATTTTGTAGGGAAAAGCC

0001-56	82	TTCTGATCTAAATTCTTTATAGTTGTACATAGCAATCTCACAGGGTTCCT

0001-10	83	AGCAGGTGGGTTTAGCGCTGGGACAGCTTTGGACAGTGTTGTTAGGTCAC

0002-10	84	TCCCACACCTCCATTTGAGAGGGCAAAGGAATGATCGAGACCAACACACA

0002-43	85	AGTGATGACTGTGGGAATATCCTGCCTTCAGACATTATGGACTTTGTACT

0001-37	86	TGCCAGTGGACTACTAAAACCCAAAGTATATAAGAAGGGTATGGTTGATT

0001-8	87	GCCTCAGCCACCTACTACAGGACCGCCAAGAAAAGAAGTTCCCAAAACCA

0002-26	88	GATGGTGTTGATGATGGGACAGAGAGTGATACTAGTGTCACAGCCACAAC

0001-25	89	AAAGGTGAGGAGAGATTTGTTTCTCTGCCATTTCTCAGGGATGTATTCTA

BioB-M	90	GGGATCAAAGTCTGTTCTGGCGGCATTGTCGGCTTAGGCGAAACCGTAAA

0001-38	91	TGGAAGGATTCACACCAAAATATTAAGAGTGTGGTTGGATTATGGGTGAC

0001-26	92	ACCCGAAAGTCCATCTATAGGGAGCATGGGTTAAAATAAGCATAGGGCAT

0002-17	93	AGAGCAAGGTCATGGCAACAATCAGGATTTAACTAGGAACAGTAGCACCC

BioC-5	94	CGCCAATGCTTGTTCAGGCACGCCAGAAGGATGCCGCAGACCATTATCTG

0002-16	95	TCAGGTGGAGAGGAACGACTGGCATCCCATAATTTATTTCGGGAGGAGGA

0002-21	96	ACTGCTGCAATAACAGCGGCATCTAGCATCTGTGTGCTCCCCTCCACTCA

0001-14	97	TTCCTATCCATCCTGAGGAGTATCAGAGGAAGTAATTCCTTCACATGGAA

0001-16	98	TCCCATGTTCTTACTATAGTTTGTCTATTGCCAAGTCTGTTGTGAGCCCT

PheX-3	99	CGTTTGATGATGTATTGATTCCAGGGGCCATGCAGGAGCTTGAAGCACTC

0001-42	100	TTTTTGGAGTATGTACCACCTTTACAATGAGGAAGGAAAAAGTAGCACAA

0001-55	101	CTATGAATTGAACAACTAGGTGAGCCTTTTAATAGTCCGTGTCTGAGATT

0001-64	102	TGAGTGTCAAAGACTTTAAATAAAGAAAATGCTACTACCAAAGGTGTTGA

0002-46	103	GAAGTATGTGCCCAATTCTACTGATAGTCCTGGCCCGTCTCAGATTTCCA

0002-53	104	GGGCTTACCCCACTCTATGGAGTAAGATCCTATGGTGAAGAAGACATTCC

0002-3	105	AGAATCCAGCCAGAGGACAGACCTCAGTACCACAGTAGCCACTCCATCCT

0002-27	106	ACCTTGAAGCTATCTGGAATGAGCAACAGATCATCCATTATCAACGAACA

0001-78	107	CCGGTTGTGGTAGTGGGTGCTTGGTAATCCTAGCTACTTGGGAGCCTGAG

0001-63	108	ATGTCACACTAATTTTATGCTTTTCATCCTTATTTTCCATCCAAAGTTGT

0002-57	109	CCCAACATCATAAAAAGATCTAAATCTAGCATCATGTATTTTGAACCGGC

BioC-3	110	CGAACGTCATCAGGCGTGGCAGGCGGTGCACGAGCGTCCGCATGCTAATC

0001-4	111	TGGGCCTCTGTATCAGTGGGTTCTGTATCCCTGGACTCAACCAACCTTGG

0001-49	112	CCCTCACCCAAATTCCCTAAGTGTTAATATGTTTCTCTGTGTGTATATAT

0001-77	113	CACTTTGGGAAGCCGAAGCAGGCAGATCACTTGAGGTCAGGAGTTGGAGA

0001-28	114	AAGTACCCCTCACCCAAATTCCCTAAGTGTTAATATGTTTCTCTGTGTGT

0002-55	115	AAACACTTCCACCTCTTCAAATTTGCAAAGGACAGTGGTTACTGTAGGCA

0002-11	116	ATTCCATTCTACAGCAGCTCAACTGGGAAGAAGCGAGGCAAGAGATCAGC

0002-8	117	AGCACAAAGTTTCCCATTTGCGGACCAGTTCTTCTGAAGCACACATTCCA

0002-47	118	TAACTTCACACCCTCCCAGCTTCCTAATCATCCAAGTCTGTTAGATTTGG

0001-3	119	ACCACCAGAATCAGGTGAGTGAGGAGGGCAAGAAGGAATTGCTGACCCAC

0001-11	120	CCCTTTCTTCACACGTCAGTCAGTACTAAAGTAGTCGTTGCCAGCATCTG

0001-62	121	TGGAAACAACCCGAAAGTCCATCTATAGGGAGCATGGGTTAAAATAAGCA

0001-58	122	TGTGAAGGCAAATAGGGTGTGATTTTGTTCTATATTCATCTTTTGTCTCC

0002-44	123	TCAGAACTCCTGAATCTTGGTGAAGGATTGGGTCTTCACAGTAATCGTGA

DapX-5	124	GGCAGAACGAACACCACATTTTGACCTTGTAGGGGCCATAGACCATACAT

CreX-5	125	AAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCGTCGGTCC

0002-14	126	TGCCTACAACAGAACCTGTGGATAGTAGTGTCTCTTCCTCTATCTCAGCA

DapX-3	127	TGATCAGGCAATTCGGTCAATTGTCACTGTCATCAGAATCTGTCGGCCAA

0002-51	128	CTGCAATAACAGCGGCATCTAGCATCTGTGTGCTCCCCTCCACTCAGACT

0002-56	129	GCAATCCTCCTTCAGGCCTGCTTATTGGGGTTCAGCCTCCTCCGGATCCC

0001-71	130	TGCCATTTGAAGTTATTACTAGCAAAATTACAAATTATTGCCTACTATTC

0001-48	131	ACAACTTATTGTTCTAAGTGCAGAAGTTCAGATATCATTGAGACTGAGAA

0001-33	132	CACTATGAATTGAACAACTAGGTGAGCCTTTTAATAGTCCGTGTCTGAGA

CreX-3	133	CTAAGGATGACTCTGGTCAGAGATACCTGGCCTGGTCTGGACACAGTGCC

0002-1	134	TCCTTGGAAGCTCAGCTCAGCTCATTGGAGTCAAGCCGCAGAGTCCACAC

0001-43	135	GCCTCTGTATCAGTGGGTTCTGTATCCCTGGACTCAACCAACCTTGGATT

0001-23	136	TGTTATATGCAAATGCTGCACCATTTTGTCTAGGGACTTGGGCATCCATG

0001-17	137	TCCCATAGCTCTTTGTTTATACCACTCTTAGGTCACTTAGCATGTTCTGT

0002-34	138	ACCTGAAGATGCTGGGGAGAAAGAACATGTCACTAAGAGTTCTGTTGGCC

0002-48	139	GTGCGTCAGTTCCAGGACACGTCACCTTAACCAACCCAAGGTTGCTTGGT

0001-6	140	AGGGTGGTTTGCTTTCTCTGTGCCAGTAGTGGGCATGTAGAGGTAAGGCA

0001-51	141	TTATAGAGAACCACCATGTGACTATTGGACTTATGTAACTTGTATTACAA

0002-40	142	AGACCAACACACAGATTCTACCCAATCAGCAAACTCCTCTCCAGATGAAG

TrpnX-M	143	CTCACTGAAGGAAGGAACGGAGCTGGCGTTAGAGACGATTACAACCGGAG

BioDn-3	144	CCGGTGATACTGGTAGTTGGTGTGAAACTCGGCTGTATTAATCACGCGAT

0001-60	145	CCCTCATTACTAGGAAATCATCTCAGGAGAGAAATTAAATCTATAAATGG

0002-52	146	TGGAACAGAGAACTTAAAGATTGATAGACCTGAAGATGCTGGGGAGAAAG

0001-80	147	AGGAGATCGAGACCATCCTGGCTAACACGGTGAAACCCTGTCTCTACTAA

0001-70	148	TGAGAACAAGTTGGAGACATAAACCATTTTACCTCTAAATATTTTAGTGT

0001-1	149	TGTCGTCGCTGCAAATTCTGTCACGTTTGTGGAGGGCAACATCACGCTAC

0002-6	150	AGGAATTACAGGCACCACGGAAACGCACAGTCAAAGTGACACTGACACCT

0001-9	151	AGTCAGTGAGACACAAACTAGCTAAGAAAGTCAACCCTGCCCACTTGCCA

0001-40	152	TGCATTATTATCTGTTGCAAATGTGAAGGCAAATAGGGTGTGATTTTGTT

ThrX-M	153	TACAGATAACCTGATCTACCAAGTGGCTAAACGGACCGCAGATTTGTACG

0002-23	154	AAACTTGCTCCCTCTAGTACCCCTTCAAACATTGCCCCTTCTGATGTGGT

0002-15	155	ACTCCATCCATGCAGGCTTTGGGTGAGAGCCCAGAGTCATCTTCATCAGA

ThrX-3	156	AAGTGCTGACAAGAGACGCGAGAGACGTGCTTCCGAAGGAGTTTCCATAT

0001-68	157	ACCAGCTAAAGAAATGTTTTGAAGTATTTTAGAGATTTTAGGAAGGAATC

0001-69	158	AAACAGTTAAATTGGAGGTATTGTTTTAATTTCCTGTTCGAAGCCTAGAG

0001-59	159	GCACTTCAAACACTTATGGATATAATTAGATAAATTGGCAAATCTGTAGA

0001-36	160	AAGTCTGGGTGAGTTATACACATGATGCTCTTTTATAGAGAACCACCATG

0001-29	161	TTCTTTTCTAGATCTGTACCAAGTGTGTTCGCTGTAAGAGCTGTGGATCC

0002-50	162	ACCTCAGTACCACAGTAGCCACTCCATCCTCTGGACTCAAGAAAAGACCC

TABLE 4


SEQ ID NO	Sequence

163	CACTTTGCACTGGAACTTACAACACCCGAGCAAGGACCCGACTCTCCCGA

164	GACACTTCCCCGCCGCTGCCAGGACCCGCTTCTCTGAAAGGCTCTCCTTG

165	CCAGCCAGCGGTCCGCAACCCTTGCCGCATCCACGAAACTTTGCCCATAG

166	CTTTGCACTGGAACTTACAACACCCGAGCAAGGAC

167	CAACCCTTGCCGCATCCACGAAACTTTGCCCATAG

168	CTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGT

169	TTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTC

170	CGAGACCTTCATCAAAAACATCATCATCCAGGACTGTATG

171	GTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAG

172	CGTTTATAGCAGTTACACAGAATTTCAATCCTAGTATATAGTACCTAGTA

173	GAGACTGAAAGATTTAGCCATAATGTAAACTGCCTCAAATTGGACTTTGG

174	CCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATG

175	TTACACAATGTTTCTCTGTAAATATTGCCATTAAATGTAAATAACTTTAA

176	CATCTCCGTATTGAGTGCGAAGGGAGGTCCCCCTATTATTATTTGACACC

177	GCCACTCCAGCCGGCGAGAGAAAGAAGAAAAGCTGGCAAAAGGAGTGTTG

178	GTATTGAGTGCGAAGGGAGGTGCCCCTATTATTATTTG

179	CTTGTATTTATGGAGGGGTGTTAAAGCCCGCGGCTGAG

180	AAAACTTTGTGCCTTGGATTTTGGCAAATTGTTTTCCTCACCGCCACCTC

181	GAGATAGCAGGGGACTGTCCAAAGGGGGTGAAAGGGTGCTCCCTTTATTC

182	AAAACTTTGTGCCTTGGATTTTGGCAAATTGTTTTCCTC

183	GGAATGGTTTTTAAGACTACCCTTTCGAGATTTCTGCCTTATGAATATAT

184	TTTTATCACTTTAATGCTGAGATGAGTCGAATGCCTAAATAGGGTGTCTT

185	CTCCCATTCCTGCGCTATTGACACTTTTCTCAGACTAGTTATGGTAACTG

186	TTATCTTACAACTCAATCCACTTCTTCTTACCTCCCGTTAACATTTTAAT

187	GATCTTCTCAGCCTATTTTGAACACTGAAAAGCAAATCCTTCCCAAAGTT

188	TTTCATTGGCAGCTTATTTAACGGGCCACTCTTATTAGGAAGGAGAGATA

189	CATTAAGTCTTAGGTAAGAATTGGCATCAATGTCCTATCCTGGGAAGTTG

190	CATTTCCAGTAAAATAGGGAGTTGCTAAAGTCATACCAAGCAATTTGCAG

191	ATCATTTGCAACACCTGAAGTGTTCTTGGTAAAGTCCCTCAAAAATAGGA

192	AATCTGGTAATTGATTATTTTAATGTAACCTTGCTAAAGGAGTGATTTCT

193	GATAATTTTGTCCAGAGACCTTTCTAACGTATTCATGCCTTGTATTTGTA

194	GTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAG

195	TACACTCAGCACCAGGTGCTCTCCTCTGACTTCAACAGCGACACCCACTC

196	CTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGG

197	CACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTG

198	AAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCT

199	CATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTG

200	CTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAG

201	TGATGCTTTTCCTAGATTATTCTCTGGTAAATCAAAGAAGTGGGTTTATG

202	CTGTCCAGTTAATTTCTGACCTTTACTCCTGCCCTTTGAGTTTGATGATG

203	TATTCTCTGGTAAATCAAAGAAGTGGGTTTATGGAGGTCCTCTTCTGTCC

204	GATTTCTGGAAAAGAGCTAGGAAGGACAGGCAACTTGGCAAATCAAAGCC

205	CACCGCACCCTGGTCTGAGGTTAAATATAGCTGCTGACCTTTCTGTAGCT

206	CAGAAGCTGAGTCATGGGTAGTTGGAAAAGGACATTTCCACCGCAAAATG

207	ATTATTCTCTGGTAAATCAAAGAAGTGGGTTTATGGAGGTCC

208	CTGTCCAGTTAATTTCTGACCTTTACTCCTGCCCTTTGAG

209	CCTGGTCTGAGGTTAAATATAGCTGCTGACCTTTCTGTAG

210	GAAAAGAGCTAGGAAGGACAGGCAACTTGGCAAATCAAAG

211	GGGAGAAGCTGAGTCATGGGTAGTTGGAAAAGGACATTTC


212	GAAAGACAAGGAAGGAACACCTCCACTTACAAAAGAAGATAAGACAGTTG

213	CAAAGTATGCCAAAGAAGGTCTTATTCGCAAACCAATATTTGATAATTTC

214	AAATAACACATGGAAAGGACATTTCAGAGTTACCAAAGGGAAACAAAGAA

215	GCTGTCAAAACCAAAATACTTATAAAGAAAGGGAGAGGAAATCTGGAAAA

216	CTCACTCTAGAATATTTGAGTCTGTAACCTTGCCTAGTAATCGAACTTCT

217	GTTTATAGAGGATGAGGATTATGACCCTCCAATTAAAATTGCCCGATTAG

218	AAATGAGAGTAATGATAGGAGAAGCAGAAGGTATTCAGTGTCGGAGAGAA

219	GACACATTACATAAACTAGGAGAACTTAAGACTACGAACAGAATATTTGG

220	TGTGTATGAATTCCTTCTTTCAAGTGAACTGATACTAGATTTATTTAAGA

221	CTTAATTATAAAGTTGGATGTCATTTGAGAAACTCTGGGAATTGGAAGTA

222	TAAATAAATTCTTATTCAGCTCCTCGAACCAATAATTACTTTCCAGTAGG

223	TTAAACCGAAATCAGGAGTAGTTGTGTAAAGAACTTATTGGTAATGATGG

224	TGCTTGTGGATACATTGTAACAAATGCTTATAAATCATTTCCAAACTAAT

225	CCAAGGAAAACAGTAGGTGTGGTATCAATATAGGAAACAAATAAGTATTT

226	TAATCATTAAGAAATACTAATTTAAGTATGGCAAAGGAAAGCACAGGTGC

227	TTTCTAGCCTATTCAAATCAATCTGGTCATTTATGGTACTTTCCTATTAG

228	CAATAACAGCATACATTTCTTGACTGGTTGAATTTCATTAACTATTTGGC

229	GCATTTGTGTTTCTTAGGTGACAGTTGCTAGGTAGAATTGAATTAAATAT

230	TTAACATTTCTCAATATCAGGCAGAGATCATATTTAAACAGTTTCAATCT

231	CTGTGTATTTGACTGTGCTTGGGTATATTATACTTTTCTTACTGATTGAG

232	AAACTGACTTTATGGAGACATAACCCTGTTTACCTTTAGAAAGAAGGAAG

233	AAAATAAACCCTGTGATTGTGATGCTTAACTTAATTTTCTACAGTGAATC

234	GAATAATTTGGGACATTGCCAGGAATCACAATAGTTTACTATCTGAAGTA

235	ATGAAATTGAGGGATAGATACAGTAAGTGAGTTGTCTAAGATTACATAGT

236	GCTTTCCAAGTGATTTCACATAAATTATTTATTCCTTACAGTGCTCAAAT

237	ATTGTGATAAGATTTTATATTAATTGTGCTGTTAGGAGTTTTGGCTGTTT

238	TTTCATGAGAAGTCATTCAGTATCATTAAGTATGCTGATTTGTCTCCTTT

239	AGAAATTTATTTGGGGTTCAGATTCACATGTTGTAGGTTAGTTATATACT

240	GGATCTCAAATGTACAGAAATCACATCTAAATGTCAATTCCTGAGTTAAG

241	CTGTATGTTTCTGCCATTATACTTATTTGCTTACCTGATTTAAAGTTGTC

242	TATTAATCAGTTTCTTTAAATAGACCATCTTTCTTGACAACTTGTGCAAA

243	GTATCTATAGTTTGAAATTAGGACTATCCTCTGTGTACTATGCACCAAAG

244	TCTGTAATAAAGCTGTATGGCTGGGTCCATTTATTTCAATATTAGTTATT

245	CCAACTATAACTGAAAATAGGATGCTTCCCTAAGTTTTAGTAAAGGATTT

246	GTCTTTGAAGAGGAGAATTTCAGCCTTTTCTTAAATAGTCCAATACTTTA

TABLE 5


				Probe
			Probe	position
SEQ			Position	within
ID		Sequence	within	gene
NO	Name	Length	fragment	sequence

163	CMYC_Exon1_NT008046.14[1_to_366]_1	366	195	195
164	CMYC_Exon1_NT008046.14[1_to_366]_2	366	273	273
165	CMYC_Exon1_NT008046.14[1_to_366]_3	366	134	134
166	CMYC_Exon1_NT008046.14[1_to_366]_short_1	366	197	197
167	CMYC_Exon1_NT008046.14[1_to_366]_short_2	366	149	149
168	CMYC_Exon2_NT008046.14[1991_to_2762]_1	772	22	2012
169	CMYC_Exon2_NT008046.14[1991_to_2762]_short_1	772	29	2019
170	CMYC_Exon2_NT008046.14[1991_to_2762]_short_2	772	378	2368
171	CMYC_Exon2_NT008046.14[1991_to_2762]_short_3	772	78	2068
172	CMYC_Exon3_NT008046.14[4141_to_5168]_1	1028	863	5003
173	CMYC_Exon3_NT008046.14[4141_to_5168]_2	1028	671	4811
174	CMYC_Exon3_NT008046.14[4141_to_5168]_3	1028	583	4723
175	CMYC_Exon3_NT008046.14[4141_to_5168]_4	1028	808	4948
176	CMYC_Intron1_NT008046.14[1110_to_1410]_1	301	158	1267
177	CMYC_Intron1_NT008046.14[1110_to_1410]_2	301	252	1361
178	CMYC_Intron1_NT008046.14[1110_to_1410]_short_1	301	165	1274
179	CMYC_Intron1_NT008046.14[1110_to_1410]_short_3	301	211	1320
180	CMYC_Intron1_NT008046.14[1551_to_1880]_1	330	54	1604
181	CMYC_Intron1_NT008046.14[1551_to_1880]_2	330	243	1793
182	CMYC_Intron1_NT008046.14[1551_to_1880]_short_1	330	54	1604
183	CMYC_Intron1_NT008046.14[367_to_1110]_1	744	222	588
184	CMYC_Intron1_NT008046.14[367_to_1110]_2	744	37	403
185	CMYC_Intron1_NT008046.14[367_to_1110]_4	744	89	455
186	CMYC_Intron2_NT008046.14[2763_to_3400]_1	637	262	3024
187	CMYC_Intron2_NT008046.14[2763_to_3400]_4	637	527	3289
188	CMYC_Intron2_NT008046.14[2763_to_3400]_5	637	55	2817
189	CMYC_Intron2_NT008046.14[3419_to_3709]_1	291	145	3563
190	CMYC_Intron2_NT008046.14[3419_to_3709]_2	291	1	3419
191	CMYC_Intron2_NT008046.14[3419_to_3709]_3	291	53	3471
192	CMYC_Intron2_NT008046.14[3996_to_4140]_1	145	78	4073
193	CMYC_Intron2_NT008046.14[3996_to_4140]_2	145	21	4016
194	GAPDH_Exon8_NT009759.15[3050_to_3462]_1	413	217	3266
195	GAPDH_Exon8_NT009759.15[3050_to_3462]_2	413	300	3349
196	GAPDH_Exon8_NT009759.15[3050_to_3462]_3	413	364	3413
197	GAPDH_Exon8_NT009759.15[3050_to_3462]_4	413	182	3231
198	GAPDH_Exon8_NT009759.15[3050_to_3462]_5	413	234	3283
199	GAPDH_Exon8_NT009759.15[3050_to_3462]_short_2	413	374	3423
200	GAPDH_Exon8_NT009759.15[3050_to_3462]_short_3	413	299	3348
201	GAPDH_Intron2_NT009759.15[328_to_1959]_1	1632	582	909
202	GAPDH_Intron2_NT009759.15[328_to_1959]_2	1632	1196	1523
203	GAPDH_Intron2_NT009759.15[328_to_1959]_3	1632	599	926
204	GAPDH_Intron2_NT009759.15[328_to_1959]_5	1632	1049	1376
205	GAPDH_Intron2_NT009759.15[328_to_1959]_6	1632	928	1255
206	GAPDH_Intron2_NT009759.15[328_to_1959]_7	1632	693	1020
207	GAPDH_Intron2_NT009759.15[328_to_1959]_short_1	1632	597	924
208	GAPDH_Intron2_NT009759.15[328_to_1959]_short_2	1632	1196	1523
209	GAPDH_Intron2_NT009759.15[328_to_1959]_short_3	1632	936	1263
210	GAPDH_Intron2_NT009759.15[328_to_1959]_short_4	1632	1057	1384
211	GAPDH_Intron2_NT009759.15[328_to_1959]_short_5	1632	691	1018
212	MLL_Exon3_AP001267.4[1_to_2654]_10	2654	491	491
213	MLL_Exon3_AP001267.4[1_to_2654]_2	2654	1402	1402
214	MLL_Exon3_AP001267.4[1_to_2654]_3	2654	199	199
215	MLL_Exon3_AP001267.4[1_to_2654]_4	2654	2361	2361
216	MLL_Exon3_AP001267.4[1_to_2654]_5	2654	1618	1618
217	MLL_Exon3_AP001267.4[1_to_2654]_6	2654	779	779
218	MLL_Exon3_AP001267.4[1_to_2654]_7	2654	1058	1058
219	MLL_Intron1_AP001267.4[10100_to_12332]_1	2233	339	10438
220	MLL_Intron1_AP001267.4[10100_to_12332]_10	2233	1609	11708
221	MLL_Intron1_AP001267.4[10100_to_12332]_2	2233	1809	11908
222	MLL_Intron1_AP001267.4[10100_to_12332]_3	2233	988	11087
223	MLL_Intron1_AP001267.4[10100_to_12332]_4	2233	803	10902
224	MLL_Intron1_AP001267.4[10100_to_12332]_6	2233	1270	11369
225	MLL_Intron1_AP001267.4[10100_to_12332]_7	2233	1147	11246
226	MLL_Intron1_AP001267.4[10100_to_12332]_8	2233	391	10490
227	MLL_Intron1_AP001267.4[12670_to_14434]_1	1765	401	13070
228	MLL_Intron1_AP001267.4[12670_to_14434]_2	1765	1204	13873
229	MLL_Intron1_AP001267.4[12670_to_14434]_3	1765	876	13545
230	MLL_Intron1_AP001267.4[12670_to_14434]_4	1765	1036	13705
231	MLL_Intron1_AP001267.4[12670_to_14434]_6	1765	1277	13946
232	MLL_Intron1_AP001267.4[12670_to_14434]_7	1765	89	12758
233	MLL_Intron1_AP001267.4[12670_to_14434]_8	1765	454	13123
234	MLL_Intron1_AP001267.4[12670_to_14434]_9	1765	625	13294
235	MLL_Intron1_AP001267.4[27613_to_29591]_1	1979	994	28606
236	MLL_Intron1_AP001267.4[27613_to_29591]_2	1979	939	28551
237	MLL_Intron1_AP001267.4[27613_to_29591]_3	1979	1304	28916
238	MLL_Intron1_AP001267.4[27613_to_29591]_7	1979	478	28090
239	MLL_Intron1_AP001267.4[27613_to_29591]_9	1979	1417	29029
240	MLL_Intron1_AP001267.4[30450_to_31832]_10	1383	844	31293
241	MLL_Intron1_AP001267.4[30450_to_31832]_2	1383	1027	31476
242	MLL_Intron1_AP001267.4[30450_to_31832]_3	1383	550	30999
243	MLL_Intron1_AP001267.4[30450_to_31832]_6	1383	1095	31544
244	MLL_Intron1_AP001267.4[30450_to_31832]_7	1383	1190	31639
245	MLL_Intron1_AP001267.4[30450_to_31832]_8	1383	680	31129
246	MLL_Intron1_AP001267.4[30450_to_31832]_9	1383	21	30470

TABLE 6


	Chromosomal
	Location	Structure/Function	Occurrence	Reference

Nuclear
transcription
factors
LAF-4	2q11	transcription factor	ALL	GenBank Accession
				No. AF422798
				(Huret, 2001)
AF4	4q21	transcription factor	ALL	(Nakamura, 1993)
(MLLT2,			t-ALL	(Raffini, 2002)
FEL)			AML
AF5α	5q12			(Taki, 1996)
AF5q31	5q31
AF6q21	6q21	forkhead transcription	t-AML	(Hillion, 1997)
(FKHRL1)		factor
AF9	9p22	transcriptional activator	AML	(Nakamura, 1993)
(MLLT3)			ALL	(Langer, 2003)
			t-AML	(Whitmarsh, 2003)
AF10	10p12	leucine zipper protein	t-AML	(Megonigal, 2000)
		2 α-helical domains
MLL	11q23		de novo
			AML
			t-AML
AF17	17q21
ENL	19p13.3	transcriptional activator	ALL	(Tkachuk, 1992)
(MLLT1,			AML	(Yamamoto, 1993)
LTG19)			T-cell ALL	(Iida, 1993)
			t-AML	(Chervinsky, 1995)
				(Rubnitz, 1996)
				(Moorman, 1998)
				(LoNigro, 2002)
AFX	Xq13	forkhead transcription		(Corral, 1993)
		factor
Proteins
involved in
transcripttional
regulation
CBP	16p13	transcriptional adaptor/	MDS	(Taki, 1997)
		co-activator; histone	(RAEB-T)	(Satake, 1997)
		acetyl transferase	t-MDS	(Sobulo, 1997)
			(RAEB-T)	(Rowley, 1997)
			t-CMML	(Hayashi, 2000)
			t-AML	(Sugita, 2000)
			t-ALL (B-
			lineage)
			T-cell ALL
ELL (MEN)	19p13.1	RNA polymerase II	AML	(Thirman, 1994)
		elongation	t-AML	(Mitani, 1995)
		factor		(Rubnitz, 1996)
				(Shilatifard, 1996)
				(Johnstone, 2001)
				(Maki, 1999)
				(Moorman, 1998)
				(LoNigro, 2002)
				(Megonigal, 2000)
p300	22q13	transcriptional co-
		activator
Nuclear
proteins of
unknown
function
AF3p21	3p21	SH3 domain, bipartite	t-AML	(Sano, 2001)
		nuclear localization		(Hayakawa, 2001)
		signal, proline rich
		domain, homo-
		oligomerization domain
LCX (TET1)	10q22	CXXC domain, nuclear	de novo	(Ono, 2002)
		localization signals,	AML	(Lorsbach, 2003)
		coiled-coil
		motif
AF15q14				(Hayette, 2000)
Cytoplasmic
proteins
AF1p	1p32	EGFR pathway tyrosine	AUL (M0)	(Bernard, 1994)
(eps15)		kinase substrate	CMML	(Wong, 1994)
			ALL	(Rogaia, 1997)
AF1q	1q21	mRNA destabilizing	AML	(Tse, 1995)
		consensus		(So, 2000)
		sequences		(Busson-Le Coniat,
		cytokine-like features		1999)
GMPS	3q24	amidotransferease	t-AML	(Pegram, 2000)
LPP	3q28
GRAF	5q31
AF6	6q27	Ras binding protein	AML	(Prasad, 1993)
			t-AML	(Taki, 1996)
			T-cell ALL	(Martineau, 1998)
			B-lineage	(Joh, 1997)
			ALL	(Mitterbauer, 2000)
				(Akao, 2000)
CDK6	7q21	kinase
FBP17	9q34
ABI-1	10p11.2
CBL	11q23.3	proline-rich domain,	de novo	(Fu, 2003)
		ubiquitin-	AML
		associated domain,
		leucine
		zipper domain, zinc
		finger
		domain, tyrosine kinase
		binding domain, linker
		region,
		ring finger domain
MPFYVE	15q14	FYVE domain	de novo	(Chinwalla, 2003)
		phosphotidyl-inositol-3	AML
		phosphate (PtdIns(3)P
		binding protein
GAS7	17p13			(Megonigal, 2000)
LASP1	17q21	LIM and SH3 domains	AML	(Strehl, 2003)
MSF	17q25	septin		(McIlhatton, 2001)
		GTP-binding domain
		lacks coiled-coil domain
		in C-
		terminus
EEN	19p13	Src homology 3 (SH3)	AML	(So, 1997)
		protein
hCDCrel	22q11			(Megonigal, 1998)
SEPTIN6	Xq23			(Slater, 2002)
Cell
membrane
proteins
CALM	11q14-q21	clathrin assembly	AML	(Wechsler, 2003)
		protein
LARG	11q23
GPHN	14q23.3
MYO1F	19p13.2-19p13.3	head domain with	AML	(LoNigro, 2002)
		conserved
		ATP- and actin-binding
		sites,
		neck domain with IQ
		motif,
		tail domain
Golgi/Endo
plasmic
reticulum
ALKALINE	19p13			(LoNigro, 2002)
CERAMIDASE
Ribosomal
protein
RPS3	11q13.3-11q13.5		AML	(LoNigro, 2003)
MIFL				U.S. Provisional
				Application No.
				60/599,385
MAM L2	11q21	Mastermind-Like		MLL exon 7 to position
		transcriptional		1799 of MAML2
		coactivator for
		mammalian Notch
		receptors (GenBank
		No. AY040322)

While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

REFERENCES

1. Fortune, J. M. & Osheroff, N. (2000) Prog Nucleic Acid Res and Molecular Biology 64, 221-53.
2. Felix, C. A. (2001) Med Pediatr Oncol 36, 525-535.
3. Rowley, J. D. & Olney, H. J. (2002) Genes Chromosomes Cancer 33, 331-45.
4. Knudson, A. G. (1992) Sem Cancer Biol 3, 99-106.
5. Woessner, R. D., Mattern, M. R., Mirabelli, C. K., Johnson, R. K. & F. H., D. (1991) Cell Growth Differ 2, 209-14.
6. Isaacs, R. J., Davies, S. L., Sandri, M. I., Redwood, C., Wells, N. J. & Hickson, I. D. (1998) Biochim Biophys Acta 1400, 121-37.
7. Megonigal, M. D., Cheung, N. K., Rappaport, E. F., Nowell, P. C., Wilson, R. B., Jones, D. H., Addya, K., Leonard, D. G., Kushner, B. H., Williams, T. M., Lange, B. J. & Felix, C. A. (2000) Proc Natl Acad Sci USA 97, 2814-9.
8. Raffini, L. J., Slater, D. J., Rappaport, E. F., Lo Nigro, L., Cheung, N.-K. V., Biegel, J. A., Nowell, P. C., Lange, B. J. & Felix, C. A. (2002) Proc Natl Acad Sci USA 99, 4568-4573.
9. Kushner, B. H., Cheung, N. K., Kramer, K., Heller, G. & Jhanwar, S. C. (1998) J Clin Oncol 16, 3880-3889.
10. Lovett, B. D., Lo Nigro, L., Rappaport, E. F., Blair, I. A., Osheroff, N., Zheng, N., Megonigal, M. D., Williams, W. R., Nowell, P. C. & Felix, C. A. (2001) Proc Natl Acad Sci USA 98, 9802-9807.
11. Whitmarsh, R., Saginario, C., Zhuo, Y., Hilgenfeld, E., Rappaport, E. F., Megonigal, M. D., Carroll, M., Liu, M., Osheroff, N., Cheung, N.-K. V., Slater, D. J., Ried, T., Knutsen, T., Blair, I. A. & Felix, C. A. (2003) Oncogene 22, 8448-8459.
12. Bromberg, K. D. & Osheroff, N. (2001) Biochem 40, 8410-8418.
13. Ueda, T., Tsuji, K., Yoshino, H., Ebihara, Y., Yagasaki, H., Hisakawa, H., Mitsui, T., Manabe, A., Tanaka, R., Kimio, K., Ito, M., Yasukawa, K. & Nakahata, T. (2000) J Clin Invest 105, 1013-1021.
14. Stong, R., Korsmeyer, S., Parkin, J., Arthur, D. & Kersey, J. (1985) Blood 65, 21-31.
15. Pocock, C. F., Malone, M., Booth, M., Evans, M., Morgan, G., Greil, J. & Cotter, F. E. (1995) Br J Haematol 90, 855-67.
16. Lozzio, B. B., Lozzio, C. B., Bamberger, E. G. & Feliu, A. S. (1981) Proc Soc Exp Biol Med 166, 546-50.
17. Livak, K. J. & Schmittgen, T. D. (2001) Methods 25, 402-408.
18. Harlow, E. & Lane, D. (1999) Using Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory.
19. Cheung, V. G. & Nelson, S. F. (1996) Proc Natl Acad Sci USA 93, 14676-14679.
20. Gelmini, S., Orlando, C., Sestini, R., Vona, G., Pinzani, P., Ruocco, L. & Pazzagli, M. (1997) Clin Chem 43, 752-8.
21. Heid, C. A., Stevens, J., Livak, K. J. & Williams, P. M. (1996) Genome Res 6, 986-94.
22. Holland, P. M., Abramson, R. D., Watson, R. & Gelfand, D. H. (1991) Proc Natl Acad Sci USA 88, 7276-80.
23. Pongers-Willemse, M. J., Verhagen, O. J., Tibbe, G. J., Wijkhuijs, A. J., de Haas, V., Roovers, E., van der Schoot, C. E. & van Dongen, J. J. (1998) Leukemia 12, 2006-14.
24. Lovett, B. D., Strumberg, D., Blair, I. A., Pang, S., Burden, D. A., Megonigal, M. D., Rappaport, E. F., Rebbeck, T. R., Osheroff, N., Pommier, Y. G. & Felix, C. A. (2001) Biochemistry 40, 1159-70.
25. Blanco, J. G., Dervieux, T., Edick, M. J., Mehta, P. K., Rubnitz, J. E., Shurtleff, S. A., Raimondi, S. C., Behm, F. G., Pui, C.-H. & Relling, M. V. (2001) Proc Natl Acad Sci USA 98, 10338-43.
26. Ford, A. M., Ridge, S. A., Cabrera, M. E., Mahmoud, H., Steel, C. M., Chan, L. C. & Greaves, M. (1993) Nature 363, 358-360.
27. Gale, K., Ford, A., Repp, R., Borkhardt, A., Keller, C., Eden, O. & Greaves, M. (1997) Proc Natl Acad Sci USA 94, 13950-13954.
28. Megonigal, M. D., Rappaport, E. F., Jones, D. H., Williams, T. M., Lovett, B. D., Kelly, K. M., Lerou, P. H., Moulton, T., Budarf, M. L. & Felix, C. A. (1998) Proc Natl Acad Sci USA 95, 6413-6418.
29. Maia, A. T., Koechling, J., Corbett, R., Metzler, M., Wiemels, J. L. & Greaves, M. (2004) Genes, Chromosomes & Cancer 39, 335-340.
30. Krishnan, A., Bhatia, S., Slovak, M. L., Arber, D. A., Niland, J. C., Nademanee, A., Fung, H., Bhatia, R., Kashyap, A., Molina, A., O'Donnell, M. R., Parker, P. A., Sniecinski, I. & Snyder, D. S. (2000) Blood 95, 1588-1593.
31. Liang, F., Han, M., Romanienko, P. J. & Jasin, M. (1998) Proc Natl Acad Sci USA 95, 5172-5177.
32. Capranico, G., Jaxel, C., Roberge, M., Kohn, K. W. & Pommier, Y. (1990) Nucleic Acids Res 18, 4553-4559.
33. Cozzio, A., Passegue, E., Ayton, P. M., Karsunky, H., Cleary, M. L. & Weissman, I. L. (2003) Genes Dev 17, 3029-35.
34. Boyd, K. E., Wells, J., Gutman, J., Bartley, S. M. & Farnham, P. J. (1998) Proc Natl Acad Sci USA 95, 13887-92.
35. Langer, T., Metzler, M., Reinhardt, D., Viehmann, S., Borkhardt, A., Reichel, M., Stanulla, M., Schrappe, M., Creutzig, U., Ritter, J., Leis, T., Jacobs, U., Harbott, J., Beck, J. D., Rascher, W. & Repp, R. (2003) Genes Chromosomes Cancer 36, 393-401.
36. Felix, C. A., Hosler, M. R., Slater, D. J., et al. (1998) J. Pediatr. Hematol/Oncol 20:299-308.
37. Felix, C. A., Jones, D. H. (1998) Leukemia 12:976-981.
38. Slater, D. J., Hilgenfeld, E., Rappaport, E. F. et al. (2002) Oncogene 21:4706-4714.
39. Megonigal, M. D. Rappaport E. F., Wilson, R. B., et al. (2000) PNAS 97:9597-9602.
40. Pegram, L. D., Megonigal, M. D., Lange, B. J., et al. (2000) Blood 96:4360-4362.
41. Felix, C. A., Kim, C. S., Megonigal, M. D., et al. (1997) Blood 90:4679-4686.
42. Lo Nigro, L., Rappaport E., Slater, D., et al. (1999) Proc ASCO 18:565a.
43. Lo Nigro, L., Slater, D. J., Rappaport, E. F., et al. (2002) Blood 100(Suppl 1):531a.
44. Dudoit, S. and Yang, Y. H. (2002) Bioconductor R packages for exploratory analysis and normalization of cDNA microarray data. In: The analysis of Gene Expression Data: Methods and Software; Parmigiani, et al. (Ed) pp. 73-101; New York:Springer.
45. Dudoit, S., Speed, T. P., Callow, M. J. (2002) Statistica Sinica 12:111-139.
46. Huret J L, et al. (2001) Leukemia, 15(6):987-9.
47. Nakamura T, et al. (1993) Proc Natl Acad Sci USA. 15; 90(10):4631-5.
48. Taki T, et al. (1996) Oncogene. 13(10):2121-30.
49. Hillion J, et al. (1997) Blood. 90(9):3714-9.
50. Moorman A V, et al. (1998) Leukemia. 12(5):805-10.
51. Rubnitz J E, et al. (1996) Blood. 87(11):4804-8.
52. Chervinsky D S, et al. (1995) Genes Chromosomes Cancer. 14(1):76-84.
53. Yamamoto K, et al. (1993) Oncogene. 8(10):2617-25.
54. Iida S, et al. (1993) Oncogene. 8(11):3085-92.
55. Tkachuk D C, et al. (1992) Cell. 71(4):691-700.
56. Corral J, et al. (1993) Proc Natl Acad Sci USA. 90(18):8538-42.
57. Taki T, et al. (1997) Blood. 89(11):3945-50.
58. Satake N, et al. (1997) Genes Chromosomes Cancer. 20(1):60-3.
59. Sobulo O M, et al. (1997) Proc Natl Acad Sci USA. 94(16):8732-7.
60. Rowley J D, et al. (1997) Blood. 90(2):535-41.
61. Hayashi Y, et al. (2000) Cancer Res. 60(4):1139-45.
62. Sugita K, et al. (2000) Genes Chromosomes Cancer. 27(3):264-9.
63. Thirman M J, et al. (1994) Proc Natl Acad Sci USA. 91(25):12110-4.
64. Shilatifard A, et al. (1996) Science. 271(5257):1873-6.
65. Maki K, et al. (1999) Blood. 93(10):3216-24.
66. Mitani K, et al. (1995) Blood. 85(8):2017-24.
67. Sano K. (2001) Leuk Lymphoma. 42(4):595-602.
68. Hayakawa A, et al. (2001) Genes Chromosomes Cancer. 30(4):364-74.
69. Ono R, et al. (2002) Cancer Res. 62(14):4075-80.
70. Lorsbach R B, et al. (2003) Leukemia. 17(3):637-41.
71. Hayette S, et al. (2000) Oncogene. 19(38):4446-50.
72. Bernard O A, et al. (1994) Oncogene. 9(4):1039-45.
73. Wong W T, et al. (1994) Oncogene. 9(6):1591-7.
74. Rogaia D, et al. (1997) Cancer Res. 57(5):799-802.
75. Tse W, et al. (1995) Blood. 85(3):650-6.
76. So C W, et al. (2000) Leukemia. 14(4):594-601.
77. Busson-Le Coniat M, et al. (1999) Leukemia. 13(2):302-6.
78. Pegram L D, et al. (2000) Blood. 96(13):4360-2.
79. Prasad R, et al. (1993) Cancer Res. 53(23):5624-8.
80. Taki T, et al. (1996) Oncogene. 13(10):2121-30.
81. Martineau M, et al. (1998) Leukemia. 12(5):788-91.
82. Joh T, et al. (1997) Oncogene. 15(14):1681-7.
83. Mitterbauer G, et al. (2000) Br J Haematol. 109(3):622-8.
84. Akao Y, et al. (2000) Genes Chromosomes Cancer. 27(4):412-7.
85. Fu J F, et al. (2003) Genes Chromosomes Cancer. 37(2):214-9.
86. Chinwalla V, et al. (2003) Oncogene. 22(9):1400-10.
87. Strehl S, et al. (2003) Oncogene. 22(1):157-60.
88. McIlhatton M A, et al. (2001) Oncogene. 20(41):5930-9.
89. So C W, et al. (1997) Proc Natl Acad Sci USA. 94(6):2563-8.
90. Wechsler D S, et al. (2003) Genes Chromosomes Cancer. 36(1):26-36.
91. Lo Nigro L, et al. (2003) Blood. 102:184-185b.

Claims

1. A method for identifying sequences present in DNA topoisomerase H-DNA complexes in cells, comprising:

a) providing cells suspected of containing DNA topoisomerase H-DNA complexes;

b) isolating DNA topoisomerase H-DNA complexes from the cell;

c) amplifying the DNA present in said isolated DNA topoisomerase H-DNA complexes via polymerase chain reaction; and

d) identifying the sequences present in said amplified DNA, thereby identifying the sequences present in said DNA topoisomerase II-DNA complexes.

2. The method of claim 1, wherein the DNA in said DNA topoisomerase 11-DNA complexes is genomic DNA.

3. The method of claim 1, wherein the identification of the sequences in step d) comprises further amplifying the amplified DNA from step c) with gene specific primers.

4. The method of claim 1, wherein the identification of the sequences in step d) comprises further amplifying the amplified DNA from step c) by real-time PCR.

5. The method of claim 1, wherein the identification of the sequences in step d) comprises hybridizing the amplified DNA from step c) with a microarray.

6. The method of claim 1, wherein said cells are CD34+ cells.

7. The method of claim 1, wherein said amplified DNA of step c) comprises sequences from the MLL gene.

8. The method of claim 1, wherein said cells are exposed to an agent suspected of modulating formation of topoisomerase cleavage complexes.

9. The method of claim 5, wherein said microarray comprises MLL bcr oligonucleotide sequences.

10. The method of claim 9, wherein said MLL bcr oligonucleotide sequences hybridize to non-repetitive MLL bcr sequences.

11. The method of claim 9, wherein said microarray further comprises oligonucleotide sequences from the Alu region between nucleotide positions 663-1779 in the MLL bcr.

12. The method of claim 9, wherein said microarray further comprises control sequences which are not involved in MLL translocations.

13. The method of claim 13, wherein said control sequences are selected from the group consisting of MLL exon 25, MLL exon 3, GAPDH, c-myc, and bacterial gene sequences.

14. The method of claim 9, wherein said microarray further comprises oligonucleotide sequences from MLL partner genes.

15. The method of claim 14, wherein said MLL partner genes are selected from the group consisting of LAF-4, AF4 (MLLT2, FEL), AF5α, AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17, ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1), AF15q14, AF1p (eps1S), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17, ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM, LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL.

16. The method of claim 5, wherein said microarray comprises oligonucleotide sequences from MLL partner genes.

17. The method of claim 16, wherein said MLL partner genes are selected from the group consisting of LAF-4, AF4 (MLLT2, FEL), AF5α, AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17, ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1), AF15q14, AF1p (eps15), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17, ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM, LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL.

18. The method of claim 9, wherein the microarray comprises oligonucleotide sequences comprising SEQ ID NOs 1-162.

19. The method of claim 9, wherein the microarray comprises oligonucleotide sequences comprising SEQ ID NOs 163-246.

20. The method of claim 1, wherein said isolating of DNA topoisomerase II-DNA complexes of step b) comprises lysing said cells and immunoprecipitating said DNA topoisomerase 11-DNA complexes.

21. A microarray comprising MLL bcr oligonucleotide sequences.

22. The microarray of claim 21, wherein said MLL bcr oligonucleotide sequences hybridize to non-repetitive MLL bcr sequences.

23. The microarray of claim 21, wherein said microarray further comprises oligonucleotide sequences from the Alu region between nucleotide positions 663-1779 in the MLL bcr.

24. The microarray of claim 21, wherein said microarray further comprises control sequences which are not involved in MLL translocations.

25. The microarray of claim 24, wherein said control sequences are selected from the group consisting of MLL exon 25, MLL exon 3, GAPDH, c-myc, and bacterial gene sequences.

26. The microarray of claim 21, wherein said microarray further comprises oligonucleotide sequences from MLL partner genes.

27. The microarray of claim 26, wherein said MLL partner genes are selected from the group consisting of LAF-4, AF4 (MLLT2, FEL), AF5α, AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17, ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1), AF15q14, AF1p (eps1S), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17, ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM, LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL.

28. A microarray comprising oligonucleotide sequences from MLL partner genes.

29. The microarray of claim 28, wherein said MLL partner genes are selected from the group consisting of LAF-4, AF4 (MLLT2, FEL), AF5α, AF5q31, AF6q21 (FKHRL1), AF9 (MLLT3), AF10, MLL, AF17, ENL (MLLT1, LTG19), AFX, CBP, ELL (MEN), p300, AF3p21, LCX (TET1), AF15q14, AF1p (eps15), AF1q, GMPS, LPP, GRAF, AF6, CDK6, FBP17, ABI-1, CBL, MPFYVE, GAS7, LASP1, MSF, EEN, hCDCrel, SEPTIN6, CALM, LARG, GPHN, MYO1F, Alkaline Ceramidase, RPS3, and MIFL.

30. The microarray of claim 21, wherein the microarray comprises oligonucleotide sequences comprising SEQ ID NOs 1-162.

31. The microarray of claim 21, wherein the microarray comprises oligonucleotide sequences comprising SEQ ID NOs 163-246.

32. A kit for performing the method of claim 1.

33. The kit of claim 32, comprising:

a) an agent and a buffer for lysing cells;

b) a solid support and a buffer for isolating DNA-DNA topoisomerase II complexes;

c) at least one primer and a buffer for PCR amplification of isolated DNA by whole genome amplification;

d) at least one first detectable label for incorporation into products of whole genome amplification;

e) calibrated reference standard DNA comprising a second detectable label;

f) a microarray comprising oligonucleotide sequences from the MLL bcr; and

g) instruction material.